Discussion_ch02
4 Pages

Discussion_ch02

Course Number: ESM 640, Spring 2013

College/University: American University of...

Word Count: 1660

Rating:

Document Preview

Chopra/Meindl 4/e CHAPTER TWO Discussion Questions 1. How would you characterize the competitive strategy of a high-end department store chain such as Nordstrom? What are the key customer needs that Nordstrom aims to fill? The Nordstrom web site states the following. Over the years, the Nordstrom family of employees built a thriving business on the principles of quality, value, selection, and service. Today,...

Unformatted Document Excerpt
Coursehero >> United Arab Emirates >> American University of Sharjah >> ESM 640

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

4/e CHAPTER Chopra/Meindl TWO Discussion Questions 1. How would you characterize the competitive strategy of a high-end department store chain such as Nordstrom? What are the key customer needs that Nordstrom aims to fill? The Nordstrom web site states the following. Over the years, the Nordstrom family of employees built a thriving business on the principles of quality, value, selection, and service. Today, Nordstrom is one of the nations leading fashion retailers, offering a wide variety of high-quality apparel, shoes, and accessories for men, women, and children at stores across the country. We remain committed to the simple idea our company was founded on, earning our customers trust one at a time. Nordstrom fills customer needs for high quality fashion merchandise and outstanding levels of customer service. Price is no object for the typical Nordstrom shopper. 2. Where would you place the demand faced by Nordstrom on the implied demand uncertainty spectrum? Why? Implied demand uncertainty is demand uncertainty due to the portion of demand that the supply chain is targeting, not the entire demand. A high-end department store chain such as Nordstrom falls on the high end of the implied demand uncertainty scale. The fashion items that Nordstrom stocks have extremely high product margin, high forecast errors and stockout rates, and once the season is over, these items are sold at deep discounts at their Nordstrom Rack outlet stores. 3. What level of responsiveness would be most appropriate for Nordstroms supply chain? What should the supply chain be able to do particularly well? Supply chain responsiveness takes many forms, including the ability to respond to a wide range of quantities, meet short lead times, handle a large variety of products, build innovative products, meet a high service level, and handle supply uncertainty. The Nordstrom supply chain must be highly responsive in the areas of handling highly innovative fashion products, customer response, and service level; they are effective in supplying well-heeled customers with merchandise and their return policy is legendary in the Pacific Northwest. 4. How can Nordstrom expand the scope of the strategic fit across the supply chain? Scope of strategic fit refers to the functions within the firm and stages across the supply chain that devise an integrated strategy with a shared objective. By adopting an intercompany interfunctional scope strategy, Nordstrom will maximize supply chain surplus. Nordstrom can move in this direction by working Chopra/Meindl 4/e with their suppliers as if they are actually owned by Nordstrom. Rather than viewing the supply chain as a zero-sum game of inventory cost minimization and profit maximization, Nordstrom must recognize that spreading the wealth and occasionally taking on more inventory than is optimal for them will result in improved customer service. The intercompany interfunctional scope of strategic fit requires more effort than the other approaches presented in this section; Nordstrom must evaluate all aspects of their supply web. 5. Reconsider the previous four questions for other companies such as Amazon.com, a supermarket chain, and auto manufacturer, and a discount retailer such as WalMart. Amazon.com focuses on cost and flexibility by providing books, music and a host of other household products at low prices. Customers place orders online and expect to receive purchases in a number of days. Customer orders are processed at central warehouses or are drop shipped from suppliers by mail or common carrier. For the most part, the implied demand uncertainty for Amazon.com is low as they cast such a wide net. Amazon.coms supply chain must be responsive in terms of flexibility; they handle an incredibly diverse range of products. Amazon.coms supply chain should be able to provide low prices wide variety and reasonable delivery schedules for its customers. In every link of the supply chain, Amazon.com must function on the cost-responsiveness efficient frontier in order to support its competitive strategy. A supermarket chain focuses on cost and quality, with some specialty chains adding flexibility by carrying a broader range of products that may be targeted towards customers interested in organic products or ethnic cuisine. Implied demand uncertainty for a supermarket chain tends to be low; shoppers are typically repeat customers and have a constant demand level. The supermarket supply chain must be responsive by receiving produce quickly to ensure freshness and have a high service level. Supermarket supply chains tend to be wellestablished and can improve strategic fit by emphasizing speed to maintain freshness, hence perceived quality. Auto manufacturers have extremely complicated supply chains that are increasingly focused on flexibility and lean operations. Implied demand uncertainty for auto manufacturers varies considerably by target market and manufacturer. Automotive supply chains among the big three in the United States have made great progress in the last decade and recognize that they must be responsive from a time and flexibility standpoint. Wal-Marts supply chain is obsessed with cost and is facilitated by a low implied demand uncertainty, their impressive logistics system and their management information systems. Their supply chain is able respond to quickly to fill a wide variety of products to keep merchandise on Wal-Marts shelves. Wal-Marts level of coordination along the supply chain is excellent; it would be difficult to point Chopra/Meindl 4/e out areas where true intercompany interfunctional scope of strategic fit has not been achieved. The sole supply chain criticism that surfaces is an occasional report that suppliers feel as if supply chain surplus is not shared equitably. 6. Give arguments to support the statement that Wal-Mart has achieved very good strategic fit between its competitive and supply chain strategies. The best argument to support the statement that Wal-Mart has achieved very good strategic fit is their success as a company. Competition today is supply chain versus supply chain, not company versus company, so a companys partners in the supply chain often determine the companys success. Wal-Marts strategic focus on cost is evident in their competitive, product development, supply chain, and marketing strategy. Their marketing strategy of advertising every day low prices appeals to consumers and does not disrupt the supply chain by causing surges in demand. Visiting one of their big box stores reveals low-priced merchandise, both national and store brands, stacked from floor to ceiling without elaborate displays or decoration. Wal-Marts logistics and information systems are famous for coordinating their entire supply chain and allowing it to meet customer needs at minimal cost. 7. What are some factors that influence implied uncertainty? How does the implied uncertainty differ between an integrated steel mill that measures lead times in months and requires large orders and a steel service center that promises 24-hour lead times and sells orders of any size? From a customer perspective, implied demand uncertainty increases when the customers range of quantity required increases, lead times decrease, variety of product increases, rate of innovation increases and required service levels increase. We also see high implied uncertainty attributed with high product margins, forecast errors above 40%, stockout rates above 10% and forced seasonend markdowns. On the supply side we see increased supply uncertainty when the supply source has frequent breakdowns, unpredictable and low yields, poor quality, limited supply capacity, and evolving production processes. For the steel mill that requires large orders and has lead times measured in months both the implied demand and supply uncertainty is less due to a better predictable capability and a better defined schedule for production. Due to the increasing number of sizes and the shorter response time associated with the steel service center, implied uncertainty is high. 8. What is the difference in implied uncertainty faced by a convenience store chain such as 7-Eleven, a supermarket chain, and a discount retailer such as Costco? When customers go to a convenience store chain such as 7-Eleven, they go there for the convenience of a nearby store and are not necessarily looking for the lowest price. Implied demand uncertainty would be high as customers are Chopra/Meindl 4/e looking for a variety of products and convenience versus cost and demand levels are hard to predict. A supermarket chain focuses on cost and quality, with some specialty chains adding flexibility by carrying a broader range of products that may be targeted towards customers interested in organic products or ethnic cuisine. Implied demand uncertainty for a supermarket chain tends to be low; shoppers are typically repeat customers and have a constant demand level. The supermarket supply chain must be responsive by receiving produce quickly to ensure freshness and have a high service level. Supermarket supply chains tend to be wellestablished and can improve strategic fit by emphasizing speed to maintain freshness, hence perceived quality. Low price is very important to customers of discount retailers such as Costco. This customer is willing to tolerate less variety and even purchase very large package sizes as long as the price is low. Customer demand can be more predictable and supply side needs are large and fairly stable. 9. What are some problems that can arise when each stage of a supply chain focuses solely on its own profits when making decisions? Identify some actions that can help a retailer and a manufacturer work together to expand the scope of strategic fit. High inventories, poor quality, low customer service, increased returns are just a number of problems that occur when each stage of a supply chain focuses solely on its own profits. The trucking company requires full truck loads for delivery forcing the retailer to carry more inventory than wanted or needed. The supplier offers discounts to their buyers to maximize production but forcing the buyers to purchase in larger quantities than desired. This concept was very prevalent during the 1950s and 1960s as companies to minimize local costs and maximize their own profits. Today, retailers and manufacturers have the opportunity to plan promotions jointly such as Wal-Mart and P&G. They can share sales information to determine customer trends. Joint product development opportunities are being explored throughout the supply chain between retailers, manufacturers and raw material suppliers.

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

University of Maine - SIE - 512
hat:ˆ The mean of Y ( s ) will also be  as long as theweights sum to oneˆE[(Y ( s )  Y ( s )) 2 ] With this constraint we minimize the mean squaredˆerror between values of Y ( s ) and Y(s)is as small as possible27287
Lehman College - BUS 423 - 001
Alabama - SOC - 101
Week 4 & 5: Social ClassWhat is social class?Mainstream view of classSociological theories of classPerrucci & Wysong: Social mobility in the US todayPovertySocial ClassWhy chapter 10 now?Social class is a fundamental concept in sociology and one o
Khazar University - ENGLISH - 1
American University of Sharjah - ESM - 640
Chopra/Meindl 4/eCHAPTER TWELVEDiscussion Questions1. Consider two products with the same cost but different margins. Which productshould have a higher level of product availability? Why?The product with the higher margin should be stocked at a highe
American University of Sharjah - ESM - 640
Chopra/Meindl 4/eCHAPTER FOURTEENDiscussion Questions1. What are some ways that a firm such as Wal-Mart benefits from good sourcingdecisions?The bottom line is that good sourcing decisions improve profits for the firm andtotal supply chain surplus.
American University of Sharjah - ESM - 640
Chopra/Meindl 4/eCHAPTER FIFTEENDiscussion Questions1. In what ways can a retailer such as Nordstrom take advantage of revenuemanagement opportunities?Nordstrom can take advantage of revenue management by using dynamic pricingthrough their Nordstrom
American University of Sharjah - ESM - 640
Chopra/Meindl 4/eCHAPTER SIXTEENDiscussion Questions1. What processes within each macro process are best suited to being enabled by IT?What processes are least suited?The macro processes in a supply chain are customer relationship management(CRM), i
American University of Sharjah - ESM - 640
Chopra/Meindl 4/eCHAPTER SEVENTEENDiscussion Questions1. What is the bullwhip effect and how does it relate to lack of coordination in asupply chain?The bullwhip effect refers to the fluctuation in orders along the length of thesupply chain as order
American University of Sharjah - ESM - 640
ELEMENTS OF A GREEN CITY:Case Study of Masdar City(Insert name)This is a sample only, all copyrights owned by the Genius Writing Services of UKOUTLINEI.INTRODUCTIONII.LITERATURE REVIEWIII.DISCUSSIONIV.CONCLUSIONThis is a sample only, all copy
American University of Sharjah - ESM - 640
Impact of Trade Promotions (Example 10.9)Monthly DemandFixed Order CostHolding CostManufacturer's Sale Price to DOOptimal Lot Size w/o promoOptimal Lot Size w/ promo (Eqn 11.15)Cycle InventoryAverage Flow TimeForward BuyNo PROMO10,000$10020%
American University of Sharjah - ESM - 640
Example 15.1 Pricing to Multiple SegmentscAiB1B2$10.0050002040Without Capacity constraints:Different prices:p1p2d1d2Total ProfitSame price:pd1d2Total ProfitDifference in profit$130.00$67.502,4002,300$467,250$88.333,233.331,466
American University of Sharjah - ESM - 640
Example 15.3 Dynamic PricingQuantity at beginning of season =400Period PriceDemand1 $162.20 137.802 $127.58 134.153 $95.53128.05Total400Revenue$22,351.28$17,114.36$12,232.30$51,697.94Example 15.3 Dynamic PricingQuantity at beginning of se
American University of Sharjah - ESM - 640
Ex. 10.1Example 10.1:ECONOMIC ORDER QUANTITYInputsDemand, R =Fixed cost per order, S=Cost per unit, C =Holding cost, h=12,000$4,000$50020%Order Size Increment =20LotSize800820840860880900920940960980100010201040106010801100
American University of Sharjah - ESM - 640
Ex. 10.7All Unit Discount (Example 10.7)Fixed cost per order =Monthly demand =Holding percentage =Pricing:$100.00 per order10,000 bottles20%Min Quantity Price per bottle0$3.005,000$2.9610,000$2.92Initial Order Quantity =Increment in Order
American University of Sharjah - ESM - 640
DOMINICAN UNIVERSITYBrennan School of BusinessOPERATIONS MANAGEMENTGSB 723-01Fall 2012Instructor name:E-mail:Office:Office Phone:Office Hours:Course Prerequisite:Mohamed Askarmaskar@dom.eduFA 201 A708.488.5222M 15: 30-18 :00GSB 613Mission
American University of Sharjah - ESM - 640
Implementing sustainability in aharsh climate:Some Lessons from MasdarExamine Ambitious Goals & Design InnovationsReview Construction Implementation: Successes,Compromises, and Lessons LearnedExplore Applications in the USCast our minds back to 200
American University of Sharjah - ESM - 640
Lecture 03Aggregate Planning,Sales & OperationsPlanningReading AssignmentChapters 8-9 (Chopra)Copyrighted by Pearson1Chapter 8: Aggregate Planning1. Identify the decisions that are best solved byaggregate planning.2. Understand the importance o
American University of Sharjah - ESM - 640
Sheet1Aggregate PlanningDemand ForecastMonthJanuaryFebruaryMarchAprilMayJuneDemand Forecast100,000110,000130,000180,000250,000300,000CostsItemCostMaterials cost/unitInventory holding cost/unit/monthMarginal cost of stockout/unit/mont
American University of Sharjah - ESM - 640
Problem 6-5Discount factorCurrent Capacity in Asia =Current Capacity in N. America =Current Annual Demand in Asia =Current Annual Demand in N. America =0.12,400,0004,200,0002,000,0004,000,000Year 1 DemandAsia =N. America =3,000,0002,400,000
American University of Sharjah - ESM - 640
Aggre. planningS&OPExercise..Lecture 05:Aggregate planning and S&OPOran Kittithreerapronchai11Department of Industrial Engineering, Chulalongkorn UniversityBangkok 10330 THAILANDlast updated: February 4, 2013SCM v1.51/ 20Aggre. planningS&OP
American University of Sharjah - ESM - 640
Bullwhip EectDesign OptionGlobal LogisticFordLi & Fung..Lecture 03:Bullwhip Effect and Global LogisticsOran Kittithreerapronchai11Department of Industrial Engineering, Chulalongkorn UniversityBangkok 10330 THAILANDlast updated: February 4, 20
American University of Sharjah - ESM - 640
PerspectiveTermsDecisionsStrategic Fit7-ElevenConceptual design..Lecture 02:Drivers of Supply Chain ManagementOran Kittithreerapronchai11Department of Industrial Engineering, Chulalongkorn UniversityBangkok 10330 THAILANDlast updated: Februa
American University of Sharjah - ESM - 640
BackgroundSmoothingArticles.Lecture 04:Demand Forecasting.Oran Kittithreerapronchai11Department of Industrial Engineering, Chulalongkorn UniversityBangkok 10330 THAILANDlast updated: February 5, 2013SCM v1.51/ 32BackgroundSmoothingArticles
American University of Sharjah - ESM - 640
Syllabus & RulesSCM 101Examples.Lecture 01:Introduction to Course.Oran Kittithreerapronchai11Department of Industrial Engineering, Chulalongkorn UniversityBangkok 10330 THAILANDlast updated: February 4, 2013SCM v1.51/ 30Syllabus & RulesSCM
American University of Sharjah - ESM - 640
IntroPlanningEOQNewsVendor.Lecture 6:Inventory Control.Oran Kittithreerapronchai11Department of Industrial Engineering, Chulalongkorn UniversityBangkok 10330 THAILANDlast updated: February 4, 2013SCM v1.51/ 24IntroPlanningEOQNewsVendorO
American University of Sharjah - ESM - 640
Table 7.1Table 7.1 Quarterly Demand for Tahoe SaltYear, Qtr1,21,31,42,12,22,32,43,13,23,33,44,1DemandDt8,00013,00023,00034,00010,00018,00023,00038,00012,00013,00032,00041,000Periodt123456789101112De mandFigure 7
American University of Sharjah - ESM - 640
Executive SummaryThis case explores the inventory and resource management for Wilkins Regulator Company.Currently they have no real plan in place that allows them to track their inventory and controlproduction in an effort to maintain and control that
York University - BIOL - 1010
Construct a cladogram.OutgroupATT C C GAG T C CSpp WATT C T GAG TT CSpp XATT C T GAG T C CSpp YATT C T GAC TT CSpp ZATAC T GACTT CNucleotides shared with outgroup and all taxa= shared ancestral traitsOutgroupATT C C GAG T C CSpp WATT C T G
York University - BIOL - 1010
BIOL 1001 Learning Objectives Macroevolution (evolutionary novelties)General Learning ObjectivesDescribe and explain how evolutionary processes can lead to major changes in body plans.MacroevolutionDefine key terms: preadaptation, exaptation, allometr
York University - BIOL - 1010
General Learning ObjectivesDescribe and explain microevolutionary processes.Microevolution1. Define key terms: population, microevolution, gene pool, allele frequency, geneticequilibrium, loci/locus, fixation. [Knowledge]2. Define and describe the ag
York University - BIOL - 1010
BIOL 1001 Learning ObjectivesGeneral Learning ObjectivesDescribe and explain different mechanisms of speciation.Specific Learning Objectives - SpeciationDescribe and contrast the definition of a species according to the Biological Species Concept, the
York University - BIOL - 1010
1) Construct a cladogramOutgroupSpp WSpp XSpp YCTACCACTCTCACTCCCAGTCTCASolutionswillbepostedlaterintime feelfreetodiscusstheseinMoodleforum2) Construct a cladogramOutgroupSpp USpp VSpp WSpp XSpp YSpp ZTCGAACTTTTGGCACGCTTCGAACTCTTCGAAC
York University - BIOL - 1010
1) Construct a cladogramOutgroupSpp WSpp XSpp YCTACCACTCTCACTCCCAGTCTCA1st step identify ancestral traitsOutgroupSpp WSpp XSpp YCTACCACTCTCACTCCCAGTCTCA2nd step which trait differentiatesthe outgroup from all the other taxa?[what is th
York University - BIOL - 1010
000480025900996019330232902786028280297003012030580313304590049720553006058060920636306930069730715507183071890738907518075670781007815085100863509456105321123811382116961170011710121301220712585128521395314040CLH
York University - BIOL - 1010
Dr. Phyl-o-rama(Or, How I Learned to Stop Worryingand Love the Cladogram)1)OutgroupSpp WSpp XSpp YSpp ZGGTTCACCGCTACACCGGTACACCGCGACAGCGCTACAGCYoulldefinitelygetaquestionlikethis,shortwrittenquestionstyle,onmidterm022)OutgroupSpp HSpp I
York University - BIOL - 1010
BacteriaLearning objectivesStudents should be able to: Describe how E. coli has been (and continues to be!) a useful modelorganism. Compare and contrast cells of bacteria, archaea and eukaryotes,identifying similarities and key differences between t
York University - BIOL - 1010
PatternsAt both the macro and the micro levelsWhat are the similarities among systems?What are the differences among systems?SimpleMoleculesChainMoleculesCellsAtomsMolecularStructuresCellularCommunitiesConcepts to review: Van der WaalsCoval
York University - BIOL - 1010
Biodiversity and EvolutionTopic learning objectives Students should be able to:Define selection, and provide a biological example ofthis process. [Knowledge]Define the theory of evolution. [Knowledge]Explain how the both the unity and the diversity o
York University - BIOL - 1010
Cell Division, SecondMessengers, Cascades,and CancerBIOL1000Section BDr. GadsdenBacterial Cell Division = BinaryfissionRemember! DNAreplication occursthroughout the cell cycleand is not a separatephase!Do bacteria go throughG1, S, G2, and M?
York University - BIOL - 1010
2010 Pearson Education CanadaBeginning in August 2007 and running through 2008, globalfinancial markets were in crisis.The epicentre of the crisis was a collapse of U.S. houseprices and a crash in the values of securities that financehouse purchases
York University - BIOL - 1010
2010 Pearson Education CanadaMoney has taken many forms. What is money today?What happens when the bank lends the money weredeposited to someone else?How does the Bank of Canada influence the quantity ofmoney?What happens when the Bank of Canada cr
York University - BIOL - 1010
2010 Pearson Education CanadaProduction grows and prices rise, but the pace is uneven.What forces bring persistent and rapid expansion of realGDP?What forces bring inflation?Why do we have business cycles?What is the range of view of macroeconomist
York University - BIOL - 1010
2010 Pearson Education CanadaFixed Prices and Expenditure PlansKeynesian model describes the economy in the very shortrun when prices are fixed.Because each firms price is fixed, for the economy as awhole:1. The price level is fixed.2. Aggregate d
York University - BIOL - 1010
2010 Pearson Education CanadaIn 2007, the federal government spent 15 cents of eachdollar Canadians earned and collected 16 cents of eachdollar earned in taxes.So the government planned a surplus of 1 cent on everydollar earned.How does the governm
York University - BIOL - 1010
The Adder worksheet implements a 4-bit full adder using logic functions.The user enters binary values for A and B and the adder performs the addition.This is accomplished by defining the output for each logic gate in the diagram.Named Ranges:A=Adder!
York University - BIOL - 1010
Family Name:First Name:Student Number:Registered Section:CSE1520.03HomeworkChapter ?e-mail address: ?????
York University - BIOL - 1010
A Look at DNA andSpectrophotometryBases - PyrimidinesNote the difference between Cytosine and the other twopyrimidines (indicated by the arrows!). U and T are missinga double bond and consequently the Nitrogen has a Hattached. Why is this important?
York University - BIOL - 1010
Cell division, DNA replication andmitosis [continuity]Ch 9, 13 (13.3, 13.4)Learning objectivesStudents will be able to Describe how mitosis and prokaryotic cell division support the cell theory. Describe the process of DNA replication, including the
York University - BIOL - 1010
Introduction to DNA StructureBIOL1010The Nucleus and Nucleic AcidsJohann Miescher (1869) isolated large acidic moleculesfrom the nuclei of sperm cellsdeoxyribonucleic acid (DNA)The nucleus separates DNA from cytoplasmprotects from damaging enzymes
York University - BIOL - 1010
ECON 1010REVIEWCHAPTER 1: What is Economics?DefinitionDefine Scarcity, Choices, Opportunity Cost andIncentivesMain branches; Micro and MacroeconomicsTwoBig Economic Questions:What, How and for whom to produceof EconomicsDefine factors of produc
York University - BIOL - 1010
Chapter 30When the overnight loans rate rises relative to the long-term bond rate the real GDPgrowth rate usually slows about one year laterIf the interest rate on treasury bills is lower than the overnight loans rate, the quantity ofovernight loans s
York University - BIOL - 1010
Theory of Endosymbiosis. Lecture notesPpt # 12: Vesicles from Phospholipids When you mix Phospholipids in an aqueous solution, the PLs will aggregate to form asphere surrounded by a PL bilayer = a membrane!Any molecules in the aqueous solution will al
York University - BIOL - 1010
Energy and enzymesCh 4SystemsEnergyReactions depend on # of collisions and orientation ofmoleculesAB A + B + EE = energy-initial and equilibrium rxn velocity are different (speed of reaction how much product is made by a number of molecules in a
York University - BIOL - 1010
Gene Structure andExpressionControl of Gene ExpressionChapter 14Chapter 15.1 (Intro only), 15.2,15.3Which of the following bestrepresents the largest to smallestorder?1. Genome, Chromosome,Gene2. Chromosome, Genome,Gene3. Chromosome, Gene,Ge
York University - BIOL - 1010
Genetics Part 1Text: Chapters 11, 12Optional (recommended): AProblem-Based Guide to BasicGenetics See Ch. 1-3.Learning objectivesStudents should be able to: Define key terms in genetic crosses : character, trait, true-breeding, P (parental)generat
York University - BIOL - 1010
Genetics Part 2BIOL1000 2012 Fall Section BDr. GadsdenReproduction in Eukaryotes Sexual reproduction produces uniqueoffspring by union of male and femalegametes (sperm and egg). Meiosis Produces gametes with half the totalchromosome number (e.g.
York University - BIOL - 1010
Lab 7 download file (use firefox, if IE causes a problem file on intranet, orwhatever) make a copy of the downloaded file: Lab_7.mdb => Lab_7-v1.mdb Access continually updates file on disk (most applications keep a workingcopy in RAM) launch Access
York University - BIOL - 1010
BIOL 1010 Section B GeneralinformationDr. M. Gadsden Me!Videos1. Biodiversityhttp:/www.youtube.com/watch?v=9laQwaKOW8s&feature=re2. Welcomehttp:/www.youtube.com/watch?v=eZcYP00b2FIDr. Gadsden Info!Email = mgadsden@yorku.caNOTE! I dont use the mo
York University - BIOL - 1010
ElongationAfter initiation is accomplished and has left the holoenzyme(perhaps), core polymerase continues to elongate the RNA.The subunits of RNA polymerase can be separated and thencombined to reconstitute the active enzyme.Can combine subunits fro
York University - BIOL - 1010
Microevolutionary ProcessesChapter 17Phenotypic variation Differences in appearance and/or function Was the focus of Darwins research describingevolution the concept of genes and genotype had not yetbeen developed!Phenotypic variation Also focus