MIS 589 Networking Concepts and Applications Assignment 2 Text Questions
1 Page

MIS 589 Networking Concepts and Applications Assignment 2 Text Questions

Course Number: MIS 589, Fall 2012

College/University: Keller Graduate School...

Word Count: 318

Rating:

Document Preview

Chapter 3: Q.1 How does a multipoint circuit differ from a point-to-point circuit? A multipoint circuit is different from a point-to-point circuit in the number of shared computers that are connected to the circuit. In a multipoint circuit the circuit is shared like my wireless LAN at my home. On a point-to-point circuit the circuit is connected for example from one router at a remote site to another router at the...

Unformatted Document Excerpt
Coursehero >> Illinois >> Keller Graduate School of Management >> MIS 589

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

3: Q.1 Chapter How does a multipoint circuit differ from a point-to-point circuit? A multipoint circuit is different from a point-to-point circuit in the number of shared computers that are connected to the circuit. In a multipoint circuit the circuit is shared like my wireless LAN at my home. On a point-to-point circuit the circuit is connected for example from one router at a remote site to another router at the main site. These two sites are able to fill the capacity of the circuit by using a dedicated circuit to communicate. Q.3 Describe three types of guided media. One type of media is twisted-pair cable. It consists of a piece of wire that is twisted a certain amount of times in order to reduce electromagnetic interference between any other pairs of twisted wires. Twisted-pair cabling is manly used in regular home telephones. Coaxial cable has a copper inner core that is surrounded by an outer shield. It is still used a as media for cable TV and microwave transmission. Fiberoptic cable is a third media type that contains one or more optical fiber elements insulated by a protective sleeve. It uses laser or LED lights to reflect particle of glass. Q.6 Clearly explain the differences among analog data, analog transmission, digital data, and digital transmission. The difference between analog data and analog transmission is that the analog data is the signal that gets transmitted through the old POTS system. In order for a computer to communicate using the POTS system the signal has to be converted to digital data. The conversion of the analog data to digital data is done by a modem. In order for a voice signal (analog data) to be transmitted over a digital network (digital transmission) the analog data has to be converted using a codec which converts the analog data to a digital transmission then converted back to an analog data (decode).

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Keller Graduate School of Management - MIS - 589
Chapter 4:Mini Case 1 Smith, Smith, Smith, and SmithThe most common network error is due to impulse noise. This type of error can be bestprevented by making sure that the network cables are not placed near any power cables. Whendesigning the LAN if th
Keller Graduate School of Management - MIS - 589
Chapter 4:Q.1 What does the data link layer do? The data link layer decides when the message can betransmitted by the physical layer. The message is then formatted with start and stop marker. Thedata link layer then places an IP packet inside the Ether
Keller Graduate School of Management - MIS - 589
Chapter 5:Q.3 What are the parts of TCP/IP and what do they do? Who is the primary user ofTCP/IP? The parts of TCP/IP are TCP and IP. TCP provides communication betwen theapplication layer and the network layer. This is accomplished by converting data
Keller Graduate School of Management - MIS - 589
The background load shows that the utilization is higher when network traffic between the citiesis used. The comparison of the increase in load versus the baseline usage shows an increasefrom 10 to 55.FTP download response time when there is load on th
Keller Graduate School of Management - MIS - 589
Chapter 7:Q.3 Compare and contrast the two types of antennas. The two types of antennas areomnidirectional antennas and directional antennas. Omnidirectional antennas are the mostcommon type of antennas used in a WLAN because the signal is transmitted
Keller Graduate School of Management - MIS - 589
The web results for the FTP were that the ABR client sending FTP traffic is less than the traffic for the traffic for the voice. The traffic thatthe ABR FTP client receives is 3.072 bytes per second. The CBR voice client receives traffic at 2,396.8 bytes
Keller Graduate School of Management - MIS - 589
Chapter 10: Mini Case 1 Cathys CollectiblesThe three different options that Cathy has to get better speed at a reasonable cost are DSL at acost of $60 per month for 1.5Mbps down and 384Kbps up, cable modem service which isavailable for a cost of $50 pe
Keller Graduate School of Management - MIS - 589
Chapter 9:Q.9 Compare and contrast circuit-switched services, dedicated-circuit services, andpacket-switched services. Circuit switched is basically a simple cloud based architecture thatthe computer uses (via a modem) to connect to another computer. T
UConn - STAT - 3025
37.51.52.
UConn - STAT - 3025
32 The parameter of interest is = the true average dietary intake of zine among malesaged 6574 years. The hypotheses are H0 : = 15 vs. Ha : < 15. Since the sample sizen = 115 is large, z -test is used. Since this is a lower-tailed test, we need to compa
UConn - STAT - 3025
llvcfw_b S oZ,f.-o3 o Zcfw_szot>6.t5e1Wtu-*-fr,2*/.(r,t*-gttuse.-zrc i -i=:e a G.e f r" f -V.z.t;2 r.'wz 4e?_ _F .rro776.2C l , u t a -x = t d / n , - . t L < ' t a 7 t 6 - , a tt/-qE-.rn'-,, ; /- x. - = !b!rt=.latb) l l-,.- Y - 4;,
UConn - STAT - 3025
UConn - STAT - 3025
39.
UConn - STAT - 3025
Chapter 2:3. Three components are connected to form a system as shown in theaccompanying diagram. Because the components in the 23 subsystem areconnected in parallel, that subsystem will function if at least one of the twoindividual components functio
UConn - STAT - 3025
UConn - STAT - 3025
STAT 3375 (Fall 2011): Quiz-2 Solutions1. This was a homework problem. Check homework solutions.2. This tree diagram is helpful. From the gure,3. Dene events : It rains on Maries wedding,(114) = 3 . 10 + 1 . 1 + 3 . 3 =368113360: The weatherma
UConn - STAT - 3025
Solutions to QUIZ 5 practice problems5.6.51.5.5 1dy1dy2 = [ y1 ]y2 +.5 dy2 = (.5 y2 )dy2 = .125.a. P(Y1 Y2 > .5) = P(Y1 > .5 + Y2 ) = 10 y 2 +.5001b. P(Y1Y2 < .5) = 1 P(Y1Y2 > .5) = 1 P(Y1 > .5 / Y2 ) = 1 11 1dy1dy2 = 1 (1 .5 / y2 )dy2.5
UConn - STAT - 3025
UConn - PHYSIC - 1010
Q. Which is NOT a characteristic of an ideal gas?A. Its properties and behavior are identical to those of air at atmospheric pressure.Q. Decreasing the volume of the container holding an ideal gas does what?A. It increases the gas pressure because gas
Kaplan University - BUS 204-02 - 204-02
Kris HoughMT302 Organizational BehaviorUnit Six AssignmentDealing with group shirkersJanuary 3, 20121. If group members end up working around shirkers, do you think this informationshould be communicated to the instructor so that each individuals co
Kaplan University - BUS 204-02 - 204-02
Kristina HoughMT302 Organizational BehaviorUnit FourCultural Differences in Job Characteristics and Job SatisfactionDecember 14, 20111. Select three countries.The three countries I have selected are the Africa, Turkey and Japan.2. Compare facts abo
Kaplan University - BUS 204-02 - 204-02
Kristina HoughMT302 Organizational BehaviorUnit FiveA Job Where I Encountered Emotional Episodes12/20/11Think of a job you have had where you have encountered emotional episodes. Describethe episodes and then answer the following questions.In 2002,
Kaplan University - BUS 204-02 - 204-02
Dell,Inc.ManagementandPolicyStrategyMarch28,2012KristinaHoughBriefHistory CompanystartedasPCsUnlimitedbyacollegestudentin1984 MichaelDellassembledandsoldcomputersfromhisdormroom Afterheplannedhisbusinessopening,heleftcollege CompanyrenamedtoDe
Kaplan University - BUS 204-02 - 204-02
Facebook vs. Twitter1Unit 3 Facebook vs. TwitterKaplan UniversitySchool of Business and ManagementMT460 Management Policy and StrategyAuthor: Kristina HoughProfessor: Dianne MartinDate: February 21, 2012Facebook vs. Twitter2Facebook vs. Twitter
Kaplan University - BUS 204-02 - 204-02
Kristina Hough -Mattels China Experience: A Crisis in ToylandUnit 4 - Mattels China Experience: A Crisis in Toyland Case Study AnalysisKaplan UniversitySchool of Business and ManagementMT460 Management Policy and StrategyAuthor: Kristina HoughProfes
Kaplan University - BUS 204-02 - 204-02
Kristina Hough - Whole Foods Market 2007 Case Study AnalysisUnit Five Whole Foods Market 2007 Case Study AnalysisKaplan UniversitySchool of Business and ManagementMT460 Management Policy and StrategyAuthor: Kristina HoughProfessor: Dr. Dianne Martin
Kaplan University - BUS 204-02 - 204-02
UnitSix:BusinessandMultibusinessStrategyMT460ManagementPolicyandStrategyCase7:TheApolloGroup,Inc.UniversityofPhoenixWrittenby:KristinaHoughCaseStudyAgendaIntroduction Synopsis/Background KeyIssues/SWOT Definetheproblem AlternativeSolutions Sel
Kaplan University - BUS 204-02 - 204-02
MT460 Unit 8 Discussion Video Operation Village PeopleAnnouncer: The place the Rock n Roll Hall of Fame, the event the 4th Annual Battle of theBands. The Competitors: BP, EBay, Wells Fargo, Nextel, Kimberly Clark. In the year 2000, therefining division
Kaplan University - BUS 204-02 - 204-02
UnitSeven:RoughDraftFinalMT460ManagementPolicyandStrategyDell,Inc.KristinaHoughCaseStudyAgendaIntroduction Synopsis/Background KeyIssues/SWOT Definetheproblem AlternativeSolutions SelectedSolution Implementation Recommendation ConclusionIntr
Uni. Southampton - ECON - 2026
CHAPTER4Exercise Solutions60Chapter 4, Exercise Solutions, Principles of Econometrics, 3e 61EXERCISE 4.1 ei22 ( yi y )(a)R2 = 1 (b)To calculate R 2 we need ( yi y )2=1182.85= 0.71051631.63 ( yi y )2,= yi2 N y 2 = 5930.94 20 16.0352 =
Uni. Southampton - ECON - 2026
CHAPTER5Exercise Solutions91Chapter 5, Exercise Solutions, Principles of Econometrics, 3e 92EXERCISE 5.1(a)y = 1, x2 = 0, x3 = 0xi*2 yi* xi*2 =13,(c)b2 =b3yi*012212011(b)xi*3121011110012212101 xi*22 = 16, yi* xi
Uni. Southampton - ECON - 2026
CHAPTER6Exercise Solutions112Chapter 6, Exercise Solutions, Principles of Econometrics, 3e113EXERCISE 6.1(a)To compute R 2 , we need SSE and SST. We are given SSE. We can find SST from theequationy = ( yi y )2 =N 1SST= 13.45222N 1Solving t
Uni. Southampton - ECON - 2026
CHAPTER8Exercise Solutions177Chapter 8, Exercise Solutions, Principles of Econometrics, 3eEXERCISE 8.1When i2 = 2N ( xi x )i =12i2 2N ( xi x ) i =12N= ( xi x )i =122 2N ( xi x ) i =12N= 2 ( xi x )2i =12N ( xi x ) i =
Uni. Southampton - ECON - 2026
CHAPTER9Exercise Solutions200Chapter 9, Exercise Solutions, Principles of Econometrics, 3eEXERCISE 9.1From the equation for the AR(1) error model et = et 1 + vt , we havevar ( et ) = 2 var ( et 1 ) + var ( vt ) + 2 cov ( et 1 , vt )from which we g
Northern Virginia - BIO 101 - 262623
UNIT I: CHEMISTRY OF LIFECHEMISTRY1. a. Ionic bond-attraction between two oppositely charged ions. Ionic bonds are formedbetween a cation, which is usually a metal, and an anion, which is usually a nonmetal.b. Covalent (polar and nonpolar) bond- a bon
Northern Virginia - BIO 101 - 262623
UNIT II: THE CELLCELL CLASSIFICATION1.Prokaryotic cells: Most primitive, earliest form of life, Do not have a pre-defined nucleus,Chromosomes are dispersed in the cytoplasm, Contain no membrane-bound organelles, Havecircular chromosomes and lack histo
Northern Virginia - BIO 101 - 262623
1UNIT III: CELLULAR ENERGETICSCELL RESPIRATION1. Formula of cellular respiration- C6H12O6 + 6 O2 6 CO2 + 6 H2O + Energy (34-36 ATP +heat)2. Glycolysis is the splitting of glucose into pyruvate. Glycolysis is the one metabolic pathway that occursin a
Northern Virginia - BIO 101 - 262623
1UNIT IV: CELL DIVISION AND GENETICSCELL CYCLE1. Cell division functions in growth, reproduction, and repair of cells.2. Mitosis occurs in eukaryotic cells. In terms of organisms, body/somatic cells divide by way of mitosis.3. chromosomes- the Xs. Or
Northern Virginia - BIO 101 - 262623
UNIT V: MOLEULAR GENETICS AND BIOTECHNOLOGYDNA REPLICATION1.2.3.Replication occurs in the nucleus of the cell.Point mutation- ATGCTGCATGTTCGTAAGATCATGCTGCACGTTCGTAAGATCFrameshift- ATGCTGCATGTTCGTAAGATCATGCTGCATGTTGCGTAAGATCPROTEIN SYNTHESIS4. T
Northern Virginia - BIO 101 - 262623
UNIT VI: BIOLOGICAL DIVERSITYDOMAIN EUBACTERIA1.2. An endospore is a dormant, tough, and temporarily non-reproductive structure produced by certainbacteria from the Firmicute phylum. The discovery of bacterial endospores was important tomicrobiology
Northern Virginia - BIO 101 - 262623
UNIT VII: PLANT STRUCTURE AND FUNCTIONPLANT TISSUES:1.Dermal Tissue SystemThe dermal tissue system is the outer protective covering. Like ourskin, it forms the first line of defense against physical damage andpathogenic organisms. In nonwoody plants
Northern Virginia - BIO 101 - 262623
VIII. ANIMAL FORM AND FUNCTIONRESPIRATORY SYSTEM1.Gills. Fish and other aquatic animals use this method. Gills are specialized tissues with manyinfoldings, each covered by a thin layer of cells and impregnated with blood capillaries. They takeup oxyge
Northern Virginia - BIO 101 - 262623
IX. ECOLOGYBIOMESa. Tropical forest- characterized by the greatest diversity of species. They occurnear the equator, within the area bounded by latitudes 23.5 degrees N and 23.5degrees S. One of the major characteristics of tropical forests is their d
Northern Virginia - BIO 101 - 262623
X: EVOLUTION1. Jean-Baptiste Lamarck proposed that organisms could pass on to their offspring traits thatwhere acquired during their lifetime. This has come to be known as inheritance of acquiredcharacteristics. On the other hand Charles Darwin recogni
UCLA - A&O SCI 2 - 126-010-22
JeffreyKimA&O2LectureNotes101112SmogLivin'nDyin'inL.A.UrbanSmogHistoryofSmogSmogPhotochemistryDefinitionsNullCycleRoleofVolatileOrganicCompoundControlofSmogSourceInventoryAutomotiveEmmisionControlSmoginLATheSouthCoastAirBasinSmogConcentrati
Kirkwood Community College - SOC - 104
1.Ofthefollowing,whichgroupwouldnotfitthedefinitionofapublicfamily?A)AgaymancaringforapartnerwithAIDSB)AchildlessmarriedcouplewithnodependentsC)AlesbiancouplejointlyraisingachildborntooneofthemD)Adivorcedmotherandherchildren2._individualismcanbestb
UCLA - A&O SCI 2 - 126-010-22
OriginofEarth'sAtmosphereItwasn'tuntiltheevolutionofbacteria,about3.3billionyearsago,thatreally changedtheearthatmosphereintotheoneweknowtodayDuringtheperiod2.7to2.2billionyearsago,theseearlybacteriaknownascyanobacteria usedenergyfromtheSunforphotosy
UCLA - A&O SCI 2 - 126-010-22
JeffreyKimAnthropology8LectureNote101212TheGenusHomoinEuropeGenusandspeciesnames(Homo:genus=erectus:species)Species=internallycoherentpackageSimadelosHuesos,Spain(evidenceforatleast32differentindividuals)EvidenceforsurvivaldespitedisabilityTheNean
UCLA - A&O SCI 2 - 126-010-22
1) South Asia has a lot of environmental diversity, from Himalayas and coastal region to dryforests2) Bhimbetka is a site where there is a lot of rock art starting around 6000BC.3) The site of Mehrgarh, occupied starting 6500 BC, is an early site of do
UCLA - A&O SCI 2 - 126-010-22
JeffreyKimAnthropology8LectureNote101512Review1)NeanderthalsarearobustformofhumanancestorthatlivedinEuropandthe easternMediterraneanfrom400000to30000yearsago.2)CranialdistinctionsofNeanderthals:occipitalbun,browridge,prognathicface3)Neanderthalstoo
UCLA - A&O SCI 2 - 126-010-22
JeffreyKimAnthropology8LectureNote100812Review1)environmentalshifts+populationgrowth=needtomanageresources2) In Egypt by 3200BC, climate became drier. Village chiefs provided ritual and coordination.3)Townsbecamecentersofredistribution,protectionan
UCLA - A&O SCI 2 - 126-010-22
1)Ritualinvolvedoingsthtoachieveasocialgoal2)Ritualevidentasearlyas1.4myawithhandaxe,butarchaeologicalevidenceof symbolicactivityisdramaticallyincreasedinUpperPaleolithic3)Treatmentofthedead4)Skeletalremainsgiveinformation.5)InNearEast,siteslikeJerfe
UCLA - A&O SCI 2 - 126-010-22
JeffreyKimAnthropology8DiscussionNote100812A.Gracile Largejaw,browridges,smallbrain(375500cc),zygomaticarch (eatinghardmaterials),progmaticA.Robust Smallbrain(400~500cc)archontheskull(sagittelcrest),larger musclemass,progmaticH.Ergaster First speci
UCLA - A&O SCI 2 - 126-010-22
HIS 22 10-30-12
UCLA - A&O SCI 2 - 126-010-22
JeffreyKimHistory22LectureNote100912WorldWar1(19141918)Largestwarinhumanhistorytodate65millionmobilizedforwar8.5millionkilled21.2millionwounded7.7millionprisoners=58%casualtyrateFirst"world"warPermanentlychangedbothworldsEuropeanempiresfellco
Northwest College - BIOLOGY - 101
Cell CommunicationChapter 11Overview of Cell SignalingCell to cell communicationcoordinates cellular activitiesCell signaling evolved prior tomulticellular creaturesYeast a and alphaProkaryote signaling quorumsensingQuorum sensing can lead to th
Northwest College - BIOLOGY - 101
Cell CycleChapter 12Overview: The Key Roles of CellDivisionThe ability of organisms to produce moreof their own kind best distinguishes livingthings from nonliving matterThe continuity of life is based on thereproduction of cells, or cell division
Northwest College - BIOLOGY - 101
Chapter 14Concept 14.1: Mendel used the scientificapproach to identify two laws ofinheritance principles ofMendel discovered the basicheredity by breeding garden peas incarefully planned experimentsMendels Experimental,Quantitative ApproachAdvant
Northwest College - BIOLOGY - 101
Meiosis and Sexual LifeCyclesChapter 13Overview: Variations on aThemeLiving organisms are distinguished by theirability to reproduce their own kindGenetics is the scientific study of heredityand variationHeredity is the transmission of traits fro
Northwest College - AMERICAN H - 101
60sFreedom RidesIntegration of interstate bus facilities, 1961CORE, Congress of Racial EqualityMinor problems until bus burned inAlabamaRiders jailed in Jackson, MSVoter Education ProjectMississippi, 1962-1963SNCC volunteersAlso SCLC, CORE, NAAC
Northwest College - AMERICAN H - 101
Suburbia in AmericaPost WWII YearsPost WWIISuburban growth increased greatlyMany suburbs were available for themassesBaby BoomFHA LoansGI Bill (veteran can get a loan for a house,school would be covered, loan was givento start a business) and VA