Corporate Political  Strategy in Action
2 Pages

Corporate Political Strategy in Action

Course Number: BADM 3102, Fall 2012

College/University: GWU

Word Count: 215

Rating:

Document Preview

Corporate Political Strategy in Action Governer blogovitch, senator harry reid, (they have a big deal of power becuas ethey effect rose associoate)s, lobbying firms, pubilc in general, citizens of the state of NJ, people who donated to campain, campain finance regulations 1.Role of lobbyist is to voice the interest of their clinets to helps decisions. Implementation- Lobbying regulatory agencies . This this...

Unformatted Document Excerpt
Coursehero >> District of Columbia >> GWU >> BADM 3102

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Political Corporate Strategy in Action Governer blogovitch, senator harry reid, (they have a big deal of power becuas ethey effect rose associoate)s, lobbying firms, pubilc in general, citizens of the state of NJ, people who donated to campain, campain finance regulations 1.Role of lobbyist is to voice the interest of their clinets to helps decisions. Implementation- Lobbying regulatory agencies . This this stage the wording of law is important agencies have comments that are sent in then from them they do an edited set of regulation,. Lobbiest are in contact with these agancies Red arrows is wheere most of the lobbying takes place Influence Access- how can you get to access pubilic policy officials Legilative- Senators and you are very interested in staff because they can provide you access to the actual public policy makers Executive- regualatory acgencies, you are interested in white house and agencies Information sharing get an information pool, information this has on us as a company, Campaign Donations- very important in terms of access to pubilc policy officials Constituent Invlovement- Grass roots, help orgainze people who come to wash , they demonstrate the impat this law will have on them Activities undertaken by business firms to acquire, develop and use power to obtain an advantage in the public policy process

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

ASU - BIOLOGY - 182
BIO19:10Synergisms:Interactionbetweenmultiplefactors.CausationVs.CorrelationCorrelation:twovariablescooccurinsomewayIndependentvariableThefactorthatisvaried/manipulatedDependentvariableThefactorthatchangeswhentheindependentvariablechangesitis dep
ASU - BIOLOGY - 182
19:06EvolutionofEukaryotesPhylogenyofeukaryoteslineagesisasubjectofresearchanddebateSomegroupsofprotistarecloselyrelatedtoanimalsandfungi,othersarerelatedto landplants;othersarenotcloselyrelatedtonayofthesegroups.Cells:UnitsofLifeAllLivingsorganis
ASU - BIOLOGY - 182
MitosisandtheCellCycle(LEC7)Prokaryotesvs.eukaryotesgenomeEscherichiacoli4,639,221basepairs4,403pairsHomosapiens(humans)>3Billionbasepairs23000proteincodinggenes.CellDivision:FoureventsmustoccurforcelldivisionReproductivesignalToinitiatecelldiv
ASU - BIOLOGY - 182
MendelianGeneticsGenotype:AnorganismsgeneticmakeupPhenotype:Anorganismsappearance(itstraits)18:4318:43PedigreeanalysisMultipletraitsPedigreeAnalysis:AutosomalDominantinheritanceDominantalleleislocatedononeoftheautosomes(chromosomes122inhumans)Ma
ASU - BIOLOGY - 182
Macroevolution:SpeciationThebiologicalspeciesconcept:Definesspeciesasapopulationorgroupofpopulationwhosemembershavethe potentialtointerbreedinnatureandproduceviable,fertileoffspringArereproductiveisolatedfromothersuchEcologicalspeciesconcept:Defines
ASU - BIOLOGY - 182
Mammals&AshortHistoryofLife18:45Howtheearthhaschangedovertime.ChangesintheatmosphereChangesintheclimateChangesinearthslandmassesChangeintheatmosphereOxygenlevelshaveincreased(overall)asaresultofphotosyntheticorganisms.Stromatolitesarecomposedofoxy
ASU - BIOLOGY - 182
EvolutionandAdaptation18:44EvolutionandAdaptation:Plants&AnimalsAngiospermsDoublefertilizationProductionofendospermOvulesandseedsenclosedinacarpelFlowersFruitsPhloemwithcompanioncellsReducedgametophytestagePhloemwithcompanioncellsSievetubeelem
ASU - FRESHMAN S - Freshman S
ASU10024/08/201111:54:00Asystemisacollectionsofinterconnectedcomponentsthathavesomefunction orpurpose. Asystemhasaninterface(Input/output) Asystemhasabehaviorrelationshipbetweeninputandoutput. Asystemhasastructuretheorganizationofitscomponents.24/0
ASU - FRESHMAN S - Freshman S
Name: Dheeraj YennamMy Mindset:Motivational Statements:My Learning Goals:1.Enjoyable Class1.Vocabulary2.Class goes by really quick.2Writing Techniques3.Group work is reallyintuitive, and you hear andlearn new ideas for the topicwe are disc
ASU - FRESHMAN S - Freshman S
WednesdayThursday9:30Class ASU-101Wakeup10:30FSE 19410:45 1:00FridaySaturdaySundayMondayComeback fromhomeMathLunch finishEnglishassignments-goto English1- 5 pm FSE194 LabLunch check mail&assignmentsCSE6-7DinnerSame7-912 -S
ASU - FRESHMAN S - Freshman S
HomeworkAssignment4(20+10BonusPoints)CSE110,Fall2011SchoolofComputing,InformaticsandDecisionSystemsEngineeringArizonaStateUniversityDue,October29 SaturdayMidnight,OnlinePleaseseesubmissioninstructionsgiventhinthelastpageIntroduction: Thisassignment
ASU - FSE - 100
Assembly Line Lab ReportDheeraj YennamAndrew KozellSebastian RustervillaJames Orr09/20/2011Table of ContentsPg.#1.Title Page2.Table of Contents3.Introduction / Summary of Requirements4.System Models (Tree Model & Graph Model)5.Analysis (D
ASU - FSE - 100
29 Seconds8 SecondsEngineConsoleFront-Axil26 Seconds30 SecondsMounts / SeatsCHASSISRear-Axil10 SecondsRobot-1 (30-Seconds)Robot-2 (32-Seconds)Front Axil:8 secondsRobot-3 (32-Secodns)Rear Axil:10 secondsChassis:12-13 secondsEngine:Cons
Baylor - REL - 1301
ParkDakota ParkProfessor MoserChristian Scriptures 13103 October 2010Introduction to PhilippiansAuthorship of PhilippiansThe author of Philippians is the apostle Paul who also wrote the Books ofColossians, Philemon, and Ephesians. Apostle Paul, or
Baylor - ECON - 2310
8.25What is Economics? The study of how individuals, firms and societies choose to use the scarce resources thatnature and previous generations have provided. Why are resources scare? There are unlimited wants, but Limited resources. Thus, decision
Baylor - ECON - 2310
8.30 Three Basic Questions What gets produced? - Resources How is it produced? - Producers Who gets what is produced? Households Resources or Factors of Production Resources, Inputs, and Factors of Production Production: The process that transforms
Baylor - ECON - 2310
9.1 Absolute (AA) and Comparative (CA) Advantage A producer has an AA over another in the production of a good or service if he canproduce that product using fewer resources (or can produce more of a product using thesame amount of resources) A produ
Baylor - ECON - 2310
9.6 Basic Decision Making Units Firms An organization that transforms inputs into outputs. The primary producing units in the economy. Entrepreneur: A person who organizes, manages, and assumes the risks of a firm,taking a new idea or a new product
Baylor - ECON - 2310
9.8 Determinants of Household Demand Income and Wealth Price of other goods Taste and preference Equilibrium Qd=Qs If Qd=28-8P and Qs=-8+16P Then 28-8P=-8+16P 36=24P 1.5=P Market in Disequilibrium If the quantity demanded is not equal to the q
Baylor - ECON - 2310
9.15 and 9.20.2011 Consumer Surplus (CS) The difference between the max amount a person will pay and its current market price. Producer Surplus (PS) Difference between current market price and the full cost of production for the firm. Deadweight Loss
Baylor - ECON - 2310
9.22.2011 Income Elasticity of Demand Measures the responsiveness of the quantity demanded of good X to a change in income Income elasticity of demand = (% change in Qd)/(% change in income) Tells us what type of good X is normal or inferior Normal G
Baylor - ECON - 2310
9.29.2011 Perfect Knowledge Households possess knowledge of the qualities and prices of everything availablein the market. Firms have all available information concerning input and output prices. Perfect Competition An industry structure in which th
Baylor - ECON - 2310
10.4.2011 All firms engage in production and attempt to maximize their profits Firms: an organization that comes into being when a person or group of people decides toproduce a good or service to meet a perceived demand Production: the process by whic
Baylor - ECON - 2310
10.11.2011 Economic profit = Total Revenue Total Economic Costs Economic Profit = TR (Implicit Costs + Explicit Costs) Short Run Costs and Output Decisionso Firms sell goods and services in the output (product) market and buy inputs [factor](land, la
Baylor - ECON - 2310
10.25.2011 Market Adjustment to Changes in Demand Allocative Efficiency Pareto Efficiency = Pareto Optimality A condition in which no change is possible that will make some members ofsociety better off without making some other members of society wor
USC - PSYC - 550x
Organizational StructureWork roles and authority relationships that influence behavior in an organization. Must support strategic goals Influences communication patterns which leads to innovation Lack of structure creates serious problems in an organi
USC - PSYC - 550x
Chapter 131. FedEx has _divisions that work together worldwide.A) centralizedB) decentralized pg 486C) disjointedD) jointedE) none of the above2. The shape of an organizations hierarchical structure is determined by all ofthe following, EXCEPT:A)
USC - PSYC - 550x
1. _refers to the amount of decision making authority that is held atthe top of the organization.A) StandardizationB) DecentralizationC) Centralization pg 491D) DepartmentalizationE) none of the above2. _is the degree to which associates and manage
USC - PSYC - 550x
1. _within a single product firm or a division of a larger firm must beintegrated.A) Centralized departmentsB) Decentralized departmentsC) Functional departments pg 497D) all of the aboveE) none of the above2. _relations increase information flow a
USC - PSYC - 550x
1. The strength of an organizations culture is based to some degree on the_of associates and managers.A) homogeneity p. 504B) heterogeneityC) diversityD) all of the aboveE) both B and C2. Which of the following is a form of corporate culture?A) cl
USC - PSYC - 550x
1.Organizational structure is the _ system of work roles andauthority relationships.A) informalB) formal p.514C) cooperativeD) competitiveE) none of the above2. Strategy plays a(n) _role in organizational structure.A) simpleB) important p. 515C
USC - PSYC - 550x
1.A)B)C)D)E)Which of the following is not a source of external pressure for change?life-force changes pg. 532changes in societal valuesgrowing international interdependencyshifting political dynamicsgovernment regulation2.College students Jef
USC - PSYC - 550x
1.Government deregulation of an industry is most likely to result in which ofthe following?A) lower costs for the industryB) a more competitive business environment pg. 536C) changes in societal valuesD) higher prices for consumersE) lower profits
USC - PSYC - 550x
1. Change leaders, who must overcome the resistance of a middle managerwho opposes the transfer of two of her best associates, are likely to bringabout the best outcomes for the organization by:A) assuring the manager that her department can manage the
USC - PSYC - 550x
Chapter 12 notes : Conflict Dysfunctional conflict- interferes with performance, detrimental to organizationalgoals and objectives Takes away resources that could be invested in achieving theorganizations mission Managers spend about 25% of their tim
University of Toronto - RSM - 100
Rotman School of Management | Faculty of Arts & ScienceUniversity of TorontoCOM 110H1 FINTRODUCTION TO COMMERCEQuizcoNo aids allowed.Duration - 45 min.mThursday, October 6, 2005buddy.45 questions x 1 mark eachTOTAL MARKS = 45dentLAST NAME
Oregon State - BA - 333
Oregon State - BA - 333
Washington - STAT - 311
About these solutionsThe solutions that follow were prepared by Darryl Nester. In some cases, solutions were basedon those prepared for earlier editions of IPS. Jackie Miller reviewed the solutions, especiallyfocusing on those which were new (or revise
Washington - STAT - 311
Washington - STAT - 311
Oregon - ARCH - 201
Establishing Necessary Transition The main hallway in Gerlinger Hall created a pathway between the two ends of the building. Thehallway itself is divided into two parts. One side is covered by huge/tall windows that correspond withthe tallness of the t
Oregon - ARCH - 201
Part IIGerlinger Annex The overall shape of Gerlinger Annex should be more rectangular with similar color contrastof off-white paint and brick design. Two ends of the building should be the same design and layout, so totally of two designperspective
Oregon - ARCH - 201
Yu Tuan951221986ARCH 201Exercise 3Charles Rennie Mackintosh, a Scottish architect, designer, and watercolorist was born inGlasgow on June 7, 1868. Mackintosh was trained as an architect in a local practice and studiedart and design at evening classe
Oregon - ARCH - 201
Establishing Longevity:The Glasgow School of Art library included a dark and light duality, darkness from thecolor of the room, columns and furniture to the bright warming sunlight from the window. Highand low duality, raised ceiling height to the low
Oregon - ARCH - 201
Exercise 3Charles Rennie Mackintosh, a Scottish architect, designer, and watercolorist was born inGlasgow on June 7, 1868. Mackintosh was trained as an architect in a local practice and studiedart and design at evening classes at the Glasgow School of
Oregon - ARCH - 201
Supporting activities and Purpose:The Glasgow School of Art is recognized as one of Europes foremost higher educationinstitutions for creative education and research in fine art, design and architecture. The mainpurpose of the building is to motivate a
LSU - BIOL - 2153
CHAPTER1TheMolecularBasisofHeredity,Variation,andEvolutionGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.1.1 Modern Genetics Has Entered ItsSecond CenturyHumans have been aware of genetics, via selectivebreeding, for over 10
LSU - BIOL - 2153
CHAPTER2TransmissionGeneticsGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.2.1 Gregor Mendel (1822-1884) Discovered theBasic Principles of Genetic TransmissionMendel obtained 34 different varieties of peas and examinedthe cha
LSU - BIOL - 2153
PCR example:ADDITIONALINFORMATION #15 AATGCACTATGCATGCATGTACTGCATGAT 3.3 TTACGTGATACGTACGTACATGACGTACTA 5These areyour two PCRprimers.Where do theybind and why?(pink = topred = bottom)5 AATGCACTATGCATGCATGTACTGCATGAT 33 TTACGTGATACGTACGTACAT
LSU - BIOL - 2153
The values inside the box indicate the size of the band(s) seen on an agarose gelfor single or double digests. Each number (#) only has a single restriction enzymewhich cuts at that particular location. Based on the number and size of thefragments, you
LSU - BIOL - 2153
CHAPTER1TheMolecularBasisofHeredity,Variation,andEvolutionGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.1.1 Modern Genetics Has Entered ItsSecond CenturyHumans have been aware of genetics, viaExploration and understanding o
LSU - BIOL - 2153
CHAPTER2TransmissionGeneticsGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.2.1 Gregor Mendel (1822-1884) Discovered theBasic Principles of Genetic TransmissionMendel obtained 34 different varieties of peas and examined thecha
LSU - BIOL - 2153
2.3 Dihybrid-Cross Analysis of Two GenesTo study the simultaneous transmission of two traits, Mendel madedihybrid crosses between organisms that differed for two traitsHe began each cross with pure-breeding lines(e.g., RRGG and rrgg) and produced F1 t
LSU - BIOL - 2153
2.5 Chi-Square Analysis Tests the Fit BetweenObserved and Expected OutcomesScientists must be able to objectively determine whether results areconsistent with expectations.The chi-square test ( 2) was developed to allow for these objectivecomparisons
LSU - BIOL - 2153
CHAPTER3CellDivisionandChromosomeHeredityGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.Cell DivisionMitosis produces two identical daughter cells that are exact replicas of theparental cell. General process by which cells mak
LSU - BIOL - 2153
3.2 Meiosis Produces Gametes for SexualReproductionReproduction can be divided into two broad categories1.In asexual reproduction, organisms reproduce without mating andproduce genetically identical offspring.2.In sexual reproduction, gametes (repr
LSU - BIOL - 2153
CHAPTER3GeneInteractionGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.Gene InteractionThe phrase gene interactions refers to the ways genes collaborate orinteract to influence a phenotypeThere are several important types of i
LSU - BIOL - 2153
4.3 Gene Interaction Modifies Mendelian RatiosGenes work together to build the complex structures and organ systems ofplants and animalsThe collaboration of multiple genes in the production of a a singlephenotypic characteristic or group of related ch
LSU - BIOL - 2153
CHAPTER7DNAStructureandReplicationGeneticsAnalysis:AnIntegratedApproachCopyright2012PearsonEducationInc.7.1 DNA Is the Hereditary Molecule of LifeHereditary molecule: any molecular substance that bothcarries & conveys the genetic information of a sp
LSU - BIOL - 2153
7.3 DNA Replication Is Semi-conservative andBi-directionalThe integrity of the nucleotide sequence of DNA is ofparamount important. Accuracy plays a very important role(i.e., sickle cell)The general mechanism of DNA replication is the same in allliv