11 Pages

DifferentialExpressionII

Course: CMSC 858, Spring 2012
School: Maryland
Rating:
 
 
 
 
 

Word Count: 1358

Document Preview

whats So next? !"#!$%&%' ()*)$+,-.)//01*$2*345/0/ 607).)*834$+,-.)//01*$99 1.Hierarchical/Bayesian methods to estimate variance (and Empirical Bayesian ways to produce estimates) 2.Non-parametric ways of obtaining pvalues 3.Corrections for multiple testing A bag of tricks for the large data analyst! Thursday, February 17, 2011 Thursday, February 17, 2011 Naive Bayes Classiers Consider the...

Register Now

Unformatted Document Excerpt

Coursehero >> Maryland >> Maryland >> CMSC 858

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
whats So next? !"#!$%&%' ()*)$+,-.)//01*$2*345/0/ 607).)*834$+,-.)//01*$99 1.Hierarchical/Bayesian methods to estimate variance (and Empirical Bayesian ways to produce estimates) 2.Non-parametric ways of obtaining pvalues 3.Corrections for multiple testing A bag of tricks for the large data analyst! Thursday, February 17, 2011 Thursday, February 17, 2011 Naive Bayes Classiers Consider the hector-recognition computer vision problem: is this a picture of hector? Introduction to Empirical Bayes Input: pixel intensities (continuous) xi Output: yes/no (categorical) g g x1 x2 ... xp Decision: P(g=yes | x1, ... , xp) > P(g=no | x1, ... , xp) ? Thursday, February 17, 2011 Thursday, February 17, 2011 Naive Bayes Classiers Bayes Rule Consider the hector-recognition computer vision problem: is this a picture of hector? P (G|X ) P (X |G)P (G) Posterior Decision: P(g=yes | x1, ... , xp) > P(g=no | x1, ... , xp) ? Dening P(g=yes | x1, ... , xp) is hard Dening P(x1, ... , xp | g=yes) is easier g x1 x2 ... xp P (x1 , . . . , xp |g = yes ) = p j =1 f (xj |g = yes ) 2 Xj |G N (j , j ) their analyses Priors may be fully specied (full Bayesian), or its parameters estimated from data (empirical Bayesian) The subject of much debate in statistics (Frequentist/ Bayesian argument) Useful way of thinking about hierarchical models Thursday, February 17, 2011 Robust Naive Bayes Classier Consider the hector-recognition computer vision problem: is this a picture of hector? Many parameters to estimate (as many means as pixels), not that much data (there arent as many images) g 1 x1 2 x2 ... ... p xp Idea: Pixels behave similarly, can we use pool data to estimate pixel means j |G N (0 , 2 ) 2 Xj |j N (j , j ) Thursday, February 17, 2011 Prior Statisticians use it as a way of bringing history into Now what? Thursday, February 17, 2011 Likelihood Thursday, February 17, 2011 Thursday, February 17, 2011 Thursday, February 17, 2011 Modeling Relative Expression Courtesy of Gordon Smyth Thursday, February 17, 2011 Thursday, February 17, 2011 Hierarchical Model Normal Model Prior Posterior Statistics Posterior variance estimators Moderated t-statistics Reparametrization of Lnnstedt and Speed 2002 Normality, independence assumptions are wrong but convenient, resulting methods are useful Thursday, February 17, 2011 Shrinkage of Standard Deviations Eliminates large t-statistics merely from very small s Thursday, February 17, 2011 Signicance analysis of microarrays (SAM) A clever adaptation of the t-ratio to borrow information across genes The data decides whether should be closer to tg,pooled or to tg Thursday, February 17, 2011 Thursday, February 17, 2011 The exchangeability factor SAM-statistic Chosen to make signal-to-noise ratios independent of signal Computation For gene i di = Let yi " xi si + s0 x i = mean of Group II samples ! ! Standard deviation of residuals for gene i aassuming same variance Exchangeability factor estimated using all genes Thursday, February 17, 2011 Thursday, February 17, 2011 values. Let values, For Compute ! where mad is the median absolute deviation from the median, divided by 0.64 Compute = coefcient of variation of the Choose and Thursday, February 17, 2011 So whats next? Scatter plots of relative difference Random fluctuations in the data, measured by balanced permutations (for cell line 1 and 2) percentile of the Compute the 100 quantiles of the denoted by y i = mean of Group I samples ! be the Relative difference for a permutation of the data that was balanced between cell lines 1 and 2. 1.Hierarchical/Bayesian methods to estimate variance (and Empirical Bayesian ways to produce estimates) 2.Non-parametric ways of obtaining pvalues 3.Corrections for multiple testing A bag of tricks for the large data analyst! Thursday, February 17, 2011 Hypothesis testing Once you have a given score for each gene, how do you decide on a cut-off? Inference and the Multiple Comparison Problem Many slides courtesy of John Storey p-values are popular. But how do we decide on a cut-off? Are 0.05 and 0.01 appropriate? Are the p-values correct? Thursday, February 17, 2011 Thursday, February 17, 2011 P-values by permutation p-values by permutations It is common that assumptions about statistics used to summarize interest (e.g., t-statistic) are not approximate enough to yield useful p-values We focus on one gene only. For the bth iteration, b = 1, !!! , B; An alternative is to use permutations After all the B permutations are done; 1. Permute the n data points for the gene (x). The rst n1 are referred to as treatments, the second n2 as controls. For each gene, calculate the corresponding sample t-statistic, two tb. 1. Put p = #{b: |tb| |tobserved|}/B. Thursday, February 17, 2011 Thursday, February 17, 2011 The reference distribution Order the values of (could be any stat) Permute the treatment labels, and compute a new set of ordered values :3;<$=1$#2" Repeat step 2 for, say, 100 permutations: From these, compute the average largest, average second largest etc. >& Thursday, February 17, 2011 Thursday, February 17, 2011 Selected genes expected d(i) Thursday, February 17, 2011 Thursday, February 17, 2011 Multiple Comparison Problem If we do have useful approximations of our p-values, we still face the multiple comparison problem Hypothesis Testing Test for each gene null hypothesis: no differential expression. Two types of errors can be committed Type I error or false positive (say that a gene is differentially When performing many independent tests p-values no longer have the same interpretation Thursday, February 17, 2011 Type II error or false negative (fail to identify a truly differentially expressed gene, i.e.,fail to reject a false null hypothesis) Thursday, February 17, 2011 Multiple Hypothesis Testing What happens if we call all genes signicant with p-values 0.05, for example? Null True expressed when it is not, i.e., reject a true null hypothesis). Called Not Called Signicant Signicant V m0 V Total m0 Altern.True S m1 S m1 Total R mR m Multiple Testing problem not only in genomics Statistical Comparisons of Classiers over Multiple Datasets, Demsar, JMLR 2006 Permutation Tests for Studying Classier Performance, Ojala, JMLR, 2010 On Comparing Classiers: Pitfalls to avoid and a recommended approach, Salzberg, 1997, Data Mining and Knowledge Discovery Null = Equivalent Expression; Alternative = Differential Expression Thursday, February 17, 2011 Thursday, February 17, 2011 Other ways of thinking of P-values A p-value is dened to be the minimum false positive rate at which an observed statistic can be called signicant If the null hypothesis is simple, then a null p-value is uniformly distributed Multiple Hypothesis Test Error Controlling Procedure Suppose m hypotheses are tested with pvalues p1, p2, , pm A multiple hypothesis error controlling procedure is a function T(p; ") such that rejecting all nulls with pi T(p; ") implies that Error " Error is a population quantity (not random) Thursday, February 17, 2011 Thursday, February 17, 2011 Error Rates Weak and Strong Control If T(p; ") is such Error " only when m0 = m, then the procedure provides weak control of the error measure If T(p; ") is such Error " for any value of m0, then the procedure provides strong control of the error measure note that m0 is not an argument of T(p; ")! Thursday, February 17, 2011 Per comparison error rate (PCER): the expected value of the number of Type I errors over the number of hypotheses " PCER = E(V)/m Per family error rate (PFER): the expected number of Type I errors " PFER = E(V) Family-wise error rate: the probability of at least one Type I error " FEWR = Pr(V 1) False discovery rate (FDR) rate that false discoveries occur " FDR = E(V/R; R>0) = E(V/R | R>0)Pr(R>0) Positive false discovery rate (pFDR): rate that discoveries are false " pFDR = E(V/R | R>0)." Thursday, February 17, 2011 FDR plug-in Bonferroni Procedure Create K permutations of the data, producing statistics tjk for features j=1,...,M and permutations k=1,...,K. Provides strong control!.. For a range of cutoffs C, let Robs = M j =1 I (|tj | > C ) E (V ) = MK 1 I (|tk | > C ) j K j =1 k=1 Estimate the FDR by F DR = E (V )/Robs Thursday, February 17, 2011 Thursday, February 17, 2011 #2"?$3@30* expected d(i) AB Thursday, February 17, 2011 Thursday, February 17, 2011 Delta Ave # False # called falsely discovery signicant signicant rate 0.3 75.1 294 0.255 0.4 33.6 196 19.8 160 0.123 0.7 10.1 94 0.107 1.0 4.0 46 More than two groups Paired data Survival data, with censored response 0.171 0.5 More general versions of SAM 0.086 Delta is the half-width of the bar around the 45-degree line. Thursday, February 17, 2011 Thursday, February 17, 2011 Finally Limitations of SAM SAM nowadays uses the q-value method to quantify signicance Solutions for s_0 are often at the extremes and sensitive to the resolution of the quantile grid. Permutation analysis throws all genes in the same bag Requires a monotone signal-to-noise relationship we did not discuss this There is a nice discussion of these issues in Section 18.7 of Elements of Statistical Learning Thursday, February 17, 2011 Thursday, February 17, 2011
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Maryland - CMSC - 858
!&quot;#$%&amp;'()%&quot;*#%*+,-.+&quot;+)(/0*(1$%23)&quot;*2%&amp;-4(3)%&quot;/5*678*2+#19:3)%&quot;*3&quot;&amp;*#1+*;,&lt;*!/:3&quot;&amp;*:3&quot;&amp;/(3,+*=,3$#*&gt;?**@A(#%$*;%$3&amp;3*B$3C%*@%N*&amp;%*N+*2+3/'$+*678*2+#19:3)%&quot;O*;DE;FGFH*E,$-&quot;.*&gt;IJ&gt;*=23&quot;9*/:-&amp;+/*(%'$#+/9*%K*L3K3+:*!$-M3$9?*P&quot;+*Q'+/)%&quot;R* S1+$+*&amp;%*N+
Maryland - CMSC - 858
!&quot;#$%&amp;'()(%&quot;*%+,-,%$-#-(%!%.'&quot;&amp;&quot;$'/0&amp;%1#+-2()0#+'#$Gene Set AnalysisCMSC 858B Spring 2012Hector Corrada BravoComputer ScienceUniversity of MarylandI'('%,'$%J(35.&quot;0'($ Gene Set Enrichment Analysis is an approachto finding sets of biologically conn
Maryland - CMSC - 858
CMSC 858B: Homework 1Homework IHector Corrada BravoDue February 27All coding to be done in R.Part I: Molecular BiologyIt is known that sickle cell anemia is caused by a change in DNA. Summarize what is known about themolecular basis of this disease
Maryland - CMSC - 858
CMSC 858B: Homework 2Homework IIHector Corrada BravoDue March 16All coding to be done in R.Part I: Select your paper for nalAs part of the nal you will review a paper in terms of methods and analysis of high-throughput genomicsexperiments. This wil
Maryland - CMSC - 858
!&quot;#$%&amp;'()%&quot;*#%*+,-.+&quot;+)(/0*(1$%23)&quot;*2%&amp;-4(3)%&quot;/5*678*2+#19:3)%&quot;*3&quot;&amp;*#1+*;,&lt;*!/:3&quot;&amp;*:3&quot;&amp;/(3,+**=&gt;(#%$*;%$3&amp;3*?$3@%*;AB;CDCE*B,$-&quot;.*FGHF*I23&quot;9*/:-&amp;+/*(%'$#+/9*%J*K3J3+:*!$-L3$9M*&lt;+&quot;+)(/0*#1+*3:,13N+#*%J*:-J+* O+P+$/*%J*678*/+Q'+&quot;(+*(3$9*#1+*-&quot;J%$2
Maryland - CMSC - 858
CMSC858P Sparsity with L1 penaltiesHector Corrada BravoMarch, 2010IntroductionWe have seen a number of times where we induce sparsity in models using l1 penalties. In this section wegive some motivation why this works.PreambleBefore we begin this s
Maryland - CMSC - 858
Gene regulationtranscription factorexampleGene regulation: transcription factor analysisHector Corrada BravoCMSC858B Spring 2012University of MarylandSlides courtesy of: Rafael A. Irizarry, Benjamin Langmead, Curtis HuttenhowerWe have studied how
Maryland - CMSC - 858
Regulatory Inferecefrom Gene ExpressionCMSC858P Spring 2012Hector Corrada Bravo2Graphical Model Let y be a vectorvalued random variable Suppose some condi8onal independence proper8es hold for some variables in y. Example: vari
Maryland - CMSC - 858
(134/ ;&lt;)$=134/$1&gt;$9&lt;0/$/)6?1*@!&quot;#!$%&amp;%'()*)$+,-.)/01*$2*345/0/ :*9.1AB6)$C06.13.35$9)6&lt;*141=5@$!&quot;#$%&amp;'()*&amp;%&amp;+,($'*&amp;$%'-&amp; D1.C340E3?1*$F9G1$/93?/?634$34=1.09&lt;C/H .&quot;*%'/01&amp;$23$'()%45&quot;+$&quot;+$6&amp;+,&amp;*$&quot;7$-0(,*02)5&quot;+&quot;06.13.35/7$83.9$: 8&quot;6'/$4&quot;/3+&quot;%0'/$*&amp;
Maryland - CMSC - 858
Intro to RHctor Corrada BravoCMSC858B Spring 2012University of MarylandComputer Sciencehttp:/www.nytimes.com/2009/01/07/technology/business-computing/07program.html?_r=2&amp;pagewanted=1http:/www.forbes.com/forbes/2010/0524/opinions-software-norman-nie-
Maryland - CMSC - 858
MappingTake a read:mRNA abundanceestimation with RNAseqHector Corrada BravoCMSC858B Spring 2012Many slides courtesy of Ben Langmead @ JHSPHMappingReference&gt;MT dna:chromosome chromosome:GRCh37:MT:1:16569:1GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTC
Maryland - CMSC - 858
RNAseq: isoform expression quantication andtranscript assemblySlides courtesy from S. Salzberg, C. Trapnell, L. Pachter and K. OkrahSec-gen SequencingmRNAfragments tobe sequenced!2Corrada Bravo 10/30/09Sec-gen SequencingPaired-EndsmRNAfragmen
Maryland - MATH - 246
First In-Class Exam SolutionsMath 246, Professor David LevermoreThursday, 23 February 2012dw= (w 2 4)(6 + w )2 ew .dtSketch its phase-line portrait over the interval 10 w 6. Identify all ofits stationary (equilibrium) solutions and classify each as
Maryland - MATH - 246
Second In-Class Exam SolutionsMath 246, Professor David LevermoreThursday, 29 March 2012(1) [4] Give the interval of denition for the solution of the initial-value problem75x +x = 2,x(3) = x (3) = x (3) = 0 .sin(t)t 4Solution. The equation is
Maryland - MATH - 246
FIRST-ORDER ORDINARY DIFFERENTIAL EQUATIONS I:Introduction and Analytic MethodsDavid LevermoreDepartment of MathematicsUniversity of Maryland22 January 2012Because the presentation of this material in lecture will dier from that in the book, I felt
Maryland - MATH - 246
FIRST-ORDER ORDINARY DIFFERENTIAL EQUATIONS II:Graphical and Numerical MethodsDavid LevermoreDepartment of MathematicsUniversity of Maryland29 January 2012Because the presentation of this material in lecture will dier from that in the book, I feltt
Maryland - MATH - 246
FIRST-ORDER ORDINARY DIFFERENTIAL EQUATIONS III:Applications and More Analytic MethodsDavid LevermoreDepartment of MathematicsUniversity of Maryland19 February 2012Because the presentation of this material in lecture will dier from that in the book,
Maryland - MATH - 246
FIRST-ORDER SYSTEMS OFORDINARY DIFFERENTIAL EQUATIONS I:Introduction and Linear SystemsDavid LevermoreDepartment of MathematicsUniversity of Maryland14 April 2012Because the presentation of this material in lecture will dier from that in the book,
Maryland - MATH - 246
FIRST-ORDER SYSTEMS OFORDINARY DIFFERENTIAL EQUATIONS II:Homogeneous Linear Systems with Constant CoecientsDavid LevermoreDepartment of MathematicsUniversity of Maryland28 January 2012Because the presentation of this material in lecture will dier f
Maryland - MATH - 246
HIGHER-ORDER LINEARORDINARY DIFFERENTIAL EQUATIONS I:Introduction and Homogeneous EquationsDavid LevermoreDepartment of MathematicsUniversity of Maryland12 March 2012Because the presentation of this material in lecture will dier from that in the bo
Maryland - MATH - 246
HIGHER-ORDER LINEARORDINARY DIFFERENTIAL EQUATIONS II:Nonhomogeneous EquationsDavid LevermoreDepartment of MathematicsUniversity of Maryland14 March 2012Because the presentation of this material in lecture will dier from that in the book,I felt th
Maryland - MATH - 246
HIGHER-ORDER LINEARORDINARY DIFFERENTIAL EQUATIONS III:Mechanical VibrationsDavid LevermoreDepartment of MathematicsUniversity of Maryland27 March 2012Because the presentation of this material in lecture will dier from that in the book,I felt that
Maryland - MATH - 246
HIGHER-ORDER LINEARORDINARY DIFFERENTIAL EQUATIONS IV:Laplace Transform MethodDavid LevermoreDepartment of MathematicsUniversity of Maryland14 April 2012Because the presentation of this material in lecture will dier from that in the book,I felt th
Maryland - MATH - 246
Sample Problems for First In-Class ExamMath 246, Spring 2012, Professor David Levermore(1) (a) Give the integral being evaluated by the following MATLAB command.int(x/(1+x4),x,0,inf)(b) Sketch the graph that would be produced by the following MATLAB c
Maryland - MATH - 246
Solutions of Sample Problems for First In-Class ExamMath 246, Spring 2012, Professor David Levermore(1) (a) Give the integral being evaluated by the following MATLAB command.int(x/(1+x4),x,0,inf)Solution. It is evaluating the denite integralrdr .1
Maryland - MATH - 246
Sample Problems for Second In-Class ExamMath 246, Spring 2012, Professor David Levermore(1) Give the interval of denition for the solution of the initial-value problemd3 x cos(3t) dxe2t+=,dt34 t dt1+tx(2) = x (2) = x (2) = 0 .(2) Suppose that
Maryland - MATH - 412
First In-Class Exam Solutions: Math 412Section 0101, Professor LevermoreThursday, 8 March 2012nm1. [15] Let f : R R be continuous. Let G Rm be open. Show that f 1 (G) is open,wheref 1 (G) = x Rn : f (x) G .Solution. In order to show that f 1 (G) i
Maryland - MATH - 412
Advanced Calculus: MATH 410Real NumbersProfessor David Levermore7 January 20121. Real Number System1.1. Introduction. Numbers are at the heart of mathematics. By now you must be fairlyfamiliar with them. Some basic sets of numbers are:natural numbe
Maryland - MATH - 412
Advanced Calculus: MATH 410Functions and RegularityProfessor David Levermore7 January 20125. Functions, Continuity, and Limits5.1. Functions. We now turn our attention to the study of real-valued functions that aredened over arbitrary nonempty subse
Maryland - MATH - 412
Advanced Calculus: MATH 410Riemann Integrals and IntegrabilityProfessor David Levermore7 January 20129. Riemann IntegralsWe now revisit the denite integral that was introduced to you when you rst studied calculus.You undoubtedly learned that the den
Maryland - MATH - 420
Modeling Epidemics: IntroductionFirst Models Preliminary goal: Model the spread of an infectiousdisease through a population. Simplifying assumptions: The total population N is constant in time. A newly infected person becomes infectious thenext da
Maryland - MATH - 420
Modeling Epidemics: IntroductionFirst Models Preliminary goal: Model the spread of an infectious(contagious) illness through a population. Simplifying assumptions: The total population N is constant in time. A newly infected person becomes infectiou
Maryland - MATH - 420
Fitting Nonlinear Models to DataSI Model The SI model we discussed before is often writtendS /dt = pS Id I /dt = pS Iwhere S is the susceptible population those at riskto become infected at a given time and I is theinfectious population. For this m
Maryland - MATH - 420
New Model andNondimensionalizationModied SIR Model A standard extension to the SIR model adds termsrepresenting births and deaths that are proportionalto the overall population. If were modeling an adult subpopulation that is eitherinfected or at r
Maryland - MATH - 420
Fitting Linear Statistical Models to Databy Least Squares I: IntroductionBrian R. Hunt and C. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 25, 2012 versionOutline of Three Lectures1)Introduction to Line
Maryland - MATH - 420
Fitting Linear Statistical Models to Databy Least Squares II: WeightedBrian R. Hunt and C. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 25, 2012 versionOutline of Three Lectures1)Introduction to Linear
Maryland - MATH - 420
Fitting Linear Statistical Models to Databy Least Squares III: MultivariateBrian R. Hunt and C. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 25, 2012 versionOutline1)Introduction to Linear Statistical M
Maryland - MATH - 420
Math 420, Spring 2012First Individual Homework ProblemA dataset consisting of the national total numbers of births in the UnitedStates on each day of 1978 can be found athttp:/www.math.umd.edu/evs/MATH420/Births1978.txt.Using these data, do the follo
Maryland - MATH - 420
Math 420, Spring 2012Second Individual Homeworkdue Friday, 10 February, 2012Exercise 1a. Compute mi , vij , and cij for each of the following groups of assets based ondaily, weekly, and monthly closing price data with uniform weights:(i) Apple, Googl
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsRisk and Return I: IntroductionC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Portfolios that Contain
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsRisk and Return II: Markowitz PortfoliosC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Portfolios that
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsRisk and Return III: Basic MarkowitzPortfolio TheoryC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Po
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsPortfolio Models I: Portfolios with Risk-Free AssetsC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Por
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsPortfolio Models II: Long PortfoliosC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingMarch 25, 2012 versionc 2011 Charles David LevermoreModeling Portfolios that Conta
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsPortfolio Models III: Long Portfolioswith a Safe InvestmentC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreMode
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsStochastic Models I: One Risky AssetC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Portfolios that Con
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsOptimization I: Model-Based Objective FunctionsC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Portfoli
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsOptimization II: Model-Based PortfolioManagementC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 26, 2012 versionc 2011 Charles David LevermoreModeling Portfo
Maryland - MATH - 420
Modeling Portfolios that Contain Risky AssetsOptimization III: ConclusionC. David LevermoreUniversity of Maryland, College ParkMath 420: Mathematical ModelingJanuary 27, 2012 versionc 2011 Charles David LevermoreModeling Portfolios that Contain Ris
Maryland - MATH - 401
Eigenpairs and DiagonalizabilityMath 401, Spring 2010, Professor David Levermore1. EigenpairsLet A be an nn matrix. A number (possibly complex even when A is real) is aneigenvalue of A if there exists a nonzero vector v (possibly complex) such that(1
Maryland - MATH - 401
Solutions to First In-Class Exam: Math 401Section 0201, Professor LevermoreMonday, 8 March 20101. [15] The coecient matrix A of the10004 5 linear system Ax = f can be row reduced to3 0 0 10 1 0 4.0 0 1 2000 0(a) What is the rank of A?(b) Do
Maryland - MATH - 401
Solutions to Second In-Class Exam: Math 401Section 0201, Professor LevermoreFriday, 16 April 2010No notes, books, or electrontics. You must show your reasoning for full credit. Good luck!1. [20] Consider the polynomialsp1 (x) = 1 x2 ,p2 (x) = x(1 x)
Maryland - MATH - 241h
MATH 241H Exam 1 (February 17, 2012)Please answer each numbered question on a dierent answer sheet. Make sure your name, myname, and the appropriate problem number appear on each answer sheet. You only need to signthe pledge on the rst answer sheet. Sh
Maryland - MATH - 241h
MATH 241H Exam 2 (Wednesday, March 14, 2012)Please answer each numbered question on a dierent answer sheet. Make sureyour name, my name, and the appropriate problem number appear on each answersheet. You only need to sign the pledge on the rst answer s
Maryland - MATH - 241h
Name:Please answer each question in the space provided using the back if necessary. Show all work andbe sure your answers are complete, with explanations where necessary.1. (4 pts) Find a unit vector in the direction of 3i 6j + 2k.|3i 6j + 2k| = 9 + 3
Maryland - MATH - 241h
MATH 241H: Quiz 2 (Monday, February 6, 2012)Name:Please answer each question in the space provided using the back if necessary. Showall work and be sure your answers are complete, with explanations where necessary.1. (7 pts) Find the equation of the l
Maryland - MATH - 241h
MATH 241H: Quiz 3 (Monday, February 13, 2012)Name:Please answer each question in the space provided using the back if necessary. Show all work andbe sure your answers are complete, with explanations where necessary.1. Consider the lines given by the s
Maryland - MATH - 241h
MATH 241H: Quiz 4 (Monday, February 27, 2012)Name:Please answer each question in the space provided using the back if necessary. Show all work andbe sure your answers are complete, with explanations where necessary.1. Determine if each of the followin
Maryland - MATH - 241h
MATH 241H: Quiz 5 (Monday, March 5, 2012)Name:Please answer each question in the space provided using the back if necessary. Showall work and be sure your answers are complete, with explanations where necessary.1. Let f (x, y ) = xexy + ydy(a) (5 pt
Maryland - MATH - 241h
MATH 241H: Quiz 6 (Wednesday, March 28, 2012)Name:Please answer each question in the space provided using the back if necessary. Showall work and be sure your answers are complete, with explanations where necessary.1. FindRydA where R is the region
Maryland - MATH - 241h
MATH 241H: Quiz 7 (Monday, April 2, 2012)Name:Please answer each question in the space provided using the back if necessary. Show all work andbe sure your answers are complete, with explanations where necessary.1. Calculate the surface area of the Sph