202finalprac2
5 Pages

202finalprac2

Course Number: BIOL 202, Summer 2012

College/University: New Mexico

Word Count: 1017

Rating:

Document Preview

1. The following prokaryotic DNA sequence encodes an mRNA. a. Circle the promoter consensus sequences found on the coding strand of DNA 2 pts b. Write out the mRNA sequence encoded by this gene (indicate the 5 and 3 ends). 4 pts c. Translate that mRNA sequence into an amino acid sequence using the provided genetic code (indicate the N and C termini of the polypeptide). 4 pts 5...

Unformatted Document Excerpt
Coursehero >> New Mexico >> New Mexico >> BIOL 202

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

The 1. following prokaryotic DNA sequence encodes an mRNA. a. Circle the promoter consensus sequences found on the coding strand of DNA 2 pts b. Write out the mRNA sequence encoded by this gene (indicate the 5 and 3 ends). 4 pts c. Translate that mRNA sequence into an amino acid sequence using the provided genetic code (indicate the N and C termini of the polypeptide). 4 pts 5 AACATTGACACCGTAACTGTACGCTCATATATTCGATCGGCTTAGATGCCT GCTTACCGGGAGTAAGCCATCGA 3 3 TTGTAACTGTGGCATTGACATGCGAGTATATAAGCTAGCCGAATCTACGGACGAATGGCCCTCATTCGGTAGCT 5 mRNA sequence: amino acid sequence: 2. The following table shows part of the sequence of a gene, with both DNA strands, the mRNA strand and the amino acid sequence indicated. Complete the table, including all of the nucleotides and amino acids. Label the 5 and 5 ends of each nucleotide strand. 2.5 pts 1234 5 6 7 89 10 11 12 DNA double helix- C G T C A T AT C AG G T T G A G A MRNA GC A UG G A Amino acids Trp Ser 3. The normal sequence of a particular protein is given here, along with several mutant versions of it. For each mutant, explain what mutation occurred in the coding sequence of the gene. Assume only a single mutational event explains each altered amino acid sequence. 4 pts () = multiple unspecified amino acids *On the final, you would only be asked about one mutant. Normal: Met-Gly-Glu-Thr-Lys-Val-Val-()-Pro Mutant 1: Met-Gly Mutant 2: Met-Gly-Glu-Asp Mutant 3: Met-Gly-Arg-Leu-Lys Mutant 4: Met-Arg-Glu-Thr-Lys-Val-Val-()-Pro 4. In the replication bubble below, label all ends of newly made DNA (in bold) with either 5 or 3 (as shown in one example below): 2 pts My drawing was getting a little crowded so I only labeled one of each fragment. 3 5 5 3 5. Answer the following questions regarding primase: a. What type of nucleic acid is synthesized by primase? 0.5 pts b. Why must primase create a primer for DNA synthesis? 1 pt c. Which enzyme (in E. coli) removes the primer after synthesis is completed? 0.5 pts 6. Why do mutations that inactivate the 3'-5' exonuclease activity of DNA polymerase III greatly increase the frequency of mutations? 7. What would be the effect of a mutation that inactivated the 5'-3' exonuclease activity of DNA polymerase I? 2 pts 8. You isolated DNA from a newly discovered plant and determined that 32% of all of the bases are adenine. What are the percentages of thymine, cytosine and guanine? 1 pt 9. In the mismatch repair process, enzyme complexes replace bases that were incorrectly inserted into the newly synthesized DNA strand. To function, they must be able to distinguish between the parent DNA strand and the new strand. How is this accomplished? a. The new strand contains ribose sugars. b. The new strand contains RNA primers. c. The parent strand is contains RNA primers. d. The parent strand is methylated. 10. What is a codon? a. The base-pairing of DNA and RNA b. The base sequence of the tRNA that brings the correct amino acid to the ribosome where protein synthesis will take place c. The three-base sequence of mRNA that specifies the addition of a specific amino acid. d. The region of the gene that recruits RNA polymerase 11. In the process of transcription, a. DNA is replicated. c. mRNA attaches to ribosomes. b. proteins are synthesized. d. RNA is synthesized. 12. does What it mean to say that the genetic code is redundant? a. The genetic code is different for different domains of organisms. b. A single codon can specify the addition of more than one amino acid. c. More than one codon can specify the addition of the same amino acid. d. The genetic code is universal (the same for all organisms). 13. The segments of DNA where transcription begins have a binding site for RNA polymerase. These segments are known as _____. a. promoters b. enzymes c. initiation factors d. sigma factor 14. In prokaryotes, how are RNA hairpins related to termination? a. Proteins bind to sites on the hairpin, causing release of the RNA transcript. b. The hairpins are formed from base-pairing and cause separation of the RNA transcript and RNA polymerase. c. A three-base sequence signals a stop sequence, and the RNA transcript is released. d. The hairpin prevents more nucleotides from entering the active site of the enzyme, shutting of the process of polymerization. 15. Eukaryotes have three nuclear RNA polymerases. The primary function of RNA polymerase II is _____. a. transcription of protein-coding genes. b. transcription of both rRNA-and tRNA-encoding genes. c. transcription of only rRNA-coding genes. d. transcription of only tRNA-coding genes. 16. Below is a double-stranded sequence of DNA encoding a short peptide. 5 TTATAACCCTGAAGTCATTGAATCGGTCGCTGG AACGTTAAGCTTTATA 3 3 AATATTGGGACTTCAGTAACTTAGCCAGCGACC TTGCAATTCGAAATAT 5 a. Identify the coding strand based on the presence of a eukaryotic TATA box *Ill only ask about prokaryotic promoter elements top strand / bottom strand (circle one) b. Give the mRNA sequence transcribed from this gene. Be sure to indicate polarity. c. Give the amino acid sequence of the corresponding peptide. Be sure to indicate polarity. 17. Loci A, B, C, D and E are on the same eukaryotic chromosome. A series of testcrosses yields the following information. Draw a map showing the relative position of these five loci. Indicate all the shortest distances between genes in map units. Gene Loci A, B % recombination 43 Gene Loci B, E % recombination 21 A, C A, D B, C 2 50 41 C, E D, E B, D 20 33 12 18. Actinomycin D inhibits transcription. This antibiotic is added to yeast (eukaryote) cultures in which the expression of 2 specific proteins (A and B) is being monitored. When actinomycin D is added to cultures expressing A, the production of protein slowly declines over a period of 5 minutes until no further protein is made. In the cultures expressing B, the protein production declines over a period of 20 minutes after the addition of actinomycin D. What can you say about the structural difference between mRNAs encoding B vs. A? 4 pts 19. Many effective antibiotics affect bacteria by inhibiting translation. The experimental use of antibiotics has also been useful in determining the steps of protein synthesis. If you have an artificial mRNA with the sequence: AUGUUUUUUUUUUUUUAG, it will produce the following polypeptide: NH2-Met-Phe-Phe-Phe-Phe-COOH In your search for new antibiotics, you find one called putyermycin, which blocks protein synthesis. When you try to translate your artificial mRNA, the product is Met-Phe. What step in protein synthesis does putyermycin affect? Explain your answer. 4 pts

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

New Mexico - BIOL - 202
1. The following prokaryotic DNA sequence encodes an mRNA.a. Circle the promoter consensus sequences found on the coding strand of DNA 2 ptsb. Write out the mRNA sequence encoded by this gene (indicate the 5 and 3 ends). 4 ptsc. Translate that mRNA seq
New Mexico - BIOL - 202
MENDELIAN GENETICS-Monohybrid matings-Dihybrid matings-Punnett Squares-Branch Diagrams-Rules of Probability (sum rule and product rule)MENDELIAN GENETICSIn cocker spaniels, black color is due to a dominant gene B, and red color to itsrecessive all
New Mexico - BIOL - 202
~160-kb fragments1. Cut DNA at random locationsinto fragments of ~160 kb.Genomic DNABAC library1-kb fragmentsShotgunclonesShotgunsequencesBAC2. Clone using BACs.Main bacterialchromosomeMany copies (three shown)of each 160-kb fragment,each
New Mexico - BIOL - 202
Biology 202Recombinant DNA Technology IChapter 19 (pgs. 338-347)Terms: recombinant DNA, gene cloning, restriction enzymes, restriction site, palindrome,cloning vector, plasmid, selectable marker gene, origin of replication, multiple cloning site(poly
New Mexico - BIOL - 202
Biology 202GenomicsChapter 20 (pgs. 359-363, 367, 370-372)Terms: shotgun sequencing, Southern blot, Northern blot, microarray analysis, RFLP, PCRDescribe the process of sequencing an entire genome using shotgun sequencing.What types of information is
New Mexico - BIOL - 202
RECOMBINANT DNA TECHNOLOGY AND GENOMICSMATCHING: For each definition, select the term from the list below. 1 pt each1. _ Separates nucleic acid fragments based on their size.2. _ Recognize specific sites in double-stranded DNA and cleaves the phosphate
New Mexico - BIOL - 202
RECOMBINANT DNA TECHNOLOGY AND GENOMICSMATCHING: For each definition, select the term from the list below. 1 pt each1. _e_ Separates nucleic acid fragments based on their size.2. _f_ Recognize specific sites in double-stranded DNA and cleaves the phosp
ECPI College of Technology - CRJ - 226
How to be a Classy WomanBeing a classy woman does not mean you have to be stuck up, it does not mean you have to berich and demand everyone. Being a classy woman is someone that respects others along withherself. Someone who dresses appropriate and con
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
Figure 9.6 All three curvesFigure 9.7 BCWP and ACWP at same pointFigure 9.8 BCWP and ACWP below planFigure 9.9 Ahead of schedule, below budgetSource: Levis JP. Project Planning, Scheduling and Control, Probus Pub., 1991
UC Davis - ECI - 137
UC Davis - ECI - 137
UC Davis - ECI - 137
MAJOR TYPES OFTRANSPORTATION CONSTRUCTIONSPECIFICATIONSA Guideline to UnderstandingTheir Evolution and ApplicationA Report of theAASHTOHighwaySubcommitteeon ConstructionQuality Construction Task ForceAugust 2003INTRODUCTIONThis guideline to M
UC Davis - ECI - 137
UC Davis - ECI - 137
Construction Contracts andBondsReferences: Hinze, Construction Contracts (McGraw-Hill) Kelleher (editor), Common Sense Construction Law(Wiley)Contracting Methods GeneralContract Usually Design-Bid-Build Contract between owner and generalcontract
UC Davis - ECI - 137
Summary of Ch. 8 HendricksonPricing and ContractingRisks Definition What are risks and who bears them?Competitive Bidding Idea Minimum qualifications required Low bid wins Usually lump sum or unit cost contract Public sector Remove corruption
UC Davis - ECI - 137
UC Davis - ECI - 137
PhaseIConceptualcostsPhaseIConceptualcosts Twomethodsofdeterminingconceptualcosts: Topdownestimates Bottomupestimates$PhaseIConceptualcosts Topdownestimates Compareswholeprojecttowholeproject Bottomupestimates Estimatecostsforcomponentswithinpr
UC Davis - ECI - 137
ProjectclosurePreparedbyD.Jones,J.HarveyRecap on project scopeSmartobjectives: Specific Measurable Achievable Realistic TimebasedPM Proverb: trackingProjectteamsdetestprogressreportingbecauseitvividlydemonstratestheirlackofprogressDefine proje
UC Davis - ECI - 137
MAJOR TYPES OFTRANSPORTATION CONSTRUCTIONSPECIFICATIONSA Guideline to UnderstandingTheir Evolution and ApplicationA Report of theAASHTOHighwaySubcommitteeon ConstructionQuality Construction Task ForceAugust 2003INTRODUCTIONThis guideline to M
UC Davis - ECI - 137
Why have a plan for the project? Guide execution of project Document planning assumptions Document assumptions about alternativeschosen Facilitate communication Define key management reviews of content andtiming Provide a baseline for progress mea
UC Davis - ECI - 137
Phase II - Planning Project Plan generally includes (PMBOK): Project charter Project management approach or strategy Scope statement Deliverables Objectives WBS Performance measurement baselines for scheduleand cost Major milestones and target d
UC Davis - ECI - 137
Phase II Scheduling Step 1 Create table of activities fromWBS Use lowest levels of each leg of WBS Higher levels become summary tasks Identify precedence in table Only show immediate predecessors In Activity on Node (AON) can mark workdeliverables
UC Davis - ECI - 137
ProjectqualitymanagementLecturesummaryOverviewDefinitionsApproachesQualitymanagement Inputs Toolsandtechniques Outputs QualityAssurance QualityControl ExampleAcknowledgementAguidetotheprojectmanagementbodyofknowledge(PMBOK)ProjectManagement
UC Davis - ECI - 137
RiskmanagementLecturesummaryI10reconstructiondiscussionRiskidentificationRiskquantificationRiskresponsedevelopmentRiskresponsecontrolExampleAcknowledgementAguidetotheprojectmanagementbodyofknowledge(PMBOK)ProjectManagementInstitute130SouthStat
UC Davis - ECI - 137
Economies of Scale Bigger organizations and projects permitmore specialization, but result in morecomplexity; must balance the two Organizations: this balance determineslevel of vertical or horizontal integrationdesired Projects: controls the cost
UC Davis - ECI - 137
What is Project Management? PMBOK definition: Project Management is the application ofknowledge, skills, tools and techniques toproject activities in order to meet or exceedstakeholder needs and expectations from aproject. Oberlender definition: T
UC Davis - ECI - 137
What is a Project? Various definitions Projects vs Operations Both are: Performed by people Constrained by limited resources Planned, executed, controlled Difference Operations are ongoing and repetitive Projects are temporary and uniqueDefiniti
UC Davis - ECI - 137
University of California, DavisDepartment of Civil and Environmental EngineeringECI 137Spring 2010Tuesdays and Thursdays 4.40 to 6.00 lecture at Olson 6; Wednesdays 5.10 to 8.00 lab at Wellman 202,1116 Academic Surge or in the fieldInstructor: John
UC Davis - ECI - 145
1ENG 145 Hydraulic Structure Design Spring Quarter 2011University of California, DavisConveyance Channel DesignTechnical MemorandumFrom: Andrew BurtonTo: Professor B. A. YounisDate: May 4, 2011Executive Summary: A conveyance channel has been desig
UC Davis - ECI - 145
University of California, DavisDepartment of Civil and Environmental EngineeringECI-145 Hydraulic Structures DesignMEMORANDUMTo: Professor B. A. YounisFrom: Malina SkorupskiDate: Wednesday 4th May 2011Re: Assignment 2- Design of Drainage ChannelEx
UC Davis - ECI - 145
ASSIGNMENT 1ESTIMATION OF PEAK RAINFALL RUNOFFTasks1. Estimate the combined peak runoff from the two watersheds shown below usingat least five different methods for estimating tc (refer to Wong, 2005). One of themethods used must be the velocity meth
UC Davis - ECI - 145
ASSIGNMENT 3STORM SEWER DESIGN (I):GUTTER AND INLETSTaskDesign a gutter and inlet system to capture the stormwater runoff from a residential arealocated adjacent to the drainage channel of Assignment 2The watershedThe watershed consists of 40 ident
UC Davis - ECI - 145
ASSIGNMENT 4STORM SEWER DESIGN (II):STORM SEWERTaskDesign a storm sewer to convey the stormwater runoff captured by the gutter and inlets ofAssignment 3 to the drainage channel of Assignment 2.The storm sewer runs for a distance of 3500 ft along the
UC Davis - ECI - 145
CULVERT DESIGNTaskIt is intended to construct a roadway to span the drainage channel of Assignment 2 atdistance of 3500 feet from its beginning, immediately downstream from the storm-seweroutlet.Your task is to design a culvert system to convey the t
UC Davis - ECI - 145
USERS GUIDECulvertMaster- Version 3.1 DAA035840-1/00012005 Bentley Systems, Incorporated. All rights reserved.This documentation is published by Bentley Systems, Inc. (Bentley), and is intended solelyfor use in conjunction with Bentleys software. Thi
UC Davis - ECI - 145
TheEnvironmentalistACF Environmental 2831 Cardwell Road, Richmond, VA 23234 Customer Service: (800) 448-3636 Fax: (804) 743-7779 Email: acfsales@aol.comVolume 1 Issue 2Summer 2000TRMs Replace Rip-Rap in DrainageChannels and Improve Water QualityPyr
UC Davis - ECI - 145
+D=FJAH"+D=FJAH"Low-Impact Development Integrated ManagementLow-Impact Development: An Integrated Environmental Design Approach4ChapterLow-Impact Development IntegratedManagement PracticesLow-impact development technology employs microscale anddi
UC Davis - ECI - 145
Assessment of Time of Concentration Formulasfor Overland FlowTommy S. W. Wong, F.ASCE1Abstract: Despite the importance of overland time of concentration on the design discharge, engineers are often bewildered by the arrayof formulas available in the l
UC Davis - ECI - 145
Technical MemorandumProfessor B. A. YounisTo:From:Date:Re:Executive Summary: You are a professional engineer who has been asked to provide expert advice on aproject. The client is very busy and would like a summary of your project report in the for
UC Davis - ECI - 145
IRGINIA DCR STORMWATER DESIGN SPECIFICATION No. 11 W.http:/vwrrc.vt.edu/swc/april_22_2010_update/DCR_BMP_Spec_No_1.VIRGINIA DCR STORMWATERDESIGN SPECIFICATION No. 11VERSION 1.8March 1, 2011SECTION 1: DESCRIPTIONWet swales can provide runoff filteri
Simon Fraser - BIO - 112
BIOL 112 Practice Questions in Preparation for the MidtermAnswer KeyQuestion12345678910111213141516171819202122232425262728293031323334AnswerDAAADCEECBAACDCEDDBAABDCDEDCADADAEOctober
Ashford University - BUS - 600
Integrity is very important to me and Im sure its very important to you to. It is vital to makesure all work turned in are yours and not anyone elses unless properly cited. As mentioned, it isour (my) responsibility to make sure that integrity is presen
Shanghai Jiao Tong University - ECE - 373
Ve373 Design of Microprocessor Based SystemHomework 1Assigned: May 22, 2012Due: May 29, 2012, by 4:00pmThe homework should be submitted electronically1. What makes an MCU different from a general-purpose microprocessor? (5 points)Answer:General-pur
Istanbul Universitesi - ENG - 411
BME402 Biomedical Signal Processing-IIAssist. Prof. Dr. Blent Ylmaz Assist. BSpring 20081Examples of biomedical signals ECG, PCG, CP: Carotid pulse EEG, ENG EMG, EGG Signals from catheter-tip sensors Speech soundDr. Blent Ylmaz BBME402: Biomedical
Istanbul Universitesi - ENG - 411
Chapter 2: Concurrent, Coupled and Correlated Processes1Contents Introduction ECG and PCG PCG and CP ECG and atrial electrogram (EG)Dr. Blent Ylmaz BBME402: Biomedical Signal Processing-II Processing-21Introduction Most biological processes with
Istanbul Universitesi - ENG - 411
31.03.2009Chapter 3 FrequencyFrequency-domain Filtering for for Removal of ArtifactsDr. Blent Ylmaz1Contents Frequency-domain filters Applications: Removal of artifacts in the ECGDr. Blent YlmazBME402: Biomedical Signal Processing-II Processing-2
Istanbul Universitesi - ENG - 411
Chapter 3 Filtering for Removal of Artifacts1Contents Introduction Problem statement Noise types Random noise and interference Illustration of the problem with casestudies Potential solutions to remove artifactsDr. Blent Ylmaz B BME402: Biomedical Si
Istanbul Universitesi - ENG - 411
Chapter 3 Time-domain Filtering for Removal of ArtifactsDr. Blent Ylmaz1Contents Time-domain filters Synchronized averaging Moving-average filters Derivative-based operators to remove lowfrequency artifacts Applications: Removal of artifacts in the
Istanbul Universitesi - ENG - 411
Chapter 4 Event Detection-1Dr. Blent Yilmaz1Contents Introduction Problem statement Detection of events and waves QRS detection Derivative-based methods Pan-Tompkins algorithmDr. Dr. Blent YilmazBME402: Biomedical Signal Processing -II Processing-
Istanbul Universitesi - ENG - 411
Chapter 4 Event Detection-2Dr. Blent Yilmaz1Contents Correlation analysis of EEG channels Matched Filter P wave detection An application: ECG rhythm analysisDr. Dr. Blent YilmazBME402: Biomedical Signal Processing -II Processing-2Correlation anal
Istanbul Universitesi - ENG - 411
Chapter 5 Analysis of Waveshape and Waveform Complexity1Contents Introduction Problem statement Morphological analysis of ECG signals Correlation coefficient Energy of ECG signalDr. Blent Ylmaz BBME402: Biomedical Signal Processing-II Processing-2
Istanbul Universitesi - ENG - 411
Chapter 6 Frequency-Domain Characterization of Signals and SystemsDr. Blent Ylmaz1Contents Introduction Problem statement Fourier Spectrum Estimation of PSD function Application: Synchronized averaging of PCG spectra Estimation of ACFBME402: Biomedi
Istanbul Universitesi - ENG - 411
Chapter 7Modeling Biomedical SignalGenerating Processes andSystemsDr. Blent YILMAZ1Mathematical modeling In modeling approach, an explicitmathematical model is used to representthe process or the system that generatesthe signal of interest. The
Istanbul Universitesi - ENG - 411
Short-time Fourier Transform (STFT) and SpectrogramDr. Blent Ylmaz1Short-time Fourier Transform The short-time Fourier transform (STFT), or alternatively short-term Fourier transform, is a Fourier-related transform used to determine the sinusoidal fre