4 Pages

IEEEXplore (4)

Course: CS 1313, Spring 2012
School: Punjab Engineering...
Rating:
 
 
 
 
 

Word Count: 2009

Document Preview

International Second Symposium on Intelligent Information Technology and Security Informatics A Novel Intrusion Detection Architecture Based on Adaptive Selection Event Triggering for Mobile Ad-hoc Networks Chuan-xiang Ma, Ze-ming Fang School of Mathematics and Computer Science. Hubei University, Wuhan fangzm@yahoo.com.cn Hubei,China 430062 Abstract Due to resource limitation, it is an optimum solution for...

Register Now

Unformatted Document Excerpt

Coursehero >> India >> Punjab Engineering College >> CS 1313

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
International Second Symposium on Intelligent Information Technology and Security Informatics A Novel Intrusion Detection Architecture Based on Adaptive Selection Event Triggering for Mobile Ad-hoc Networks Chuan-xiang Ma, Ze-ming Fang School of Mathematics and Computer Science. Hubei University, Wuhan fangzm@yahoo.com.cn Hubei,China 430062 Abstract Due to resource limitation, it is an optimum solution for intrusion detection in mobile Ad-hoc networks (MANETs) that all nodes investigate system and user activities while a subset of network nodes are selected as monitoring nodes to monitor and detect network packets. In this paper, a novel intrusion detection architecture for energy-constrained mobile Ad-hoc networks is proposed, in which the network detection module is optional. Monitoring nodes are selected by activating the network detection model to work. A selection scheme of monitoring nodes called Event Triggering Based Adaptive Selection (ETBAS) is also proposed, which introduces the mechanism of monitoring states and the method of event triggering. Triggering events, for example, a node has been voted to be a monitoring node by its neighbors, the battery power of a monitoring node has consumed to a threshold, or the networks topology has changed, can activate a non-monitoring node, or make a monitoring node fall asleep. High connectivity and energy resource are balanced in ETBAS for adaptive selection scheme, which is adaptable to dynamically changing networks and enhances the network lifetime. 1. Introduction Compared with traditional wire or wireless network, security in mobile Ad hoc networks is hard to achieve for dynamically changing, distributed collaboration, lacking of certification center and the limitation of node energy resources. In the recent years, intrusion detection technology has been applied into Ad-hoc networks to resolve those security problems, but efficiency architecture for energy-constrained wireless network is an unavoidable challenge. A distributed and cooperative intrusion detection architecture for mobile wireless networks is proposed by Zhang etc in [1], in which every node should participate in local and network intrusion detection and response. On account of the additional resources consumed during monitoring and detecting, this architecture is not efficient in utilizing the limited network energy resources. Anjum etc in [2] showed that it is certainly not necessary for all the nodes to run the IDS. Instead, they can be selected randomly on the network and the number of IDS node can be defined in order to obtain a good percentage of detection. In order to save energy resources, the problem of selecting monitoring nodes has been raised. Kachirski and Guha in [3] proposed a layered mobile agent architecture, in which the network is logically divided into clusters with a single clusterhead for each cluster. This clusterhead, as well as network monitoring nodes, will monitor the packets within the cluster and only packets whose originators are in the same cluster are captured and investigated. A simpler selection scheme called lifetimeenhancing selection (LES) is proposed in [4], which adaptively choose a monitoring node that has a maximum remaining battery power between adjacent mobile nodes for intrusion detection. Once its power becomes the lowest among its neighbors, re-choosing happens. Thus, by dispersing the battery consumption among the nodes with relatively high remaining battery power, LES scheme can enhance the network lifetime. However, LES does not accommodate to dynamically changing topology of Ad Hoc networks, because the rechoosing may impact more other monitoring nodes, Ze-ming Fang: the corresponding author. This research is supported by National Natural Science Foundation of China (No: 60603069) , the projects of science and research plan of Hubei provincial department of education (D20060003) and the Natural Science Foundation Of Hubei Province of China (2006ABA016). 978-0-7695-3579-1/09 $25.00 2009 IEEE DOI 10.1109/IITSI.2009.54 198 Authorized licensed use limited to: Maharaja Agrasen Institute of Technology. Downloaded on January 27, 2010 at 18:07 from IEEE Xplore. Restrictions apply. especially when a monitoring nodes leaves network suddenly. In our architecture, it is more flexible because each node with the same IDS has an equal opportunity to be selected as monitoring node on activating its network detection model. In ETBAS scheme each node has its monitoring state that can be automatically transformed by event triggering. Therefore, ETBAS is an adaptive selection scheme and adaptable to dynamically changing networks. The main contributions of this paper are as follows: 1 A novel intrusion detection architecture with alterable network detection model that can be awaken or closed according to monitoring states is proposed, consequently the limited network energy resource is efficiently utilized. 2 A selection scheme corresponding to our framework is presented, in which a node is selected to be a monitoring node by activating its network detection model to work once an appropriate triggering event occurring. This paper is organized as follows. In Section 2, the novel IDS architecture is described. Section 3 presents the mechanism of monitoring states and the method of event triggering firstly, then describes the original section and updating selection of ETBAS. Section 4 is the conclusion. The triggering events are monitored by monitoring state management and monitoring state is alternated correspondingly. IDS agent resource manage module monitoring state manage module local detection module network detection module user and system activities network packets Figure 1. The conceptual model for IDS agent. Dashed pane indicates that the network detection module is available when the node is selected as a monitoring node. In this paper, we concentrate on the selection of monitoring nodes to enhance network lifetime instead of intrusion detection techniques. 3. ETBAS scheme In our architecture, all nodes have different monitoring states according to whether their network detection module is available or not. A monitoring node is at the activating state when its network detection module is in effect, while a non-monitoring node, or called as a normal node, is at the sleeping state with this module closed. The sleeping state is also set to be the default state of all nodes when the network is established. When appropriate events happen, one monitoring state can transform to another. For example, when a non-monitoring node is voted by its neighbors, it then will be altered to activating state. Or once the battery power of a monitoring node is lower than a threshold value, it will send control packets to inform neighbors to choose a new one, and turn into sleeping state. Since are nodes self-organized in Ad hoc networks, the selection process of ETBAS scheme can accordingly divide into original selection and updating selection. 2. The model architecture Because of the distributed and cooperative features of mobile Ad-hoc networks, local and network intrusion should be given attention. Since it is testified in [2] that a subset of IDS nodes obtain a good percentage of network detection, we focus on energy saving and propose a flexible architecture as illustrated in Figure 1. It comprises the following four major components: local detection, network detection, resource management and monitoring state management. Local detection module collects the user and system activities, detects local intrusion and generates a local alert with sufficient evidence. Network detection model is an optional module which can be activated to capture and investigate network packets only when the monitoring nodes are in effect. Resource management module supervises the remaining energy resource of the node and its neighbors, and generates a vote if required. When the battery power of a monitoring node is lower than threshold value, it will be reported to monitoring state manage module as a triggering event. 3.1. Original selection The original selection process selects monitoring nodes during the establishment of network. The selection criterion of monitoring nodes in this process is the remaining battery power and requires an exchange of energy information. 199 Authorized licensed use limited to: Maharaja Agrasen Institute of Technology. Downloaded on January 27, 2010 at 18:07 from IEEE Xplore. Restrictions apply. First, each node broadcasts a control packet containing its battery power information. With comparing the battery power among it and its neighbors, resource management module then chooses the highest one, and send a control packet to it. If a node has been voted, it will activate its network detection module and broadcast a new control packet, which tells its neighbors that it is a monitoring node. Any nodes that have not been voted but receipted such control packets will go to sleep to be a non-monitoring one. But if a node has not, which means no monitoring node is its neighbor, it will awaken itself. Nodes 2, 3, 5, 9 selected as monitoring nodes are illustrated in Figure 2. 63w 81w 3 77w 5 85w 70w 1 2 7 92w 9 8 68w 70w 4 57w 6 11; otherwise, it will awaken itself to be a monitoring node. Node 10 is self-activated as given in Figure 3. 63w 81w 3 77w 5 85w 70w 1 2 7 92w 9 87w 11 8 68w 70w 4 57w 6 67w 10 Figure 3. Re-selection process when a new node entering network. (2) Before a monitoring node leaving the network, it must broadcast a packet to inform its neighbors. Once non-monitoring nodes have receipted such packet, they exchange their energy information and select new monitoring nodes according to the original selection process. A re-selection when monitoring node 2 leaves is shown in Figure 4. 63w 81w 3 77w 5 4 57w 6 67w 10 70w 7 92w 87w 11 9 8 68w Figure 2. The original selection process in ETBAS scheme. Dashed lines indicate a vote packet route. The first step nearly selects monitoring nodes synchronously in ETBAS scheme. Those monitoring nodes also will be altered when triggering events happen. Relative to LES scheme, nodes do not need to exchange energy information periodically if no triggering events occur. Consequently, ETBAS observably reduces the traffic load and enhances the network lifetime. 85w 70w 1 2 3.2. Updating selection When triggering events occur, nodes in local network will vote new monitoring nodes in ETBAS scheme. The main triggering events discussed in this paper are: (1) a new node enters the network; (2) a monitoring node leaves the network; and (3) the battery power of a monitoring node is lower than threshold value. The re-selection processes triggered by those events are described as follows. (1) When a new node enters the network, at first it broadcast a request packet that its neighbors will reply with a packet containing their monitoring states information. If it receives at least one response from monitoring nodes, it will still be sleeping state as node Figure 4. Re-selection process when a monitoring node leaving network. (3) If the battery power of a monitoring node is lower than threshold value, it also need to broadcast a packet to inform its neighbors, then transform to sleeping state and will not be selected again. This node and its non-monitoring neighbors that receive such packet exchange their energy information and select new monitoring nodes according to the original selection process. An example is shown in Figure 5. 200 Authorized licensed use limited to: Maharaja Agrasen Institute of Technology. Downloaded on January 27, 2010 at 18:07 from IEEE Xplore. Restrictions apply. 63w 81w 3 19w 5 70w 1 92w 87w 11 9 8 68w 7 4 57w 6 67w 10 70w Networks", International Journal of Electronics and Communications, 2006; 248-250. Figure 5. Re-selection process when the battery power of a monitoring node is lower than threshold value (here is 20w). The selection scheme based on event triggering is adaptive to the dynamically changing of mobile Ad-hoc network, with motion regarded as leaving and entering network later. It is advantageous that re-selection happens in local network without impacting other monitoring nodes. 4. Conclusions In this paper, we proposed a novel intrusion detection architecture for energy-constrained mobile Ad-hoc networks with optional network detection module. In ETBAS, an adaptive selection scheme of monitoring nodes, each node has its monitoring states, activating state or sleeping state. Monitoring nodes can be updated by three triggering events as discussed above. Compared to LES scheme, ETBAS scheme has much better performance in terms of the network lifetime and stability. 5. References [1] Y.Zhang, W.Lee, Y.Huang, "Intrusion Detection Techniques for Mobile Wireless Networks", ACM/Kluwer Wireless Networks Journal (ACM WINET) 2003 Vol. 9, No. 5, September 2003, pp. 545-556. [2] F.Anjum, D.Subhadrabandhu, S.Sarkar, "Signature-based Intrusion Detection for Wireless Ad-hoc Networks", In Proceedings of Vehicular Technology Conference, Wireless Security Symposium, Orlando, Florida, October 2003. [3] O.Kachichirski, R.Guha, "Effective intrusion detection using multiple sensors in wireless ad hoc networks", Proceedings of the 36th Annual Hawaii International Conference on System Sciences (HICSS'03), Hawaii, January 2003, pp. 57-64, [4] H.Kim, D.Kim, S.Kim, "Lifetime-enhancing Selection of Monitoring Nodes for Intrusion Detection in Mobile Ad Hoc 201 Authorized licensed use limited to: Maharaja Agrasen Institute of Technology. Downloaded on January 27, 2010 at 18:07 from IEEE Xplore. Restrictions apply.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Punjab Engineering College - CS - 1313
Intrusion Detection in Mobile Ad-Hoc Networks: A Mobile Agent ApproachUpinder Kaur and R.B. Patel Dept. of Computer Engineering, M. M. Engineering College, Mullana-133203, Haryana, INDIA raj_chawla94@yahoo.com, patel_r_b@indiatimes.com AbstractIn this p
Punjab Engineering College - CS - 1313
A Self-adaptive Intrusion Detection Method for AODV-based Mobile Ad Hoc NetworksSatoshi Kurosawa, Hidehisa Nakayama, Nei Kato , Abbas Jamalipour , and Yoshiaki Nemoto Graduate School of Information Sciences, Tohoku University Aoba 6309, Aramaki, Aoba-ku,
Drexel - ANTH - 101
"Life is a constant struggle between being an individual and being a member of the community" "Each funeral was a funeral for all of us. We lived and died together" Converging Cultures: One of the Tribe, A Tribe of One I. Introduction: a clear statement o
Drexel - ANTH - 101
Clash between cultures, especially Native American and White, is no new concept within the field of anthropology. Though some differences between them are obvious, such as appearance and heritage, it is the underlying differences that are explored by auth
Drexel - ANTH - 101
Clash between cultures, especially Native American and White, is no new concept within the field of anthropology. Though some differences between them are obvious, such as appearance and heritage, it is the underlying differences that are explored by auth
Drexel - ANTH - 101
Bio 124 Diversity Portfolio Group 1Introduction Everyone recognizes the signs of moldy bread, the white spider-web like substance spreading over the bread with portions of fuzzy blue or green patches. Not only is it a great disappointment after hopes of
Drexel - ANTH - 101
Clash between cultures, especially Native American and White, is no new concept within the field of anthropology. Though some differences between them are obvious, such as appearance and heritage, it is the underlying differences that are explored by auth
Drexel - ANTH - 101
Sikhism Bibliography (Rachel) Groff, Garin. "Brother of Sikh Murdered after 9/11 Educates Community." East Valley Tribune. Sept. 2011. Web. 12 Mar. 2012. <http:/www.eastvalleytribune.com/arizona/article_c81a3ee0-d8e3-11e0-9bb5001cc4c002e0.html>. Matharu,
Drexel - ANTH - 101
I'm going to discuss second half of the worship and daily practices. Temples One of the most important elements to the Sikh worship is the temples. The Golden Temple was the first temple created in Amritsar, Punjab, and it is very important in Sikhism, an
Drexel - ANTH - 101
Sikhism Rachel Lumnitzer and Akash BhalaniOverviewHistory Philosophies Customs Worship and Daily Practices Rituals Misconceptions InterviewsHistoryMigrated from India/Punjab over last 130 yrs Over 20 million worldwide, most live in Punjab Founded duri
Drexel - ANTH - 101
Sikhism Overview Over 20 million Sikhs worldwide, most of which live in Punjab province of India Founded during 16th century in Punjab, based on teachings of Guru Nanak and the 9 gurus after him The most important part of Sikhism is the religious state of
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012Week 4 Lab PTC gene and Hardy-Weinberg Lab Overview: Week 4 Lab: Gel Electrophoresis and Lesson on Determining PTC genotype Week 4 Recitation: Analysis of Results Week 6 Lab: Lab report DUE to Lab TA
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012Group Member Names: _ _ _ _ Grade: _/20 points Week 7 Lab Plant Diversity A. Photosynthetic Pigment Nutritionally, two basic types of organisms exist in our world, autotrophs and heterotrophs. Autotro
Drexel - BIO - 124
BIO 124 Section 65 Lab Report 1 Group 1 Results Table 1- Group Genotypes and Phenotype ObservationsGroup 1 Members Rachel Lumnitzer (Group Member 1) Divya Paramesh (Group Member 2) Anjali Misra (Group Member 3) Cara Jourdan (Group Member 4)Phenotype Mod
Drexel - BIO - 124
IntroductionThe ability to taste, or not to taste phenylthiocarbamide (PTC) is expressed by a single gene that codes for a taste receptor on the tongue. The first acknowledgement of this gene was by Arthur Fox in the 1930s, the actual PTC gene, TAS2R38,
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012PTC Lab Report GuidelinesDue Date: Week 6 lab (100 points: 9% of total grade) Specification: - Double-spaced - Times New Roman, 12 font Section Details: 1. Introduction (15 points): 2 pages Relevant
Drexel - BIO - 124
SCIENCE OBSERVERHow a Fungus Boosts a Beetle's InvasionMicrobial evolution helps explain why a mildmannered American beetle has become a tree killer in AsiaElsa YoungsteadtWhen China opened its borders to international commerce in the late 1970s, it g
Drexel - BIO - 224
Lepisosteus oculatus>gi|38304785|gb|AY442350.1| Lepisosteus oculatus mitochondrion, complete genomeGCTAGTGTAGCTTAACCAAAGCATAGCACTGAAGATGTTAAGATGGACTCTAACGGGTCCCACGGGCRCAAAGGCTTGGTCCTGACCTTGCTATCAGTTTTAGCCGAACTTACACATGCAAGTATCCGAGGTTTGGTCCTGACCTTGCTATC
Drexel - BIO - 224
BIO 224 Section 001: Fish Cladogram Project Character Matrix Rachel Lumnitzer, My Dung Ha, Nazaneen Zahedi, Ravi Patel, Catheryn Blankenbiller Traits Atlantic Sturgeon (Acipens er oxyrinch us) 1 2 No Estuary Upriver in spring Spotted Gar (Lepisost eus ocu
Drexel - BIO - 224
Spotted Garmonochromatic vision (type of vision) eyes dorsal fin number or shape: 1 ventral fin number: 3 tail texture (scales, etc.):gray spots lateral scales: diamond shaped ganoid scales, non-overlapping freshwater/saltwater: freshwater caudal fin: ye
Drexel - BIO - 224
Bio 224 Section 001 Project: Rachel Lumnitzer, Cat Blankenbiller, Ravi Patel, Nazaneen Zahedi, My Dung Ha, Species Teeth Ventral Fin 2 2 0 0 1 0 1 Lateral Tail Fin Scales Scales No No No No No Yes Yes No No No No No No Yes Stripe None None None Light Dark
Drexel - BIO - 224
Drexel - BIO - 224
- Fungal phylogeny was once based on morphology and heterotrophic nutrition - Now use molecular analysis of fungal DNA and distinguishing fungal characteristics. -Examples of fungi characters include flagellation, cell wall structure, mitochondrial struct
Drexel - BIO - 124
Drexel - BIO - 124
Fungi are classified under the domian domain Eukarya. To be categorized within this domain an organism must have cells that feature membrane-bound, complex structures such as a nucleus, enclosed within membranes. A fungal cell is more similar of the cells
Drexel - BIO - 124
Fungi are classified under the domian Eukarya. To be categorized within this domain an organism must have cells that feature membrane-bound, complex structures such as a nucleus, enclosed within membranes. A fungal cell is more similar of the cells of ani
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Anjali Misra, Cara Jourdan, Divya Paramesh, Rachel Lumnitzer IntroductionCommon characteristics all fungus share are that their cells feature membranebound, complex structures suc
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Divya Paramesh, Rachel Lumnitzer, Anjali Misra, Cara JourdanIntroductionCommon characteristics all Fungus share are that their cells feature membranebound, complex structures such
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and Animals BodyBy Divya Paramesh, Rachel Lumnitzer, Anjali Misra, Cara JourdanIntroductionCommon characteristics all Fungus share are that their cells feature membranebound, complex structures
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Anjali Misra, Cara Jourdan, Divya Paramesh, Rachel Lumnitzer IntroductionCommon characteristics all fungus share are that their cells feature membranebound, complex structures suc
Drexel - BIO - 124
-For evolution I will first discuss the phylogeny of fungi and then move onto the evolution. -For several years, classification was based on the morphology and nutrition of fungus. As we know, this is a well-known way to distinguish organisms for specific
Drexel - BIO - 124
Bio 124 Diversity Portfolio Group 1 Evolutionary For technique of tree. Fungi were this did the same eliminate these these selective evolutionary Figure 1. and Phylogenetic Analysis of Fungi Taxonomy several years, mycologists relied on an ambiguous class
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Anjali Misra, Cara Jourdan, Divya Paramesh, Rachel Lumnitzer http:/www.zeitnews.org/agricultureresearch/fungireduceneedforfertilizerinagriculture.htmlIntroductionCommon characteri
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012Group Member Names: _ _ _ _ Grade: _/20 points Week 5 Lab Bacterial Diversity What are some key characteristics of bacteria? Small cell size Prokaryotic cell structure Lack internal organelles Commons
Drexel - ANTH - 101
Rachel Lumnitzer Chem 103 Lab 2
Drexel - ANTH - 101
Panel Discussion Audience Evaluation Form Name of Audience Member _ Date _ Topic _ _1.Before hearing the panel discussion, I held that:2.The major factors, if any, that led me to that tentative conclusion were: a. _ b. _Based upon my readings, listen
Drexel - ANTH - 101
Post 1 To prevent the continuing speculation of water, one of the most important changes that needs to be made is to stop treating corporations like people. Once they are no longer allowed to take water from wherever they want, they'll have to purchase th
Drexel - COM - 230
References Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology Vol.166 (4) pp. 557-580. Lefimil, C., Jedlicki, E., Holmes, D. 2011. An artifact in studies of gene regulation using Betagalactosidase
Drexel - COM - 230
COM 230: Appendix 1 (Giving your first speech) 1. Much research has been conducted on public speaking anxiety, and many articles containing practical tips for overcoming public speaking anxiety have been published. Find one such article on this topic (hin
Drexel - COM - 230
COM 230: Chapters 1, 2, 3 (Public Speaking overview; Listening; Ethics) 1. List and briefly explain what you believe to be the five most important characteristics of effective speaker. Also, list and briefly explain what you believe are the five most comm
Drexel - COM - 230
COM 230: Chaps 4 & 14 (Topic Selection; Informative Speaking)1. Using one or more of the brainstorming methods described in Chapter 4, come up with 3 general topics for your upcoming Informative Speech. For each topic, develop three possible specific pur
Drexel - COM - 230
COM 230: Chapters 12, 13, Appendix 2 (Delivery, Visual Aids & PowerPoint) 1. One effective way to improve your public speaking skills is by critiquing others' speeches. Select one of the following TED (Technology, Education & Design) talks and analyze the
Drexel - COM - 230
COM 230: Chap 15 & 16 (Persuasive Speaking, cont.; Monroe's sequence & Credibility)1. MAKE SURE TO INCLUDE YOUR PROPOSED SPECIFIC PURPOSE STATEMENT FOR YOUR PERSUASIVE SPEECH IN YOUR ANSWER TO THIS QUESTION FOR FULL CREDIT. Speaker credibility becomes ev
Drexel - COM - 230
COM 230: Chapter 5 (Adapting your speech to a specific audience)1. Below are three general speech topics and, for each, two hypothetical audiences to which a speech might be delivered. For each topic, write a brief paragraph referencing techniques outlin
Drexel - COM - 230
COM 230: Chapters 6 & 7 (Supporting Materials)1. Each of the following statements violates at least one of the criteria for effective supporting materials discussed in your book. Identify the flaw/s in each statement:a.According to a study conducted by
Drexel - COM - 230
COM 230: Chapter 8 (Organizing information) and Chapter 10 (Speech outlining)1. Identify the organizational method used in each of the following sets of main points for student speeches: Topical organization; two different aspects of Chavez's workI. Ces
Texas Pan American - ACC - 3320
Chapter 7: Standard Costing and Variance AnalysisCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in
Texas Pan American - ACC - 3320
IntroductionThis Student Guide is a self-study aid to accompany the 13th edition of Cost Accounting: A Managerial Emphasis, by Horngren, Datar, Foster, Rajan and Ittner. The Student Guide has three purposes: (1) to reinforce and clarify your understandin
Texas Pan American - ACC - 3320
Chapter 4: Activity-Based Management and Activity-Based CostingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as
Texas Pan American - ACC - 3320
Chapter 5: Job Order CostingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in a license distributed
Texas Pan American - ACC - 3320
Chapter 1: Introduction to Cost AccountingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in a licen
Texas Pan American - ACC - 3320
Chapter 2: Cost Terminology and Cost BehaviorsCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in a l
Texas Pan American - ACC - 3320
Chapter 3: Predetermined Overhead Rates, Flexible Budgets, and Absorption/ Variable CostingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole o
Texas Pan American - ACC - 3322
Chapter 14-1CHAPTER14LONG-TERM LIABILITIESIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 14-2Learning Objectives1. 2. 3. 4. 5. 6. 7. 8. Describe the formal procedures associated with issuing longterm debt. Identify variou
Texas Pan American - ACC - 3322
Chapter 16-1CHAPTER16DILUTIVE SECURITIES AND EARNINGS PER SHAREIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 16-2Learning Objectives Learning Objectives1.Describe the accounting for the issuance, conversion, and retirem
Texas Pan American - ACC - 3322
Chapter 17-1CHAPTER17INVESTMENTSIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 17-2Learning Objectives Learning Objectives1.Identify the three categories of debt securities and describe the accounting and reporting treat
Texas Pan American - ACC - 3322
Chapter 20-1CHAPTER20ACCOUNTING FOR PENSIONS AND POSTRETIREMENT BENEFITSIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 20-2Learning Objectives1. 2. 3. 4. 5. 6. 7. 8. 9. Distinguish between accounting for the employer's pe
Texas Pan American - ACC - 3322
Chapter 18-1CHAPTER18REVENUE RECOGNITIONIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 18-2Learning Objectives1. 2. 3. 4. 5. 6. 7. Apply the revenue recognition principle. Describe accounting issues for revenue recognitio
Texas Pan American - ACC - 3322
Chapter 21-1CHAPTER21ACCOUNTING FOR LEASESIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 21-2Learning Objectives Learning Objectives1. 2. 3. 4. 5. 6. 7. 8. 9.Explain the nature, economic substance, and advantages of leas
Texas Pan American - ACC - 3322
Chapter 22-1CHAPTER22ACCOUNTING CHANGES AND ERROR ANALYSISIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 22-2Learning ObjectivesChapter 22-3Accounting Changes and Error AnalysisAccounting ChangesChanges in accounting p