2 Pages

CH18

Course: ECON 0102, Fall 2011
School: HKU
Rating:
 
 
 
 
 

Word Count: 779

Document Preview

18 Commercial Chapter Banking Industry: Structure and Competition 107 Answers to End-of-Chapter Questions 1. Agricultural and other interests in the U.S. were quite suspicious of centralized power and thus opposed the creation of a central bank. 2. a. b. c. d. Office of the Controller of the Currency; the Federal Reserve; state banking authorities and the FDIC; the Federal Reserve. 3. False. Although there are...

Register Now

Unformatted Document Excerpt

Coursehero >> China >> HKU >> ECON 0102

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
18 Commercial Chapter Banking Industry: Structure and Competition 107 Answers to End-of-Chapter Questions 1. Agricultural and other interests in the U.S. were quite suspicious of centralized power and thus opposed the creation of a central bank. 2. a. b. c. d. Office of the Controller of the Currency; the Federal Reserve; state banking authorities and the FDIC; the Federal Reserve. 3. False. Although there are many more banks in the United States than in Canada, this does not mean that the American banking system is more competitive. The reason for the large number of U.S. banks is anticompetitive regulations such as restrictions on banking. 4. New technologies such as electronic banking facilities are frequently shared by several banks, so these facilities are not classified as branches. Thus they can be used by banks to escape limitations to offering services in other states and, in effect, to escape limitations from restrictions on branching. 5. Because becoming a bank holding company allows a bank to: a. circumvent branching restrictions since it can own a controlling interest in several banks even if branching is not permitted, and b. engage in other activities related to banking that can be highly profitable. 6. International banking has been encouraged by giving special tax treatment and relaxed branching regulations to Edge Act corporations and to international banking facilities (IBFs); this was done to make American banks more competitive with foreign banks. The hope is that it will create more banking jobs in the United States. 7. IBFs encourage American and foreign banks to do more banking business in the United States, thus shifting employment from Europe to the United States. 8. No, because the Saudi-owned bank is subject to the same regulations as the American-owned bank. 9. The elimination of reserve requirements would decrease the size of money market mutual funds because banks could then offer higher interest rates on their deposits; funds would flow out of money market mutual funds into banks. 108 Mishkin/Eakins Financial Markets and Institutions, Sixth Edition 10. The rise of inflation and the resulting higher interest rates on alternatives to checkable deposits meant that banks had a big shrinkage in this low-cost way of raising funds. The innovation of money market mutual funds also meant that the banks lost checking account business. The abolishment of Regulation Q and the appearance of NOW accounts did help decrease disintermediation but raised the cost of funds for American which banks, now had to pay higher interest rates on checkable and other deposits. Foreign banks were also able to tap a large pool of domestic savings, thereby lowering their cost of funds relative to American banks. 11. True. Higher inflation helped raise interest rates which caused the disintermediation process to occur and which helped create money market mutual funds. As a result banks lost cost advantages on the liabilities side of their balance sheets and this has led to a less healthy banking industry. However, improved information technology would still have eroded the banks' income advantages on the assets side of their balance sheet, so the decline in the banking industry would still have occurred. 12. The growth of the commercial paper market and the development of the junk bond market meant that corporations were now able to issue securities rather than borrow from banks, thus eroding the competitive advantage of banks on the lending side. Securitization has enable other financial institutions to originate loans, again taking away some of the banks' loan business. 13. Uncertain. The invention of the computer did help lower transaction costs and the costs of collecting information, both of which have made other financial institutions more competitive with banks and have allowed corporations to bypass banks and borrow directly from securities markets. Therefore, computers were an important factor in the decline of traditional banking. However, another source of the decline in the traditional banking industry was the loss of cost advantages for the banks in acquiring funds, and this loss was due to factors unrelated to the invention of the computer, such as the rise in inflation and its interaction with regulations which produced disintermediation. 14. Brokerage firms began to engage in the traditional banking business of issuing deposit instruments, while foreign bank activities in the United States further eroded the competitive position of U.S. banks. This led to the Federal Reserve's allowing bank holding companies to enter the underwriting business through a loophole in Glass-Steagall in order to keep them competitive. Finally, legislation in 1999 was passed to repeal Glass-Steagall. 15. The Gramm-Leach-Bliley Act now opens the door to consolidation, not only in terms of the number of banking institutions, but also across financial service activities. Banking institutions will become larger and increasingly complex organizations, engaging in the full gamut of financial services activities.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

HKU - ECON - 0102
Chapter 20Banking Regulation113Answers to End-of-Chapter Questions1. There would be adverse selection because people who might want to burn their property for some personal gain would actively try to obtain substantial fire insurance policies. Moral h
HKU - ECON - 0102
HKU - ECON - 0102
FINA0102 Financial Markets and Institutions Answers for Tutorial 1M.C. 1) The bond markets are important becauseA) they are easily the most widely followed financial markets in the United States. B) they are the markets where interest rates are determin
HKU - ECON - 0102
SCHOOL OF ECONOMICS AND FINANCE FINA0102 Financial Markets and Institutions Tutorial 3 (To be discussed in the week of Oct 3 & Oct 5)OCTOBER 2011M.C. 1) The risk premium on corporate bonds becomes smaller if A) the riskiness of corporate bonds increases
HKU - ECON - 0102
SCHOOL OF ECONOMICS AND FINANCE FINA0102 Financial Markets and Institutions Tutorial 4 (To be discussed in the week of Oct 10)OCTOBER 2011M.C. 1) The theory of purchasing power parity cannot fully explain exchange rate movements because A) not all goods
HKU - ECON - 0102
SCHOOL OF ECONOMICS AND FINANCE FINA0102 Financial Markets and Institutions Tutorial 5 (Ch. 7, 8) (To be discussed in the week of Oct 31)OCTOBER 2011M.C 1) Which of the following is not one of the eight basic facts about financial structure? A) Debt con
HKU - ECON - 0102
SCHOOL OF ECONOMICS AND FINANCE FINA0102 Financial Markets and Institutions Tutorial 6 (Ch. 10) (To be discussed in the week of Nov 14)NOVEMBER 2011M.C. 1) The federal funds rate is A) the interest rate on loans from the Fed to a bank. B) the price the
LSU - AG - 1005
Chapter100:11ScienceempiricaltestsofideasthatgenerateknowledgeofthenaturalworldCharacteristics:ScienceinvolvesempiricaltestsofideasScienceinvolvestheinterplayofinductiveanddeductivereasoningDeductivegeneraltospecificInductivespecifictogeneralScien
Nashville State Community College - CHEM - 102
CHM 111COLLEGE CHEMISTRY 1COURSE INFORMATIONAssistant Professor: M. Jahangeri;Office: LS 152; Telephone: (703) 948 7783Email: mjahangeri@NVCC.edu Mailbox: Division Office LR303Office Hours:Flexible (by appointments):Mondays 9:00- 11:00 AM, Wednesd
UMSL - ACCT - 110
Question 12 out of 2 pointsThe information inthe following table isfrom the statementof cash flows for acompany at fourdifferent points intime (Period 1,Period 2, Period 3,and Period 4).Negative values arepresented inparentheses.Based on thi
UMSL - ACCT - 110
1. The principle purpose of posting is toAnswerhelp identify errors made in the journal.accumulate the effects of journalized transactions in the individual accounts.enter transactions directly into the ledger.help determine if the financial statemen
Oxford Brookes - 123 - 123
MARKETING PLANCONTENTI.Executivesummary.3NurzhamalII. Currentmarketsituation.4A. Marketoverview.4i.MarketdemographicsandneedsMarkettrendsandtargetmarketgrowthii.B. SWOTanalysis5Alexsandri.Strengthsii.Weaknessesiii.Opportunitiesiv.T
LSU - BIOL 1201 - 1201
OUTLINES FOR BIOLOGY 1201Sections 003 and 004Fall 2009DR. STEVEN POMARICO5CChapter 17FROM GENE TO PROTEINDNA is the instructions (program) that tells the cell what to do. Proteins are theresults of those instructions.Molecular Genetics: The Prote
LSU - BIOL 1201 - 1201
SI Exam 1 Review (Ch. 1-4)Chapter 1Definitions to know: emergent propertiesenergyinheritanceDNAhomeostasisdomaintaxonomynatural causality-theory1) What are the unifying characteristics of life?2) What are the levels of biological organization?3) Wha
LSU - BIOL 1201 - 1201
StudyGuideChapters8and9Whatarethetwolawsofenergytransformation?1stLawofThermodynamics energycanbetranferredortransformed,butitcannotbedestroyed2ndLawofThermodynamics everyenergytransferortransformationmakestheuniversemoredisorderedPg.45Whatisthe
LSU - BIOL 1201 - 1201
StudyGuideChapters1013Whatarethepropertiesoflight?LightiselectromagneticenergyIthaswavelikepropertiesIthasparticlelikepropertiesCalledphotonsWhatisthecorrelationbetweenwavelengthandenergy?Thesmallerthewavelength,themoreenergyitcarriesWhatisthed
LSU - BIOL 1201 - 1201
Chapter 10 - PhotosynthesisPhotosynthesis transforms light energy trapped by chloroplasts into chemical bond energyand stores that energy in sugar and other organic molecules. A lot of mechanisms inphotosynthesis are very similar to cellular respiratio
LSU - BIOL 1201 - 1201
Chapter 14MENDEL AND THE GENE IDEAHeredity: The Story of Gregor MendelThe father of genetics: Johann (Gregor) Mendelo Mendel was a monk who was trained in science at the University of Vienna.o The realization that both parents contributed to the char
LSU - BIOL 1201 - 1201
Biology Test 1What do atoms for when they share electron pairs?1. Molecules2. Elements3. Ions4. Aggregates5. IsotopesThe formation of ice on a pond during colder weather helps to temper the seasonal transition towinter. This is mainly because :1.
LSU - BIOL 1201 - 1201
SI Review Test 2Chapter 5 MacromoleculesCarbohydrates1) What is an alpha and beta structure? Alpha structure is when the H is up and theOH is down on the 1st carbon, Beta structure is when the OH is up and the H isdown on the 1st carbon. What are ald
LSU - BIOL 1201 - 1201
Exam 4 pretest:Binary fission: bacteria prokaryotic cellsWhat in chlorophyll has highest pHKaryotypePictures (two were pics of chromosomes)Daughter cellWhat reproduces asexually:bacteria prokaryotesOnly way to have genetic variation with asexual re
LSU - BIOL 1201 - 1201
ProkaryotesAnimalsPlantsNucleoidER smooth and roughER smooth and roughRibosomesNucleus envelope,nucleolus, chromatinNucleus envelope,nucleolus, chromatinPlasma membranePlasma membraneRibosomesRibosomesGolgi apparatusGolgi apparatusLysosom
CUNY Brooklyn - CSE - 494
REMOVAL & INSTALLATION1 of 3http:/arrc.epnet.com.oh0049.oplin.org/autoapp/9307MER/9307CH08_.REMOVAL & INSTALLATIONFrontALL MODELS EXCEPT E CLASS 4-MATIC1. Before servicing the vehicle, refer to the precautions in the beginning of this section.2. Re
CUNY Brooklyn - CSE - 494
CUNY Brooklyn - CSE - 494
CS 332: AlgorithmsGraph AlgorithmsDavid Luebke1Review: Depth-First Search Depth-first search is another strategy forexploring a graph Explore deeper in the graph whenever possible Edges are explored out of the most recentlydiscovered vertex v tha
CUNY Brooklyn - CSE - 494
Lecture 9: More PHPG64HLL, High Level Languageshttp:/www.cs.nott.ac.uk/~gxo/g64hll.htmlDr. Gabriela Ochoagxo@cs.nott.ac.ukBased on: Deitel & Deitel book, Chapter 26, and R.Sebesta, Chapter 12Outline - PHPPHP Last Lecture1.2.3.4.IntroductionP
CUNY Brooklyn - CSE - 494
Lecture 8: PHPG64HLL, High Level Languageshttp:/www.cs.nott.ac.uk/~gxo/g64hll.htmlDr. Gabriela Ochoagxo@cs.nott.ac.ukBased on Deitel & Deitel book. Chapter 26Outline - PHP1.2.3.4.IntroductionPHP: arithmetic expressions, data conversion, arrays
CUNY Brooklyn - CSE - 494
CSC 382 Non-Comprehensive FinaldepartmentDue date 12/15/11 at 5PM my mailbox CSCSC 382 Version 2 (Graph-theory and Backtracking) - Due Date 12/15/11 (drop-it in mailbox not later than 5 PM)Must sign name on every page and last 4 digits of SSNNAME:SS
CUNY Brooklyn - CSE - 494
C SC 230 Computer Architecture and Assembly Language April 2000 Exam Sample Solutions 1. (12 marks) Circle the correct answer for each of the following: The 8-bit two's complement representation of -1510 is 111100012. Two's complement representation has d
CUNY Brooklyn - CSE - 494
Mid-Term Exam CS2422 Assembly Language and System Programming November 27, 2007INSTRUCTIONS: Show your work (i.e., how you derived your answer or the reason behind your thinking) in addition to your answer. Budget your time wisely (e.g., do not spend too
CUNY Brooklyn - CSE - 494
CSC424Prof Emile C. ChiIntroduction to Database1st ExamMarch 27, 2012NAME_1)(30 points) Let R (A, B, C, D, E) be a relations with attributes A, B, C, D, E.Let F be the set of functional dependencies:A -> B,CC,D -> EB -> DE -> Aa) Compute the
CUNY Brooklyn - CSE - 494
Job Interview One-Sheeter - Your Personal Cliffs NotesBrought to you by Jenny Blake, LifeAfterCollege.orgCheck out my book on Amazon - Life After College: The Complete Guide to Getting What You Want Note from Jenny: My approach to preparing for intervi
Prairie View A & M - BIOL - 1123
1.What is an advantage to using plants to cleanse soil, as opposed to just removing the soil itself?(see book section: Biology and Society: Planting Hope in the Wake of Katrina)Your Answer:Plants will remove bacteria and other potential pathogens from
CUNY Brooklyn - CSE - 494
Prairie View A & M - BIOL - 1123
Biochemistry IntroductionSelect LanguageAfrikaansAlbanianArabicBelarusianBulgarianCatalanChinese(Simplified)Chinese(Traditional)CroatianCzechDanishDutchEsperantoEstonianFilipinoFinnishFrenchGalicianGermanGreekHaitianCreoleHebrewHindiHungarianIcelandi
CUNY Brooklyn - CSE - 494
Solutions to Exam TwoCS130 - Computer Organization and Assembly Language Drake University - Fall, 2003Directions: Do all problems. Show all work. Please work first on problems with which you are more comfortable.Problem 1 - protected addressing mode. (
Prairie View A & M - BIOL - 1123
Water Properties andMineral SaltsSelect LanguageAfrikaansAlbanianArabicBelarusianBulgarianCatalanChinese(Simplified)Chinese(Traditional)CroatianCzechDanishDutchEsperantoEstonianFilipinoFinnishFrenchGalicianGermanGreekHaitianCreoleHebrewHindiHungaria
CUNY Brooklyn - CSE - 494
CS 332: AlgorithmsGraph AlgorithmsDavid Luebke1Administrative Test postponed to Friday Homework: Turned in last night by midnight: full credit Turned in tonight by midnight: 1 day late, 10% off Turned in tomorrow night: 2 days late, 30% off Extr
Prairie View A & M - BIOL - 1123
Carbohydrates Properties Review1. What are the organic chemical groups that characterize carbohydrates? How are carbohydratesclassified according to the presence of those groups?Carbohydrates are also known as sugars (starches, cellulose and other subs
CUNY Brooklyn - CSE - 494
Lecture 9: More PHPG64HLL, High Level Languageshttp:/www.cs.nott.ac.uk/~gxo/g64hll.htmlDr. Gabriela Ochoagxo@cs.nott.ac.ukBased on: Deitel & Deitel book, Chapter 26, and R.Sebesta, Chapter 12Outline - PHPPHP Last Lecture1.2.3.4.IntroductionP
Prairie View A & M - BIOL - 1123
Fat ReviewUnderstand LipidsSelect LanguageAfrikaansAlbanianArabicBelarusianBulgarianCatalanChinese(Simplified)Chinese(Traditional)CroatianCzechDanishDutchEsperantoEstonianFilipinoFinnishFrenchGalicianGermanGreekHaitianCreoleHebrewHindiHungarianIcela
CUNY Brooklyn - CSE - 494
Eulers method with TI-89Step1:1. Press (Mode)2. Go to Graph, press () and selectDIFF EQUATIONS3. Press (enter) twiceStep2:1. Press () and then (F1).2. Press (F1), go down to 9:Format.,and then press (enter)3. Go to Solution Method, press ()and
Prairie View A & M - BIOL - 1123
Protein Structure Review1. What are proteins? How can the protein diversity of living beings be explained?Proteins are molecules made of sequences of amino acids bound by a peptide bond.The genetic code codifies twenty different amino acids that can co
CUNY Brooklyn - CSE - 494
Job Interview One-Sheeter - Your Personal Cliffs NotesBrought to you by Jenny Blake, LifeAfterCollege.orgCheck out my book on Amazon - Life After College: The Complete Guide to Getting What You WantNote from Jenny: My approach to preparing for intervie
Prairie View A & M - BIOL - 1123
Enzyme Activity - Q&A Review1. What are catalysts?Catalysts are substances that reduce the activation energy of a chemical reaction, facilitating it ormaking it energetically viable. The catalyst increases the speed of the chemical reaction.2. What am
CUNY Brooklyn - CSE - 494
Chapter 4: Advanced SQLDatabase System Concepts, 5th Ed.Silberschatz, Korth and Sudarshan See www.db-book.com for conditions on re-useChapter 4: Advanced SQLs SQL Data Types and Schemas s Integrity Constraints s Authorization s Embedded SQL s Dynamic
Prairie View A & M - BIOL - 1123
DNA and RNA Review1. What are nucleic acids? What is the historic origin of this name?DNA and RNA, the nucleic acids, are the molecules responsible for the hereditary informationthat commands the protein synthesis in living beings. The name nucleic der
IUPUI - ISOM - 221
Chapter 10 Supply Chain StrategyChapterPart 3: Managing Value Chains10TRUE/FALSESupply Chain Strategy1. Supply chain management is the strategy of organizing, motivating and controlling a firm's processes andthose of its suppliers to match the flow
IUPUI - ISOM - 221
Chapter 11 LocationChapter11TRUE/FALSELocation1. If the customer must be physically present at the process, location is an important issue.Answer: True Reference: Introduction Difficulty: Easy Keywords: location, physical, presence, customer2. Seco
University of Phoenix - RES - 341
Father Absence and the Welfare of Children By Sara McLanahanIntroduction Increases in divorce and out-of-wedlock childbearing have dramatically altered the family life of American children. Whereas in the early 1960s, nearly 90 percent of all children li
Case Western Reserve University - ENGR - 225
ENGR 225 Introduction to Fluid and Thermal Engineering Hour Examination # 3 April 27th, 2012Name:_ Email:_Problem I Problem II Problem III Problem IV Problem V Total(True or False)_/20 _/20 _/20 _/20 _/20 _/100ENGR 225 Hour Test # 3 April 27, 2012I
Case Western Reserve University - ENGR - 225
ENGR 225 Introduction to Fluid and Thermal Engineering Final Examination April 28th, 2011Name:_ Email:_ Recitation Section_ Teaching Assistant_ PART I Thermodynamics page 2 Problem I (True /False) 3 4 5 Problem II Problem III Problem IV_/10 _/20 _/20 _/
University of Florida - AEB - 4383
AEB4283 - International Development PolicyExam 2 Study GuideUrbanization and Rural-Urban Migration (Chapter 7) What are the correlations between development and urbanization? What trends exist? What economic benefits do cities offer? What economic costs
MIT - CS - 551
String Matching Z(Following Guseld Chapter 2)Exact String SearchMicroscopy of chromosomes of a human female (karyotype):Bolzer et al, PLoS Biol. 2005ggccgggccctgtgaccacagtccacatcacaccaggacacagaggaagggccgggccctgtgaccacagtccacatcacaccaggacacagaggaagggc
Park - MG - 365
MG365 Homework Week 5 Timothy Boyland 1. What must a manager determine about a subordinate before deciding to move the subordinate into the developmental cycle? How can a manager determine that this action should be taken? Before a manager decides to move
Park - MG - 365
MG365 Week 6 Homework Timothy Boyland 1. If you completed the LEAD self instrument, would you be able to assess your leader's style? why, or Why not? If I completed the LEAD self instrument, I would not be able to assess my leader's style of leadership. L
Park - MG - 365
MG365 Week 7 Homework Timothy Boyland 1. Explain how performance readiness can be applied to teams. Provide examples. Assessing performance readiness for teams is very similar to individuals. There are still four levels. A group with a performance readine
Park - MG - 365
MG365 Organizational Behavior Student Study Guide Final Examination 1.05 This is a two-hour, closed book and closed notes test. Therefore, it cannot be a take-home test. Students may use a hand-held calculator during the test provided it does not have fea
Royal Melbourne Institute of Technology - ECON - BAFI2040
Economic Group AssignmentGroup membersYi-Ying Chen, s3092072Melissa Lee, s3159707Weiru Zhou, s3313398Anthony Permana Putera Jaya, s3339651Kaijing Qin, s3312017Date: 16/Oct/2011Economic Group AssignmentMembers/Yi-Ying Chen s3092072, Melissa Lee s3
WVU - ACCT - 311
Chapter 2Conceptual Framework- Establishes the concepts that underlie financial reporting.- Coherent systems of concepts that flow from an objective.- Provides guidance on:1. Identifying the boundaries of financial reporting2. Selecting the transact