Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.
Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more.
Course Hero has millions of course specific materials providing students with the best way to expand
their education.
Below is a small sample set of documents:
LSU - BIOL 1201 - 1201
SI Review Test 2Chapter 5 MacromoleculesCarbohydrates1) What is an alpha and beta structure? Alpha structure is when the H is up and theOH is down on the 1st carbon, Beta structure is when the OH is up and the H isdown on the 1st carbon. What are ald
LSU - BIOL 1201 - 1201
Exam 4 pretest:Binary fission: bacteria prokaryotic cellsWhat in chlorophyll has highest pHKaryotypePictures (two were pics of chromosomes)Daughter cellWhat reproduces asexually:bacteria prokaryotesOnly way to have genetic variation with asexual re
LSU - BIOL 1201 - 1201
ProkaryotesAnimalsPlantsNucleoidER smooth and roughER smooth and roughRibosomesNucleus envelope,nucleolus, chromatinNucleus envelope,nucleolus, chromatinPlasma membranePlasma membraneRibosomesRibosomesGolgi apparatusGolgi apparatusLysosom
CUNY Brooklyn - CSE - 494
REMOVAL & INSTALLATION1 of 3http:/arrc.epnet.com.oh0049.oplin.org/autoapp/9307MER/9307CH08_.REMOVAL & INSTALLATIONFrontALL MODELS EXCEPT E CLASS 4-MATIC1. Before servicing the vehicle, refer to the precautions in the beginning of this section.2. Re
CUNY Brooklyn - CSE - 494
CUNY Brooklyn - CSE - 494
CUNY Brooklyn - CSE - 494
CS 332: AlgorithmsGraph AlgorithmsDavid Luebke1Review: Depth-First Search Depth-first search is another strategy forexploring a graph Explore deeper in the graph whenever possible Edges are explored out of the most recentlydiscovered vertex v tha
CUNY Brooklyn - CSE - 494
Lecture 9: More PHPG64HLL, High Level Languageshttp:/www.cs.nott.ac.uk/~gxo/g64hll.htmlDr. Gabriela Ochoagxo@cs.nott.ac.ukBased on: Deitel & Deitel book, Chapter 26, and R.Sebesta, Chapter 12Outline - PHPPHP Last Lecture1.2.3.4.IntroductionP
CUNY Brooklyn - CSE - 494
Lecture 8: PHPG64HLL, High Level Languageshttp:/www.cs.nott.ac.uk/~gxo/g64hll.htmlDr. Gabriela Ochoagxo@cs.nott.ac.ukBased on Deitel & Deitel book. Chapter 26Outline - PHP1.2.3.4.IntroductionPHP: arithmetic expressions, data conversion, arrays
CUNY Brooklyn - CSE - 494
CSC 382 Non-Comprehensive FinaldepartmentDue date 12/15/11 at 5PM my mailbox CSCSC 382 Version 2 (Graph-theory and Backtracking) - Due Date 12/15/11 (drop-it in mailbox not later than 5 PM)Must sign name on every page and last 4 digits of SSNNAME:SS
CUNY Brooklyn - CSE - 494
C SC 230 Computer Architecture and Assembly Language April 2000 Exam Sample Solutions 1. (12 marks) Circle the correct answer for each of the following: The 8-bit two's complement representation of -1510 is 111100012. Two's complement representation has d
CUNY Brooklyn - CSE - 494
Mid-Term Exam CS2422 Assembly Language and System Programming November 27, 2007INSTRUCTIONS: Show your work (i.e., how you derived your answer or the reason behind your thinking) in addition to your answer. Budget your time wisely (e.g., do not spend too
CUNY Brooklyn - CSE - 494
CSC424Prof Emile C. ChiIntroduction to Database1st ExamMarch 27, 2012NAME_1)(30 points) Let R (A, B, C, D, E) be a relations with attributes A, B, C, D, E.Let F be the set of functional dependencies:A -> B,CC,D -> EB -> DE -> Aa) Compute the
CUNY Brooklyn - CSE - 494
Job Interview One-Sheeter - Your Personal Cliffs NotesBrought to you by Jenny Blake, LifeAfterCollege.orgCheck out my book on Amazon - Life After College: The Complete Guide to Getting What You Want Note from Jenny: My approach to preparing for intervi
Prairie View A & M - BIOL - 1123
1.What is an advantage to using plants to cleanse soil, as opposed to just removing the soil itself?(see book section: Biology and Society: Planting Hope in the Wake of Katrina)Your Answer:Plants will remove bacteria and other potential pathogens from
CUNY Brooklyn - CSE - 494
Prairie View A & M - BIOL - 1123
Biochemistry IntroductionSelect LanguageAfrikaansAlbanianArabicBelarusianBulgarianCatalanChinese(Simplified)Chinese(Traditional)CroatianCzechDanishDutchEsperantoEstonianFilipinoFinnishFrenchGalicianGermanGreekHaitianCreoleHebrewHindiHungarianIcelandi
CUNY Brooklyn - CSE - 494
Solutions to Exam TwoCS130 - Computer Organization and Assembly Language Drake University - Fall, 2003Directions: Do all problems. Show all work. Please work first on problems with which you are more comfortable.Problem 1 - protected addressing mode. (
Prairie View A & M - BIOL - 1123
Water Properties andMineral SaltsSelect LanguageAfrikaansAlbanianArabicBelarusianBulgarianCatalanChinese(Simplified)Chinese(Traditional)CroatianCzechDanishDutchEsperantoEstonianFilipinoFinnishFrenchGalicianGermanGreekHaitianCreoleHebrewHindiHungaria
CUNY Brooklyn - CSE - 494
CS 332: AlgorithmsGraph AlgorithmsDavid Luebke1Administrative Test postponed to Friday Homework: Turned in last night by midnight: full credit Turned in tonight by midnight: 1 day late, 10% off Turned in tomorrow night: 2 days late, 30% off Extr
Prairie View A & M - BIOL - 1123
Carbohydrates Properties Review1. What are the organic chemical groups that characterize carbohydrates? How are carbohydratesclassified according to the presence of those groups?Carbohydrates are also known as sugars (starches, cellulose and other subs
CUNY Brooklyn - CSE - 494
Lecture 9: More PHPG64HLL, High Level Languageshttp:/www.cs.nott.ac.uk/~gxo/g64hll.htmlDr. Gabriela Ochoagxo@cs.nott.ac.ukBased on: Deitel & Deitel book, Chapter 26, and R.Sebesta, Chapter 12Outline - PHPPHP Last Lecture1.2.3.4.IntroductionP
Prairie View A & M - BIOL - 1123
Fat ReviewUnderstand LipidsSelect LanguageAfrikaansAlbanianArabicBelarusianBulgarianCatalanChinese(Simplified)Chinese(Traditional)CroatianCzechDanishDutchEsperantoEstonianFilipinoFinnishFrenchGalicianGermanGreekHaitianCreoleHebrewHindiHungarianIcela
CUNY Brooklyn - CSE - 494
Eulers method with TI-89Step1:1. Press (Mode)2. Go to Graph, press () and selectDIFF EQUATIONS3. Press (enter) twiceStep2:1. Press () and then (F1).2. Press (F1), go down to 9:Format.,and then press (enter)3. Go to Solution Method, press ()and
Prairie View A & M - BIOL - 1123
Protein Structure Review1. What are proteins? How can the protein diversity of living beings be explained?Proteins are molecules made of sequences of amino acids bound by a peptide bond.The genetic code codifies twenty different amino acids that can co
CUNY Brooklyn - CSE - 494
Job Interview One-Sheeter - Your Personal Cliffs NotesBrought to you by Jenny Blake, LifeAfterCollege.orgCheck out my book on Amazon - Life After College: The Complete Guide to Getting What You WantNote from Jenny: My approach to preparing for intervie
Prairie View A & M - BIOL - 1123
Enzyme Activity - Q&A Review1. What are catalysts?Catalysts are substances that reduce the activation energy of a chemical reaction, facilitating it ormaking it energetically viable. The catalyst increases the speed of the chemical reaction.2. What am
CUNY Brooklyn - CSE - 494
Chapter 4: Advanced SQLDatabase System Concepts, 5th Ed.Silberschatz, Korth and Sudarshan See www.db-book.com for conditions on re-useChapter 4: Advanced SQLs SQL Data Types and Schemas s Integrity Constraints s Authorization s Embedded SQL s Dynamic
Prairie View A & M - BIOL - 1123
DNA and RNA Review1. What are nucleic acids? What is the historic origin of this name?DNA and RNA, the nucleic acids, are the molecules responsible for the hereditary informationthat commands the protein synthesis in living beings. The name nucleic der
IUPUI - ISOM - 221
Chapter 10 Supply Chain StrategyChapterPart 3: Managing Value Chains10TRUE/FALSESupply Chain Strategy1. Supply chain management is the strategy of organizing, motivating and controlling a firm's processes andthose of its suppliers to match the flow
IUPUI - ISOM - 221
Chapter 11 LocationChapter11TRUE/FALSELocation1. If the customer must be physically present at the process, location is an important issue.Answer: True Reference: Introduction Difficulty: Easy Keywords: location, physical, presence, customer2. Seco
University of Phoenix - RES - 341
Father Absence and the Welfare of Children By Sara McLanahanIntroduction Increases in divorce and out-of-wedlock childbearing have dramatically altered the family life of American children. Whereas in the early 1960s, nearly 90 percent of all children li
Case Western Reserve University - ENGR - 225
ENGR 225 Introduction to Fluid and Thermal Engineering Hour Examination # 3 April 27th, 2012Name:_ Email:_Problem I Problem II Problem III Problem IV Problem V Total(True or False)_/20 _/20 _/20 _/20 _/20 _/100ENGR 225 Hour Test # 3 April 27, 2012I
Case Western Reserve University - ENGR - 225
ENGR 225 Introduction to Fluid and Thermal Engineering Final Examination April 28th, 2011Name:_ Email:_ Recitation Section_ Teaching Assistant_ PART I Thermodynamics page 2 Problem I (True /False) 3 4 5 Problem II Problem III Problem IV_/10 _/20 _/20 _/
University of Florida - AEB - 4383
AEB4283 - International Development PolicyExam 2 Study GuideUrbanization and Rural-Urban Migration (Chapter 7) What are the correlations between development and urbanization? What trends exist? What economic benefits do cities offer? What economic costs
MIT - CS - 551
String Matching Z(Following Guseld Chapter 2)Exact String SearchMicroscopy of chromosomes of a human female (karyotype):Bolzer et al, PLoS Biol. 2005ggccgggccctgtgaccacagtccacatcacaccaggacacagaggaagggccgggccctgtgaccacagtccacatcacaccaggacacagaggaagggc
Park - MG - 365
MG365 Homework Week 5 Timothy Boyland 1. What must a manager determine about a subordinate before deciding to move the subordinate into the developmental cycle? How can a manager determine that this action should be taken? Before a manager decides to move
Park - MG - 365
MG365 Week 6 Homework Timothy Boyland 1. If you completed the LEAD self instrument, would you be able to assess your leader's style? why, or Why not? If I completed the LEAD self instrument, I would not be able to assess my leader's style of leadership. L
Park - MG - 365
MG365 Week 7 Homework Timothy Boyland 1. Explain how performance readiness can be applied to teams. Provide examples. Assessing performance readiness for teams is very similar to individuals. There are still four levels. A group with a performance readine
Park - MG - 365
MG365 Organizational Behavior Student Study Guide Final Examination 1.05 This is a two-hour, closed book and closed notes test. Therefore, it cannot be a take-home test. Students may use a hand-held calculator during the test provided it does not have fea
Royal Melbourne Institute of Technology - ECON - BAFI2040
Economic Group AssignmentGroup membersYi-Ying Chen, s3092072Melissa Lee, s3159707Weiru Zhou, s3313398Anthony Permana Putera Jaya, s3339651Kaijing Qin, s3312017Date: 16/Oct/2011Economic Group AssignmentMembers/Yi-Ying Chen s3092072, Melissa Lee s3
WVU - ACCT - 311
Chapter 2Conceptual Framework- Establishes the concepts that underlie financial reporting.- Coherent systems of concepts that flow from an objective.- Provides guidance on:1. Identifying the boundaries of financial reporting2. Selecting the transact
WVU - ACCT - 311
Accounting 311 FinalChapter 1Essential Characteristics of Accounting1. Identification, measurement, and communication of financial information.2. Economic entities3. Interested partiesFinancial Accounting- the process that culminates in the preparat
WVU - WMST - 245
W.GraemeDonovan,WMST245:MidTermExamStudyGuidePage1WestVirginiaUniversityEberlyCollegeofArtsandSciencesWomensStudiesCenterWMST245:WOMENININTERNATIONALDEVELOPMENTMIDTERMEXAMSTUDYGUIDE1.GENDEREQUALITY&WHYITMATTERS1Whatisgender?Genderisasocialcategory.
WVU - WMST - 245
Final Study GuideLieser, History 104This guide is designed to direct your studying. Not all material on the guide will be on the exam andthere may be some material only loosely associated with these items. It is not designed as a substitutefor doing t
Washington State - COMM - 409
Com 409 Exam 2 study guideCorrelation versus CausationCorrelation- tells you two things about the relationship (strength and direction).Measured between -1 and 1positive correlation X goes up when Y goes up, Negative X and Y move in opposite directions
Washington State - COMM - 409
Com409FinalExamMaterialContentAnalysisContentAnalysisThemethodofstudyingandanalyzingcommunicationinthesystematic,objective,and quantitativemannerforthepurposeofmeasuringvariablesWhyUse:DescribeshowmuchorwhatkindofcertainmessagesexistComparesmediaco
Washington State - COMM - 409
Chapter 6 Content analysisContent AnalysisDefinition: The method of studying and analyzing communication in the systematic, objective, andquantitative manner for the purpose of measuring variablesCharacteristics: how much or what kind of message exist
Washington State - SOC - 361
Reasons For TheftBy Matthew CondonChapter I.Introduction- I have decided to do my research on two people that I knew in high school, and who iwill leave unnamed in this research study. I will refer to them as subject 1 and 2 throughout my paper.My na
Washington State - CES - 301
Matt Condon4/24Ces 301The Maquiladoras and NAFTAAs the world continues to expand and globalization increases, the reliance on foreign labor ishigher than ever before. This is due to the cheapness and availability of workers in foreign countries.A pr
FIU - ARC - 5744
Revolu'on, Industrializa'on, and Architectural Transforma'ons Man and NatureForm and StructureThe Enlightenment and Changes in theConception of Architecture and Spacec. 1750Marc-Antoine Laugier,The Primitive Hut,from Essai sur larchitectur
Texas San Antonio - BIO - 1404
Biology Final ReviewFinal Exam-Saturday May 5th at 1:30-4Cumulative. chapter 1 has only one question20 pages long 100 questions 2.5 points eachThemes in the Study of LifeChapter 1 question:-Darwin and Evolution Scientific Method-*Unity in diversity*
Texas San Antonio - CHEM - 1103
Composition of MatterAtoms and MoleculesScientific MethodStructure Determines Properties the properties of matter are determined by the atomsand molecules that compose itcarbon monoxide1.2.3.4.composed of one carbon atom andone oxygen atomcol
Texas San Antonio - CHEM - 1103
Scanning Tunneling Microscope Gerd Bennig and HeinrichRohrer found that as you passa sharp metal tip over a flatmetal surface, the amount ofcurrent that flowed variedwith distance between the tipand the surfacemeasuring this tunnelingcurrent allo
Texas San Antonio - CHEM - 1103
Elements and Compounds elements combine together to make an almostlimitless number of compounds the properties of the compound are totallydifferent from the constituent elementsTro, Chemistry: A MolecularApproach1Formation of Water from Its Elemen
Texas San Antonio - CHEM - 1103
Reaction Stoichiometry the numerical relationships between chemical amountsin a reaction is called stoichiometrythe coefficients in a balanced chemical equation specifythe relative amounts in moles of each of the substancesinvolved in the reaction2
Texas San Antonio - CHEM - 1103
Air Pressure & Shallow Wells water for many homes issupplied by a well less than30 ft. deep with a pump atthe surfacethe pump removes air fromthe pipe, decreasing the airpressure in the pipethe outside air pressure thenpushes the water up the pip
Texas San Antonio - CHEM - 1103
1Name _CHE 1103General Chemistry IStudent I.D._SAMPLE Questions for Exam 1Answer on ParSCORE Test Form No. X-101864 with a No. 2 pencil.1. Select the answer that expresses the result of this calculation with the correct numberof significant figure
Texas San Antonio - CHEM - 1103
CHE 1103 General Chemistry I.STUDY GUIDE, EXAM 1Chapter 1 Matter, Measurement and Problem SolvingA. Elements, compounds and mixturesB. Three States of Mattera. Differentiate and defineb. Submicroscopic vs. macroscopici. Examplesc. Physical and ch
Texas San Antonio - CHEM - 1103
The University of Texas at San AntonioCHE 1103.001: General Chemistry I Spring, 2009 SyllabusMWF, 9:00-9:50 A.M., SB 2.01.12Instructor:Office Hours:Contact:Dr. Walter C. ErmlerMWF 1:00-2:00 P.M., BSE 1.104E, Phone: 210-458-7005walter.ermler@utsa.e
Texas San Antonio - BIO - 1033
CHAPTER1I.HistoryofPsychoactiveDrugsA.Definitionofapsychoactivedrugisanysubstancethatdirectly altersthenormalfunctioningofthecentralnervoussystem.B.Morethan4,000plantscontainpsychoactivesubstancesII.AncientCivilizationsA.Alcoholcanbetracedtothee