Bio- Final exam notes
21 Pages
Bio- Final exam notes

Course: BIO 1001, Fall 2013

School: UWO

Word Count: 9574

Rating:

Document Preview

uble strands -Taq has an error rate of 1/9000 base pairs. Because it cannot fix the errors, some of the replicated areas will have mismatched base pairs How to make primers to amplify an unknown gene sequence -You can use either local or global alignment to compare organisms -You want to compare it with organisms that have their genome or the specific gene already sequenced (through Genbank (NCBI)) -You find the...

Unformatted Document Excerpt
Coursehero >> Canada >> UWO >> BIO 1001

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

strands -Taq uble has an error rate of 1/9000 base pairs. Because it cannot fix the errors, some of the replicated areas will have mismatched base pairs How to make primers to amplify an unknown gene sequence -You can use either local or global alignment to compare organisms -You want to compare it with organisms that have their genome or the specific gene already sequenced (through Genbank (NCBI)) -You find the highly conserved regions and make primers out of those regions Why it is necessary to make degenerate primers for PCR -If there are no regions where at least 16 base pairs match up perfectly, you can create degenerate primers -You see where there are variances and you create several types of primers because one of them will be a perfect (or almost perfect) match -Make degenerate primers to account for all of the information in the conserved area and one of the primers is bound to be correct and be in the vaucheria sequence How to use RT-PCR to amplify particular mRNA -This is when you want to do PCR with mRNA -But, the DNA polymerase (Taq polymerase) wont work on mRNA, and therefore you need to use reverse transcriptase -First, you isolate the mRNA -Then you use the enzyme reverse transcriptase to reverse transcribe the mRNA into cDNA (complementary DNA=double stranded DNA synthesized from info in mRNA) using a Poly-T primer -There is nothing specific about the Poly-T tail, all mRNA has it -Note that reverse transcriptase cannot proofread, therefore is able to make mistakes -Once cDNA the is made, you can then use PCR to amplify the desired region (PsbO) -In addition, once you have the amplified DNA, you excise the PCR band from the agarose gel -Then you sequence it, and after BLAST the sequence -You can now find out that the sequence is similar to PsbO Usefulness of Northern blots in addition to standard RT-PCR -Northern blots are useful as they measure the total abundance of RNA in a sample -If mRNA were to be isolated, a Northern blot analysis could be run to show that the sample contains this certain mRNA and therefore must have the gene used to create the mRNA -Northern blot acts as evidence of transcription in Elysia and Vaucheria Mechanism and result of secondary endosymbiosis -Primary endosymbiosis is when one eukaryote ingested another -This gave rise to the mitochondria and the chloroplast -Secondary endosymbiosis is when a eukaryote with both mitochondria and chloroplasts ingested another eukaryote to get more chloroplasts, NOT MITOCHONDRIA -This gave rise to chloroplasts with 4 outer membranes instead of only two Role of tripartite target sequences in localizing proteins to sub-organellar compartments (ie. thylakoid lumen) -Genes have protein targeting signals found on the amino end of the protein (it is part of the gene sequence, not added) -BIG QUESTION: Elysia has PsbO, but does it make a protein that goes to the chloroplast? Does the protein sequence that you get from the transcript sequence tall you that it can get into t

Find millions of documents on Course Hero - Study Guides, Lecture Notes, Reference Materials, Practice Exams and more. Course Hero has millions of course specific materials providing students with the best way to expand their education.

Below is a small sample set of documents:

WVU - PHYS - 331
Physics 331 Fall 2012, BarnesQuiz 6Due Wednesday October 10, 2012 at the start of class.A Damped Simple Harmonic Oscillator: Initial Conditions and Time EvolutionDamped Simple Harmonic Oscillators are easy to describe, but have to be very precise ina
Cornell - AEP - 4900
2855253231812E-7+1.9840675028170733E-7i 2.6159376537179717E-6-6.980150256297963E-7i5.2778277490773396E-5 -1.4578675366207103E-4 -1.7394832030627298E-5 5.936757869606731E-7-1.833434083097071E-7i -5.371020966226892E-7+1.229925854
Cornell - AEP - 4900
4951137859351066E-6+6.351566824627312E-7i-1.2039532082310357E-4 1.2635950096291003E-4 0 -7.979720031663949E-9+5.446118383922728E-9i -3.575762416172089E-7-1.4950223016668849E-7i -1.5911754281216813E-6+6.4971539
UWO - BIO - 1001
Dear Dr. ScienceDont tell anyone, but I am making some extra money as a first year sciencestudent spying on Westerns new Centre for Planetary Science and Exploration. Ihave a miniature camera and a code name and a hollow tooth filled with cyanidethat
UWO - BIO - 1001
BiologySecondTermTestISO:1.Meaningofdeme,population,allelefrequency,genotypefrequencyDeme:subdivisionofapopulationconsistingofcloselyrelatedplants,animals,or people,typicallybreedingmainlywithinthegroup.Population:alltheindividualsofasinglespeciestha
UWO - BIO - 1001
LECTURE OUTCOMES - (What you should be able to do after attending and reviewingthe lecture. These Outcomes are testable on exams etc.)Lecture 2 Outcomes- HIVGeneral global distribution of HIV infections.General temporal trends in HIV infection rates.
UWO - BIO - 1001
Prep 101 Biology 1002 Supplement for Term Test 1 MaterialOXYGEN CONSUMPTIONMeasuring the rate of oxygen consumptionLect mitochondria e an oxygen metabolismIf you addure 8: Intto grated electrode chamber what happens to the oxygenconcentration in the
UWO - BIO - 1001
Tutorial 5 Homework QuestionsGroup 41.What do biologists believe are the genetic/evolutionary relationships between theEastern Wolf (Canis lycaon) of Algonquin Provincial Park, the Gray Wolf (Canislupus), the Red Wolf (Canis rufus) and Coyotes (Canis
UWO - BIO - 1001
Biology201302273:30PMPandemicsfeltgloballyHIV/AIDSmainlyfeltinsubSaharanAfrica,butalsoaroundtheworld moretherethananywhereelseintheworldNumberofpeoplelivingwithHIVcontinuestogrow,deathsduetoAIDSareactually decreasingbecauseofnewmedicines,stillmajorh
UWO - BIO - 1001
Biology2/27/201303:37:00PMPandemicsfeltgloballyHIV/AIDSmainlyfeltinsubSaharanAfrica,butalsoaroundtheworld moretherethananywhereelseintheworldNumberofpeoplelivingwithHIVcontinuestogrow,deathsduetoAIDSareactually decreasingbecauseofnewmedicines,stillm
UWO - BIO - 1001
BiologyPandemicsfeltgloballyHIV/AIDSmainlyfeltinsubSaharanAfrica,butalsoaroundtheworld moretherethananywhereelseintheworldNumberofpeoplelivingwithHIVcontinuestogrow,deathsduetoAIDSareactually decreasingbecauseofnewmedicines,stillmajorhumansufferings
UWO - BIO - 1001
LECTURE 16: EVOLUTION OF MULTI-CELLULARITYMulticellularity has evolved several times- It is not monophyletic (it did not evolve once), it has evolved in multiple branchesV o lv o c in e a lg a e p r o v id e a p r o d u c t iv e m o d e lsy st e m . .
UWO - BIO - 1001
Biology100203:04InteractionoflightwithBiology:fundamentaltotheevolutionoflifeLightusedbybiologicalsystemforsourceofenergyandsourceofinformationaboutthe environmentChlamydomonas:singleunit,systemoflookingatlifeandlightsexuallyactive,lightharvesting,c
UWO - PSYCHOLOGY - 1000
Chapter 3- Biological Foundations of BehaviorNeural bases of behavior- Brain is a grapefruit sized, 3 pound mass of tissue is made up of neurons- Neurons are the building block of the nervous systemNEURONSCell body contains the biochemical structures
UWO - PSYCHOLOGY - 1000
September 17, 2012Chapter 2- Studying Behavior Scientifically-Scientific AttitudesScientific processTypes of variablesCorrelation researchExperimental researchStatisticsScientific attitudes- Curiosity- why?- Skepticism- show me your evidence?-
UWO - PSYCHOLOGY - 1000
Chapter 5- Sensation and PerceptionInformation comes in through our sensesOur brains interpret this information- you look through your eyes- you see through your brainSensation- stumulus- detection process- organs translate stimuli into nerve impuls
UWO - PSYCHOLOGY - 1000
Chapter 4- Genes and EvolutionThe Jim Twins- Given up for adoption when they were babiesJim SpringerJim LewisChromosomes and GenesHippocrates- suggested that semen contains some sort of design for the formation ofoffspring-Partially correctGregor
UWO - PSYCHOLOGY - 1000
September 12, 2012Chapter 1- Psychology: the Science of BehaviorWhat is psychology?It is the scientific study of behavior and the mindBehavior- refers to actions and responses that we can directly observeMind- refers to internal states and processes,
UWO - PSYCHOLOGY - 1000
ReadingNotesChapter119:32Psychology:scientificstudyofbehaviourandthemind Behavior:actionsandresponseswecandirectlyobserve Mind:internalstatesandprocesses(ex:feelings,thoughts)thatcantbeseen andmustbeinferredClinicalpsychology:studyandtreatmentofment
UWO - PSYCHOLOGY - 1000
Chapter 6 ConsciousnessWhat is consciousness?- Moment to moment awareness of ourselves and the environmentIt is:- Subjective- Dynamic- Self-reflectiveFreud: 3 levels of awareness1) the conscious mind2) preconscious3) unconsciousCognitive perspe
UWO - PSYCHOLOGY - 1000
A. note about names and dates. There are many researchers mentioned in2 Psychology takes many different approaches to the study ofthis (and every) chapter in the text. Do not be concerned with memorizingbehaviour.the names and 1: The Science of Psycho
UWO - PSYCHOLOGY - 1000
1. How many research credits do you need to obtain by the end of the year?A) 1B) 100C) 6D) 2500E) research credits?2. Which of the following statements comparing the behavioral and psychodynamicperspectives is most accurate?A) though they are rath
UWO - PSYCHOLOGY - 1000
Correlational studies are fine but they do the Mean = MedianAlso note that, in this example, not give us informationMode. cause. If I want to say the distribution will be normal i.e.,MostaboutWhenever thisthose who received $20.00 for telling a, lieto
UWO - PSYCHOLOGY - 1000
Bouchard is very important here. When Bouchard reunites identicaltwins who were separated at birth, he reports remarkable similaritiesThe lastbehaviour. Regarding intelligence, the similarity is alsoin their few pages of the chapter introduce some impo
UWO - PSYCHOLOGY - 1000
y ody, but this has in general, the major regions each depolarized,b ou should know, of is gradedit may be little the at the verythat a neuron activity information Itmay be a to of bit brain. Do notYourself what kind only one axon. is restrictedbranche
UWO - PSYCHOLOGY - 1000
Psychology 1000John CampbellJdcampb2@uwo.caOffice- SSC 74404 multiple-choice exams during the year1. MIDTERM 1 (20%) is set for Sat Oct 20th at 9:00am. Covers chapters 1-4 plusthe appendix2. XMAS TEST (20%) December 8th -19th chapters 5-83. MIDTER
Forest Hills High School - SCIENCE - bio
Homework- Pg. 240 #2,3,5,6-92) To determine which kind of replication occurred, Meselsen and Stahl grew two types of E.coli cultures one type in a medium of 15N (heavy nitrogen) isotope and another type in amedium of 14N (normal nitrogen). Once the bac
Forest Hills High School - SCIENCE - bio
Rhizobium giardinii strain H152 16S ribosomalRNA, partial sequencecaatgggcgc aagcctgatc cagccatgcc gcgtgagtga tgaaggcctt agggttgtaa agctctttcaccggagaaga taatgacggt atccggagaa gaagccccgg ctaacttcgt gccagcagcc gcggtaatacgaaggggggct agcgttgttc ggaattactg
Forest Hills High School - SCIENCE - bio
9.1 Mutations and Mutagens-Even when a gene is not expressed in one generation, the gene itself is not changed andit may be expressed in a future generations-However if this was true^, there would be no opportunity for genetic change anddiversity-MUT
Forest Hills High School - SCIENCE - bio
Forest Hills High School - SCIENCE - bio
Endocrine System AssignmentAnterior Pituitary GlandsHypothalamus secretes releasing hormone that targets the Anterior Pituitary gland Anterior Pituitary glandThyroid stimulatinghormonethyroid glandcontrols the secretion of hormones by the thyroid gland
Forest Hills High School - SCIENCE - bio
Enzymes as CatalystsQuestions #1,2,3,5,6,7,8,9,131) Catalysis is the acceleration of a chemical reaction by a catalyst.2) A)B) The cyclic nature of the catalytic cycle is energy efficient for the cell because thecatalyst lowers the activation energy
Forest Hills High School - SCIENCE - bio
Lab Activity Identifying NutrientsBy Daryl BlankensteinIntroduction- Macromolecules are very important in living things since carbohydrates,lipids and proteins are critical in all characteristics of metabolic processes. Medicalresearch, and food and w
Forest Hills High School - SCIENCE - bio
Moving to the Mitochondrion Glycolysis occurs in the cell cytosol The remaining reactions of aerobic cellular respiration take place inside themitochondria Mitochondria is composed of an outer and inner membrane Inner membrane folds ATP synthesis oc
Forest Hills High School - SCIENCE - bio
Enzymes LabBy Daryl BlankensteinObservations:Time (sec)0-2021-4041-6061-8081-100101-120Total (pennies)Overall Rate(pennies/sec)Trial #135 (+2)7 (+2)9 (+2)11 (+2)13 (+2)130.1083Trial #224 (+2)6 (+2)8 (+2)9 (+1)11 (+2)110.0917
Forest Hills High School - SCIENCE - bio
Ryerson Field Trip- SequencesGenetic Engineering TechniquesMETHODS OF AMPLIFYING DNA1. Cloning2. PCRCloning-Combining DNA with a restriction enzyme-The enzyme cuts double stranded DNA at a specific recognition sequences known asRESTRICTION SITES-
Forest Hills High School - SCIENCE - bio
Strawberry DNA Lab ReportDaryl BlankensteinObservations:1. See biological sketch on the back page.2. Wet: A mucus-like globular substance, faded pink colour almost white and translucent,a little grainy.Dry: Denser part in the middle is redder, appea
Forest Hills High School - SCIENCE - bio
Rough Endoplasmic ReticulumLocation in cell and type of cell where it is present: Located in the inner partof the cytoplasm of a cell. Found in both plant and animal cells.Structure: Ribosomes cover the surface of rough endoplasmic reticulum andmake i
Forest Hills High School - SCIENCE - bio
Transport Across a MembraneVery small molecules such as oxygen, carbondioxide, and water are permeable and movedirectly across the membranes bilayer.Why do materials move?All molecules in a fluid exhibit Brownian motion - random motion (dye in water
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
WVU - PHYS - 331
The angular momentum about the CM, is just the next external torque, measured relative to the CMThe angular momentum may not be in the same direction as the angular velocity! This only happenswhen the body is axially symmetric and rotating about its axi
WVU - PHYS - 331
Physics 331 Fall 2012Quiz 1Due Wednesday, August 29, 2012 at the start of classIntegrating the Equations of MotionA particle is subject to a central forceF ( x) = kx2This is the same form as Coulombs law of Newtons law of gravity. A particle isin
WVU - PHYS - 331
Physics 331 Fall 2012Quiz 2Due Wednesday, September 5, 2012 at the start of classStokes Law for Viscous Drag on Spheres: Millikans Oil Drop ExperimentMillikan was a cleaver fellow. He figured out that oil droplets with charge on them couldbe minipula
WVU - PHYS - 331
Physics 331 Fall 2012Quiz 3Due Wednesday, September 12, 2012 at the start of classA Model of Raindrop Growth (Accreation)In physics we are often faced with the problem of trying out a hypothesis to see if an ideawe have agrees with the observed behav
WVU - PHYS - 331
Generated by CamScanner from intsig.com
WVU - PHYS - 331
Physics 331 Fall 2012Quiz 4Due Wednesday, September 19, 2012 at the start of classForces and Potential: A One-dimensional ExampleMany forces we encounter are conservative. That means there is a potential fromwhich the force can be calculated using th
WVU - PHYS - 331