Course Solutions And Notes - La3-1-Draft1 02

Displaying 18501-19000 of 23245 documents:
next page of documents

handout 3 - digestive enzymes.doc
Path: UNC Wilmington >> BIO >> 241 Fall, 2009
Description: DIGESTIVE ENYZMES FLOW SHEET CARBOHYDRATES STARCH salivary amylase DEXTRINl salivary amylase MALTOSE SUCROSE LACTOSE PROTEINS _ HCl pepsin <- pepsinogen MALTOSE SUCROSE LACTOSE POLYPEPTIDES FATS gastric lipase ? S T O M A C H PROTEINS SUCROSE LACTOSE...
Date Added: 2009-06-11 20:57:28

mgp00007.txt
Path: UF >> CGS >> 6305 Fall, 2009
Description: Virtual Methods class SavingsAccount : public Account { double interest_rate; public: SavingsAccount(double init_bal, double rate) : Account(init_bal), interest_rate(rate) { } . virtu...
Date Added: 2009-06-11 20:57:59

greenstudyobj.doc
Path: Western Michigan >> PSY >> 378 Fall, 2009
Description: Psy 378 Spring 2006 Dr. Green Presentation Study Objectives 1. 2. 3. 4. 5. 6. 7. 8. 9. Characterize the DSM-IV-TR definition of dementia of the Alzheimer type. List the cognitive deficits that must be present for this diagnosis. Summarize the preval...
Date Added: 2009-06-11 20:58:36

ComputerAssignment2A.doc
Path: TAMU Kingsville >> EEEN >> 1201 Fall, 2008
Description: Computer Assignment #2 LAB GROUP A DUE 10/05/2006 A) In this assignment, you will want to duplicate the example class grades spreadsheet found below as well as the two charts. You then need to add two other chart types 1) X-Y Scatter and 2) bar in ad...
Date Added: 2009-06-11 20:59:51

Assertions.pdf
Path: UMKC >> IT >> 350 Fall, 2009
Description: References: internet notes; Bertrand Meyer, Object-Oriented Software Construction; 10/14/2004 1 Assertions Statements about input to a routine or state of a class Have two primary roles As documentation, they express valid ways of using a routi...
Date Added: 2009-06-11 20:59:58

chapter5.txt
Path: Arizona >> MIS >> 440 Fall, 2009
Description: * Page 128 * # put this code in a file called \"module1.py\", # located in a directory on PYTHONPATH (or \".\") def printer(x): # module attribute print x # then, import it in the interactive prompt % python > import module1 ...
Date Added: 2009-06-11 21:01:31

cs2335_umlexer.ppt
Path: Georgia Tech >> CS >> 2335 Fall, 2008
Description: UML Class Exercise CS2335 Spring 2005 Problem Statement Build a specification-level design of the software to support a computerized banking network including both human cashiers and ATM\'s to be shared by a consortium of banks. Each bank provides it...
Date Added: 2009-06-11 21:02:14

TW0032_Calling_notice_SA_Final C.pdf
Path: Stetson >> TW >> 0001 Fall, 2009
Description: ISO/IEC JTC 1 SWG for Technology Watch Secretariat: US (ANSI) ISO/IEC JTC1 TW0032 2006-06-26 Document Type Title Source Project Status Reference Action ID Due Date Distribution No. of Pages Note SWG, JTC 1 Secretariat 12 ACT Final Calling notice and...
Date Added: 2009-06-11 21:05:24

cant1.a.txt
Path: NMT >> ES >> 421 Fall, 2008
Description: /TITLE, Name and date here, cant1.a ! deflection and stress for ! cantilever beam, W8 x 31, /PREP7 ! preprocessor section f2 = -3000 ! force at free end ET,1,Beam3 ! type 3 is beam R,1,9.1,110,8 ! area, Iz, height MP,EX...
Date Added: 2009-06-11 21:05:36

ag.doc
Path: Iowa State >> MR >> 0629 Fall, 2009
Description: Associated Press 06-21-07 Shortage of ag teachers puts some programs in jeopardy HUDSON, Iowa (AP)-Some educators warn that a shortage of agriculture instructors could stifle student development in one of Iowa\'s largest industries. \"We have not produ...
Date Added: 2009-06-11 21:08:31

130B_notes.pdf
Path: UCSD >> PHYS >> 130 Fall, 2009
Description: B ...
Date Added: 2009-06-11 21:09:24

pointers.pdf
Path: GWU >> CS >> 135 Fall, 2009
Description: Next. . . Pointers and Arrays Read Chapters 16, 18 of text CS 135: Computer Architecture I Instructor: Prof. Bhagi Narahari Dept. of Computer Science Course URL: www.seas.gwu.edu/~bhagiweb/cs135/ Dynamic data structures Allocating space during ru...
Date Added: 2009-06-11 21:11:35

Z_hig_1504.pdf
Path: Hamline >> SAVE >> 110207 Fall, 2009
Description: HIGHAM FERRERS, NORTHAMPTONSHIRE V. William Thorpe and M.S. VI his widow Marion London: \"F\" series (?) Blessed Virgin Mary Z hig 1504 Effigies of William Thorpe, mercer, 1504, and his widow Marion, with six sons and six daughters; with arms of the ...
Date Added: 2009-06-11 21:11:51

Answer Sheet-Reading3.doc
Path: BU >> EM >> 610 Fall, 2009
Description: Answer Sheet Civil Rights Icon Rosa Park Dies 1. T/F a. b. c. d. e. f. g. h. 2. Synonym Match a. b. c. d. e. f. g. h. i. j. 3. Phrase Match a. b. c. d. e. f. g. h. i. j. ...
Date Added: 2009-06-11 21:12:52

week 4.doc
Path: Washington >> FACULTY >> 521 Fall, 2009
Description: 521s01 being drafted at home in A:\\ 521-a/00 Week 4 notes Before class load wb Encarta note y...
Date Added: 2009-06-11 21:14:05

Week 8 - Carnival and the grotesque body.doc
Path: East Los Angeles College >> TH >> 242 Fall, 2009
Description: Carnival and the grotesque body Images of bodily exaggeration or oddity fat/thin, tall/short, overdressed/undressed, bald/hairy, grinning/scowling, clumsy/overrefined etc. have probably always been at the centre of comedy. In...
Date Added: 2009-06-11 21:16:29

co24.pdf
Path: Wisc Stevens Point >> BIOL >> 101 Fall, 2009
Description: CHAPTER 24 EVOLUTION AND DIVERSITY OF PLANTS Chapter Outline 24.1 Evolutionary History of Plants A. Characteristics of Plants (kingdom Plantae) 1. Plants are multicellular photosynthetic eukaryotes. 2. Plants are believed to have evolved from a fr...
Date Added: 2009-06-11 21:17:20

pages-105-a-124.ps
Path: Neumont >> IFT >> 2030 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: notes.dvi %Pages: 5 0 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %BeginProcSet: PStoPS 1 15 userdict begin [/showpage/erasepage/copypage]{dup where{pop ...
Date Added: 2009-06-11 21:18:17

Week04_PR_F06a_T03.xls
Path: USC >> CSCI >> 577 Fall, 2009
Description: Team Number: Week: Program Size (SLOC) Base Added Deleted Modified Reused # of COTS Total New SLOC Effort (Hours) Project Mgmt. Requirements OCD COTS Assessment Design Life Cycle Planning Configuration Mgmt. Feasibility Analysis Code COTS Tailoring C...
Date Added: 2009-06-11 21:20:20

Econ321Ch04.pdf
Path: University of Hawaii - Hilo >> ECON >> 321 Fall, 2009
Description: CHAPTER 4 Introduction Probability as a general concept can be defined as the chance of an event occurring. In addition to being used in games of chance, probability is used in the fields of insurance, investments, and weather forecasting, and in va...
Date Added: 2009-06-11 21:20:47

Benchmarking Results.pdf
Path: RIT >> P >> 09011 Fall, 2009
Description: Benchmarking Results P09011 Updated 12/12/2008 1. Major Issues with Prior Apparatus: 1.1. Excessive setup time 1.2. Lack of built-in experimental repeatability 1.3. Lack of smooth motion between sets 1.4. Does not hide objects from trainer during M...
Date Added: 2009-06-11 21:21:11

Lecture10.pdf
Path: Mines >> PHGN >> 462 Fall, 2008
Description: CALVIN, CAN \'(0\\) Tal US W\\-\\A-T Stt M( ,b.,\\lt.R CUSS. Q.l\'J\\~. I\'M I-\\~ AMPfRE~ LAW MeANS? A CDl<\\tI\\p.ND cr: mOR~\\.\'{ \\.lSEI.fS\'3 \\~l=C)RHj\\T\\()N. . ~()\\ D\\JM8. I J\\JST ~. E~ WtJt.~ (\\. ~ .~ , \\ S~ . <r t1Mc.~ ). ~ottJ./~\"- ~ Ji...
Date Added: 2009-06-11 21:21:25

hw08.txt
Path: Michigan >> CSC >> 365 Fall, 2009
Description: Do the following problems from Chapter 8 (pp. 315-317): 8.1 (a) and (b), 8.14, 8.15, 8.19 ...
Date Added: 2009-06-11 21:21:53

OCD_LCA_F06a_T16_V2.8.doc
Path: USC >> CSCI >> 577 Fall, 2009
Description: Operational Concept Description (OCD) Version no 2.8 Operational Concept Description (OCD) USC CONIPMO TEAM No. 16 Kumar Yalla Project Manager & Software Architect Gaurav Batra OCD Jenish Jariwala Prototype Developer Shivam Gupta Requirement...
Date Added: 2009-06-11 21:22:40

HERS380S06Syl.pdf
Path: Winona >> COURSE >> 380 Fall, 2009
Description: Winona State University Department of Health, Exercise & Rehabilitative Sciences Course Syllabus - HERS 380 Spring 2006 Laboratory Methods in Exercise Science (3 S.H.) Oral Communications Flag Instructor: Dr. Dawn E. Anderson Phone: 457-5205 Office H...
Date Added: 2009-06-11 21:23:19

RFID-sec3.ppt
Path: Oregon State >> BA >> 471 Fall, 2008
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02c382c44691cf0f341c96034186fab390a12082.ppt</Key><RequestId>E 9EC2EA94CDBF984</RequestId><HostId>xoiT2Q9YaZWJudKvGjR1vCaPSMj...
Date Added: 2009-06-11 21:25:08

6-15sol.ps
Path: Kentucky >> MA >> 114 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: 6-15sol.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips 6-15sol %DVIPSParameters: dpi=300, comments removed %DVIP...
Date Added: 2009-06-11 21:25:13

probplot1.ps
Path: Purdue >> STAT >> 511 Fall, 2008
Description: ...
Date Added: 2009-06-11 21:25:35

ex6-03.xls
Path: Purdue >> STAT >> 511 Fall, 2008
Description: C1 0.83 0.88 0.88 1.04 1.09 1.12 1.29 1.31 1.48 1.49 1.59 1.62 1.65 1.71 1.76 1.83 ...
Date Added: 2009-06-11 21:25:37

ex12-82.txt
Path: Purdue >> STAT >> 511 Fall, 2008
Description: \"temp\",\"removal%\" 7.68,98.09 6.51,98.25 6.43,97.82 5.48,97.82 6.57,97.82 10.22,97.93 15.69,98.38 16.77,98.89 17.13,98.96 17.63,98.9 16.72,98.68 15.45,98.69 12.06,98.51 11.44,98.09 10.17,98.25 9.64,98.36 8.55,98.27 7.57,98 6.94,98.09 8.32,98.25 10.5,9...
Date Added: 2009-06-11 21:25:49

ex13-35.xls
Path: Purdue >> STAT >> 511 Fall, 2008
Description: x 10 15 20 25 30 y 37.10 70.10 109.70 177.20 222.60 ...
Date Added: 2009-06-11 21:26:15

ex11-50.txt
Path: Purdue >> STAT >> 511 Fall, 2008
Description: \"Fabric\",\"Response\",\"Drying\" \"Crepe\",3.3,1 \"Double knit\",3.6,1 \"Twill\",4.2,1 \"Twill mix\",3.4,1 \"Terry\",3.8,1 \"Broadcloth\",2.2,1 \"Sheeting\",3.5,1 \"Corduroy\",3.6,1 \"Denim\",2.6,1 \"Crepe\",2.5,2 \"Double knit\",2,2 \"Twill\",3.4,2 \"Twill mix\",2.4,2 \"Terry\",1....
Date Added: 2009-06-11 21:26:21

online-student-eval.pdf
Path: Alabama >> CHEM >> 232 Fall, 2009
Description: StudentOpinionsofTeachingSurveyisnowonline! AvailableApril20,2009 TheUniversityispilottestinganewonlinesystemtocollectyourfeedbackon courses.Yourresponsesareveryimportantandareusedtoassesscurricularand instructionalqualityaswellastoidentifyopportunit...
Date Added: 2009-06-11 21:29:51

ws8sol.pdf
Path: Princeton >> MAT >> 141 Fall, 2009
Description: Worksheet 8, Solutions Math 141: College Algebra, Spring 2009 1. Consider the following graphs of polynomials: Note that all minima and maxima fall in the visible part of the graph. (a) A parabola is a 2nd degree polynomial. A 2nd degree polynomial ...
Date Added: 2009-06-11 21:34:13

A1.pdf
Path: WPUNJ >> WW >> 044 Fall, 2009
Description: Average Enrollment 10.0 15.0 20.0 25.0 30.0 35.0 40.0 45.0 50.0 0.0 5.0 Chem istry Cu lture s 21.1 22.6 Engli sh Biolo gy 23.5 Math em atics 23.7 28.0 Wom en \'s Stu dies 29.1 Polit ical S cienc e Env Sci...
Date Added: 2009-06-11 21:35:04

NMTA.doc
Path: NMSU >> EDLT >> 36804 Fall, 2009
Description: I have not yet taken the NMTA Basic Skills. ...
Date Added: 2009-06-11 21:37:40

Fact Sheet.doc
Path: NMSU >> EDLT >> 51890 Spring, 2009
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02568d58af9f8e85b5e574a457ab93677b881788.doc</Key><RequestId>7 48939F7744E46D6</RequestId><HostId>p3n1xCxq3SyDnwQiOELMgYkKPov...
Date Added: 2009-06-11 21:37:58

Final Examination.pdf
Path: Stanford >> POLISCI >> 211 Fall, 2009
Description: Political Science 211Z: Victory and Defeat Alex Montgomery and Todd Sechser Final Examination This exam consists of one essay that must not exceed 1500 words. The exam is due both electronically and in hard copy format by 1:15pm on Thursday, August ...
Date Added: 2009-06-11 21:39:40

CS1024_6.ppt
Path: Virginia Tech >> CS >> 1024 Fall, 2008
Description: Ch. 6 - Debugging Errors in compilation Compilation errors Translating the source code to machine language Mistake in syntax Warnings vs. Errors One error can cause several errors Ex. Error in record definition Usually work on the top error ...
Date Added: 2009-06-11 21:39:45

MeetingNotesOctober2_2008.rtf
Path: UMBC >> C >> 299 Fall, 2009
Description: COMP 299 Record of Meeting Comp 299 Electronics ? meeting Thursday October 2, 2008 Tech 175 8.30 - 10.30 AM Meeting Record Page 1 of 1 Present: Hartman, Comp 299 class, Electronics class Guests: Stephanie Milne, Absent: Brandon Tennent, Bentley Wo...
Date Added: 2009-06-11 21:41:24

hw6sol.pdf
Path: UNC Charlotte >> STAT >> 1222 Fall, 2008
Description: ...
Date Added: 2009-06-11 21:42:01

Silent Floor Info.pdf
Path: CSU Fullerton >> FIR >> 005 Fall, 2009
Description: 1 WOOD I-Joists and Fire BACKGROUND Fire is a threat to all buildings, whether they\'re constructed of concrete, steel or wood. There are many important aspects related to fire safety of lightweight frame construction. Building codes in Canada and the...
Date Added: 2009-06-11 21:43:46

Mascarenhas Defense Seminar Flyer.pdf
Path: University of Illinois, Urbana Champaign >> MCB >> 595 Fall, 2009
Description: BIOCHEMISTRY OF Final Defense Seminar ANJALI MASCARENHAS Department of Biochemistry (Martinis lab) Linkers and their Role in Enzymatic Activities of Escherichia coli LeucyltRNA Synthetase\" Friday, Jan. 11, 2008 11:00 AM, 401 Roger Adams Lab Seminar...
Date Added: 2009-06-11 21:43:55

cheatsheet.pdf
Path: Duke >> CPS >> 006 Fall, 2009
Description: Throughout this test, assume that the following classes and methods are available. These classes are taken directly from the material used in class. There should be no methods you have never seen before here. Point public class Point { / coordinates...
Date Added: 2009-06-11 21:46:53

homogenization.ps
Path: UC Davis >> M >> 204 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: m204.dvi %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -ohomogenization.ps m204 %DVI...
Date Added: 2009-06-11 21:47:17

W06_SYL_BA339.doc
Path: Portland >> BA >> 339 Fall, 2008
Description: Operations and Quality Management BA 339 FallWinter 200320046 Section 007001, Monday,/ Wednesday 10:15 AM - 12:05 PM, NH222SBA17390, CRN 1025040273 Section 005002, Monday,/ Wednesday 1213:45 00 PM - 214:35 50 PM, BA170101 SB2SBA 170, CRN 1025240274 I...
Date Added: 2009-06-11 21:47:25

5_MethodsofProof.ppt
Path: Georgia Tech >> CS >> 1050 Fall, 2008
Description: With examples from Number Theory (Rosen 1.5, 3.1, sections on methods of proving theorems and fallacies) Basic Definitions Theorem - A statement that can be shown to be true. Proof - A series of statements that form a valid argument. Start with you...
Date Added: 2009-06-11 21:47:39

IV-Using NAT to Translate External Addresses.pdf
Path: California State University, Monterey Bay >> IT >> 341 Spring, 2009
Description: Setting up Our Network, strangeland.cs.umb.edu V. We use NAT to translate the public external addresses to private internal addresses. Right now, our iptables commands translate the local addresses for all inside hosts to a single (strangelands) addr...
Date Added: 2009-06-11 21:47:44

11circuits.pdf
Path: Arkansas Little Rock >> CS >> 229 Fall, 2009
Description: 6 922 TUPMC 6002/01/03 5 922 TUPMC 6002/01/03 1 0 0 0 0 tuO tuO 1 0 1 1 0 2n 2 nII 1 1 0 0 0 1n 1 nII 0 1 tuO tuO 1 0 n nII DNA setaG TON setaG setaG 4 922 TUPMC 6002/01/03 3 922 TUPMC 6002/01/03 sl o b m y s sl o b m y s y b s m a...
Date Added: 2009-06-11 21:48:33

submit.txt
Path: Washington >> JOBS >> 60191 Fall, 2009
Description: executable = pass6_60191.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs60000-60199/60191...
Date Added: 2009-06-11 21:49:22

log.txt
Path: Washington >> JOBS >> 60000 Fall, 2009
Description: 000 (59395.000.000) 02/13 11:17:24 Job submitted from host: <128.95.94.28:1092> . 009 (59395.000.000) 02/13 11:32:24 Job was aborted by the user. via condor_rm (by user burnett) . 000 (59595.000.000) 02/13 11:50:10 Job submitted from host: <128.95.9...
Date Added: 2009-06-11 21:49:35

output.txt
Path: Washington >> JOBS >> 60000 Fall, 2009
Description: = running on = COMPUTERNAME=B280WS8 - local directory - Volume in drive C has no label. Volume Serial Number is B020-E7D5 Directory of C:\\condor\\execute\\dir_2912 02/13/2008 03:06 PM <DIR> . 02/13/2008 03:06 PM <D...
Date Added: 2009-06-11 21:50:55

Quiz4-f00.pdf
Path: UConn >> ME >> 233 Fall, 2008
Description: ...
Date Added: 2009-06-11 21:52:05

hw6.pdf
Path: Maryland >> ENEE >> 244 Fall, 2008
Description: ...
Date Added: 2009-06-11 21:54:39

Phil10006 Rousseau 1.doc
Path: East Los Angeles College >> PHIL >> 10006 Fall, 2009
Description: Lecture 6 Rousseau and the Social Pact Rousseau and the Social Contract Who was Rousseau? Jean-Jacques Rousseau (1712-78) was a Genevan-born writer, autobiographer, composer, musical theorist, educationalist, novelist and, for our purposes most imp...
Date Added: 2009-06-11 21:55:49

John_HW2.pdf
Path: UCLA >> EE >> 181 Fall, 2009
Description: ...
Date Added: 2009-06-11 21:57:52

P9.pdf
Path: Allan Hancock College >> COMP >> 6300 Fall, 2009
Description: Bit Operations and Traps in PeANUt q ref: [PeANUt Spec, sect 2.8.3 and Appendix B] q bitwise operations q traps: s concepts s in PeANUt; x predefined and user-definable s trap handler and trap table q debugging q other issues: s s s s s s Minute Pape...
Date Added: 2009-06-11 22:00:23

money_co.xls
Path: Columbia >> DJ >> 114 Fall, 2008
Description: A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 B C D E F G H Reinvestment rate Bond A Amount invested (in millions) Maximum Bond Inv. Year Year 1 Year 2 Year 3 Year 4 0.175 <= 1.05 Bond B 0.435 <= Bond C Bond D Bond E Cash Yr1-Yr2 Ca...
Date Added: 2009-06-11 22:02:42

Hoffman98.pdf
Path: Cornell >> FS >> 616 Fall, 2009
Description: J. Agric. Food Chem. 1998, 46, 235-241 235 Quantitative Model Studies on the Effectiveness of Different Precursor Systems in the Formation of the Intense Food Odorants 2-Furfurylthiol and 2-Methyl-3-furanthiol T. Hofmann and P. Schieberle* Deutsche...
Date Added: 2009-06-11 22:04:56

jf9705983.pdf
Path: Cornell >> FS >> 616 Fall, 2009
Description: J. Agric. Food Chem. 1998, 46, 235-241 235 Quantitative Model Studies on the Effectiveness of Different Precursor Systems in the Formation of the Intense Food Odorants 2-Furfurylthiol and 2-Methyl-3-furanthiol T. Hofmann and P. Schieberle* Deutsche...
Date Added: 2009-06-11 22:05:05

openGLcompile.txt
Path: Central Connecticut State University >> CS >> 423 Fall, 2009
Description: From the author\'s (Angel) web site: > For Visual C+ you should do the following: > > Opengl32.dll and glu32.dll should already be in the system folder. > Opengl32.lib and glu32.lib should already be in the lib folder > for VC+. gl.h and glu.h shoul...
Date Added: 2009-06-11 22:05:13

Homework8.pdf
Path: Concordia Chicago >> MATH >> 327 Fall, 2009
Description: MATH 327: EIGHTH PROBLEM SET Due Monday, May 25 In the following problems, G is a group, M is a G-module (= Z[G]-module), and I is the augmentation ideal Ker( : Z[G] - Z). 1. Show that H0 (G; M ) M/IM and H 0 (G; M ) M G {m|Im = 0}. = = 2. Show t...
Date Added: 2009-06-11 22:06:05

hwk2_supp.ps
Path: Texas >> M >> 472 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.526b Copyright 1986, 1993 Radical Eye Software %Title: hwk2_supp.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips hwk2_supp.dvi -o hwk2_supp.ps %DVIPSParameters: dpi=60...
Date Added: 2009-06-11 22:06:12

EcologicalModeling.pdf
Path: UCSB >> ESM >> 224 Fall, 2008
Description: Ecological/Watershed Modeling Cindy Ryals Taylor Carroll Defining Models Defining the problem the question Conceptual Model a set of ideas Verbal Model translate into words Mathematical Model translate words into equations Which Model to us...
Date Added: 2009-06-11 22:06:46

m1-2_s03.pdf
Path: Minnesota >> VALIQ >> 001 Fall, 2009
Description: ...
Date Added: 2009-06-11 22:07:32

Assignment 6 2006 Introduction to Management Science.pdf
Path: UMass (Amherst) >> CC >> 252 Fall, 2009
Description: Assignment 6 Introduction to Management Science 61.252 2006 Pages 365 Problems in Hillier & Hillier 8.4 8.7 8.11 8.17 ...
Date Added: 2009-06-11 22:07:56

Grandfatherclocks.xls
Path: UMass (Amherst) >> CC >> 252 Fall, 2009
Description: Special Products Company Analysis of Grandfather Clock Production Data Unit Revenue Unit Cost Fixed Cost Sales Forcast $900.00 $400.00 $50,000.00 300 Production Quantity Resuts Total Revenue Total Variable Costs Total Costs Profit 300 Break-Even Po...
Date Added: 2009-06-11 22:08:18

P&TDistribution.xls
Path: UMass (Amherst) >> CC >> 252 Fall, 2009
Description: A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 B C D E F G H I J K P&T Co. Distribution Problem Unit Cost Source (Cannery) Bellingham Eugene Albert Lea Destination (Warehouse) Sacramento Salt Lake City Rapid City Albuquerque $464 $513 $654 $8...
Date Added: 2009-06-11 22:08:25

Week11s.pdf
Path: Allan Hancock College >> MATH >> 1902 Fall, 2009
Description: The University of Sydney MATH1902 Linear Algebra (advanced) Exercises for Week 11 (beginning May 18) Preliminary Reading: Chapter 3 of the Linear Algebra book. Objectives: By the end of Week 11, to achieve at least a pass level, you should be able to...
Date Added: 2009-06-11 22:08:58

notes08.pdf
Path: Allan Hancock College >> MATH >> 1011 Fall, 2009
Description: MATH1011 Lecture 8 Dr Emma Carberry 27 March 2009 Differentiation Geometrically, the derivative f (a) of the function f (x) at the value x = a is the gradient, or slope, of the tangent line to y = f (x) at x = a. y (a, f (a) f (a) is the gradient of...
Date Added: 2009-06-11 22:09:05

dailyhw7.pdf
Path: Texas >> M >> 362 Spring, 2002
Description: Math 362K Probability Fall 2007 Instructor: Geir Helleloid Daily Homework 7: Due Thursday, October 11 1. (Chapter 4, Problem 1) Two balls are chosen randomly from an urn containing 8 white, 4 black, and 2 orange balls. Suppose that we win $2 for e...
Date Added: 2009-06-11 22:09:36

IntroHW.pdf
Path: University of Dayton >> MCT >> 446 Fall, 2009
Description: Finite Element Modeling Homework #1 1. For the structure below, compute: a) the magnitude and location of the maximum stress in the bar, b) the displacement at the mid-point of the bar. 24 in 16 in 7/8 in steel shaft 6 in 175 lbs 350 lbs 500 2. Se...
Date Added: 2009-06-11 22:10:36

lab9.pdf
Path: Oklahoma State >> PLP >> 3343 Fall, 2008
Description: PLP 3343/5343 LAB PERIOD #9: Parasitic Plants and Oomycetes October 22, 2008 Objectives: 1. Parasitic Plants a. Specimens and slide 2. Oomycetes a. Videos b. Isolations on selective media c. Zoospore demo d. Specimens and slides Activities: Parasitic...
Date Added: 2009-06-11 22:11:22

PUAD700 Ethical Qualities.doc
Path: George Mason >> PUAD >> 700 Fall, 2008
Description: Ethical Dimensions of Public Administration PUAD 700 Prof. Brack Brown BENEVOLENT QUALITIES OF CHARACTER, BEHAVIOUR, AND ACTION Altruistic Courage Fairness Humble Autonomous Trustworthy Loyal Compassionate Dutiful Decency Kindness Just Merciful ...
Date Added: 2009-06-11 22:12:00

ILP_Exercises.pdf
Path: Neumont >> IFT >> 6551 Fall, 2009
Description: Integer Programmming Exercices Brigitte Jaumard Universit de Montral Department of Computer Science and Operations Research Table of contents 1. Mathematical Modeling .. 3 Exercise 1.1 (Nemhauser and Wolsey, Chap. I.1, Exercise 4, p. 22) . 3 Exerci...
Date Added: 2009-06-11 22:12:41

Audio Recording Syllabus 09SQ.pdf
Path: Seattle >> DRMA >> 265 Fall, 2009
Description: DRMA/MUSC 265: Audio Recording - Syllabus Brendan Patrick Hogan Classroom: FINR 122 Office: FINR 122A Class Meets: M/W 10:00am-12:05pm 206-296-2449 Project Presentations: M June 8 hoganb@seattleu.edu Finished Project Due: W June 10, 12:00pm Office Ho...
Date Added: 2009-06-11 22:13:11

lect12.pdf
Path: Rochester >> PHY >> 415 Fall, 2009
Description: ...
Date Added: 2009-06-11 22:14:18

lect23.pdf
Path: Rochester >> PHY >> 415 Fall, 2009
Description: ...
Date Added: 2009-06-11 22:14:21

announcements.ppt
Path: Stanford >> SLAC >> 07012005 Fall, 2009
Description: SVAC Instrument Analysis Meeting, July 1, 2005 Announcements 6 tower data delayed! TKR problems: Special diagnostic runs needed Loss of TKR TEM diagnostics with 1-shot trigger: Special trigger run for TKR STRETCH scan today At what value are...
Date Added: 2009-06-11 22:16:38

hw9-der.ps
Path: Duke >> MATH >> 225 Fall, 2008
Description: %!PS-Adobe-2.0 %Title: hw9-der.ps %Creator: gnuplot 4.0 patchlevel 0 %CreationDate: Mon Apr 9 14:44:38 2007 %DocumentFonts: (atend) %BoundingBox: 50 50 554 770 %Orientation: Landscape %Pages: (atend) %EndComments /gnudict 256 dict def gnudict begin /...
Date Added: 2009-06-11 22:17:39

hom3.pdf
Path: Utah >> MATH >> 531 Fall, 2009
Description: kF w \'ca % 2 V )c1% w W %1 E% W D 1% W y 1cF 2%a w y D c XE F w p ! \' )% 1%c (\"hEH g(8H6(i(\"n0a\' p \"(G\"hEy\"(U`Hbu 601\"E p 0a\' ic`HS(8 A Q\"E (n0a\' p (\"f\"H0F\' { { { dF | 9 xP I % P I E c D % E e E | o c c q F w \' c 1 e %...
Date Added: 2009-06-11 22:19:15

smooth.ps
Path: University of Hawaii - Hilo >> CS >> 005 Fall, 2009
Description: ...
Date Added: 2009-06-11 22:19:55

a.pdf
Path: Duke >> CPS >> 149 Fall, 2009
Description: 3194 - Mersenne Composite Numbers North America - Pacific Northwest - 2004/2005 One of the world-wide cooperative computing tasks is the `Grand Internet Mersenne Prime Search\" - GIMPS - striving to find ever-larger prime numbers by examining a parti...
Date Added: 2009-06-11 22:21:29

Writing Persuasive Letter2.ppt
Path: CSU Northridge >> AGK >> 33107 Fall, 2009
Description: AYSE KARABAY 5th Grade Writing Persuasive Letters WHAT IS PERSUASIVE WRITING? In persuasive writing, a writer takes a position for or against an issue and writes to convince the reader to believe or do something. The purpose is to get the reader...
Date Added: 2009-06-11 22:22:10

experiment 1.pdf
Path: Earlham >> CHEM >> 111 Fall, 2008
Description: Please bring a pen, calculator, closed-toed shoes and this print-out to lab. Don\'t forget to write your title and introduction in your notebook. Experiment 1: Nuclear Alchemy: The Half-Life of Iodine-128 Objectives Become familiar with the neutro...
Date Added: 2009-06-11 22:22:14

W9-2SeasonalIndex.pdf
Path: Oregon >> DSC >> 330 Fall, 2008
Description: ...
Date Added: 2009-06-11 22:22:31

W4-2Dummy Variables.doc
Path: Oregon >> DSC >> 330 Fall, 2008
Description: Regression Analysis: Dummy Variables There are situations in which we might be interested in how extraneous effects such as: Price controls has on wages Gender has on wage War or regional conflict may have on price of oil We can incorporate these...
Date Added: 2009-06-11 22:22:34

07_1acetate.pdf
Path: Rush >> IFT >> 459 Fall, 2009
Description: INTERPRTEURS PAR PASSAGE DE CONTINUATION (CHAP 7 EOPL) Dans le chapitre 3, nous avons utilis le concept d\'environnement pour explorer le comportement des liaisons (bindings). Dans le chapitre 3, nous avons explor la notion d\'environnements comme con...
Date Added: 2009-06-11 22:23:40

lec51.pdf
Path: Kent State >> TECH >> 64012 Spring, 2008
Description: Week 5 Course notes Introduction to material covered this week Having reviewed the instruction set for the MC68HC11 with practice on some of the more frequently used opcodes, we are now ready to learn and work with the interface and programming of I...
Date Added: 2009-06-11 22:23:48

Sol5.pdf
Path: University of Illinois, Urbana Champaign >> STAT >> 424 Spring, 2008
Description: STAT 424 HOMEWORK 5: SOLUTION May 6, 2009 1. Motor Oil Prices (a) See Table 1 Table 1: Two-way ANOVA Table SS df MS F value Pr(>F) 6293.5 1773.6 169.6 8236.7 8 3 24 35 786.7 591.2 7.1 111.316 83.657 < 2.2 -16 7.553 10-13 Source MR0 MC0 M R+C Total...
Date Added: 2009-06-11 22:24:11

Quiz-11c.doc
Path: UT Chattanooga >> ENGR >> 328 Fall, 2009
Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|17 Oct 2006 13:18:45 -0000 vti_extenderversion:SR|5.0.2.6417 vti_author:SR|JIMHENRY\\jhenry vti_modifiedby:SR|JIMHENRY\\jhenry vti_timecreated:TR|17 Oct 2006 13:18:45 -0000 vti_cacheddtm:TX|17 Oct 2006 13...
Date Added: 2009-06-11 22:30:38

duration.xls
Path: Laurentian >> MGT >> 200803 Fall, 2009
Description: Duration 3 year- bond coupon rate = .10 Required rate of return or yield to maturity = .12 Find duration Yr Cash flows, C PV of c at .12 pv of c/price 1 100 89.29 0.09 2 100 79.72 0.08 3 1100 782.96 0.82 Price 951.96Duration A*D 0.09 0.17 2.47 2.73 ...
Date Added: 2009-06-11 22:31:13

220Ex1.pdf
Path: Sveriges lantbruksuniversitet >> LING >> 220 Fall, 2009
Description: LINGUISTICS 220 Introduction to Linguistics EXERCISE #1 Due on Week 3 on the day of your tutorial. 1. Consider the content of these two statements. A. B. I learned a new word today. I learned a new sentence today. Put a check mark beside whichever ...
Date Added: 2009-06-11 22:32:31

limit.dead.examples.pdf
Path: Oakland University >> AME >> 20212 Fall, 2009
Description: Name: AME 20212 - Introduction to Mechanical Engineering Limit Configurations, Time Ratios, Transmission Angles and Dead Positions Example 1 This example concerns itself with the four bar kinematic chain shown below which contains all pin joints. 2...
Date Added: 2009-06-11 22:33:05

pchindaphorn_FinalExam.rtf
Path: Santa Clara >> COEN >> 120 Fall, 2009
Description: Piya (Ray) Chindaphorn COEN 120 Final 6/4/2009 final Report on Configuration VxWorks Overridden Properties Subjects: CG Metaclasses: CGGeneral Properties: GeneratedCodeInBrowser: False Piya (Ray) Chindaphorn COEN 120 Final 6/4/2009 PACKAGES Defaul...
Date Added: 2009-06-11 22:38:07

politics.rtf
Path: JMU >> BIOS >> 347 Fall, 2009
Description: The Politics of Policy-Making I. Social Cleavages II. Interest Group Politics III. Party Politics & Voting Behavior IV. Electoral Systems V. Executive-Legislative Relations VI. Federal v. Unitary Government VII. The Role of the Bureaucracy VIII. The ...
Date Added: 2009-06-11 22:38:42

hcp-bra.rtf
Path: JMU >> BIOS >> 347 Fall, 2009
Description: The Brazilian System I. Coverage II. Health Delivery III. Funding IV. Costs and Cost Control V. Reform I. Coverage *A. Who is covered & how? *75% Unified Health System (SUS) *all citizens have a right to SUS system, but those w/ jobs that still provi...
Date Added: 2009-06-11 22:38:43

Sec1038.pdf
Path: UMKC >> CE >> 020701 Fall, 2009
Description: SECTION 1038 BEARING PADS FOR STRUCTURES 1038.1 Scope. These specifications cover elastomeric bearing pads of neoprene, of rubber and fabric and of rubber and fiber. Elastomeric bearing pads as herein specified shall include plain bearings (consisti...
Date Added: 2009-06-11 22:39:43

lect25-ece636.ppt
Path: UMass (Amherst) >> ECE >> 636 Fall, 2009
Description: ECE 636 Reconfigurable Computing Lecture 25 Course Wrap-up Lecture 25: Course Wrap-up May 12, 2009 What is Reconfigurable Computing? Computation using hardware that can adapt at the logic level to solve specific problems Why is this interesting...
Date Added: 2009-06-11 22:40:06

blank_timecode.txt
Path: UAB >> NUR >> 613 Fall, 2009
Description: u 00:00:00.0 00.00:00.0 http:/.html ...
Date Added: 2009-06-11 22:40:14

13-Recruitment1.xls
Path: Oregon State >> FW >> 431 Fall, 2009
Description: The Ricker Spawner-Recruit Model a= a = S 0 40 80 120 160 200 240 280 320 360 400 440 480 520 560 600 640 680 720 760 800 840 880 920 960 1000 5 -1 b= b = 0 0 R1(S) Change the values in the highlighted and watch how the pink curve (R2) c relative to...
Date Added: 2009-06-11 22:42:03

Willie Nelson biodeisel Jan2005.ppt
Path: Widener >> ASC >> 400 Fall, 2009
Description: Environmental Ethics defined: \"In general, environmental ethics presents and defends a systematic and comprehensive account of the moral relations between human beings and their natural environment. Environmental ethics assumes that human behavior to...
Date Added: 2009-06-11 22:42:22

WebExercise1.pdf
Path: Kentucky >> AS >> 120 Fall, 2009
Description: Name _ GLY 120: Web Exercise #1 - Soils Due date: Tuesday, October 14 at the beginning of class (11 a.m.) 24 Points possible For our first web exercise, you will answer questions based on information and data found at various World Wide Web sites on ...
Date Added: 2009-06-11 22:43:46

Assignment 4 -- Arrays.doc
Path: Kent State >> CS >> 10051 Fall, 2008
Description: Assignment 4 Arrays Dean Zeller CS10051 Spring, 2006 Due: Wednesday, February 22nd by 9:00 PM Lab: 10 points Assignment: 10 points Objective: The student will write and analyze programs with arrays. Instructions: Given below are three (3) programs ...
Date Added: 2009-06-11 22:43:55

EME 236Lecture36_Buckling of Columns.doc
Path: Loras >> CM >> 418218 Fall, 2009
Description: EME 236 Properties and Mechanics of Materials Lecture 36: Buckling of Columns Today: - Homework questions: - Final Exam on Monday at 1:00 p.m. - New Topics: - Buckling of Columns - Homework: Read Section 13:1, 2, and 6 Work Chap 13 Problems 8, 16 Sp...
Date Added: 2009-06-11 22:44:13

ch_02.ppt
Path: SPSU >> CS >> 4263 Fall, 2009
Description: C hapte 2: Application Laye r r Our goals: conce ptual, im m ntation ple e aspe of ne cts twork application protocols r transport-laye se r rvice m ls ode r clie nt-se r paradigm rve r le about protocols by arn e ining popular xam application-le ...
Date Added: 2009-06-11 22:44:50

engr2030finalexams08.pdf
Path: Armstrong >> ENGR >> 2030 Spring, 2008
Description: ENGR 2030 Final Exam Spring 2008 Given: 5/7/2008 Name: The exam is closed book and closed notes; however, you may use four 8 by 11 inch sheets of notes and you may use a calculator. The exam is to be individual work. You have 150 minutes to compl...
Date Added: 2009-06-11 22:45:11

PracticeQuestions1.pdf
Path: UCSD >> CHEM >> 219 Fall, 2009
Description: CHE M 21 9C 3D E LE CTR O N M IC RO S COPY OF M AC RO MOLE CU LE S PRA CT IC E EXAM QU ES TIO NS Here are several questions to give you a flavor of the types of questions to expect on the upcoming Mideterm Exam. Questions that are not multiple choi...
Date Added: 2009-06-11 22:46:28

MyAnswers.docx
Path: Penn State >> JAM >> 811 Fall, 2009
Description: In-Class Activity 2: Defining Alternative Sets 2 individually to determine the types of alternative sets and why. Exchange your work with another student and explain your reasonin...
Date Added: 2009-06-11 22:47:22

10.pdf
Path: Bridgeport >> GSB >> 549 Fall, 2009
Description: ...
Date Added: 2009-06-11 22:47:46

class 23 Nonlinear propagation equations.doc
Path: UCF >> OSE >> 5312 Fall, 2008
Description: Fundamentals of Optical Science OSE 5312 Fall 2003 Tuesday, December 02, 2003 Nonlinear Propagation Equations Now that we have seen how it is possible to generate nonlinear polarizations, we must address how these polarizations cause new waves to gr...
Date Added: 2009-06-11 22:49:43

exam 1 2007.pdf
Path: UCF >> OSE >> 5312 Fall, 2008
Description: OSE 5312 FUNDAMENTALS OF OPTICAL SCIENCE Spring 2007 Mid Term Exam 1 Wednesday, Feb, 21. This is a closed notes, closed book exam. Answer all questions. Try to use drawings & figures to help explain your answers. Clearly state all your assumptions, d...
Date Added: 2009-06-11 22:49:47

module-a.ppt
Path: Creighton >> MIS >> 470 Fall, 2009
Description: More on TCP/IP Module A Copyright 2003 Prentice Hall Panko\'s Business Data Networking and Telecommunications, 4th edition Multiplexing Multiplexing IP packets can carry different things in their data fields TCP segments UDP datagrams ICMP sup...
Date Added: 2009-06-11 22:51:03

pakes.pdf
Path: UVA >> ECON >> 871 Fall, 2008
Description: ...
Date Added: 2009-06-11 22:51:33

Lecture13_2008.ppt
Path: Washington >> BIOC >> 441 Winter, 2008
Description: 1 \"Discovery consists of seeing what everybody has seen and thinking what nobody has thought\" Albert Szent-Gyorgyi (Hungarian-born US Biochemist) Lecture 13 Biochemistry 441 February 8, 2008 Ted Young Topic for today: RNA processing 3 RNA process...
Date Added: 2009-06-11 22:52:14

solutions_ex2sp08.pdf
Path: Maryland >> ENEE >> 425 Fall, 2008
Description: ...
Date Added: 2009-06-11 22:53:49

Electrophysiology 2.ppt
Path: UCSD >> COGS >> 107 Fall, 2009
Description: COGNITIVE SCIENCE 107A Electrophysiology: Electrotonic Properties 2 Jaime A. Pineda, Ph.D. Initial segment origin of AP Pyramidal cells. -75mV Thalamic cells. -65mV Photoreceptors. -40mV Phases of the Action Potential Absolute refractory period ...
Date Added: 2009-06-11 22:53:55

10 year job retention rate.pdf
Path: Wesleyan >> ECON >> 262 Spring, 2009
Description: 10 year job retention rate (tenure<5 years) Ages 1977-1987 25-29 33 30-34 41 35-39 55 40-44 56 45-49 58 50-54 60 10 year job retention rate (tenure>=5 years) Ages 1977-1987 30-34 46 35-39 68 40-44 80 45-49 83 50-54 80 1987-1997 31 38 50 47 45 48 19...
Date Added: 2009-06-11 22:54:14

Animal Welfare.pdf
Path: UMBC >> ENVR >> 242 Fall, 2009
Description: Threats to Individual Vertebrates Animal Welfare Issues Rose Harbour, B.C. 1918 Effect of Humans (and Human Value Systems) on Non-human Vertebrates Population/species level: conservation -extirpation /extinction decline Individual level: animal ...
Date Added: 2009-06-11 22:56:59

assignment2.ps
Path: UC Davis >> ECS >> 152 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: assignment2.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o assignment2.ps assignm...
Date Added: 2009-06-11 22:57:33

Solns Exam 1.pdf
Path: Colorado State >> M >> 345 Fall, 2009
Description: M 345 Take Home Exam I t y t a y t t4, Solutions y T y0 1. Use variation of parameters to solve for y(t) (a) find the general homogeneous solution and explain the meaning of the term \"general solution\" Rewrite the equation as y t a y t t3, t ...
Date Added: 2009-06-11 22:57:45

readMe.txt
Path: Clemson >> PROBS >> 307 Fall, 2009
Description: Can you find the error in the solution to the problem in prob.doc ? Notice that the calculation of the short-circuit current on the second page is not the same as as Vth / Rth from the first page. So why are the answers not that same ? Will Jones ...
Date Added: 2009-06-11 22:59:52

ASSIGNME05.pdf
Path: Johns Hopkins >> COG >> 205 Fall, 2008
Description: The Johns Hopkins University Department of Cognitive Science Luigi Burzio, Krieger 247 <burzio@jhu.edu> TAs: Charley Beller <beller@cogsci.jhu.edu>, Jennifer Culbertson <culbertson@cogsci.jhu.edu>, Ehren Reilly <reilly@cogsci.jhu.edu>, Michael Oliver...
Date Added: 2009-06-11 23:00:38

CarmeanChristie.pdf
Path: ASU >> WEST >> 547 Fall, 2009
Description: ePortfolios: Carmean & Christie 1 ePortfolios: Constructing Meaning Across Time, Space and Curriculum An article submission for Handbook on Research for ePortfolio, Jafari and Kaufman, eds. Authors Colleen Carmean Arizona State University 4701 W T...
Date Added: 2009-06-11 23:01:02

StandardCard.txt
Path: Iowa State >> CS >> 228 Fall, 2009
Description: package edu.iastate.cs228.cards; /* * * @author Kevin Flores - isukevin * */ public class StandardCard extends AbstractCard{ private Rank r; private Suit s; /Makes Suit and Rank enumerated types so they cannot be changed easily public en...
Date Added: 2009-06-11 23:01:14

hw17.pdf
Path: Arizona >> MATH >> 160 Fall, 2008
Description: Homework 17, Due F 04/13 Read Chapters 3, 11, 14 and 15; and solve the exercise problems. Best of luck for Exam 3 ! Problems to be turned in: Show all working. Answers without explanation will not get any credit. 1. Ex. 15.25 2. Ex. 15.26 3. Ex. 15....
Date Added: 2009-06-11 23:02:27

Module 2 - Materials Management Org Structures.doc
Path: UCF >> ISM >> 6158 Spring, 2008
Description: Module 2: Material Management Org. Structures Organizational Structures Valuation Level You define the valuation level by specifying the level at which material stocks are valuated. You can valuate material stocks at either the company code level or...
Date Added: 2009-06-11 23:02:57

icans0504.pdf
Path: ASU >> MAT >> 272 Fall, 2009
Description: Answers to in-class exercises, May 4, 2009 1. (Problem 10) See Theorem 8 in 8.3. Since F is smooth and F = 2x2 , the answer is no. 2. (Problem 11) A calculation shows that F = 2a, which is nonzero in general. Hence F is not conservative. 3. (Prob...
Date Added: 2009-06-11 23:03:43

Ruiz - Elites and Masses.ppt
Path: UCSD >> PS >> 235 Fall, 2009
Description: Chains of Delegation in Argentina, Brazil, Chile and Mexico Alexander Ruiz Euler Poli 235A Broad analytical framework.- Delegation Are chains of delegation of political authority functional for voters in Latin America? Functional: Useful for trans...
Date Added: 2009-06-11 23:03:54

lect15.pdf
Path: UConn >> PHYS >> 1501 Fall, 2009
Description: PHYS-1501 Lecture Notes R.T. Jones, University of Connecticut Physics 1501: Lecture 15 Today\'s Agenda Today\' Conservative Forces Potential Energy Copyright, Department of Physics, University of Illinois at Urbana-Champaign Physics 1501: Lecture ...
Date Added: 2009-06-11 23:04:26

lect25.ppt
Path: UConn >> PHYS >> 1501 Fall, 2009
Description: Physics 1501: Lecture 25 Today\'s Agenda q Rolling motion Rotational vectors and torque Angular momentum q q Copyright, Department of Physics, University of Illinois at Urbana-Champaign Physics 1501: Lecture 25, Pg 1 Rolling Motion q Now cons...
Date Added: 2009-06-11 23:04:30

lec33.ppt
Path: UConn >> PHYS >> 1501 Fall, 2009
Description: q Physics 151: Lecture 33 Today\'s Agenda Announcements Homework 12 will be posted on the Web Ch.15: # 12, 15, 19, 30, 38, 39, 41 and 45. Recitation Tuesday Nov. 18 Room P-103A (instead of P-121) Topics Review of pendula Potential energy and SH...
Date Added: 2009-06-11 23:05:34

techniques.pdf
Path: UWO >> ENG >> 491 Fall, 2009
Description: FULL-SCALE, WIND TUNNEL AND CFD WIND ENGINEERING STUDIES A variety of methods can be used to obtain wind engineering design information. These include codes of practice, full-scale, wind tunnel or Computational Fluid Dynamics (CFD) studies. Each of t...
Date Added: 2009-06-11 23:08:34

Test3review.doc
Path: Virginia Tech >> MATH >> 1206 Fall, 2008
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02a0e8dcf3b905f9ff965bf1645d54ab8e1ebdc2.doc</Key><RequestId>2 F1FB2C74DA41478</RequestId><HostId>oYTUspSbyNhzsxsnDoyMbWM9hSN...
Date Added: 2009-06-11 23:09:16

Test4Review.doc
Path: Virginia Tech >> MATH >> 1206 Fall, 2008
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>025472eaac8dcb7d404e9238487fe893b0d6112b.doc</Key><RequestId>3 788248A1BA53FEE</RequestId><HostId>D1KD7I9UHizE1+RtlfSQXUcwr4+...
Date Added: 2009-06-11 23:09:17

Chapter 8 Final.pdf
Path: North Texas >> CECS >> 0096 Fall, 2009
Description: Nw e O la s re n Jz az a d n Bu s le F sia e tv l CaAeu o l vn e O e aH u e pr os O t b r 41 co e 1 -7 T e tei t eP r h ar n h a k Te h C me y f o do Err r s o y u ut t o r l ma e i d si a in et t ! n o ...
Date Added: 2009-06-11 23:09:59

ex11-67.txt
Path: Minnesota >> CH >> 3022 Fall, 2009
Description: x y 10 25 12 30 14 36 15 37 18 42 19 50 23 55 ...
Date Added: 2009-06-11 23:11:12

ex03-3.pdf
Path: Laurentian >> LOGI >> 200103 Fall, 2009
Description: Exercise 3.3 1. (a) I am a pacifist I am not a pacifist (c) I am a pacifist I am a loyalist (b) I am a pacifist I am not a pacifist (d) I am a pacifist I am a non-pacifist warmonger (e) I am a pacifist I am not a pacifist and I am a warmonger I am n...
Date Added: 2009-06-11 23:11:44

e894l6j.pdf
Path: Sveriges lantbruksuniversitet >> E >> 894 Fall, 2009
Description: Matrix Methods in Optics For more complicated systems use Matrix methods & CAD tools Both are based on Ray Tracing concepts Solve the optical system by tracing may optical rays In free space a ray has position and angle of direction y1 is radial ...
Date Added: 2009-06-11 23:12:01

07-TDD.ppt
Path: Arizona >> CS >> 335 Fall, 2009
Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|21 Sep 2006 21:39:22 -0000 vti_title:SR|Object-Oriented Programming and Design vti_author:SR|mercer vti_syncwith_localhost\\p\\:/p\\:TR|14 Sep 2004 20:00:36 -0000 vti_syncwith_localhost\\x\\:/x\\:TR|21 Sep 20...
Date Added: 2009-06-11 23:12:29

99a0663_1.pdf
Path: Wisconsin >> LAW >> 465 Fall, 2009
Description: 1999 2000 LEGISLATURE LRBa0663/1 JEO:kmg&wlj:ch ASSEMBLY AMENDMENT 14, TO 1999 ASSEMBLY BILL 465 September 23, 1999 Offered by Representative F. LASEE. 1 2 3 4 5 6 7 8 9 10 11 12 At the locations indicated, amend the bill as follows: 1. 2. P...
Date Added: 2009-06-11 23:15:17

99a0520df.pdf
Path: Wisconsin >> LAW >> 389 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:18:14

99-2389df.pdf
Path: Wisconsin >> LAW >> 317 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:18:22

99-3200_3dn.pdf
Path: Wisconsin >> LAW >> 389 Fall, 2009
Description: DRAFTER\'S NOTE FROM THE LRB3200/3dn MDK:kmg:jf LEGISLATIVE REFERENCE BUREAU June 15, 1999 Representative Hoven: This version is identical to LRB3150/3. Mark D. Kunkel Legislative Attorney Phone: (608) 2660131 Email: Mark.Kunkel@legis.state.wi.us ...
Date Added: 2009-06-11 23:18:41

99f2_1.pdf
Path: Wisconsin >> LAW >> 051 Fall, 2009
Description: 1999 2000 LEGISLATURE LRBf2/1 JTK:jlg:km ASSEMBLY AMENDMENT 1, TO ASSEMBLY AMENDMENT 11, TO ASSEMBLY SUBSTITUTE AMENDMENT 1, TO 1999 ASSEMBLY BILL 51 January 26, 1999 Offered by Representative KAUFERT. 1 2 3 At the locations indicated, amend t...
Date Added: 2009-06-11 23:18:53

99-0683df.pdf
Path: Wisconsin >> LAW >> 001 Fall, 2009
Description: LRB-0683 1999 DRAFTING REQUEST Bill Received: 10/28/98 Wanted: As time permits For: Wayne Wood (608) 266-7503 This file may be shown to any legislator: NO May Contact: Subject: Tax - sales Received By: shoveme Identical to LRB: By/Representing: Dott...
Date Added: 2009-06-11 23:19:42

99-2198df.pdf
Path: Wisconsin >> LAW >> 277 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:21:26

Lecture02.pdf
Path: Wisconsin >> CS >> 538 Fall, 2008
Description: Typed exceptions are provided. Abstract data types, with constructors, are included. 3. Prolog (Programming in Logic) Programs are Facts and Rules. Programmers are concerned with definition, not execution. Execution order is automatically determined....
Date Added: 2009-06-11 23:21:45

FinalReview.pdf
Path: Washington >> ATMOS >> 211 Fall, 2009
Description: ATMS 211 Review sheet for final The final exam is at 8:30 AM Monday 12 March, in Law 127. It is comprehensive, but material from the last 3 weeks, on which you haven\'t been tested, will make up about 40-50% of the exam. As on previous exams, you will...
Date Added: 2009-06-11 23:22:11

v003a001.ps
Path: Concordia Chicago >> V >> 003 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: auxiliary/v003a001.dvi %Pages: 23 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Italic CMSY10 Times-Bold Symbol CMR10 %+ CMTT8 CMSY9 ...
Date Added: 2009-06-11 23:23:48

SaeedCh6.pdf
Path: Colorado >> LAM >> 5430 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:24:31

studyguide4sol011.pdf
Path: Arizona >> MATH >> 110 Fall, 2008
Description: ...
Date Added: 2009-06-11 23:24:54

E2-4B (Horizontal Model).xls
Path: Uni. Westminster >> GTG >> 0324 Fall, 2009
Description: TEMPLATE-ACCOUNTING EQUATION ASSETS EVENT Beg Bal. Cash $0 $0 $0 $0 = = $0 $0 LIABILITIES UATION + + EQUITY Common Retained Stock Earnings $0 $0 TYPE R, E, D, G, L CF Gary Glodowski E2-4B Todd & Co. Horizontal Statement Event No. Assets Cash Beg. ...
Date Added: 2009-06-11 23:27:27

E8-4B.xls.xls
Path: Uni. Westminster >> GTG >> 0324 Fall, 2009
Description: Gary Glodowski E8-4B Cash 2b. 900 4. 190,000 Accounts Receivable Bal. 80,000 2a. 900 1. 3,500 3. 200,000 2b. 900 4. 190,000 Bal. 86,500 Allowance for Doubt Acct. Bal. 3,000 1. 3,500 2a. 900 5. 4,000 Bal. 4400 Sales Revenue 3. 200,000 Bad Debts Ex...
Date Added: 2009-06-11 23:27:33

exam03.ps
Path: East Los Angeles College >> PHYS >> 3007 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: ph316.dvi %CreationDate: Mon Mar 10 11:40:58 2003 %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Times-Roman Times-Italic Times-BoldItalic Sym...
Date Added: 2009-06-11 23:29:35

section 3-PPT slides.pdf
Path: Laurentian >> ECON >> 236 Fall, 2009
Description: 1) Introduction to Markets 3. An Economic Model of Criminal Behaviour R. Freeman (coursepack), \"3. Crime in a Market Context\" and \"4. Evidence on the Supply of Crime\" C. Fellows, G. Flanagan, S. Shedd, (coursepack), \"An Economic Analysis of Criminal...
Date Added: 2009-06-11 23:30:29

194lec22.pdf
Path: University of Iowa >> PHYS >> 194 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:31:29

Science Curriculum.doc
Path: University of Illinois, Urbana Champaign >> CI >> 351 Fall, 2009
Description: Amanda McDaniel C & I 351 Science Unit Topic September 29, 2003 Topic: Changes in Matter Grade Level: 3rd Rationale: My next placement is in a third grade classroom and because of this I thought it would be beneficial for me to use one of the Champai...
Date Added: 2009-06-11 23:32:36

PHY 114, HW 4.doc
Path: Rochester >> PHY >> 114 Fall, 2009
Description: PHY 114, Summer 2007 Langenbrunner HW 4 due Wednesday, July 18 at 5:00 (in my mailbox or office) 1. Two capacitors, of 2.0 and 4.0 F capacitance, are connected in parallel across a 300 V potential difference. Calculate the total energy stored in the...
Date Added: 2009-06-11 23:33:52

lectures5-6.pdf
Path: New Mexico >> PHYS >> 406 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:35:02

wk9_lec.ppt
Path: East Los Angeles College >> STG >> 0607 Fall, 2009
Description: Multimedia Design Sound and the Interface Why use Audio? Heightens awareness of message Responsiveness Atmosphere and mood Promotion (i.e. music artists) Multimedia Design Week 9 2 Audio Issues Must be appropriate and relevant to subject ma...
Date Added: 2009-06-11 23:35:21

exam3_sol.pdf
Path: Washington >> MENGR >> 430 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:36:11

notes_a.pdf
Path: Washington >> MENGR >> 430 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:36:18

notes_b.pdf
Path: Washington >> MENGR >> 430 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:36:18

Homework10_F07.pdf
Path: Iowa State >> STAT >> 104 Fall, 2008
Description: Stat 104 Homework 10 Due Friday, December 7, 2007 Reading: November 27 November 29 December 4 December 6 Chapter 9 Chapter 10 Assignment: 1. Complete the following problems from the text: 9.28a, 9.38a, 9.54, 10.4, 10.12, 10.20, and 10.36a. 1 ...
Date Added: 2009-06-11 23:36:44

3310L04.pdf
Path: Mansfield >> MA >> 3310 Fall, 2009
Description: Math 3310-Numerical Analysis Lecture 04 9/6/06 On my web page, youll see Project 01. Youre going to write a computer program, and turn it into me. You should study the program bisect3.pas, and understand what it does and how it does it. A small modi...
Date Added: 2009-06-11 23:36:55

3362L07.pdf
Path: Mansfield >> MA >> 3362 Fall, 2009
Description: MA 3362 Lecture 07 - Some Basic Properties of Rings Friday, September 19, 2008. Objectives: Practice doing algebraic proofs by proving some basic ring properties We\'ve done some proofs on specific rings. We\'ll practice some more general proofs here t...
Date Added: 2009-06-11 23:37:10

3345L18.pdf
Path: Mansfield >> MA >> 3345 Fall, 2009
Description: Math 3345-Real Analysis Lecture 18 10/24/05 1. It aint differentiable nowhere Heres an exciting way to construct a simple function. Im interested in building a continuous function that is nowhere dierentiable. Consider the function f0 (x) = [x]. Thi...
Date Added: 2009-06-11 23:37:21

SETI.pdf
Path: Ursinus >> PHYSICS >> 101 Fall, 2009
Description: SETI Misconceptions about the Conflict between Science and Religion \"The Old Testament description of the creation of the world, for instance, does not fit scientific observations.\" - Michael Seeds \".religion is a matter of faith and not subject...
Date Added: 2009-06-11 23:38:26

Lanpher 2006 Nat Rev Gen _flux from mendelian to complex diseases.pdf
Path: UC Davis >> MCB >> 138 Fall, 2008
Description: REVIEWS Inborn errors of metabolism: the flux from Mendelian to complex diseases Brendan Lanpher*, Nicola Brunetti-Pierri* and Brendan Lee* Abstract | Inborn errors of metabolism are characterized by dysregulation of the metabolic networks that und...
Date Added: 2009-06-11 23:38:29

AssignmentCh16-3.doc
Path: Winona >> CHEM >> 213 Fall, 2008
Description: Chem. 213 Assignment Chapter 16-3 WINONA STATE UNIVERSITY [10 points] Name: _ Team Name: _ 1. A 0.200 M solution of a weak acid, HA, is 9.4% ionized. Calculate [H+], [A-], and [HA] at equilibrium and Ka for HA. 2. Explain what is meant by the stre...
Date Added: 2009-06-11 23:38:46

HP502 unit description 2006.doc
Path: Allan Hancock College >> HP >> 502 Fall, 2009
Description: HP502. Introductory Psychology: Memory, Learning and Cognition. UNIT CODE: UNIT COORDINATOR: COURSE: YEAR: SEMESTER: PRE-REQUISITE: CO-REQUISITE: CREDIT POINTS: 1. UNIT OBJECTIVES This unit aims to enable students to: HP502 Dr. Meredith McKague. Ba...
Date Added: 2009-06-11 23:39:49

New Beijing, Great Olympics.doc
Path: Stanford >> E >> 297 Fall, 2009
Description: 1 \"New Beijing Great, Olympics\" Grant Lee E297B Introduction The 2008 Olympic Games promise to capture the world\'s attention. With a budget of nearly $30 billion and the motto, \"New Beijing, Great Olympics,\" it is evident that Beijing is utilizing t...
Date Added: 2009-06-11 23:43:28

060125_05.ps
Path: Wisconsin >> SH >> 060125 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: MATLAB, The Mathworks, Inc. %Title: 060125_05.ps %CreationDate: 01/27/2006 15:32:31 %DocumentNeededFonts: Helvetica %DocumentProcessColors: Cyan Magenta Yellow Black %Extensions: CMYK %Pages: (atend) %BoundingBox: (atend) %En...
Date Added: 2009-06-11 23:45:32

060125_ZPD256F02.ps
Path: Wisconsin >> SH >> 256 Fall, 2009
Description: %!PS-Adobe-3.0 %Creator: MATLAB, The Mathworks, Inc. %Title: 060125_ZPD256F02.ps %CreationDate: 02/28/2006 20:01:43 %DocumentNeededFonts: Helvetica %DocumentProcessColors: Cyan Magenta Yellow Black %LanguageLevel: 2 %Pages: (atend) %BoundingBox: (ate...
Date Added: 2009-06-11 23:45:39

Syllabus-318_Ostrovskii_2007.pdf
Path: Ole Miss >> PHYS >> 318 Fall, 2008
Description: 1 PHYSICS - 318: SPRING - 2007 INTRODUCTION TO MODERN PHYSICS II Instructor: Dr. Igor Ostrovskii Course objectives: 1. Introduce the physics major students to the physics of 2nd half of 20-th century; 2. Expand an understanding of the ideas and res...
Date Added: 2009-06-11 23:47:08

hw4.pdf
Path: Ole Miss >> PHYS >> 451 Fall, 2008
Description: Chapter 4 Homework #1! Monochromatic light of \" = 600nm passes through a fast shutter #t = 10 !9 s. Find #\". E= hc hc so #E = 2 #\" \" \" ! 2 hc ! #\"#t $ 2 \"2 and #\" $ #E#t $ \"2 = 9.6 x10 !14 m 4% c#t #3 ! Demonstrate that if a particle is in a 1D st...
Date Added: 2009-06-11 23:47:59

DP2_HAWT.pdf
Path: Penn State >> OJK >> 5003 Fall, 2009
Description: Test Name: HAWT 6 Blade Date: 3/30/2009 Team #: 3 Section #: 1 Wind speed (m/s) Blade Length (outside tip) inch Blade Length (inside tip) inch Length of travel (inch) Weight (g) Pmax 4.5 9.5 4 23.35 124.28 8.228156732 Time (s) HAWT 6 Blade Pitch 8 Pi...
Date Added: 2009-06-11 23:48:33

01-11.20.07.doc
Path: UC Davis >> ATT >> 0711 Fall, 2009
Description: Students for Sustainable Agriculture 11/20 Sodexo SSA hosted a web conference with the Yale/ Santa Cruz food service directors and forty other stakeholders from other universities. We invited stakeholders on campus including Sodexo, student groups, a...
Date Added: 2009-06-11 23:49:11

shadow_out.txt
Path: Clemson >> CPSC >> 210 Fall, 2009
Description: Type: camera Name: cam1 pixel_dim 400 320 world_dim 10.0 8.0 viewPoint 0.0 0.0 4.0 SURFACES: Type: surface Name: purple color: 4.000 1.000 4.000 diffuse: 1.000 reflective: ...
Date Added: 2009-06-11 23:49:16

qz5sol.doc
Path: Texas A&M >> STAT >> 651 Fall, 2008
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02c5a19606c390d59cfbdeea4773aa3623d75c8e.doc</Key><RequestId>2 DF5CBC207AC7ACF</RequestId><HostId>m1BGFLkqXi4WEXY8VziwhVqGwOI...
Date Added: 2009-06-11 23:51:08

SEM-english.ppt
Path: NSULA >> MQT >> 11947 Fall, 2009
Description: An Introduction to Structural Equation Modeling (SEM) Albert Dionne Laval University Nov. 2000 An Introduction to Structural Equation Modeling (SEM) INTRODUCTION PATH DIAGRAMS GLOBAL MODEL SEM in SEVEN STEPS EQS commands GOODNESS-OF-FIT IND...
Date Added: 2009-06-11 23:51:57

Syllabus_FIN4453_04.pdf
Path: UCF >> BUS >> 4453 Fall, 2009
Description: FIN 4453-04 Financial Models Mondays, 6:00 pm 8:50 pm Room CL1 120, Spring 2009 Professor: Office: Phone: Office Hours: Computer Lab Hours: e-mail: Course Web Site: Vladimir A. Gatchev Room BA 414 823-3694 (office and voicemail) Mon. and Wed. 2:30pm...
Date Added: 2009-06-11 23:52:30

Lecture 25a.pdf
Path: University of Illinois, Urbana Champaign >> PHYS >> 581 Spring, 2008
Description: 4 Hartree-Fock Approximation In the last Chapter we showed that the Hamiltonian for interacting electrons in a solid can be written in second quantized form as He = |h(1)| a a + 1 e2 | a a a a , | 2 |r1 - r2 | (4.1) where h(1) = p2 /2m + Vi...
Date Added: 2009-06-11 23:53:04

202sigfigs
Path: Nicholls State >> CHEM >> 105 Spring, 2009
Description: SIGNIFICANT FIGURES Glenn V. Lo Department of Physical Sciences Nicholls State University Reporting Measurements Properly reported measurements should give reader an indication of its precision (reproducibility). Precision is indicated expl...
Date Added: 2009-06-11 23:53:57

198A_Communication_WOrkshop.ppt
Path: San Jose State >> MATE >> 198 Fall, 2009
Description: Giving a Presentation so that the Audience Pays Attention Dr. Emily Allen with ideas from The Craft of Scientific Presentations by Michael Alley A mapping slide can help the audience know where the presentation is going Structure Do\'s & Don\'ts For...
Date Added: 2009-06-11 23:55:32

Note4.pdf
Path: Tulsa >> PHYS >> 4043 Fall, 2009
Description: ...
Date Added: 2009-06-11 23:55:41

Vieilla Preload Septic Shock Anesthesio 2001.pdf
Path: Neumont >> CHAP >> 6500 Fall, 2009
Description: Anesthesiology 2001; 94:400 6 2001 American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins, Inc. Early Preload Adaptation in Septic Shock? A Transesophageal Echocardiographic Study Antoine Vieillard-Baron, M.D.,* Jean-Marie Schm...
Date Added: 2009-06-11 23:57:04

124ln041701.pdf
Path: E. Michigan >> HST >> 124 Fall, 2009
Description: LECTURE #19 - April 17, 2001 WATERGATE & THE RESURGENCE OF CONSERVATISM Theme: Severely tarnished after the 60s, liberalism fell out of favor as the Republicans regained first the Presidency and then the Congress and the mood of the nation grew conse...
Date Added: 2009-06-11 23:57:06

lecture_23_sim_results.pptx
Path: Fayetteville State University >> CIS >> 5930 Fall, 2009
Description: Analysis of Simulation Results Andy Wang Click to edit Master subtitle style CIS 5930-03 Computer Systems Performance Analysis Analysis of Simulation Results Check for correctness of implementation Model verification Check for representativeness...
Date Added: 2009-06-11 23:58:15

cs230-21.ppt
Path: Western Kentucky University >> CS >> 230 Fall, 2008
Description: CS230 Chapter 6 6.2 Processing Lists of Data with Do Loops March 30, 2009 cs230 Chapter 6 VB 2005 by Schneider 1 6.2 Processing Lists of Data with Do Loops Peek Method Counters and Accumulators Flags Nested Loops cs230 Chapter 6 VB 2005 by ...
Date Added: 2009-06-11 23:59:08

hw2.doc
Path: Penn State >> CHE >> 438 Fall, 2009
Description: H.W.#2 - Enzyme Dynamics Due: Monday, Oct. 18, 2004 ChE 438 Name: _ Many of the answers to questions posed in this homework are short answer. To facilitate grading, TYPE in the answers and include this with the homework set. A space is provided aft...
Date Added: 2009-06-12 00:03:18

slides14.ppt
Path: Duke >> CPS >> 108 Fall, 2009
Description: How Java works q The java compiler takes a .java file and generates a .class file The .class file contains Java bytecodes, the assembler language for Java programs Bytecodes are executed in a JVM (java virtual machine), the valid bytecodes are s...
Date Added: 2009-06-12 00:06:03

abs_067.pdf
Path: Allan Hancock College >> MDL >> 112 Fall, 2009
Description: Etching characteristics of Na0.5K0.5NbO3 thin films in an inductively coupled plasma Chan-Min Kang, Gwan-Ha Kim, and Chang-Il Kim* School of Electrical and Electronics Engineering, Chung-Ang University, 221, Heukseuk-Dong, Dongjak-Gu, Seoul,156756, K...
Date Added: 2009-06-12 00:06:39

abs_148.pdf
Path: Allan Hancock College >> MDL >> 112 Fall, 2009
Description: Current-free electric double layers: diagnostics and applications Christine Charles Space Plasma, Power and Propulsion group, Research School of Physical Sciences and Engineering, The Australian National University, Canberra, ACT 0200, Australia A c...
Date Added: 2009-06-12 00:06:45

abs_200.pdf
Path: Allan Hancock College >> MDL >> 112 Fall, 2009
Description: Removal of Harmful Algae and Blue-Green Algae Using a Pulsed Arc Discharge in Water Chae Bog Lee1, Young Ho Na1 and Sang Sik Kim1 Han Yong Lee2 and Han Sup Uhm2 1 Plasma Technology Center, Institute for Advanced Engineering 2 Ajou university, Suwon,...
Date Added: 2009-06-12 00:07:02

ec8103-lec15.pdf
Path: Minnesota >> EC >> 8104 Fall, 2009
Description: ...
Date Added: 2009-06-12 00:07:12

hw10.pdf
Path: Penn State >> MATH >> 230 Spring, 2008
Description: MATH 230 VECTOR CALCULUS AND ANALYSIS SECTION 3 HW #9 Section 16.6 18. (3 points) Evaluate the triple integral E z dV , where E is bounded by the cylinder 2 + z 2 = 9 and the planes x = 0, y = 3x, and z = 0 in the first octant. y 32. (3 points) Expr...
Date Added: 2009-06-12 00:07:56

Kristin McNulty_Invocation.doc
Path: National Taiwan University >> ENGLISH >> 560 Fall, 2009
Description: Kristin McNulty May 24, 2007 English 560 Invocation You know, I sit here and wonder about certain things in life having to do with musician worship, things reminiscent of the way Lester Bangs describes the fan-fair, horror-show of people who indeed w...
Date Added: 2009-06-12 00:08:06

SSC handout.doc
Path: CSU Long Beach >> CECS >> 440 Fall, 2008
Description: Figure 1: Single-Cycle Computer Load PI 16 W R DA 15 BA AA A d d re s s CU 3 3 3 P ro g ra m C o u n te r R e g is te r file m o d u le re g file A d a ta 16 16 1 m ux_b 1 0 m ux_m A d d r_ o u t B d a ta 16 0 In s t r u c t io n M e m o ry In s t...
Date Added: 2009-06-12 00:08:55

02.ppt
Path: Barry >> CS >> 232 Fall, 2009
Description: CH APT ER 2 BASI C EL EM EN T S OF C+ + The Basics of a C+ Program A C+ program is a collection of one or more subprograms, called functions. Roughly speaking, a subprogram or a function (like a program) is a collection of statements and when it i...
Date Added: 2009-06-12 13:26:22

jimjasperwriting article.pdf
Path: Rutgers >> GRSTAT >> 502 Fall, 2009
Description: Chronicle of Higher Education, Career Network Tuesday, March 26, 2002 Why So Many Academics are Lousy Writers By JAMES M. JASPER When you were in elementary school you probably scored well on standardized reading tests. In high school teachers prais...
Date Added: 2009-06-12 13:27:51

calc_k.ps
Path: RIT >> PHYS >> 311 Fall, 2009
Description: %!PS-Adobe-2.0 %Title: calc_k.ps %Creator: gnuplot 4.0 patchlevel 0 %CreationDate: Fri Oct 27 14:23:52 2006 %DocumentFonts: (atend) %BoundingBox: 50 50 554 770 %Orientation: Landscape %Pages: (atend) %EndComments /gnudict 256 dict def gnudict begin /...
Date Added: 2009-06-12 13:30:00

long_term_logscale.ps
Path: RIT >> PHYS >> 311 Fall, 2009
Description: %!PS-Adobe-2.0 %Title: long_term_logscale.ps %Creator: gnuplot 4.0 patchlevel 0 %CreationDate: Fri Oct 27 14:51:40 2006 %DocumentFonts: (atend) %BoundingBox: 50 50 554 770 %Orientation: Landscape %Pages: (atend) %EndComments /gnudict 256 dict def gnu...
Date Added: 2009-06-12 13:30:00

Chapters 5 & 6.ppt
Path: Stanford >> EDUC >> 39105 Fall, 2009
Description: Chapter 5: The Modality Principle The Principle: when technical constraints are not present, use audio narrative instead of onscreen text Rationale: audio presentation with visual presentation utilizes separate cognitive channels reduce cognitive l...
Date Added: 2009-06-12 13:30:41

Newark PR-Y.pdf
Path: Stanford >> EDUC >> 39105 Fall, 2009
Description: THE NEWARK PUBLIC SCHOOLS Office of Public Information 2 Cedar Street Newark, New Jersey 07102-3091 Phone: 973-733-7338 Fax: 973-733-8053 Marion A. Bolden State District Superintendent Gregory S. King Public Information Officer William L. Librera Com...
Date Added: 2009-06-12 13:30:50

bd6.ppt
Path: Illinois State >> EAF >> 509 Fall, 2008
Description: 06/04/09 EAF 509 By Design Chapter Six 06/04/09 EAF 509 What Are Your Outcomes? You Have to Choose What to Measure and How to Measure Three Key Topics Covered in the Chapter Be familiar with different types of outcomes. Be able to distinguish achi...
Date Added: 2009-06-12 13:30:53

Wk 4 R2.pdf
Path: Washington >> ENGL >> 200 Fall, 2008
Description: Engl 200C, su 2008 M T W Th 8/11 8/12 8/13 8/14 Reading Schedule, Week 4 Robinson, Housekeeping, pp. 1-82-160; Review Cronon et. al., \"Becoming West,\" pp. 21-27 Conclude Robinson, pp. 160-219; Galehouse \"Their Own Private Idaho\" Final Paper Propos...
Date Added: 2009-06-12 13:31:29

090429_HW1.pdf
Path: BYU >> CE >> 421 Fall, 2009
Description: Brigham Young University CE 421, Spring 2009 Homework Set #1 Due Friday May 1 Dept. of Civil and Env. Eng. Instructor: Dr. Paul Richards Name _ Pick a 5 digit alias. Use numbers not letters. (10 points) Alias Problems from Course Notes (30 point...
Date Added: 2009-06-12 13:32:59

gmtk_icassp02.pdf
Path: Benjamin Franklin Institute of Technology >> ECE >> 5526 Fall, 2009
Description: THE GRAPHICAL MODELS TOOLKIT: AN OPEN SOURCE SOFTWARE SYSTEM FOR SPEECH AND TIME-SERIES PROCESSING Jeff Bilmes and Geoffrey Zweig Department of Electrical Engineering, University of Washington, Seattle WA 98195 IBM T. J. Watson Research Center, Yorkt...
Date Added: 2009-06-12 13:34:09

test3Sp-04.doc
Path: University of Louisiana at Lafayette >> CHEM >> 107 Fall, 2008
Description: CHEM 107 (Spring-2004) Exam 3 (102 pts) Name: -, SSN -LAST NAME, First (Circle the alphabet segment of your LAST NAME): A,B C-H I-M N-S T-Z Please answer the following questions: Part I: Multiple Choices (56 pts: 14 @ 4 pts each). Circle the ONE bes...
Date Added: 2009-06-12 13:35:13

hw7ans.pdf
Path: University of Illinois, Urbana Champaign >> M >> 478 Fall, 2009
Description: ...
Date Added: 2009-06-12 13:35:21

NovelChapter6.pdf
Path: UCLA >> AAS >> 119 Winter, 2006
Description: ...
Date Added: 2009-06-12 13:35:31

quiz3.ps
Path: Duke >> CPS >> 170 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: quiz3.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips quiz3 %DVIPSParameters: dpi=600...
Date Added: 2009-06-12 13:37:09

YoungE_HMS770Ass1.doc
Path: Allan Hancock College >> HMS >> 770 Fall, 2009
Description: Elisa Young HMS770 Assignment 1 Student No. 6725015 Statistical Practice 1 Due 12th April HMS: Statistical Practice 1: Assignment 1 Question 1: Table 1 details the level of measurement of each variable given along with the name of an appropriate gr...
Date Added: 2009-06-12 13:40:04

qs11.doc
Path: CSU Northridge >> ME >> 390 Fall, 2009
Description: Name: College of Engineering and Computer Science Mechanical Engineering Department Mechanical Engineering 390 Fluid Mechanics Spring 2008 Number: 11971 Instructor: Larry Caretto Solution to Quiz Eleven External Flow A hollow steel (density 7800 ...
Date Added: 2009-06-12 13:40:06

9-21-83_Mallard.pdf
Path: Wisc Stevens Point >> CNR >> 1983 Fall, 2009
Description: ...
Date Added: 2009-06-12 13:41:01

9-15-89_Thunderer_of_woods_[grouse].pdf
Path: Wisc Stevens Point >> CNR >> 1989 Fall, 2009
Description: MIKE DOMBECK grew up in the Moose Lake area, attended Hayward schools, UW-Stevens Point, University of Minnesota and Iowa State University. He has a Ph. D. in Aquatic Biology. Mike has worked as an area fishing guide, taught Zoology at UW-Stevens Poi...
Date Added: 2009-06-12 13:41:06

time1.txt
Path: Kentucky >> AS >> 220 Fall, 2009
Description: CONCEPTS OF TIME: Bishop Ussher- Earth 6,000 yrs. old (16 th century) Charles Lyell- Principles of geology: Earth very old (maybe millions of years). Recognised importance of unconformities: gaps in geologic record due to erosion. Darwin - Origin of ...
Date Added: 2009-06-12 13:41:27

table3.pdf
Path: National University of Singapore >> TAB >> 0304 Fall, 2009
Description: TABLE 3 FACULTY-LADDER RANKS-BUSINESS/MANAGEMENT/ENGINEERING* ACADEMIC YEAR Rank Assistant Professor Salary Scale Years at 10/1/02 Step Step Annual Monthly I II III IV V VI I II III IV V I II III IV V VI VII VIII IX 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 -6...
Date Added: 2009-06-12 13:41:59

titles.pdf
Path: National University of Singapore >> TAB >> 0102 Fall, 2009
Description: UNIVERSITY OF CALIFORNIA TITLE CODE INDEX 2001-02 Index limited to title codes with corresponding salary scales. TITLE CODE 0840 0841 0842 0843 0844 0845 0846 0847 0848 0849 1061 1062 1063 1064 1065 1066 1067 1100 1101 1102 1103 1106 1107 1108 1109 1...
Date Added: 2009-06-12 13:42:23

table11b-2.pdf
Path: National University of Singapore >> TAB >> 0708 Fall, 2009
Description: TABLE 11B-2 LECTURERS AND SENIOR LECTURERS WITH SECURITY OF EMPLOYMENT, WITH POTENTIAL SECURITY OF EMPLOYMENT - 100% TIME Salary Scale 10/1/06 Annual 79,632 81,708 83,520 85,140 87,132 89,532 91,608 93,612 95,532 98,028 99,960 101,976 104,460 107,076...
Date Added: 2009-06-12 13:43:14

traction.pdf
Path: Idaho >> FINAL >> 480 Fall, 2009
Description: Slippage Detection and Traction Control System May 10, 2004 Sponsors Dr. Edwin Odom U of I Mechanical Engineering Department Advisors Dr. Jim Frenzel Dr. Richard Wall Team Members Nick Carter Kellee Korpi Brian McConnel 0 Table of Contents ABSTRA...
Date Added: 2009-06-12 13:44:33

hw17.doc
Path: Rose-Hulman >> PH >> 112 Fall, 2009
Description: 21.1. (a) IDENTIFY and SET UP:Use the charge of one electron ( -1.602 10-19 C) to find the number of electrons required to produce the net charge. EXECUTE:The number of excess electrons needed to produce net charge q is q -3.20 10-9 C = = 2.00 1010 ...
Date Added: 2009-06-12 13:44:37

review2_answers.pdf
Path: Washington >> OCEAN >> 410 Fall, 2008
Description: Answers to Review Questions #2 1. In what ways is the Lost City hydrothermal field different than black smoker systems (location, fluid chemistry, etc.). What tectonic processes helped in its development? The Lost City is hosted on 2 million-year-old...
Date Added: 2009-06-12 13:45:14

ex_statistics.doc
Path: Washington >> ESS >> 522 Spring, 2008
Description: May 24 Statistics and Line Fitting Due in class on Thursday, June 1 1. The file atg1year.mat (see the April 6 exercise on convolution) contains 1 year of temperature data from the roof of ATG sampled every 5 minutes. (a) Calculate the mean (mean) and...
Date Added: 2009-06-12 13:45:19

slides.pdf
Path: UNI >> SESSION >> 061 Fall, 2009
Description: Quick Exercise Write a Sound method named amplify( int change ) that increases the volume of the sound by change units. Recall the availability of these methods of the Sound class: getSamples() getLength() getSamplingRate() getSampleValueAt( int slot...
Date Added: 2009-06-12 13:45:26

virial.ps
Path: UCSC >> CHEM >> 163 Fall, 2009
Description: %! %Title: /home/hydrogen3/faculty/gene/CLASSES/CHEM_163A/HTML/PS/virial.ps %Creator: IslandWrite for gene %CreationDate: Wed Sep 27 16:49:38 2000 %DocumentNeededResources: font Times-Bold Times-Roman Times-Italic %EndComments %BeginFont: CMMI10 %!PS...
Date Added: 2009-06-12 13:46:56

HPLUS_energy_contributions.ps
Path: UCSC >> CHEM >> 163 Fall, 2009
Description: %! %Title: /home/hydrogen3/faculty/gene/CLASSES/CHEM_163A/HTML/PS/HPLUS_energy_contributions.p s %Creator: IslandWrite for gene %CreationDate: Tue Nov 27 07:19:14 2001 %DocumentNeededResources: font Times-Roman Times-Bold %EndComments % % ISLANDWRITE...
Date Added: 2009-06-12 13:47:04

debye.pdf
Path: UCSD >> SIO >> 224 Fall, 2009
Description: SIO 224 Thermodynamics and the behavior of materials at high temperatures and pressures 1. Debye theory and \"high\" temperatures It is interesting to try to infer the mineralogical, chemical, and thermal state of the deep Earth by using available exp...
Date Added: 2009-06-12 13:48:57

astrometry_12_4.txt
Path: Caltech >> GROUP >> 20070108 Fall, 2009
Description: -13.2504 -6.68434 -13.3763 -7.0224 -12.5044 -5.97277 -12.9106 -5.88383 -12.3961 -6.06792 -12.3571 -5.76379 -12.4253 -5.87467 -12.3394 -5.97001 -12.4336 -5.97069 -12.3147 -5.85175 -12.2178 -6.28111 -12.7329 -5.71677 -12.4383 -5.90482 -12.3692 -6.04053...
Date Added: 2009-06-12 13:50:48

astrometry_13_8.txt
Path: Caltech >> GROUP >> 20070108 Fall, 2009
Description: -0.992808 -4.10026 -1.35823 -4.14231 -1.8718 -4.27489 -1.00461 -4.09059 -1.01835 -4.09768 -1.00046 -4.00249 -1.23345 -3.96301 -0.682298 -3.52263 -1.62258 -3.91388 ...
Date Added: 2009-06-12 13:51:40

astrometry_12_9.txt
Path: Caltech >> GROUP >> 20070108 Fall, 2009
Description: -11.5674 6.53293 -11.5545 6.53722 -11.5714 6.53662 -11.5653 6.52673 -11.5764 6.53018 -11.5721 6.54093 -11.5707 6.52559 -11.5702 6.52502 -11.5708 6.53177 -11.577 6.51113 -11.5659 6.52773 -11.5593 6.53134 -11.5717 6.52259 -11.5671 6.53724 -11.5558 6.51...
Date Added: 2009-06-12 13:51:57

astrometry_8_7.txt
Path: Caltech >> GROUP >> 20070108 Fall, 2009
Description: 14.9106 2.53957 14.9069 2.53512 14.9122 2.5358 14.7673 2.72943 15.2096 2.07774 15.8984 1.51108 13.7696 7.09344 14.891 3.19741 15.2449 1.91107 15.1179 1.99579 15.017 2.28027 14.9156 2.53668 14.9086 2.52933 14.9095 2.53625 14.9033 2.50194 14.9017 2.540...
Date Added: 2009-06-12 13:52:06

astrometry_8_3.txt
Path: Caltech >> GROUP >> 20070108 Fall, 2009
Description: 22.222 -6.34538 21.553 -6.14497 19.3907 -5.66291 22.9107 -6.79786 23.2702 -6.22474 20.8335 -8.5659 6.99487 -8.3929 ...
Date Added: 2009-06-12 13:53:10

astrometry_13_7.txt
Path: Caltech >> GROUP >> 20070108 Fall, 2009
Description: 13.8619 -1.54122 13.8882 -1.95914 13.9343 -1.55377 13.9295 -1.56306 13.9362 -1.56123 13.9242 -1.5573 13.9271 -1.56099 13.9446 -1.56002 13.9322 -1.55576 13.9325 -1.56192 13.9253 -1.5634 13.9296 -1.55754 13.9229 -1.56781 13.9238 -1.55699 13.9361 -1.560...
Date Added: 2009-06-12 13:53:22

solder_tube_clamp_top.pdf
Path: Oakland University >> ME >> 463 Fall, 2009
Description: ...
Date Added: 2009-06-12 13:53:40

RobertFlaherty_Bio.doc
Path: Santa Barbara City >> FILMST >> 113 Fall, 2009
Description: Robert Flaherty b. February 16, 1884, Iron Mountain, Michigan, USA d. July 23, 1951, Vermont, Montana, USA _ filmography bibliography web resources Robert Flaherty is often proclaimed one of the founding fathers of documentary film. Flaherty indirec...
Date Added: 2009-06-12 13:55:21

excred_assign.pdf
Path: S.E. Louisiana >> CSCI >> 273 Fall, 2009
Description: Name: _ CSCI 273 Extra Credit Assignment Suppose we have a data file containing information about a collection of audio recordings. The file has the following fields: Field Name RecordSize Label IDNumber Title Composer Artist Type of Data Maximum F...
Date Added: 2009-06-12 13:57:29

javacc hw.doc
Path: Goucher >> CS >> 325 Fall, 2008
Description: CS325 Javacc Homework A grammar for SIMPL: <prog> -> <iddec> \\( <varlist> \\) \ <varlist> \ <statlist> ! <varlist> -> (<iddec> )* <iddec> -> <ID> (\'bool)? <statlist> -> ( <stat> )* <stat> -> <assign> | <ifstat> | <whilestat> <assign> -> <ID> <- <ex...
Date Added: 2009-06-12 13:58:04

pillow.pdf
Path: LSU >> BUS >> 7025 Fall, 2009
Description: ...
Date Added: 2009-06-12 13:58:57

mooloomba plan-Layout1.pdf
Path: Texas Tech >> PROJECT >> 091 Spring, 2009
Description: ...
Date Added: 2009-06-12 14:00:01

MEDI.pdf
Path: Arizona >> EM >> 0102 Fall, 2009
Description: MEDICINE JOSEPH S. ALPERT, M.D., HEAD Andrea Lopez, Departmental Contact (626 2761) MEDI 800C - Research (Cancer) Drs. A.M. Lopez, F. Ahmann, D. Alberts, M. Bishop, A. Briggs, R. Dorr, T. Dragovich, S. Ebbinghaus, E. Epner, H. Garewal, L. Garland, ...
Date Added: 2009-06-12 14:03:08

J490_New_schedule_22_Sept.docx
Path: N. Illinois >> J >> 490 Fall, 2009
Description: Amended J490 Schedule distributed on 22 Sept. 2008 In the future, some lectures will be placed on: http:/www.comm.niu.edu/faculty/onajjar/ There is nothing there now, but will be, as needed. Important Test Dates: Test 1: Media Law 29 (see other detai...
Date Added: 2009-06-12 14:03:14

saturation_pressure_memo.pdf
Path: Mich Tech >> MEEM >> 3220 Fall, 2008
Description: MEMORANDUM Date: To: February 6, 2009 Engineering Students of the Michigan Tech Energy Lab From: Egil Thorolfson Morton Midfirth, Inc. Re: Water vaporization problem. To the students of MTU Energy Lab: I have learned that you recently performed a...
Date Added: 2009-06-12 14:04:55

Larman Chapter 8.ppt
Path: NJIT >> CIS >> 683 Fall, 2009
Description: From Inception to Elaboration Chapter 8 Applying UML and Patterns Craig Larman NJIT Objectives Elaboration is the initial series of iterations during which the team does the following Serious investigation Discover & stabilize major requir...
Date Added: 2009-06-12 14:06:19

Lab3.pdf
Path: Laurentian >> GEOG >> 309 Fall, 2009
Description: Geography 309 Lab 3 Page 1 Lab 3: Image Acquisition and Geometric Correction Due Date: October 17 Objectives to introduce you to digital imagery and how it can be displayed and manipulated to explore the concepts of image histograms to becom...
Date Added: 2009-06-12 14:06:47

chapter05basedOnPrev.ppt
Path: La Salle >> TEACH >> 240 Fall, 2009
Description: Chapter 5 5 Normalization of Database Tables Database Systems: Design, Implementation, and Management, Seventh Edition, Rob and Coronel Database Tables and Normalization 5 Normalization is a process for assigning attributes to entities. It reduc...
Date Added: 2009-06-12 14:07:51

WittenFrankChapter4Part7InstanceBased.ppt
Path: La Salle >> TEACH >> 658 Fall, 2009
Description: # #1C@#WittenFrankChapter4Part7InstanceBased.ppt#\\S#| #!AQQ# 8pV-! #_$?#~a 5e o/>9wOw~h @;!# YZ #| xCF#sEz0dMxGKl#_oW*=k XyKvrJ#r{e? \'#b# t~/ : y M#2f #-...
Date Added: 2009-06-12 14:08:30

mathematics.pdf
Path: UCF >> MANUAL >> 0607 Fall, 2009
Description: MATHEMATICS: Minor TRANSFER SERVICES HOTLINE (407) 823-5959 WEB SITE http:/transfer.sdes.ucf.edu 2006-2007 UNIVERSITY OF CENTRAL FLORIDA College of Sciences Department of Mathematics, MAP 207 http:/math.ucf.edu E-mail: math@mail.ucf.edu Contact: ...
Date Added: 2009-06-12 14:08:56

extra3.pdf
Path: Washington >> MATH >> 480 Fall, 2008
Description: -~- ~_._~_~_T~_~_2~.[ ~ ~(~-XL+.~) ~ -eu\'U:~ Rs p4~ ~ ~, ~ \'~b ~ nd-v0J . . ~-~21 ~ ~ ~ Q 4(1 q-CI-bj 7 :~?~ G=:) > -.o? ! 0 I 0 p;r 7t\\ a.=-.01 ~ ~V~ ~\'C eue- {+1) O.7\'j ,> (;L - J1.OVI- /lXeJ !~\\~, - 5~. . _ -_._- ...
Date Added: 2009-06-12 14:09:32

handout1.ps
Path: Cornell >> P >> 116 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: handout1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o handout1.ps handout1 %...
Date Added: 2009-06-12 14:10:13

h1.pdf
Path: Cornell >> HMWK >> 661 Fall, 2009
Description: P661 Homework # 1 Due Tuesday 9/7/04 Read Polchinski Ch 1. 8/26/04 Read Johnson Ch. 1 and earlier parts of Ch. 2. Part 1 (1) Problem 1.2 (2) For the lightest spin-2 closed string mode to be massless, what is the spacetime dimension and what is the ...
Date Added: 2009-06-12 14:10:35

h10.pdf
Path: Cornell >> HMWK >> 661 Fall, 2009
Description: P661 Homework # 1 Due Tuesday 9/7/04 Read Polchinski Ch 1. 8/26/04 Read Johnson Ch. 1 and earlier parts of Ch. 2. Part 1 (1) Problem 1.2 (2) For the lightest spin-2 closed string mode to be massless, what is the spacetime dimension and what is the ...
Date Added: 2009-06-12 14:10:38

SOFT1002L07_GUI.pdf
Path: Allan Hancock College >> SOFT >> 1002 Fall, 2009
Description: Overview SOFT1002 07: GUIs School of Information Technologies GUI concepts and history Swing classes and their use Event-handling Components and layout See Big Java chapter 10 and 12 GUI Graphical User Interface Pronounced \"gooey\" A type of User Int...
Date Added: 2009-06-12 14:11:28

eyewitnessguide.pdf
Path: Minnesota >> PSY >> 4960 Fall, 2008
Description: DE PA U.S. Department of Justice Office of Justice Programs National Institute of Justice MEN RT T OF JU S CE TI Eyewitness Evidence A Guide for Law Enforcement research report N BJ A C E I OF F IJ J O F OJJ DP B RO J US TIC E P S G OVC RA M...
Date Added: 2009-06-12 14:12:24

notes72-78.pdf
Path: UCSC >> CMPE >> 016 Fall, 2009
Description: ...
Date Added: 2009-06-12 14:12:33

454Lec11_Comb1.pdf
Path: Texas A&M >> ECEN >> 454 Fall, 2008
Description: ECEN 454 Digital Integrated Circuit Design Lecture 11 Combinational Logic I ECEN 454 Lecture 11 1 Combinational vs. Sequential Logic Out In Combinational Logic Circuit In Out Combinational Logic Circuit State Combinational Output = f(In) ECE...
Date Added: 2009-06-12 14:13:59

8815 week 6.pdf
Path: Minnesota >> PSY >> 8815 Fall, 2008
Description: Analysis of Psychological Data Topic #6: Confirmatory Factor Analysis Two types of factor analysis Exploratory: attempts to discover how many factors are present and which variables they explain, without making any prior assumptions about what\'s in...
Date Added: 2009-06-12 14:14:44

PlaceValueEq.doc
Path: Austin Peay >> MATH >> 1410 Fall, 2009
Description: Which of these expressions describe the same quantity? 340 hundreds 3,400 tens 34 ten-thousands 3 4 + 4 3 10 10 30,000 + 4,000 34 1000 34,000 3.4 10 4 3.4 10- 4 34 10 4 34 10 5 3 3 + 4 4 10 10 ...
Date Added: 2009-06-12 14:14:49

le4.pdf
Path: Minnesota >> ECON >> 4171 Fall, 2008
Description: Econ 4171: Lecture 4 The development of modern science and the \"mercantilists\" Adam Galambos 1171 Heller Hall, 625-0511, galambos@econ.umn.edu Office hours: Mo. 9:30-10:30 & Th. 9:10-10:10, and by appt. class homepage: http:/www.econ.umn.edu/galambos...
Date Added: 2009-06-12 14:15:13

lecture8-351.ppt
Path: S.F. State >> LI >> 123456 Fall, 2008
Description: Risk, returns and WACC CAPM and the capital budgeting FIN 351: lecture 8 Todays plan Review what we have learned in the last lecture CAPM and the expected return The security market line The application of CAPM in capital budgeting WACC FIN ...
Date Added: 2009-06-12 14:15:48

Lecture 17- Immunity2.ppt
Path: Sveriges lantbruksuniversitet >> BISC >> 441 Fall, 2009
Description: EVOLUTION, IMMUNITY, AND THE MHC (1) History and basics of the immune system (2) MHC, disease risk, mate choice, and reproduction (3) Trade-offs and `tuning of\' immune system (4) Evolutionary ecology of human immunity In 1796 Edward Jenner infects a...
Date Added: 2009-06-12 14:16:26

Crespi & Summers 2005.pdf
Path: Sveriges lantbruksuniversitet >> BISC >> 441 Fall, 2009
Description: Review TRENDS in Ecology and Evolution Vol.20 No.10 October 2005 Evolutionary biology of cancer Bernard Crespi1 and Kyle Summers2 1 2 Behavioural Ecology Research Group, Department of Biosciences, Simon Fraser University, Burnaby, BC, Canada, V5A...
Date Added: 2009-06-12 14:16:31

hw3.pdf
Path: Berkeley >> EE >> 140 Fall, 2009
Description: Department of Electrical Engineering and Computer Sciences EE140 Spring 2006 Prof. Subramanian Homework #3 4 problems on 1 page Due in class on Tuesday February 28th, 2006 Problem 1: Gray, Hurst, Lewis and Meyer, Q 4.5 Problem 2: Gray, Hurst, Lewis ...
Date Added: 2009-06-12 14:17:11

hw4.pdf
Path: Colorado State >> AT >> 620 Fall, 2009
Description: AT 620: Thermodynamics and Cloud Physics Problem Set #4 Due: Nov 1, 2000 Problem 1 a) Derive an expression for r and G for ice nucleation on a planar substrate. b) Using the following values: C = 1.7 1010 (J/m3 ) ns = 3.07 1028 (m-3 ) sv = 0.109 ...
Date Added: 2009-06-12 14:17:43

1012 - 2007-03 - CH07_30Q.pdf
Path: Laurentian >> MISC >> 1012 Fall, 2009
Description: Econ 1012B Practice Questions Chapter 7 1. Compounding means that changes in living standards depend A) only on the initial level of income. B) only on the accumulation of changes in income since the initial year. C) on both the initial level of inc...
Date Added: 2009-06-12 14:18:06

project_02.pdf
Path: San Diego State >> ART >> 496 Fall, 2008
Description: ...
Date Added: 2009-06-12 14:18:51

Voice_Quality_Acoustics_2.pdf
Path: UF >> SPA >> 3011 Fall, 2008
Description: SPA 3011 SPA 3011 Voice Quality and Acoustics 2 1 Introduction Amodal voice qualities (roughness, q ( g , breathiness, tremor, strain) are those which deviate from modal voicing due to Presence of aperiodic noise Presence of aperiodic Excessi...
Date Added: 2009-06-12 14:19:25

Chapter4.pdf
Path: Cardinal Stritch >> CEDO >> 515 Fall, 2009
Description: ...
Date Added: 2009-06-12 14:20:39

Peer_Review_Assignments.doc
Path: UMBC >> HIST >> 201 Fall, 2008
Description: Peer Review Assignments Be sure to post your review as a reply to your assigned peer\'s posting on the Discussion Board. Group 1 Corinne Bruins-review Deidryn Duncan\'s paper Deidryn Duncan-review Portia Walker\'s paper Portia Walker-review Corinne Buin...
Date Added: 2009-06-12 14:20:46

SCHOOL OF LAW(JJ)-final0506.doc
Path: East Los Angeles College >> UG >> 0506 Fall, 2009
Description: School of Law : Final Year Students Student Experience Questionnaire - 2005/2006 % .0% 100.0% .0% 91.0% .9% 8.1% 37.7% 62.3% 114 85.1% 14.9% 114 100.0% .0% .0% .0% .0% 92.1% 7.9% .0% 100.0% 82.5% .0% .0% 5.3% 1.8% .9% 0 6 2 1 9 0 114 114 114 94 0 0 0...
Date Added: 2009-06-12 14:22:50

assign1.rtf
Path: Kentucky >> TEL >> 201 Fall, 2008
Description: First Critical Review Assignment TEL 201-001 Spring 2008 Due Date: Tuesday, February 5 Here\'s the description of the Critical Review assignments, lifted directly from your course syllabus: Critical Reviews: You will be required to write two critical ...
Date Added: 2009-06-12 14:22:55

assign3.rtf
Path: Kentucky >> TEL >> 201 Fall, 2008
Description: TEL 201: Interactive Communications Systems Research Paper Assignment Spring 2008 Due date: Tuesday, April 22 The purpose of this paper is to engage you an in-depth research project in the field of telecommunications. As you have learned from the fir...
Date Added: 2009-06-12 14:22:56

finalH00sol.pdf
Path: Neumont >> IFT >> 1010 Fall, 2009
Description: DEPARTEMENT D\'INFORMATIQUE ET DE RECHERCHE OPERATIONNELLE SIGLE DU COURS: IFT 1010 (H2000) NOM DU PROFESSEUR: Nadia El-Mabrouk TITRE DU COURS: Programmation I EXAMEN FINAL Date : 13 avril 2000 Heure : 9:00-12:00 Salle : B-2245 { Toute documentation e...
Date Added: 2009-06-12 14:24:32

Real-Time Service (RTS) Introduction Class v0.1.ppt
Path: George Mason >> ISA >> 763 Fall, 2008
Description: RealTime Service (RTS) Introduction Barry Sweeney, Ph.D. 703-676-2282 sweeneyb@saic.com September 2007 1 Agenda Legacy Voice and Video Technologies IP RTS Technologies IP RTS Information Assurance IP RTS Quality of Service Future Techn...
Date Added: 2009-06-12 14:25:05

WP_Technology.pdf
Path: FIU >> NUTRITION >> 2030 Fall, 2009
Description: How you gather, manage and use information will determine whether you win or lose.\" -Bill Gates, Business @ the Speed of Thought INTRODUCTION Advancements in technology, specifically computerization, are spawning rapid changes throughout society (1-...
Date Added: 2009-06-12 14:25:36

lect1.pdf
Path: East Los Angeles College >> P >> 201 Fall, 2009
Description: Image Searching and Modelling Part IB Paper 8 Information Engineering Elective Lecture 1: Feature vectors and Models Zoubin Ghahramani zoubin@eng.cam.ac.uk Department of Engineering University of Cambridge Easter, 2007 http:/learning.eng.cam.ac.uk/...
Date Added: 2009-06-12 14:26:31

cribsheet.ps
Path: East Los Angeles College >> COURSE >> 201 Fall, 2009
Description: XSym 0024 e3d3929c965092865e3daad1656d9b8d ./course04/cribsheet.ps ...
Date Added: 2009-06-12 14:26:51

More Practice for the Final Exam-- Adjusting Entries.doc
Path: Cal Poly Pomona >> ACCT >> 304 Fall, 2009
Description: More Practice for the Final Exam Adjusting Entries _ 1. Accruals occur when cash flows: A) Occur before expense recognition. B) Occur after revenue or expense recognition. C) Are uncertain. D) May be substituted for goods or services. _ 2. An example...
Date Added: 2009-06-12 14:28:20

camp_deloitte_description.doc
Path: UConn >> P >> 1093 Fall, 2009
Description: Title: CAMP Deloitte- Career Action Map Program Location: New York, NY Come explore what Deloitte and a career in Public Accounting has to offer! Deloitte LLP (\"Deloitte\") is the U.S. member organization of Deloitte Touche Tohmatsu and services are ...
Date Added: 2009-06-12 14:29:23

hw7ans.pdf
Path: CSU Mont. Bay >> WEEK >> 3140 Fall, 2009
Description: Economics/Engineering 3140 Fall, 2006 Answers to assignment 7 8-1 A = $1,000; N = 10 (a) f = 6% per year; ir = 4% per year In Part (a), the $1,000 is an A$ uniform cash flow (annuity) ic = 0.04 + 0.06 + (0.04)(0.06) = 0.1024, or 10.24% per year PW(ic...
Date Added: 2009-06-12 14:31:50

NOTES1222.xls
Path: Neumont >> GEO >> 1222 Fall, 2009
Description: GEO 1222 - HIVER 2009 U de M. VERSION 16-03-09 code permanent modifi INTRA 25 12.6 12 23.5 19 14 18.8 17.5 20.3 15 22.5 14.5 24.3 18 14.5 22 6 18.6 12.5 23.4 21 20.6 19.5 19.5 15.1 23.1 10.4 19.4 11.4 13.3 23 21.4 21 14 23.3 13 17 17.1 19.5 21.8 17...
Date Added: 2009-06-12 14:32:15

Lecture_1.pdf
Path: Wisconsin >> ECE >> 352 Fall, 2008
Description: ECE/CS 352 Digital Systems Fundamentals Spring 2001 Chapter 1 Tom Kaminski C. Kime 1 Digital System Takes a set of discrete information inputs and discrete internal informati...
Date Added: 2009-06-12 14:32:36

ÎleMontréalRevenu.pdf
Path: Neumont >> GEO >> 3282 Fall, 2009
Description: ...
Date Added: 2009-06-12 14:33:48

assignment 2.pdf
Path: Allan Hancock College >> MECH >> 3300 Fall, 2009
Description: The University of Queensland School of Engineering MECH 3300 Assignment 2 Assignment 2 is due on Friday 30 May, 2003. Please submit your reports to the Materials Division office, 43-201 by 4.00pm. Make sure you append a signed cover sheet. The cover ...
Date Added: 2009-06-12 14:34:34

material_properties.pdf
Path: Iowa State >> ME >> 325 Fall, 2009
Description: As we begin the design procedure we should keep in mind manufacturing and processing concerns the part(s) have thin sections? the part(s) have thick sections? nWill the geometry be symmetric or asymmetric? nWill the part(s) be subject to fatigue? nWi...
Date Added: 2009-06-12 14:35:28

materials_processing.pdf
Path: Iowa State >> ME >> 325 Fall, 2009
Description: As we begin the design procedure we should keep in mind manufacturing and processing concerns the part(s) have thin sections? the part(s) have thick sections? nWill the geometry be symmetric or asymmetric? nWill the part(s) be subject to fatigue? nWi...
Date Added: 2009-06-12 14:35:28

BOT 06-22-04 Item 6D Attachment 3 Supplemental Charges.pdf
Path: UNF >> BOT >> 062204 Fall, 2009
Description: HOUSING OPERATIONS RENTAL RATES SCHEDULE OF SUPPLEMENTAL CHARGES 2005-2006 University of North Florida Description of Charges/Fees Amount of Fee/Charge Who Assessed Assessment Period A. Prepaid Rent $ 100.00 All Residents Collected with appli...
Date Added: 2009-06-12 14:36:11

5C_Student_Goverment_fs.pdf
Path: UNF >> BOT >> 071703 Fall, 2009
Description: Agenda item: 5C UNF Board of Trustees July 17, 2003 Issue: Revised Constitution for Student Government Approval Proposed action: Background information: At the end of the academic year, Student Government revised its constitution, which is submitte...
Date Added: 2009-06-12 14:36:48

07_item_06_fs.pdf
Path: UNF >> BOT >> 012209 Fall, 2009
Description: Item 6 UNF Board of Trustees January 22, 2009 Issue Discussions on the Proposal for the Purchase of the Museum of Contemporary Art (MOCA) Proposed Action Discussion Background Information President Delaney will discuss the current status of the pr...
Date Added: 2009-06-12 14:38:00

OS130S07_L2_optics.pdf
Path: UCSC >> OS >> 130 Fall, 2009
Description: Heat Flow Controlled by: Blackbody Radiation Angle of Incidence Tilt of the earth Hadley Cell Ferrell Cell Polar Cell 1 Review of basic Oceanography: Thermohaline Circulation 2 T-S Plots Antarctic Bottom Water (AABW) N Atlantic Deep Water...
Date Added: 2009-06-12 14:38:20

hw2005_4.pdf
Path: Virginia Tech >> CS >> 4234 Fall, 2008
Description: Homework #4 Collective Communication Due Mon., Nov. 7 2005 CS4234 (CRN 91538) Question 1 The innity norm of a matrix A nn is dened as: n A = max 1in |ai,j | j=1 This means that: (1) we rst compute the sum of absolute values of elements in ...
Date Added: 2009-06-12 14:38:50

08Serie2 2066corrige.pdf
Path: Laurentian >> COURSMATH >> 2066 Fall, 2009
Description: ...
Date Added: 2009-06-12 14:38:54

homework_4.pdf
Path: Virginia Tech >> CS >> 4234 Fall, 2008
Description: Homework #4 Collective Communication Due Mon., Nov. 7 2005 CS4234 (CRN 91538) Question 1 The innity norm of a matrix A nn is dened as: n A = max 1in |ai,j | j=1 This means that: (1) we rst compute the sum of absolute values of elements in ...
Date Added: 2009-06-12 14:39:36

Lec4_markups.pdf
Path: Saint Louis >> ECE >> 301 Fall, 2009
Description: ...
Date Added: 2009-06-12 14:41:45

17583-Examen1H2000 Corrige.pdf
Path: NSULA >> IFT >> 17583 Fall, 2009
Description: IFT-17583 Structure interne des ordinateurs Examen 1, le 18 mars 2000, de 8h30 11h20 la salle 1112 du pavillon Adrien-Pouliot. 1. Quelle est la valeur du nombre de virgule flottante IEEE de simple prcision suivant : 80000008IEEE ? Comme le signe ...
Date Added: 2009-06-12 14:42:14

SPE-L04.ppt
Path: San Jose State >> CSCE >> 963 Fall, 2009
Description: Software Process Engineering Dr. Mohamed Fayad, Associate Professor Department of Computer Science & Engineering University of Nebraska, Lincoln Ferguson Hall, P.O. Box 880115 Lincoln, NE 68588-0115 http:/www.cse.unl.edu/~fayad 1998-01 Fayad UNL ...
Date Added: 2009-06-12 14:42:23

lec16_detection probability.pdf
Path: University of Alaska Fairbanks >> WLF >> 201 Fall, 2009
Description: WLF 201 Lecture 16 - Detection Probability Next Time - Food and Cover For a census, we must assume that detection probability is 1.00. For a valid index, we must assume that detection probability is constant (index is constant proportion of truth). B...
Date Added: 2009-06-12 14:43:35

M201-L28.ppt
Path: Salisbury >> FACULTY >> 201 Fall, 2009
Description: Differentiating Logarithmic Functions DERIVATIVE OF NATURAL LOG A RELATED FORMULA CONVERTING THE BASE OF LOGS DERIVATIVE OF ARBITRARY LOG LOG DIFFERENTIATION [1] EXAMPLES [1-8] THE NUMBER e AS A LIMIT Derivative of the Natural Log y = ln x e ...
Date Added: 2009-06-12 14:43:40

R9059add1.pdf
Path: Southern Oregon >> R >> 9059 Fall, 2009
Description: UNIVERSITY OF OKLAHOMA PURCHASING DEPARTMENT 2750 VENTURE DRIVE NORMAN, OK 73069 TELEPHONE: (405) 325-2811 Request for Proposal ISSUED 08/18/08 CLOSING DATE 09/23/08 RFP NO R-9059-09 CLOSING TIME 2:00 PM CST Request for Proposal to the Board of Re...
Date Added: 2009-06-12 14:44:59

B-9146-09.pdf
Path: Southern Oregon >> B >> 9146 Fall, 2009
Description: UNIVERSITY OF OKLAHOMA PURCHASING DEPARTMENT TELEPHONE 405-325-2811 2750 VENTURE DRIVE NORMAN, OK 73069 INVITATION TO BID B-9146-09 CLOSE DATE: February 24, 2009, 2:00 PM CST Live Color Cathodoluminescence Imaging System For the University of Okla...
Date Added: 2009-06-12 14:45:13

ScientificTerms.pdf
Path: Penn State >> UNIT >> 275 Fall, 2009
Description: UNIT 1: Investigations, Measurement, and Graphing PHYSICS NOTES Predictions, Hypotheses, etc. Describes what is expected to happen in a specific situation. A Prediction is a mini-Law. (Example: When I release a rock, it will fall.) - Attempts to ...
Date Added: 2009-06-12 14:45:24

833_ds.pdf
Path: Johns Hopkins >> DOCS >> 314 Fall, 2009
Description: ...
Date Added: 2009-06-12 14:45:56

week12.pdf
Path: East Los Angeles College >> TERM >> 2525 Fall, 2009
Description: Articles From Data Mining to Knowledge Discovery in Databases Usama Fayyad, Gregory Piatetsky-Shapiro, and Padhraic Smyth s Data mining and knowledge discovery in databases have been attracting a significant amount of research, industry, and media ...
Date Added: 2009-06-12 14:45:59

lecture1_4up.pdf
Path: Portland >> CS >> 558 Winter, 2008
Description: G OALS OF THE C OURSE CS558 Programming Languages Winter 2008 Lecture 1 Learn fundamental structure of programming languages. Understand key issues in language design and implementation. Increase awareness of the range of available languages a...
Date Added: 2009-06-12 14:46:55

CAMx36k_STN_Statistics.txt
Path: UC Riverside >> MAR >> 308 Fall, 2009
Description: AllSite_AllDay SO4 NO3 NH4 OC EC TCM PM25 Fraction_Bias(%) 1.85189 16.02169 -16.77421 -81.594...
Date Added: 2009-06-12 14:47:39

Three Points 1105 Vision Statement.doc
Path: Penn State >> JDS >> 437 Fall, 2009
Description: Julie Sutsko Three Points Corporate Vision 11/05/07 In the article \"Building Your Company\'s Vision\" from the Harvard Business Review, James Collins and Jerry Porras discuss the need to separate the core ideology and policy issues. The authors espe...
Date Added: 2009-06-12 14:48:48

ho04.ps
Path: UCSC >> CMPS >> 102 Winter, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: ho04.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Courier Times-Italic %EndComments %DVIPSWebPage: (www.radicaleye...
Date Added: 2009-06-12 14:49:12

SP_2-4.14.pdf
Path: E. Kentucky >> ITTC >> 220 Fall, 2009
Description: 8/29/2005 Special Problem 2-4.14.doc 1/1 Special Problem 2-4.14 Consider a vector A, written in terms of orthonormal base vectors ^ ^ ^ a, b,c : ^ ^ A =2a -2 2 c Rewrite vector A in terms of a new set of orthonormal base vectors given in the tab...
Date Added: 2009-06-12 14:49:43

section_4C_Noise_in_Microwave_Systems.pdf
Path: E. Kentucky >> ITTC >> 220 Fall, 2009
Description: 10/18/2007 Noise in Microwave Systems 1/2 C. Noise in Microwave Systems Bad News: Even if we completely reject the image and all spurious signals, there will still be an unwanted signal that will always appear at the detector/demodulator. NOISE Q:...
Date Added: 2009-06-12 14:50:23

3rd Rev_01.pdf
Path: University of Illinois, Urbana Champaign >> ARCH >> 372 Fall, 2009
Description: SITE PLAN GROUP I BUILDING PLANS GROUP I ...
Date Added: 2009-06-12 14:50:58

Chapter 18.pdf
Path: Fort Lewis >> BA >> 301 Fall, 2009
Description: 11/27/2007 18-1 Chapter 18 Creating and Managing Change McGrawMcGraw-Hill/Irwin Management, 7/e Copyright 2007 The McGraw-Hill Companies, Inc. All rights reserved. McGraw- 1 11/27/2007 18-3 Learning Objectives After Studying Chapter 18, You...
Date Added: 2009-06-12 14:51:09

classlist.xls
Path: Calvin >> EN >> 331 Fall, 2009
Description: Name Baumann, Nichole Berrier, Lance Blanchard, Mary Brewster, Diane Herron, Jared Huff, Janyce Kermode, Kelly Plouff, Robin Posthumus, Cindi Redinger, Ryan Reges, Paul Rowe, Rebecca Rumohr-Voskuil, Gretchen Shaw, Sharri Smalligan, Thomas Sparks, Joy...
Date Added: 2009-06-12 14:51:16

hw11.pdf
Path: Texas San Antonio >> CS >> 6243 Fall, 2009
Description: Homework 11 CS 6243 Spring 2005 Tom Bylander, Instructor assigned April 21, 2005 due April 28, 2005 1. (64 pts.) k-means and EM clustering are available in Weka\'s explorer. Both of them produce measures of the goodness of the clustering. For the si...
Date Added: 2009-06-12 14:51:38

Genetic applications 2008.pdf
Path: University of Alaska Fairbanks >> WLF >> 421 Fall, 2009
Description: Genetic Applications in Wildlife Biology Evolutionary genetics Understanding species biology Taxonomic uncertainties Introgression Conservation Genetics Forensics Small populations Inbreeding Loss of genetic diversity Population structure & fragm...
Date Added: 2009-06-12 14:51:51

sm13_84.pdf
Path: UConn >> ME >> 3242 Fall, 2009
Description: PROBLEM 13.84 KNOWN: Temperatures of two large parallel plates and desired radiation heat flux between them. FIND: (a) If plate emissivities are uniform and equal, show that required emissivity is 0.5. (b) If plates are painted with checkerboard pat...
Date Added: 2009-06-12 14:52:36

sm3_113.pdf
Path: UConn >> ME >> 2233 Fall, 2008
Description: Excerpts from this work may be reproduced by instructors for distribution on a not-for-profit basis for testing or instructional purposes only to students enrolled in courses for which the textbook has been adopted. Any other reproduction or translat...
Date Added: 2009-06-12 14:52:39

test1.ps
Path: NMT >> PHYS >> 122 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: test1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o test1.ps test1 %DVIPSPara...
Date Added: 2009-06-12 14:53:27

chem312exam2solns copy.pdf
Path: UMass (Amherst) >> CHEM >> 312 Fall, 2008
Description: Chem.312.Spring2007.Exam # 2. Name: Su*6\'t\"^t Read everythingbefore doing anything. Answer all the questions. Not all the questionsare weightedequally; plan your time accordingly. Merit is attached clarity of presentation to 5 points will be deauc...
Date Added: 2009-06-12 14:55:17

lec3.ps
Path: Caltech >> CS >> 522 Fall, 2009
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02da8d32faac99b47383b5beaf78135ddac5e3ab.ps</Key><RequestId>D1 D89FA14E8FC200</RequestId><HostId>kba5UFFOJ3Vbi3NTrtKaAqaYmJZu...
Date Added: 2009-06-12 14:56:51

711 2008 Gen Intro safety.pdf
Path: Laurentian >> CHEM >> 200801 Fall, 2009
Description: 7 General Introduction - Laboratory Safety CHEMISTRY 2000 General Introduction This manual provides the necessary information for the Chemistry 2000 laboratory course. If you, at any time, have doubts as to what is required during an experimental p...
Date Added: 2009-06-12 15:00:04

HW4.pdf
Path: UCSB >> MATH >> 120 Fall, 2009
Description: MATH 120 Homework 4 due October 7, 2004 Fall 2004 1. September 28, 2004: Chapter 3.1 (1-4, 19-22, 28, 33-37) Chapter 3.2 (3-24 every 3rd, 29, 30, 43-48, 51, 54, 70) 2. September 30, 2004: 3.3 (1-4, 9, 10, 12, 14, 19-31 odd, 35, 37, 39-42, 47, 49-...
Date Added: 2009-06-12 15:03:03

IST311-Lecture-Intro-Classes-PhoneNumber.rtf
Path: Cleveland State >> IST >> 511 Fall, 2009
Description: Example-0: PUBLIC Accessability of class variables Public Class PhoneNumber \'A very simple definition of the phone class using PUBLIC class variables \'Note: PUBLIC accessability is NOT a good practice Public theAreaCode As String Public theNumber A...
Date Added: 2009-06-12 15:03:35

316_Repositioning_Crompton.pdf
Path: W. Alabama >> REC >> 316 Fall, 2009
Description: ...
Date Added: 2009-06-12 15:05:14

set13_hashing--shandout.pdf
Path: W. Alabama >> CS >> 240 Fall, 2009
Description: Outline Hash techniques Introduction Hashing Techniques Hash Functions Division Hash Functions Multiplication Hash Functions Universal Hash Functions Extendible Hashing Introduction Search Insert Delete Value-Based Sorting Counting Sort Radix Sort Bu...
Date Added: 2009-06-12 15:05:51

climthm.pdf
Path: Stanford >> POLISCI >> 100 Fall, 2009
Description: Political Science 100a/200a Fall 2001 The central limit theorem and the law of large numbers1 1 Estimating a population statistic from a sample statistic Question 1: You want to predict the outcome of an upcoming presidential election, but you lac...
Date Added: 2009-06-12 15:06:30

2006-smr-106-bauer.pdf
Path: Berkeley >> UGBA >> 106 Fall, 2008
Description: ...
Date Added: 2009-06-12 15:07:56

2002-spr-123-stanton2.pdf
Path: Berkeley >> UGBA >> 102 Fall, 2009
Description: ...
Date Added: 2009-06-12 15:08:30

ar08-1118.pdf
Path: Moorpark College >> COA >> 20090422 Fall, 2009
Description: NOT DESIGNATED FOR PUBLICATION ARKANSAS COURT OF APPEALS DIVISION II No. CACR08-1118 Opinion Delivered April 22, 2009 RICHARD DONNELL GEORGE APPELLANT V. STATE OF ARKANSAS APPELLEE APPEAL FROM THE MILLER COUNTY CIRCUIT COURT [NO. CR-99-31-1] HONO...
Date Added: 2009-06-12 15:10:02

Diary of Lt.doc
Path: CSU Sacramento >> EDTE >> 305 Fall, 2009
Description: Diary of Lt. John Barker, A British Soldier: Last night 600 men crossed to the other shore of Cambridge marsh. It was between 10 and 11 o\'clock. The leaders of these men were Lt. Col. Smith and Major Pitcairn. Only the leaders and ...
Date Added: 2009-06-12 15:12:27

OCD_FC_ExitCriteria_IIVVb_F08a_T14_V3.0.doc
Path: USC >> CSCI >> 577 Fall, 2009
Description: Exit criteria for OCD 1. All sections of the OCD document mentioned below must be present. a. Project name, Team number, Team members and roles. b. Date at the bottom right of first page. c. Version history Date, Author, Version, Changes made and Ra...
Date Added: 2009-06-12 15:14:51

SSAD_FCPackage_Evaluation_IIVVb_F08a_T14_V3.0.doc
Path: USC >> CSCI >> 577 Fall, 2009
Description: Evaluation Report for SSAD 1. Management Overview The document shows 27 use-case processes for the system. Text description of each process has also been included for clarity. 2. Technical Details The system has the below six key Software component...
Date Added: 2009-06-12 15:14:56

wbChpt13.pdf
Path: Maryville MO >> STAT >> 3500 Fall, 2009
Description: ...
Date Added: 2009-06-12 15:15:21

APA Pres Task F 06.pdf
Path: U. Houston >> EPSY >> 8334 Fall, 2008
Description: Evidence-Based Practice in Psychology APA Presidential Task Force on Evidence-Based Practice The evidence-based practice movement has become an important feature of health care systems and health care policy. Within this context, the APA 2005 Presid...
Date Added: 2009-06-12 15:15:42

P211 Aggression.pdf
Path: California PA >> P >> 211 Fall, 2009
Description: Aggression:Hurting Others 12/1/2004 Aggression.ppt 1 What We Will Cover in This Section Quiz Introduction Biological approaches. Learning approaches. Cognitive approaches 12/1/2004 Aggression.ppt 2 Which of the following is AGGRESSIVE BEHAV...
Date Added: 2009-06-12 15:16:12

T07-Horizontal.pdf
Path: Western Kentucky University >> CS >> 325 Fall, 2008
Description: Table 7.4 Intel 8237A Registers Bit D0 D1 D2 D3 D4 D5 D6 D7 Command Memory-to-memory E/D Channel 0 address hold E/D Controller E/D Normal/compressed timing Fixed/rotating priority Late/extended write selection DREQ sense active high/low DACK sense ac...
Date Added: 2009-06-12 15:17:31

f08.pdf
Path: Western Kentucky University >> CS >> 325 Fall, 2008
Description: (a) A 1 1 B (b) A 1 1 1 0 B 0 0 1 0 1 (c) A 1 0 C 1 1 0 C B 0 0 (d) A 1 0 C 1 1 0 C B 0 0 Figure 5.8 Hamming Error-Correcting Code ...
Date Added: 2009-06-12 15:17:48

lecture02.pdf
Path: Bucknell >> CS >> 363 Spring, 2009
Description: Statistical Multiplexing queue switch Network Architecture and Performance 1/20/2006 CSCI 363 Computer Networks 1 Each flow is broken into packets and sent to a switch, which can deal with the arriving packets according to a policy (FIFO, round-ro...
Date Added: 2009-06-12 15:19:19

Chapter1.pdf
Path: Valdosta >> M >> 2620 Fall, 2009
Description: Chapter 1 Introduction to Statistics This chapter introduces the basic ideas and terminology of statistics. 1.1 Basic Definitions, Part 1 I. Statistic and Statistics A. The Basic Idea \"Use data to learn something about our world.\" In statistics, w...
Date Added: 2009-06-12 15:19:51

Pics.doc
Path: RIT >> P >> 02027 Fall, 2009
Description: Miscellaneous Pictures This is a picture of the Instron fatigue tester used by the team to perform all of our testing. Pictured here are the hydraulic grippers. New grippers (top and bottom clevises) were manufactured specifically for use with this ...
Date Added: 2009-06-12 15:20:57

MD2004_04032.doc
Path: RIT >> P >> 04032 Fall, 2009
Description: RIT Proceedings of KGCOE-MD2004: Multi-Disciplinary Engineering Design Conference Kate Gleason College of Engineering Rochester Institute of Technology Rochester New York May, 2004 MD2004-04032 SOFC DURABILITY TEST STAND DESIGN CHALLENGES AND PROC...
Date Added: 2009-06-12 15:21:18

jdb_520.pdf
Path: UNC Charlotte >> COE >> 6141 Fall, 2009
Description: Test #2 November 6, 2001 CEGR 6141/ 2001 Water Quality Modeling open book and notes, show all calculations for partial credit due Thursday, November 8, 2001, in class Problem 1 (50 points) Sediment Dynamics Two rivers discharge into a lake. The...
Date Added: 2009-06-12 15:21:30

Micro_Turbine_III_PDR.doc
Path: RIT >> P >> 05002 Fall, 2009
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>02dd04b56bc70b9ef8f5678d923470e56745ef5b.doc</Key><RequestId>F DEAFA0192976766</RequestId><HostId>kLFIeakbKI0U3aMqyA8RDZVdJ+t...
Date Added: 2009-06-12 15:21:36

shock tube table1.xlsx
Path: Purdue >> AAE >> 334 Fall, 2009
Description: gamma 1.4 a1=a4 gamma 1=gamma 4 gamma +1 2.4 gamma -1 0.4 Ms 1 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.1 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.2 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.3 1.31 1.32 1.33 1.34 1.35 1.36 1.37 1.38...
Date Added: 2009-06-12 15:24:18

Lecture 20.ppt
Path: Wesleyan >> CHEM >> 388 Spring, 2009
Description: Estimation of the Free Energy From Molecular Mechanics Simulations Chem 388: Molecular Dynamics and Molecular Modeling Overview Molecular Dynamics simulations Classical Statistical Thermodynamics Methods to Compute Free Energies Results from so...
Date Added: 2009-06-12 15:24:36

assignment#9.doc
Path: CSU Northridge >> GME >> 32619 Fall, 2009
Description: (1) Introduction to Databases: A database is a collection of information organized so that a computer program can quickly retrieve desired pieces of data. A field is a single piece of information; a record is one complete set of fields; and a table i...
Date Added: 2009-06-12 15:24:59

sumdiffconst_soln.pdf
Path: Oregon >> MATH >> 241 Fall, 2008
Description: ...
Date Added: 2009-06-12 15:25:03

8.ps
Path: Caltech >> CS >> 181 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips 5.519 Copyright 1986, 1993 Radical Eye Software %Title: 8.dvi %CreationDate: Thu Oct 30 04:07:56 1997 %Pages: 25 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips 8 %DVIPSSource: TeX out...
Date Added: 2009-06-12 15:26:24

middist.txt
Path: FIU >> COP >> 3530 Fall, 2008
Description: MIDTERM GRADE DISTRIBUTION HI 200 AVG 152 MEAN 152 180+ 5 160-179 3 140-159 7 120-139 4 <120 3 ...
Date Added: 2009-06-12 17:04:08

M03.txt
Path: NJIT >> IT >> 202 Fall, 2009
Description: <html><head> </head> <?php $v = $_GET[\"x\"]; for ( $k = 0; $k < 10; $k+ ) { print \"<div>\"; print \"k is: $k \" ; print \": $v \" ; print \"</div>\"; } /show_source(\"M03.php\"); ?> </body> </html>...
Date Added: 2009-06-12 17:08:50

Chapter 9.ppt
Path: UNC Charlotte >> BIOL >> 3222 Fall, 2008
Description: Chapter 9 Water in Plants Molecular Movement Diffusion Def: m ove e of a substancefroma re m nt gion of hig2h conce ntration to a re gion of low conce ntration C once ntration gradie m e nts ust xist Move e is randomm cular m m nt ole ove e m nt...
Date Added: 2009-06-12 17:09:04

ECE531_07S_hw4.pdf
Path: Illinois Tech >> ECE >> 531 Fall, 2009
Description: ECE 531 LINEAR SYSTEM THEORY HOMEWORK ASSIGNMENT #4 Due: 28 March 2007 SPRING 2007 1. The spring-mass system in the gure below is described by the equations 0 0 1 0 0 x1 (t) 0 x1 (t) 0 0 1 x2 (t) x2 (t) 0 k1 b1 b1 x1 (t) ...
Date Added: 2009-06-12 17:10:45

lect1_web.pdf
Path: Colby >> CH >> 141 Fall, 2009
Description: Chapter One Chemistry and Measurement What Is Chemistry? The study of the composition, structure, properties of matter and energy, and the changes that matter undergoes What Is Matter? Matter is anything that occupies space and has mass What Is ...
Date Added: 2009-06-12 17:13:06

02.pdf
Path: Allan Hancock College >> COMP >> 3062 Fall, 2009
Description: 3Q QQQTC TTQaCQagfQ QQQTjC T g e ` d a @ P C a E S d c C @ H b a ` Y E @ X W U T E S R H @ P H B @ F E C B @ 84 8 7 6 4 1 ) \' \" $ \" VfVD3GQI#DQQQVVIVVQDVVGG#QDQQI3GDD3A059305353320(#&%#! ...
Date Added: 2009-06-12 17:16:36

popper2 and 3.pdf
Path: U. Houston >> MATH >> 1310 Fall, 2008
Description: ...
Date Added: 2009-06-12 17:16:44

proj2.ps
Path: Ill. Chicago >> PROJECT >> 471 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: proj2.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o proj2.ps proj2.dvi %DVIPS...
Date Added: 2009-06-12 17:17:39

tas_50m_state_machines.pdf
Path: Oregon State >> ECE >> 474 Fall, 2008
Description: ...
Date Added: 2009-06-12 17:18:48

04NestedClasses.pdf
Path: University of Louisiana at Lafayette >> CACS >> 360 Fall, 2009
Description: Nested Classes (11.21.04) Nested Classes 2 Nested Classes classes can be top-level (the usual ones) or nested nested classes are classes created inside of another class nested classes are static classes or inner classes inner classes are member...
Date Added: 2009-06-12 17:19:31

lecture9.pdf
Path: UPR Mayagüez >> FISI >> 3171 Fall, 2009
Description: Linear Momentum and Collisions Linear momentum is defined as: p = mv Momentum is given by mass times velocity. Momentum is a vector. The units of momentum are (no special unit): [p] = kgm/s Since p is a vector, we can also consider the components of...
Date Added: 2009-06-12 17:20:28

Act.03.18_web.pdf
Path: LSU >> PHYS >> 2102 Spring, 2007
Description: Physics 2102 Section 6 Christian Buth Activity 9, March 18, 2009 The figure shows four wire loops, with edge lengths of either L or 2L. All four loops will move through a region of uniform magnetic field B (directed out of the page) at the same co...
Date Added: 2009-06-12 17:21:50

MGMT 050 Homework 3.pdf
Path: Solano Community College >> MGMT >> 050 Fall, 2008
Description: MGMT 050 Principles of Management Homework Assignment #3 October 21, 2008 Due: October 28, 2008 50 points Use additional paper as needed. Name_ A. Equal Employment Opportunity (10 points) Tell which EEO law(s) would protect each of the following jo...
Date Added: 2009-06-12 17:23:14

quiz04.pdf
Path: USC >> MATH >> 218 Spring, 2000
Description: MATH 218 QUIZ #4 02/10/05 Mathias Knape Last Name: _ First Name: _ Discussion Time (circle one) 11am 12pm 1pm Note: In order to get all the points, please show all your work. 2. Let X denote the number of movie rentals per household in a week an...
Date Added: 2009-06-12 17:23:31

kulikd036.pdf
Path: Texas >> KULIKD >> 036 Fall, 2009
Description: Copyright by Dmitri Kulik 2003 The Dissertation Committee for Dmitri Kulik certifies that this is the approved version of the following dissertation: STUDIES OF OPTICAL PROPERTIES OF SINGLE CdS NANORODS Committee: C. K. Shih, Supervisor J. W. Ket...
Date Added: 2009-06-12 17:24:21

lab1.docx
Path: Solano Community College >> CIS >> 800 Fall, 2009
Description: Earl T. Wylie CIS 1 TTh 8:00 1/22/2009 Lab 1 1. Root of Chip 2. First name 3. Middle Name 4. Last name 5. System 32 ...
Date Added: 2009-06-12 17:24:28

greenwellkf039.pdf
Path: Texas >> GREENWELLK >> 039 Fall, 2009
Description: Copyright by Karen Fern Greenwell 2003 The Dissertation Committee for Karen Fern Greenwell certifies that that this is the approved version of the following dissertation: THE EFFECTS OF CHILD WELFARE REFORM ON LEVELS OF CHILD ABANDONMENT AND DEINST...
Date Added: 2009-06-12 17:25:00

lecture11.pdf
Path: UC Riverside >> CS >> 153 Spring, 2008
Description: Threads (4) and Concurrency: Mutual Exclusion and Synchronization (1) Lecture 11 Solaris: user-level thread execution usern n Transitions among these states is under the exclusive control of the application u a transition can occur only when a cal...
Date Added: 2009-06-12 17:27:31

131SecH,I.pdf
Path: Washington University in St. Louis >> MATH >> 131 Spring, 2006
Description: ...
Date Added: 2009-06-12 17:28:14

prim.pdf
Path: University of San Francisco >> CS >> 245 Fall, 2008
Description: / Prim\'s algorithm d[v0] = 0; marked[v0] = true; for each vertex v != v0 do { marked[v0] = false; p[v] = v0; if (v is adjacent to v0) d[v] = length of edge v0 -> v; else d[v] = infinity; } for (i = 0; i < n-1; i+) { min_w = first unmarked vertex; min...
Date Added: 2009-06-12 17:29:09

Diaz2003USP6512494pp28.pdf
Path: E. Kentucky >> EECS >> 501 Fall, 2009
Description: ...
Date Added: 2009-06-12 17:29:30

notes25 2317.pdf
Path: U. Houston >> ECE >> 2317 Fall, 2008
Description: ECE 2317 Applied Electricity and Magnetism Spring 2009 Prof. D. Wilton ECE Dept. Notes 25 Notes prepared by the EM group, University of Houston. Magnetic Field N r v q S Lorentz Force Law: F = qv B This experimental law defines the magnetic fl...
Date Added: 2009-06-12 17:29:41

chapter 5 measurement.ppt
Path: University of Baltimore >> HOME >> 632 Fall, 2009
Description: Chapter 5: Developing a Measurement Strategy Scales of Measurement Reliability and Validity Modalities of Measurement Locating and Evaluating Measures 1 Reliability & Validity Why is reliability important? Theory can\'t do without it Construc...
Date Added: 2009-06-12 17:29:58

values-and-weights.pdf
Path: Charleston Law >> MA >> 536 Fall, 2009
Description: Finding Value Functions This note describes methods of finding, approximately, a DMs value function for a criterion. Recall that, for i = 1, 2, ., n, the consequence of alternative Ai on criterion Qj is cji. A value function for criterion Qj is a fun...
Date Added: 2009-06-12 17:31:54

hw1_histo.pdf
Path: Maryland >> PHYS >> 122 Fall, 2007
Description: scores for HW1 number of students with that score 9 8 7 6 5 4 3 2 1 0 0.2 0.4 0.6 0.8 hw1 Entries 60 Mean 0.7167 RMS 0.1957 1 1.2 your score/23 ...
Date Added: 2009-06-12 17:32:01

syllabus.ps
Path: Rutgers >> MATH >> 250 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: syllabus.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMBX10 CMSL10 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandL...
Date Added: 2009-06-12 17:33:23

09_26_08.ppt
Path: Colby >> PS >> 111 Fall, 2009
Description: INTERACTION OF CELLS CODE COLOR, ALSO. Brightness Contrast Central squares reflect same amount of light. The darker the surround, the lighter they look. Implies interaction in connections between neighboring cells: some signals boosted, some signa...
Date Added: 2009-06-12 17:34:53

class-09_2004.pdf
Path: Maryville MO >> OCG >> 501 Fall, 2009
Description: Class 9 12 October 2004 180 The Rossby Number (advection vs Coriolis) Now we would like to evaluate the importance of rotation; in particular the importance of the Coriolis term to the advection terms. For the Reynolds Number Horizontal and ver...
Date Added: 2009-06-12 17:34:53

presentation_2.pdf
Path: UPenn >> MATH >> 170 Fall, 2008
Description: 1 John von Neumann The goal of the presentation is to discuss John von Neumann. Your presentation should include at least A discussion of his role in the development of the atomic bomb. A discussion of his contributions to economics A discussion ...
Date Added: 2009-06-12 17:37:24

2320Lecture10.ppt
Path: Laurentian >> PSYC >> 2320 Fall, 2009
Description: First a bit about your test Mean 74.5% Range - \"unfortunately low\" to 15/15 Some problem questions Telephones use a compressed signal from which the high and low frequency components of speech are omitted. Why might this make it hard to understand ...
Date Added: 2009-06-12 17:37:58

QMB10 01.ppt
Path: Pima CC >> MGMT >> 0250 Fall, 2009
Description: Slide 1 Chapter 1 Introduction s s s s s s Body of Knowledge Problem Solving and Decision Making Quantitative Analysis and Decision Making Quantitative Analysis Models of Cost, Revenue, and Profit Management Science Techniques ...
Date Added: 2009-06-12 17:38:01

2006Spring Exer-12.pdf
Path: CSU Long Beach >> SOC >> 100 Fall, 2009
Description: Soc.100 / Hicks Marlowe Discussion Exercise #12 Race and Ethnicity (Chap. 12) Note Taker: Group Mem bers: (5 pts.each) 1. Identify the main idea(s) of the following terms: (Provide examples where possible) (a) race versus ethnicity (and the difficu...
Date Added: 2009-06-12 17:38:28

hw2part1.pdf
Path: RPI >> ECSE >> 6400 Fall, 2009
Description: II: 04 :n\'A:u:. VAKJAUU:! IU:!t\'KBSBNTATION OF SYSTEMS Ul PROBLEMS 65 I I\" !\". I I \" Y2 U2 1 , ~ , 1 J I FIG. P2.2 (Continued) 2.3 Draw the simulation diagram for the followingdifferential equations: (a) y+kj+(~+Ecost)y=U (b) y+ry+5y=u ...
Date Added: 2009-06-12 17:39:15

hw5.pdf
Path: Bethel VA >> MATH >> 20091 Fall, 2009
Description: Math 444/544 Homework 5, due Monday 20 October. 1. (15 points) Section 3.1 problem 6c. 2. (15 points) Section 3.1 problem 8c. 3. (15 points) Section 3.1 problem 10c. Fall 2008 4. (20 points) Do this problem as a Good Problem, paying attention to th...
Date Added: 2009-06-12 17:41:01

Lecture10.4up.pdf
Path: Wisconsin >> CS >> 701 Fall, 2008
Description: Reading Assignment Adding Saves & Restores Wall designed his save-free interprocedural allocator for a machine with 52 registers. Most computers have far fewer registers, and hence saving and restoring across calls, when profitable, should be allow...
Date Added: 2009-06-12 17:42:38

LimitLawExamples.pdf
Path: ASU >> MAT >> 270 Fall, 2009
Description: Limit Laws Examples 1. lim(sin x + cos x ) = limsin x + limcos x = x 6 x 6 x 6 1 3 + 2 2 1 1 1 2. lim - x 2 = lim -lim x 2 = - 4 = -3.5 x2 x 2 x x x 2 2 3. lim h 0 f ( a + h) - f (a ) 1 f ( a + h) - f ( a) 1 = lim = (slope of the tangen...
Date Added: 2009-06-12 17:43:36

out-of-plane_displacement.pdf
Path: Washington >> MENGR >> 568 Fall, 2009
Description: International Journal of Solids and Structures 38 (2001) 33773391 www.elsevier.com/locate/ijsolstr Analysis of out-of-plane displacement and stress eld in a piezocomposite plate with functionally graded microstructure Abdulhakim Almajid, Minoru Tay...
Date Added: 2009-06-12 17:45:38

AppendixC1.Weed and Seed area.doc
Path: Cal Poly Pomona >> EVALUATION >> 550 Fall, 2009
Description: Appendix C. 1 Weed and Seed Target Area: ...
Date Added: 2009-06-12 17:46:07

M2224-notes6.pdf
Path: Allan Hancock College >> M >> 2224 Fall, 2009
Description: The University of Western Australia SCHOOL OF MATHEMATICS AND STATISTICS MATH2224 Operations Research 2008 Notes on Simplex Algorithm 4 minimize z such that -2x1 + x2 -x1 + x2 x2 x 1 , x2 = x1 - 2x2 1 2 4 0 minimize z such that -2x1 + x2 + s1 ...
Date Added: 2009-06-12 17:46:13

1.5finalproject.doc
Path: Michigan State University >> WEB >> 0007 Fall, 2009
Description: Final Project Topic: 0007C Women in Agriculture and Natural Resources After learning about these inspiring women list some of the qualities that you think these women had in common. Then find a woman in your area who you believe to be an inspiration ...
Date Added: 2009-06-12 17:46:46

activity0007a-c.pdf
Path: Michigan State University >> WEB >> 0007 Fall, 2009
Description: ACTIVITY: 0007A - C LEGISLATION CHANGES ? Determine if a farmer may spread manure on his land in light of the new phosphorus legislation. ? Invite the county Soil Conservation director to speak to the class about changes in the past decade. ...
Date Added: 2009-06-12 17:46:55

evaluacion2.pdf
Path: UNC >> SPAN >> 344 Fall, 2008
Description: Pas/Regin: _ Evaluacin de _ En una escala de 0 (no ha hecho nada) a 10 (la perfeccin), indica la calidad y cantidad del trabajo del equipo y de sus miembros. _ La calidad del contenido del proyecto _ La calidad de la presentacin del proyecto _ La cal...
Date Added: 2009-06-12 17:48:01

22.Limits,Futures.War or Politics as a Solution to Terrorism.doc
Path: UMBC >> POLS >> 311 Fall, 2009
Description: Agenda: April 6, 2009 Winning the conflict with Militant Jihadism: Do we need to \"re-brand\" the GWOT? I. Introductory Functions New Quiz, Quizzes returned Term papers due April 8 Other Current Events comments/questions. II. Discussion of de Wi...
Date Added: 2009-06-12 17:48:32

systems27.doc
Path: Baylor >> ACC >> 4502 Fall, 2009
Description: ACC 4502 TEACHING PLAN Fall 2000 Systems 27 TODAY\'S TOPICS 1. Electronic Commerce CONTENT OBJECTIVES 1. 2. Identify and explain the benefits and risks associated with Electronic Commerce Identify and explain the controls available to mitigate risks...
Date Added: 2009-06-12 17:48:34

Section 6 - Design and Implementation Techniques.doc
Path: DePaul >> IS >> 375 Fall, 2009
Description: Section 6 - Design and Implementation Techniques Reposted with permission from the original author Ezequiel Cuellar of CrossLogic Corporation http:/www.crosslogic.com Section 6 - Design and Implementation Techniques. Use Case Realizations. A use-cas...
Date Added: 2009-06-12 17:48:54

Section 6 - Design and Implementation Techniques.doc
Path: DePaul >> SE >> 430 Fall, 2009
Description: Section 6 - Design and Implementation Techniques Reposted with permission from the original author Ezequiel Cuellar of CrossLogic Corporation http:/www.crosslogic.com Section 6 - Design and Implementation Techniques. Use Case Realizations. A use-cas...
Date Added: 2009-06-12 17:48:55

Long essay Question-final spr 2008.doc
Path: Lynchburg College >> COMM >> 341 Fall, 2009
Description: COMM 341 - Midterm Long essay Question: (20 pts) The following essay question is to hand in class when you take the exam. Please type your answer on one page single-spaced to hand in when you take the exam on Thursday. Please attach this sheet to you...
Date Added: 2009-06-12 17:49:46

hw7.pdf
Path: Penn State >> MATH >> 557 Fall, 2008
Description: Math 557 Homework # 7 Due: Friday, 12-14-07 1. Determine whether each of the following theories is complete. Justify your answers, but you do not need to give a full proof. (a) The theory of dense linear orders with endpoints (b) The theory of infini...
Date Added: 2009-06-12 17:51:04

Timbre.ppt
Path: Rochester >> PHY >> 103 Fall, 2009
Description: On Timbre Phy103 Physics of Music Four complex tones in which all partials have been removed by filtering (Butler Example 2.5) One is a French horn, one is a violin, one is a pure sine, one is a piano (but out of order) It\'s hard but not impossibl...
Date Added: 2009-06-12 17:51:37

hw2.pdf
Path: Penn State >> MATH >> 457 Spring, 2008
Description: Math 457 Homework # 2 Due: Friday, 1-27-06 1. Put the following formula in Disjunctive Normal Form: (P (Q R) 2. Define a new binary connective with the truth table: G T T F F H T F T F (G H) F F F T Show that any propositional formula is logical...
Date Added: 2009-06-12 17:51:46

Lab3-API Correction to 60 F.pdf
Path: Iowa State >> ME >> 449 Fall, 2009
Description: ...
Date Added: 2009-06-12 17:52:32

cheatsheet.pdf
Path: Duke >> X >> 006 Fall, 2009
Description: Throughout this test, assume that the following classes and methods are available. These classes are taken directly from the material used in class. There should be no methods you have never seen before here. Point public class Point { / coordinates...
Date Added: 2009-06-12 17:52:38

practice-2-key.pdf
Path: Benjamin Franklin Institute of Technology >> CSE >> 1503 Fall, 2009
Description: Mid-Term 2 Practice Answer Key page 1 / 14 1. Write the Fortran code that performs the following actions: Note: For this question, your code does not need to follow the Style Guide. must be legal Fortran code. (a) [xx points] a user-dened function...
Date Added: 2009-06-12 17:52:54

SAMA_TRACKING.ppt
Path: CUNY Queens >> DB >> 841 Fall, 2009
Description: SAMA DE BOUCLE EN CASCADE TRACKING FIG. 1 PT 101 VACUATION PIC 101 BOUILLOIRE 50% VAPEUR 50% 50% FIC 101 LT 101 BRULEUR I/P 50% FT 101 50% FY 101 AIR/FUEL X= 1.2 LIC 101 I/P I/P FUEL 60% FIC 102 FT 102 50% EAU 60% AIR Modes dopration ...
Date Added: 2009-06-12 17:53:50

lecture8quad.pdf
Path: USC >> CSCI >> 460 Fall, 2008
Description: Artificial Intelligence Encoding Planning Problems Nilsson - Chapter 22 Russell and Norvig - Chapter 11 initial state you are at home and don\'t have milk, bananas, and a drill goal state you are at home and have milk, bananas, and a drill this start...
Date Added: 2009-06-12 17:55:57

HipHM.pdf
Path: UF >> EIN >> 4333 Fall, 2009
Description: ...
Date Added: 2009-06-12 17:56:04

Exam1S08key_spring.pdf
Path: University of Illinois, Urbana Champaign >> STAT >> 100 Fall, 2008
Description: ...
Date Added: 2009-06-12 17:57:17

Spring 2009 Schedule.pdf
Path: Texas >> HT >> 376 Fall, 2009
Description: Regi ra ion h p :/u direc .u exa .edu/regi ra ion/regi ra ion.WBX? _ccyy =2 . UT Direct - The University of Texas at Austin Registration for Spring 2009 NAVIGATION MENU Home Course Schedule My Tuition Bill RIS page See My Waitlists Registration Dir...
Date Added: 2009-06-12 17:57:35

Chapter 27.pdf
Path: Chester >> PHY >> 180 Fall, 2009
Description: Reading Questions Kirchhoff\'s loop rule states that the algebraic sum of the changes in potential encountered in a complete traversal of any loop of a circuit (a) must be zero (b) must be positive. (c) must be negative. (d) This was not in the readin...
Date Added: 2009-06-12 17:58:04

PHY170_Assignment_06_Soln.pdf
Path: Chester >> PHY >> 170 Fall, 2008
Description: ...
Date Added: 2009-06-12 17:58:45

Math116Quiz1.pdf
Path: UConn >> MATH >> 116 Fall, 2009
Description: Name Date Math 116Q-08: Quiz #1 5 5 (5 pts.) 1. If 2 (2f (x) + 3) dx = 17, find 2 f (x) dx. Solution: 5 5 5 5 17 = 2 (2f (x) + 3) dx = 2 2 5 f (x) dx + 2 3 dx = 2 2 f (x) dx + 3x 5 2 17 = 2 2 5 f (x) dx + (15 - 6) 17 - (15 - 6) =4 2 ...
Date Added: 2009-06-12 17:59:03

5302_04.pdf
Path: NYU >> ED >> 2175 Fall, 2009
Description: Engaging By Design: How Engagement Strategies in Popular Computer and Video Games Can Inform Instructional Design Michele D. Dickey Computer and video games are a prevalent form of entertainment in which the purpose of the design is to engage players...
Date Added: 2009-06-12 17:59:27

Binary Trees.ppt
Path: JMU >> CS >> 240 Fall, 2008
Description: The Mystery Vault Game Played by radio stations A listener can win up to $25,000 if he/she guesses the correct amount in the vault One guess per hour until somebody wins Let\'s play! Binary Trees What are they? A tree such that no node has more...
Date Added: 2009-06-12 17:59:48

lec9.pdf
Path: Purdue >> MA >> 694 Fall, 2008
Description: LECTURE 9 9. Normalized Solutions, Rescalings, and Blowups 9.1. Local and globals solutions. The further analysis of the free boundary is based on so-called blowup approach. Since the regularity of the free boundary is a local question, we may restr...
Date Added: 2009-06-12 17:59:49

Oct8.pdf
Path: Acton School of Business >> CHEM >> 151 Fall, 2008
Description: Reading: Friday 6.6-6.7 Monday ? Wednesday Ch4-Ch6 Friday (Oct. 17) Exam one 8.5 x 11 sheet handwritten review Balancing Oxidation-Reduction Reactions 1. Write two half reactions2. Balance atoms (except H, O) on both sides 3. Balance Oxygen by addin...
Date Added: 2009-06-12 17:59:59

inclass6.ppt
Path: SMU - Cox School of Business >> SE >> 7300 Fall, 2009
Description: In-Class Assignment #6: Axioms of Probability Solve the following problems from Montgomery and Runger in class with your team 1. 2-52 2. 2-58 3. 2-72 ...
Date Added: 2009-06-12 18:02:09

Table152.xls
Path: Cornell >> ERS >> 86003 Fall, 2009
Description: FILE: WrldChickpeaProd.xls Revised: 09/10/07 Table 152-World chickpea production: 1990-2005 COUNTRY 1990 1991 1992 1993 1994 1995 1996 1997 1,000 metric tons World India Pakistan Turkey Iran, Islamic Rep of Ethiopia Myanmar Mexico Australia Canada ...
Date Added: 2009-06-12 18:03:29

Table22.xls
Path: Cornell >> ERS >> 89029 Fall, 2009
Description: Table 22-U.S. fresh watermelon: Export volume, by country, 1978-2007 Trading Partner : 1978 0.0 0.0 0.0 21.6 0.0 0.0 231.7 78,506.6 0.0 0.0 0.0 0.0 0.0 33.9 0.0 0.0 74.2 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 60.0 0.0 0.0 267.0 0.0 0.0 0.0 0.0 0.0 0.0 644.4...
Date Added: 2009-06-12 18:03:34

Table059.xls
Path: Cornell >> ERS >> 92010 Fall, 2009
Description: Table 59-Texas fresh tomatoes: Acreage, yield, production, and value, 1960-2006 Year Acreage Planted Harvested Yield Production 1,000 cwt 858 1,217 1,339 750 639 728 444 441 453 481 525 548 470 444 374 450 430 511 413 482 460 255 332 293 332 228 240 ...
Date Added: 2009-06-12 18:04:03

Table002.xls
Path: Cornell >> ERS >> 91011 Fall, 2009
Description: Table 2-Alabama potatoes: Spring and summer acreage, yield, production, value, and disposition, 1949-2006 Farm disposition Acreage Year Planted Harvested - Cwt 82 95 102 103 118 107 27 112 125 130 120 140 110 155 125 130 117 155 130 130 120 130 115 1...
Date Added: 2009-06-12 18:04:24

Table15.xls
Path: Cornell >> ERS >> 03001 Fall, 2009
Description: Table 15-New Jersey sweet potatoes: Acreage, yield, production, value, and disposition, 1960-2008 Year Acreage Planted Harvested Yield Production Total used for seed Farm disposition Where grown Seed, feed Shrink and and home loss Price per cwt - Val...
Date Added: 2009-06-12 18:04:57

Project Descriptions.doc
Path: N. Georgia >> CMBALD >> 9501 Fall, 2009
Description: Project Descriptions Station 1: Students will go to the library where the students will research their country. Each group must include at least one book recourse. Station 2: For the Encarta station, students will research their country thoroughly an...
Date Added: 2009-06-12 18:05:08

Table43.xls
Path: Cornell >> ERS >> 94013 Fall, 2009
Description: Table 43-Onions, fresh: U.S. f.o.b. shipping-point prices, monthly, by season, 1960-2006 Year and season Jan Feb Mar Apr May Jun Jul Aug Sep Cents per pound ($/cwt) Spring 1/ 1960 1961 1962 1963 1964 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 ...
Date Added: 2009-06-12 18:05:14

how-to-lit-review.pdf
Path: Purdue >> AAE >> 520 Fall, 2009
Description: Brief Introduction to Literature Reviews in AAE 1. Lots of work has been done in the last century. There are many thousands of papers. 2. Most of the work is not in books and not on the internet it won\'t turn up in searches on THOR (the University b...
Date Added: 2009-06-12 18:06:13

STAT131_Exam_04_Solns.pdf
Path: Allan Hancock College >> DIPT >> 131 Fall, 2009
Description: STAT131 Surname. Question 1 (30 marks) (a) What is the minimum blood glucose reading for time 1? (b) First Name . marks 1 Minimum reading is 6.5. Write a short report comparing the blood glucose readings for time 1 and time 2? 5 Both are mound /uni...
Date Added: 2009-06-12 18:06:28

IP_IOC1_S05b_T08.pdf
Path: USC >> CSCI >> 577 Fall, 2009
Description: Iteration Plan Iteration Plan Correspondence Document Data Center Team# 8 577b Ian Beckles Sudhir Patel Pritesh Patel Salman Ali Rajrupa Ghosh Dan Ingold Tiffany Kim - IV V IP_IOC1_S05_T08.doc 1 Version Date: 4/2/05 Iteration Plan ...
Date Added: 2009-06-12 18:07:08

dec01.pdf
Path: University of South Dakota >> BIOL >> 164 Fall, 2008
Description: Volume 1, Issue 1 BRIN December News December 5, 2001 Biomedical Research Infrastructure Network BRIN Undergraduate Fellows Program (for students at Augustana, BHSU & SWCC) The BRIN Undergraduate Fellowship program has been designed to be prestigi...
Date Added: 2009-06-12 18:07:49

99-4823df.pdf
Path: Wisconsin >> LAW >> 122 Fall, 2009
Description: ...
Date Added: 2009-06-12 18:07:51

GOVT312 Lecture 9.ppt
Path: George Mason >> GOVT >> 312 Fall, 2008
Description: GOVT 312: Parties and Campaigns Lecture 9: Targeting Voters Winning an Election Simple: Get 50% +1 of the vote Time and money are limited quantity Persuasion vs. Mobilization Some people will vote for your candidate no matter what and others wil...
Date Added: 2009-06-12 18:08:53

ece203-l1.pdf
Path: Michigan >> EECS >> 203 Fall, 2008
Description: Introduction to Computer Engineering ECE 203 Northwestern University Department of Electrical Engineering and Computer Science Teacher: Office: Email: Phone: Webpage: Teaching Assistants Robert Dick L477 Tech dickrp@ece.northwestern.edu 4672298 htt...
Date Added: 2009-06-12 18:09:02

solutions10.pdf
Path: Allan Hancock College >> MATH >> 111 Fall, 2009
Description: q g y t q t q y g y 4 i q 1 W ct c t f x giq m ki f dq i giq z t giq i i g i d q i m r e | g | k kq f x giq w\'69wqk t ywd}uwe}o\'6...
Date Added: 2009-06-12 18:09:37

022107_team_agenda.doc
Path: RIT >> P >> 07310 Fall, 2009
Description: P07310 Polaris ESMT Project Meeting Purpose: The purpose of this meeting is to discuss the design review and the project review for Friday, and also, to discuss each team\'s responsibilities. Materials to be Reviewed: Tracking Sheet, Agenda Sheet Meet...
Date Added: 2009-06-12 18:09:57

04-narrative-6up.pdf
Path: Allan Hancock College >> MMDS >> 2202 Fall, 2009
Description: Overview Pre-Production MMDS2202 Digital Audio Production Ralf Mhlberger ralf@itee.uq.edu.au Pre-Production overview/context Narrative Types of Plot Plot axis: Tension & Conflict Elements/Characters FAQ 1 2 Lifecycle Pre-production: Design s...
Date Added: 2009-06-12 18:12:20

AEDE 711_HW5_2008.pdf
Path: Ohio State >> AED ECON >> 711 Fall, 2008
Description: AEDE 711: HW 5 Fall 2008 Due: November 13, 2008, 5p. (1) Page 295, Problem 6 (2) Let the domestic market demand and supply curves for chicken be: QD = 2500 50P QS = 150P 500 Q is given in million pounds, and P is given in $ per 10 pounds. (A) Calc...
Date Added: 2009-06-12 18:13:05

Lecture_8.pdf
Path: East Los Angeles College >> EB >> 402 Fall, 2009
Description: Lecture 8 Lecturer: Date: Aims `Market Structures\' Dr. Bill Gleave 4th December 2007 To explore the characteristics of different types of market structure and consider the relative influence firms have within these markets on the price of their pr...
Date Added: 2009-06-12 18:15:08

power jack.doc
Path: RIT >> P >> 07009 Fall, 2009
Description: ...
Date Added: 2009-06-12 18:15:59

ece 380 - Test 02 - Solutions.pdf
Path: Western Michigan >> ECE >> 380 Fall, 2009
Description: ...
Date Added: 2009-06-12 18:16:20

ecoli50000.txt
Path: UVA >> CS >> 101 Fall, 2008
Description: AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGTAACGGTGCGG...
Date Added: 2009-06-12 18:16:36

output.txt
Path: Washington >> V >> 24226 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-345QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3384 12/25/2007 10:28 AM <DIR> . 12/25/2007 10:28 ...
Date Added: 2009-06-12 18:17:34

Heath 2000.pdf
Path: Toledo >> CSB >> 452 Fall, 2009
Description: Plant Molecular Biology 44: 321334, 2000. E. Lam, H. Fukuda and J. Greenberg (Eds.), Programmed Cell Death in Higher Plants. 2000 Kluwer Academic Publishers. Printed in the Netherlands. 321 Hypersensitive response-related death Mich` le C. Heath e...
Date Added: 2009-06-12 18:17:41

error.txt
Path: Washington >> V >> 29500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Dec 30 09:24:08 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Dec 30 10:39:31 2007 ( 4523 s elapsed) ...
Date Added: 2009-06-12 18:17:53

10_item_11_fs.pdf
Path: UNF >> FAC >> 031208 Fall, 2009
Description: Item 11 UNF Finance and Audit Committee March 12, 2008 Issue Treasurer\'s Report Proposed Action Review Background Information The purpose of this item is to present the current treasurer\'s report. Supporting Documentation Treasurer\'s Report ...
Date Added: 2009-06-12 18:18:50

multdiv.txt
Path: Université du Québec à Montréal >> K >> 20250 Fall, 2009
Description: ; * ; Programme: MULTDIV.TXT version PEP8 ; ; Multiplication d\'un nombre par 10, par 80, par 100 ; par 1000 puis division du nombre *1000 par 7. ; ; auteur: Bernard Martin ; courriel: martin.bernard@uqam.ca ; ...
Date Added: 2009-06-12 18:20:25

submit.txt
Path: Washington >> V >> 23296 Fall, 2009
Description: executable = allgamma_23296.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs23000-23499/...
Date Added: 2009-06-12 18:20:43

output.txt
Path: Washington >> V >> 26000 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-32WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 3C9A-2CA7 Directory of C:\\condor\\execute\\dir_2716 12/26/2007 05:57 AM <DIR> . 12/26/2007 05:57 ...
Date Added: 2009-06-12 18:20:52

log.txt
Path: Washington >> V >> 10500 Fall, 2009
Description: 000 (42147.000.000) 12/30 07:05:45 Job submitted from host: <128.95.94.28:1084> . 001 (42147.000.000) 12/30 13:21:26 Job executing on host: <172.25.101.191:1056> . 006 (42147.000.000) 12/30 13:41:34 Image size of job updated: 468428 . 006 (42147.000....
Date Added: 2009-06-12 18:23:13

error.txt
Path: Washington >> V >> 27141 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Dec 26 22:19:18 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Dec 26 23:31:34 2007 ( 4336 s elapsed) ...
Date Added: 2009-06-12 18:25:24

meltdowns.ppt
Path: Brandeis >> FIN >> 285 Fall, 2009
Description: Financial Meltdowns IEF 217a: Lecture Section 4 Fall 2002 Reading: Jorion, chapter 2 Large Insolvencies Japan 1990s, $550 billion, 14% GDP China 1990s, $498 billion, 47% ? US S+L, $150 billion, 2.7 Other banking crises: Mexico 95, Argentina 80-...
Date Added: 2009-06-12 18:26:02

montest.txt
Path: Rush >> IFT >> 287 Fall, 2009
Description: - Une ligne commenant par - doit tre ignore par pgmJDBC.Main - Insertion valide I 1 abc 2007-01-16 04:24:00 2007-01-16-04:24:00 11.0 - Cas d\'erreur - Insertion invalide - enregistrement existe dj I 1 abc 1999-09-01 19:24:54 1999-09-01-19:24:54 11.0...
Date Added: 2009-06-12 18:27:04

Week3_InverseTrigReview.pdf
Path: Drexel >> MATH >> 121 Fall, 2009
Description: ...
Date Added: 2009-06-12 18:27:56

output.txt
Path: Washington >> V >> 26500 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-895QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_632 12/26/2007 09:12 AM <DIR> . 12/26/2007 09:12 A...
Date Added: 2009-06-12 18:28:21

week1.ppt
Path: Cal Poly >> CSC >> 205 Fall, 2009
Description: CSC 205, Software Engineering I CSC 205 Software Engineering I Spring Quarter, 2000 Clark S. Turner, J.D., Ph.D. 1 CSC 205, Software Engineering I Why are we here? Software Engineering is. the study of software process, software development pri...
Date Added: 2009-06-12 18:31:18

SampleDeliverable2.doc
Path: Dallas >> PROJECT >> 045100 Fall, 2009
Description: CS6361 Requirements Engineering October 2000 Project II Structural Requirements Modeling Instructor Project Group : : Dr. Chung Xin Ding Jian Ma Joon Ho B2B-HUBTM System Page 2 -- B2B Anything Anywhere Anytime University of Texas at Dallas ...
Date Added: 2009-06-12 18:31:31

submit.txt
Path: Washington >> V >> 23000 Fall, 2009
Description: executable = allgamma_23179.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs23000-23499/...
Date Added: 2009-06-12 18:32:56

error.txt
Path: Washington >> V >> 26500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Dec 26 09:30:33 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Dec 26 10:57:04 2007 ( 5191 s elapsed) ...
Date Added: 2009-06-12 18:34:07

submit.txt
Path: Washington >> V >> 10500 Fall, 2009
Description: executable = allgamma_10774.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs10500-10999/...
Date Added: 2009-06-12 18:34:37

submit.txt
Path: Washington >> V >> 20500 Fall, 2009
Description: executable = allgamma_20824.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs20500-20999/...
Date Added: 2009-06-12 18:34:57

Ch06RegularExpressions.ppt
Path: Winthrop >> CSCI >> 371 Spring, 2008
Description: Regular Expressions Chapter 6 Regular Languages L Regular Language Regular Expression Accepts Finite State Machine Regular Expressions The regular expressions over an alphabet are all and only the strings that can be obtained as follows: 1. ...
Date Added: 2009-06-12 18:36:53

submit.txt
Path: Washington >> V >> 24276 Fall, 2009
Description: executable = allgamma_24276.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs24000-24499/...
Date Added: 2009-06-12 18:38:09

IONS-NA_Love_Courtney.txt
Path: Penn State >> MVS >> 115 Fall, 2009
Description: someone\'s information job research volunteering leadership publications awards...
Date Added: 2009-06-12 18:38:12

IONS-NA__.txt
Path: Penn State >> MVS >> 115 Fall, 2009
Description: someone\'s information job research volunteering leadership publications awards...
Date Added: 2009-06-12 18:38:13

output.txt
Path: Washington >> V >> 28500 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-83WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2608 12/29/2007 10:42 PM <DIR> . 12/29/2007 10:42 ...
Date Added: 2009-06-12 18:39:09

11 am 2006.xls
Path: Uni. Westminster >> ADS >> 0424 Fall, 2009
Description: Fixed 5.00 mL Phenanthroline 1.0000 0.9000 0.8000 0.7000 0.6000 Absorbance 0.5000 0.4000 0.3000 0.2000 0.1000 0.0000 0.0 0.5 1.0 1.5 2.0 2.5 Volume FeSO4(aq) 3.0 3.5 4.0 4.5 5.0 Fixed 2.00 mL FeSO4 0.8000 0.7000 0.6000 0.5000 Absorbance 0.4000 ...
Date Added: 2009-06-12 18:39:14

error.txt
Path: Washington >> V >> 29000 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Dec 29 23:57:56 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Dec 30 01:09:34 2007 ( 4298 s elapsed) ...
Date Added: 2009-06-12 18:39:22

error.txt
Path: Washington >> V >> 21500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 24 09:26:05 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 24 10:37:31 2007 ( 4286 s elapsed) ...
Date Added: 2009-06-12 18:39:45

error.txt
Path: Washington >> V >> 20500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Dec 23 23:26:49 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 24 00:44:55 2007 ( 4686 s elapsed) ...
Date Added: 2009-06-12 18:42:40

error.txt
Path: Washington >> V >> 20500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 24 02:08:31 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 24 03:14:37 2007 ( 3966 s elapsed) ...
Date Added: 2009-06-12 18:42:43

output.txt
Path: Washington >> V >> 28500 Fall, 2009
Description: = running on = COMPUTERNAME=B280WS1 - local directory - Volume in drive C has no label. Volume Serial Number is 5692-E1E5 Directory of C:\\condor\\execute\\dir_2152 12/29/2007 09:34 PM <DIR> . 12/29/2007 09:34 PM <D...
Date Added: 2009-06-12 18:43:25

error.txt
Path: Washington >> V >> 22612 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 24 19:24:26 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 24 20:30:44 2007 ( 3978 s elapsed) ...
Date Added: 2009-06-12 18:43:36

submit.txt
Path: Washington >> V >> 26500 Fall, 2009
Description: executable = allgamma_26724.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs26500-26999/...
Date Added: 2009-06-12 18:44:03

error.txt
Path: Washington >> V >> 23676 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Dec 25 05:18:15 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Dec 25 06:35:14 2007 ( 4619 s elapsed) ...
Date Added: 2009-06-12 18:44:58

error.txt
Path: Washington >> V >> 27000 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Dec 26 21:06:09 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Dec 26 22:19:17 2007 ( 4388 s elapsed) ...
Date Added: 2009-06-12 18:46:32

error.txt
Path: Washington >> V >> 24706 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Dec 25 15:04:39 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Dec 25 16:11:16 2007 ( 3997 s elapsed) ...
Date Added: 2009-06-12 18:46:40

submit.txt
Path: Washington >> V >> 28233 Fall, 2009
Description: executable = allgamma_28233.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs28000-28499/...
Date Added: 2009-06-12 18:49:21

comp3502_Tut_12_A.pdf
Path: Allan Hancock College >> COMP >> 3502 Fall, 2009
Description: The University of Queensland School of Information Technology and Electrical Engineering Semester 2, 2005 COMP3502/7506 Tutorial 12, Answers Questions What is web sign-on? What is web single sign-on? What are the two different ways that security to...
Date Added: 2009-06-12 18:51:16

submit.txt
Path: Washington >> V >> 28350 Fall, 2009
Description: executable = allgamma_28350.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs28000-28499/...
Date Added: 2009-06-12 18:54:41

output.txt
Path: Washington >> V >> 28108 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-205QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3152 12/27/2007 07:05 AM <DIR> . 12/27/2007 07:05 ...
Date Added: 2009-06-12 18:56:27

submit.txt
Path: Washington >> V >> 28471 Fall, 2009
Description: executable = allgamma_28471.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs28000-28499/...
Date Added: 2009-06-12 18:57:14

error.txt
Path: Washington >> V >> 28312 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Dec 27 09:00:46 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Dec 27 10:18:59 2007 ( 4693 s elapsed) ...
Date Added: 2009-06-12 18:58:17

362Assign1Scenario.pdf
Path: Sveriges lantbruksuniversitet >> BUS >> 362 Fall, 2009
Description: Bus 362 Assignment 1: Assessing Economic Feasibility Instructions In this assignment, you will create an Excel workbook to help you assess the economic feasibility of a potential information technology initiative. You are provided with two resources:...
Date Added: 2009-06-12 19:02:02

RESUME.doc
Path: Evansville >> AP >> 103 Fall, 2009
Description: Anant Patel 643 South Rotherwood Ave Evansville, IN 47714 812-764-0684 ap103@evansville.edu OBJECTIVE Computer Science related Co-op or internship SUMMARY Highly-motivated and goal oriented; Open minded and flexible; Organized and dedicated leader;...
Date Added: 2009-06-12 19:02:11

chap12.pdf
Path: Evansville >> AP >> 103 Fall, 2009
Description: C H A P T E R THE BROADER PERSPECTIVE 12 Learning Objectives: By the end of this chapter, you should be able to discuss: Laws governing hacking and other computer crimes. Consumer privacy. Employee workplace monitoring. Government surveillanc...
Date Added: 2009-06-12 19:02:14

101Statistics.pdf
Path: Cal Poly Pomona >> WEB >> 101 Fall, 2009
Description: 1 SCI 101: Fall 2008 SCI 101/101A: Statistics Assignment Name: Mean Standard Deviation n Name: = 1 n n (xi - )2 xi = i=1 i=1 n Work with a partner, and survey at least 10 students each. Collect the on the form provided on the back of this s...
Date Added: 2009-06-12 19:02:52

4450t2_f04.ps
Path: TN Tech >> CSC >> 445 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: 4450t2_f04.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMBX12 CMR12 CMSY10 CMR8 CMR6 CMMI6 CMMI12 CMMI8 CMSY8 %EndComments %DVIPSWebPag...
Date Added: 2009-06-12 19:03:58

weather.xls
Path: U. Houston >> CUIN >> 3111 Fall, 2008
Description: Temperature Monday Tuesday Wednesday ThursdayFriday High 54 63 76 71 64 Low 35 58 60 46 37 Mean 44.5 60.5 68 58.8 50.5 Sacramento, California Weather 80 temperature 60 40 20 0 Monday Tuesday Thursday Wednesday Friday Day of Week Row 2 Low Mean ...
Date Added: 2009-06-12 19:04:02

NormApproxBinom1.pdf
Path: Idaho >> STAT >> 514 Fall, 2008
Description: Normal approximation to the Binomial 0.20 0.15 0.10 0.05 0.00 0 1 2 3 4 5 6 7 8 9 10 12 14 0.00 0 0.05 0.10 0.15 0.20 1 2 3 4 5 6 7 8 9 10 12 14 without continuity correction with continuity correction ...
Date Added: 2009-06-12 19:05:43

hwk499.doc
Path: Texas A&M >> AGECON >> 661 Fall, 2009
Description: AGRICULTURAL ECONOMICS 661 Homework #4 Spring 1999 Due anytime between March 1216, 1999 This homework covers the material in class dealing with twostage and three stage least squares estimation. It uses the same data as in homework 2 and 3. Ba...
Date Added: 2009-06-12 19:07:32

Pge2.pdf
Path: Berkeley >> EE >> 117 Fall, 2009
Description: ...
Date Added: 2009-06-12 19:07:56

tutorial_marks_03.pdf
Path: Allan Hancock College >> ECON >> 1102 Fall, 2009
Description: MACROECONOMICS 1 (ECON1102) SEMESTER 2, 2008 Uni ID Test 1 Test 2 Test 3 Test 4 Test 5 Best 4 4488779 4491167 4492171 4493589 4493805 4493969 4495418 4495519 4497071 4497590 4500649 4502858 4503316 4503886 4505145 4506010 4507265 4507416 4508622 450...
Date Added: 2009-06-12 19:09:25

Lab_2_hints.ppt
Path: UCSC >> CMPE >> 012 Fall, 2009
Description: Lab #2 Hints Want to produceAS I I table C Ne ds to bein a formlike e : De c 48 He x 30 Oct 60 C har 0 C MPE12c 2 C Baze yrus ghi MAL and data type s What doe our MI PSarchite s cturestoreinto re r $s1 giste for this instruction? li 31 $s1,...
Date Added: 2009-06-12 19:09:36

intro.ppt
Path: Harvey Mudd College >> CS >> 155 Fall, 2000
Description: C G an alm factual account of thehistory of ost com r graphics pute a long long tim ago . e be buzz . fore be quake. fore be m fore icrosloth windows . be m of you we born . fore ost re theworld e d without com r graphics xiste pute 06/06/09 C 155...
Date Added: 2009-06-12 19:09:40

OldFinal2.pdf
Path: Utah >> MATH >> 1100 Fall, 2008
Description: Math 1100-005: Quantitative Analysis Final Exam (April 29, 2008) If you do not follow any of the following rules, you will get partial or zero credit. 1. Write everything clearly. 2. Don\'t forget to use equal signs appropriately. 3. Show all the step...
Date Added: 2009-06-12 19:12:32

NRGSystems-Pineau.ppt
Path: Hudson VCC >> CDAE >> 170 Fall, 2009
Description: ...
Date Added: 2009-06-12 19:13:36

RCOE-OVER-USN.ppt
Path: Penn State >> AERSP >> 097 Fall, 2009
Description: PENNSTATE 1 8 5 5 Penn State Rotorcraft Center of Excellence NASA Ames Cooperative Agreement NGT-2-52275 Contact: Prof. Ed Smith 814-863-0966 ecs5@psu.edu http:/www.psu.edu/dept/rcoe/ US Navy Briefing August 8, 2005 Updated Meeting Objecti...
Date Added: 2009-06-12 19:14:00

7-sto_proc.pdf
Path: Harvard >> ES >> 150 Fall, 2009
Description: Topic 7: Random Processes Definition, discrete and continuous processes Specifying random processes Joint cdf\'s or pdf\'s Mean, auto-covariance, auto-correlation Cross-covariance, cross-correlation Stationary processes and ergodicity ES150 Har...
Date Added: 2009-06-12 19:14:32

118pracmt2bsolns.pdf
Path: Agnes Scott >> MAT >> 118 Fall, 2009
Description: Math 118 Solutions to 2nd Midterm 1. Find an equation for the tangent line to the ellipse x2 + xy + y 2 = 3 at the point (1, 1). Use implicit dierentiation. Take d/dx of both sides to get 2x + y + xy + 2yy = 0, 2x y solve to get y = , plug in (1, 1)...
Date Added: 2009-06-12 19:15:18

118mt2solns.pdf
Path: Agnes Scott >> MAT >> 118 Fall, 2009
Description: Math 118 Solutions to 2nd Midterm 1. Find an equation for the tangent line to the ellipse x2 + xy + y 2 = 3 at the point (1, 1). Use implicit dierentiation. Take d/dx of both sides to get 2x + y + xy + 2yy = 0, 2x y solve to get y = , plug in (1, 1)...
Date Added: 2009-06-12 19:16:42

error.txt
Path: Washington >> V >> 21000 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 24 04:36:02 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 24 05:51:24 2007 ( 4522 s elapsed) ...
Date Added: 2009-06-12 19:16:43

submit.txt
Path: Washington >> V >> 21000 Fall, 2009
Description: executable = allgamma_21193.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs21000-21499/...
Date Added: 2009-06-12 19:16:49

submit.txt
Path: Washington >> V >> 21000 Fall, 2009
Description: executable = allgamma_21021.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs21000-21499/...
Date Added: 2009-06-12 19:17:34

log.txt
Path: Washington >> V >> 21000 Fall, 2009
Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>028db924f128f7b7e968886afba32290d711574a.txt</Key><RequestId>AD5EBD24311DADE0</RequestId><HostId>CwW1VSmNW59GeDbdZIH0CxGo0fy/...
Date Added: 2009-06-12 19:17:36

Get Started With Course Hero Today!

Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.

Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners.

Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs.

What People Are Saying About Course Hero

“I was going to fail my Evidence exam, but then I found a great outline on Course Hero!”
- Kim Cowan, Cornell University



“I worked for tens of hours on my chemistry lab reports this semester, and now I can publish my hard work to thousands of people who care to read about what I found.”
- David Grauer, Princeton University




“Many times, students learn best from other students, their peers, rather than from a teacher.  Course Hero provides such a forum for students to teach students.”
- Somerset Perry, Georgetown University


“Course Hero is a great new research tool for college students.  Students can find lots of pertinent information to their studies that they previously could not find or have access to.  It’s for sure an educational innovation and potentially an educational revolution.”
- Andy Suiter, UCLA and UC Davis



“As a freshman, Course Hero will help me to decide what I am actually interested in studying in college.”
- Caity Feindt, Ithaca College



“I have found lecture notes on corporate finance created by students from multiple schools, which has really helped me learn more about the subject.”
- John Stacey III, UCSB



“I study less and learn more with Course Hero.”
- John Sweazey, CU-Boulder



 

Explore the benefits of joining Course Hero's social learning network.

Get millions of study materials now!

Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!

Get over 200,000 textbook solutions now!

Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.

Meet over 300,000 students and your fellow classmates now!

Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!