Documents about Stop Codon

 

ass9s

Allan Hancock College, STAT 3004
Excerpt: ... Discipline of Mathematics The University of Queensland Probability Models & Stochastic Processes Assignment 9 Solutions 1. Ribonucleic acid or RNA is a chemical which occurs in genetic transcription. It consists of a sequence of four kinds of chemicals (which we will denote A, C, U and G). It is possible, though not very accurate, to regard a particular RNA as a long sequence (Z1 , Z2 , . . .) where the Zi are i.i.d. and equal A, C, U or G with probability 1/4. A stop codon is a sequence of three consecutive letters (Zm , Zm+1 , Zm+2 ) which equal (U, A, G), (U, G, A), or (U, A, A). The number of stop codon s observed in an RNA may be regarded as a lattice, delayed renewal process: N (t) is the number of stop codon s which occur in (Z1 , Z2 , . . . , Zm+2 ) where m = t . (a) For the corresponding interarrival time X, show that i. P [X < 3] = 0. [2] Solution. If (Zm , Zm+1 , Zm+2 ) equals any of the stop codon s then it is clearly impossible for either (Zm+1 , Zm+2 , Zm+3 ) or (Zm+2 , Zm+3 , Zm+4 ) to also equal ...

Chapter 7 Answers

Wayne State University, BIO 2600
Excerpt: ... Study Guide Chapter 7 Answers 1. A-4; B-2; C-1; D-3 2. Choice (d) is the correct answer. Such changes would probably destroy the function of the promoter, making RNA polymerase unable to bind to it. Decreasing the amount of sigma factor or RNA polymerase (choices (a) or (b) would affect the transcription of most of the genes in the cell, not just one specific gene. Introducing a stop codon before the coding sequence (choice (c) would have no effect on transcription of the gene, since the transcription machinery does not recognize translational stops. Moving the termination signal farther away (choice (e) would merely make the transcript longer. 3. Choices (a), (c), and (d) are the correct reasons. Choices (b) and (e) are true for both primase and RNA polymerase. 4. 1. A poly(A) tail must be added. 2. A 5 cap must be added. 3. Introns must be spliced out. ("Export from nucleus" is also an acceptable answer.) 5. The change creates a stop codon (TGA, or UGA in the mRNA) very near the beginning of the ...

hmwk1

Wright State, CS 271
Excerpt: ... # Bio/CS 271 # Homework #1 # # Input: None (although the DNA sequence to analyze is contained # in the string $DNAsequence) # # Output: 1) The position of the start codon in $DNAsequence # 2) Each of the codons following the start codon # until a stop codon is found # 3) The number of codons, including the start codon # but not including the stop codon . # # NOTE: The START codon is ATG, which also codes for # methionine. The STOP codon s are TAG, TGA and TAA. # # Example: # $DNAsequence: AACAGTATGCGAACTTATCGATTATAGATCGACATAGGAC # Output: # Start codon found at position 6 # ATG CGA ACT TAT CGA TTA TAG # 6 Codons identified. DUE DATE: At the beginning of class, 4/4/06 please turn in a printout of your program AND the results of its execution for each of the three following sequences: $DNAsequence = "AACAGTATGCGAACTTATCGATTATAGATCGACATAGGAC"; $DNAsequence = "TTATCATTGCTATGATCTATCC ...

lecture_23_notes

UC Davis, BIS bis2a
Excerpt: ... esistance to errors. Note that amino acids with similar properties are close to each other on the table. This means that errors (such as pairing of tRNA to codon in which one base is off) would still result in incorporation of similar amino acid in protein It turns out that this code is one of the very best possible for error correction. Definitely not a random code. Additional properties of the code are still being discovered. Function of code One start codon: AUG for Met Three stop codon s: UGA, UAG, UAA Code can be read or written in DNA language as well: AUG is ATG etc. Using the DNA code, a polypeptide can be encoded as follow: 5'ATGGATTTTTTGGATCCCTGA. .TACCTAAAAAACCTAGGGACT-5'. ATG GAT TTT TTG GAT CCC TGA Met Asp Phe Leu Asp Pro stop DNA sequence (top strand) bottom strand codons in DNA code amino acids note that the sequence of DNA specifying the polypeptide will be embedded in DNA and that it is recognizable in the top strand. (promoter>)tgtattcttaATGGATTTTCCCGATTTGTG ...

Gene_expression

Lander, BIOL 111
Excerpt: ... ncode proteins, will be translated in the cytoplasm. 2. tRNA: transfer RNA, part of the translational machinery, responsible for matching sequences in the mRNA (codons) with the appropriate amino acid 3. rRNA: integral components of the ribosome, necessary for proper ribosome structure and function, involved in regulation of the proper association of mRNA, and tRNA with the ribosome. Eukaryotic mRNAs are processed before they are exported from the nucleus (see Figure 17.10): 1. 5' Cap: modified guanine nucleotide 2. 3' Poly-A Tail: 200 A's 3. Splicing: removal of introns (non-coding) & joining exons (coding) Translation: Synthesis of a polypeptide (linear sequence of AA's) from the linear sequence of nucleotides in mRNA (see Figure 17.4): Groups of 3 nucleotides in mRNA are CODONS Each codon specifies the position of ONE AMINO ACID in the polypeptide encoded by a gene Three STOP codon s specify the completion of the polypeptide and the end of translation Translation begins at an AUG codon Codons in mRNA ar ...

Quiz 4key

Arizona, BIO 340
Excerpt: ... picture. 4. a) There is an important difference in the location of initiation of translation in prokaryotes and eukaryotes. Please explain. A simple drawing may be helpful as part of your answer. b) this difference explains why eukaryotic mRNA cannot be polycistronic. Why? (As part of your answer please explain what polycistronic means.) a) In prokaryotes translation can be initiated at the Shine-Dalgarno sequence (ribosomal binding site) that is located within a mRNA molecule (see figure below- this will code for three polypeptides), while in eukaryotes translation can only be initiated at the 5' cap (that is the initiation complex can only form at the 5' cap - see figures in lecture ppt). b) In eukaryotes once translation has been initiated and then terminated at a stop codon , it cannot be initiated again within the same mRNA molecule. Shine-Dalgarno sequence Shine-Dalgarno sequence Shine-Dalgarno sequence Start codon Stop codon Start codon Stop codon Start codon Stop codon 5. Models of riboso ...

quiz_1_S09

Western Washington, CHEM 425
Excerpt: ... Chem 425s/578 Quiz #1 DUE 1pm Wednesday 4/8/09 Provide succinct answers to the following questions. 1) Why is it critically important to have a robust protein purification protocol as part of the experimental design of chemical modification studies? Give at least two reasons as part of your answer. 2) What, in your opinion, is the major drawback to the total synthesis approach to protein engineering? Briefly explain your choice. 3) List two advantages to recombinant DNA methods ("genetic methods") for protein engineering over total synthesis and/or chemical modification methods. What limitations, if any, exist for recombinant DNA methods? 4) Why did the early development of the biosynthetic approach to unnatural amino acid mutagenesis require the use of stop codon s? 5) How many different unnatural amino acids can be incorporated into a protein biosynthetically and site specifically if only stop codon s are used to direct the insertion of the unnatural amino acid(s)? Explain. Questions on: Noren et al., Scienc ...

trpLab

University of Alaska Fairbanks, FFDEW 2
Excerpt: ... d translation trp trp trp ACC ACC trp ribosome ribosome aporepressor RNA polymerase Parts of the gene rip them apart so you can put them together in the right order trpO trpE trpD -35 trpC DNA 1 repeat 2 DNA -10 promoter trpB trpA TGGTGG-repeat repeat 3 repeat 4 TTTTTTT UGGUGG-repeat 1 repeat 2 mRNA repeat 3 repeat 4 UUUUUUU trpE trpD trpC mRNA trpB trpA These are all components of the mRNA. Rip the pieces apart Show where each part will be on the mRNA rho-independent termination structure When and where do you see these structures? A U C A G A U A C C Ribosome binding site Ribosome binding site Ribosome binding site Ribosome binding site Ribosome binding site Ribosome binding site AUG AUG AUG AUG AUG AUG Stop codon Stop codon Stop codon Stop codon Stop codon Stop codon These are the polypeptides produced. Show where each is produced leader polypeptide A B C D E ...

Biosci_111_Study_Guide_Test_Three

Michigan State University, BS 111
Excerpt: ... occur in prokaryotes? Eukaryotes? 9. Know the following codons: - AUG = start = Methionine (Met) - 3 STOP codon s - UAA = STOP codon 10. What's the function of amino-acyl synthetase? -Describe how ATP, anti-codons, tRNA and amino acids are involved 11. Know the 3 sites in a ribosome and what the tRNA "holds" in each site - How is the ribosome a ribozyme? 12. Know the 3 stages of translation. -including: Met-initiator tRNA, small ribosomal subunit, GTP, release factors, peptide bond formation, etc. 13. Given a DNA sequence, be able to give the corresponding: - mRNA sequence - anti-codon - translated protein (you will be given the appropriate codon chart minus START and STOP) - Hint: Remember strand directionality is anti-parallel! 14. What are the 4 types of mutations that can occur in a protein? -What are their effects on the amino acid? On the protein? ...

Lecture 33 Genetic code

Stony Brook University, BIO 202
Excerpt: ... everal different codons (more on this later). There is punctuation in the genetic code Start codon = ATG, which also encodes methionine STOP codon s= UAA,UAG,UGA . These stop codon s do not encode any amino acids Punctuation establishes the reading frame. After the first codon is established by the translation machinery, each following codon is read (as groups of three nucleotides). The cells proteinsynthesizing machinery reads the frame as a series of non-overlapping threeletter words. . For instance: THE FAT CAT ATE THE BIG RAT Insertion or deletion of a single base pair will cause a frameshift mutation that will cause the genetic message to be misread. The proper reading frame can be restored only by an additional compensatory insertion or deletion somewhere else (a suppressor mutation). THE FAT CAT ATE THE BIG RAT Delete C Insert A THE FAT ATA TET HEB IGR AT THE FAT ATA ATE THE BIG RAT Consider the above example in which 3-letter words are used to represent the codons. Deletion ...

lecture8notes

Arkansas Little Rock, BINF 4445
Excerpt: ... of various kinds Contents: Functional annotation What the sequence does What else? longer (non-localized) sequences Homologies: molecules with the same ancestor as x Lets look at these in more detail Telltale Features Signals: localized motifs of various kinds Contents: longer (non-localized) sequences Homologies: molecules with the same ancestor as x Signals include: promoters splice sites start codons stop codon s polyadenylation sites Telltale Features Signals I: Promoters Signals include: promoters binds transcription factor protein thereby enables the gene downstream to be expressed not all promoters are identical, but they are similar differences affect their binding effectivenesses sometimes you want less effective binding (why?) a theory about promoter mutations They explain many differences between closely related species (e.g. humans, chimps) See e.g. pp. 32-35 of Ridley, The Agile Gene splice sites, start codons, stop codon s, polyadenylation sites Telltale Features ...

Lecture 12

UCLA, LS 3
Excerpt: ... in a single amino acid change in the protein: CCC UUA GGU -> CCC GUA GGU Pro Leu Gly -> Pro Val Gly 3. Nonsense mutations change the codon for an amino acid to a STOP codon - result in premature termination of the protein at the STOP codon : CCC UUA GGU -> CCC UGA GGU Pro Leu Gly -> Pro STOP 4. Frameshift mutations occur when inserted or deleted bases change the open reading frame (ORF) of mRNA - such shifts in the ORF alter the remainder of the protein sequence. Frameshifts result from the insertion or deletion of 1 or 2 bases, but not 3 bases. Single base insertion: CCC U UA GGU -> CCC UGU AGG U Pro Leu Gly -> Pro Cys Arg Frameshift -> tRNA (Transfer RNA) Translation of the genetic code requires adaptor molecules (proposed by F. Crick, 1956, to RNA Tie Club) Each Amino acid is attached to its specific adaptor Read the codons in mRNA by base pairing Deliver the amino acid specified by the codon These adaptors are transfer RNAs (tRNAs) - confirmed by P. Zamecnik and M. Hoagland (1957) ...

27_Lieb_Translation

UNC, BIOL 201
Excerpt: ... some motors), etc. Page 1 of 4 Lieb- Biology 202 Translation & Protein Structure III. The universal genetic code Yanofsky studied mutations in E. coli trpA and found that positions of amino acid alterations were co-linear with the genetic map of the corresponding mutations: 5' nucleotide sequence 3' H2N amino acid sequence COOH The genetic code is non-overlapping: most mutations alter only a single amino acid. Crick et al. studied many different mutations due to addition of a single base pair (+1) or deletion of a single base pair (-1) . They concluded that the code must be made of triplets. Each of the 64 possible triplets is called a codon. Brenner was the first to determine a stop codon (UAG, often called amber codon), UGA and UAA are also stop codon s. There are no spaces or commas in the code. AUG is the start codon. It encodes methionine, so all translation begins with met (which is often removed from the polypeptide after synthesis). AUG can also occur within a translated sequence ...

7 translation4

CSU Northridge, BIO 561
Excerpt: ... 500 1000 3 2 1 -1 -2 -3 Reading frames in reverse direction <- Small lines = ATG start codons Long lines = stop codon s Open = no stop codon s! What's the chance occurrence of a stop codon ? Amanoacylated fMet-tRNA Other t-RNAs Translation extension Formyl group removal Peptide deformylase F-Met removal Methionine aminopeptidase Extension factors Ts Tu G GTP A, P, E sites Acceptor Polymerization Exit Translation termination Release factors Stop codon Polysistronic mRNA Transcribed as an operon >1 gene / mRNA transcript Translational coupling Translation of upstream gene is required for translation of the downstream gene STOP codon Polar mutations Mutation in upstream gene affects expression of downstream gene Example that stops tx 1) Premature terminator Example that stops tl of transcriptionally coupled downstream gene (s) in an operon 1) Nonsense mutation in first gene Point, frameshift, deletion Polar mutations Rho-dependent polarity Nons ...

Problem set 6 key

Arizona, BIO 340
Excerpt: ... of two bases, thus in one or the other sequences it is a frameshift mutation that is it shifts the reading frame for the translation process. If we assume the coyote sequence codes for a functional polypeptide then the bases read AUA CCC etc. (isoleucine proline), then the wolf sequence reads GGA UAA (glycine stop codon ). 2. 3. 4. Normally a stop codon would not be found in the coding sequence supporting the hypothesis that two G's were inserted into the wolf sequence for a frameshift mutation that then resulted in the presence of a stop codon in the sequence. Thus the wolf sequence is unlikely to code for a functional polypeptide depending on how near the 3' end of the coding region the two sequences given above are located. 5) see discussion above for number 4, but also a C to A or A to C change represents a base substitution that is also a transversion. It could also be a nonsense mutation, but consider discussion for number 4. A gene mutation changes an AT base pair to a CG base pair. This cau ...

7 translation2

CSU Northridge, BIO 42367
Excerpt: ... Long lines = stop codon s Open = no stop codon s! What's the chance occurrence of a stop codon ? Translation initiation Initiation factors SSU LSU SD sequence Correct spacing to start codon Amanoacylated fMet-tRNA Other t-RNAs Formyl group removal Peptide deformylase F-Met removal Methionine aminopeptidase Translation extension Extension factors Ts Tu G GTP A, P, E sites Acceptor Polymerization Exit Translation termination Release factors Stop codon Polysistronic mRNA Transcribed as an operon >1 gene / mRNA transcript Translational coupling Translation of upstream gene is required for translation of the downstream gene STOP codon Polar mutations Mutation in upstream gene affects expression of downstream gene Example that stops tx 1) Premature terminator Example that stops tl of transcriptionally coupled downstream gene (s) in an operon 1) Nonsense mutation in first gene Point, frameshift, deletion Polar mutations Rho-dependent polarity ...

Translation

UCSD, BILD 1
Excerpt: ... Genes to Proteins DNA mRNA Protein Transla4on Transcrip4on Vocab Codon set of 3 nucleo4des on mRNA that corresponds to the amino acid on the protein 5' AUG GUC AAA UAA 3' Met Val Lys Stop Start Codon AUG, codes for Methione Stop Codon s UAA, UAG, UGA, does not code for any amino acid Ribosomes consists of 2 subunits, large subunit and small subunit AminoacyltRNA A binding site, "acceptor" P Polype4dyltRNA binding site, "polype4de" E Exit tRNA carries amino acids/polypep4des and can transfer whatever it's carrying to another tRNA An4codon determines what AA it carries and which codon it pairs with When reading the codon chart, use the mRNA codon! Transla4on Ini4a4on Uses proteins called ini4a4on factors Elonga4on Elonga4on factors Termina4on Release Factors Ini4a4on 1. Small subunit scans mRNA from the 5' end un4l it finds the start codon, AUG Ini4a4on 2. Ini4al tRNA hydrogen bonds and aXach ...

lect08

Washington, CS 527
Excerpt: ... genetic information from the DNA to the ribosomes, where it is translated into protein. The polypeptide chains are elongated as the ribosomes move along the m-RNA molecules, with the 5 ends of the m-RNA being translated rst. LECTURE 8. GENE PREDICTION, I DRAFT 54 Figure 8.3: Genetic Code: Lists the codons which code for the amino acids. Also shows the START and STOP codon s. Note that ATG is the START codon and it also codes for Methionine. 8.3. Codons, Reading Frames and Translation Start/Stop There are 20 amino acids which are found in proteins in organisms. The coding by which a sequence of 4 bases represents a sequence of the 20 amino acids was a mystery for a long time and different and complicated coding schemes were suggested. As it turned out, the coding scheme used by nature is very simple. A triplet of bases, called codons represent an amino acid. Since there are 64 different possible codons, multiple codons represent the same amino acid. Besides those codons coding for amino acids, ...

lecture 14 2008- DNAII

Washington State, BIOL 102
Excerpt: ... NA) bonds form between adjacent amino acids 3) Termination Stop codon in mRNA moves into ribosome No corresponding anticodon (in tRNA) Proteins called "release factors" bind to ribosome mRNA and protein are released RNA- 3 types: Messenger RNA (mRNA) o Result of transcription o Takes "message" from nucleus to ribosome o Has codons Ribosomal RNA (rRNA) o Site of protein synthesis Transfer RNA (tRNA) o Has "anticodons" to mRNA o Each "anticodon" attached to appropriate amino acid o "transfers" amino acids to ribosomes o Helps build amino acid chain (protein) Key Points DNA replication - DNA "unzips" and 2 "daughter" strands formed by adding complementary bases Protein synthesis goes from genetic code to protein 1) Transcription Like replication, but RNA turned to mRNA 2) Editing mRNA edited (introns cut out) 3) "mature" mRNA attaches to ribosome 4) Translation tRNA "anticodons" bring appropriate amino acids complementary mRNA "codons" Amino acid chain formed Protein released ...

Lecture10

W. Alabama, CS 882
Excerpt: ... essarily easy. CS 882, Winter 2003 5 Prokaryote gene finding Recall how prokaryote genes are laid out: Coding region ATGCCAGAGTAG Whole gene Start codon: translated to methionine (M) Stop codon : tells the ribosome to stop translating RNA usually longer than what eventually is translated into the protein. The cell can find the start of the translated region. Can we find the signal, too? CS 882, Winter 2003 6 How to assess? Suppose we know all genes in a genome Suppose that we also have a predicted set of genes. Sensitivity = What fraction of genes are predicted exactly correctly? Specificity = What fraction of predicted genes are exactly real genes? Easy way to have high specificity: build a terrific arginase finder. (Sensitivity 0, specificity 100%) Reasonable gene finders dont predict overlapping genes, so its hard to get high sensitivity reasonably. CS 882, Winter 2003 7 Information sources Translation starts with ATG codon Translation ends with stop co ...

Lecture17

Maryland, CMSC 17
Excerpt: ... ere q s is background probability of character si in genome i i i Scoring motifs Note: Score usually presented as a log-likelihood (log(p(M|s1.sk) The p/q ratios in the motif are often called Position Specific Scoring Matrix (PSSM) The program psi-blast can search a sequence against a database of PSSMs Motifs are just one piece of the puzzle How do we handle more complex signals Gene finding/prediction Given a string of DNA, identify regions that might be genes Question: What does a gene look like? Start codon: ATG Stop codon : TGA, TAG, TAA Splicing: GT.intron.AG Also, DNA composition is different in genes mutations are more likely in the third position of codons. Simple gene finder (in bacteria) Find all stop-codons in the genome For each stop-codon, identify an in-frame start-codon upstream of it. Each section between a start and a stop is called an ORF open reading frame. The long ORFs are likely genes evolution pre ...

Lecture 36-Mutation

UWO, BIOLOGY 1222
Excerpt: ... nd thus no hydrogen bonding) and cut out the chunk with the mismatch and replaces it with the appropriate sequence. This is the repair or damage that persists after replication -This is a way that mutations are prevented. Mutations arise as a result of damage in DNA replication Silent Mutation -A change in a base of codon, but still codes for the same amino acid (genetic code is redundant) Missense Mutation -A change in the base of a codon, a different amino acid is coded for, meaning is changed -Codes for an amino acid, but the wrong one, so it may or may not have effects on the final protein Nonsense Mutation -Codon is changed to a stop codon -Encoded protein will be too short Insertion/Deletion -Reading frame is shifted -Devastating mutations -Start codon sets the frame for translating the codons downstream all the way to the stop codon -One gene can be inside another Huntington Disease -Ubiquitinlyated huntingtin proteins accumulate in neurons -Mutant proteins aggregate to form insoluble amyloid fib ...

MCB 2007 October 15th Lecture Notes

BC, BI 304
Excerpt: ... lude: triplet code tRNA anticodons bind to mRNA Cell-free translation experiments were used to determine the genetic code synthetic mRNAs were added to bacterial cell extracts, ATP, and ribosomes showed a redundant genetic code in order for transcription to occur, you need: an energy source (ATP for tRNAs, GTP for ribosomes) experiment to determine the genetic code: altered the mRNA sequence to determine what codons code for which protein alternated dinucleotides, kept increasing RNA complexity until a pattern was discovered codon variability mostly occurs in the third position: the wobble position results: a redundant genetic code consisting of 3 nucleotides (a codon) per amino acid (Y = pyrimidine, R= purine) o some animo acids have multiple codons, but variability mostly occurs in the third position, will usually be one of the same type of base (purine for purine, pyrimidine for pyrimidine) o stop codon s are statistically underrepresented an RNA sequence can be translated in ...

Camerini 2

UC Irvine, BIOL 97
Excerpt: ... Lecture 2: The Genetic Code Today, we will discuss the following: Demonstration of 3 bp reading frame (Brenner and Crick) using frameshift mutations Completion of the codon table by Nirenberg and Khorana The Start codon Discovery of Stop Codon s The Universal Genetic and Variants Codon bias Overview of protein synthesis tRNA structure 1 What is the biochemical basis for mutation? Mutation and alteration of the sequence of DNA. Chemical carcinogens and ionizing radiation can result in changes in the nuc leotide sequence of DNA . These mutations fall into three classes: 1. Changes in the identity of a single base pair; Base substitution: Spontaneous reversion can occur. 2. Insertion or deletion of a single base; Frameshift mutation: Spontaneous reversion is extremely rare. 3. Deletion of t wo or more bases; Deletion mutation: Spontaneous reversion is extremely rare. 2 The genetic code in brief How is the information coded? If we only have 4 bases in DNA (and in ...