Course Solutions And Notes - InternetApplication_R 02
| hwch11_a.txt Path: Colorado >> TLEN >> 5832 Fall, 2008 Description: 11-1 defender challenger First cost \"$1,300 \" First cost \"$6,400 \" expension \"$3,600 \" life 10 life 10 Salvage \"$4,000 \" MV / 4 heater $800 MARR 15% AC of defender= \"$3,600(A/P, 15%, 10) + $800(A/P, 15%, 10) =\" ... Date Added: 2009-06-03 15:03:52 |
| InternetApplication_R.ppt Path: FAU >> COP >> 3813 Fall, 2008 Description: I ntroduction to I nte t Applications rne Intro. to I nte t Applications rne 1 S eI nte t apps om rne E-m ail We b I nstant m ssaging e Re otelogin m P2P filesharing Multi-use ne r twork gam s e S am store vide clips tre ing d o I nte t te... Date Added: 2009-06-03 15:05:48 |
| small_room19-clean.txt Path: FAU >> DATA >> 051222 Fall, 2009 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Transitional/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\" xml:lang=\"en\" lang=\"en\"> <head> <meta http-equiv=\"Content-Type\" ... Date Added: 2009-06-03 15:05:51 |
| eti4448-04.ppt Path: FAU >> ETI >> 4448 Fall, 2008 Description: Prof. Roy Levow Session 4 The Work Breakdown Structure Uses for the WBS Generating the WBS Six Criteria to Test for Completeness in the WBS Approaches to Building the WBS Representing the WBS \"A hierarchical description of the work that must be do... Date Added: 2009-06-03 15:05:55 |
| Lab3.doc Path: Rose-Hulman >> ECE >> 300 Fall, 2009 Description: Rose-Hulman Institute of Technology Department of Electrical and Computer Engineering ECE 300 Signals and Systems Fall 2002 B.A. Black Insertion Loss of a Filter by Bruce A. Black with changes by Mark A. Yoder, Ed Doering and Bruce A. Black Objecti... Date Added: 2009-06-03 15:06:38 |
| 118sexdetshow2.ppt Path: Wesleyan >> BIOL >> 118 Fall, 2009 Description: Genetic, chromosomal basis for sex determination Gonad differentiation Associating plumbing Early stages of sex determination: internal Boy Indifferent Girl External What about the presence of a Y chromosome promotes testis differentiation? S... Date Added: 2009-06-03 15:07:08 |
| working_with_tables1.ppt Path: Arkansas Little Rock >> IFSC >> 3320 Fall, 2009 Description: Chapter 5. Working with Tables DML and Data Retrieval Statements Populate a Table Change Existing Data Remove Unnecessary Rows Data Retrieval from a Single Table Filtering, Sorting and Grouping of Data Single-row and Group Functions Adding a New Row... Date Added: 2009-06-03 15:07:11 |
| Lab10.doc Path: CUNY Baruch >> CSC >> 126 Fall, 2009 Description: Inlab Assignment 10 1. Complete the following code: (This program prompts user input a number, an operator(+,-,*,/) and another number, then output the expression and the calculated result.) #include<iostream> using namespace std; int main() { int ... Date Added: 2009-06-03 15:08:22 |
| activations.ppt Path: Binghamton >> CS >> 552 Fall, 2009 Description: Scheduler Activations (Anderson, et al.) Kenneth Chiu Introduction What is a thread? An \"execution context\" Thread 1 Stack User-level What happens when a thread blocks? Can you start a thread from userlevel? Can you stop a thread from userlev... Date Added: 2009-06-03 15:08:59 |
| Agenda12.doc Path: Wayne State University >> GST >> 2710 Fall, 2009 Description: Computers and Society Twelfth class: Agenda 12 I. Announcements A. Quiz 2 today, 60 minutes at the beginning of class. B. Final Exam period is Wednesday April 28 through Tuesday May 4. The Final Exam will be cumulative from the beginning of the semes... Date Added: 2009-06-03 15:09:52 |
| finalkey.doc Path: Rutgers >> CHEM >> 209 Fall, 2009 Description: Seat Assignment: _KEY_ Elementary Organic Chemistry - Chem 209 Final Exam December 17, 2001 Name (print): _ Name (sign): _ Student Number: _ Multiple Choice Answers (one letter per question, 3 points each) 9. A 10. B 11. D 12. E 13. E 14. C 15. D 16.... Date Added: 2009-06-03 15:12:06 |
| WQ.ppt Path: SUNY Buffalo >> LAW >> 874 Fall, 2009 Description: CATTARAUGUS CREEK WATERSHED QUALITY UB ENVIRONMENTAL LAW CLINIC WATERSHED POLLUTION Types of Pollutants (2002) Known Sources of Pollution (2002) Suspected D.O./Oxygen Demand Nutrients (nitrogen) Silt/Sediment Algal/Weed Growth... Date Added: 2009-06-03 15:12:10 |
| intro.ppt Path: SUNY Buffalo >> CSE >> 421 Fall, 2009 Description: Introduction to Operating Systems B. Ramamurthy (adapted from C. Egert\'s and W. Stallings\' slides) 05/13/09 CSE421, Spring 2001 1 An Operating System? What is an Operating System? A program that acts as an intermediary between a user of a com... Date Added: 2009-06-03 15:12:28 |
| ckvins.doc Path: SUNY Buffalo >> I >> 386 Fall, 2009 Description: C-KERMIT 5A INSTALLATION INSTRUCTIONS FOR VMS and OpenVMS 5A(189) Most Recent Update: Tue Aug 24 16:14:15 1993 F. da Cruz, C. Gianone, Columbia University, New York, NY Terry Kennedy, Saint Peters College, Jersey City, NJ And: Peter Mossel, James Stu... Date Added: 2009-06-03 15:12:31 |
| nn.ppt Path: DePaul >> HON >> 207 Fall, 2009 Description: Connectionist models Connectionist Models Motivated by Brain rather than Mind A large number of very simple processing elements A large number of weighted connections between elements (network) Parallel, distributed control Emphasis on learning... Date Added: 2009-06-03 15:14:50 |
| DNAbasecodes.txt Path: DePaul >> CSC >> 378 Fall, 2009 Description: >H_DJ0577P23 1 73524 74861 138640 GATCCCACCACAGCATTCCAGCCTGCGAGATTGAGGTAAACCCTGTGTAA AAAAATTAAAAAACTATCCAGGTGTGCAATAAAACATGAGGCTGGCTGGG CCCTACTGTAATCCCAGCACTTTGGGAGGCCGAGGCGGGAGGATGGATGG CTTGGGCTCAGGAGTTCGAGACCAGCCTGGGCAACATGACGAAACCCCGT CTCTACAGA... Date Added: 2009-06-03 15:15:07 |
| Midterm2007.doc Path: DePaul >> INSTRUCTOR >> 20090101 Fall, 2009 Description: Midterm This is an exam for a class that meets in a 1 hour session. An exam for a class that meets 1.5 hours or in the evenings should be longer. ISP 120 Quantitative Reasoning Autumn 2007 Section 105 DIRECTIONS: Open a Word document and save it as... Date Added: 2009-06-03 15:15:09 |
| c12tr.doc Path: DePaul >> ACCY >> 204 Fall, 2009 Description: Prof. K. Stevens Theory 1 Chap.11 I. Intangible assets A. Identifiable 1. copyrights 2. patents 3. trademarks 4. research and development (R & D) 5. organization costs B. Non-identifiable a. goodwill b. negative goodwill c. covenant not to compete I... Date Added: 2009-06-03 15:15:26 |
| HCI201_class8A.ppt Path: DePaul >> WEEK >> 201 Fall, 2009 Description: Multimedia and the World Wide Web HCI 201 Lecture Notes #8A What will we learn today? Review of what we have learned about CSS The <div> tag The <span> tag Formatting block-level element boxes Resizing the boxes Moving the boxes Image proce... Date Added: 2009-06-03 15:15:53 |
| HCI201_class8A.ppt Path: DePaul >> HCI >> 201 Fall, 2009 Description: Multimedia and the World Wide Web HCI 201 Lecture Notes #8A What will we learn today? Review of what we have learned about CSS The <div> tag The <span> tag Formatting block-level element boxes Resizing the boxes Moving the boxes Image proce... Date Added: 2009-06-03 15:15:53 |
| Form1.vb.txt Path: DePaul >> IT >> 236 Fall, 2009 Description: \' PhoneBook-NoArrays Example \' The user inputs a name. The application looks up the \' name in a file and outputs the corresponding phone number. Imports System.IO Public Class Form1 Inherits System.Windows.Forms.Form #Region \" Windows Form De... Date Added: 2009-06-03 15:16:14 |
| Lineage.ppt Path: DePaul >> GEOG >> 458 Fall, 2009 Description: Lineage February 13, 2006 Geog 458: Map Sources and Errors Outlines What is lineage? Role of lineage in quality assessment Contents of lineage Detecting errors in lineage What do standards say about lineage? SDTS CSDGM Exercise What is li... Date Added: 2009-06-03 15:16:16 |
| 360_IVA_FluidsS.doc Path: Norwich >> BI >> 360 Fall, 2009 Description: IV. - ALTERATIONS IN BODY FLUIDS THEIR DYSFUNCTION (most body fluids are at least 90% water) A.a. PHYSIOLOGY OF BODY FLUID VOLUMES, COMPOSITION & DISTRIBUTION A.a.A. GENERAL [fluid = water (solvent) + solutes (pro... Date Added: 2009-06-03 15:17:15 |
| trace18.txt Path: NMSU >> CS >> 471 Fall, 2009 Description: > (interpret tree) parent(bill,jake) |trying parent(bill,jake) with parent(x,y) | |x1=bill |y2=jake | mother(bill,jake) |trying mother(bill,jake) with mother(mary,shelley) |trying mother(bill,jake) with mother(mary,jake) Backtrack |trying par... Date Added: 2009-06-03 15:18:36 |
| geli_ch13_SM.doc Path: St. Thomas >> QMCS >> 419 Fall, 2009 Description: Accounting Information Systems, 7e1 SOLUTIONS FOR CHAPTER 13 Discussion Questions DQ13-1 Refer to effectiveness goals A and B shown in the control matrix in Figure 13.11. For each activity (accounts payable and cash disbursements), describe goals ot... Date Added: 2009-06-03 15:19:30 |
| s2.txt Path: St. Thomas >> C >> 130 Fall, 2009 Description: Moose Mountain 986 Mystery Mountain 650 Eagle Mountain 650 Ullr Mountain 350 Welch Village 360 Spirit Mountain 700 Keystone 3128 Steamboat Springs 3668 Sunday River 2340 ... Date Added: 2009-06-03 15:19:51 |
| s2.txt Path: St. Thomas >> CISC >> 130 Fall, 2009 Description: Moose Mountain 986 Mystery Mountain 650 Eagle Mountain 650 Ullr Mountain 350 Welch Village 360 Spirit Mountain 700 Keystone 3128 Steamboat Springs 3668 Sunday River 2340 ... Date Added: 2009-06-03 15:19:52 |
| Ambient_air072205.m1.ppt Path: Michigan >> EHS >> 500 Fall, 2008 Description: Ambient Air Pollution Thomas Robins, MD, MPH University of Michigan Environmental Health Sciences air-pollution 1 Air Pollution Definition: The addition of harmful substances to the atmosphere resulting in damage to the environment, human health, ... Date Added: 2009-06-03 15:20:50 |
| Cummins_prospectus_2005.ppt Path: Michigan >> NRE >> 701 Fall, 2008 Description: The Business Case for Sustainability: A financial model and strategic analysis for Cummins, Inc. Problem Statement: Cummins (CMI): diesel engine and power company with more than $6 billion in annual sales Despite CSR reports, company has ye... Date Added: 2009-06-03 15:21:13 |
| mw_birds_eye.txt Path: RIT >> PHYS >> 240 Fall, 2009 Description: Numerous observations, from microlensing surveys to space-based infrared views, suggest that our own Milky Way is a modestly barred spiral galaxy seen from within. Sky & Telescope diagram by Steven Simpson. ... Date Added: 2009-06-03 15:22:15 |
| answers_b.txt Path: RIT >> PHYS >> 200 Fall, 2009 Description: E(A) = 5 GeV = 8 x 10^(-10) J We can figure out its gamma factor from 2 E(A) = gamma(A) * m * c Plugging in m = 1.67 x 10^(-27) kg, we find gamma(A) = 5.33 We can th... Date Added: 2009-06-03 15:22:17 |
| proj11_for_lecture.ppt Path: Lincoln U. CA >> INFO >> 11 Fall, 2009 Description: Introduction Extensible Markup Language (XML) Uses tags to describe the structure of a document Simplifies the process of sharing information Extensible Stylesheet Language (XSL) XML is a subset of Standard Generalized Markup Language 1 Introdu... Date Added: 2009-06-03 15:26:10 |
| proj11_for_lecture.ppt Path: Lincoln U. CA >> INFO >> 3366 Fall, 2009 Description: Introduction Extensible Markup Language (XML) Uses tags to describe the structure of a document Simplifies the process of sharing information Extensible Stylesheet Language (XSL) XML is a subset of Standard Generalized Markup Language 1 Introdu... Date Added: 2009-06-03 15:26:10 |
| 522-classprojectdescription.ppt Path: Wisconsin >> ENGR >> 522 Fall, 2009 Description: 1 2 3 Additional Site Information System 1 - Contaminated Surface Soil Estimated volume 2000 cubic yards Estimated size (50 ft 200 ft 5 ft) System 2 - Pit Containing Contaminated Sludges and Soils Surface Area Pit size (overall) 1 acre Wast... Date Added: 2009-06-03 15:27:06 |
| peak.txt Path: Wisconsin >> BMSE >> 000270 Fall, 2009 Description: DU=C:/Bruker/XWIN-NMR, USER=cui, NAME=cq_00022, EXPNO=1, PROCNO=1 F1=8.622ppm, F2=3.622ppm, MI=0.50cm, MAXI=36.00cm, PC=4.000 # ADDRESS FREQUENCY INTENSITY [Hz] [PPM] 1 7242.9 ... Date Added: 2009-06-03 15:27:12 |
| sap_instructions.doc Path: Wisconsin >> SAP >> 2000 Fall, 2009 Description: Instructions for turning in SAP 2000 assignments For Moment Diagrams (follow same directions for shear diagrams): Display > Element forces/stresses > Frames. Choose Moment 3-3 Uncheck fill diagram and check show values on diagram Options > Colors ... Date Added: 2009-06-03 15:27:14 |
| sap_instructions.doc Path: Wisconsin >> SAP >> 340 Fall, 2009 Description: Instructions for turning in SAP 2000 assignments For Moment Diagrams (follow same directions for shear diagrams): Display > Element forces/stresses > Frames. Choose Moment 3-3 Uncheck fill diagram and check show values on diagram Options > Colors ... Date Added: 2009-06-03 15:27:15 |
| message-passing.doc Path: Binghamton >> CS >> 350 Fall, 2009 Description: Message Passing Concepts and Synchronization Applications CS 350 Fall 2002, 10/23/02, 9/17/03 Message Passing (Reference: Stallings, \"Operating Systems\", 4th ed., section 5.6) Below are some of the key ideas on this topic. Fundamental requirements f... Date Added: 2009-06-03 15:27:44 |
| rtdata.txt Path: Texas >> PSY >> 394 Fall, 2009 Description: 0.692 0.490 0.441 0.415 0.649 0.483 0.584 0.445 0.737 0.508 0.492 0.505 0.621 0.642 0.435 0.474 0.595 0.482 0.471 0.552 0.578 0.522 0.468 0.456 0.825 0.548 0.518 0.494 0.577 0.520 0.569 0.489 0.692 0.470 0.491 0.366 0.450 0.427 0.441 1.306 0.650 0.50... Date Added: 2009-06-03 15:32:02 |
| e19bhd-prt1_isoe.txt Path: UCLA >> E >> 0002 Fall, 2009 Description: * SEQUENCE OF EVENTS: YEAR-DAY OF YEAR -> 1999-042 GENERATED ON DAY OF YEAR = 041 PAGE 1 * PROJECT * COMMAND TABLE = PHASE #2 * GALILEO * FINAL APPROVED S... Date Added: 2009-06-03 15:32:09 |
| 05_Part2.ppt Path: Purdue >> ECON >> 370 Spring, 2008 Description: 5 MOVEMENT OF LABOR AND CAPITAL BETWEEN COUNTRIES Part 2 Effects of Immigration in the Long Run H-O Model Computers are capital intensive and shoes are labor intensive. As before, LS/KS > LC/KC and KC/LC > KS/LS Again we can see the PPF and sho... Date Added: 2009-06-03 15:32:57 |
| 5_Lorenzana_Timothy_Avionics.ppt Path: Purdue >> AAE >> 450 Fall, 2009 Description: Timothy Lorenzana 1/31/2008 Avionics Range Safety AAE 450 Spring 2008 Range Safety - Responsibilities Range Safety Officer (RSO) Ensure Public Safety During Launch Trajec... Date Added: 2009-06-03 15:33:05 |
| 5_Lorenzana_Timothy_Avionics.ppt Path: Purdue >> WEEK >> 450 Spring, 2009 Description: Timothy Lorenzana 1/31/2008 Avionics Range Safety AAE 450 Spring 2008 Range Safety - Responsibilities Range Safety Officer (RSO) Ensure Public Safety During Launch Trajec... Date Added: 2009-06-03 15:33:05 |
| week5.ppt Path: BYU >> CS >> 330 Fall, 2009 Description: What we will see today Tuples and records A list is a tuple A tuple is a record Binary ordered trees Search trees Trees 1 Tuples 2 Tuples X=state(1 a 2) X state 1 a 2 A tuple allows the combination of several values For example: 1... Date Added: 2009-06-03 15:33:13 |
| email1.txt Path: Bucknell >> ELEC >> 320 Fall, 2009 Description: From kozick@charcoal.eg.bucknell.edu Mon Sep 15 14:04 EDT 1997 Date: Mon, 15 Sep 1997 14:03:31 -0400 From: Kozick Rich <kozick@charcoal.eg.bucknell.edu> To: gamache@bucknell.edu, louie@bucknell.edu, dkline@bucknell.edu, rbrooks@bucknell.edu,... Date Added: 2009-06-03 15:35:40 |
| Proposal_Bisphenol-A_(FINAL).doc Path: Hudson VCC >> ENSC >> 202 Fall, 2009 Description: Reassessing the Risk of Bisphenol-A to Humans Kyla Bedard Doug Brown Katie Gibbons Kate Riley Stephanie Walsh Problem Statement: Bisphenol A (BPA) is a prevalent component of household plastic items but is known to disrupt endocrine processes, which ... Date Added: 2009-06-03 15:36:30 |
| U_700mb_July_90S_90N.txt Path: UC Davis >> ATM >> 240 Fall, 2008 Description: -90.00000 1.0891570E-02 -87.50000 -1.691450 -85.00000 -1.643131 -82.50000 -9.4168313E-02 -80.00000 1.191114 -77.50000 1.120288 -75.00000 0.3777741 -72.50000 0.408887... Date Added: 2009-06-03 15:38:19 |
| mem-manage.ppt Path: Acton School of Business >> GW >> 4314 Fall, 2009 Description: M emor y M anagement and Vi r tual M emor y Fr ed Kuhns (fr edk@ l .wustl .edu, http:/ / www.ar l .wustl .edu/ ~fr edk) ar Appl i ed Resear ch L abor ator y Depar tment of Computer Sci ence and Engi neer i ng Washi ngton Uni ver si ty i n St. L oui... Date Added: 2009-06-03 15:38:21 |
| p1.doc Path: Wisconsin >> ENGR >> 101 Fall, 2009 Description: EPD 101 Contemporary Issues in the Engineering Profession Spring 2004 Project I: Job Connection Assignment Attend the College of Engineering Job Connection event with one or more of your team members for at least one hour and ask questions of the co... Date Added: 2009-06-03 15:39:39 |
| September%202006.doc Path: Wisconsin >> DOCUMENT >> 29169 Fall, 2009 Description: IceCube Project Monthly Report September 2006 Accomplishments A series of final readiness reviews were completed in preparation for the upcoming construction season at the South Pole. These reviews covered drilling, installation, counting house activ... Date Added: 2009-06-03 15:39:52 |
| 9-13.txt Path: Wisconsin >> SECTION >> 318 Fall, 2009 Description: Audiology - science of hearing and balance Focus on the inner ear Parameters: tool for education complex enough to teach basic functions audio-impaired education students highschool, grade school Teach kids how damage can happen in the ear i... Date Added: 2009-06-03 15:40:56 |
| Introduction.ppt Path: Mich Tech >> EE >> 5900 Fall, 2008 Description: Advanced Algorithms for Robust VLSI CAD Dr. Shiyan Hu Office: EERC 731 shiyan@mtu.edu Introduction Adapted and modified from Digital Integrated Circuits: A Design Perspective by Jan M. Rabaey, Anantha Chandrakasan, and Borivoje Nikolic. EE141 Digi... Date Added: 2009-06-03 15:42:25 |
| lab14.doc Path: Mich Tech >> FW >> 2051 Fall, 2008 Description: FW2051 Field Techniques Other Measurement Tools Objective: To learn basic operation of: Trimble/Recon computers, relaskop, hip chain, increment borer and scaling stick. Materials: Relaskop, hip chain, increment borer, scaling stick, Trimble GPS, Rec... Date Added: 2009-06-03 15:42:37 |
| chapter_15au.ppt Path: Mich Tech >> CH >> 1120 Fall, 2008 Description: Chemistry, The Central Science, 10th edition Theodore L. Brown; H. Eugene LeMay, Jr.; and Bruce E. Bursten Chapter 15 Chemical Equilibrium John D. Bookstaver St. Charles Community College St. Peters, MO 2006, Prentice Hall Equilibrium The Concept... Date Added: 2009-06-03 15:42:44 |
| midtermonesummer2008.doc Path: Wisconsin >> ECON >> 101 Fall, 2008 Description: Economics 101 Summer 2008 First Midterm 6/5/08 Name _ Day and Time of Discussion Section _ Student ID Number _ Version 1 DO NOT BEGIN WORKING UNTIL THE INSTRUCTOR TELLS YOU TO DO SO. READ THESE INSTRUCTIONS FIRST. You have 90 minutes to complete th... Date Added: 2009-06-03 15:43:06 |
| homework6.doc Path: Alabama >> PY >> 603 Fall, 2008 Description: Stat II Homework 6 Due November 8, 2007 Sequential and Set Regression Problem 1 Sequential Regression The data set NUTRITION.sav (along with its documentation NUTRITION.doc) is available on the class website. We want to predict the percent of suppor... Date Added: 2009-06-03 15:43:07 |
| Project1Raytheon.doc Path: UCSD >> ECE >> 191 Fall, 2004 Description: Spring 2006 ECE 191 Project Sponsor: Raytheon Mentor: Michael D Deshler Deployable Wireless Access Point (DWAP) or Man-Portable Adaptable Distribution Interface (MADI) In modern command and control LAN environments, command and control data is multic... Date Added: 2009-06-03 15:43:12 |
| Ch11.ppt Path: Clayton >> ITMM >> 4405 Fall, 2009 Description: 05/14/09 Chapter 11: Business Organization David Baumer, NCSU BUS 504, Spring 2001 Business Organizations Sole Proprietorships This is an easy form of business to organize The owner is the business If the business is sued, the owner is sued Th... Date Added: 2009-06-03 15:43:27 |
| Lecture30.ppt Path: UF >> PHYS >> 4523 Fall, 2009 Description: Lecture 30 The Planck Distribution Chapter 8, Friday March 28th The Free energy of a photon gas Radiation pressure Quiz Einstein and Debye models of vibrations in solids Reading: All of chapter 8 (pages 160 - 185) Homework 8 due Mon. Mar. 31st... Date Added: 2009-06-03 15:43:32 |
| Shanna.ppt Path: Washington >> COM >> 538 Fall, 2009 Description: RFID Competes With Privacy of Healthcare Records Shanna Taylor COM538 What to expect in 13 minutes Defining RFID Applications of RFID Overview of how healthcare records are kept Examples of privacy Issues Future of RFID Conclusion 05/14/09 ... Date Added: 2009-06-03 15:46:57 |
| handle.ppt Path: Washington University in St. Louis >> CSE >> 332 Fall, 2009 Description: Reference counting, handles and the STL Fred Kuhns Applied Research Laboratory, Department of Computer Science and Engineering, Washington University in St. Louis fredk@cse.wustl.edu WASHINGTON UNIVERSITY IN ST LOUIS Washington Background In ... Date Added: 2009-06-03 15:49:56 |
| 1984.txt Path: Washington University in St. Louis >> DATASET >> 1970 Fall, 2009 Description: * 1984 data * DATA LIST FILE=\'C:\\TechnicalAppendix/da8429.p52\' / V1 1-4 V2 5-5 V3 6-7 ... Date Added: 2009-06-03 15:50:14 |
| ESM202Lecture6_2008.ppt Path: UCSB >> ESM >> 202 Winter, 2008 Description: Global carbon cycle: reservoirs, fluxes and processes 1 IPCC [2001] 2 Global Carbon Cycle 3 Carbon cycle Role of biota Key processes: Photosynthesis Autotrophic respiration Aerobic oxidation Anaerobic oxidation Methanogenesis 4 Reservoir size... Date Added: 2009-06-03 15:51:08 |
| cartozian.doc Path: UCSB >> READINGS >> 115 Fall, 2009 Description: UNITED STATES v. CARTOZIAN District Court, D. Oregon 6 F.2d 919; 1925 U.S. Dist. LEXIS 1183 July 27, 1925 WOLVERTON, District Judge. This is a suit on the part of the government to cancel defendant\'s certificate of naturalization, on the ground that,... Date Added: 2009-06-03 15:51:28 |
| intro.ppt Path: N.C. State >> CSC >> 570 Fall, 2008 Description: Introductory Concepts Rudra Dutta ECE/CSC 570 - Fall 2008, Section 001 Digital Communication Digital representation of information Reduces diverse information to same form Allows infinite replication Allows general purpose manipulation (compu... Date Added: 2009-06-03 15:51:31 |
| homework3.txt Path: UCSB >> CS >> 162 Fall, 2009 Description: CS162 Homework #3 = Due: Thursday, February 3, 2000, 9:30 a.m. (Note the due time! ABSOLUTELY NO LATE ASSIGNMENTS! Do not use the homework box! Bring your homework to class!) Total: 60 points 1. (10 points) Consider the following declarations: ty... Date Added: 2009-06-03 15:51:56 |
| chp8-hmwk_grad.doc Path: N.C. State >> PA >> 598 Fall, 2008 Description: Spring 2006 Government and Nonprofit Accounting PA 598 Chapter Homework solutions Chapter 8* Questions 1. Unlike businesses, governments have the power to tax and, at least in theory, their available resources are limited only by the wealth of thei... Date Added: 2009-06-03 15:52:24 |
| series_a_term_sheet.DOC Path: UCSB >> ENGR >> 191 Fall, 2009 Description: MEMORANDUM OF TERMS SERIES A PREFERRED STOCK OF XYZ, INC. _, 200_ Offering Terms Issuer: Securities to be Issued: XYZ, Inc. (the \"Company\"), a California corporation Minimum of _ shares up to a maximum of _ shares of Series A Preferred Stock (\"Series... Date Added: 2009-06-03 15:52:53 |
| cs170_NN_big_test_38.txt Path: UC Riverside >> CS >> 170 Fall, 2008 Description: 1.0000000e+000 2.7183431e+001 -5.0501125e+000 -6.9092946e+000 1.2847999e+002 3.3920506e+001 3.9304245e+001 1.5636913e+001 -4.6187589e+001 -1.7256938e+001 -4.5612694e+001 8.5971480e+000 -5.2699207e+001 -3.5614731e+001 -2.3555520e+001 -3.555531... Date Added: 2009-06-03 15:53:56 |
| hw4-soln.doc Path: USC >> ISE >> 330 Fall, 2008 Description: University of Southern California Daniel J. Epstein Depa rtment of I ndustrial and Systems Engineering ISE 330: I n t roduction to Operations Research Homework 4 Solution: prepa red by Jie L iu Homework 4: 4.7-5, 5.1-17 4.7-5 (a) Bas Var Z X4 X5 X6 ... Date Added: 2009-06-03 15:56:27 |
| TM_TRR_S08b_T15_V1.1.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Proctor and Test Site Tracking System Training Materials (TM) Team 15 Name Mingoo Kim Heeseo Chae Soojin Kim Hsiu-hui Hsu Maged Boctor Role Project Manager (mingoo.kim@usc.edu) Operational Concept Engineer (hchae@usc.edu) Prototype Manager (sooji... Date Added: 2009-06-03 15:58:00 |
| SSRD_LCA_F04a_T03_V02.40.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: System and Software Requirements Definition (SSRD) Online Bibliographies on Chinese Religions in Western Languages Team 3 Stephan Pak : Project Manager Atul Vij : Requirements Rukmani khajuria : Operational Concept Puneet khurania : Prototype Nanta... Date Added: 2009-06-03 15:58:21 |
| KNOWTHIS1.doc Path: Nevada >> NRES >> 497 Spring, 2008 Description: NRES 497/697 Know this and you will ace Quiz 1 on 8 Feb 2008 Factors of soil formation Soil water fractions - field moisture capacity, permanent wilting, plant available water, available water capacity How plant available water varies in in clay... Date Added: 2009-06-03 15:59:58 |
| Monte_Carlo.ppt Path: UNC >> COMP >> 238 Fall, 2008 Description: Monte-Carlo Methods Lastra, 05/15/09 Slide 1 Topics Kajiya\'s paper Showed that existing rendering methods are approximations of rendering equation. Introduced path tracing. More recent work Lafortune, Veach. Lastra, 05/15/09 Slide 2 Kajiya... Date Added: 2009-06-03 16:02:00 |
| script02.txt Path: UNC >> PHYS >> 006 Fall, 2009 Description: please do # The following script does the same as the previous one # except that it will write results in a file # so that you don\'t have to click 47 times on OK. # besides you can keep track of results, which is convenient. open pdb from download ... Date Added: 2009-06-03 16:03:45 |
| 012GradSchool.ppt Path: UNC >> COMP >> 136 Fall, 2009 Description: Graduate School Why go? When go? 1 University of North Carolina Chapel Hill COMP 136 05/15/09 Graduate Studies In Computer Science (at UNC) Masters Degree MS 1.53 years Doctoral Degree Ph.D. 47 years 2 University of North Carolina Cha... Date Added: 2009-06-03 16:04:53 |
| CHEM362_HW4_S08.doc Path: Texas A&M >> CHEM >> 362 Fall, 2008 Description: HW 4 CHEM 362 Available: Feb. 18, 2008 1. Draw all of the isomers, geometrical and optical for the following: a. [Co(en)2Cl2]+ b. [Co(en)2NH3Cl]2+ c. [Co(en)(NH3)2Cl2]2+ Draw the molecular structures of the following complexes: a. cis-dichlorotetracy... Date Added: 2009-06-03 16:05:00 |
| OverCancer_1003.ppt Path: UNC >> BIOLOGY >> 133 Fall, 2009 Description: Ove w of Le m rvie uke ias/Lym phom as and C r in Ge ral ance ne Friday, Octobe 10, 2003 r ading Re Le m uke iaI ntroduction (pp 38-39) De finition and Exam s of Abnorm C lls ple al e Hype rplasia: An incre in thenum r of ce and usually in them of ... Date Added: 2009-06-03 16:05:38 |
| wetlands.pdf Path: Texas A&M >> WFSC >> 406 Fall, 2008 Description: SP-316 8/07 TECHNIQUES FOR CONSTRUCTION M University, College Stati... Date Added: 2009-06-03 16:06:44 |
| HBWideNarrowLetters.doc Path: SMU - Cox School of Business >> HB >> 7300 Fall, 2009 Description: jxhDB a THE NARROW LETTERS: nyzwG LETTERS THAT GO \"OUTSIDE THE BOX\": qla FINAL LETTERS THAT GO \"OUTSIDE THE BOX\": #@!~$a ... Date Added: 2009-06-03 16:07:33 |
| lecture8.ppt Path: UVA >> CS >> 205 Fall, 2008 Description: cs205: engineering software university of virginia fall 2006 Data Abstraction www.cs.virginia.edu/cs205 David Evans Managing Complexity Modularity Divided problem into procedures Used specifications to separate what from how A big... Date Added: 2009-06-03 16:07:48 |
| java-interfaces-collections.ppt Path: UVA >> CS >> 494 Fall, 2008 Description: CS494 Interfaces and Collection in Java 1/20/03 A2-1 Java Interfaces Note that the word \"interface\" Is a specific term for a language contstruct Is not the general word for \"communication boundary\" Is also a term used in UML (but not in C+) 1... Date Added: 2009-06-03 16:07:55 |
| ch7m.ppt Path: UVA >> CS >> 662 Fall, 2008 Description: Storing Data: Disks and Files Chapter 7 \"Yea, from the table of my memory I\'ll wipe away all trivial fond records.\" Shakespeare, Hamlet Database Management Systems, R. Ramakrishnan and J. Gehrke 1 Disks and Files y y DBMS stores information on ... Date Added: 2009-06-03 16:08:00 |
| shading_example.doc Path: Delaware >> CIS >> 640 Fall, 2009 Description: Example 5-1 Simple Illumination Model Recalling Fig. 5-5 assume that at point P on the surface the normal, light and sight vectors are n= j L = -i + 2 j k S = i + 1.5 j + 0.5k By insection the reflection vector R is then R = i + 2j + k Assuming that... Date Added: 2009-06-03 16:10:26 |
| Chap07.ppt Path: CSU Bakersfield >> MIS >> 300 Winter, 2008 Description: Chapter 7 ENTERPRISE INFRASTRUCTURE, METRICS, AND BUSINESS CONTINUITY PLANNING Building and Sustaining the Dynamic Enterprise McGrawHill 2008 The McGrawHill Companies, Inc. All rights reserved. STUDENT LEARNING OUTCOMES 1. 2. 3. 4. Describe how... Date Added: 2009-06-03 16:13:07 |
| study_final.doc Path: SHSU >> CJ >> 742 Fall, 2008 Description: Study Questions Overview of Multivariate Statistics 1. Define, compare, and contrast the concepts of statistical significance and operational significance. Give an example. 2. Using examples, define and contrast the terms univariate, bivariate, and m... Date Added: 2009-06-03 16:14:12 |
| IslamicInfluence.ppt Path: CSU Sacramento >> AIA >> 2 Fall, 2009 Description: Islamic Influences in Indian Art Architecture Within a few centuries after the death of the prophet Muhammad, the center of Islamic power had shifted from Arabia to Persia (roughly corresponding to the present da... Date Added: 2009-06-03 16:14:44 |
| ACCY161_Fa08_E01_A_KEY.doc Path: CSU Sacramento >> ACCY >> 161 Fall, 2008 Description: ACCY 161 Fall 2008 Exam #1 September 30th KEY 1. Fiscal accountability is found in: a. the governmental-wide financial statements b. the governmental fund financial statements c. all the fund financial statements d. both a. and b. e. both a. and ... Date Added: 2009-06-03 16:14:48 |
| JSL10B.ppt Path: Pittsburgh >> JSL >> 10 Fall, 2009 Description: Lesson 10B te iru zonziru to (together with); ni/kara (source) Lesson 10B-te iru Gerund Form Indicates that the one action has either happened or begun prior to the occurrence of the next action. iru indicates animate presence; state \"be\" \"is ... Date Added: 2009-06-03 16:16:31 |
| paper.doc Path: SHSU >> STAT >> 533 Fall, 2009 Description: Incomplete Block Designs: factorial Treatment Designs Yofeng Nie STA 533 Dr. Butar Abstract 2 n and 3 n factorial experiments is just a special case of general factorial experiments in which each factor has just two or three levels (two or three trea... Date Added: 2009-06-03 16:19:55 |
| Bachelor\'sDegreeMarineBiology.doc Path: University of Alaska Fairbanks >> FY >> 03 Fall, 2009 Description: ACADEMIC PLANNING INITIATIVE Title: Bachelor\'s Degree in Marine Biology Units: School of Fisheries and Ocean Sciences, Biology & Wildlife Dept., U.A. Museum Submitted by: SFOS faculty: Dr. Shannon Atkinson, Dr. Michael Castellini, Dr. Ray Highsmith, ... Date Added: 2009-06-03 16:20:33 |
| D_concept.txt Path: Pratt >> YLEE >> 19 Fall, 2009 Description: info=Everyone has a story to tell. From New York sophistication to the rolling plains of the Midwest, this unique and eclectic blend of city meets country is celebrated in the essence of Silo Cafe. Silo Cafe creates an environment that is warm and we... Date Added: 2009-06-03 16:22:12 |
| CSC651_2status.ppt Path: Austin CC >> C >> 650 Fall, 2009 Description: February 26,2003 Automated Electronic Invoicing System Presented By: Richard J. Urlakis Jr. Agenda AEIS Richard J. Urlakis Jr. 02.26.2003 Agenda Project Status Overview Project Issues Project Risks Project Tasks Project Summary AEIS Richar... Date Added: 2009-06-03 16:22:54 |
| land.det.txt Path: Stockton >> STK >> 2153 Fall, 2009 Description: +-+ | Layer: land.det Date of Processing to GRASS: Dec 22 16:48:01 1993| | Date of Processing to ARC/INFO: Jan 29 12:53 1996| | | | Ti... Date Added: 2009-06-03 16:23:06 |
| IPT2006_01A_Phase3_GAARD_Final_Review_Presentation_rev05.ppt Path: Alabama Huntsville >> IPT >> 2006 Fall, 2009 Description: Gravity Assessment And Radiation Detection Final Review April 21,2006 Project Office (J. Rimmer, S. Butson, D. Calvert, L. Trotman) Objective: The Robotic Lunar Lander mission objective is to measure the partial gravity and radiation on the lunar... Date Added: 2009-06-03 16:23:39 |
| google_rewrite.doc Path: Simmons >> BILDER >> 1 Fall, 2009 Description: Original Company Overview Google\'s mission is to organize the world\'s information and make it universally accessible and useful. As a first step to fulfilling that mission, Google\'s founders Larry Page and Sergey Brin developed a new approach to onli... Date Added: 2009-06-03 16:24:12 |
| EconomicPaper2.doc Path: St. Johns >> SBAGU >> 221 Fall, 2009 Description: Unsolicited Settings By: Shaifur Bagum Between the late 1700s and the early 1800s, the newly liberated and premature America was mostly composed of farmers and small business. The factories in Europe where production was on unimaginable immense scale... Date Added: 2009-06-03 16:24:13 |
| BPDef2_2.doc Path: Marist >> M >> 111 Fall, 2009 Description: Banzhaf Power The Banzhaf Power Index provides a way of numerically assessing the relative power of the voters in a particular Yes-No voting system. The main intuition here is that voter only has power when his vote in truly necessary. We say that vo... Date Added: 2009-06-03 16:26:04 |
| 32.ppt Path: Emory >> BAHS >> 501 Fall, 2009 Description: Glycogen Metabolism Glycogen synthesis Glycogen degradation Regulation of glycogen metabolism Glycogen storage diseases Alec Hodel 10/26/01 Metabolic pathways (in 3D!) http:/www.hfni.gsehd.gwu.edu/~mpb/index.html Glycolysis animation http:/www.n... Date Added: 2009-06-03 16:26:34 |
| Chapter2.ppt Path: Southern New Orleans >> NHTEXT >> 1 Fall, 2009 Description: An Introduction to Programming and Object Oriented Design using Java 2nd Edition. May 2004 Jaime Nio Frederick Hosch Chapter 2: Defining a Simple Class Object Interaction: Clients and Servers Objectives: After studying this chapter you should unde... Date Added: 2009-06-03 16:26:50 |
| Chapter2.ppt Path: Southern New Orleans >> NHTEXT >> 5 Fall, 2009 Description: An Introduction to Programming and Object Oriented Design using Java 2nd Edition. May 2004 Jaime Nio Frederick Hosch Chapter 2: Defining a Simple Class Object Interaction: Clients and Servers Objectives: After studying this chapter you should unde... Date Added: 2009-06-03 16:26:51 |
| LA_Teacher_Assessment_Program.doc Path: SUBR >> FILE >> 475 Fall, 2009 Description: Southern University, Baton Rouge Analysis of 1999.00 Appendix Louisiana Teacher Assistance and Assessment Program School Year Assessment Semester Results for Degree This appendix presents the total number of teachers, the number of teachers who me... Date Added: 2009-06-03 16:27:22 |
| feedbackmessage.txt Path: Dickinson State >> CS >> 345 Fall, 2009 Description: Thank you for the feedback. We will do our best to answer you or to take corrective measures in a timely manner. ... Date Added: 2009-06-03 16:28:49 |
| class-scav-hunt.doc Path: UMass Dartmouth >> BIO >> 600 Fall, 2009 Description: Classification Scavenger Hunt Name_ Purpose: Students will collect various items and organize/categorize them into classifications/sets. Materials: Writing utensil and paper. The same number of slips of paper as the number of groups performing th... Date Added: 2009-06-03 16:29:24 |
| readme.txt Path: UMass Dartmouth >> ICASSP >> 1998 Fall, 2009 Description: ICASSP98 PROCEEDINGS ON CDROM - README.TXT README.PDF Last minute information April 14, 1998 *) The Acrobat files on this CDROM have file names which are based on the paper number of the manuscript (and NOT its ... Date Added: 2009-06-03 16:29:25 |
| PREC.AG.ppt Path: Oklahoma State >> SOIL >> 4213 Fall, 2008 Description: Genetically Modified Organisms By Patrick Hurley Genetically Modified Organisms Definition: A genetically modified organism (GMO) is an organism whose genetic structure has been altered by incorporating a gene that will express a desirable t... Date Added: 2009-06-03 16:35:48 |
| ProjectFinal.doc Path: Minnesota >> DHARASURKA >> 08 Fall, 2009 Description: Title: Further evaluation of the Gogate et al synchrony measurement algorithm. Name: Anagha Dharasurkar Advisor: Christopher G. Prince Introduction: Psychological evidence shows that audio-visual synchrony influences the localization of acoustic and... Date Added: 2009-06-03 16:35:55 |
| holes.txt Path: University of West Georgia >> FY >> 04 Fall, 2009 Description: HOLES IN WALLS/FLOORS/CEILINGS Breaches in walls, floors, and ceilings should be fixed as soon as practical. These holes encourage the harborage of insects and varmin, and present moisture control problems as well.... Date Added: 2009-06-03 16:37:17 |
| 11-6-08 Path: Allegheny >> ECON >> 290 Fall, 2008 Description: Entrepreneurship Class Notes 11/6/08 VC firms will take an equity stake in private startup companies in exchange for funding often have experience in a particular area General partners 2% managing fee and 20% of the profits Limited partners ... Date Added: 2009-06-03 16:37:28 |
| KellerCh2EQsPart1.ppt Path: N. Arizona >> GLG >> 112 Fall, 2008 Description: Earthquakes Chapter 2 What is an earthquake? Vibration of Earth caused by sudden release of energy Usually displacement along faults (fracture) Also due to volcanoes, meteorite impacts, nuclear explosions Stress builds up until rock breaks/f... Date Added: 2009-06-03 16:38:08 |
| KellerCh2EQsPart1.ppt Path: N. Arizona >> GLG >> 25 Fall, 2009 Description: Earthquakes Chapter 2 What is an earthquake? Vibration of Earth caused by sudden release of energy Usually displacement along faults (fracture) Also due to volcanoes, meteorite impacts, nuclear explosions Stress builds up until rock breaks/f... Date Added: 2009-06-03 16:38:08 |
| T070138-00.doc Path: Caltech >> T >> 070138 Fall, 2009 Description: LASER INTERFEROMETER GRAVITATIONAL WAVE OBSERVATORY LIGO Laboratory / LIGO Scientific Collaboration LIGO- T070138-00-K ADVANCED LIGO Ribbon/Fibre Length Budget 28 Aug 2007 Mark Barton, Alan Cumming, Alastair Heptonstall, Russell Jones, Ken Strai... Date Added: 2009-06-03 16:40:44 |
| Lecture12.ppt Path: Caltech >> PH >> 1 Fall, 2009 Description: Oscillatory Motion Spring d x k =- x 2 dt m Solution x = A cos t + B sin t k 2 = m 2 T= 1 f = T 2 Spring d x k =- x 2 dt m Solution x = A cos t + B sin t k 2 = m 2 T= 1 f = T 2 Spring d x k =- x 2 dt m Solution x = A cos t + B sin t k 2 = m 2... Date Added: 2009-06-03 16:41:26 |
| M030259-00.doc Path: Caltech >> M >> 030259 Fall, 2009 Description: LIGO M030259-00-M LSC Six-Month Progress Report Organization Institute of Applied Physics (IAP) of the Russian Academy of Sciences at Nizhny Novgorod Report Date August 15, 2003 Attachment C Laser/Optics Development Group / Feb 2003 - Aug 2003 a) A ... Date Added: 2009-06-03 16:41:27 |
| Lecture-9-2008-Bi-CNS150.ppt Path: Caltech >> BI >> 150 Fall, 2008 Description: Superfamilies of Ligandgated Ion Channels 1. Cysloop Receptors Nicotinic ACh receptors 5HT3 receptors GABAA and GABAC receptors Glycine receptors AMPAtype Receptors Kainatetype Receptors NMDAtype Receptors 2. Ionotropic Glutamate Receptors 3... Date Added: 2009-06-03 16:42:36 |
| hw3sol.doc Path: Auburn >> E >> 6270 Fall, 2009 Description: ELEC 6270-001 Low-Power Design of Electronic Circuits Fall 2007 Homework 3 Solution Assigned 11/12/07, due 11/16/07 Problem 1: The following circuit is implemented in 65 nm CMOS technology, which suffers from high leakage. For high speed, only low t... Date Added: 2009-06-03 16:43:38 |
| lp1.ppt Path: Auburn >> E >> 6270 Fall, 2009 Description: Power Reduction Technique Parallelism in circuits using duplication of logic ELEC 6270 By Sreekumar Menon OUTLINE Problem Definition Steps for Implementation Background Information Experimental Results Theoretical Results Conclusion Lessons... Date Added: 2009-06-03 16:43:38 |
| p27219080522.txt Path: Auburn >> DIGDATA >> 1908 Fall, 2009 Description: 272 I recommend that the action of the Executive Committee concerning Professor Mitcham and Professor Brown be confirmed. After extended conrrespondence and most painstaking investigation, the name of Doctor W. E. Hinds was presented to the Executi... Date Added: 2009-06-03 16:44:54 |
| RSOP4TastingMethod.doc Path: Iowa State >> B >> 66771 Fall, 2009 Description: Standard Operating Procedure Tasting Method Policy: All restaurant employees will use the correct and sanitary tasting method to prevent contamination and ensure food safety. Procedure: All restaurant employees must: Use a Two Spoon Tasting Method: 1... Date Added: 2009-06-03 16:45:33 |
| aug30-2.txt Path: Iowa State >> CS >> 362 Fall, 2009 Description: Com S 362 August 30 - Lecture notes addendum Example use cases * Example # 1 * Library Administration Problem - A system is needed to administer a lending library. Membership is required to borrow books, but not for reading them in the libra... Date Added: 2009-06-03 16:46:57 |
| FabiosaLecture8PerfectCompetition.ppt Path: Iowa State >> ECON >> 101 Fall, 2008 Description: Perfect Competition Lecture by: Jacinto Fabiosa Fall 2005 Market Structure Sellers want to sell at the highest possible price Buyers seek lowest possible price All trade is voluntary When we observe buyers and sellers in action See that differ... Date Added: 2009-06-03 16:47:32 |
| doc00078.doc Path: New Hampshire >> T >> 2 Fall, 2008 Description: Taking a Closer Look at SAFETEA-LU By Robert J. Fogel Senior Legislative Director The following analysis of the Safe, Accountable, Flexible, and Efficient Transportation Safety Act: A Legacy for Users (SAFETEA-LU), the nation\'s new transportation law... Date Added: 2009-06-03 16:50:27 |
| cs201-comparators-s08.ppt Path: UVA >> CS >> 201 Fall, 2008 Description: CS201: Software Development Methods Comparators Topics: Textbook readings: Comparable and Comparator interfaces in JCF Function objects More from MSD, Chapter 9 Pages 641647 Pages 650651 up to 9.4.1; Pages 666671. Back to Java: Comparabl... Date Added: 2009-06-03 16:50:53 |
| microprogramming.ppt Path: UVA >> CS >> 333 Fall, 2008 Description: Microprogramming C S D A 2/e Microprogramming Main Points/Terminology Difference between hardwired control unit and microprogrammed control unit Microprogram Microinstruction Macroinstruction Control store and micro-branching Horizontal an... Date Added: 2009-06-03 16:51:07 |
| 2001-11.doc Path: UVA >> CAP >> 2001 Fall, 2009 Description: 2001 Systems Engineering Capstone Conference University of Virginia THE DEVELOPMENT OF METRICS FOR THE INFORMATION TECHNOLOGY DEPARTMENT OF AN INTERNET SERVICE PROVIDER Student Team: Carolyn Bleck, Eugene Choi, Shantanu Rudra, Rohit Saroop, Mousmi ... Date Added: 2009-06-03 16:51:28 |
| ss_economy_2_ppt.ppt Path: S.E. Louisiana >> ETEC >> 644 Fall, 2008 Description: US Economy Free Enterprise System What is an economy? An economy is the resources of a country, state, region, or community and how the resources are managed. What is a free enterprise system? A free enterprise system is one in which busines... Date Added: 2009-06-03 16:53:08 |
| 11-16-05.txt Path: BU >> LOG >> 05 Fall, 2009 Description: COLLOQUIUM Computer Science Department, Boston University Speaker: Dina Katabi MIT Date: Wednesday, November 16 Time: 11:00 Place: Room MCS 135, 111 Cummington Street (for directions, s... Date Added: 2009-06-03 16:54:44 |
| 2007-November.txt Path: BU >> CS >> 3 Fall, 2009 Description: From liulk at cs.bu.edu Thu Nov 15 13:57:12 2007 From: liulk at cs.bu.edu (LiKai Liu) Date: Thu, 15 Nov 2007 13:57:12 -0500 (EST) Subject: [Church-active] JFP Vol 6 #1 Message-ID: <Pine.LNX.4.64.0711151355550.28791@mantar.bu.edu> Hello, Does anyon... Date Added: 2009-06-03 16:55:17 |
| ex65b.txt Path: Pittsburgh >> NEW >> 2 Fall, 2009 Description: #- this is example 6.5 using ss1 -# #!# #- assumes ss1 has been sourced -# #!# #~ detailed comments are in ex65.txt ~# # the only difference here is that # A is an array of num 1x1 matrices (see line 17) #- generate data - set.seed... Date Added: 2009-06-03 16:55:47 |
| peerevaluation.doc Path: CSU Sacramento >> IMET >> 2 Fall, 2009 Description: Peer Evaluation Rarely 1 Points Participation Participated in group discussion without prompting Contributed his/her fair share of the work Respected other group members\' contributions and point of view Sometimes 2 points Often 3 points Almost Alw... Date Added: 2009-06-03 16:56:30 |
| Lab4.doc Path: Pittsburgh >> CS >> 0131 Fall, 2008 Description: CS 0131 Software for Personal Computing Lab4: Creating Reports and Tables Due Date: In Class Points: 60 points, 30 points each document Purpose: The purpose of this lab is to provide you with hands-on experience working with the topics and features t... Date Added: 2009-06-03 16:56:57 |
| Lab4.doc Path: Pittsburgh >> CS >> 42 Fall, 2009 Description: CS 0131 Software for Personal Computing Lab4: Creating Reports and Tables Due Date: In Class Points: 60 points, 30 points each document Purpose: The purpose of this lab is to provide you with hands-on experience working with the topics and features t... Date Added: 2009-06-03 16:56:57 |
| how_develop.ppt Path: CSU Sacramento >> IMET >> 1 Fall, 2009 Description: How Architectural Styles Develop Many features develop over time Development of one architectural solution in one culture often caused changes in architecture of another culture Transitions occur from one time period to another Also... Date Added: 2009-06-03 16:57:08 |
| cs2335_umlseq.ppt Path: Georgia Tech >> CS >> 2335 Fall, 2008 Description: Sequence Diagrams CS2335 Summer 2005 Agenda Sequence Lab Diagrams Symbology 3 Seq Diagram Sequence Diagrams AKA Interaction Diagrams Semantically equivalent to Collaboration Diagrams Dynamic Model relating use cases (scenarios) and class ... Date Added: 2009-06-03 16:57:38 |
| 2_253.txt Path: Georgia Tech >> CS >> 12 Fall, 2009 Description: Paper: Application Aware Adaptation for Mobile Computing 1) Problem: The paper proposes a collaborative partnership between mobile applications and operating systems in accessing data in a mobile environment. This concept is between the two extr... Date Added: 2009-06-03 16:58:09 |
| 2_253.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper: Application Aware Adaptation for Mobile Computing 1) Problem: The paper proposes a collaborative partnership between mobile applications and operating systems in accessing data in a mobile environment. This concept is between the two extr... Date Added: 2009-06-03 16:58:09 |
| lecture11-interaction-models.ppt Path: Georgia Tech >> CS >> 2003 Fall, 2009 Description: I nte raction Mode ls Evaluation fram works for inte e raction Age nda Que stions HW 2 fe dback e FS m ling e rcisere M ode xe visite d I nte raction m ls ode Norm 7 stage an s DFAB I nte raction Fram work e S ide an Dire m hne rm ct anipulation T... Date Added: 2009-06-03 16:59:08 |
| lecture11-interaction-models.ppt Path: Georgia Tech >> CS >> 4470 Fall, 2008 Description: I nte raction Mode ls Evaluation fram works for inte e raction Age nda Que stions HW 2 fe dback e FS m ling e rcisere M ode xe visite d I nte raction m ls ode Norm 7 stage an s DFAB I nte raction Fram work e S ide an Dire m hne rm ct anipulation T... Date Added: 2009-06-03 16:59:08 |
| First.doc Path: USF >> SS >> 691 Fall, 2009 Description: Melissa Traber 1st grade standards CONTENT: (HISTORY) -knows ways people in different cultures live, work, play, move about, and communicate. -knows ways in which communication methods have changed as well as transportation methods (for example, the ... Date Added: 2009-06-03 17:02:17 |
| lect23.ppt Path: SUNY Fredonia >> CSIT >> 435 Fall, 2009 Description: Chapter 7: Network security Foundations: cryptography what is security? authentication message integrity Security in practice: application layer: secure email transport layer: Internet commerce, SSL, 7: Network Security 1 Friends and en... Date Added: 2009-06-03 17:02:55 |
| Morin-Sacca.ppt Path: Universität St. Gallen (HSG) >> USS >> 1109 Fall, 2009 Description: Innovation et interdisciplinarit Danielle Morin Vice-rectrice adjointe aux tudes Universit Concordia Elizabeth Sacc Doyenne, cole des tudes suprieures Universit Concordia Acfas Montral, 18 May 2006 The Need for Interdisciplinary Research & Teachin... Date Added: 2009-06-03 17:05:41 |
| 10.txt Path: SUNY Albany >> CSI >> 635 Fall, 2009 Description: 9 9 10 8 8 10 10 13 17 21 24 27 28 27 27 27 27 26 26 26 25 25 25 24 24 24 24 23 23 23 23 23 22 22 22 22 21 21 21 20 20 20 19 19 19 19 19 19 19 18 19 19 19 18 19 21 24 24 24 24 18 14 23 25 14 20 21 20 20 20 18 18 18 17 17 17 14 18 18 20 20 20 20 20 20... Date Added: 2009-06-03 17:05:53 |
| 7.txt Path: SUNY Albany >> CSI >> 635 Fall, 2009 Description: 162 163 163 163 163 163 163 163 163 163 162 162 162 162 162 162 154 154 154 154 154 153 153 153 159 159 159 162 162 162 164 164 164 160 160 160 153 153 153 152 138 138 141 141 141 137 137 137 144 144 144 145 146 146 145 145 145 143 143 143 143 143 14... Date Added: 2009-06-03 17:05:55 |
| exp07_a07_ir.doc Path: UMBC >> CHAPTER >> 128 Fall, 2009 Description: Instructor Reference Card Access Chapter 7 | Advanced Queries: Using Queries to Change Data ConceptsAt a Glance Summary KEY CONCEPTS (blue)Most important concepts in this chapter TIPS (red)Useful shortcuts and information for more productive use ... Date Added: 2009-06-03 17:07:17 |
| TAYLOR_Hayley1.ppt Path: Allan Hancock College >> LAW >> 83811 Fall, 2009 Description: Saliva Drug Screening in W.A. Correctional Settings Hayley Taylor Kati Kraszlan Christine Anderton May October 2004 Department of Justice Feb 2003 DoJ hosted the Drugs Roundtable Forum. - Justice Drug Plan developed reduce drug demand/supply/harm... Date Added: 2009-06-03 19:27:02 |
| Snippets.ppt Path: UCF >> ISM >> 5219 Fall, 2008 Description: Process Design Patterns in BPMN When I grade exams, I grade each exam completely. Only when I\'ve graded all exams do I record the grades in my grading program and post them to the to the course web site. Multiple Instance Pattern Without Runtime Kn... Date Added: 2009-06-03 19:29:18 |
| Group_project_7May07.doc Path: Allan Hancock College >> MKTG >> 8462 Fall, 2009 Description: Draft Group Project Guidelines (revised 7 May 2007) The objective of this assignment is hands on global marketing experience through developing a global marketing strategy for the UWA Business School (UWABS). Your strategy should be no more than 12 ... Date Added: 2009-06-03 19:32:52 |
| sort.ppt Path: ECCD >> ECOR >> 1606 Fall, 2009 Description: ECOR 1606 - Problem Solving and Computers Sorting and Searching Carleton University Department of Systems and Computer Engineering 1 Sorting Algorithms It is often desirable to sort a list of numbers. For example, sort the following list: 8,... Date Added: 2009-06-03 19:48:19 |
| HMWK-4-solution.doc Path: ECCD >> SYSC >> 4600 Fall, 2009 Description: Carleton University Department of Systems and Computer Engineering SYSC 4600 Digital Communications Fall 2007 Homework #4 (Due on Thursday, Oct. 18) Problem #1: In a DS/BPSK system, the feedback shift register used to generate the PN sequence has le... Date Added: 2009-06-03 19:49:28 |
| 60-375-01%20-%20fortier%20.doc Path: UWI Mona >> CS >> 1477 Fall, 2009 Description: Course Description Topics in Object-Oriented Programming Author: Date: Randy J. Fortier 2007/11/16 Target Group The course is intended for students who have completed the 60-212 and 60-254 courses, and want to increase their understanding of Java, ... Date Added: 2009-06-03 19:51:24 |
| BlackSeaFlood_Nov17th.ppt Path: McGill >> ATOC >> 530 Fall, 2009 Description: Black Sea Flood 5600 BC (What happened ?) Findings and Interpretation of Geologist Dr. William Ryan as Presented by John Kozlowski Friday November 17, 2006 Overview Background : Classical Story, then physical and scientific context Conditions (Glo... Date Added: 2009-06-03 19:52:40 |
| ARMExceptions.ppt Path: UMass (Amherst) >> ECE >> 7650 Fall, 2009 Description: ECE 7650: Advanced Computer Architecture Chapter 9: Exceptions: Advanced RISC Machines ARM Ltd. Ch09: ARM Exceptions 10/18/2007 1 of 18 Exceptions Overview Exceptions are generated by internal and external sources. Preservation of the process... Date Added: 2009-06-03 19:52:55 |
| ME513ABET.doc Path: Rose-Hulman >> AY >> 0405 Fall, 2009 Description: ME 513 ENVIRONMENTAL NOISE 2004-2005 Catalog Data: 4R-0L-4C F Pre: Senior class standing Introduces noise and its sources as a potential public health hazard. Covers the basics of sound propagation relating to noise measurement and analysis. Emphasiz... Date Added: 2009-06-03 19:54:33 |
| 06_mutualExclusion_and_synchronization.ppt Path: RMCAD >> EE >> 551 Fall, 2009 Description: Real Time Operating Systems Mutual Exclusion, S ynchronization I nte rtask C m om unications Sm e aphore s Me ssageMailboxe ... Date Added: 2009-06-03 19:54:58 |
| work5h.doc Path: East Los Angeles College >> BALL >> 0888 Fall, 2009 Description: Introduction to Logic, MT 2007, Week 5 (Ofra Magidor) Up to now we have been concerned with a branch of logic called propositional calculus. From now on, we will be concerned with an extension of propositional calculus called `predicate calculus\'.... Date Added: 2009-06-03 19:54:59 |
| mitnik.ppt Path: RMCAD >> EE >> 579 Fall, 2009 Description: TCP/IP Security TEACHING POINTS TCP/IP vulnerabilities Mitnick attack firewalls IDS IPSEC, SSL, VPN TCP/IP Vulnerabilities The TCP/IP protocol stack was developed in a \"trusting\" environment Passwords for telnet, ftp, mail, etc. are sent o... Date Added: 2009-06-03 19:55:00 |
| Sound_creation_editing.ppt Path: Air Force Academy >> TUTORIAL >> 100 Fall, 2009 Description: Sound creation and editing Sound Physics Sounds are pressure waves of air No air = no sound (thus no sound in space) We hear sound because our ears are sensitive to the pressure waves So how do we record sound? A microphone consists of a smal... Date Added: 2009-06-03 19:56:00 |
| McDonalds6.doc Path: Wisc La Crosse >> ECO >> 310 Fall, 2009 Description: McDonalds6: Health/Science THE GREENING OF MCDONALD\'S ENVIRONMENTAL HOUDINI ACT TRANSFORMS CHAIN FROM ROGUE TO ROLE MODEL Scott Allen, GLOBE STAFF 01/24/2000 The Boston Globe THIRD C1 (Copyright 2000) City councils banned its styrofoam burger boxes, ... Date Added: 2009-06-03 19:56:11 |
| me307_03-04.doc Path: East Los Angeles College >> ME >> 307 Fall, 2009 Description: s SCHOOL OF ENGINEERING LEVEL 3 SEMESTER 2 2003 / 2004 AIRCRAFT PERFORMANCE AND CONTROL ME307 1 /8 Examiners: Mr. J. Hutchinson / Dr D F Pearce Attempt FOUR questions only. Open Book Student may take their classroom notes into the examination room... Date Added: 2009-06-03 19:56:24 |
| ME110_04-05.doc Path: East Los Angeles College >> ME >> 110 Fall, 2009 Description: s SCHOOL OF ENGINEERING MODULAR HONOURS DEGREE COURSE LEVEL 1 SEMESTER 2 2004/2005 ME110 1/9 AIRCRAFT AND AUTOMOTIVE SYSTEMS Examiner: Dr J Leary/Dr D F Pearce Attempt FOUR questions only Time allowed: 2 hours Total number of questions = 6 All ... Date Added: 2009-06-03 19:56:36 |
| Verzani-SimpleR.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 403 Fall, 2009 Description: simpleR Using R for Introductory Statistics John Verzani y 2e+05 20000 40000 60000 80000 4e+05 6e+05 8e+05 120000 160000 page i Preface These notes are an introduction to using the statistical software package R for an introductory statisti... Date Added: 2009-06-03 19:58:02 |
| generateMap-0.21.txt Path: East Los Angeles College >> CS >> 3203 Fall, 2009 Description: <!- Author: Ben Strangeway Date: Dec 2006 This \'driver\' script imcludes the xml parser and the algorithm scripts, functions and variables. The php loops through the map array creating a dynamic html table. The TD images are decided by looking at the... Date Added: 2009-06-03 19:58:49 |
| haag6s.ppt Path: Laurentian >> MGT >> 3061 Fall, 2009 Description: Chapter 6 Systems Development Steps, Tools, and Techniques 1 Presentation Overview Seven Phases In The Systems Development Life Cycle Knowledge Workers and Their Roles In The Systems Development Life Cycle Why Systems Fail Selfso... Date Added: 2009-06-03 20:00:21 |
| car200322003n159446.txt Path: Allan Hancock College >> CAR >> 200322003 Fall, 2009 Description: CORPORATIONS (FEES) AMENDMENT REGULATIONS 2003 (NO. 2) 2003 NO. 159 CORPORATIONS (FEES) AMENDMENT REGULATIONS 2003 (NO. 2) 2003 NO. 159 - TABLE OF PROVISIONS 1. Name of Regulations 2. Commencement 3. Amendment of Corporations (Fees) Regu... Date Added: 2009-06-03 20:01:47 |
| CHAP09PP2.PPT Path: Laurentian >> MGT >> 200802 Fall, 2009 Description: Chapter 9 Staffing, Training, and Compensation for Global Operations PowerPoint by Kristopher Blanchard North Central University 2006 Prentice Hall 9-1 Introduction [In the new millennium], the caliber of the people will be the only source of com... Date Added: 2009-06-03 20:01:59 |
| dreamweaverC.ppt Path: Laurentian >> NMED >> 200703 Fall, 2009 Description: NMED 1000 Dreamweaver Project NMED 1000 Dreamweaver Assignment Form visual and text-based conceptual relationships to tell a digital story Continue to work with Adobe Photoshop Develop a series of six images Become familiar with Adobe Dreamweav... Date Added: 2009-06-03 20:02:32 |
| L3235_2007_paperoutline.doc Path: Laurentian >> GEOG >> 200703 Fall, 2009 Description: Geography 3235 Quantitative Models for Geographic Analysis Instructors: Office: Phone: EMail: Ian MacLachlan B872 3292076 maclachlan@uleth.ca Jacqueline Montain C755 3292486 j.montain@uleth.ca Lewis Baarda C754 3292535 lewis.baarda@uleth.ca Sch... Date Added: 2009-06-03 20:02:37 |
| dr_n_grigg_gifted_grp_a.ppt Path: Laurentian >> ED >> 3602 Fall, 2009 Description: Students Who are Gifted Education 3602 Nancy Grigg, Ph.D Spring, 2008 Myths and Realities of Giftedness Myth or Reality? It\'s more important to provide resources to children who have learning problems -gifted children will be fine on their own. My... Date Added: 2009-06-03 20:03:17 |
| scott-post.doc Path: Laurentian >> ANTH >> 200103 Fall, 2009 Description: Deconstructing equality versus difference: Or the uses of poststructuralist theory for feminism/Joan. W. Scott Claim: feminism needs theory that can analyse the workings of patriarchy in all its manifestations ideological, institutional, organizatio... Date Added: 2009-06-03 20:03:59 |
| Caribbean.ppt Path: Laurentian >> MUSI >> 200803 Fall, 2009 Description: MUSIC IN THE CARIBBEAN The peoples of the Caribbean Islands share a colonial history Creole is a person of mixed African and European ancestry Syncretism is the result of a fusion, or reconciliation, of differing cultures Rake-n-scrape is a tradi... Date Added: 2009-06-03 20:06:26 |
| ExamRoom.txt Path: Virgin Islands >> CSC >> 326 Fall, 2009 Description: Please be advised that we have had to move the exam for CSC 326 to an alternate room. The new room is DSB C114. This change will be noted on the web site. Please ensure that all students are notified of this change. Thank you for your attention to t... Date Added: 2009-06-03 20:07:03 |
| eeb2005306.txt Path: Allan Hancock College >> EEB >> 2005306 Fall, 2009 Description: PARLIAMENT OF VICTORIA Environment Effects (Amendment) Act 2005 Act No. TABLE OF PROVISIONS Clause ... Date Added: 2009-06-03 20:08:15 |
| type_1.ppt Path: East Los Angeles College >> MH >> 1108 Fall, 2009 Description: S tandard 5: All children and young people with diabetes will receive C onsistently highquality care and they, with their families and o thers involved in their daytoday care, will be supported to o ptimise the control of their blood glucose ... Date Added: 2009-06-03 20:09:30 |
| baet_june07_monday.ppt Path: East Los Angeles College >> MD >> 907 Fall, 2009 Description: MMedEd Becoming an Effective Teacher Day 1 June 2007 Adrian Stokes Links with other modules Medical Education (`the PGA\') Broad introduction Assessment & Evaluation Key concepts/principles: validity, reliability. Summative, `high stakes\', `big... Date Added: 2009-06-03 20:09:33 |
| rs_010523.ppt Path: Virgin Islands >> PHYS >> 010523 Fall, 2009 Description: HEC Beam Test Software MC events MC-TDS converter schematic view ASCII-TDS converter ASCII Data file EPIO-ASCII converter T D S monitoring EPIO-TDS converter HEC raw beam test data EPIO hec_adc user analysis ATHENA framework hec_adc framework... Date Added: 2009-06-03 20:10:03 |
| extension_request.doc Path: East Los Angeles College >> ME >> 932 Fall, 2009 Description: Directorate of Masters Accredited Programmes Extension Request Student Name: _ Name of Module: Date Coursework Due: I am unable to submit my course assignment by the due date for the following reasons: __ _ I am writing to request that I be granted a... Date Added: 2009-06-03 20:10:21 |
| QuestiononBioethicsandHR_000.doc Path: Virgin Islands >> LAW >> 343 Fall, 2009 Description: Question on Bioethics, Difference and Human Rights Identify an historical event or incident that implicates bioethics. Is the event or incident that you have identified a story about race, ethnicity, gender, class, disability, or some other identity ... Date Added: 2009-06-03 20:10:34 |
| csb2006231_2.txt Path: Allan Hancock College >> CSB >> 2006231 Fall, 2009 Description: 1 Corrective Services Bill 2006 Corrective Services Bill 2006 Amendments agreed to during Consideration 1 Clause 181- At page 128, line 3, `period\'- omit, insert- ... Date Added: 2009-06-03 20:10:35 |
| poster.ppt Path: Allan Hancock College >> ENGG >> 4801 Fall, 2009 Description: School of Information Technology & Electrical Engineering Build a Pr ototype Par allel Robot By Matthew St.Clair, Supervisor: Dr. Geir Hovland T opic What is a Gantry-Tau? It is a six link parallel kinematic structure with links configured in 3/2/1 ... Date Added: 2009-06-03 20:10:59 |
| Searle2.doc Path: Allan Hancock College >> COGS >> 1000 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?><!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Transitional/EN\" \"DTD/xhtml1-transitional.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\" xml:lang=\"en\" lang=\"en\"> <head> <title>Staff Web Page</title> <meta http-equiv=... Date Added: 2009-06-03 20:13:13 |
| hs10_2.txt Path: UPenn >> VHM >> 802 Fall, 2009 Description: Solution file for additional exercise 10.2 - Data on length and height of English cathedrals (or parts hereof), of either Roman or Gothic architectural style. We will explore models for the logarithmic length as a function of the logarithmic height,... Date Added: 2009-06-03 20:15:04 |
| lecture3.ppt Path: W. Alabama >> PSYCH >> 353 Fall, 2009 Description: Heuristics Shortcuts Instead of Normative Decision Making Representativeness Heuristic We make judgments of probability based on similarity and do not consider other rules that we should. Let\'s look at the evidence first we ignore baserates. ... Date Added: 2009-06-03 20:16:53 |
| ccapb2002436.txt Path: Allan Hancock College >> CCAPB >> 2002436 Fall, 2009 Description: CRIMINAL CODE AMENDMENT (CORRUPTION PENALTIES) BILL 2002 CLAUSE NOTES Clause 1. Short title Provides for the Act to be cited as the Criminal Code Amendment ... Date Added: 2009-06-03 20:17:02 |
| hisab1997456.txt Path: Allan Hancock College >> HISAB >> 1997456 Fall, 2009 Description: 1996-97 The Parliament of the Commonwealth of Australia HOUSE OF REPRESENTATIVES Presented and read a first time Health Insurance (Pathology Services) Amendment Bill 1997 No. , 1997 (Health and Family Services) A Bill for a... Date Added: 2009-06-03 20:17:12 |
| The_Piano_script.txt Path: Université du Québec à Montréal >> M >> 102360 Fall, 2009 Description: THE PIANO LESSON Screenplay for a film by JANE CAMPION Producer JAN CHAPMAN Script editor ... Date Added: 2009-06-03 20:17:38 |
| uvlight.txt Path: Université du Québec à Montréal >> MAT >> 3880 Fall, 2009 Description: Ultraviolet effects on the incidence of skin cancer among whites in the United States (free format) Data Items 1 Gender 0 Female 1 Male 2 AgeFrom Lower Limit of age category 3 AgeTo Upper Limit of age categor... Date Added: 2009-06-03 20:17:58 |
| lecture17.doc Path: Toledo >> ENV >> 200 Fall, 2009 Description: The background reading on carbon The carbon cycle and implications of rising CO2 for the future (what would Kyoto do?) KR # 6.2 (pp. 7177) KR # 7 (pp. 307312; 316326) Draper pp. 73 (Chp 3) + (Chp. 5) 132140, 154156 (II) or 126137 (I) Neither the m... Date Added: 2009-06-03 20:22:38 |
| POL443D01.TXT Path: Sveriges lantbruksuniversitet >> POL >> 20033 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: POL 443-4 D01 TITLE: INTL.SECURITY SEMESTER: 2003-3 LOCATION: SFU SECTION TYPE: SEM ENROL: 14 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown separ... Date Added: 2009-06-03 20:24:32 |
| mla1987162.txt Path: Allan Hancock College >> MLA >> 1987162 Fall, 2009 Description: MELBOURNE LANDS ACT 1987 Act No. 77/1987 Version incorporating amendments as at 9 August 2000 Melbourne Lands Act 1987 - TABLE OF PROVISIONS Section Page 1. Purpose 2. Commencement 3. Revocation of reservations and Crown grants 4. Land deem... Date Added: 2009-06-03 20:25:16 |
| v03n051.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) Subject: Cdn-Firearms Digest V3 #51 Sender: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Errors-to: owner-cdn-firearms-dig... Date Added: 2009-06-03 20:28:14 |
| v03n051.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) Subject: Cdn-Firearms Digest V3 #51 Sender: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Errors-to: owner-cdn-firearms-dig... Date Added: 2009-06-03 20:28:14 |
| 04_044.txt Path: UPenn >> VHM >> 801 Fall, 2009 Description: Exercise 4.44 of IPS6e (4.38 of IPS5e) - Transmission of ABO blood types. Let X denote the gene received from father (Jose): values A,B. and let Y denote the gene received from mother (Jennifer): A,O. Possible allele combinations and blood types o... Date Added: 2009-06-03 20:28:26 |
| f8outline_002.DOC Path: Virgin Islands >> LAW >> 322 Fall, 2009 Description: Family Law 322 Family Eight: September 30, 2008 Child Protection Outline I. 1. Child Protection Law State Intervention and Family Autonomy the balance: the need to protect vulnerable family members vs. support for the in tact family as a whole prot... Date Added: 2009-06-03 20:28:33 |
| pro13.txt Path: Maple Springs >> COURSES >> 4080 Fall, 2009 Description: Project #13 - Project title: Development of algorithms for geometric correction of remote-sensed imagery Supervisor name (email): Professor James Elder (jelder@yorku.ca) Location: Human Performance Lab: Visual Psychophysics and Computation ... Date Added: 2009-06-03 20:29:26 |
| lec-week2.txt Path: W. Alabama >> ENG >> 464 Fall, 2009 Description: The following topics were covered during week #2 - - TOPIC SOURCE - Memory Mapped Architecture Chap #1, 1.1.3 Text Book Chap #9, 9.1 Text Book - Interfacing Methods ... Date Added: 2009-06-03 20:30:50 |
| ch13stu.ppt Path: Maple Springs >> MICRO >> 1000 Fall, 2009 Description: Chapter 13: Competition, Globalization, and Technology Prepared by: Kevin Richter, Douglas College Charlene Richter, British Columbia Institute of Technology 2006 McGrawHill Ryerson Limited. All rights reserved. 1 Chapter Objectives 1. Defi... Date Added: 2009-06-03 20:32:57 |
| v03n145.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From - Wed Sep 15 13:29:06 1999 Received: from broadway.sfn.saskatoon.sk.ca (broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id GAA10706; Wed, 15 Sep 1999 06:33:25 -0600 (CST) Received: (from majordomo@loc... Date Added: 2009-06-03 20:33:33 |
| v03n145.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From - Wed Sep 15 13:29:06 1999 Received: from broadway.sfn.saskatoon.sk.ca (broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id GAA10706; Wed, 15 Sep 1999 06:33:25 -0600 (CST) Received: (from majordomo@loc... Date Added: 2009-06-03 20:33:33 |
| v02n408.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From owner-cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Thu May 21 16:48:41 1998 Date: Thu, 21 May 1998 16:31:32 -0600 From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca... Date Added: 2009-06-03 20:34:15 |
| v02n408.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From owner-cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Thu May 21 16:48:41 1998 Date: Thu, 21 May 1998 16:31:32 -0600 From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca... Date Added: 2009-06-03 20:34:15 |
| lecture18.ppt Path: Toledo >> AST >> 210 Fall, 2009 Description: Lecture 18: Stellar motions, Spectral Types, the HR Diagram, Multiple Stars 2004 Jones and Bartlett Publishers Motions of Stars 1. In 1718 Halley discovered that stars do move with respect to one another. Thus, constellations do gradually change s... Date Added: 2009-06-03 20:34:27 |
| DDLexercises.doc Path: East Los Angeles College >> CE >> 00205 Fall, 2009 Description: MSc Computing for Business Module CM207-6 Database Management Systems Database Tables The exercises will use the following tables:- Employee and Branch. The format and content of the two tables is shown below:Exercise 1: Create and populate both tabl... Date Added: 2009-06-03 20:35:13 |
| MC1752_unit3.doc Path: East Los Angeles College >> MC >> 1752 Fall, 2009 Description: Sri Venkateswara College of Engineering, Sriperumbudur Department of Computer Applications M.C.A IV SEMESTER (Jan Apr 2007) Problem Set MC1752 Resource Management Techniques UNIT III INTEGER PROGRAMMING PROBLEMS 1. 1. Integer Programming P... Date Added: 2009-06-03 20:35:47 |
| page.txt Path: Allan Hancock College >> MC >> 163 Fall, 2009 Description: <wysiwyg classlist >33008AD8-D1B7-4739-A27F-FB64353077D1<p></p><table class=\"inline\" border=\"0\" width=\"654\" cellspacing=\"0\" cellpadding=\"0\" class=\"inline\" style=\"width: 492pt; border-collapse: collapse;\" x:str=\"><colgroup><col width=\"122\" style=\"wid... Date Added: 2009-06-03 20:36:51 |
| hrca1994297.txt Path: Allan Hancock College >> HRCA >> 1994297 Fall, 2009 Description: [pic] Human Rights (Sexual Conduct) Act 1994 Act No. 179 of 1994 This Act was prepared on 1 April 2004 Prepared by the Office of Legislative Drafting, Attorney-General\'s Department, Canberra Contents 1 Short title [see Note 1] ... Date Added: 2009-06-03 20:38:41 |
| sara1972218.txt Path: Allan Hancock College >> SARA >> 1972218 Fall, 2009 Description: SPORT AND RECREATION ACT 1972 No. 8344 of 1972 Version incorporating amendments as at 1 February 2008 Sport and Recreation Act 1972 - TABLE OF PROVISIONS Section Page 1. Short title and commencement 2. Definitions 3. Objects 4. Repealed 5. ... Date Added: 2009-06-03 20:39:23 |
| psoar199911999n112608.txt Path: Allan Hancock College >> PSOAR >> 199911999 Fall, 2009 Description: PUBLIC SERVICE (PARLIAMENTARY OFFICERS) AMENDMENT REGULATIONS 1999 (NO. 1) 1999 NO. 112 PUBLIC SERVICE (PARLIAMENTARY OFFICERS) AMENDMENT REGULATIONS 1999 (NO. 1) 1999 NO. 112 - TABLE OF PROVISIONS 1. Name of regulations 2. Commencement 3... Date Added: 2009-06-03 20:39:39 |
| nhahcb1999414_2.txt Path: Allan Hancock College >> NHAHCB >> 1999414 Fall, 2009 Description: _ NATIONAL HEALTH AMENDMENT (LIFETIME HEALTH COVER) BILL 1999 1999-2000 THE PARLIAMENT OF THE COMMONWEALTH OF AUSTRALIA SENATE NATIONAL HEALTH AMEN... Date Added: 2009-06-03 20:39:43 |
| pilar20079n262o2007666.txt Path: Allan Hancock College >> PILAR >> 20079 Fall, 2009 Description: EXPLANATORY STATEMENT Select Legislative Instrument 2007 No. 262 Issued by the Authority of the Parliamentary Secretary to the Minister for Agriculture, Fisheries and Fo... Date Added: 2009-06-03 20:39:57 |
| gpcb2007352.txt Path: Allan Hancock College >> GPCB >> 2007352 Fall, 2009 Description: [Page Break] New South Wales Government Publicity Control Bill 2007 Contents Page Part 1 Preliminary ... Date Added: 2009-06-03 20:40:03 |
| outline0708.doc Path: East Los Angeles College >> MUSI >> 5060 Fall, 2009 Description: Introduction to Musical Scholarship, MUSI 5060M (60cr) Thursdays 11.00 1.00 (LT4), 2.00-400 (LT4), 4.30-6.00 (LT1), as relevant, Semesters 1 and 2 Module Manager: Dr Michael Allis m.allis@leeds.ac.uk with Professors Clive Brown, Julian Rushton, Dere... Date Added: 2009-06-03 20:40:57 |
| Lecture1_Introduction.ppt Path: Allan Hancock College >> COMP >> 5138 Fall, 2009 Description: COM P 5138 R elational D atabase M anagement Systems Sem 2, 2007 Lecture 1 Introduction to Database Systems L1 Overview & Introduction What is a DBMS? Data: Facts that can be recorded Important for users Need to persist (not just temporary val... Date Added: 2009-06-03 20:41:19 |
| EDU2441-WK4.ppt Path: Allan Hancock College >> EDU >> 2441 Fall, 2009 Description: COMMONWEALTH OF AUSTRALIA Copyright Regulations 1969 WARNING This material has been copied and communicated to you by or on behalf of The University of Southern Queensland pursuant to Part VA of the Copyright Act 1968 (the Act). The material in this ... Date Added: 2009-06-03 20:45:01 |
| op2004333.txt Path: Allan Hancock College >> OP >> 2004333 Fall, 2009 Description: Published in Gazette 1.7.2004 p 2402 South Australia Oaths (Appointments) Proclamation 2004 under section 33 of the Oaths Act 1936 1-Short title This proclamation may be cited as the Oaths (Appointments) Proclamation 2004. 2-Commenceme... Date Added: 2009-06-03 20:45:07 |
| carajb2006448.txt Path: Allan Hancock College >> CARAJB >> 2006448 Fall, 2009 Description: Passed by both Houses New South Wales Crimes (Appeal and Review) Amendment (Double Jeopardy) Bill 2006 Contents ... Date Added: 2009-06-03 20:45:34 |
| hab21993232.txt Path: Allan Hancock College >> HAB >> 21993232 Fall, 2009 Description: Queensland HARBOURS AMENDMENT BILL (No. 2) 1993 Queensland HARBOURS AMENDMENT BILL (No. 2) 1993 TABLE OF PROVISIONS Section ... Date Added: 2009-06-03 20:48:08 |
| 909.TXT Path: East Los Angeles College >> LJ >> 562 Fall, 2009 Description: 0.005402 0.278441 0.889112 0.278445 -0.709509 -0.709494 0.720432 0.720253 -0.267684 -0.878206 -0.267567 0.005481 0.290565 0.928390 0.290587 -0.741352 -0.741374 1.213635 1.213594 -0.456137 -1.488082 -0.456186 1.037315 0.005368 1.675399 1.675131 1.0372... Date Added: 2009-06-03 20:48:11 |
| qcaab2000469.txt Path: Allan Hancock College >> QCAAB >> 2000469 Fall, 2009 Description: Queensland QUEENSLAND COMPETITION AUTHORITY AMENDMENT BILL 2000 Queensland QUEENSLAND COMPETITION AUTHORITY AMENDMENT BILL 2000 TAB... Date Added: 2009-06-03 20:49:49 |
| A3002_gal.ppt Path: Allan Hancock College >> A >> 3002 Fall, 2009 Description: VR sun V l r vR P v N (tangent pt) Ro R galactic center Geometry of galactic rotation Galactic rotation: measure Vmax , v (Ro) | sin l | sets the baseline v (R ) v (R) Vmax v (Ro) | sin l | | sin l | = R/Ro Rotation of the Galaxy: Merrif... Date Added: 2009-06-03 20:50:39 |
| pipa200446o2004407.txt Path: Allan Hancock College >> PIPA >> 200446 Fall, 2009 Description: The legislation that is being viewed is valid for Sessional. Personal Information Protection Act 2004 (No. 46 of 2004) - CONTENTS Personal Information Protection Act 2004 ... Date Added: 2009-06-03 20:51:48 |
| O2ATM-TEMPa.txt Path: Allan Hancock College >> PHYSICS >> 004 Fall, 2009 Description: Time Time In Secs O2ATM-TEMPa 2009_04_21 09:26:01 3323150761 279 2009_04_21 09:33:10 3323151190 246 2009_04_21 09:42:23 3323151743 252 2009_04_21 09:49:32 3323152172 246 2009_04_21 09:58:37 3323152717 248 2009_04_21 10:05:46 3323153146 247 2009_04_21... Date Added: 2009-06-03 20:52:00 |
| events_25.txt Path: East Los Angeles College >> PHYS >> 1100 Fall, 2009 Description: #CalcHEP version 2.5b #Type 2 -> 4 #Initial_state P1_3=7.000000E+03 P2_3=-7.000000E+03 StrFun1=\"PDT:cteq6l(proton)\" 2212 StrFun2=\"PDT:cteq6m(proton)\" 2212 #PROCESS 2(u1) 2(u1) -> 23(Z) 24(W+) 2(u1) 1(d1) #MASSES 0.0000000000E+00 0.00000... Date Added: 2009-06-03 20:52:46 |
| TSFsubmissionForm.doc Path: Allan Hancock College >> MDL >> 112 Fall, 2009 Description: SUBMISSION FORM 8th APCPST & 19th SPSM (Complete this form and send it to the Editorial Office by Email if you want to publish your paper in the Proceedings) PROGRAM NUMBER: PAGE OF YOUR ABSTTACT IN BOOKLET OF ABSTRACTS: TITLE OF PAPER: NAMES OF AUT... Date Added: 2009-06-03 20:53:10 |
| poster2.ppt Path: East Los Angeles College >> ECS >> 122 Fall, 2009 Description: Servers on Mobile Devices Server Applications Answerphone Paul Dart pd204@soton.ac.uk Mobile Web Servers Primarily when people think of serving data the think of websites. Traditional models for servers are high density racks of machines in data cen... Date Added: 2009-06-03 20:53:17 |
| w10obler_and_hannigan96.doc Path: East Los Angeles College >> LING >> 212 Fall, 2009 Description: LAEL Department, Lancaster University LING212 - Second Language Acquisition Obler and Hannigan (1996) - Study questions 1. 2. 3. What ages have been proposed for the critical period for the acquisition of nativelike pronunciation? What does the notio... Date Added: 2009-06-03 20:53:19 |
| application_form_2009.doc Path: East Los Angeles College >> ME >> 913 Fall, 2009 Description: DIABETES COUNSELLING COURSE KNUSTON HALL IRCHESTER NORTHANTS NN9 7EU Organiser: Dr Charles Fox APPLICATION FORM 1) 2) 3) 4) FAMILY NAME: FORENAME(S) DATE OF BIRTH: ADDRESS FOR CORRESPONDENCE: .. . POST CODE . 5) 6) 7) WORK TEL. NO.: EMAIL : PRESENT ... Date Added: 2009-06-03 20:54:51 |
| hwp08.doc Path: CSU Northridge >> ME >> 496 Fall, 2009 Description: College of Engineering and Computer Science Mechanical Engineering Department Mechanical Engineering 496ALT Alternative Energy Spring 2009 Number: 18650 Instructor: Larry Caretto March 24 Homework Assignment 1. Problem 15.2 in text. Estimate the tot... Date Added: 2009-06-03 20:56:20 |
| c25c-kl.doc Path: CSU Northridge >> HCECO >> 008 Fall, 2009 Description: 25.c. The Federal Reserve i. Structure The formal structure of the Federal Reserve was designed to diffuse power along regional lines, between the private sector and the government, and among bankers, businessmen, and the public. As a result, the Fed... Date Added: 2009-06-03 20:56:23 |
| MC4ForkN71PClasses.txt Path: SHSU >> LDG >> 005 Fall, 2009 Description: Class 1: p0000, p1111 Class 2: p0001, p0010, p1101, p1110 Class 3: p0011, p1100 Class 4: p0100, p0111, p1000, p1011 Class 5: p0101, p0110, p1001, p1010 ... Date Added: 2009-06-03 20:56:44 |
| Libeay.txt Path: Allan Hancock College >> TTSH >> 151 Fall, 2009 Description: Copyright (C) 1997 Eric Young (eay@cryptsoft.com) All rights reserved. This package is an SSL implementation written by Eric Young (eay@cryptsoft.com). The implementation was written so as to conform with Netscapes SSL. This library is free for com... Date Added: 2009-06-03 20:57:51 |
| Chapter7.2.ppt Path: Valdosta >> CS >> 4500 Fall, 2008 Description: PDAs and Context-Free Languages (Review) Greibach Normal Form A context free grammar is in Greibach Normal Form if all productions are of the form A aX where a T, and X D V*. Constructing a PDA for a CFG Assume the grammar is in Greibach Normal ... Date Added: 2009-06-03 20:58:12 |
| ece699_lecture6.ppt Path: George Mason >> ECE >> 699 Fall, 2008 Description: ECE 699-Digital Signal Processing Hardware Implementations Lecture 6 Fast Fourier Transforms 2/25/09 1 Outline Discrete Fourier Transform Fast Fourier Transform Radix-2 Decimation in Time Radix-2 Decimation in Frequency Radix-4 Algorithms FFT... Date Added: 2009-06-03 21:01:14 |
| sakai_site_section.doc Path: East Los Angeles College >> QA >> 20080617 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 Sakai Site Sections October 2, 2005 Please direct questions or comments about this document to: Glenn R. Golden, ggolden@umich.edu DRAFT 10Introduction 11This documents the Sakai framework\'s new features to Site; Site Sections. T... Date Added: 2009-06-03 21:01:41 |
| 13_concerns.ppt Path: Allan Hancock College >> FOE >> 1000 Fall, 2009 Description: Communication concerns Peter Albion FOE1000 Sexism in the classroom Schools teach what is important Often as hidden curriculum Sex discrimination affects male and female Boys Achieve lower grades Drop out and/or are suspended more often Experi... Date Added: 2009-06-03 21:03:28 |
| 634.TXT Path: East Los Angeles College >> LJ >> 562 Fall, 2009 Description: 0.363990 0.638970 1.250936 0.635255 -0.356037 -0.350988 1.080116 1.077554 0.085085 -0.526570 0.088243 0.360117 0.650535 1.289448 0.646666 -0.387628 -0.384348 1.576899 1.573443 -0.104871 -1.133342 -0.098327 1.398464 0.362246 2.038130 2.037837 1.395723... Date Added: 2009-06-03 21:04:04 |
| U123.doc Path: East Los Angeles College >> U >> 123 Fall, 2009 Description: WP Fluency evaluation instructions Look carefully at each segment of text and give each one a score according to how much you think the text reads like fluent English written by a native speaker. Enter your scores in the appropriate boxes in the rig... Date Added: 2009-06-03 21:04:31 |
| presentation.ppt Path: East Los Angeles College >> ECS >> 124 Fall, 2009 Description: Data Authentication for Sensor Networks Philip Basford 16 June 2008 The Problem Sensor networks deployed without security are vulnerable to the injection of false data Sensor networks have limited resources available Power is the scarcest ... Date Added: 2009-06-03 21:05:26 |
| guideline.txt Path: East Los Angeles College >> AST >> 20021224 Fall, 2009 Description: Provisional strategy of the observing plan for XID INT/WFC 2002 DEC run W. Yuan General: the emphasis is on completing fields properly and doing a full (i r g ?) set of filters for new fields. ... Date Added: 2009-06-03 21:06:34 |
| 060955_220708.txt Path: East Los Angeles College >> OP >> 220708 Fall, 2009 Description: Point,Lambda,OHSig,OHA,OHB/X,HO2Sig,HO2A,HO2B/X,RCSig,RCA,RCB/X,OHPD,HO2PD,RefPD,InletPT,PMT1V,PMT1A,PMT2V,PMT2A,PMT3V,PMT3A,MFC1,MFC2,MFC3,DetP,RefP,Pitot,NOValveState,Mode,Date,Time 1,461.987,16,17,1,22,23,1,6826,6828,2,13.57,3.28,1.39,0.04,2787.70... Date Added: 2009-06-03 21:08:33 |
| exception.txt Path: East Los Angeles College >> ATT >> 0009 Fall, 2009 Description: I run abc with the following command-line : java -Xms512M -Xmx1G abc.main.Main -d \"C:\\sabs/local/system/temp/sablecc/sablecc\" C:\\sabs/local/benchmarks/sablecc/sablecc/*.java C:\\sabs/local/benchmarks/sablecc/sablecc/analysis/*.java C:\\sabs/local/... Date Added: 2009-06-03 21:08:53 |
| Probioticsandprebiotics.ppt Path: East Los Angeles College >> GM >> 607 Fall, 2009 Description: Probiotics and prebiotics in the newborn Alison Bedford Russell Consultant Neonatologist Birmingham Heartlands Probiotics and prebiotics Probiotic: A live microbial food supplement that beneficially affects the host by alteration of its... Date Added: 2009-06-03 21:08:54 |
| Business_Inferno_Org_App.doc Path: Penn State >> MPS >> 5056 Fall, 2009 Description: Penn State Women In Business Presents the 4nd Annual . Business Inferno Women in Business is hosting the Business Inferno, which will take place on Sunday April 5, 2009 from 9:00am to 3:30pm in the Business Building. The Business Inferno will con... Date Added: 2009-06-03 21:13:36 |
| HOMEWORK_3_2008.doc Path: San Jose State >> MET >> 172 Fall, 2009 Description: Met 172 Homework 3 due Wednesday, February 13, 2008 at beginning of class in either print or electronic form Read Holton 7.3.2 (3rd pg 193 196; 4th pg 192 - 195) 1. Given: ( / y)p = -(f /g)( u/ z) Ri = N2/( u/ z)2 N2 = g( ln / z) ( u/ y) = ( u/ y)p... Date Added: 2009-06-03 21:16:41 |
| sta216_2005.ppt Path: Duke >> STA >> 216 Fall, 2008 Description: STA 216 Generalized Linear Models Meets: 2:50-4:05 T/TH (Old Chem 025) Instructor: David Dunson 219A Old Chemistry, 684-8025 dunson@stat.duke.edu Teaching Assistant: Dawn Barnard 112 Old Chemistry, 684-4365 dawn@stat.duke.edu STA 216 Syllabus Topi... Date Added: 2009-06-03 21:20:24 |
| 153lecture1.2008.ppt Path: UCSB >> PSYC >> 153 Winter, 2009 Description: What are humans for? Why do we think/behave the ways we do? What is Evolutionary Psychology? Metatheoretical position that the human brain contains a collection of specialized processing mechanisms designed by natural selection to address specific... Date Added: 2009-06-03 21:20:53 |
| hwk2_6.09.pgm.txt Path: N.C. State >> ST >> 732 Spring, 2008 Description: /* Multivariate repeated measures analysis of variance on the cd4 data */ options ls=80 ps=59 nodate; run; /** Read in the data. The data are already in the correct form for PROC GLM to perform the MANOVA analysis. */ data cd41; ... Date Added: 2009-06-03 21:22:00 |
| SIMPLE_SPICE_Para.doc Path: Contra Costa College >> COEN >> 6511 Fall, 2009 Description: * MOS3 models for use in SpectrE .MODEL CMOSN mos3 type=n + PHI=0.700000 TOX=9.6000E-09 XJ=0.200000U TPG=1 + VTO=0.6566 DELTA=6.9100E-01 LD=4.7290E-08 KP=1.9647E-04 + UO=546.2 THETA=2.6840E-01 RSH=3.5120E+01 GAMMA=0.5976 + NSUB=1.3920E+17 NFS=5.9090E... Date Added: 2009-06-03 21:22:11 |
| ec-13v0.doc Path: USC >> CS >> 577 Fall, 2009 Description: USC C S E University of Southern California Center for Software Engineering CS577a 3 Section Project\'s Life Cycle and Tasks rd 2009 A W Brown BES/MSEE & USC CSE0228a1013395fcb37700d499a9a2ae81d8ae4cb0.doc 1 of 17 v 0.8 04/02/00 USC C S E... Date Added: 2009-06-03 21:23:02 |
| Week06_PR_F04a_T13.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: TEAM #13 Period: 10/22/04 10/27/04 WEEKLY STATUS REPORT Team #13 Automated Accounts Reconciliations Week #6 Progress: -During this past week we have completed some major accomplishments: Had our Artifact Review Board with Professor Barry Boehm, ou... Date Added: 2009-06-03 21:23:41 |
| lab06.ppt Path: New Mexico >> CS >> 341 Fall, 2009 Description: Welcome to CS341 Labs Computer Architecture MIPS programming Jong Park @UNM CS Administrative Lab #1 ~ #4 grades out to your mail box. If you still have an issue, give me non-UNM mail address. Otherwise, you need to wait till we have an alternativ... Date Added: 2009-06-03 21:32:01 |
| 6th-NLC-MAC-letter.doc Path: Princeton >> E >> 166 Fall, 2009 Description: Building 510F P.O. Box 5000 Upton, NY 11973-5000 Phone 631 344-5590 Fax 631 344-2166 ozaki@bnl.gov managed by Brookhaven Science Associates for the U.S. Department of Energy www.bnl.gov <http:/www.bnl.gov> Dr. Jonathan M. Dorfan Director SLAC P.O. B... Date Added: 2009-06-03 21:34:04 |
| rohit.ppt Path: UT Arlington >> CSE >> 6339 Fall, 2008 Description: IRLbot: Scaling to 6 Billion Pages and Beyond Presented by rohit tummalapalli sashank jupudi Agenda Introduction Challenges Overcoming the challenges o Scalability o Reputation and spam o Politeness Experimental results Conclusion Introduction... Date Added: 2009-06-03 21:36:34 |
| s03.ppt Path: UNI >> CS >> 062 Fall, 2009 Description: Behavior and State We define objects by their behavior-by what they can do in helping to solve a problem. In order to perform their intended behaviors, objects often need to have state-variables that allow them to keep track of information about th... Date Added: 2009-06-03 21:40:16 |
| sam1.txt Path: Cornell >> CS >> 212 Fall, 2008 Description: ADDSP 2 PUSHIMM 13 STOREOFF 1 PUSHOFF 1 STOREOFF 0 ADDSP -1 STOP ... Date Added: 2009-06-03 21:41:49 |
| 2009_03_12_10_55_56-doc.doc Path: Cornell >> INDO >> 121 Fall, 2008 Description: Mata Kuliah INDO 1122 (INDO 1122 Course) Semester Musim Semi 2009 (Spring 2009 Semester) Dosen (lecturer) E-mail Kantor (office) : Ibu Jolanda Pandin : jmp244@cornell.edu Telepon (telephone) : (607) 255-0408 : 180 Rockefeller Jam kantor (office hours... Date Added: 2009-06-03 21:42:00 |
| checklist.doc Path: UNL >> ECON >> 321 Spring, 2008 Description: High School/College Course Checklist _ To be filled out by Instructional Designer_ Date: 6/2/05 H.S. Introduction to International Economics ECON 321 B03 u College Course Title: Course Number: Textbook: Title Author(s) Publisher City, State Inte... Date Added: 2009-06-03 21:42:20 |
| Lecture12.ppt Path: Midwestern State University >> CS >> 580 Fall, 2009 Description: Liveness and Performance Issues Deadlock Starvation Livelock Lock contention Lock-free data structures Deadlock Dining Philosophers Wait-for graph If wait-for graph contains a cycle there is a deadlock Potential deadlock (static property)... Date Added: 2009-06-03 21:42:23 |
| Decision-MakingRecord.doc Path: Boise State >> CSI >> 20080221 Fall, 2009 Description: Decision Making Record It is important to keep a running record of key decisions that a team makes. The record can help a team more efficiently maximize the critical resource of time. For instance, some decisions need to be re-decided at regular time... Date Added: 2009-06-03 21:42:30 |
| 121-2.txt Path: UCCS >> CS >> 591 Fall, 2009 Description: Rule: - Sid: 121-2 - Summary: This event is generated when the pre-processor flow-portscan detects network traffic that may constitute an attack. Specifically a sliding scale scanner limit exceeded event was generated. - Impact: Unknown. This is... Date Added: 2009-06-03 21:43:31 |
| ch04.ppt Path: FIU >> EIN >> 4334 Fall, 2008 Description: Chapter 4 Product, Process, and Service Design 1 Overview q q q q q q q q Designing and Developing Products and Services Process Planning and Design Major Factors Affecting Process Design Decisions Types of Process Designs Interrelationships Amo... Date Added: 2009-06-03 21:44:14 |
| ex10_sstypes_intcontrasts_3way.txt Path: Maple Springs >> PSYCH >> 6130 Fall, 2009 Description: # Exercise 10, Question 1 # library(foreign) newdat<-read.dta(file.choose() attach(newdat) head(newdat) mod1<-aov(num_corr~conditin*gender) mod1ni<-aov(num_corr~conditin+gender) # Results for Type I SS # anova(mod1) # No SS pooling anova(mod1ni) # ... Date Added: 2009-06-03 21:44:21 |
| WEBASSIGN.doc Path: Southern Oregon >> PHYS >> 2414 Fall, 2009 Description: CONCISE NOTES FOR WEBASSIGN Note: this document is no excuse for not reading the online student manual. The online student manual can be accessed at the student login website. 1. WEBASSIGN is setup so that your username = 4+4 and your initial WEBASS... Date Added: 2009-06-03 21:45:06 |
| feb23-245.txt Path: Vassar >> CS >> 245 Fall, 2008 Description: ; = ; CMPU-245, Spring 2009 ; Code used in class ; Feb. 23, 2009 ; = ; A pair of mutually-recursive functions defined ; using LETREC. (letrec (f (lambda (n) (if (= n 0) 1 (* n (g (- ... Date Added: 2009-06-03 21:45:20 |
| hw4.doc Path: San Jose State >> CS >> 116 Fall, 2009 Description: CS 116A Fall 2007 Project Part II: Multi-Resolution 3D View (due 11:59pm Sun 12/2/07) Extend Project Part I for multi-resolution. All the features of Project Part I (perspective view of terrain, lighting, navigation) should still be present. Make a h... Date Added: 2009-06-03 21:46:23 |
| description.doc Path: Youngstown >> CHEM >> 3706 Spring, 2008 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02756e72a82aa4c9f0b9bb2c528dd9bb0b155274.doc</Key><RequestId>2 6283C43337E40F7</RequestId><HostId>GIOMMcN64tJay6wqtrnw4j/tBaz... Date Added: 2009-06-03 21:46:34 |
| assignment12_answers_econ337_F05.doc Path: Alaska Anch >> ECON >> 337 Fall, 2009 Description: Econ 337 Fall 2005 Assignment 12 / Review Official Suggested Answers 1. Poverty Trap What is the fundamental idea from economic theory that underlies the poverty trap idea? (2 words). Increasing Returns. (to physical capital or human capital) *How do... Date Added: 2009-06-03 21:46:35 |
| 2007-August.txt Path: Portland >> MKTG >> 443 Fall, 2008 Description: From pcanney at fosters.com Thu Aug 16 05:12:27 2007 From: pcanney at fosters.com (Paula Canney) Date: Thu Aug 16 05:11:50 2007 Subject: [Mktg443cadi] Microsoft Promotion Team (WINNING NOTIFICATION)! Message-ID: <4841962259DDCB42ABB9F40652007376036A... Date Added: 2009-06-03 21:46:48 |
| AldolW04.doc Path: UMKC >> ORGO >> 320 Fall, 2009 Description: Name GTA Lab Section Station # 6. Aldol Reaction Pre-lab questions Complete the following questions and submit before beginning your experiment. 1. In order to produce dibenzalacetone and not benzalacetone, what should the limiting reagent in thi... Date Added: 2009-06-03 21:47:03 |
| GIS+Technician+III+PLN0018.doc Path: UNC >> READ >> 4924966 Fall, 2009 Description: Page 1 of 4 COUNTY of CUMBERLAND POSITION DESCRIPTION Department/Division/Section: Planning Fund: 101 Agency: 450 Org: 4502 Position #: PLN0018 Title: Planning Assistant FLSA: Non-Exempt Grade: 66 GENERAL DESCRIPTION OF DUTIES Under general directio... Date Added: 2009-06-03 21:50:46 |
| 9_beam_deflection.ppt Path: Texas Tech >> MECH >> 3364 Fall, 2009 Description: Third Edition CHAPTER 9 MECHANICS OF MATERIALS Ferdinand P. Beer E. Russell Johnston, Jr. John T. DeWolf Lecture Notes: J. Walt Oler Texas Tech University Deflection of Beams 2002 The McGrawHill Companies, Inc. All rights reserved. MECHANICS ... Date Added: 2009-06-03 21:51:04 |
| heightfoot.txt Path: CSU Fullerton >> MATH >> 120 Fall, 2009 Description: \'height\' \'foot\' 66.5 27 73.5 29 70 25.5 71 27.900000000000002 73 27 71 26 71 29 69.5 27 73 29 71 27 69 29 69 27.2 73 29 75 29 73 27.2 72 27.5 69 25 68 25 72.5 28 78 31.5 79 30 71 28 74 29 66 25.5 71 26.7 71 29 71 28 84 27 77 29 72 28 70 26 76 30 68 2... Date Added: 2009-06-03 21:52:15 |
| MIS4850Class6.ppt Path: N.E. Illinois >> MIS >> 4850 Fall, 2009 Description: TCP/IP Internetworking (February 3, 2009) Abdou Illia Spring 2009 1 Security Goals: Review Three main security goals: Confidentiality of communications and proprietary information Integrity of corporate data Availability of network services a... Date Added: 2009-06-03 21:53:11 |
| 060403reform.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Transitions Online: Damned Statistics TRANSITIONS ONLINE: Serbia: Damned Statistics by Ivan Jankovic 3 April 2006 The World Bank declares Serbia to be the fastest-reforming economy in Eastern Europe. Ordinary Serbs know better... Date Added: 2009-06-03 21:53:56 |
| simpsons.ppt Path: NJ City >> POL >> 254 Fall, 2009 Description: The Simpsons Movie Overview Democracy Executive Power Governance What is the role of government? Is government necessary? Is government competent? Democracy Democracy = demos + kratia = rule by people Executive Power The President is Chief... Date Added: 2009-06-03 21:54:27 |
| standardspowerpoint.ppt Path: SUNY Plattsburgh >> BROW >> 3442 Fall, 2009 Description: Standards and Testing Part 4 Education 330 What makes a good teacher? The Educational Costs of Standardization How do you feel about standardized testing as a future teacher? This system reduces the quality and quantity of what is taught... Date Added: 2009-06-03 21:54:37 |
| ce3401Lec30.doc Path: Mich Tech >> CE >> 3401 Fall, 2008 Description: Lecture 32 PCA Method Background and Computer Program Base on the assumption that each load applied to a pavement uses up a percent of the fatigue life of the pavement. The solution is determined by summing the percent of fatigue life used by the ant... Date Added: 2009-06-03 21:54:53 |
| Project.txt Path: Pittsburgh >> IS >> 1052 Fall, 2009 Description: Here is a checklist for the project. Not all of these need to be done on April 01 but will be evaluated at the end of the term.We will talk more about these elements in the next class. 1) Two or three column design 2) Fixed or liquid 3) Appropriate u... Date Added: 2009-06-03 21:55:15 |
| F08Econ384Sylbs.doc Path: CSB-SJU >> ECON >> 384 Fall, 2009 Description: ECON 384-01A Advanced Research in Economics Fall 2008 CSB Main 323 odd-cycle days (1-3-5) 2:40-3:50 PM COURSE SYLLABUS Dr. John F. Olson e-mail: jolson@csbsju.edu Office: CSB Main 331 Office Phone: 363-5406 Office Hours: 1:00 to 2:30pm, weekdays or ... Date Added: 2009-06-03 21:55:20 |
| F15-Stalls-And-Flushes.ppt Path: University of Illinois, Urbana Champaign >> CS >> 232 Fall, 2008 Description: Stalls and flushes Last time, we discussed data hazards that can occur in pipelined CPUs if some instructions depend upon others that are still executing. - Many hazards can be resolved by forwarding data from the pipeline registers, instead of w... Date Added: 2009-06-03 21:58:14 |
| F12-Pipelining.ppt Path: University of Illinois, Urbana Champaign >> CS >> 232 Fall, 2008 Description: A relevant question Assuming you\'ve got: - One washer (takes 30 minutes) - One drier (takes 40 minutes) - One \"folder\" (takes 20 minutes) It takes 90 minutes to wash, dry, and fold 1 load of laundry. - How long does 4 loads take? May 16, 2009 ... Date Added: 2009-06-03 21:58:14 |
| S21-x86.ppt Path: University of Illinois, Urbana Champaign >> CS >> 232 Fall, 2008 Description: A job ad at a game programming company QuickTimeTM and a TIFF (LZW) decompressor are needed to see this picture. May 16, 2009 ISA\'s, Compilers, and Assembly 1 Assembly Programming Why do they take assembly programming \"very seriously\"? May 1... Date Added: 2009-06-03 21:58:16 |
| lecture15-crommie.ps Path: Bergen CC >> CS >> 191 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: (CrommieLecture7.pdf) %Version: 1 4 %Creator: (Acrobat 5.0 Image Conversion Plug-in for Windows) %CreationDate: (D:20031021173911-07\'00\') %DocumentData: Clean7Bit %LanguageLevel: 2 %BoundingBox: 0 0 612 841 %Pages: 10 %Document... Date Added: 2009-06-03 21:58:28 |
| lecture15-crommie.ps Path: Berkeley >> CS >> 191 Spring, 2005 Description: %!PS-Adobe-3.0 %Title: (CrommieLecture7.pdf) %Version: 1 4 %Creator: (Acrobat 5.0 Image Conversion Plug-in for Windows) %CreationDate: (D:20031021173911-07\'00\') %DocumentData: Clean7Bit %LanguageLevel: 2 %BoundingBox: 0 0 612 841 %Pages: 10 %Document... Date Added: 2009-06-03 21:58:29 |
| ps5.ps Path: Berkeley >> CS >> 150 Fall, 1996 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: ps5.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o ps5.ps ps5.dvi %DVIPSParameters: dpi=300, comments removed... Date Added: 2009-06-03 21:58:45 |
| week8_2.ps Path: Berkeley >> CS >> 150 Fall, 1996 Description: %!PS-Adobe-3.0 %P8BIT %Title: Microsoft PowerPoint - week8_2.ppt %Creator: Adobe Printer Driver 3.0 for Windows 3.1 %CreationDate: 03/02/97 17:36:11 %BoundingBox: 18 8 593 784 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (... Date Added: 2009-06-03 21:58:54 |
| lesson10.ppt Path: University of San Francisco >> CS >> 635 Fall, 2008 Description: What Linux does with IDE? Introduction to Pentium features for trapping reads/writes to memory-locations and i/o-ports Breakpoint Address Registers DR0 DR1 DR2 DR3 Special `MOV\' instructions Use `mov DRn, genreg\' to write into DRn Use `mov gen... Date Added: 2009-06-03 21:59:55 |
| cFunctionalApplications.ps Path: UWO >> CS >> 4472 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.78 Copyright 1998 Radical Eye Software (www.radicaleye.com) %Title: cFunctionalApplications.dvi %Pages: 31 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Bold Times-Roman... Date Added: 2009-06-03 22:00:25 |
| dpg50.txt Path: Michigan State University >> GEO >> 5662 Fall, 2009 Description: MT PLEASANT CMU DIVISION: 6 STATION #5662 ... Date Added: 2009-06-03 22:00:31 |
| Mathcad Asignment-MC_2.doc Path: Mary Hardin-Baylor >> ENGR >> 1320 Fall, 2009 Description: Mathcad Asignment-MC#2 All Mathcad assignments are taken from the text: Mathcad-A Tool For Engineering Problem Solving: Second Edition by Philip J. Pritchard: McGraw Hill Publishers copyright 2008. Chapter-5 -5.1, 5.2, 5.4, 5.6, 5.8, 5.10, 5.13, 5.... Date Added: 2009-06-03 22:02:24 |
| hw1.ps Path: Trinity U >> JOLDHAM >> 1321 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.85 Copyright 1999 Radical Eye Software %Title: hw1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -t letter hw1.dvi -o %DVIPSPar... Date Added: 2009-06-03 22:02:39 |
| hw1.ps Path: Trinity U >> HW >> 1321 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.85 Copyright 1999 Radical Eye Software %Title: hw1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -t letter hw1.dvi -o %DVIPSPar... Date Added: 2009-06-03 22:02:39 |
| final.dist.txt Path: Minnesota >> CS >> 5721 Fall, 2008 Description: CS 5721 Spring, 2003 Computer Graphics Doug Dunham, Ruinan Lu Distribution for final Points = 200.0 n = 18, mean = 109.7 200. 199. 198. 197. 196. 195. 194. 193. 192. 191. 190. 189. 1... Date Added: 2009-06-03 22:03:13 |
| ContextFreeGrammars.ppt Path: Richmond >> CS >> 315 Fall, 2009 Description: I ntroduction to Parsing C opyright 2003, Ke D. C r, Ke Ke dy & Linda Torczon, all rights re rve ith oope n nne se d. S nts e tude nrolle in C p 412 at RiceUnive d om rsity havee xplicit pe ission to m copie of the m rials for the pe rm ake s se ate... Date Added: 2009-06-03 22:03:59 |
| intro_to_ANOVA_4.ppt Path: UWO >> PSYCH >> 2800 Fall, 2009 Description: Relevance: The design and statistical analysis you will use for your pairs projects. Analysis of Variance (ANOVA) is a statistical test. Like a t-test, it tells you whether or not differences between groups are significant. Unlike t-tests, ANOVAs... Date Added: 2009-06-03 22:04:28 |
| LV_Getting_Started.pdf Path: Berkeley >> ME >> 135 Fall, 2008 Description: LabVIEW Getting Started with LabVIEW TM Getting Started with LabVIEW August 2007 373427C-01 Support Worldwide Technical Support and Product Information ni.com National Instruments Corporate Headquarters 11500 North Mopac Expressway Worldwide Offi... Date Added: 2009-06-03 22:07:14 |
| mobility.doc Path: Iowa State >> MR >> 1222 Fall, 2009 Description: World Changing 12-17-06 The Week in Sustainable Mobility Mike Millikin The global mean surface temperature in 2006 is currently estimated to be + 0.42C above the 1961-1990 annual average (14C / 57.2F), according to the records maintained by Members o... Date Added: 2009-06-03 22:09:44 |
| mobility.doc Path: Iowa State >> PUBLIC >> 1222 Fall, 2009 Description: World Changing 12-17-06 The Week in Sustainable Mobility Mike Millikin The global mean surface temperature in 2006 is currently estimated to be + 0.42C above the 1961-1990 annual average (14C / 57.2F), according to the records maintained by Members o... Date Added: 2009-06-03 22:09:44 |
| AOL and Time Warner merger.doc Path: Cal Poly Pomona >> COM >> 423 Fall, 2009 Description: AOL and Time Warner: The Take-Over (Oliver Boyd-Barrett*) In the relationship between `traditional\' media and the new Internet media, the initial assumption had been that traditional media would gradually branch out into and absorb `new media\' activi... Date Added: 2009-06-03 22:11:33 |
| wirelessTCP.ps Path: Berkeley >> CS >> 294 Fall, 1924 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Pages: (atend) %PageOrder: (atend) %DocumentFonts: (atend) %Creator: Frame 4.0 %DocumentData: Clean7Bit %EndComments %BeginProlog % % Frame ps_prolog 4.0, for use with Frame 4.0 products % This ps_prolog file is ... Date Added: 2009-06-03 22:11:42 |
| Test.doc Path: Penn State >> DLD >> 5002 Fall, 2009 Description: Test: Worth 60 Points (I have written the answers in the questions.) Identifying the speaker (2 points each) 1. \"No? I\'ll give you ten seconds to pick up that book, boy, or I\'m going to get my switch.\" (Miss Crocker, the teacher) 2. \"But, Big Ma, ifn... Date Added: 2009-06-03 22:11:54 |
| nair7158.pdf?file=nair7158 Path: UMass (Amherst) >> CMSTEX >> 7158 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02d2354cd7670d5469baf798205d7dd609b182e9.pdf%3Ffile %3Dna</Key><RequestId>23470313F4E12942</RequestId><HostId>NA8WMSmCxjPxriI... Date Added: 2009-06-03 22:12:28 |
| Chappell Lecture 14 Notes.doc Path: Purdue >> ECE >> 311 Fall, 2008 Description: Lecture 14 Notes Magnetic Energy, Torque and Hall Effect Cheng 6.12 and 6.13 Magnetic Energy In electrostatics we had a certain amount of work that needed to be done to bring charges in proximity. This work was found to be 1 We = (Q1V1 + Q2V2 + .Qn... Date Added: 2009-06-03 22:13:07 |
| 218cloning.ppt Path: Wesleyan >> BIOL >> 218 Spring, 2009 Description: Animal Cloning: how and why Dolly, with child Cloned mice Why clone an animal? Test potency of nucleus To maintain prize specimen To save endangered species-bring back extinct species To maintain valuable transgenic animal To produce genetica... Date Added: 2009-06-03 22:13:12 |
| detailed_log.txt Path: Southern Oregon >> CASA >> 20080521 Fall, 2009 Description: 2008-05-21 08:13:04 CDT - BEGIN (Anl, 2008-05-21.13:05Z, casa400, casa_anal) 2008-05-21 08:13:08 CDT - Processing background grids for hours 0 - 0 [Using 20080521_06Z NAM12 run] 2008-05-21 08:13:38 CDT - Processing data for 7 radars: KSAO KRSP KLWE K... Date Added: 2009-06-03 22:13:23 |
| field_curvature_plot_side_1264660.ps Path: Stanford >> CPT >> 080619 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 42 394 552 %Title: Graphics produced by IDL %For: production@hmisan.nascom.nasa.gov, /home/production/CPT080619a %Creator: IDL Version 6.3 (linux x86_64 m64) %CreationDate: Tue Jun 24 06:55:29 2008 %DocumentData: Clean... Date Added: 2009-06-03 22:14:22 |
| Sol2.doc Path: Alabama Huntsville >> PH >> 251 Fall, 2009 Description: University of Alabama in Huntsville Department of Physics Fall, 2008 PH 251: Special Relativity Solutions to Homework 2 ... Date Added: 2009-06-03 22:15:13 |
| lakemary.txt Path: Duke >> STA >> 244 Spring, 2008 Description: Age Length 1 67 1 62 2 109 2 83 2 91 2 88 3 137 3 131 3 122 3 122 3 118 3 115 3 131 3 143 3 142 2 123 3 122 4 138 4 135 4 146 4 146 4 145 4 145 4 144 4 140 4 150 4 152 4 157 4 155 4 153 4 154 4 158 4 162 4 161 4 162... Date Added: 2009-06-03 22:16:00 |
| 16_09_respiration.ppt Path: Eckerd >> BI >> 200 Fall, 2009 Description: Respiration Respiratory Systems - becomes necessary when organisms are too large for gas exchange to occur by simple diffusion - a gas will follow a diffusion gradient from an area of higher concentration to an area of lower concentration Direct di... Date Added: 2009-06-03 22:16:46 |
| IP_Coalescent_README.doc Path: UF >> ZOO >> 6005 Fall, 2009 Description: C. Baer Fall 2006 1 README for IP Coalescent simulation - The goal of this experiment is to get you to show for yourself the extent of the variability in the evolutionary process, particularly with respect to a small sample of genes, as might be samp... Date Added: 2009-06-03 22:18:14 |
| IB1090917Medicinecompleted.doc Path: University of Illinois, Urbana Champaign >> IB >> 109 Fall, 2008 Description: IB1090917 Insects in medicine March 2, 2009, Pages 165-176 1. If you believed in the doctrine of signatures, for what ailments would you prescribe: a. crickets throats or ear b. earwigs hearing difficulties c. hairy flies alopecia (baldness) d. spott... Date Added: 2009-06-03 22:18:35 |
| IB 109-Predators lab2.doc Path: University of Illinois, Urbana Champaign >> IB >> 109 Fall, 2008 Description: Ent. 105 Insects and People Predation Lab 1. Principles of Predation Some insects catch and kill other species for food. This sort of association is known as predation. Predation is an extremely common way to make a living among arthropods-it is know... Date Added: 2009-06-03 22:18:46 |
| process.ps Path: Wisconsin >> CS >> 537 Spring, 2001 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Pages: (atend) %PageOrder: (atend) %DocumentFonts: (atend) %DocumentNeedsFonts: (atend) %DocumentSuppliedFonts: (atend) %Creator: Frame 5.5 %DocumentData: Clean7Bit %EndComments %BeginProlog % % Frame ps_prolog 5... Date Added: 2009-06-03 22:19:24 |
| abc3023.txt Path: Montana >> ABC >> 3023 Fall, 2009 Description: 10 20 30 40 50 KC3023R.SEQ > 1 TAATCCAGTT ACtGAAATGT aCTACCCCCA CAcCCgcACC AAAGCCGTTG 50 MC3023R.SEQ > -13 . .GAAATGT ACTACCCCCA CACCCGCACC AAAGCCGTTG 37 MC3023... Date Added: 2009-06-03 22:20:08 |
| Project Overview and Presentation.doc Path: Benedictine IL >> CISCMSC >> 398 Fall, 2009 Description: CIS/CMSC 398 Capstone Project Project Overview and Presentation Assigned January 15, 2008; Due February 12, 2008 As a team, prepare and submit a description of the \"significant software application\" that you will define, design, develop, test and de... Date Added: 2009-06-03 22:20:16 |
| 07.ppt Path: North-West Uni. >> WIN >> 211 Fall, 2009 Description: Overloading Overloading allows a function or operator to have a different meaning depending on the type of objects it is used on. Examples: operator+ can be applied to both integers and strings. When applied to integers, it adds them. When a... Date Added: 2009-06-03 22:23:56 |
| 05html.ppt Path: UMass Lowell >> CS >> 113 Fall, 2009 Description: HTML Hypertext Markup Language Coding of web pages for a browser to render Markup language is NOT a programming language (what is a programming language ? later) Consists of TAGS describing contents HTML contains tags specifying text, images,... Date Added: 2009-06-03 22:24:57 |
| IESLecture15 - Debugging_notation.ppt Path: UNC Charlotte >> ECGR >> 4101 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|14 Nov 2006 17:04:54 -0000 vti_extenderversion:SR|12.0.0.6211 vti_author:SR|CONRADUNCCLAPTO\\Robot vti_modifiedby:SR|CONRADUNCCLAPTO\\Robot vti_timecreated:TR|14 Nov 2006 17:04:54 -0000 vti_cacheddtm:TX|1... Date Added: 2009-06-03 22:25:20 |
| Readme.txt Path: UNC Charlotte >> ECGR >> 4101 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|15 Oct 2003 17:45:48 -0000 vti_extenderversion:SR|6.0.2.6353 vti_cacheddtm:TX|15 Oct 2003 17:45:48 -0000 vti_filesize:IR|307 vti_backlinkinfo:VX| ... Date Added: 2009-06-03 22:25:40 |
| Residuals.xls Path: Wells >> MATH >> 251 Fall, 2009 Description: Simple linear regression, The regression line is the line that minimizes the sum of the squared residuals. Graph of residuals residual Sum of squared residuals x y predicted y-predictedsquared resid. 8.45 1 1.63 2.15 -0.52 0.27 2 1.51 2.71 -1.20 1.45... Date Added: 2009-06-03 22:28:05 |
| Residuals.xls Path: Wells >> MATH >> 151 Fall, 2009 Description: Simple linear regression, The regression line is the line that minimizes the sum of the squared residuals. Graph of residuals residual Sum of squared residuals x y predicted y-predictedsquared resid. 8.45 1 1.63 2.15 -0.52 0.27 2 1.51 2.71 -1.20 1.45... Date Added: 2009-06-03 22:28:26 |
| L03OperatingSystems.ppt Path: UMBC >> CS >> 104 Fall, 2009 Description: Review Practice Conversion Problems on web Tuesday, Sep 10: ECS 104 Thursday, Sep 12: Algorithms I w/ Dr. Marie desJardins Binary, Decimal, Hexadecimal o o Addition (carry the one!) Subtraction (borrow 2! UMBC CMSC 104, Section 0801 - Fall 20... Date Added: 2009-06-03 22:28:57 |
| HW1key04.doc Path: Central Washington University >> CHEM >> 345 Fall, 2009 Description: HW#1 KEY Steady State Box Model Problem: From the hint h2o= pollutant. Calculate h2o from Mh2o/Fh2o: h2o= (4x107 m3)/(8x104 m3/day)=5x102 days Since pollutant=5x102 days=Mpollutant/(0.16 tonnes/day) Mpollutant=80 tonnes # moles Cr2O72- = 4.7x10... Date Added: 2009-06-03 22:30:27 |
| 2007_09_05.03ToPresent.ppt Path: Wake Forest >> CSC >> 101 Fall, 2008 Description: Overview of Computer Science CSC 101 - Fall 2007 Introduction to The Internet Lecture 4 - September 5, 2007 Copyright 2007 Brian A. Kell Announcements TA change: The TA for the lecture part of the course is: Adam Humenansky humeja2@wfu.edu ... Date Added: 2009-06-03 22:30:57 |
| ArchRptDefects.doc Path: Syracuse >> CSE >> 681 Fall, 2008 Description: CSE681 Software Modeling and Analysis Fall 2002 Architectural Report Defect Analysis Project # Name: topic Discussion too brief: - context diagram, module diagram, activity diagram, class diagram, data structure diagram, event trace, structure cha... Date Added: 2009-06-03 22:32:28 |
| carrano_ppt13_H.ppt Path: Vassar >> CS >> 102 Fall, 2008 Description: Chapter 13 (excerpts) Advanced Implementation of Tables CS102 Sections 51 and 52 Marc Smith and Jim Ten Eyck Spring 2007 2006 Pearson Addison-Wesley. All rights reserved 13 B-1 AVL Trees An AVL tree A balanced binary search tree Can be searched... Date Added: 2009-06-03 22:33:08 |
| Lecture 06 2008 MS115a.ppt Path: Caltech >> MS >> 115 Fall, 2009 Description: Structures of Complex Oxides Multiple cations Perovskite: ABO3 Capacitors Covalency Zinc blende Semiconductors Spinel Magnetic properties Diamond Semiconductors Silicates Minerals Perovskite Perovskite: ABO3 [B boron] A2+B4+O3 Ca... Date Added: 2009-06-03 22:33:08 |
| PHY615_L4.ppt Path: Syracuse >> PHY >> 615 Fall, 2008 Description: Prote the stability and dynam ins, ir ics Le cture#4 S pte be 13th e m r Homework for Tuesday, Sep 13th Can ions penetrate in between the bases in DNA or RNA polymers? Please respond this for either Na+, K+, and Cl- ions. Outline: ins? What aret... Date Added: 2009-06-03 22:33:34 |
| ms project.doc Path: Sveriges lantbruksuniversitet >> BUS >> 361 Fall, 2009 Description: Trent Lin #301017201 BUS361 MS Project Assignment Feb 15,07 Trent Lin #301017201 BUS361 MS Project Assignment Feb 15,07 Trent Lin #301017201 BUS361 MS Project Assignment Feb 15,07 ... Date Added: 2009-06-03 22:33:42 |
| Football+Review.doc Path: UNC >> READ >> 1710482 Fall, 2009 Description: The University of North Carolina Bands Music Department/CB #3320/106 Hill Hall Chapel Hill, NC 275993320 (919) 9625695 www.uncbands.org During the spring 2004 semester, the UNC Bands staff and student members will conduct a comprehensive review of ... Date Added: 2009-06-03 22:35:25 |
| ps_4.doc Path: Stevens >> E >> 344 Fall, 2009 Description: Problem Set 4 Due: Tuesday, 12 February, 2008 at the beginning of lecture E-344 Spring 2008 * On the solution you submit, please staple multiple pages together and legibly (e.g. print) write your name and 4-digit ID number. Papers without this info... Date Added: 2009-06-03 22:36:43 |
| ps_4.doc Path: Stevens >> PS >> 344 Fall, 2009 Description: Problem Set 4 Due: Tuesday, 12 February, 2008 at the beginning of lecture E-344 Spring 2008 * On the solution you submit, please staple multiple pages together and legibly (e.g. print) write your name and 4-digit ID number. Papers without this info... Date Added: 2009-06-03 22:36:43 |
| P10_07.doc Path: Stevens >> E >> 344 Fall, 2009 Description: For a composition of Ag-30 at% Cu, for T1 = 900 oC, T2 = 800 oC, T3 = 779 oC, T4 = 778 oC, and T5 = 200 oC: a) identify the phase or phases present b) deternmine the composition of each phase c) determine the fraction of each phase d) sketch a possib... Date Added: 2009-06-03 22:38:29 |
| 2007Guestspeaker-Settimi.ppt Path: DePaul >> CS >> 578 Fall, 2009 Description: Automated Requirements Traceability: an application of IR techniques in Software Engineering Raffaella Settimi School of CTI In collaboration with Dr. Jane Huang and PhD student Xuchang (Cindy) Zou Funded by NSF grant #: CCR-0306303 Outline ... Date Added: 2009-06-03 22:41:54 |
| Worksheet%2030%20-%20Interpretations.doc Path: Arizona >> MATH >> 124 Fall, 2008 Description: Worksheet 30 - INTERPRETATIONS Name _ Two mice are initially placed at the center of a 200 foot tunnel. Their velocities are recorded below. Assume velocity is positive when the mouse is moving to the right. Velocity of Mice 1.25 1 0.75 ft/sec 0.5... Date Added: 2009-06-03 22:44:55 |
| simulation.xls Path: Michigan Flint >> BUS >> 381 Fall, 2009 Description: Monte Carlo Simulation Example: Simulation Results ReplicationDemand 1 60 2 40 3 70 4 90 5 90 6 90 7 40 8 60 9 90 10 40 11 50 12 40 13 40 14 40 15 50 16 40 17 50 18 60 19 70 20 60 21 60 22 60 23 90 24 60 25 60 26 50 27 90 28 80 29 90 30 50 31 90 32 ... Date Added: 2009-06-03 22:45:29 |
| cookie2.jsp.txt Path: CSU LA >> CS >> 320 Fall, 2009 Description: <%@ page language=\"Java\" %> <html> <head> <title>Cookie 2</title> </head> <body> <% String username = \"; Cookie [] cookieArray = request.getCookies(); for (int i=0; i < cookieArray.length; i+) { if (cookieArray[i].getName... Date Added: 2009-06-03 22:47:12 |
| filtering_lists.doc Path: MS Women >> BU >> 160 Fall, 2009 Description: Filtering Lists October 24, 2006 Filtering: o When you filter a list of data, all records that do not meet your specified criteria are temporarily hidden from view (EX 212). o To filter a list using AutoFilter, Make sure that the active cell is ... Date Added: 2009-06-03 22:47:58 |
| expect-excel.doc Path: Delaware >> MEEG >> 101 Fall, 2008 Description: Modeling Assessment Expectations E1, NASA Cone, Introduction to Excel Modeling Assignment Expectations 1. Follow the instructions in this handout, which has been updated to Office 2000. 2. Your final goal is to make a graph similar to Figure 23. 3. P... Date Added: 2009-06-03 22:48:02 |
| Chapter 26 Outline.doc Path: Ill. Wesleyan >> BUS >> 200 Fall, 2009 Description: Chapter 26 Outline I. General Liability Loss Exposures A.Premises and Operations 1. Liability because of ownership and maintenance of premises 2. Liability because of operations, either on or off premises B.Products Liability C.Completed Operations 1... Date Added: 2009-06-03 22:52:11 |
| Chapter 12 Outline.doc Path: Ill. Wesleyan >> BUS >> 200 Fall, 2009 Description: Chapter 12 Outline I. Life Insurance Contractual Provisions A.Ownership Clause 1. Possible owners: the insured, beneficiary, or a third party 2. Owner\'s rights: may change the beneficiary (unless irrevocable); surrender the policy; receive dividends;... Date Added: 2009-06-03 22:52:12 |
| 180act3.doc Path: ASU >> MTE >> 180 Fall, 2009 Description: ACTIVITY 3 MIXED PROBLEMS FROM CHAPTER 1 1. Use the words car, depreciates, and the numbers 26500, 1200, 3 to construct a problem. Solve the problem. 2. A farmer has hens and rabbits. They have a total of 50 heads and 140 feet. How many hens and ... Date Added: 2009-06-03 22:53:11 |
| Day18-200607Spring-Rijndael.ppt Path: Rose-Hulman >> CSSE >> 479 Fall, 2009 Description: DTTF/NB479: Dszquphsbqiz Announcements: Day 18 Quiz grades entered Homework 4 updated with more details. Discussion forum is picking up traffic Today: Prep. for Rijndael and Discrete Logs: GF(28) Rijndael Questions? Rijndael A.k.a. AES (Ad... Date Added: 2009-06-03 22:53:55 |
| Verzani-SimpleR.pdf Path: Calvin >> M >> 243 Spring, 2008 Description: simpleR Using R for Introductory Statistics John Verzani y 2e+05 20000 40000 60000 80000 4e+05 6e+05 8e+05 120000 160000 page i Preface These notes are an introduction to using the statistical software package R for an introductory statisti... Date Added: 2009-06-03 22:55:09 |
| dewey_review_3rd_lect_f07.ppt Path: University of Hawaii - Hilo >> LIS >> 605 Fall, 2009 Description: Dewey Decimal Classification System Review of Lecture 3 Fall 2007 Bair-Mundy Ten main classes 000 Generalities 100 Philosophy, paranormal phenomena, psychology 200 Religion 300 Social sciences 400 Language 500 Natural sciences and mathematics 600 T... Date Added: 2009-06-03 22:55:18 |
| assign1.txt Path: Cincinnati >> STAT >> 534 Fall, 2009 Description: SAS PROGRAMMING DUE JANUARY 19 ASSIGNMENT #1 1) Save the following data as a text file (on A:), and then write a SAS program to read ... Date Added: 2009-06-03 22:56:11 |
| hand20.txt Path: Cincinnati >> YR >> 615 Fall, 2009 Description: LINEAR MODELS III HANDOUT #20 This handout will use PROC IML to compute the multivariate statistics data weights; input subj program$ s1 s2 s3 s4 s5 s6 s7; ONE=1; ... Date Added: 2009-06-03 22:56:29 |
| Exam2.F99.362.doc Path: Wisc Stout >> BIO >> 362 Fall, 2009 Description: Bio362 Advanced Physiology Fall 1999 Exam 2 100 points Name _ Multiple Choice: Choose the best correct answer. (2 points each) 1. Which of the following best describes why an animal (humans included) would have a crossedextensor reflex. A. Extens... Date Added: 2009-06-03 22:57:42 |
| chap-05.ppt Path: UF >> COP >> 5615 Fall, 2008 Description: Synchronization Chapter 5 Clock Synchronization When each machine has its own clock, an event that occurred after another event may nevertheless be assigned an earlier time. Physical Clocks (1) Computation of the mean solar day. Physical Clocks ... Date Added: 2009-06-03 22:58:24 |
| MAO-Sunil.doc Path: UF >> SK >> 99310 Fall, 2009 Description: Probabilistic Optimization of Integrated Thermal Protection System Sunil Kumar, Bhavani V. Sankar and Raphael T. Haftka University of Florida, Gainesville, Florida, 32611, USA 1. INTRODUCTION Probabilistic structural optimization is expensive because... Date Added: 2009-06-03 22:59:02 |
| sp07ex3csol.doc Path: UF >> STA >> 4321 Fall, 2008 Description: STA 4321/5325 Exam 3 Spring 2007 0 y - 1 e - y / dy = ( ) 1 0 y - 1 (1 - y ) - 1 dy = ( )( ) ( + ) The moment generating function for the gamma distribution with parameters and is M(t) = (1-t)- . Use this to demonstrate that the... Date Added: 2009-06-03 22:59:55 |
| Cost vs Equity Method.doc Path: Idaho >> ACCT >> 592 Spring, 2008 Description: Acct 415/515 Prof. Teresa Gordon Accounting for Investments under FASB No. 115 A Review For commercial enterprises (nonprofit entities follow SFAS No.124) Does the investor have substantial influence or control? Investor owns 20% to 50% of stock a... Date Added: 2009-06-03 23:00:26 |
| projec~1.doc Path: RPI >> DSES >> 6620 Fall, 2009 Description: Appendix A DSES-6620 SIMULATION MODELING AND ANALYSIS Spring 2002 Project Proposal (revised) R. Sewersky Summary: Using a previously developed Supply Chain Simulation (developed in TaylorED) complete an analysis to verify and validate it. The model ... Date Added: 2009-06-03 23:03:28 |
| assignment_8.txt Path: Fayetteville State University >> PHZ >> 4151 Fall, 2009 Description: main () { { int j = 10; } j = 11; } ... Date Added: 2009-06-03 23:03:33 |
| assignment_8.txt Path: Fayetteville State University >> ASSIGNMENT >> 4151 Spring, 2009 Description: main () { { int j = 10; } j = 11; } ... Date Added: 2009-06-03 23:03:33 |
| Garfield_Construction_w_blanks_n_IFRS_sol.xls Path: Idaho >> ACCT >> 414 Spring, 2008 Description: Acct 414 05/16/2009 Prof. Teresa Gordon Garfield Construction Inc. - Construction Accounting Garfield Construction Inc. (GCI) has contracted to build hydroelectric plant on the Palouse River. The project will take three years to complete. The cont... Date Added: 2009-06-03 23:04:37 |
| 23-Virtual-Memory.ppt Path: University of Illinois, Urbana Champaign >> CS >> 232 Fall, 2008 Description: A Real Problem What if you wanted to run a program that needs more memory than you have? May 16, 2009 Cache writes and examples 1 Virtual Memory (and Indirection) Finally, we get to Virtual Memory! - We\'ll talk about the motivations for virtu... Date Added: 2009-06-03 23:06:06 |
| ch08.ppt Path: Bowling Green >> CSC >> 2310 Fall, 2009 Description: Chapter 8: More Control Structures Chapter 8 More Control Structures Java Programming FROM THE BEGI NNI NG 1 Copyright 2000 W. W. Norton & Company. Chapter 8: More Control Structures 8.1 Exceptions When a Java program performs an illegal ope... Date Added: 2009-06-03 23:06:27 |
| hw1.ps Path: UCSD >> CSE >> 207 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw1.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -ohw1.ps hw1 %DVIPSParameters:... Date Added: 2009-06-03 23:07:38 |
| sma04.ps Path: UCSD >> CSE >> 101 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: sma04.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f sma04.dvi %DVIPSParameter... Date Added: 2009-06-03 23:08:58 |
| McGuinness.ppt Path: UCSD >> ARIES >> 0506 Fall, 2008 Description: Power Loads and Divertor Design Hayden McGuinness Don Steiner Rensselaer Polytechnic Institute In collaboration with T.K. Mau and A. Grossman Overview Objective: Feasible Divertor Design considering heat loads, temperature distribution and physical... Date Added: 2009-06-03 23:10:05 |
| SSRD_IOC2_S07b_T07_V3.4.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: System and Software Requirements Definition (SSRD) Version no 3.4 System and Software Requirements Definition (SSRD) USC CCR Web Application Team 7 CS-577b Development Team Andrew Hart Kailash Karol Skanda Ramesh Sutap Chatterjee Clients Carolina ... Date Added: 2009-06-03 23:10:59 |
| quiz5_sol.doc Path: USC >> CSCI >> 570 Spring, 2008 Description: Quiz 5 1. a. CCT_FIND_SAT decision problem: Given a circuit C with inputs x1, x2, . xn CCT_FIND_SAT(C) = 1 if there exist a truth assignment for x1, x2, .xn such that C is satisfiable = 0 otherwise. Boolean Foo(C): C is a circuit with inputs x1, x2, ... Date Added: 2009-06-03 23:11:53 |
| 213.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Thu Oct 2 19:57:54 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:13:01 |
| 52.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sun Sep 7 07:57:50 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:13:14 |
| 060215forc.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Warsaw Voice WEEKLY NEWSMAGAZINE Regional Growth Up A.R. 2006-02-15 The World Bank has positively rated prospects for economic growth in the new member states of the European Union. ... Date Added: 2009-06-03 23:13:58 |
| hong_hu.ppt Path: Ball State >> CS >> 689 Fall, 2008 Description: Internet Database Engines Selection and Implementation CS689 Research Method Hong Hu December 5, 2000 Content Introduction Methodology Findings Management plan, timeline, feasibility Conclusion References Introduction A. General background o... Date Added: 2009-06-03 23:14:20 |
| hw2.doc Path: W. Kentucky >> CSC >> 501 Fall, 2009 Description: CSC 501 Homework #2 Due Date: Monday, February 2 1. Do problems 13 and 14 on page 373. 2. Its interesting that the array-based version of the queue is more complicated to implement than the array-based version of the stack and yet the linked implemen... Date Added: 2009-06-03 23:14:39 |
| sadker8_ppt_ch09.ppt Path: UNC Asheville >> EDUC >> 310 Fall, 2009 Description: 9 CHAPTER Financing and Governing America\'s Schools DAVID MILLER SADKER MYRA POLLACK SADKER KAREN R. ZITTLEMAN TEACHERS, SCHOOLS, AND SOCIETY EIGHTH EDITION Sadker/Sadker/Zittleman, Teachers, Schools, and Society, Eighth Edition. 2008 The McGraw-... Date Added: 2009-06-03 23:14:50 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 5658 Fall, 2009 Description: : 49695:43683:153:594 37291:34819:128:277 ; 20606:35295:102:337 29935:35295:102:337 10918:35335:76:337 a 51079:37873:717:575 51848:62124:692:575 actions 40828:41383:4664:575 advisor 29064:34661:3460:436 after 40956:39023:3306:575 al 42775:35731:845:3... Date Added: 2009-06-03 23:15:13 |
| EX6.TXT Path: Midwestern State University >> ECONS >> 511 Fall, 2009 Description: Sheet1 new cls g gausset /*Load the data from the file and identify the variables */ load data[20,9] = c:\\wsu\\teach\\511\\2007\\example\\housing.txt Y Yr = data[.,1] Q = data[.,2]*1000 P = data[.,3] I IR = data[.,4] T TRM = data[.,5] TC = data[.,6] MHC ... Date Added: 2009-06-03 23:15:45 |
| Week12.ppt Path: Michigan >> STAT >> 350 Fall, 2008 Description: Today\'s Agenda Final Exam Review Final CAOS and Attitudes Survey Lab evaluations 1 HW and Final Info 1. HW 11 is due today 2. HW 12 is due on Monday to 2237 Chem 3. Graded HW 11 and HW 12 will be available in 2237 Chem during open office hours W... Date Added: 2009-06-03 23:16:35 |
| WhatITriedTemplateME305.doc Path: Rose-Hulman >> AY >> 0506 Fall, 2009 Description: Mechanical Engineering ME 305 Introduction to Aerospace Design Academic Year: 2005-2006 Evaluation of the course: What was good? Textbook Class discussions with historical development of aeronautical design. Class is presented as an introductory c... Date Added: 2009-06-03 23:16:53 |
| 911.txt Path: Texas A&M >> X >> 075 Fall, 2009 Description: Dispatcher: 9-1-1 What is your emergency? Caller: I heard what sounded like gunshots coming from the brown house on the corner. Dispatcher: Do you have an address? Caller: No, I\'m wearing a blouse and slacks, why? Dispatcher: 9-1-1 What is your eme... Date Added: 2009-06-03 23:19:42 |
| kirschner-euler1.txt Path: Texas A&M >> MATH >> 308 Fall, 2008 Description: # # Numerical dsolve is used with Euler\'s method. The numeric solutions # are graphed and compared with the analytic solution. # # Maple Worksheet written by Denise Kirschner # > with(DEtools): with(plots): -- # > p1:=DEplot(diff(y(x),x)=2*y(x... Date Added: 2009-06-03 23:19:53 |
| leopoldcenter.doc Path: Iowa State >> MR >> 0713 Fall, 2009 Description: Wallace\'s Farmer, IA 07-11-07 Leopold Center Seeks Projects for 2007 Compiled By Staff The Leopold Center for Sustainable Agriculture at Iowa State University wants to work with Iowans who have innovative ideas for sustainable agriculture alternative... Date Added: 2009-06-03 23:21:31 |
| leopoldcenter.doc Path: Iowa State >> PUBLIC >> 0713 Fall, 2009 Description: Wallace\'s Farmer, IA 07-11-07 Leopold Center Seeks Projects for 2007 Compiled By Staff The Leopold Center for Sustainable Agriculture at Iowa State University wants to work with Iowans who have innovative ideas for sustainable agriculture alternative... Date Added: 2009-06-03 23:21:31 |
| 12307.doc Path: Iowa State >> NR >> 68545 Fall, 2009 Description: Extension TOW Food Safety Week December 3, 2007 Most of us will be cooking this holiday season, whether it be baking cookies or entertaining family. Keep your family and houseguests safe from food borne illness with these four helpful key words: Cl... Date Added: 2009-06-03 23:22:09 |
| plan00.doc Path: Michigan >> CIS >> 375 Fall, 2008 Description: #># #m#o #q#s#u#w#~# #7 #RL#bjbjU#U# #7|#7| #YF#Z## l#2#2#2#F# #8#d#*#F#/#2#:# #\"#\"#\"#6# #$#a# #h##2# #\"#\" #$#*#\"#2#\"# # #h##c#x# #:#2#*# #\"# #R#F#H#n#~#*# #0#/#>#*#F#F# #Purpose of planThe purpose of this plan is to develop a web-based too... Date Added: 2009-06-03 23:23:57 |
| 3.pdf Path: Bergen CC >> ARE >> 263 Fall, 2009 Description: Larry Karp Notes for Dynamics September 2001 III. The Maximum Principle 1) Necessary conditions using Maximum Principle. 2) Relation between COV and Maximum Principle approaches. 3) Various terminal conditions, sufficiency. 4) An example with two s... Date Added: 2009-06-03 23:24:10 |
| page02.ps Path: Minnesota >> A >> 05088 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58e Copyright 1986, 1994 Radical Eye Software %Title: tmp.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Helvetica-Bold %EndComments %DVIPSCommandLine: dvips tmp.dvi -o tmp.ps %DVIPSParame... Date Added: 2009-06-03 23:25:15 |
| assignment4.xls Path: Idaho >> ECE >> 101 Spring, 2008 Description: ECE 101 Intro to ECE Assignment #4 Problem 1 I (A) 0 0 0 0 0 0 V (V) 0 4.7 9.4 14.4 19.7 24.5 a) Enter the above data in to an excel spread sheet b) Graph V versus I. c) Determine R using a first order (linear) trendline. d) Calculate the voltage... Date Added: 2009-06-03 23:27:34 |
| BrewBuggy.doc Path: UCSD >> MAE >> 156 Fall, 2008 Description: MAE156 Sponsored Project Description Project Title: Brew Buggy Contact (name, email, phone): Dan Wolfson danw@usa.net 858-546-0707 Company website: Availability During Kickoff Week: The student team will contact each sponsor to arrange for a conveni... Date Added: 2009-06-03 23:27:45 |
| CS210_Assignment01.doc Path: Coker >> CS >> 210 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|11 Jan 2005 16:46:38 -0000 vti_extenderversion:SR|5.0.2.2623 vti_thicketsupportingfile:BW|true ... Date Added: 2009-06-03 23:28:20 |
| Lab2-ATM.doc Path: Wilfrid Laurier >> SENG >> 401 Fall, 2009 Description: Specification of an Automated Teller Machine (ATM) in RTPA Dr. Y. Wang, 2003 1. Description of System Architecture (ATM) ATM.Architecture | ATM.StaticBehaviors | ATM.DynamicBehaviors | | | | | | | ServiceCancelledBL SsytemFailureBL SstShutDownBL Va... Date Added: 2009-06-03 23:28:27 |
| 185_W99.ps Path: UCSC >> SOE >> 185 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: this-quarter-only.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o this-quarter-onl... Date Added: 2009-06-03 23:29:17 |
| Saponification - Kato.ppt Path: Oregon State >> CHE >> 414 Fall, 2008 Description: Saponification of Ethyl acetate by Sodium hydroxide in a Plug Flow Reactor Lindsey Kato Shawna Togioka Luke Sugie February 2, 2005 Overview Project Objectives Project Planning and Execution Background and Experimental Methods Results and Conclus... Date Added: 2009-06-03 23:30:46 |
| Part Drawings.ppt Path: Georgia Tech >> ME >> 4182 Fall, 2008 Description: Engineering Analysis Presentation Team Up Ed Fleiss Chris Jacobs Josh Marcy Phillip Nichols Mark Zoller PREVIOUSLY o Post Mid-Term Review Drawings We analyzed the written and oral comments made by the class about the midterm presentation,... Date Added: 2009-06-03 23:31:09 |
| test4revsols.ps Path: Boise State >> MATH >> 187 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: test4revsols.dvi %Pages: 9 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips test4revsols -otest4r... Date Added: 2009-06-03 23:31:28 |
| test2grades.txt Path: Boise State >> MATH >> 187 Fall, 2008 Description: Test II grades the lowest question on your paper was dropped; the best of the two parts of question 8 was counted. With this grading scheme, the average grade in the class was 75. This is not an official report: clerical errors here do not force m... Date Added: 2009-06-03 23:31:30 |
| sphsu2.ppt Path: Lake City CC >> CS >> 5400 Fall, 2009 Description: From Calculus of Fuzzy Restrictions to Approximate Reasoning Presented by Peter Hsu Presentation #2 Provide more formal and detailed definitions for fuzzy operations Calculus of Fuzzy Relations Approximate Reasoning New Notations (page 1) A = {u1 ,... Date Added: 2009-06-03 23:31:34 |
| Arrays.ppt Path: University of Montana >> CS >> 101 Fall, 2008 Description: Arrays An array is a collection of data items that have the same type. You can think of an array as a list of items. The list must contain only items that have the same type. For example, we can\'t have a list of Strings AND Integers. Arrays Ar... Date Added: 2009-06-03 23:32:37 |
| 06-Operating_Systems.doc Path: University of Montana >> CS >> 487 Fall, 2009 Description: Network System Administration (CS487) The University of Montana- Computer Science Dept Servers: Operating Systems & Hardware Instructor: Anne A. Stenberg SERVERS What is a server? A server is a computer or software package that provides services... Date Added: 2009-06-03 23:32:39 |
| Tutorial_set_9.ppt Path: UMDNJ >> BINF >> 5030 Fall, 2009 Description: INTRODUCTION TO MARKOV MODELS OUTLINES DECISION TREES AND MARKOV MODELS Markov model is a recursive (repetitive) decision tree that is for modeling conditions that have events that may occur repeatedly over time or for modeling predictable events tha... Date Added: 2009-06-03 23:33:14 |
| Lecture_1.ppt Path: UMDNJ >> BINF >> 5230 Fall, 2009 Description: Advances in Molecular & Cellular Genetics Principles and Applications of Bioinformatics BINF 5230 Lecture 1 Spring 2005 1 Who am I? Alexander Kister, Ph.D Research in Bioinformatics. kisterae@umdnj.edu Rm 364 Phone (973) 972 8596 2 Who are y... Date Added: 2009-06-03 23:33:20 |
| Chapter1.ppt Path: Troy >> CS >> 3332 Fall, 2009 Description: An Introduction to Software Engineering Ian Sommerville 2006 Software Engineering, 8th edition. Chapter 1 Slide 1 Objectives q q q To introduce software engineering and to explain its importance To set out the answers to key questions about so... Date Added: 2009-06-03 23:35:02 |
| m2e30s03.doc Path: UCSB >> EEMB >> 030 Fall, 2009 Description: EEMB 30 Second Midterm Exam FORM A Answer all questions on the Scantron sheet. Values: Problem 1 2 3 4 5 6 7 8 9 10 11 Points 4 4 4 7 7 4 5 7 7 9 12 Spring 2003 12 9 13 9 14 8 15 11 16 4 The first 3 questions concern the following plots. They show... Date Added: 2009-06-03 23:36:15 |
| Sharese Van Sloten-Resume1.doc Path: Wartburg >> BA >> 325 Fall, 2009 Description: Sharese Van Sloten OBJECTIVE: EDUCATION: Bachelor of Arts, Business Administration Major Concentrations: Marketing and Management Projected graduation in May 2009 Wartburg College, Waverly, IA; GPA: 3.2 / 4.0 EXPERIENCE: Telemarketer, Knightcallers, ... Date Added: 2009-06-03 23:36:55 |
| Recursion.ppt Path: Nevada >> CS >> 308 Fall, 2009 Description: Recursion CS 308 Data Structures What is recursion? Sometimes, the best way to solve a problem is by solving a smaller version of the exact same problem first Recursion is a technique that solves a problem by solving a smaller problem of the sam... Date Added: 2009-06-03 23:37:40 |
| MSE355F02Quiz3Solution.doc Path: Michigan State University >> MSE >> 355 Fall, 2009 Description: MSE355Quiz3 Name:_ The following table contains steady-state strain rate data for three tests conducted at two different temperartures and two different stresses. The temperatures given are the homologous temperatures for a material with a melting ... Date Added: 2009-06-03 23:38:12 |
| quiz3_ss04.doc Path: Michigan State University >> ME >> 361 Fall, 2008 Description: Name: _ PID: _ ME 361 Dynamics Friday, April 23, 2004 Quiz 3 Comments and general instructions: Be neat and clear in your presentation, and show all work for full credit. This is a closed-book and closed-notes Opportunity to Shine. Calculator... Date Added: 2009-06-03 23:38:21 |
| exam2studyguide.doc Path: CSU Fresno >> MATH >> 150 Fall, 2009 Description: Calculus I, Drs. Nogin and Wyels, Fall `06 Exam 2 Study Guide General Information Exam 1 will be held in class Thursday, Nov. 9. You will have 75 minutes to complete the exam the ability to work through the material efficiently is part of the exam... Date Added: 2009-06-03 23:38:50 |
| 04 057ab.xls Path: East Los Angeles College >> UKHR >> 0405 Fall, 2009 Description: Table 57a Gross social housing investment in Great Britain Table 57b Gross social housing investment in Great Britain at constant prices Table 57a Gross social housing investment in Great Britain million (cash) 1979/80 1980/81 1981/82 1982/83 1983/8... Date Added: 2009-06-03 23:39:35 |
| rousseau_resume.doc Path: St. Norbert >> CS >> 460 Fall, 2009 Description: 718 3rd St. DePere, WI 54115 Phone (920) 819-3258 E-mail john.rousseau@snc.edu Relocation: Yes John W. Rousseau Objective To obtain a challenging position in the technology industry utilizing my skills and allowing for the ability to develop new sk... Date Added: 2009-06-03 23:40:03 |
| engler.txt Path: Michigan State University >> SS >> 040596 Fall, 2009 Description: Slug: Engler April 3, 1996 By BRYAN EDER Capital News Service LANSING-He says he\'s staying put, but Michigan Gov. John Engler is still fighting off rumors of a vice-presidential bid. \"If I walk out of this room and something falls on my head,\" he... Date Added: 2009-06-03 23:41:14 |
| MSE 536 HW1 Sol.doc Path: CSU Northridge >> RDC >> 536 Fall, 2009 Description: MSE 536 1.1 Homework #1 Answers 1.2 ... Date Added: 2009-06-03 23:41:40 |
| lecture10.ppt Path: Michigan State University >> CSE >> 450 Spring, 2008 Description: Storage Storage Layout Where to put what How much space Alignment Token Stream Parser Memory Intermediat e Code We\'re going to start making some code with memory allocations! 1 CSE 450 Dr. Charles B. Owen Translation of Programming Languages... Date Added: 2009-06-03 23:43:01 |
| 11-Memories.ppt Path: UNC >> COMP >> 190 Fall, 2008 Description: Memories, Part I Anselmo Lastra The UNIVERSITY of NORTH CAROLINA at CHAPEL HILL Topics RandomAccess Memory Static today Dynamic next 2 The UNIVERSITY of NORTH CAROLINA at CHAPEL HILL Memories in General Computers have mostly RAM ROM (or e... Date Added: 2009-06-03 23:43:54 |
| pol_obs_Side.txt Path: Stanford >> POL >> 070715 Fall, 2009 Description: Polarization analysis for FSN=185738-186016 Side camera obsmode. Processed Mon Jul 16 13:48:08 2007 Param Mean Stddev Minplot Maxplot Range I 0.659483 0.060103 0.492792 0.821602 0.328810 Q -0.000722 0.001522 ... Date Added: 2009-06-03 23:46:54 |
| Lectc3.ppt Path: W. Alabama >> HLTH >> 340 Fall, 2009 Description: Free radical toxicity 2: Oxidative stress and antioxidant defenses exogenous radicals environmental oxidants (O3, NO2) ionizing radiation bioactivated xenobiotic chemicals and drugs endogenous radicals generated within the cell through 1-elec... Date Added: 2009-06-03 23:46:57 |
| Rolfe_Purdom.doc Path: Eastern Washington University >> CSCD >> 320 Fall, 2008 Description: SIGCSE inroads, Vol. 36, No. 4 (December 2004), pp. 83-84. An Alternative Problem for Backtracking and Bounding Timothy J. Rolfe Computer Science Department Eastern Washington University 202 Computer Sciences Building Cheney, WA 99004-2412 Timothy.R... Date Added: 2009-06-03 23:47:33 |
| Midterm_Takehome_SP09.doc Path: Winona >> STAT >> 305 Fall, 2009 Description: STAT 305 Midterm: Take Home Spring 2009 Points: 45 pts ` Name(s):_ _ _ This midterm exam is centered on a report published by Greg Johnson from the Minnesota Pollution Control Agency. You should download and read this report bef... Date Added: 2009-06-03 23:48:00 |
| Lecture01 Physics Intro 0118.ppt Path: Georgia Tech >> PHYSICS >> 2211 Fall, 2009 Description: Physics 2211 Spring Semester, 2005 Dr. Bill Holm 404-385-6158 bill.holm@dlpe.gatech.edu Office: 441, Global Learning Center Physics 2211 Spring 2005 2005 Dr. Bill Holm Lecture 03, Page 1 Physics Help Room N209 1 - 4 PM, Monday-Thursday Physics 2... Date Added: 2009-06-03 23:56:58 |
| Chapter 11 Discussion Questions 6e.doc Path: Oregon State >> BA >> 469 Fall, 2008 Description: BA 469 Dowling Chapter 11 Discussion Questions 6e 1. Think about a business you know fairly well as an employee, as a family member, or as a long-term customer. Can you identify any examples of organizational inertia that characterize this busines... Date Added: 2009-06-04 00:01:18 |
| Solutions to Problem I on Normal Costing.doc Path: University of Illinois, Urbana Champaign >> ACCY >> 302 Fall, 2008 Description: Solutions to Problem I on Normal Costing/Flexible Budgeting Additional Discussion Questions 1) 4,500 (units in Beg. FG) + 10,000 (units produced) - 10,500 (units sold) 4,000 x *$30/unit = $120,000 *$12+$8+$6+$4 2) Normal costing of OH Sales ($50 x ... Date Added: 2009-06-04 00:02:51 |
| Ch11 Path: Seneca >> BUSINESS >> LAW380 Fall, 2008 Description: CHAPTER 11 THE TORT OF NEGLIGENCE Objectives After studying this chapter, you should have an understanding of: the conduct that the law of negligence addresses the principles of the law of negligence the defences in a negligence action the common... Date Added: 2009-06-04 09:43:37 |
| 02-IEP409-8.doc?OpenElement Path: East Los Angeles College >> IEP >> 409 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>0270180ceb97bc75f1003dfed8b5ae2b79650b89.doc %3FOpenEleme</Key><RequestId>F82D4ECAE4A61441</RequestId><HostId>+Y+5+g7R9tf83et... Date Added: 2009-06-04 13:13:28 |
| Chapter 1 and 2 Homework solutions.docx Path: UNC Wilmington >> ACG >> 301 Fall, 2009 Description: Exercise 1-1 Requirement 1 Pete, Pete, and Roy Operating Cash Flow Cash collected Cash disbursements: Salaries Utilities Purchase of insurance policy Net operating cash flow Requirement 2 Pete, Pete, and Roy Income Statements Revenues Expenses: Salar... Date Added: 2009-06-04 13:16:20 |
| ch 10 - foundations of behavior.ppt Path: UNC Wilmington >> MGT >> 350 Fall, 2009 Description: MGT 350 Principals of Management Weekly Management Meeting dynamics of behavior Principals of Management Organizational Behavior Interdisciplinary field dedicated to the study of: attitudes behavior performance Organizational Behavior Attitude ... Date Added: 2009-06-04 13:16:27 |
| 2004-10-14Shielding Women From a Renewal of Domestic Violence.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Shielding Women From a Renewal of Domestic Violence October 14, 2004 By SABRINA TAVERNISE BAGHDAD, Iraq - A sampling of the smashed lives in this city\'s first shelter for battered women shows just how much work its founder, Yanar Mohamed, has bef... Date Added: 2009-06-04 13:18:14 |
| 2004-8-27Chiles Top Court Strips Pinochet of Immunity.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Chile\'s Top Court Strips Pinochet of Immunity August 27, 2004 By REUTERS SANTIAGO, Chile, Aug. 26 - Chile\'s Supreme Court stripped the former dictator Augusto Pinochet of immunity from prosecution in a notorious human rights case on Thursday, rai... Date Added: 2009-06-04 13:18:37 |
| 0503-002.ps Path: UCLA >> MATH >> 0503 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.76 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: mancosu.dvi %CreationDate: Thu Jul 29 19:47:51 1999 %Pages: 28 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: TimesGamma-SmallCap Times... Date Added: 2009-06-04 13:22:49 |
| hw7_sol.ps Path: Virginia Tech >> CS >> 5034 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: hw7_sol.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips hw7_sol.dvi %DVIPSParameters: dpi=300, compressed, commen... Date Added: 2009-06-04 13:23:07 |
| e3.txt Path: Wisc La Crosse >> M >> 145 Fall, 2009 Description: This file is not ready yet. ... Date Added: 2009-06-04 13:23:17 |
| Lab 1 Subnetting Questions.doc Path: ECPI >> CIS >> 403 Fall, 2009 Description: Lab Activity IP Addressing 1) What network is the ip address 192.168.1.165/27 on? a. 192.168.1.64 b. 192.168.0.0 c. 192.168.1.128 d. 192.168.1.160 e. 192.168.1.192 2) How many usable hosts / subnet does 192.168.1.64/27 have? a. 14 b. 27 c. 30 d. 32 e... Date Added: 2009-06-04 13:26:23 |
| ch01.ppt Path: ECPI >> IST >> 314 Fall, 2009 Description: Linux+ Guide to Linux Certification, Second Edition Chapter 1 Introduction to Linux Objectives Understand the purpose of an operating system Outline the key features of the Linux operating system Describe the origins of the Linux operating system... Date Added: 2009-06-04 13:26:26 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 804 Fall, 2009 Description: 40,000 15451:42391:7725:1331 ; 46085:20802:466:1351 a 29677:13821:1250:948 51849:46165:1250:1008 45521:37045:1275:1029 33086:15536:1250:988 27715:28247:1250:1008 40689:17332:1250:1008 about 22907:49998:6278:1008 action 46257:42472:7333:1250 acute 302... Date Added: 2009-06-04 13:27:32 |
| L-22.ps Path: Duke >> CPS >> 130 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: Book.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Courier Times-Italic %EndComments %DVIPSWebPage: (www.radicaley... Date Added: 2009-06-04 13:28:25 |
| Chapter15.ppt Path: SIU Edwardsville >> CS >> 111 Fall, 2008 Description: Chapter 15: Networks Data communication networks are set up in two basic configurations. The mesh configuration uses direct, point-to-point connections between each pair of communicating devices. While this approach guarantees a direct connection bet... Date Added: 2009-06-04 13:34:19 |
| module9.xls Path: Purdue >> STAT >> 503 Fall, 2008 Description: Hypothesis Testing In this module, we will discuss how to do the t-test using Excel for one, two, and paired sample experiments. We\'ll also describe how sample size, the population mean under the alternative hypothesis, and significance level affect ... Date Added: 2009-06-04 13:35:55 |
| hist304d01.txt Path: Sveriges lantbruksuniversitet >> HIST >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 304-4 D01 LOCATION: SFU TITLE: STT-MODERNITY IN AM. SECTION TYPE: SEM SEMESTER: 1996-3 ENROL: 15... Date Added: 2009-06-04 13:37:06 |
| hist485d01.txt Path: Sveriges lantbruksuniversitet >> HIST >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 485-4 D01 LOCATION: SFU TITLE: SELECTED TOPICS SECTION TYPE: SEM SEMESTER: 1996-3 ENROL: 20... Date Added: 2009-06-04 13:37:08 |
| econ305e01.txt Path: Sveriges lantbruksuniversitet >> ECON >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: ECON 305-5 E01 LOCATION: SFU TITLE: MACROECONOMIC THEORY SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 63... Date Added: 2009-06-04 13:37:10 |
| cmpt105d01.txt Path: Sveriges lantbruksuniversitet >> APSC >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: CMPT 105-3 D01 LOCATION: SFU TITLE: ORG./ASSEMBLY LANG. SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 17... Date Added: 2009-06-04 13:37:19 |
| G415-Ch10.ppt Path: Iowa State >> GE >> 415 Fall, 2009 Description: Dendroclimatology (Chapter 10) Andrew Ellicot Douglass (1867-1962) Helped found Lowell Observatory in Flagstaff, AZ (1894) Fired by Lowell for questioning PL\'s judgment Studied tree rings for evidence of solar-cycle (sunspot-cycle) influence on ... Date Added: 2009-06-04 13:37:38 |
| submit.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: executable = pass6_72428.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs72000-72499/72428... Date Added: 2009-06-04 13:38:42 |
| submit.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: executable = pass6_72062.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs72000-72499/72062... Date Added: 2009-06-04 13:39:39 |
| Fung.doc Path: Western Washington >> CHEM >> 474 Fall, 2008 Description: Chem/Biol 474 Winter 2001 BLAST Search assignment DUE 10:30am Wednesday 3/21/00 NAME: A. Fung To complete this assignment (worth 15 pts toward your final exam score) you will need to visit the following web site: http:/www.ncbi.nlm.nih.gov/BLAST/ 1... Date Added: 2009-06-04 13:41:23 |
| wiz5.doc Path: Syracuse >> CSE >> 775 Spring, 2008 Description: Write dll to Client\'s Debug Directory Define output location here. ... Date Added: 2009-06-04 13:41:47 |
| seasonspowerpoint.ppt Path: North Texas >> COURSEWEB >> 4100009 Spring, 2009 Description: CHANGING SEASONS By Stacee Green Texas Essesntials Knoledge and Skills (TEKS) (b)Knowledge and skills. (13) Science concepts. The student knows components of our solar system. The student is expected to: (A) identify and illustrate... Date Added: 2009-06-04 13:42:24 |
| submit.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: executable = pass6_60398.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs60200-60399/60398... Date Added: 2009-06-04 13:44:29 |
| TableB.7.xls Path: UMass (Amherst) >> BIOEP >> 540 Fall, 2009 Description: sbp 43 51 42 39 48 31 31 40 57 64 46 47 63 56 49 87 46 66 42 52 51 47 54 64 37 36 45 39 29 61 53 64 35 34 62 59 36 47 45 62 75 44 39 48 43 19 63 42 44 25 26 27 gestage 29 31 33 31 30 25 27 29 28 29 26 30 29 29 29 29 29 33 33 29 28 30 27 33 32 28 29 ... Date Added: 2009-06-04 13:46:05 |
| CSIS360Lecture1.doc Path: Fort Lewis >> CSIS >> 360 Fall, 2009 Description: CSIS 360 Lecture 1 How old is \"software engineering\"? The term was first used in 1968 as the title of a very influential NATO conference held in Germany, in response to the \"software crisis\". What is SWE? A) \"the establishment and use of sound engin... Date Added: 2009-06-04 13:46:32 |
| 01iti_2.txt Path: Minnesota >> WETTE >> 001 Fall, 2009 Description: ITI FFL Week 2 Points this Week: - Radio Free - (15 ohms, 15 ohms total) Underdogs - Club Med - Loony Toons - Swandick - Three Point - Charlie - Freds Rev... Date Added: 2009-06-04 13:46:39 |
| Chapter 5 - Dowling 6e.ppt Path: Oregon State >> BA >> 469 Fall, 2008 Description: 5 Chapter 5: Building Competitive Advantage Through Business-Level Strategy BA 469 Spring Term, 2007 Prof. Dowling Business-Level Strategy Developing a firm-specific business model that will allow a company to gain competitive advantage over its ri... Date Added: 2009-06-04 13:46:47 |
| Female_Anatomy.rtf Path: CSU San Marcos >> PSYC >> 352 Fall, 2009 Description: FEMALE SEXUAL ANATOMY beauty) Labia majora (ma... Date Added: 2009-06-04 13:48:03 |
| MIS4850Class1.ppt Path: N.E. Illinois >> MIS >> 4850 Fall, 2009 Description: School of Business Eastern Illinois University MIS 4850 Systems Security (Tuesday 1/13/2009) Abdou Illia, Ph.D aillia@eiu.edu Objectives Class overview (course syllabus) Explain How class will be organized 2 Why a Systems Security class? Secu... Date Added: 2009-06-04 13:48:25 |
| UML_Draft_DC_Evaluation_IIVV_F08a_T06_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: UML Draft DC Package Evaluation a) Management Overview: As implemented, the diagram does not accurately represent the deployment planned for the system. b) Technical Details: See above. c) Technical, Project and Operational Risks Failure to correct ... Date Added: 2009-06-04 13:48:55 |
| Final_Examination_Econ_640_Spring_2007b.doc Path: Kansas State >> EXAM >> 640 Fall, 2009 Description: FINAL EXAMINATION INDUSTRIAL ORGANIZATION AND PUBLIC POLICY (Econ 640) May 10, 2007 Professor D. Weisman Instructions: There are two parts to this examination, weighted 40 points and 60 points, respectively. Write legibly and think carefully about y... Date Added: 2009-06-04 13:50:40 |
| two-ans.ps Path: Maple Springs >> CSE >> 4411 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: test.dvi %Pages: 16 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMBX10 CMR17 CMBX12 CMSY10 CMTI10 CMSSBX10 CMSS10 %+ CMR8 CMMI10 CMR6 CMR9 LASY... Date Added: 2009-06-04 13:51:18 |
| pro13.txt Path: Maple Springs >> CSE >> 4080 Fall, 2009 Description: Project #13 - Project title: Development of algorithms for geometric correction of remote-sensed imagery Supervisor name (email): Professor James Elder (jelder@yorku.ca) Location: Human Performance Lab: Visual Psychophysics and Computation ... Date Added: 2009-06-04 13:51:25 |
| peerrev2_grid_win07.doc Path: Washington >> ENG >> 198 Fall, 2009 Description: Eng198B/Anth 204 Winter 2007 Instructor: Megan Styles Paper 2: An Ethnographic Essay Based on a Period of Silent Observation Reviewer: _ Criteria Numerical Rating (1-4) Writer: _ 4. Excellent and complete. 3. Very good start, but I have a few sugges... Date Added: 2009-06-04 13:51:52 |
| StatsCh04.ppt Path: Colgate >> PPT >> 143 Fall, 2009 Description: Chapter 4 Gathering Data 1 2 Bush Disapproval Graph What does it tell us? Jumps: Spread of points at date t: 3 Data Acquisition Interested in population phenomena, but need sample data. Acquire data via: 1) Experiment 4 Data Acquisition ... Date Added: 2009-06-04 13:52:15 |
| StatsCh04.ppt Path: Colgate >> CORE >> 143 Fall, 2009 Description: Chapter 4 Gathering Data 1 2 Bush Disapproval Graph What does it tell us? Jumps: Spread of points at date t: 3 Data Acquisition Interested in population phenomena, but need sample data. Acquire data via: 1) Experiment 4 Data Acquisition ... Date Added: 2009-06-04 13:52:15 |
| Lab7.doc Path: Iowa State >> PUBLIC >> 230 Fall, 2009 Description: Beckert 1 Introduction: The purpose of this lab is to investigate applications of non linear operational amplifier circuits and to investigate the uses of saturated op amps, including hysteresis. Build a Comparator The comparator in figure 1 was cre... Date Added: 2009-06-04 13:53:29 |
| punctuation-made-easy.ppt Path: Weber >> FACULTY >> 3140 Fall, 2009 Description: Punctuation Made Easy Or at least . well, at least you get to review it Punctuation Made Easy Continuing from Tuesday (any Tuesday), we have the nine most common punctuation errors. http:/www.dartmouth.ed u/~compose/student/ac_ paper/grammar.html... Date Added: 2009-06-04 13:57:42 |
| chapter11.ppt Path: U. Houston >> CS >> 3300 Fall, 2009 Description: Chapter 11: Inheritance and Polymorphism Java Programming: From Problem Analysis to Program Design, Second Edition Chapter Objectives Learn about inheritance. Learn about subclasses and superclasses. Explore how to override the metho... Date Added: 2009-06-04 13:58:16 |
| 72.ppt Path: Portland >> CS >> 533 Winter, 2008 Description: Scheduler Activations: Effective Kernel Support for the User-Level Management of Parallelism. Thomas E. Anderson, Brian N. Bershad, Edward D. Lazowska, and Henry M. Levy. Presented by Diana Carroll User-level threads c Divide up the process resource... Date Added: 2009-06-04 14:02:14 |
| Visitor.ppt Path: Portland >> CS >> 410 Winter, 2008 Description: CS 410/510 Advanced Programming The Visitor Pattern Andrew P. Black 1 Recap Recall the rows and columns diagram Each row is a separate class adding rows is easy Each column is a method in multiple classes adding columns is hard 2 Visitor: S... Date Added: 2009-06-04 14:02:20 |
| 4189.txt Path: UCCS >> CS >> 591 Fall, 2009 Description: Rule: - Sid: 4189 - Summary: This event is generated when an attempt is made to return to a web client a file with a Class ID (CLSID) embedded in the file. - Impact: A successful attack may result in the execution of code of the attackers choosing... Date Added: 2009-06-04 14:02:39 |
| 404exam305key.doc Path: Montana >> BIOL >> 404 Fall, 2008 Description: Biol. 404 Exam 3 Note that the exam contains no resurrection points this time. Use the reverse sides of the paper if needed. 1. (5 pts) What two major groups of zooplankton go through parthenogenesis? What are the advantages of parthenogenesis? Rotif... Date Added: 2009-06-04 14:03:00 |
| ak4.doc Path: Montana >> HOMEPAGE >> 311 Fall, 2009 Description: Homework #4 Due Wed October 22nd Consider the following model of a labor market for teachers. In each district, suppose schools require a fixed number of teachers. (That is, we are going to ignore class size.) Demand is determined by voter preferen... Date Added: 2009-06-04 14:03:11 |
| arf_wt.txt Path: Berkeley >> ASTRO >> 00348428 Fall, 2009 Description: ;instrument XRT ;exposure 129.00297 ;xunit kev ;bintype counts 0.0000000 0.0049999999 10.126601 1.00000 0.0049999999 0.0099999998 10.162803 1.00000 0.0099999998 0.015000000 10.199005 1.0... Date Added: 2009-06-04 14:05:24 |
| esi6448-02.ppt Path: UF >> ESI >> 6448 Fall, 2008 Description: ESI 6448 Discrete Optimization Theory Section number 5643 Lecture 2 Totally unimodular From the idea that a basic feasible solution for a linear program is of form (xB, xN) = (B-1b, 0) If det(B) = 1, then B-1b is integral, i.e. LP relaxatio... Date Added: 2009-06-04 14:05:42 |
| 517MidtermExamSpring2008.doc Path: Mines >> CSM >> 517 Fall, 2009 Description: MIDTERM EXAM EGGN 517 SPRING 2008 Open-book, Open-Notes, 90 minutes PROBLEM 1 (20 points) Consider the following system: 0 0 1 1 x = 1 0 2 x + 1u 0 1 3 1 y = [ 0 0 1] x a) b) Design a full-order observer for this system, placing all the poles... Date Added: 2009-06-04 14:06:44 |
| Lec24.ppt Path: CUNY Baruch >> PHYSICS >> 101 Fall, 2009 Description: Final exam: Dec 18, 11.30am -1.30pm, here, cumulative Two Review Sessions: Fri Dec 7 and Tue Dec 11. Find out more info about what\'s on the exam then. Actual exam questions (minus choices) will be distributed Dec.11. Today: An intro to Quantum Theo... Date Added: 2009-06-04 14:07:12 |
| error.txt Path: Washington >> V >> 12500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Jan 31 22:07:33 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Jan 31 23:20:15 2008 ( 4362 s elapsed) ... Date Added: 2009-06-04 14:10:14 |
| log.txt Path: Washington >> V >> 11798 Fall, 2009 Description: 000 (45298.000.000) 01/30 18:18:36 Job submitted from host: <128.95.94.28:1098> . 001 (45298.000.000) 01/30 23:03:23 Job executing on host: <172.25.101.189:1062> . 006 (45298.000.000) 01/30 23:23:31 Image size of job updated: 464600 . 005 (45298.000.... Date Added: 2009-06-04 14:11:23 |
| output.txt Path: Washington >> V >> 16822 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-535QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2620 02/05/2008 05:48 PM <DIR> . 02/05/2008 05:48 ... Date Added: 2009-06-04 14:11:29 |
| output.txt Path: Washington >> V >> 15500 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS3 - local directory - Volume in drive C has no label. Volume Serial Number is 7A24-68F3 Directory of C:\\condor\\execute\\dir_4004 02/04/2008 04:43 PM <DIR> . 02/04/2008 04:43 PM <D... Date Added: 2009-06-04 14:11:46 |
| error.txt Path: Washington >> V >> 14500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 04:28:33 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 05:48:31 2008 ( 4798 s elapsed) ... Date Added: 2009-06-04 14:13:16 |
| submit.txt Path: Washington >> V >> 16743 Fall, 2009 Description: executable = allgamma_16743.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 14:14:32 |
| submit.txt Path: Washington >> V >> 11874 Fall, 2009 Description: executable = allgamma_11874.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:14:39 |
| log.txt Path: Washington >> V >> 11943 Fall, 2009 Description: 000 (45443.000.000) 01/30 18:19:13 Job submitted from host: <128.95.94.28:1098> . 001 (45443.000.000) 01/31 00:25:22 Job executing on host: <172.25.101.183:1063> . 010 (45443.000.000) 01/31 00:29:03 Job was suspended. Number of processes actually su... Date Added: 2009-06-04 14:14:58 |
| error.txt Path: Washington >> V >> 11697 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Jan 30 21:56:33 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 23:16:32 2008 ( 4799 s elapsed) ... Date Added: 2009-06-04 14:16:41 |
| error.txt Path: Washington >> V >> 11704 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Jan 30 22:02:06 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 23:10:52 2008 ( 4126 s elapsed) ... Date Added: 2009-06-04 14:17:04 |
| Appendix 11 GR Complaints.doc Path: East Los Angeles College >> V >> 2117 Fall, 2009 Description: Appendix 11 Introduction Complaints procedure The formal complaints procedure detailed below is not intended to take the place of informal complaints resolution and all complainants are urged to seek to resolve their complaint informally either bef... Date Added: 2009-06-04 14:18:37 |
| output.txt Path: Washington >> V >> 15337 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-725QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_468 02/04/2008 10:50 AM <DIR> . 02/04/2008 10:50 A... Date Added: 2009-06-04 14:18:47 |
| log.txt Path: Washington >> V >> 15286 Fall, 2009 Description: 000 (48781.000.000) 02/04 05:07:17 Job submitted from host: <128.95.94.28:1098> . 001 (48781.000.000) 02/04 10:31:20 Job executing on host: <172.25.101.91:1056> . 006 (48781.000.000) 02/04 10:51:28 Image size of job updated: 425308 . 005 (48781.000.0... Date Added: 2009-06-04 14:19:24 |
| error.txt Path: Washington >> V >> 15496 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 12:59:31 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 14:06:53 2008 ( 4042 s elapsed) ... Date Added: 2009-06-04 14:19:34 |
| Class Three.ppt Path: Laurentian >> ANTH >> 3100 Fall, 2009 Description: MEMORY, HISTORY AND MACHISMO IN N ICARAGUA Nicaraguan cultural practices afford numerous mnemonic techniques for preserving, remembering, and binding people together in the face of adversity. And if the sandinista position has remained stronger than... Date Added: 2009-06-04 14:19:36 |
| submit.txt Path: Washington >> V >> 15492 Fall, 2009 Description: executable = allgamma_15492.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-06-04 14:19:41 |
| error.txt Path: Washington >> JOBS >> 10207 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 02:47:34 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 02:59:40 2008 ( 726 s elapsed) ... Date Added: 2009-06-04 14:20:40 |
| log.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: 000 (51206.000.000) 02/06 08:20:49 Job submitted from host: <128.95.94.28:1098> . 001 (51206.000.000) 02/06 08:40:18 Job executing on host: <172.25.101.48:1057> . 005 (51206.000.000) 02/06 08:53:47 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 14:22:07 |
| log.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: 000 (51494.000.000) 02/06 08:25:20 Job submitted from host: <128.95.94.28:1098> . 001 (51494.000.000) 02/06 09:13:57 Job executing on host: <172.25.101.87:2338> . 005 (51494.000.000) 02/06 09:27:44 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 14:25:31 |
| DSC.ppt Path: Michigan >> EECS >> 373 Fall, 2005 Description: Its uses and relevance in modern digital circuits Allen Chang Prakit Mohal Jacob Oberlin Chung Jong Yoo 1 http:/www.beis.de/Elektronik/DeltaSigma/DeltaSigma.html DSCs are another type of ADC 2 Overview A. Intro to DSC What is a Delta Sigma Co... Date Added: 2009-06-04 14:26:45 |
| BG205-Mod8-Part1-script.txt Path: Colorado State >> MOD >> 205 Fall, 2009 Description: <title=\"BG205_Mod8_Part1\"> <!stamp=\"BG205-Mod8-Part1-imp.jar 691231 17:00:00\"> <s=\"Title Slide\"> <t=> <!slideid=\"393\"> <video=\"> PROFESSOR RAY HOGLER Welcome back to Business Law and Ethics. We\'re almost through with this, Jennifer, I\'m sure you\'r... Date Added: 2009-06-04 14:29:53 |
| PE 232 Instruction Manual.doc Path: Erskine >> PE >> 232 Fall, 2009 Description: PE 232 Competency Instruction Fitting of Hockey Equipment Research manufacture\'s instructions Document manufacture\'s instructions Demonstrate proper fitting of equipment according to the instructions Remove equipment Identify warning labels Fitting o... Date Added: 2009-06-04 14:30:23 |
| indep.xls Path: Clemson >> WEB >> 301 Fall, 2009 Description: S 23 24 24 24 23 22 23 21 R 23 20 21 22 19 20 18 19 23 22 20 18 17 17 19.93 avg 4.23 var 14 n t-Test: Two-Sample Assuming Equal Variances S Mean 23 Variance 1.14 Observations 8 Pooled Variance 3.15 Hypothesized Mean Difference 1 df 20 t Stat 2.63 P(... Date Added: 2009-06-04 14:32:37 |
| kllist8.txt Path: Utah >> SPIN >> 143 Fall, 2009 Description: Block: 8 Size: 34 - Printing 6 polynomials . Maximum Degree: 2 -> q^2+1 Maximum Coefficient: 1 -> 1 - 0 1 q q+1 q^2+1 q^2 ... Date Added: 2009-06-04 14:33:48 |
| block10.txt Path: Utah >> SPIN >> 103 Fall, 2009 Description: 0( 23): * 0 0 0 * 0 ( 1, *) ( *, *) ( *, *) ( *, *) ( *, *) ( *, *) [i1,ic,ic,ic,Cn,rn] 1 1( 27): * 2 1 1 * 1 ( 0, *) ( *, *) ( *, *) ( *, *) ( *, *) ( *, *) [r1,C+,ic,ic,Cn... Date Added: 2009-06-04 14:34:24 |
| rlist37.txt Path: Utah >> SPIN >> 134 Fall, 2009 Description: Block: 37 Size: 77 - Printing 33 polynomials . Maximum Degree: 10 -> q^10-2q^9+q^8 Maximum Coefficient: 2 -> q^2-2q+1 - 0 1 q-1 -q+1 q^2-2q+1 -q^2+2q-1 -q^2+q q^2-q q^3-q^2 -q^3+2q^2-q q^3-2q^2+q q^4-2q^3+q^2 -q^4+2q^3-q^2 -q^3+q^2 q^4-q^3 q^5-q^4... Date Added: 2009-06-04 14:35:02 |
| error.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 20:39:42 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 21:22:17 2008 ( 2555 s elapsed) ... Date Added: 2009-06-04 14:40:01 |
| submit.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: executable = pass6_31281.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31000-31499/31281... Date Added: 2009-06-04 14:41:07 |
| log.txt Path: Washington >> V >> 11000 Fall, 2009 Description: 000 (25594.000.000) 12/03 06:52:37 Job submitted from host: <128.95.94.28:4757> . 001 (25594.000.000) 12/03 06:53:54 Job executing on host: <172.25.101.51:1065> . 006 (25594.000.000) 12/03 07:14:02 Image size of job updated: 453560 . 005 (25594.000.0... Date Added: 2009-06-04 14:43:08 |
| buec433d01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19972 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: BUEC 433-5 D01 LOCATION: SFU TITLE: FORECASTING SECTION TYPE: LEC SEMESTER: 1997-2 ENROL: 11... Date Added: 2009-06-04 14:47:50 |
| final_project_instructions.doc Path: Purdue >> OLS >> 388 Fall, 2008 Description: OLS 388 Final Papers Two papers will be required near the end of the semester, prior to or at the final presentation: Paper #1: The first is a 4 to 5 page team paper, written in collaboration as a team, which describes each team member\'s performance ... Date Added: 2009-06-04 14:48:50 |
| 2-Service Learning 1.doc Path: Samford >> EDU >> 322 Fall, 2009 Description: Community Service hours Lakeshore Foundation Super Sports Saturday This past Saturday I was lucky enough to get to play with some amazing kids at Lakeshore Foundation for Super Sports Saturday. While some of the children were only in wheelchairs to p... Date Added: 2009-06-04 14:49:12 |
| mt1ans.aw.ps Path: NMSU >> CS >> 273 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: Applixware %Pages: 3 %DocumentNeededResources: font Times-Italic Times-BoldItalic Courier %+ font Helvetica Times-Bold Symbol Times-Roman Courier-Oblique %EndComments %BeginProlog /bd { bind def } bind def /n { newpath } bd /... Date Added: 2009-06-04 14:49:13 |
| ME409.doc Path: Rose-Hulman >> AY >> 0405 Fall, 2009 Description: ME 409 - Air Conditioning 2003-2005 Catalog Data: (4R-0L-4C) Human comfort and the properties of air. Air conditioning in residences, public and industrial buildings using vapor compression and absorption units. Cooling loads, psychrometry, fans, duc... Date Added: 2009-06-04 14:49:25 |
| lab 4.docx Path: Rose-Hulman >> ME >> 406 Fall, 2009 Description: ME 406 Control Systems Rose-Hulman Institute of Technology Lab 4 RsVs Xs oller x khw Plantf P Conr m Fs 1sms+b K Experimental Root Locus Dete rmination Overview The theoretical model for the plant in Lab 3, where we applied P, PD, and PID control... Date Added: 2009-06-04 14:49:29 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
