Chapter 15
77 Pages

Chapter 15

Course: ECON 101, Spring 2013

School: Chattahoochee Valley...

Word Count: 13280

Rating:

Document Preview

Testbank 01 - Chapter 15 Money Creation -------------------------------------------------------------------------------1. The goldsmith's ability to create money was based on the fact that: A. withdrawals of gold tended to exceed deposits of gold in any given time period. B. consumers and merchants preferred to use gold for transactions, rather than paper money. C. the goldsmith was required to keep 100 percent...

Unformatted Document Excerpt
Coursehero >> Alabama >> Chattahoochee Valley Community College >> ECON 101

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

01 Testbank - Chapter 15 Money Creation -------------------------------------------------------------------------------1. The goldsmith's ability to create money was based on the fact that: A. withdrawals of gold tended to exceed deposits of gold in any given time period. B. consumers and merchants preferred to use gold for transactions, rather than paper money. C. the goldsmith was required to keep 100 percent gold reserves. D. paper money in the form of gold receipts was rarely redeemed for gold. Points Earned: 0/1 Correct Register to View AnswerYour Response: 2. When the receipts given by goldsmiths to depositors were used to make purchases: A. the gold standard was created. B. existing banking laws were violated. C. the receipts became in effect paper money. D. a fractional reserve banking system was created. Points Earned: 0/1 Correct Register to View AnswerYour Response: 3. Which one of the following is presently a major deterrent to bank panics in the United States? A. the legal reserve requirement B. the fractional reserve system C. the gold standard D. deposit insurance Points Earned: 0/1 Correct Register to View AnswerYour Response: 4. Most modern banking systems are based on: A. money of intrinsic value. B. commodity money. C. 100 percent reserves. D. fractional reserves. Points Earned: 0/1 Correct Register to View AnswerYour Response: 5. A fractional reserve banking system: A. is susceptible to bank panics. B. prevents money creation through the lending process. C. only tends to exist in developing economies. D. prevents the Federal Reserve from influencing the money supply. Points Earned: 0/1 Correct Register to View AnswerYour Response: 6. In a fractional reserve banking system: A. bank panics cannot occur. B. the monetary system must be backed by gold. C. banks can create money through the lending process. D. the Federal Reserve has no control over the amount of money in circulation. Points Earned: 0/1 Correct Register to View AnswerYour Response: 7. Bank panics: A. occur frequently in fractional reserve banking systems. B. are a risk of fractional reserve banking, but are unlikely when banks are highly regulated and lend prudently. C. cannot occur in a fractional reserve banking system. D. occur more frequently when the monetary system is backed by gold. Points Earned: 0/1 Correct Register to View AnswerYour Response: 8. Which of the following statements is correct? A. The actual reserves of a commercial bank equal its excess reserves minus its required reserves. B. A bank's liabilities plus its net worth equal its assets. C. When borrowers repay bank loans, the supply of money increases. D. A single commercial bank can safely lend a multiple amount of its excess reserves. Points Earned: 0/1 Correct Register to View AnswerYour Response: 9. A bank that has assets of $85 billion and a net worth of $10 billion must have: A. liabilities of $75 billion. B. excess reserves of $10 billion. C. liabilities of $10 billion. D. excess reserves of $75 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 10. A bank that has liabilities of $150 billion and a net worth of $20 billion must have: A. excess reserves of $130 billion. B. assets of $150 billion. C. excess reserves of $150 billion. D. assets of $170 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 11. If a bank has liabilities that exceed its net worth it: A. will not be able to meet the legal reserve ratio. B. is considered to be insolvent. C. most likely is a heavy borrower from its district Federal Reserve Bank. D. may or may not be a profitable firm. Points Earned: 0/1 Correct Register to View AnswerYour Response: 12. Which of the following describes the identity embodied in a balance sheet? A. Net worth plus assets equal liabilities B. Assets plus liabilities equal net worth C. Assets equal liabilities plus net worth D. Assets plus reserves equal net worth Points Earned: 0/1 Correct Register to View AnswerYour Response: 13. The claims of the owners of a firm against the firm's assets are called: A. working capital. B. assets. C. net worth. D. liabilities. Points Earned: 0/1 Correct Register to View AnswerYour Response: 14. Which of the following are all assets to a commercial bank? A. demand deposits, stock shares, and reserves B. vault cash, property, and reserves C. vault cash, property, and stock shares D. vault cash, stock shares, and demand deposits Points Earned: 0/1 Correct Register to View AnswerYour Response: 15. The reserves of a commercial bank consist of: A. the amount of money market funds it holds. B. deposits at the Federal Reserve Bank and vault cash. C. government securities that the bank holds. D. the bank's net worth. Points Earned: 0/1 Correct Register to View AnswerYour Response: 16. A commercial bank's reserves are: A. liabilities to both the commercial bank and the Federal Reserve Bank holding them. B. liabilities to the commercial bank and assets to the Federal Reserve Bank holding them. C. assets to both the commercial bank and the Federal Reserve Bank holding them. D. assets to the commercial bank and liabilities to the Federal Reserve Bank holding them. Points Earned: 0/1 Correct Register to View AnswerYour Response: 17. The primary purpose of the legal reserve requirement is to: A. prevent banks from hoarding too much vault cash. B. provide a means by which the monetary authorities can influence the lending ability of commercial banks. C. prevent commercial banks from earning excess profits. D. provide a dependable source of interest income for commercial banks. Points Earned: 0/1 Correct Register to View AnswerYour Response: 18. The ABC Commercial Bank has $5,000 in excess reserves and the reserve ratio is 30 percent. The bank must have: A. $90,000 in outstanding loans and $35,000 in reserves. B. $90,000 in checkable deposit liabilities and $32,000 in reserves. C. $20,000 in checkable deposit liabilities and $10,000 in reserves. D. $90,000 in checkable deposit liabilities and $35,000 in reserves. Points Earned: 0/1 Correct Register to View AnswerYour Response: 19. Commercial banks monetize claims when they: A. collect checks through the Federal Reserve System. B. make loans to the public. C. accept repayment of outstanding loans. D. borrow from the Federal Reserve Banks. Points Earned: 0/1 Correct Register to View AnswerYour Response: 20. Checkable deposits are also called: A. checking accounts. B. high-powered money. C. savings balances. D. Federal Reserve Notes. Points Earned: 0/1 Correct Register to View AnswerYour Response: 21. Suppose a commercial bank has checkable deposits of $100,000 and the legal reserve ratio is 10 percent. If the bank's required and excess reserves are equal, then its actual reserves: A. are $30,000. B. are $10,000. C. are $20,000. D. cannot be determined from the given information. Points Earned: 0/1 Correct Register to View AnswerYour Response: 22. Banks create money when they: A. add to their reserves in the Federal Reserve Bank. B. accept deposits of cash. C. sell government bonds. D. exchange checkable deposits for the IOU's of businesses and individuals. Points Earned: 0/1 Correct Register to View AnswerYour Response: 23. Refer to row 1 in the above table. The number appropriate for space W is: A. 4. B. 6. C. 10. D. 12. Points Earned: 0/1 Correct Register to View AnswerYour Response: 24. Refer to row 2 in the above table. The number appropriate for space X is: A. $20,000. B. $60,000. C. $200,000. D. $100,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 25. Refer to row 3 in the above table. The number appropriate for space Y is: A. $24,000. B. $32,000. C. $48,000. D. $96,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 26. Refer to row 4 in the above table. The number appropriate for space Z is: A. $10,000. B. $70,000. C. $48,000. D. zero. Points Earned: 0/1 Correct Register to View AnswerYour Response: 27. When a check is drawn and cleared, the A. reserves and deposits of both the bank against which the check is cleared and the bank receiving the check are unchanged by this transaction. B. bank against which the check is cleared loses reserves and deposits equal to the amount of the check. C. bank receiving the check loses reserves and deposits equal to the amount of the check. D. bank against which the check is cleared acquires reserves and deposits equal to the amount of the check. Points Earned: 0/1 Correct Register to View AnswerYour Response: 28. Suppose the ABC bank has excess reserves of $4,000 and outstanding checkable deposits of $80,000. If the reserve requirement is 25 percent, what is the size of the bank's actual reserves? A. $16,000 B. $84,000 C. $24,000 D. $20,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 29. Excess reserves refer to the: A. difference between a bank's vault cash and its reserves deposited at the Federal Reserve Bank. B. minimum amount of actual reserves a bank must keep on hand to back up its customers deposits. C. difference between actual reserves and loans. D. difference between actual reserves and required reserves. Points Earned: 0/1 Correct Register to View AnswerYour Response: 30. Suppose the reserve requirement is 10 percent. If a bank has $5 million of checkable deposits and actual reserves of $500,000, the bank: A. can safely lend out $500,000. B. can safely lend out $5 million. C. can safely lend out $50,000. D. cannot safely lend out more money. Points Earned: 0/1 Correct Register to View AnswerYour Response: 31. A reserve requirement of 20 percent means a bank must have $1,000 of reserves if its checkable deposits are: A. $100. B. $1,000. C. $5,000. D. $12,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 32. Assume that a bank initially has no excess reserves. If it receives $5,000 in cash from a depositor and the bank finds that it can safely lend out $4,500, the reserve requirement must be: A. zero. B. 10 percent. C. 20 percent. D. 25 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 33. Suppose the reserve requirement is 20 percent. If a bank has checkable deposits of $4 million and actual reserves of $1 million, it can safely lend out: A. $1 million. B. $1.2 million. C. $200,000. D. $800,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 34. Suppose that a bank's actual reserves are $5 million, its checkable deposits are $5 million, and its excess reserves are $3 million. The reserve requirement must be: A. 40 percent. B. 20 percent. C. 10 percent. D. 5 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 35. Assume the Continental National Bank's balance statement is as follows: Assuming a legal reserve ratio of 20 percent, how much in excess reserves would this bank have after a check for $10,000 was drawn and cleared against it? A. $3,000 B. $24,000 C. $6,000 D. $16,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 36. The reserve ratio refers to the ratio of a bank's: A. reserves to its liabilities and net worth. B. capital stock to its total assets. C. checkable deposits to its total liabilities. D. required reserves and vault cash to its checkable deposits. Points Earned: 0/1 Correct Register to View AnswerYour Response: 37. The amount that a commercial bank can lend is determined by its: A. required reserves. B. excess reserves. C. outstanding loans. D. outstanding checkable deposits. Points Earned: 0/1 Correct Register to View AnswerYour Response: 38. A commercial bank can expand its excess reserves by: A. demanding and receiving payment on an overdue loan. B. buying bonds from a Federal Reserve Bank. C. buying bonds from the public. D. paying back money borrowed from a Federal Reserve Bank. Points Earned: 0/1 Correct Register to View AnswerYour Response: 39. Commercial banks create money when they: A. accept cash deposits from the public. B. purchase government securities from the central banks. C. create checkable deposits in exchange for IOUs. D. raise their interest rates. Points Earned: 0/1 Correct Register to View AnswerYour Response: 40. Individual commercial banks are limited in their ability to create money by lending because: A. lending is likely to result in the loss of reserves to other banks. B. only the Treasury and the Federal Reserve Banks are authorized to create new money. C. the Board of Governors prohibits bank lending when the result is an expansion of the money supply. D. banking is a highly competitive industry. Points Earned: 0/1 Correct Register to View AnswerYour Response: 41. Assume Company X deposits $100,000 in cash in commercial Bank A. If no excess reserves exist at the time this deposit is made and the reserve ratio is 20 percent, Bank A can increase the money supply by a maximum of: A. $50,000. B. $180,000. C. $80,000. D. $500,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 42. Assume that Smith deposits $600 in currency into her checking account in the XYZ Bank. Later that same day Jones negotiates a loan for $1,200 at the same bank. In what direction and by what amount has the supply of money changed? A. decreased by $600 B. increased by $1,800 C. increased by $600 D. increased by $1,200 Points Earned: 0/1 Correct Register to View AnswerYour Response: 43. Assume the Standard Internet Company negotiates a loan for $5,000 from the Metro National Bank and receives a checkable deposit for that amount in exchange for its promissory note (IOU). As a result of this transaction: A. the supply of money is increased by $5,000. B. the supply of money declines by the amount of the loan. C. a claim has been "demonetized." D. the Metro Bank acquires reserves from other banks. Points Earned: 0/1 Correct Register to View AnswerYour Response: 44. Use the following balance sheet for the ABC National Bank in answering the next question(s). Assume the required reserve ratio is 20 percent. Refer to the above data. This commercial bank has excess reserves of: A. $0. B. $3,000. C. $12,000. D. $5,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 45. Use the following balance sheet for the ABC National Bank in answering the next question(s). Assume the required reserve ratio is 20 percent. Refer to the above data. This bank can safely expand its loans by a maximum of: A. $7,000. B. $25,000. C. $12,000. D. $5,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 46. Use the following balance sheet for the ABC National Bank in answering the next question(s). Assume the required reserve ratio is 20 percent. Refer to the above data. Assuming the bank loans out all of its remaining excess reserves as a checkable deposit, and has a check cleared against it for that amount, its reserves and checkable deposits will now be: A. $25,000 and $122,000 respectively. B. $22,000 and $110,000 respectively. C. $32,000 and $115,000 respectively. D. $22,000 and $105,000 respectively. Points Earned: 0/1 Correct Register to View AnswerYour Response: 47. Use the following balance sheet for the ABC National Bank in answering the next question(s). Assume the required reserve ratio is 20 percent. Refer to the above data. Assuming the bank loans out all of its remaining excess reserves as a checkable deposit, and has a check cleared against it for that amount, the bank will now have excess reserves of: A. $0. B. $3,000. C. $12,000. D. $5,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 48. Use the following balance sheet for the ABC National Bank in answering the next question(s). Assume the required reserve ratio is 20 percent. Refer to the above data. If the original balance sheet was for the commercial banking system, rather than a single bank, loans and checkable deposits could have been expanded by a maximum of: A. $8,000. B. $15,000. C. $48,000. D. $25,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 49. A single commercial bank must meet a 25 percent reserve requirement. If the bank has no excess reserves initially and $5,000 of cash is deposited in the bank, it can increase its loans by a maximum of: A. $1,250. B. $120,000. C. $5,000. D. $3,750. Points Earned: 0/1 Correct Register to View AnswerYour Response: 50. If you deposit a $50 bill in a commercial bank that has a 10 percent legal reserve requirement the bank will: A. have $45 of additional excess reserves. B. be capable of lending an additional $500. C. be capable of lending an additional $50. D. have $50 of required reserves. Points Earned: 0/1 Correct Register to View AnswerYour Response: 51. When a commercial bank has excess reserves: A. it is in a position to make additional loans. B. its actual reserves are less than its required reserves. C. it is charging too high an interest rate on its loans. D. its reserves exceed its assets. Points Earned: 0/1 Correct Register to View AnswerYour Response: 52. If we both have checking accounts in the same commercial bank and I write a check in your favor for $200, the bank's: A. balance sheet will be unchanged. B. reserves and checkable deposits will both decline by $200. C. liabilities will decline by $200, but its net worth will increase by $200. D. assets and liabilities will both decline by $200. Points Earned: 0/1 Correct Register to View Answer Your Response: 53. Which of the following is correct? A. Both the granting and repaying of bank loans expand the aggregate money supply. B. Granting and repaying bank loans do not affect the money supply. C. Granting a bank loan destroys money; repaying a bank loan creates money. D. Granting a bank loan creates money; repaying a bank loan destroys money. Points Earned: 0/1 Correct Register to View AnswerYour Response: 54. If the reserve requirement is 10 percent, how much excess reserves does a bank acquire when a business deposits a $500 check drawn on another bank? A. $450 B. $400 C. $5000 D. $550 Points Earned: 0/1 Correct Register to View AnswerYour Response: 55. The amount of reserves that a commercial bank is required to hold is equal to: A. the amount of its checkable deposits. B. the sum of its checkable deposits and time deposits. C. its checkable deposits multiplied by the reserve requirement. D. its checkable deposits divided by its total assets. Points Earned: 0/1 Correct Register to View AnswerYour Response: 56. Banks create money when they: A. allow loans to mature. B. accept deposits of cash. C. buy government bonds from households. D. sell government bonds from households. Points Earned: 0/1 Correct Register to View AnswerYour Response: 57. In prosperous times banks are likely to hold very small amounts of excess reserves because: A. the Fed wants commercial banks to increase the money supply during economic expansions. B. it is very costly to transfer funds between commercial banks and the central banks. C. the Federal Reserve Banks do not pay interest on bank reserves. D. the Federal Reserve Banks want to minimize their interest payments on such deposits. Points Earned: 0/1 Correct Register to View AnswerYour Response: 58. Which of the following is correct? A. Required reserves minus actual reserves equal excess reserves. B. Required reserves equal excess reserves minus actual reserves. C. Required reserves equal actual reserves plus excess reserves. D. Actual reserves minus required reserves equal excess reserves. Points Earned: 0/1 Correct Register to View AnswerYour Response: 59. Answer the next question(s) on the basis of the following balance sheet for the First National Bank of Bunco. All figures are in millions. Refer to the above data. If this bank has excess reserves of $6 million, the legal reserve ratio must be: A. 10 percent. B. 12 percent. C. 14 percent. D. 20 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 60. Answer the next question(s) on the basis of the following balance sheet for the First National Bank of Bunco. All figures are in millions. Refer to the above data. Suppose that this bank currently has $6 million in excess reserves and that customers of this bank collectively write checks for cash at the bank in the amount of $6 million. As a result, the bank's excess reserves diminish to: A. $0. B. $6 million. C. $0.72 million. D. $0.84 million. Points Earned: 0/1 Correct Register to View AnswerYour Response: 61. When a bank has a check drawn and cleared against it: A. excess reserves in the banking system decline. B. the nation's total money supply falls. C. the bank's balance sheet does not change. D. the amount of required reserves the bank must have will fall. Points Earned: 0/1 Correct Register to View AnswerYour Response: 62. A bank's actual reserves can be found by: A. adding its required and excess reserves. B. subtracting its required reserves from its excess reserves. C. multiplying its excess reserves by the reserve ratio. D. multiplying its checkable deposits by the reserve ratio. Points Earned: 0/1 Correct Register to View AnswerYour Response: 63. Suppose a savings and loan association has checkable deposits of $500,000 and the legal reserve ratio is 10 percent. If the institution has excess reserves of $4,000, then its actual reserves are: A. $46,000. B. $50,000. C. $54,000. D. $4,000. Points Earned: 0/1 Correct Register to View Answer Your Response: 64. The legal reserve ratio applies to checkable deposits at: A. national banks. B. credit unions. C. savings and loans. D. institutions of all of these types. Points Earned: 0/1 Correct Register to View AnswerYour Response: 65. When commercial banks use excess reserves to buy government securities from the public: A. new money is created. B. commercial bank reserves increase. C. the money supply falls. D. checkable deposits decline. Points Earned: 0/1 Correct Register to View AnswerYour Response: 66. Which of the following would reduce the money supply? A. Commercial banks use excess reserves to buy government bonds from the public. B. Commercial banks loan out excess reserves. C. Commercial banks sell government bonds to the public. D. A check clears from Bank A to Bank B. Points Earned: 0/1 Correct Register to View AnswerYour Response: 67. Overnight loans from one bank to another for reserve purposes entail an interest rate called the: A. prime rate. B. discount rate. C. Federal funds rate. D. treasury bill rate. Points Earned: 0/1 Correct Register to View AnswerYour Response: 68. A bank temporarily short of required reserves may be able to remedy this situation by: A. borrowing funds in the Federal funds market. B. granting new loans. C. shifting some of its vault cash to its reserve account at the Federal Reserve. D. buying bonds from the public. Points Earned: 0/1 Correct Register to View AnswerYour Response: 69. The market for immediately available reserve balances at the Federal Reserve is known as the: A. money market. B. long-term bond market. C. short-term bond market. D. Federal funds market. Points Earned: 0/1 Correct Register to View AnswerYour Response: 70. The Federal funds market is the market in which: A. banks borrow from the Federal Reserve Banks. B. U.S. securities are bought and sold. C. banks borrow reserves from one another on an overnight basis. D. Federal Reserve Banks borrow from one another. Points Earned: 0/1 Correct Register to View AnswerYour Response: 71. The multiple by which the commercial banking system can expand the supply of money is equal to the reciprocal of: A. the MPS. B. its actual reserves. C. its excess reserves. D. the reserve ratio. Points Earned: 0/1 Correct Register to View AnswerYour Response: 72. The multiple by which the commercial banking system can expand the supply of money on the basis of excess reserves: A. is larger the smaller the legal reserve ratio. B. is the reciprocal of the bank's actual reserves. C. is directly or positively related to the size of the required reserve ratio. D. will be zero when the required reserve ratio is 100 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 73. The multiple by which the commercial banking system can increase the supply of money on the basis of each dollar of excess reserves is equal to: A. the reciprocal of the legal reserve ratio. B. 1 minus the legal reserve ratio. C. the reciprocal of the income velocity of money. D. 1/MPS. Points Earned: 0/1 Correct Register to View AnswerYour Response: 74. If m equals the maximum number of new dollars that can be created for a single dollar of excess reserves and R equals the required reserve ratio, then for the banking system: A. m = R-1. B. R = m/1. C. R = m-1. D. m = 1/R. Points Earned: 0/1 Correct Register to View AnswerYour Response: 75. If D equals the maximum amount of new demand-deposit money that can be created by the banking system on the basis of any given amount of excess reserves; E equals the amount of excess reserves; and m is the monetary multiplier, then: A. m = E/D. B. D = E m. C. D = E-1/m. D. D = m/E. Points Earned: 0/1 Correct Register to View AnswerYour Response: 76. If the reserve ratio is 15 percent and commercial bankers decide to hold additional excess reserves equal to 5 percent of any newly acquired checkable deposits, then the relevant monetary multiplier for the banking system will be: A. 31/2. B. 4. C. 5. D. 10. Points Earned: 0/1 Correct Register to View AnswerYour Response: 77. Other things equal, if the required reserve ratio was lowered: A. banks would have to reduce their lending. B. the size of the monetary multiplier would increase. C. the actual reserves of banks would increase. D. the Federal funds interest rate would rise. Points Earned: 0/1 Correct Register to View AnswerYour Response: 78. Suppose a commercial banking system has $100,000 of outstanding checkable deposits and actual reserves of $35,000. If the reserve ratio is 20 percent, the banking system can expand the supply of money by the maximum amount of: A. $122,000. B. $175,000. C. $300,000. D. $75,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 79. If a portion of the loans extended by commercial banks is taken as cash rather than as checkable deposits, the maximum money-creating potential of the commercial banking system will: A. be equal to twice the reciprocal of the reserve ratio. B. be unaffected. C. increase. D. decrease. Points Earned: 0/1 Correct Register to View AnswerYour Response: 80. The basic reason why the commercial banking system can increase its checkable deposits by a multiple of its excess reserves is that: A. reserves lost by any particular bank will be gained by some other bank. B. the central banks follow policies that prevent reserves from falling below the level required by law. C. the MPC of borrowers is greater than zero, but less than 1. D. the banking system must keep reserves equal to 100 percent of its checkable-deposit liabilities. Points Earned: 0/1 Correct Register to View AnswerYour Response: 81. Answer the next question(s) on the basis of the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 30 percent. All figures are in billions. Refer to the above data. The commercial banking system has excess reserves of: A. $9 billion. B. $7 billion. C. $6.1 billion. D. $5 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 82. Answer the next question(s) on the basis of the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 30 percent. All figures are in billions. Refer to the above data. The maximum amount by which the commercial banking system can expand the supply of money by lending is: A. $30 billion. B. $23.1 billion. C. $27 billion. D. $15 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 83. Answer the next question(s) on the basis of the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 30 percent. All figures are in billions. Refer to the above data. If the commercial banking system actually loans the maximum amount it is able to lend: A. reserves and deposits equal to that amount will be gained. B. excess reserves will be $2.6 billion. C. excess reserves will fall to $1.7 billion. D. excess reserves will be reduced to zero. Points Earned: 0/1 Correct Register to View AnswerYour Response: 84. Given a 25 percent reserve ratio, assume the commercial banking system is loaned up. Now assume the reserve ratio is reduced to 20 percent. As a result of this reduction: A. we can expect bank lending and bank profits to decline. B. each dollar of bank reserves will now support a maximum of $5 of checkable deposits. C. the banking system must now reduce outstanding loans by 5 percent. D. the banking system can now increase lending by 5 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 85. Answer the next question(s) on the basis of the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 10 percent. All figures are in billions. Refer to the above data. The commercial banking system has excess reserves of: A. $0 billion. B. $30 billion. C. $60 billion. D. $70 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 86. Answer the next question(s) on the basis of the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 10 percent. All figures are in billions. Refer to the above data. After a deposit of $10 billion of new currency into a checking account in the banking system, excess reserves will increase by: A. $0 billion. B. $7 billion. C. $9 billion. D. $10 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 87. Answer the next question(s) on the basis of the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 10 percent. All figures are in billions. Refer to the above data. After the deposit of $10 billion of new currency, the maximum amount by which this commercial banking system can expand the supply of money by lending is: A. $9 billion. B. $45 billion. C. $36 billion. D. $90 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 88. Answer the next question(s) on the basis of the following information about a banking system: new currency deposited in the system = $40 billion; legal reserve ratio = 0.20; excess reserves prior to the currency deposit = $0. Refer to the above information. The $40 billion deposit of currency into checking accounts will initially create: A. $8 billion of new checkable deposits. B. $10 billion of new checkable deposits. C. $40 billion of new checkable deposits. D. $160 billion of new checkable deposits. Points Earned: 0/1 Correct Register to View AnswerYour Response: 89. Answer the next question(s) on the basis of the following information about a banking system: new currency deposited in the system = $40 billion; legal reserve ratio = 0.20; excess reserves prior to the currency deposit = $0. Refer to the above information. The $40 billion deposit of currency into checking accounts will create excess reserves of: A. $20 billion. B. $32 billion. C. $40 billion. D. $0. Points Earned: 0/1 Correct Register to View AnswerYour Response: 90. Answer the next question(s) on the basis of the following information about a banking system: new currency deposited in the system = $40 billion; legal reserve ratio = 0.20; excess reserves prior to the currency deposit = $0. Refer to the above information. The banking system will be able to expand the money supply through loans by: A. $160 billion. B. $200 billion. C. $40 billion. D. $128 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 91. Answer the next question(s) on the basis of the following information about a banking system: new currency deposited in the system = $40 billion; legal reserve ratio = 0.20; excess reserves prior to the currency deposit = $0. Refer to the above information. The $40 billion deposit of new currency will support total checkable deposits of: A. $160 billion. B. $200 billion. C. $40 billion. D. $128 billion. Points Earned: 0/1 Correct Register to View AnswerYour Response: 92. Answer the next question(s) on the basis of the following table for a commercial bank or thrift: Refer to the above table. When the legal reserve ratio is 25 percent, the excess reserves of this single bank are: A. $0. B. $1,000. C. $5,000. D. $30,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 93. Answer the next question(s) on the basis of the following table for a commercial bank or thrift: Refer to the above table. When the legal reserve ratio is 10 percent, the money creating potential of this single bank is: A. $0. B. $6,000. C. $30,000. D. $60,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 94. Answer the next question(s) on the basis of the following table for a commercial bank or thrift: Refer to the above table. When the legal reserve ratio is 20 percent, the money creating potential of the entire banking system is: A. $4,000. B. $6,000. C. $8,000. D. $10,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 95. Answer the next question(s) on the basis of the following table for a commercial bank or thrift: Refer to the above table. When the legal reserve ratio is 30 percent, the monetary multiplier is: A. 5. B. 4. C. 3.33. D. 2.5. Points Earned: 0/1 Correct Register to View AnswerYour Response: 96. Answer the next question(s) on the basis of the following table for a commercial bank or thrift: Refer to the above table. If the legal reserve ratio falls from 25 percent to 10 percent, excess reserves of this single bank will: A. rise by $6,000 and the monetary multiplier will increase from 4 to 10. B. rise by $60,000 and the monetary multiplier will increase from 4 to 10. C. fall by $6,000 and the monetary multiplier will decline from 30 to 10. D. fall by $2,000 and the monetary multiplier will decline from 10 to 4. Points Earned: 0/1 Correct Register to View AnswerYour Response: 97. If excess reserves in the banking system are $4,000, checkable deposits are $40,000, and the legal reserve ratio is 10 percent, then actual reserves are: A. $4,000. B. $6,000. C. $8,000. D. $5,000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 98. If actual reserves in the banking system are $8,000, checkable deposits are $70,000, and the legal reserve ratio is 10 percent, then excess reserves are: A. zero. B. $1,000. C. $2,000. D. $500. Points Earned: 0/1 Correct Register to View AnswerYour Response: 99. If actual reserves in the banking system are $40,000, excess reserves are $10,000, and checkable deposits are $240,000, then the legal reserve requirement is: A. 10 percent. B. 12.5 percent. C. 20 percent. D. 5 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 100. If actual reserves in the banking system are $50,000, excess reserves are $5,000, and checkable deposits are $225,000, then the monetary multiplier is: A. 10. B. 4. C. 5. D. 2. Points Earned: 0/1 Correct Register to View AnswerYour Response: 101. If the monetary authorities want to reduce the monetary multiplier, they should: A. lower the legal reserve ratio. B. raise the legal reserve ratio. C. increase bank reserves. D. lower interest rates. Points Earned: 0/1 Correct Register to View AnswerYour Response: 102. If the reserve ratio is 100 percent, the value of the monetary multiplier is: A. 0. B. 1. C. 10. D. 100. Points Earned: 0/1 Correct Register to View AnswerYour Response: 103. The value of the monetary multiplier is: A. 1/MPS. B. 1/Excess Reserves. C. 1/MPC. D. 1/Required Reserve Ratio. Points Earned: 0/1 Correct Register to View Answer Your Response: 104. The greater the legal reserve ratio, the: A. higher is the spending multiplier. B. lower is the spending multiplier. C. lower is the monetary multiplier. D. higher is the monetary multiplier. Points Earned: 0/1 Correct Register to View AnswerYour Response: 105. Money is destroyed when: A. loans are made. B. checks written on one bank are deposited in another bank. C. loans are repaid. D. the net worth of the banking system declines. Points Earned: 0/1 Correct Register to View AnswerYour Response: 106. Banks destroy money when they: A. buy government bonds. B. accept deposits of cash into checkable accounts. C. fail to reissue loans that are paid off. D. clear checks against another bank. Points Earned: 0/1 Correct Register to View AnswerYour Response: 107. When a bank loan is repaid the supply of money: A. is constant, but its composition will have changed. B. is decreased. C. is increased. D. may either increase or decrease. Points Earned: 0/1 Correct Register to View AnswerYour Response: 108. Answer the next question(s) on the basis of the following information for the Moolah Bank. Assume that the listed amounts constitute this bank's complete set of accounts. Moolah's: A. assets are $1000. B. liabilities are $1000. C. net worth is zero. D. profit is $1000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 109. Answer the next question(s) on the basis of the following information for the Moolah Bank. Assume that the listed amounts constitute this bank's complete set of accounts. Moolah's: A. assets are $1100. B. liabilities are $1100. C. net worth is $300. D. profit is $1000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 110. Answer the next question(s) on the basis of the following information for the Moolah Bank. Assume that the listed amounts constitute this bank's complete set of accounts. Moolah's: A. assets are $1000. B. liabilities are $300. C. net worth is $100. D. annual profit is $200. Points Earned: 0/1 Correct Register to View AnswerYour Response: 111. Answer the next question(s) on the basis of the following information for the Moolah Bank. Refer to the above information. If Moolah Bank is legally "loaned up," the reserve requirement must be: A. 10 percent. B. 15 percent. C. 20 percent. D. 25 percent. Points Earned: 0/1 Correct Register to View AnswerYour Response: 112. Answer the next question(s) on the basis of the following information for the Moolah Bank. Refer to the above information. If Moolah Bank is legally "loaned up," the banking system's monetary multiplier must be: A. 5. B. 8. C. 10. D. 20. Points Earned: 0/1 Correct Register to View AnswerYour Response: 113. Answer the next question(s) on the basis of the following information for the Moolah Bank. Refer to the above information and assumed that Moolah bank is "loaned up." If it receives a $100 deposit of currency, it could safely expand its loans by: A. $100. B. $90. C. $900. D. $1000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 114. Refer to the above information and assume that Moolah Bank is "loaned up." If it receives a $100 deposit of currency, the banking system of which Moolah is a part could expand loans by: A. $100. B. $90. C. $900. D. $1000. Points Earned: 0/1 Correct Register to View AnswerYour Response: 115. (Last Word) The bank panics of 1930-1933: A. resulted in the passage of the Smoot-Hawley Act. B. boosted the nation's money supply, causing inflation. C. directly resulted in the Federal insured deposit program. D. caused a significant outflow of gold from the United States. Points Earned: 0/1 Correct Register to View AnswerYour Response: 116. (Last Word) A "national bank holiday" that closed all banks for a week and resulted in Federal deposit insurance occurred in the United States in: A. 1903, following the "Louisiana stampede." B. 1987, following the collapse of numerous savings and loan associations. C. 1945, following the end of the Second World War. D. 1933, following the bank panics of 1930-1933. Points Earned: 0/1 Correct Register to View AnswerYour Response: 117. (Last Word) Which of the following represents a change in today's banking policies that should prevent a recurrence of the bank panics of 1930-1933? A. banks are more cautious lenders B. banks keep large amounts of excess reserves on hand C. the FDIC insures bank deposits and therefore depositors do not panic and rush to withdraw money when individual banks have financial problems D. the President now has the authority to close banks whenever panics occur Points Earned: 0/1 Correct Register to View AnswerYour Response: 118. (Last Word) The bank panics of 1930-1933 and the resulting failures of many banks were caused by: A. the widespread conversion of checkable deposits to cash by the public. B. the raising of the reserve requirement by the Board of Governors. C. a massive inflow of gold bullion to the United States. D. a massive inflow of cash into bank deposits by citizens who feared their money was losing its value. Points Earned: 0/1 Correct Register to View AnswerYour Response: 119. Excess reserves are the amount by which required reserves exceed actual reserves. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 120. The supply of money increases when the public buys government securities from commercial banks. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 121. Commercial bank reserves are an asset to commercial banks but a liability to the Federal Reserve Bank holding them. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 122. Commercial banks increase the supply of money when they purchase either personal IOU's or government bonds from businesses and households. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 123. Balance sheets always balance because reserves must always equal liabilities plus net worth Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 124. When commercial banks retire outstanding loans, the supply of money is increased. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 125. Commercial banks monetize claims when they sell securities to Federal Reserve Banks. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 126. Actual reserves equal required reserves plus excess reserves. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 127. The banking system can lend by a multiple of its excess reserves because lending does not result in a loss of reserves to the banking system as a whole. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 128. The monetary multiplier and the income multiplier are two ways of referring to the same concept. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 129. In an uncontrolled or unregulated system commercial bank lending will tend to intensify the business cycle. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 130. Loans made to customers are a liability on a bank's balance sheet. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 131. Checkable deposits are a liability on a bank's balance sheet. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 132. An individual bank can safely lend out a multiple of its excess reserves, but the banking system can safely lend out only an amount equal to the excess reserves in the banking system. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 133. If the reserve requirement is 10 percent, the monetary multiplier will be 10. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 134. If the reserve requirement is 20 percent, the monetary multiplier will be 4. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 135. The higher the reserve requirement, the lower is the monetary multiplier. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 136. Federal deposit insurance discourages but does not prevent bank runs. Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: Testbank 02 - Chapter 15 Money Creation Your response has been submitted successfully. -------------------------------------------------------------------------------Points Awarded 0 Points Missed 135 Percentage 0% 1. The fractional reserve system of banking started when goldsmiths began: A. Accepting deposits of gold for safe storage B. Charging people who deposited their gold C. Using deposited gold to produce products sale for to others D. Issuing paper receipts in excess of the amount of gold held Points Earned: 0/1 Correct Register to View AnswerYour Response: 2. What is one significant characteristic of fractional reserve banking? A. Banks are vulnerable to "panics" or "runs." B. Banks can only lend an amount equal to its checkable deposits C. Gold serves as the basis for determining the stability of banks D. Government regulation of banks is not needed because there is deposit insurance Points Earned: 0/1 Correct Register to View AnswerYour Response: 3. What is one significant characteristic of fractional reserve banking? A. Banks are not subject to "panics" or "runs." B. Banks use deposit insurance for loans to customers C. Bank loans will be equal to the amount of gold on deposit D. Banks can create money through lending their reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 4. Bank net worth is the: A. Measure of the profitability of the bank B. Value of the bank's vault cash and loan portfolio C. Claims of the owners of the bank against bank assets D. Claims of the nonowners of the bank against bank assets Points Earned: 0/1 Correct Register to View AnswerYour Response: 5. A bank owns a 10-story office building. In the bank's balance sheet, this would be an example of: A. An asset B. A liability C. Capital stock D. A checkable deposit Points Earned: 0/1 Correct Register to View AnswerYour Response: 6. A bank has $2 million in checkable deposits. In the bank's balance sheet, this would be an example of: A. An asset B. A liability C. Net worth D. Capital stock Points Earned: 0/1 Correct Register to View AnswerYour Response: 7. The claims of no owners of a bank against the bank's assets are called: A. Loans B. Net worth C. Liabilities D. Required reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 8. Which are liabilities to a bank? A. Capital stock and reserves B. Property and capital stock C. Vault cash and demand deposits D. Capital stock and demand deposits Points Earned: 0/1 Correct Register to View AnswerYour Response: 9. A checkable deposit at a commercial bank is a(n): A. Asset to the bank B. Liability to the bank C. Liability to the depositor D. Asset to the Federal Reserve Points Earned: 0/1 Correct Register to View AnswerYour Response: 10. A checkable deposit at a commercial bank is a(n): A. Liability to the depositor and an asset to the bank B. Liability to both the depositor and the bank C. Asset to the depositor and a liability to the bank D. Asset to both the depositor and the bank Points Earned: 0/1 Correct Register to View AnswerYour Response: 11. Cash held by a bank is sometimes called: A. Token money B. Legal tender C. Vault cash D. Fractional reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 12. When a bank sells capital stock (equity shares) in return for cash: A. The capital stock is an asset and the cash is a liability B. The capital stock is a liability and the cash is an asset C. The capital stock is part of the net worth of the bank and the cash is a liability D. The capital stock is part of the net worth of the bank and the cash is an asset Points Earned: 0/1 Correct Register to View AnswerYour Response: 13. When cash is deposited in a checkable-deposit account in a commercial bank, there is: A. A decrease in the money supply B. An increase in the money supply C. A decrease in checkable deposits D. An increase in checkable deposits Points Earned: 0/1 Correct Register to View AnswerYour Response: 14. When cash is deposited in a checkable-deposit account in a commercial bank: A. The money supply increases B. The money supply decreases C. The composition of the money supply changes D. The composition of the money supply does not change Points Earned: 0/1 Correct Register to View AnswerYour Response: 15. Legal reserve requirements: A. Give commercial banks more legal control over the money supply B. Limit "windfall" profits in the commercial banking system C. Permit the Federal Reserve System to control the lending capacity of banks D. Provide the FDIC with the power to protect deposits at commercial banks and thrifts Points Earned: 0/1 Correct Register to View AnswerYour Response: 16. The above table specifies the: A. Monetary multipliers for the economy B. Reserve requirements of depository institutions C. Vault cash or till money requirements of depository institutions D. Checkable deposits requirements as a percentage of assets and liabilities for depository institutions Points Earned: 0/1 Correct Register to View AnswerYour Response: 17. Refer to the above table. The current reserve requirement for the first $42.8 million in checkable deposits at depository institutions is: A. 3 percent B. 8 percent C. 12 percent D. 16 percent Points Earned: 0/1 Correct Register to View AnswerYour Response: 18. The reserve ratio is equal to: A. A commercial bank's checkable-deposit liabilities divided by its required reserves B. A commercial bank's required reserves divided by its checkable-deposit liabilities C. A commercial bank's checkable-deposit liabilities multiplied by its excess reserves D. A commercial bank's excess reserves divided by its required reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 19. A commercial bank's required reserves can be calculated by: A. Dividing its excess reserves by its required reserves B. Dividing its required reserves by its excess reserves C. Multiplying its checkable-deposit liabilities by the reserve ratio D. Multiplying its checkable-deposit liabilities by its excess reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 20. A commercial bank has actual reserves of $50,000 and checkable deposits of $200,000, and the required reserve ratio is 20%. The excess reserves of the bank are: A. $10,000 B. $20,000 C. $40,000 D. $50,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 21. A commercial bank's checkable-deposit liabilities can be calculated by: A. Dividing its required reserves by its excess reserves B. Dividing its required reserves by the reserve ratio C. Multiplying its required reserves by its excess reserves D. Multiplying its required reserves by the reserve ratio Points Earned: 0/1 Correct Register to View AnswerYour Response: 22. A commercial bank has required reserves of $6,000 and the reserve ratio is 20 percent. What are the commercial bank's checkable-deposit liabilities? A. $1,200 B. $9,000 C. $30,000 D. $120,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 23. A commercial bank has checkable-deposit liabilities of $50,000 and a reserve ratio of 20 percent. What is the amount of required reserves? A. $10,000 B. $50,000 C. $250,000 D. $1 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 24. A commercial bank has actual reserves of $1 million and checkable-deposit liabilities of $9 million, and the required reserve ratio is 10 percent. The excess reserves of the bank are: A. $50,000 B. $100,000 C. $900,000 D. $1 million Points Earned: 0/1 Correct Register to View Answer Your Response: 25. A bank is in the position to make loans when required reserves: A. Equal actual reserves B. Equal excess reserves C. Are less than actual reserves D. Are greater than actual reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 26. Sharon sells a government security worth $4,600,000 to the Federal Reserve Bank of Kansas City. She deposits these funds in her checking account to the First Commerce Bank. Her checking account had a $150,000 balance before the sale of the security. The reserves of the First Commerce Bank would: A. Increase by $4,750,000 B. Increase by $4,600,000 C. Decrease by $4,600,000 D. Decrease by $4,450,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 27. An individual deposits $12,000 in a commercial bank. The bank is required to hold 10 percent of all deposits on reserve at the regional Federal Reserve Bank. The deposit increases the loan capacity of the bank by: A. $11,000 B. $10,800 C. $9,600 D. $6,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 28. A bank originally had $40 million in checkable deposits but now has $33 million in checkable deposits. What is the approximate amount of money that must be kept on deposit at the Federal Reserve Bank? A. $0.8 million B. $1.0 million C. $1.2 million D. $1.8 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 29. A bank has checkable deposits of $150 million. Approximately what amount of money must be kept on deposit at the Federal Reserve Bank? A. $5 million B. $12 million C. $18 million D. $25 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 30. A bank has checkable deposits of $100 million and noncheckable time deposits of $300 million. About how much required reserves will this bank need to keep on deposit at the Federal Reserve Bank? A. $4 million B. $7 million C. $21 million D. $24 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 31. Assume that the required reserve ratio is 25 percent. If a commercial bank has $2 million cash in its vault, $1 million in short-term government securities, $3 million on deposit at a Federal Reserve Bank, and $6 million in checkable deposits, its total reserves equal: A. $3 million B. $4 million C. $5 million D. $8 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 32. A bank has excess reserves of $5,000 and deposit liabilities of $50,000 when the required reserve ratio is 20 percent. If the reserve ratio is raised to 25 percent, this bank can lend a maximum of: A. $1,000 B. $1,500 C. $2,000 D. $2,500 Points Earned: 0/1 Correct Register to View AnswerYour Response: 33. Suppose the Northwestern Bank has excess reserves of $12,000 and outstanding checkable deposits of $125,000. If the reserve requirement is 20 percent, what are the bank's actual reserves? A. $25,000 B. $37,000 C. $44,000 D. $47,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 34. Henry Trudeau deposits $2,000 in currency in the First Street Bank. Later that same day Jane Harris negotiates a loan for $5,400 at the same bank. After these transactions, the supply of money has: A. Increased by $2,100 B. Increased by $3,300 C. Increased by $5,400 D. Decreased by $3,300 Points Earned: 0/1 Correct Register to View AnswerYour Response: 35. Which of the following is correct? A. When borrowers repay bank loans, the money supply is increased B. When borrowers take out bank loans, the money supply is decreased C. A single commercial bank can legally lend an amount greater than its excess reserves D. The actual reserves of a commercial bank equal its excess reserves plus its required reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 36. Assume that Johnson deposits $350 of currency in his account in the XYZ bank. Later the same day Swanson negotiates a loan for $2,000 at the same bank. In what direction and by what amounts has the supply of money changed? A. Increased by $2,350 B. Increased by $2,000 C. Decreased by $350 D. Decreased by $1,650 Points Earned: 0/1 Correct Register to View AnswerYour Response: 37. When a check is cleared against a bank, it will lose: A. Cash and securities B. Checkable deposits and reserves C. Reserves and capital stock D. Loans and demand deposits Points Earned: 0/1 Correct Register to View AnswerYour Response: 38. Other things being equal, an expansion of commercial bank lending: A. Changes the composition, but not the size, of the money supply B. Is desirable during a period of demand-pull inflation C. Reduces the money supply D. Increases the money supply Points Earned: 0/1 Correct Register to View AnswerYour Response: 39. The primary reason commercial banks must keep required reserves on deposit at Federal Reserve Banks is to: A. Add to the liquidity of the commercial bank B. Allow the Fed to control the amount of bank lending C. Protect the deposits in the commercial bank against losses D. Provide the means by which checks drawn on a commercial bank and deposited in other commercial banks can be collected Points Earned: 0/1 Correct Register to View AnswerYour Response: 40. The primary reason commercial banks must keep required reserves on deposit at Federal Reserve Banks is to: A. Enhance the liquidity of banks B. Protect bank depositors from losses C. Make the Fed the largest stockholder of banks D. Give the Fed control over the lending ability of banks Points Earned: 0/1 Correct Register to View AnswerYour Response: 41. A depositor places $5,000 in cash in a commercial bank, and the reserve ratio is 20 percent; the bank sends the $5,000 to the Federal Reserve Bank. As a result, the reserves and excess reserves of the bank have been increased, respectively, by: A. $5,000 and $1,000 B. $5,000 and $4,000 C. $5,000 and $5,000 D. $4,000 and $4,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 42. A depositor places $10,000 in cash in a commercial bank, and the reserve ratio is 10 percent. The bank sends the $10,000 to its Federal Reserve Bank. As a result, the actual reserves, the required reserves, and excess reserves of the bank have been increased, respectively, by: A. $10,000, $9000, and $1000 B. $10,000, $500, and $4500 C. $10,000, $1000, and $9000 D. $1000, $10,000, and $9000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 43. A commercial bank has no excess reserves until a depositor places $5000 in cash in the bank. The bank then adds the $5000 to its reserves by sending it to the Federal Reserve Bank. The commercial bank then lends $4000 to a borrower. As a consequence of these transactions the size of the money supply has: A. Not been affected B. Increased by $4000 C. Increased by $5000 D. Decreased by $5000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 44. A commercial bank has excess reserves of $5000 and a required reserve ratio of 20 percent. It makes a loan of $6000 to a borrower. The borrower writes a check for $6000 that is deposited in another commercial bank. After the check clears, the first bank will be short of reserves in the amount of: A. $1000 B. $1200 C. $5000 D. $6000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 45. A commercial bank has no excess reserves until a depositor places $2,000 in cash in the bank. The bank then adds the $2,000 to its reserves by sending it to the Federal Reserve Bank. The commercial bank then lends $1,500 to a borrower. As a consequence of these transactions the size of the money supply has: A. Not been affected B. Increased by $1,500 C. Increased by $2,000 D. Increased by $4,500 Points Earned: 0/1 Correct Register to View AnswerYour Response: 46. A commercial bank has excess reserves of $10,000 and a required reserve ratio of 20%; it grants a loan of $13,000 to a borrower. If the borrower writes a check for $13,000 that is deposited in another commercial bank, the first bank will be short of reserves, after the check has been cleared, in the amount of: A. $2,000 B. $3,000 C. $10,000 D. $12,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 47. A commercial bank buys a $50,000 government security from a securities dealer. The bank gives the dealer an increase in its checkable deposits of $50,000. The money supply has: A. Not been affected B. Decreased by $50,000 C. Increased by $50,000 D. Increased by $50,000 multiplied by the reciprocal of the required reserve ratio Points Earned: 0/1 Correct Register to View AnswerYour Response: 48. Answer the next question(s) on the basis of the following figures for a single commercial bank which you are to arrange on the balance sheet. All figures are in thousands of dollars Refer to the above data. This bank has liabilities and net worth of: A. $400 million B. $440 million C. $550 million D. $580 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 49. Answer the next question(s) on the basis of the following figures for a single commercial bank which you are to arrange on the balance sheet. All figures are in thousands of dollars Refer to the above data. This bank has assets of: A. $340 million B. $440 million C. $520 million D. $580 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 50. Answer the next question(s) on the basis of the following figures for a single commercial bank which you are to arrange on the balance sheet. All figures are in thousands of dollars Refer to the above data. If the required reserve ratio is 10 percent, the bank has excess reserves of: A. $28,000 B. $22,000 C. $18,000 D. $16,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 51. Answer the next question(s) on the basis of the following figures for a single commercial bank which you are to arrange on the balance sheet. All figures are in thousands of dollars Refer to the above data. If the reserve ratio is 10 percent and a check for $10,000 is drawn and cleared in favor of another bank, it can be concluded that excess reserves will be: A. $8,000 B. $12,000 C. $13,000 D. $18,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 52. The relative importance of various asset items on a commercial bank's balance sheet reflects a bank's pursuit of which two conflicting goals? A. Profits and risk B. Liquidity and profits C. Assets and liabilities D. Buying and selling government securities Points Earned: 0/1 Correct Register to View AnswerYour Response: 53. When commercial banks and thrift institutions make loans, they: A. Buy government securities from the Federal Reserve B. Sell government securities to the Federal Reserve C. Monetize the credit extended to borrowers D. Decrease their balance-sheet liabilities Points Earned: 0/1 Correct Register to View AnswerYour Response: 54. If you deposit $1,200 in a commercial bank which has an 18 percent reserve requirement, the bank will have increased: A. Required reserves by $216 B. Excess reserves by $900 C. Excess reserves by $1,200 D. Required reserves by $1,200 Points Earned: 0/1 Correct Register to View AnswerYour Response: 55. Assume that the required reserve ratio is 20 percent. A business deposits a $50,000 check drawn on another bank at its own bank. What is the additional amount that must be added to required reserves on deposit at the Federal Reserve Bank by the business' bank? A. $5,000 B. $10,000 C. $20,000 D. $50,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 56. The Norfolk Bank has $18,000 in excess reserves and the reserve ratio is 20 percent. Which level of checkable deposits and reserves might this bank hold? A. $160,000 in checkable-deposit liabilities and $47,000 in reserves B. $140,000 in checkable-deposit liabilities and $46,000 in reserves C. $120,000 in checkable-deposit liabilities and $32,000 in reserves D. $100,000 in checkable-deposit liabilities and $30,000 in reserves Points Earned: 0/1 Correct Register to View AnswerYour Response: 57. A single commercial bank must meet a 25 percent reserve requirement. If it initially has no excess reserves and then $2,000 in cash is deposited in the bank, it can increase its loans by a maximum of: A. $2,000 B. $1,500 C. $1,250 D. $1,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 58. If the reserve ratio is 25 percent, what level of excess reserves does a bank acquire when a business deposits a $12,000 check drawn on another bank? A. $3,000 B. $6,000 C. $9,000 D. $12,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 59. Assume a commercial bank has excess reserves of $5,000 and can make new loans of $35,000 and just meet its legal reserve requirements. The required reserve ratio must be about: A. 7 percent B. 14 percent C. 20 percent D. 26 percent Points Earned: 0/1 Correct Register to View AnswerYour Response: 60. In an unregulated environment, the commercial banking system would tend to vary the supply of money in a way that: A. Increased the money supply to the maximum at all times B. Decreased the money supply to the minimum at all times C. Emphasized the use of currency over demand deposits D. Reinforced cyclical variations in the economy Points Earned: 0/1 Correct Register to View AnswerYour Response: 61. The basic purpose of imposing legal reserve requirements on commercial banks is to: A. Assure the liquidity of commercial banks B. Provide a device through which the credit-creating activities of banks can be controlled C. Provide a proper ratio between earning and no earning bank assets D. Provide the central banks with necessary working capital Points Earned: 0/1 Correct Register to View AnswerYour Response: 62. Lending temporary excess reserves held at the Federal Reserve Banks is a way that banks can partly reconcile the conflicting goals of: A. Stocks and flows B. Inputs and outputs C. Profit and liquidity D. Expansion and contraction Points Earned: 0/1 Correct Register to View AnswerYour Response: 63. A bank borrows money from another bank on an overnight basis to meet reserve requirements. This money would be borrowed in the: A. Stock market B. Bond market C. Federal funds market D. U.S. Treasury bill market Points Earned: 0/1 Correct Register to View AnswerYour Response: 64. In the Federal funds market, a bank that needs to meet reserve requirements will borrow the money from another bank: A. Overnight B. Over a week C. For a month D. For six months Points Earned: 0/1 Correct Register to View AnswerYour Response: 65. The fact that reserves lost by any particular bank will be gained by some other bank explains why the commercial banking system: A. Has been able to reduce the vulnerability of banks to "runs" or "panics." B. Can increase its demand deposits by a multiple of its excess reserves C. Can decrease its demand deposits by a multiple of its excess reserves D. Has been based on the fractional reserve system of banking Points Earned: 0/1 Correct Register to View AnswerYour Response: 66. The commercial banking system can lend by a multiple of its excess reserves primarily because: A. Its reserves are on deposit with the Federal Reserve Banks B. Its reserves are highly liquid assets C. It loses reserves when it extends credit D. Its reserves are fractional Points Earned: 0/1 Correct Register to View AnswerYour Response: 67. Assume the required reserve ratio is 16.67 percent and that the commercial banking system has $110 million in excess reserves. The maximum amount of money which the banking system could create is: A. $110 million B. $330 million C. $660 million D. $1,353 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 68. If the required reserve ratio is 20 percent and commercial bankers decide to hold additional excess reserves equal to 5 percent of any newly acquired checkable deposits, then the effective monetary multiplier for the banking system will be: A. 3 B. 4 C. 5 D. 6 Points Earned: 0/1 Correct Register to View AnswerYour Response: 69. Maximum checkable-deposit expansion is equal to: A. Actual reserves minus excess reserves B. Assets plus net worth and liabilities C. Excess reserves times the monetary multiplier D. Excess reserves divided by the monetary multiplier Points Earned: 0/1 Correct Register to View AnswerYour Response: 70. The multiple by which the commercial banking system can expand the supply of money is equal to: A. Its excess reserves B. The reciprocal of the discount rate C. The reciprocal of the reserve ratio D. The ratio of fixed to liquid assets Points Earned: 0/1 Correct Register to View AnswerYour Response: 71. Assume that the legally required reserve is 15 percent and commercial banks choose to hold additional excess reserves equal to 5 percent of any newly acquired deposits. Under these circumstances the monetary multiplier for the commercial banking system is: A. 6.67 B. 5 C. 4 D. 3 Points Earned: 0/1 Correct Register to View AnswerYour Response: 72. If commercial banks decide to hold more excess reserves, this would: A. Decrease the maximum checkable-deposit creation of the banking system B. Increase the lending potential of the banking system C. Increase checkable deposits held by the banking system D. Decrease the reserve ratio of the banking system Points Earned: 0/1 Correct Register to View AnswerYour Response: 73. A commercial bank has checkable-deposit liabilities of $500,000, reserves of $150,000, and a required reserve ratio of 20 percent. The amount by which a single commercial bank and the amount by which the banking system can increase loans are respectively: A. $30,000 and $150,000 B. $50,000 and $250,000 C. $50,000 and $500,000 D. $100,000 and $500,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 74. If the required reserve ratio were 15 percent, the value of the monetary multiplier would be: A. 5.50 B. 6.67 C. 7.32 D. 8.54 Points Earned: 0/1 Correct Register to View AnswerYour Response: 75. The commercial banking system has excess reserves of $200,000, makes new loans of $800,000, and is just meeting its reserve requirements. The required reserve ratio is: A. 10 percent B. 20 percent C. 25 percent D. 30 percent Points Earned: 0/1 Correct Register to View AnswerYour Response: 76. The commercial banking system, because of a recent change in the required reserve ratio from 8 percent to 10 percent, finds that it is $50 million short of reserves. If it is unable to obtain any additional reserves, it must: A. Increase the money supply by $500 million B. Decrease the money supply by $400 million C. Decrease the money supply by $500 million D. Decrease the money supply by $50 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 77. Only one commercial bank in the banking system has an excess reserve, and its excess reserve is $400,000. This bank makes a new loan of $300,000 and keeps an excess reserve of $100,000. If the required reserve ratio for all banks is 12.5 percent, the potential expansion of the money supply from this $300,000 loan is: A. $37,500 B. $300,000 C. $2.4 million D. $3.2 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 78. When bankers hold excess reserves: A. The size of the monetary multiplier increases B. The money-creating potential of the banking system increases C. The money-creating potential of the banking system decreases D. There is no change in the money-creating potential of the banking system Points Earned: 0/1 Correct Register to View AnswerYour Response: 79. A commercial bank has checkable deposit liabilities of $400,000, reserves of $150,000, and a required reserve ratio of 25%. The amount by which a single commercial bank and the amount by which the banking system can increase loans are, respectively: A. $50,000 and $100,000 B. $50,000 and $150,000 C. $50,000 and $200,000 D. $150,000 and $200,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 80. Only one commercial bank in the banking system has an excess reserve, and its excess reserve is $500,000. This bank makes a new loan of $400,000 and keeps an excess reserve of $100,000. If the required reserve ratio for all banks is 20%, the potential expansion of the money supply from this $400,000 loan is: A. $500,000 B. $900,000 C. $2,000,000 D. $3,000,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 81. When loans are repaid at commercial banks: A. Money is created B. Money is destroyed C. The assets of commercial banks increase D. The net worth of commercial banks increases Points Earned: 0/1 Correct Register to View AnswerYour Response: 82. When required reserves exceed actual reserves, commercial banks will be forced to have borrowers: A. Use credit cards B. Use fiat money C. Repay loans D. Take out loans Points Earned: 0/1 Correct Register to View AnswerYour Response: 83. A commercial bank sells a $10,000 government bond to a securities dealer. The dealer pays for the bond in cash, which the bank adds to its vault cash. The money supply has: A. Decreased by $10,000 multiplied by the reciprocal of the required reserve ratio B. Decreased by $10,000 C. Increased by $10,000 D. Not been affected Points Earned: 0/1 Correct Register to View AnswerYour Response: 84. If the Federal Reserve System sells $5 billion of government securities to the commercial banking system, the deposit reserves of commercial banks would: A. Increase by $5 billion B. Decrease by $5 billion C. Be added to net worth D. Remain the same Points Earned: 0/1 Correct Register to View AnswerYour Response: 85. Answer the next question(s) based on the following balance sheet for the First National Bank. Assume the reserve ratio is 15 percent Refer to the above data. This commercial bank has excess reserves of: A. $15,000 B. $18,000 C. $27,000 D. $32,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 86. Answer the next question(s) based on the following balance sheet for the First National Bank. Assume the reserve ratio is 15 percent Refer to the above data. This bank can make new loans of up to: A. $50,000 B. $41,000 C. $32,000 D. $27,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 87. Answer the next question(s) based on the following balance sheet for the First National Bank. Assume the reserve ratio is 15 percent Refer to the above data. If a check for $14,000 is drawn and cleared against this bank, its reserves and checkable deposits will be, respectively: A. $50,000 and $120,000 B. $50,000 and $106,000 C. $36,000 and $120,000 D. $36,000 and $106,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 88. Answer the next question(s) based on the following balance sheet for the First National Bank. Assume the reserve ratio is 15 percent Refer to the above data. If a check for $20,000 is drawn and cleared against this bank, it will have excess reserves of: A. $15,000 B. $20,000 C. $25,000 D. $30,000 Points Earned: 0/1 Correct Register to View Answer Your Response: 89. Answer the next question(s) based on the following balance sheet for the First National Bank. Assume the reserve ratio is 15 percent Refer to the above data. If the original balance sheet was for the commercial banking system, rather than a single bank, loans and deposits could have been expanded by a maximum of approximately: A. $120,000 B. $213,333 C. $333,500 D. $415,373 Points Earned: 0/1 Correct Register to View AnswerYour Response: 90. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 12 percent. All figures are in billions of dollars Refer to the above data. The commercial banking system has excess reserves of: A. $32 billion B. $36 billion C. $42 billion D. $60 billion Points Earned: 0/1 Correct Register to View AnswerYour Response: 91. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 12 percent. All figures are in billions of dollars Refer to the above data. The maximum amount by which the commercial banking system can expand the supply of money by lending is: A. $250 billion B. $350 billion C. $450 billion D. $600 billion Points Earned: 0/1 Correct Register to View AnswerYour Response: 92. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 12 percent. All figures are in billions of dollars Refer to the above data. If the commercial banking system actually loans the maximum amount it is able to lend, excess reserves will fall: A. By $28 billion B. By $22 billion C. By $20 billion D. To zero Points Earned: 0/1 Correct Register to View AnswerYour Response: 93. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 12 percent. All figures are in billions of dollars Refer to the above data. The claims of owners in the commercial banking system are equal to: A. $60 billion B. $100 billion C. $135 billion D. $150 billion Points Earned: 0/1 Correct Register to View AnswerYour Response: 94. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 12 percent. All figures are in billions of dollars Refer to the above data. If commercial bankers decide to hold additional excess reserves equal to 7 percent of any newly acquired checkable deposits, then the relevant monetary multiplier for this banking system will be: A. 8.33 B. 6.66 C. 5.26 D. 4.76 Points Earned: 0/1 Correct Register to View AnswerYour Response: 95. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 30 percent. All figures are in millions of dollars Refer to the above data. There are excess reserves in this commercial bank system of: A. $10 million B. $20 million C. $30 million D. $180 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 96. Answer the next question(s) based on the following consolidated balance sheet for the commercial banking system. Assume the required reserve ratio is 30 percent. All figures are in millions of dollars Refer to the above data. The commercial banking system can expand the supply of money by a maximum of: A. $23.5 million B. $36.5 million C. $51.9 million D. $66.6 million Points Earned: 0/1 Correct Register to View AnswerYour Response: 97. Suppose a commercial banking system has $240,000 of outstanding checkable deposits and actual reserves of $85,000. If the reserve ratio is 25 percent, the banking system can expand the supply of money by a maximum of: A. $75,000 B. $25,000 C. $5,000 D. $100,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 98. Use the following balance sheet for the First Federal Bank. Assume the required reserve ratio is 20 percent Refer to the above information. This commercial bank has required reserves of: A. $40,000 B. $60,000 C. $100,000 D. $200,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 99. Use the following balance sheet for the First Federal Bank. Assume the required reserve ratio is 20 percent Refer to the above information. This bank can safely expand its loans by a maximum of: A. $20,000 B. $40,000 C. $100,000 D. $200,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 100. Use the following balance sheet for the First Federal Bank. Assume the required reserve ratio is 20 percent Refer to the above information. The monetary multiplier is: A. 3.00 B. 4.00 C. 5.00 D. 6.67 Points Earned: 0/1 Correct Register to View AnswerYour Response: 101. Use the following balance sheet for the First Federal Bank. Assume the required reserve ratio is 20 percent Refer to the above information. Using the original bank balance sheet, assume that the bank makes a loan of $20,000 and has a check cleared against it for the amount of the loan. The bank's reserves and checkable deposits will now be: A. $100,000 and $100,000 B. $100,000 and $200,000 C. $80,000 and $300,000 D. $80,000 and $100,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 102. Use the following balance sheet for the First Federal Bank. Assume the required reserve ratio is 20 percent Refer to the above information. Using the original bank balance sheet, assume that the bank makes a loan of $30,000 and has a check cleared against it for the amount of the loan. The bank will then have excess reserves of: A. $10,000 B. $20,000 C. $30,000 D. $40,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 103. Use the following balance sheet for the First Federal Bank. Assume the required reserve ratio is 20 percent Refer to the above information. If the original bank balance sheet was for the commercial banking system, rather than a single bank, loans and deposits could have been expanded by a maximum of: A. $40,000 B. $100,000 C. $200,000 D. $300,000 Points Earned: 0/1 Correct Register to View AnswerYour Response: 104. Answer questions 104-107 on the basis of the following consolidated balance sheet for the commercial banking system. All figures are in billions. Assume that the required reserve ratio is 10 percent Refer to the above information. The amount of excess reserves is: A. $20 billion B. $90 billion C. $120 billion D. $600 billion Points Earned: 0/1 Correct Register to View Answer Your Response: 105. Answer questions 104-107 on the basis of the following consolidated balance sheet for the commercial banking system. All figures are in billions. Assume that the required reserve ratio is 10 percent Refer to the above information. The monetary multiplier: A. 4 B. 5 C. 8 D. 10 Points Earned: 0/1 Correct Register to View AnswerYour Response: 106. Answer questions 104-107 on the basis of the following consolidated balance sheet for the commercial banking system. All figures are in billions. Assume that the required reserve ratio is 10 percent Refer to the above information. The maximum amount by which this commercial banking system can expand the supply of money by lending is: A. $120 billion B. $300 billion C. $480 billion D. $600 billion Points Earned: 0/1 Correct Register to View AnswerYour Response: 107. Answer questions 104-107 on the basis of the following consolidated balance sheet for the commercial banking system. All figures are in billions. Assume that the required reserve ratio is 10 percent Refer to the above information. If there is a deposit of $10 billion of new currency into checking accounts in the banking system, excess reserves will increase by: A. $1 billion B. $2 billion C. $9 billion D. $10 billion Points Earned: 0/1 Correct Register to View AnswerYour Response: 108. The establishment of a federally insured deposit program resulted from the: A. Establishment of the Federal Reserve System in 1913 B. Speculation during World War I C. Stock market crash of 1929 D. Bank panics of 1930-1933 Points Earned: 0/1 Correct Register to View AnswerYour Response: 109. Assume that the reserve ratio is 20 percent and banks were loaning out all their excess reserve. If people collectively cash out $10 billion from their checking accounts, then the loaning ability of commercial banks has been: A. Increased by $10 billion B. Decreased by $10 billion C. Decreased by $40 billion D. Decreased by $50 billion Points Earned: 0/1 Correct Register to View AnswerYour Response: 110. During the bank panics of 1930-1933 the money supply had decreased by: A. 5 percent B. 15 percent C. 25 percent D. 50 percent Points Earned: 0/1 Correct Register to View AnswerYour Response: 111. Which factors contributed to a further reduction in the money supply in addition to the withdrawal of currency from banks during the 1930-1933 bank panic? A. Bank purchases of government bonds to meet liquidity demands B. Bank sales of government bonds to meet liquidity demands C. An increase in the required reserve ratio D. A decrease in the required reserve ratio Points Earned: 0/1 Correct Register to View AnswerYour Response: 112. The claims of the owners of a firm against the firm's assets are called net worth Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 113. Modern banking systems are based on a fractional reserve system of banking Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 114. When a bank accepts deposits of cash, the composition of the money supply is changed but the total supply of money is not directly altered Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 115. The legal reserve is an amount of funds equal to a specified percentage of its own deposit liabilities which a member bank must keep on deposit with the Federal Reserve Bank in its district or as vault cash Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 116. The primary purpose of the legal reserve requirement is to provide the means by which the monetary authorities can influence the lending ability of commercial banks Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 117. Excess reserves are equal to actual reserves minus required reserves Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 118. A check is drawn against Bank A and deposited in Bank B. The collection of that check will increase both the reserves and checkable deposits of Bank A Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View Answer Your Response: 119. A check for $10,000 drawn on Bank A by a depositor and deposited in Bank B will increase the excess reserves in Bank B by $10,000 Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 120. A bank that has a check drawn and collected against it will lose to the recipient bank both reserves and deposits greater than the value of the check Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 121. The granting of a $10,000 loan and the purchase of a $10,000 government bond from a securities dealer by a commercial bank have the same effect on the money supply Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 122. The buying of a government bond by a commercial bank will increase the money supply Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 123. Commercial banks create money in the form of checkable deposits when they make loans Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 124. Commercial bank bond purchases from the public increase the supply of money in the same way as does lending to the public Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 125. The main goal of a commercial bank is liquidity Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 126. The Federal funds rate is the interest rate at which the Federal government lends funds to commercial banks Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 127. A single bank in a multi-bank system can safely lend and create money by an amount equal to its excess reserves; the banking system can lend and create money by a multiple of its excess reserves Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 128. The monetary multiplier is the reciprocal of the excess reserve ratio Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 129. Maximum checkable-deposit expansion is equal to the amount of actual reserves multiplied by the monetary multiplier Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 130. The monetary multiplier is excess reserves multiplied by required reserves Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 131. If the banking system has $20 billion in excess reserves and if the reserve ratio is 10 percent, the system can increase its loans by $20 billion Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 132. If a commercial banking system has $200,000 of outstanding checkable deposits and actual reserves of $70,000, then with a reserve ratio of 20 percent the banking system can expand the supply of money by a maximum of $180,000 Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 133. Given a monetary multiplier, if the amount of excess reserves increases, then the maximum checkable-deposit capacity of the banking system will decrease Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 134. When a borrower repays a loan of $4000, either in cash or by check, the supply of money is reduced by $4000 Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response: 135. Commercial banks create money--that is, checkable deposits, or bank money--when they retire loans Answer Correct Feedback: correct Incorrect Feedback: incorrect Points Earned: 0/1 Correct Register to View AnswerYour Response:

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

Union - MAT - 111
emical present at any time. b. If the amount of chemical exceeds 0.10 mg/dL, the animal will die. When will this happen? c. When is the concentration double the initial concentration?4Lecture Section 28 NoneObjective First Order Differen
California State University - CHEMISTRY - 12
the water as you mix it, the lowerlayer is aqueous.1-butanol went through an SN2 reaction by using sodium bromide in water to createhydrobromic acid in the presence of excess sulfuric acid. Thus, water was the leavinggroup and bromide ion was
University of Toronto - SOC - SOC313H1
the three categories, but  type of force/weapon use were important in domestic as well as whether there was a  witness. What explains this ineffective police response1. Police lacked motivation to get involve din 
Livingston High - MODERN WOR - Modern Wor
of day, fromthe same type of water at a similar temperature, and from the same depth.Questions:In a classroom investigation, students filled two bottles with pond water containing onlyphotosynthesizing organisms. They used a dissolved oxygen (DO
Chattahoochee Valley Community College - ECON - 101
Testbank 01 - Chapter 16 Interest Rates and Monetary Policy-1. The transactions demand for money is most closely related to money functioning as a:A. unit of account.B. medium of exchange.C. store of value.D. measure of value.Points Earned: 0/1Corr
Chattahoochee Valley Community College - ECON - 101
Chapter 17 Financial Economics-1. What are the two most important factors influencing investor preferences?A. The desire for high rates of return and the thrill of uncertainty.B. The desire for high rates of return and dislike of risk and uncertainty.
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 1.00Points Missed 69.00Percentage 1.4%1. In China, which of the following would be a resource in the production of rice?A) laborB) capital equipmentC) fertile landD) all of the aboveFeedba
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 80.00Percentage 0%1. A simplified representation that is used to study that real situation is called:A) a model.B) a production possibilities frontier.C) an assumption.D)
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 1.00Points Missed 88.00Percentage 1.1%1. The Kansas market for corn is considered a competitive market. This means there are_ buyers and _ sellers of corn in Kansas.A) many; fewB) few; many
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 81.00Percentage 0%1. A binding price ceiling is designed to:A) keep prices low.B) increase the quality of the good.C) prevent shortages.D) none of the above.Feedback:Lev
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 90.00Percentage 0%1. The only producer of chocolate bunnies in the world, Choco's Bunny Company, recentlyexpanded its production capacity from 1,000 bunnies per day to 2,000
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 80.00Percentage 0%1. In many parts of the United States when Wal-Mart opens a new store, some smaller retailersgo out of business. One of the reasons for this development cou
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 82.00Percentage 0%1. Jacquelyn is a student at a major state university. Which of the following is not an exampleof an explicit cost of her attending college?A) tuitionB) t
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 1.00Points Missed 87.00Percentage 1.1%1. In the short run:A) all inputs are fixed.B) all inputs are variable.C) some inputs are fixed and some inputs are variable.D) all costs are variable.
Chattahoochee Valley Community College - ECON - 101
1. If a Florida strawberry wholesaler is in a perfectly competitive market, that wholesaler willhave a _ share of the market, and consumers will consider her strawberries to be _.Therefore, _ advertising will take place in this market.A) large; standar
Chattahoochee Valley Community College - ECON - 101
1. G. Reecy's Hamburger Joint is a fast-food restaurant that specializes in hamburgers. It usesinputs and factors of production in the production process. Which of the following is a factor ofproduction?A) the raw meat used for the hamburgersB) the ha
Chattahoochee Valley Community College - ECON - 101
1. Market structures are categorized by the following two criteria:A) the number of firms and the size of the firms.B) whether or not products are differentiated and the extent of advertising.C) the number of firms and whether products are differentiat
Chattahoochee Valley Community College - ECON - 101
1. In an oligopoly:A) there are a few sellers.B) there are some barriers to entry.C) firms recognize their interdependence.D) all of the above are true.Feedback:Level: MPage: 364Topic: Prevalence of oligopolyPoints Earned: 0.0/1.0Correct Answer(
Chattahoochee Valley Community College - ECON - 101
1. Which of the following industries is most likely to be monopolistically competitive?A) automobilesB) fresh bagel shopsC) cornD) an electric utilityFeedback:Level: EPage: 389Topic: The meaning of monopolistic competitionPoints Earned: 0.0/1.0C
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 85.00Percentage 0%1. Goods and services purchased from abroad are _, while goods and services soldabroad are _.A) exports; importsB) imports; exportsC) exports; quotasD)
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 76.00Percentage 0%1. A market economy, without any government regulation, will produce:A) too little pollution.B) too much pollution.C) the social optimally quantity of pol
Chattahoochee Valley Community College - ECON - 101
Maximum number of choices allowed is cfw_0.Points Awarded 0.00Points Missed 78.00Percentage 0%1. Which of the following is an example of a nonexcludable good?A) police protectionB) national defenseC) coast-guard servicesD) all of the aboveFeedbac
ASU - GCU - 351
Population Study Guide Exam 3Chapters 9, 10If you do not have the 9th edition, your page numbers will be different. See me (email me) to borrow my bookor ask a classmate if you can check page numbers.Chapter 9 Population & the Environment1. p. 261. W
Strayer - BUSINESS - 6501
Week Three Homework Assignment - Linear RegressionThe personnel director for a local manufacturing firm has received complaints from theemployees in a certain shop regarding what they perceive to be inequities in the annualsalary for employees who have
UNSW - MGMT - 3721
DistributiveSecret WeaponDraft 20 Mar 2013Planning Points WorksheetConcession Plan: Number of steps will vary accordingto circumstances.SELLERTarget PriceResistance PointOpening OfferWhat will SELLER give away to reach an agreementMarketDescri
Acton School of Business - ECONOMICS - egj
Exchange rates and the economy In this lecture we will model the operationof our IS-LM model in an open economywith fixed or floating exchange rates. An open economy has two meanings here: Goods market: trades goods and services Financial market: al
LSU - BIOL - 1001
Quote of the DayScience can only ascertain whatis, but not what should be, andoutside of its domain valuejudgments of all kinds remainnecessary.- Albert Einstein.Next ClassPre-Read Chapter 11Pages 184-206What is Life?What characteristics do you
LSU - BIOL - 1001
BIOL 1001 learning Objectives (Draft II)1) Describe the basic model of DNA Structure, including the directionality of thebackbones.2) Use the basic process of DNA replication to solve replication problems.3) Describe the differences between karyokines
LSU - BIOL - 1001
BIOL 1001 learning Objectives (Draft II)1) Describe the basic model of DNA Structure, including the directionality of thebackbones.2) Use the basic process of DNA replication to solve replication problems.3) Describe the differences between karyokines
LSU - BIOL - 1001
BIOL 1001 learning Objectives (Draft)1) Describe the basic model of DNA Structure, including the directionality ofthe backbones.2) Use the basic process of DNA replication to solve replication problems.3) Describe the differences between karyokinesis
LSU - BIOL - 1001
Quote of the DayThe abdomen, the chest, and thebrain will forever be shut from theintrusion of the wise and humanesurgeon.- Sir John Eric Ericksen, British surgeon,appointed Surgeon- Extraordinary toQueen Victoria 1873Next ClassPre-read Sections
LSU - BIOL - 1001
Quote of the DayScience is what you know.Philosophy is what you don'tknow.- Bertrand Russell (1872-1970)English philosopher,mathematicianNext ClassPre-read Pages sections12.5-12.9Genetics Problems end of Chap.12Figure 11.11Figure 11.11A dipl
LSU - BIOL - 1001
Quote of the DayWho the hell wants to hearactors talk?.- H.M. Warner, Warner Brothers,1927Next ClassNo New ReadingProblems end of Chap. 12Think of an inherited disease thatyou would like to know moreaboutMonohybrid Cross (Flower Color)PPurple
LSU - BIOL - 1001
Quote of the DayThe problem with the gene poolis that there is no lifeguard.- Steven WrightNext ClassPre-Read Sections 10.110.3R/r Y/y X R/r Y/yWhat is the probability of producingan offspring with the genotypeR/- Y/yR/r Y/y A/a X R/r Y/y A/AWh
LSU - BIOL - 1001
Quote of the DayScience is the labor andhandicraft of the mind ..- Francis BaconNext ClassPre-read pages 196-206How is DNA CopiedHow do you makeexact copies?What does thestructure of DNA tellyou about how tocopy it?DNA replication occurs in
LSU - BIOL - 1001
Quote of the DayWhatisascientistafterall?Itisacuriousmanlookingthroughakeyhole,thekeyholeofnature,tryingtoknowwhat'sgoingon.- Jacques Yves CousteauFinal ExamWednesday 12 May12:30-2:30Exam ReviewSunday 6-8pmLocation 103 WilliamsEnergy Transform
LSU - BIOL - 1001
Quote of the DayLouis Pasteur's theory ofgerms is ridiculous fiction.-Pierre Pachet, Professor ofPhysiology at Toulouse,1872.Next ClassPre-Read Chapter 8Next ClassView simulation of transcriptionInstructions in MOODLENext ClassPhenylketonuria
LSU - BIOL - 1001
Quote of the DayThe only thing thatinterferes with my learningis my education.-Albert Einstein1Final ExamWednesday 12 May12:30-2:30Exam Review?Sunday 6-8pm?Location ?Next ClassPre-Read Chapter 7View simulation of translationOne question tha
LSU - BIOL - 1001
Quote of the DayWhoever undertakes to set himself up asjudge in the field of truth and knowledgeis shipwrecked by the laughter of theGods.-Albert EinsteinPick up 1 index card, if youdont already have onePre-Reading for Next ClassPages 58-77Weekl
LSU - BIOL - 1001
BIOL 1001 Section 004Revised Schedule of Topics (30 March-6 May)DateMarch 30Major TopicGeneticsDetailed TopicDNA Structure andReplicationApril 1GeneticsApril 13GeneticsApril 15GeneticsCell Division(Mitosis)Cell Division(Meiosis)Mendelia
LSU - BIOL - 1001
BIOL 1001 student issuesI was absent from class on Thursday 4/22 because I was involved in a car accident onWednesday 4/21. I have a doctor's note from the hospital excusing me from school andI was wondering if there was any way I could make up the qui
LSU - BIOL - 1001
Quote of the DayWhatisascientistafterall?Itisacuriousmanlookingthroughakeyhole,thekeyholeofnature,tryingtoknowwhat'sgoingon.- Jacques Yves CousteauBears have a tissue known as brown fat. Inthese cells the mitochondria have a specialprotein known a
LSU - BIOL - 1001
Quote of the DayIf a bear in Yosemite and a bearfrom Alaska fall into the water,which one dissolves faster?The one in Alaska, because it isPolar- Anonymous.A cell with a cell membrane, DNA,and ribosomes could be:1.2.3.4.procaryoticeucaryotic
LSU - BIOL - 1001
Meiosis FiguresFigure 11.11Figure 11.11
LSU - BIOL - 1001
Quote of the DayThe abdomen, the chest, and thebrain will forever be shut from theintrusion of the wise and humanesurgeon.- Sir John Eric Ericksen, British surgeon,appointed Surgeon- Extraordinary toQueen Victoria 1873Human somatic cells containb
LSU - BIOL - 1001
Quote of the DayScience is what you know.Philosophy is what you don'tknow.- Bertrand Russell (1872-1970)English philosopher,mathematicianA cell in G1 of the cell cycle contains12 chromosomes in homologouspairs. It undergoes Meiosis, duringMetaph
LSU - BIOL - 1001
Quote of the DayWho the hell wants to hearactors talk?.- H.M. Warner, Warner Brothers,1927Next ClassPre-Read Pages 286-304Problems end of Chap. 15An individual with the genotype (A/aB/b C/C D/d) cannot produce whichof the following gametes?1. A
LSU - BIOL - 1001
Quote of the DayThe problem with the gene poolis that there is no lifeguard.- Steven WrightNext ClassPre-Read Sections 10.110.3R/r Y/y X R/r Y/yWhat is the probability of producingan offspring with the genotypeR/- Y/y3/4 X 1/2 = 3/8R/r Y/y A/a
LSU - BIOL - 1001
Quote of the DayScience is the labor andhandicraft of the mind ..- Francis BaconIn a repressible operon the repressorprotein is made in an _shape (form) and _bind tothe operator preventing _?1.2.3.4.Inactive, does not, transcriptionActive, d
LSU - BIOL - 1001
Normal #1#256 GGLAFRVFGGGATTTCTTG/GGTGGCCTGGCCTTCCGAGTCTTMutant #1a#256 GGLAFQVFSmall impact due to single aminoGGGATTTCTTG/GGTGGCCTGGCCTTCCAAGTCTTacid changeMutant #1b#256 GGLAFTerLarge impact due to early terminationGGGATTTCTTG/GGTGGCCTGGCCTT
LSU - BIOL - 1001
Quote of the Day640K ought to be enoughfor anybody.- BillGates, 1981.If you begin with 1 molecule ofAcetyl-CoA how many oxidativelevel ATPs will be produced in amitochondrion with only onehydrogen ion pump in the ETC (nearthe end).1.2.3.4.5
LSU - BIOL - 1001
Quote of the DayLouis Pasteur's theory ofgerms is ridiculous fiction.-Pierre Pachet, Professor ofPhysiology at Toulouse,1872.Leading Strand DNA synthesis wouldoccur in locations?IIIIIIIVOrigin1.2.3.4.5.I and III and IIII and IVII and
LSU - BIOL - 1001
Quote of the DayThe only thing thatinterferes with my learningis my education.-Albert Einstein1The human dystrophin gene contains 2.4million base pairs with 79 exons, while thefinal (mature) mRNA transcribed from thisgene is 14,000 base pairs. Wh
LSU - BIOL - 6147
Energy TransformationsCellular RespirationPhotosynthesisFigure 9.2Cellular RespirationBreakdown glucose release energy thencapture the energy in ATPADP + P + energy -> ATP7.3 kcal/moleGlucose+O2>CO2+H20+energy686kcal/moleWhere and how is most o
LSU - BIOL - 6147
Quote of the Day"This 'telephone' has too manyshortcomings to be seriouslyconsidered as a means ofcommunication. The device isinherently of no value to us."-Western Union internal memo,1876.Which of the following represents theactivation energy o
LSU - BIOL - 6147
Figure 9.20Photosynthesis6CO2 + 12 H2O + Light6O2 + C6H12O6 + 6H2OConvert 2 low energy moleculesinto a high energy moleculeFigure 10.4PhotosynthesisTwo Stage process1) Capture light energy in chemicalenergy (Light Reactions)2) Use the chemical
LSU - BIOL - 6147
Given this pedigree of a alkaptonuria, isit possible that it is dominant? (14.16)1. Yes2. NoA woman with type B blood has child withblood type O which of the following cannot be the father of the child?1. A2. B3. AB4. OA man with red-green colo
LSU - BIOL - 6147
Gene RegulationWhy Regulate?EnergeticsControl1Figure18.22Bacterial OperonPromoterOperatorStructural GenesRegulator produces repressor3RegulatoryGeneStructuralGenesPromoter1RepressorProtein23Protein 1Protein 2Protein 34Repressib
LSU - BIOL - 6147
What sequence of amino acids would thisDNA molecule produce?3ATATTTTACAGGTGACGCCAG5TATAAAATGTCCACTGCGGTC1. Tyr-Lys-Met-Ser-Thr-Ala-Val2. Met-Ser-Thr-Ala-Val3. Arg-Ser-Tyr4. I dont know how to start1What information do youneed to know to answer t
LSU - BIOL - 6147
Chapter 34VertebratesFig. 33-2Calcareaand SiliceaLophotrochozoaBilateriaCommonancestor ofall animalsCnidariaEumetazoaNCESTRALROTISTEcdysozoaDeuterostomiaBasic Animal FeaturesBody Plan/SymmetryTissue layers/germ layersBody Cavity/Coelom
LSU - BIOL - 6147
Basic PhysiologyGas ExchangeCirculationDigestionCell SignalingNervous/Sensory Systems1Gas Exchange What are the requirements for movinggasses into or out of organisms Moist membrane Sufficient surface area Concentration gradient Hemoglobin ox