This preview has intentionally blurred parts. Sign up to view the full document

View Full Document

Unformatted Document Excerpt

1. The following prokaryotic DNA sequence encodes an mRNA. a. Circle the promoter consensus sequences found on the coding strand of DNA 2 pts b. Write out the mRNA sequence encoded by this gene (indicate the 5 and 3 ends). 4 pts c. Translate that mRNA sequence into an amino acid sequence using the provided genetic code (indicate the N and C termini of the polypeptide). 4 pts 5 AACATTGACACCGTAACTGTACGCTCATATATTCGATCGGCTTAGATGCCT GCTTACCGGGAGTAAGCCATCGA 3 3 TTGTAACTGTGGCATTGACATGCGAGTATATAAGCTAGCCGAATCTACGGACGAATGGCCCTCATTCGGTAGCT 5 mRNA sequence: amino acid sequence: 2. The following table shows part of the sequence of a gene, with both DNA strands, the mRNA strand and the amino acid sequence indicated. Complete the table, including all of the nucleotides and amino acids. Label the 5 and 5 ends of each nucleotide strand. 2.5 pts 1 2 3 4 5 6 7 8 9 10 11 12 DNA double helix-- C G T C A T A T C AG G T T G A G A MRNA GC A U G G A Amino acids Trp Ser 3. The normal sequence of a particular protein is given here, along with several mutant versions of it. For each mutant, explain what mutation occurred in the coding sequence of the gene. Assume only a single mutational event explains each altered amino acid sequence. 4 pts () = multiple unspecified amino acids * On the final, you would only be asked about one mutant. Normal: Met-Gly-Glu-Thr-Lys-Val-Val-()-Pro Mutant 1: Met-Gly Mutant 2: Met-Gly-Glu-Asp Mutant 3: Met-Gly-Arg-Leu-Lys Mutant 4: Met-Arg-Glu-Thr-Lys-Val-Val-()-Pro 4. In the replication bubble below, label all ends of newly made DNA (in bold) with either 5 or 3 (as shown in one example below): 2 pts... View Full Document

End of Preview

Sign up now to access the rest of the document