Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
Punjab Engineering College - CS - 1313
Intrusion Detection in Mobile Ad-Hoc Networks: A Mobile Agent ApproachUpinder Kaur and R.B. Patel Dept. of Computer Engineering, M. M. Engineering College, Mullana-133203, Haryana, INDIA raj_chawla94@yahoo.com, patel_r_b@indiatimes.com AbstractIn this p
Punjab Engineering College - CS - 1313
A Self-adaptive Intrusion Detection Method for AODV-based Mobile Ad Hoc NetworksSatoshi Kurosawa, Hidehisa Nakayama, Nei Kato , Abbas Jamalipour , and Yoshiaki Nemoto Graduate School of Information Sciences, Tohoku University Aoba 6309, Aramaki, Aoba-ku,
Drexel - ANTH - 101
"Life is a constant struggle between being an individual and being a member of the community" "Each funeral was a funeral for all of us. We lived and died together" Converging Cultures: One of the Tribe, A Tribe of One I. Introduction: a clear statement o
Drexel - ANTH - 101
Clash between cultures, especially Native American and White, is no new concept within the field of anthropology. Though some differences between them are obvious, such as appearance and heritage, it is the underlying differences that are explored by auth
Drexel - ANTH - 101
Clash between cultures, especially Native American and White, is no new concept within the field of anthropology. Though some differences between them are obvious, such as appearance and heritage, it is the underlying differences that are explored by auth
Drexel - ANTH - 101
Bio 124 Diversity Portfolio Group 1Introduction Everyone recognizes the signs of moldy bread, the white spider-web like substance spreading over the bread with portions of fuzzy blue or green patches. Not only is it a great disappointment after hopes of
Drexel - ANTH - 101
Clash between cultures, especially Native American and White, is no new concept within the field of anthropology. Though some differences between them are obvious, such as appearance and heritage, it is the underlying differences that are explored by auth
Drexel - ANTH - 101
Sikhism Bibliography (Rachel) Groff, Garin. "Brother of Sikh Murdered after 9/11 Educates Community." East Valley Tribune. Sept. 2011. Web. 12 Mar. 2012. <http:/www.eastvalleytribune.com/arizona/article_c81a3ee0-d8e3-11e0-9bb5001cc4c002e0.html>. Matharu,
Drexel - ANTH - 101
I'm going to discuss second half of the worship and daily practices. Temples One of the most important elements to the Sikh worship is the temples. The Golden Temple was the first temple created in Amritsar, Punjab, and it is very important in Sikhism, an
Drexel - ANTH - 101
Sikhism Rachel Lumnitzer and Akash BhalaniOverviewHistory Philosophies Customs Worship and Daily Practices Rituals Misconceptions InterviewsHistoryMigrated from India/Punjab over last 130 yrs Over 20 million worldwide, most live in Punjab Founded duri
Drexel - ANTH - 101
Sikhism Overview Over 20 million Sikhs worldwide, most of which live in Punjab province of India Founded during 16th century in Punjab, based on teachings of Guru Nanak and the 9 gurus after him The most important part of Sikhism is the religious state of
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012Week 4 Lab PTC gene and Hardy-Weinberg Lab Overview: Week 4 Lab: Gel Electrophoresis and Lesson on Determining PTC genotype Week 4 Recitation: Analysis of Results Week 6 Lab: Lab report DUE to Lab TA
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012Group Member Names: _ _ _ _ Grade: _/20 points Week 7 Lab Plant Diversity A. Photosynthetic Pigment Nutritionally, two basic types of organisms exist in our world, autotrophs and heterotrophs. Autotro
Drexel - BIO - 124
BIO 124 Section 65 Lab Report 1 Group 1 Results Table 1- Group Genotypes and Phenotype ObservationsGroup 1 Members Rachel Lumnitzer (Group Member 1) Divya Paramesh (Group Member 2) Anjali Misra (Group Member 3) Cara Jourdan (Group Member 4)Phenotype Mod
Drexel - BIO - 124
IntroductionThe ability to taste, or not to taste phenylthiocarbamide (PTC) is expressed by a single gene that codes for a taste receptor on the tongue. The first acknowledgement of this gene was by Arthur Fox in the 1930s, the actual PTC gene, TAS2R38,
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012PTC Lab Report GuidelinesDue Date: Week 6 lab (100 points: 9% of total grade) Specification: - Double-spaced - Times New Roman, 12 font Section Details: 1. Introduction (15 points): 2 pages Relevant
Drexel - BIO - 124
SCIENCE OBSERVERHow a Fungus Boosts a Beetle's InvasionMicrobial evolution helps explain why a mildmannered American beetle has become a tree killer in AsiaElsa YoungsteadtWhen China opened its borders to international commerce in the late 1970s, it g
Drexel - BIO - 224
Lepisosteus oculatus>gi|38304785|gb|AY442350.1| Lepisosteus oculatus mitochondrion, complete genomeGCTAGTGTAGCTTAACCAAAGCATAGCACTGAAGATGTTAAGATGGACTCTAACGGGTCCCACGGGCRCAAAGGCTTGGTCCTGACCTTGCTATCAGTTTTAGCCGAACTTACACATGCAAGTATCCGAGGTTTGGTCCTGACCTTGCTATC
Drexel - BIO - 224
BIO 224 Section 001: Fish Cladogram Project Character Matrix Rachel Lumnitzer, My Dung Ha, Nazaneen Zahedi, Ravi Patel, Catheryn Blankenbiller Traits Atlantic Sturgeon (Acipens er oxyrinch us) 1 2 No Estuary Upriver in spring Spotted Gar (Lepisost eus ocu
Drexel - BIO - 224
Spotted Garmonochromatic vision (type of vision) eyes dorsal fin number or shape: 1 ventral fin number: 3 tail texture (scales, etc.):gray spots lateral scales: diamond shaped ganoid scales, non-overlapping freshwater/saltwater: freshwater caudal fin: ye
Drexel - BIO - 224
Bio 224 Section 001 Project: Rachel Lumnitzer, Cat Blankenbiller, Ravi Patel, Nazaneen Zahedi, My Dung Ha, Species Teeth Ventral Fin 2 2 0 0 1 0 1 Lateral Tail Fin Scales Scales No No No No No Yes Yes No No No No No No Yes Stripe None None None Light Dark
Drexel - BIO - 224
- Fungal phylogeny was once based on morphology and heterotrophic nutrition - Now use molecular analysis of fungal DNA and distinguishing fungal characteristics. -Examples of fungi characters include flagellation, cell wall structure, mitochondrial struct
Drexel - BIO - 124
Fungi are classified under the domian domain Eukarya. To be categorized within this domain an organism must have cells that feature membrane-bound, complex structures such as a nucleus, enclosed within membranes. A fungal cell is more similar of the cells
Drexel - BIO - 124
Fungi are classified under the domian Eukarya. To be categorized within this domain an organism must have cells that feature membrane-bound, complex structures such as a nucleus, enclosed within membranes. A fungal cell is more similar of the cells of ani
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Anjali Misra, Cara Jourdan, Divya Paramesh, Rachel Lumnitzer IntroductionCommon characteristics all fungus share are that their cells feature membranebound, complex structures suc
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Divya Paramesh, Rachel Lumnitzer, Anjali Misra, Cara JourdanIntroductionCommon characteristics all Fungus share are that their cells feature membranebound, complex structures such
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and Animals BodyBy Divya Paramesh, Rachel Lumnitzer, Anjali Misra, Cara JourdanIntroductionCommon characteristics all Fungus share are that their cells feature membranebound, complex structures
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Anjali Misra, Cara Jourdan, Divya Paramesh, Rachel Lumnitzer IntroductionCommon characteristics all fungus share are that their cells feature membranebound, complex structures suc
Drexel - BIO - 124
-For evolution I will first discuss the phylogeny of fungi and then move onto the evolution. -For several years, classification was based on the morphology and nutrition of fungus. As we know, this is a well-known way to distinguish organisms for specific
Drexel - BIO - 124
Bio 124 Diversity Portfolio Group 1 Evolutionary For technique of tree. Fungi were this did the same eliminate these these selective evolutionary Figure 1. and Phylogenetic Analysis of Fungi Taxonomy several years, mycologists relied on an ambiguous class
Drexel - BIO - 124
The Role of Fungi in the Pathogenic Destruction of Plants and AnimalsBy Anjali Misra, Cara Jourdan, Divya Paramesh, Rachel Lumnitzer http:/www.zeitnews.org/agricultureresearch/fungireduceneedforfertilizerinagriculture.htmlIntroductionCommon characteri
Drexel - BIO - 124
Bio 124Evolution and Organismal DiversityWinter 2012Group Member Names: _ _ _ _ Grade: _/20 points Week 5 Lab Bacterial Diversity What are some key characteristics of bacteria? Small cell size Prokaryotic cell structure Lack internal organelles Commons
Drexel - ANTH - 101
Rachel Lumnitzer Chem 103 Lab 2
Drexel - ANTH - 101
Panel Discussion Audience Evaluation Form Name of Audience Member _ Date _ Topic _ _1.Before hearing the panel discussion, I held that:2.The major factors, if any, that led me to that tentative conclusion were: a. _ b. _Based upon my readings, listen
Drexel - ANTH - 101
Post 1 To prevent the continuing speculation of water, one of the most important changes that needs to be made is to stop treating corporations like people. Once they are no longer allowed to take water from wherever they want, they'll have to purchase th
Drexel - COM - 230
References Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology Vol.166 (4) pp. 557-580. Lefimil, C., Jedlicki, E., Holmes, D. 2011. An artifact in studies of gene regulation using Betagalactosidase
Drexel - COM - 230
COM 230: Appendix 1 (Giving your first speech) 1. Much research has been conducted on public speaking anxiety, and many articles containing practical tips for overcoming public speaking anxiety have been published. Find one such article on this topic (hin
Drexel - COM - 230
COM 230: Chapters 1, 2, 3 (Public Speaking overview; Listening; Ethics) 1. List and briefly explain what you believe to be the five most important characteristics of effective speaker. Also, list and briefly explain what you believe are the five most comm
Drexel - COM - 230
COM 230: Chaps 4 & 14 (Topic Selection; Informative Speaking)1. Using one or more of the brainstorming methods described in Chapter 4, come up with 3 general topics for your upcoming Informative Speech. For each topic, develop three possible specific pur
Drexel - COM - 230
COM 230: Chapters 12, 13, Appendix 2 (Delivery, Visual Aids & PowerPoint) 1. One effective way to improve your public speaking skills is by critiquing others' speeches. Select one of the following TED (Technology, Education & Design) talks and analyze the
Drexel - COM - 230
COM 230: Chap 15 & 16 (Persuasive Speaking, cont.; Monroe's sequence & Credibility)1. MAKE SURE TO INCLUDE YOUR PROPOSED SPECIFIC PURPOSE STATEMENT FOR YOUR PERSUASIVE SPEECH IN YOUR ANSWER TO THIS QUESTION FOR FULL CREDIT. Speaker credibility becomes ev
Drexel - COM - 230
COM 230: Chapter 5 (Adapting your speech to a specific audience)1. Below are three general speech topics and, for each, two hypothetical audiences to which a speech might be delivered. For each topic, write a brief paragraph referencing techniques outlin
Drexel - COM - 230
COM 230: Chapters 6 & 7 (Supporting Materials)1. Each of the following statements violates at least one of the criteria for effective supporting materials discussed in your book. Identify the flaw/s in each statement:a.According to a study conducted by
Drexel - COM - 230
COM 230: Chapter 8 (Organizing information) and Chapter 10 (Speech outlining)1. Identify the organizational method used in each of the following sets of main points for student speeches: Topical organization; two different aspects of Chavez's workI. Ces
Texas Pan American - ACC - 3320
Chapter 7: Standard Costing and Variance AnalysisCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in
Texas Pan American - ACC - 3320
IntroductionThis Student Guide is a self-study aid to accompany the 13th edition of Cost Accounting: A Managerial Emphasis, by Horngren, Datar, Foster, Rajan and Ittner. The Student Guide has three purposes: (1) to reinforce and clarify your understandin
Texas Pan American - ACC - 3320
Chapter 4: Activity-Based Management and Activity-Based CostingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as
Texas Pan American - ACC - 3320
Chapter 5: Job Order CostingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in a license distributed
Texas Pan American - ACC - 3320
Chapter 1: Introduction to Cost AccountingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in a licen
Texas Pan American - ACC - 3320
Chapter 2: Cost Terminology and Cost BehaviorsCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole or in part, except for use as permitted in a l
Texas Pan American - ACC - 3320
Chapter 3: Predetermined Overhead Rates, Flexible Budgets, and Absorption/ Variable CostingCost Accounting: Foundations & Evolutions, 8e Kinney and Raiborn 2011 Cengage Learning. All Rights Reserved. May not be copied, scanned, or duplicated, in whole o
Texas Pan American - ACC - 3322
Chapter 14-1CHAPTER14LONG-TERM LIABILITIESIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 14-2Learning Objectives1. 2. 3. 4. 5. 6. 7. 8. Describe the formal procedures associated with issuing longterm debt. Identify variou
Texas Pan American - ACC - 3322
Chapter 16-1CHAPTER16DILUTIVE SECURITIES AND EARNINGS PER SHAREIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 16-2Learning Objectives Learning Objectives1.Describe the accounting for the issuance, conversion, and retirem
Texas Pan American - ACC - 3322
Chapter 17-1CHAPTER17INVESTMENTSIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 17-2Learning Objectives Learning Objectives1.Identify the three categories of debt securities and describe the accounting and reporting treat
Texas Pan American - ACC - 3322
Chapter 20-1CHAPTER20ACCOUNTING FOR PENSIONS AND POSTRETIREMENT BENEFITSIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 20-2Learning Objectives1. 2. 3. 4. 5. 6. 7. 8. 9. Distinguish between accounting for the employer's pe
Texas Pan American - ACC - 3322
Chapter 18-1CHAPTER18REVENUE RECOGNITIONIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 18-2Learning Objectives1. 2. 3. 4. 5. 6. 7. Apply the revenue recognition principle. Describe accounting issues for revenue recognitio
Texas Pan American - ACC - 3322
Chapter 21-1CHAPTER21ACCOUNTING FOR LEASESIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 21-2Learning Objectives Learning Objectives1. 2. 3. 4. 5. 6. 7. 8. 9.Explain the nature, economic substance, and advantages of leas
Texas Pan American - ACC - 3322
Chapter 22-1CHAPTER22ACCOUNTING CHANGES AND ERROR ANALYSISIntermediate Accounting 13th Edition Kieso, Weygandt, and WarfieldChapter 22-2Learning ObjectivesChapter 22-3Accounting Changes and Error AnalysisAccounting ChangesChanges in accounting p