f13 lecture 20
22 Pages

f13 lecture 20

Course Number: BIOLOGY 110, Fall 2010

College/University: University of Waterloo,...

Word Count: 1477

Rating:

Document Preview

Basic review: Lactose operon: Catabolic Negative regulation Regulatory protein is repressor; effector = inducer: allolactose (converted lactose) Existence of catabolite activator protein (CAP); has effector as well Tryptophane operon: Anabolic Negative regulation Regulatory protein is aporepressor; effector = co-repressor: tryptophan Autoregulation L-arabinose operon Catabolic Positive and negative regulation...

Unformatted Document Excerpt
Coursehero >> Canada >> University of Waterloo, Waterloo >> BIOLOGY 110

Course Hero has millions of student submitted documents similar to the one
below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

Course Hero has millions of student submitted documents similar to the one below including study guides, practice problems, reference materials, practice exams, textbook help and tutor support.

review: Lactose Basic operon: Catabolic Negative regulation Regulatory protein is repressor; effector = inducer: allolactose (converted lactose) Existence of catabolite activator protein (CAP); has effector as well Tryptophane operon: Anabolic Negative regulation Regulatory protein is aporepressor; effector = co-repressor: tryptophan Autoregulation L-arabinose operon Catabolic Positive and negative regulation Same regulatory protein acts as both activator and repressor (=regulator) two different conformations / corresponding binding sites effector = inducer: arabinose Autoregulation of AraC and CAP regulation of the operon Regulation of transcription in Prokaryotes: additional ways/events Regulation of transcription in Prokaryotes (cont.) Multiple operators auxiliary operators Operator regions more complicated then previously shown Lac-operon region contains 3 operators: Strongest commonly shown O1 Downstream O2 inside lacZ reading frame Upstream O3 All three present transcription suppressed 1000-fold If either O2 or O3 are missing 500-fold Both O2 and O3 missing 20-fold Repressor binds as a tetramer could bind to all three Os (two and two at a time) DNA looping RNAP prevented from binding to promoter Also: presence of auxiliary operators (O2 and O3) near the functional operator (O1) increases the local concentration of the repressor, so that it can occupy the functional operator (O1) Regulation of transcription in Prokaryotes (cont.) Two component regulatory systems 1. One protein is the sensor-transmitter protein- monitors specific changes in the environment (level of nutrients, pH, solvent concentration-osmolarity etc.); kinase 2. Second protein is response regulator protein - either stimulates or represses regulation of specific genes changes in gene expression necessary for bacterium to adapt to environmental change Two component regulatory system (cont.) Sensor-transmitter usually spans across the cell membrane: sensor is an outer part which detects specific changes in environment transmitter is an inner part which usually acts as a kinase changes in the environment sensed by sensor change of the conformation of sensor domain change of the conformation of sensor domain activates (change of the conformation) transmitters kinase part in the cell activated kinase - autophosphorylation of the transmitter domain (transfers usually g phosphate from ATP to itself) change of conformation the same phosphate is then transferred to the receiver domain of response regulator change of conformation activation of the effector domain Response regulator binds to DNA regulatory sequences in gene(s) encoding proteins that help cell to cope with environmental change Two component regulatory system (cont.) Regulation of transcription in Prokaryotes (cont.) Direct contact between RNAP and regulator protein could happen even when binding sites are far apart -polmerase binds to the promoter (closed complex) -if organic N/glutmine are low regulation through two component regulatory system: protein kinase NtrB phosphorilates protein NtrC activation of NtrC -NtrC binds to enhancers at -140 & -108 far from RNAP promoter -Phosphorylated (activated) NtrC interacts with s54 factor (recall: s54 - genes for nitrogen metabolism ) through looping of DNA DNA forms a loop -The ATPase activity of NtrC stimulates the polymerase to unwind the template and form open complex Review: control of initiation of transcription in E. coli Repressor (trans-acting factor) will block transcription initiation when bound to the operator (cis-acting element) negative control One way: sites for RNAP (promoter) and repressor (operator) could overlap repressor binding blocks RNAP from interacting with DNA at the start site Presence of auxiliary operators additional repressor binding sites Affinity of repressor for operator depends on presence/absence of effector (repressor / inducer and corepressor / aporepressor) its binding changes repressors conformation change in activity There are proteins - activators that could increase binding of RNAP to start site - positive control Binding sites for activators are called enhancers (elements) Affinity of activator for enhancer also sometimes depends on presence/absence of effector ontrol of initiation of transcription in E. coli (cont.) Some proteins are regulators (could execute positive or negative regulation depending on presence/absence of effector different conformation = affinity for different cis elements). Regulation through two component regulatory system; two proteins involved: sensor-transmitter (kinase) AND response regulator DNA bending (as a consequence of binding of a trans factor) could lead to negative or positive regulation - regulatory protein can directly contact RNAP - preventing or helping RNAP to interact with at DNA the start site (promoter) Direct contact could be achieved even when promoter and regulatory proteins binding site are far apart DNA looping Direct contact of RNAP and activator protein causes conformational changes in RNAP which promote formation of open complex Transcription: Prokaryotes Prokaryotic DNA Binding Proteins Learning Objectives Identify how DNA binding proteins bind to specific sites Describe the structure of the helix-turn helix structural motif Review allosteric modification of DNA binding proteins RNA polymerase initiates transcription at a unique site promoter: asymmetrical RNAP is positioned so it can transcribe only one strand from one promoter Transcription - initiation site or start site (+1) Upstream and downstream cis elements Weak vs. strong promoter Regulatory proteins and RNA polymerase work together to regulate transcription initiation distribution and actual nucleotide sequence of binding sites for regulatory proteins - very important Binding sites: usually not perfect inverted repeats proteins bind as dimers Two basic methods that have led to understanding of transcriptional initiation and control in bacteria Gel shift or Electrophoretic mobility shift assay (EMSA) DNase I /DMS footprinting What exactly DNA binding proteins read when they look for the place to bind? Proteins recognize hydrogen bond acceptors (A; oxygen and nitrogen ions) and donors (D; hydrogen bound to acceptor) Protein sees base pairs: A-T T-A G-C C-G Proteins have to recognize differences among the bases in their base paired state They recognize specific string of base pairs (= nucleotide sequence) They have to make H bonds or form Van der Waals and/or hydrophobic interactions with these base-pairs Recognition of basepairs without the need to open double helix CH3-hydrophobic -non-polar -very stable -do not form hydrogen bonds H- bound to C is not available for hydrogen bonding What does protein see in case of palindromic sequence 5 GGGGAATTCCGGAATTCCCC3 3 CCCCTTAAGGCCTTAAGGGG 5 Major groove Minor groove DNA Binding Proteins bound to DNA Usually 10-20 contacts: specific H-bond donors and acceptors on protein and DNA complement each other. DNA Binding Proteins bound to DNA Tight fit between DNA and protein distortion of DNA conformation to maximize the fit - maximum protein:DNA contact achieved only when DNA is distorted These proteins usually recognize DNA sequences that are easily bent Binding of (homodimeric) CAP to CAP site (e.g. E. coli lac operon) bending of DNA E. Coli DNA Binding Proteins Proteins in general: Domains: the tertiary structure of large proteins is organized in distinct regions of the protein; each domain is responsible for different function(s) Motifs: specific combinations of secondary structures, which are organized into specific 3D structure inside the domains - responsible for the actual functioning of a domain Transcription factors (TFs): 1. DNA binding domain(s): part of the protein responsible for binding DNA, with structural motifs that read DNA sequence (the part of DNA binding domain which actually comes in contact with DNA) 2. Effector binding domain: conformation of regulatory protein can be altered by binding of a small molecule effector 3. Oligomerization (dimerization) domain Helix-turn-helix motif in DNA binding domain of Pro TFs DNA binding domains of regulatory proteins share similar structural motifs The most frequent motif in DNA binding domain of bacterial repressors is the helix-turn-helix motif, about 20 amino acids long 2 short alpha helices (7 9 amino acids long) connected with a short turn DNA recognition helix (binds specific DNA sequence) makes most of the contact with the DNA and the other stabilizes the interaction Recognition helix and stabilizing helix (closer to N terminus) form ~ 90 angle First recognized in prokaryotes (also present in eukaryotes) Helix-turn-helix motif in DNA binding domain of Pro TFs Helix-turn-helix motif regulatory proteins bind as dimers Lac operator two DNA-binding regulatory proteins of lambda phage ; binding motif is the same: helix-turn-helix recognizing helix is #3, stabilizing is #2 (Lewin, 2006. Fig. 14.19) as well as the helix-turn-helix motif interacting with one face of the DNA, the N-terminal arms of the dimers monomers wrap around to the other face (Lewin, 2006. Fig. 14.20) Conformational Changes and Repressors Effector binding domain: Binding of repressors can be affected by small molecules- effectors: inducers (lac operon) co-repressors (Trp operon) Allosteric conformational change E.g. trp repressor trp repressor binds ligand effector corepressor (tryptophan) and then is able to bind DNA trp repressor blocks production of enzymes for tryptophan synthesis when tryptophan is absent trp repressor is known as trp aporepressor
MOST POPULAR MATERIALS FROM BIOLOGY 110
MOST POPULAR MATERIALS FROM BIOLOGY
MOST POPULAR MATERIALS FROM University of Waterloo