Course Solutions And Notes - DB-design-r 06
| log.txt Path: Washington >> V >> 17000 Fall, 2009 Description: 000 (50561.000.000) 02/05 23:53:12 Job submitted from host: <128.95.94.28:1098> . 001 (50561.000.000) 02/05 23:55:49 Job executing on host: <172.25.101.180:1065> . 006 (50561.000.000) 02/06 00:15:57 Image size of job updated: 395384 . 006 (50561.000.... Date Added: 2009-06-04 14:12:37 |
| submit.txt Path: Washington >> V >> 15010 Fall, 2009 Description: executable = allgamma_15010.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-06-04 14:13:35 |
| submit.txt Path: Washington >> V >> 15036 Fall, 2009 Description: executable = allgamma_15036.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-06-04 14:19:21 |
| submit.txt Path: Washington >> JOBS >> 10097 Fall, 2009 Description: executable = pass6_10097.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10000-10499/10097... Date Added: 2009-06-04 14:20:52 |
| log.txt Path: Washington >> JOBS >> 10075 Fall, 2009 Description: 000 (51071.000.000) 02/06 08:18:14 Job submitted from host: <128.95.94.28:1098> . 001 (51071.000.000) 02/06 08:18:29 Job executing on host: <172.25.101.190:1055> . 006 (51071.000.000) 02/06 08:38:37 Image size of job updated: 443024 . 005 (51071.000.... Date Added: 2009-06-04 14:22:00 |
| error.txt Path: Washington >> JOBS >> 10438 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 03:13:35 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 03:24:02 2008 ( 627 s elapsed) ... Date Added: 2009-06-04 14:25:42 |
| log.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: 000 (51232.000.000) 02/06 08:21:08 Job submitted from host: <128.95.94.28:1098> . 001 (51232.000.000) 02/06 08:41:40 Job executing on host: <172.25.101.164:1060> . 005 (51232.000.000) 02/06 08:56:12 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 14:25:57 |
| Lecture27_202.ppt Path: Berkeley >> IS >> 202 Fall, 1998 Description: Introduction to Databases and Database Design University of California, Berkeley School of Information Management and Systems SIMS 202: Information Organization and Retrieval 11/28/2000 Information Organization and Retrieval Review Thesaurus Design... Date Added: 2009-06-04 14:28:22 |
| tvac_hot_veto_lo_side_1_B.ps Path: Stanford >> EXP >> 080110 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: test_veto_side_1_B.ps: test_veto_side_1_B %Creator: ROOT Version 5.16/00 %CreationDate: Mon Jan 28 15:44:44 2008 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} d... Date Added: 2009-06-04 14:29:07 |
| tvac_hot_veto_mid_side_2_A.ps Path: Stanford >> EXP >> 080110 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: test_veto_side_2_A.ps: test_veto_side_2_A %Creator: ROOT Version 5.16/00 %CreationDate: Mon Jan 28 15:45:31 2008 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} d... Date Added: 2009-06-04 14:29:08 |
| Unit 2- Legal Considerations and Taking Action.ppt Path: Erskine >> PE >> 216 Fall, 2009 Description: Unit 2 Legal Considerations and Taking Action PE 216 Emergency Response Legal Considerations Duty to Act A legal responsibility to provide care in an emergency Scope of Practice Set of skills and knowledge you acquire through training Limits the... Date Added: 2009-06-04 14:30:24 |
| CSSE 220 BinaryInteger assignment.docx Path: Rose-Hulman >> CSSE >> 200830 Fall, 2009 Description: CSSE 220 Binary Integer in-class programming problem. I encourage you to work with another class-mate; each of you must submit it, but it is okay for this one assignment if what you submit is identical. In our last class, we discussed implementing no... Date Added: 2009-06-04 14:32:21 |
| h10.ps Path: Kentucky >> MA >> 114 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: h10.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips h10 %DVIPSParameters: dpi=600,... Date Added: 2009-06-04 14:32:47 |
| rlist4.txt Path: Utah >> SPIN >> 103 Fall, 2009 Description: Block: 4 Size: 87 - Printing 81 polynomials . Maximum Degree: 8 -> 2q^8-7q^7+9q^6-5q^5+3q^3-3q^2+q Maximum Coefficient: 9 -> 2q^8-7q^7+9q^6-5q^5+3q^3-3q^2+q - 0 1 q-1 q^2-2q+1 -q+1 -q^2+2q-1 q^3-2q^2+2q-1 -q^3+2q^2-q q^3-2q^2+q -q^2+q q^2-q q^3-3q... Date Added: 2009-06-04 14:33:18 |
| block20.txt Path: Utah >> SPIN >> 143 Fall, 2009 Description: 0(363): * * 0 0 0 * 0 0 (*,*) (*,*) (*,*) (*,*) (*,*) (*,*) (*,*) (*,*) [Cn,Cn,ic,ic,ic,Cn,rn,rn] 10 ... Date Added: 2009-06-04 14:33:29 |
| log.txt Path: Washington >> V >> 11089 Fall, 2009 Description: 000 (25634.000.000) 12/03 06:52:45 Job submitted from host: <128.95.94.28:4757> . 001 (25634.000.000) 12/03 06:55:46 Job executing on host: <172.25.101.164:1088> . 006 (25634.000.000) 12/03 07:15:54 Image size of job updated: 411748 . 005 (25634.000.... Date Added: 2009-06-04 14:36:26 |
| submit.txt Path: Washington >> JOBS >> 31386 Fall, 2009 Description: executable = pass6_31386.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31000-31499/31386... Date Added: 2009-06-04 14:38:11 |
| output.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-20WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1048 02/10/2008 09:13 PM <DIR> . 02/10/2008 09:13 ... Date Added: 2009-06-04 14:39:59 |
| output.txt Path: Washington >> V >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-1Z4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_576 12/03/2007 06:54 AM <DIR> . 12/03/2007 06:54 A... Date Added: 2009-06-04 14:42:10 |
| log.txt Path: Washington >> V >> 11000 Fall, 2009 Description: 000 (25985.000.000) 12/03 06:54:41 Job submitted from host: <128.95.94.28:4757> . 001 (25985.000.000) 12/03 11:59:29 Job executing on host: <172.25.101.195:1056> . 006 (25985.000.000) 12/03 12:19:37 Image size of job updated: 397020 . 005 (25985.000.... Date Added: 2009-06-04 14:44:50 |
| SI Density Lab Figures.ppt Path: Kentucky >> FOR >> 350 Fall, 2008 Description: Simulation Parameters: Plantation Spacing = 8 x 8 ft, Site Index = 75 Plan tatio n Age Numbe r Trees 0 10 15 20 25 30 681 563.3 556.8 526.3 486 436.9 Mea n 5.65 6.88 7.64 8.26 8.81 Stand and Tree Characteristics at Age 30 Diameter (in) Mi n 3 3 4 4 ... Date Added: 2009-06-04 14:45:59 |
| Problem Set 3 (2008).doc Path: University of Illinois, Urbana Champaign >> NRES >> 201 Fall, 2008 Description: NRES 201 Fall, 2008 Problem Set No. 3 (Due Wednesday, December 10. SHOW YOUR WORK.1) The following data were reported by a soil testing laboratory, for a golf course in the Chicago area where the fairways had been sampled to a depth of 6 inches. ... Date Added: 2009-06-04 14:46:36 |
| engl312c01.txt Path: Sveriges lantbruksuniversitet >> ENGL >> 19972 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 312-4 C01 LOCATION: SFU TITLE: SHAKESPEARE SECTION TYPE: SEC SEMESTER: 1997-2 ENROL: 59... Date Added: 2009-06-04 14:47:42 |
| lec7.ps Path: Kentucky >> CS >> 623 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: many.dvi %Pages: 5 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o lec7.ps many.dvi %DVIPSParame... Date Added: 2009-06-04 14:48:07 |
| dec9.ps Path: Kentucky >> CS >> 621 Fall, 2008 Description: #sn6#dec9.ps#=kH;En[9m#~`cZ{zZZujN.l#3/\"2N#W#0G2\"222b y sss~ #x#o9w#J4#Orn=/{?~oV! #$OC9#U#@\'#f#%H#8Y#mb#De5#u2\\LY #90YpL;c 4|*?#~f#? Kx#PD\"O~OC#Dy_a#%E) $ YC ?#<Y# q$8}J ?<\\u#:#r #`!#G\\5>\"#e#Z#u#[_\"OY#y Q#g| Yi##2#$^Q2... Date Added: 2009-06-04 14:48:12 |
| websites.doc Path: Purdue >> OLS >> 386 Fall, 2008 Description: Web Sites for Change Management http:/www.bsr.org/BSRResources/index.cfm = Business for Social Responsibility http:/www.prosci.com/ = Business Process Reengineering http:/www.solonline.org/ = The Society for Organizational Learning http:/www.spiritua... Date Added: 2009-06-04 14:48:45 |
| websites.doc Path: Purdue >> OLS >> 582 Fall, 2008 Description: Web Sites for Change Management http:/www.bsr.org/BSRResources/index.cfm = Business for Social Responsibility http:/www.prosci.com/ = Business Process Reengineering http:/www.solonline.org/ = The Society for Organizational Learning http:/www.spiritua... Date Added: 2009-06-04 14:48:45 |
| USB Controlled IO Module.ppt Path: Virgin Islands >> ECE >> 499 Fall, 2009 Description: USB Controlled IO Module A 499a Project Jon Knoll Dave Wolowicz Sponsored by: Dr. Kin Li Objective To create a low cost automation control using the USB Protocol. This I/O module is to be a replacement for the Festo EasyPort D16. The following desi... Date Added: 2009-06-04 14:50:54 |
| cs457_19.ps Path: UWO >> CS >> 457 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 26 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where {... Date Added: 2009-06-04 14:52:02 |
| cs641_11.ppt Path: UWO >> CS >> 641 Fall, 2009 Description: Level Design Level Design s Good level design combines several elements to form a compelling world in which the game is played. s s If a game level is designed well, these will fit together seamlessly. s Modeling, lighting, animation,... Date Added: 2009-06-04 14:52:26 |
| LICENSE.txt Path: Carnegie Mellon >> HW >> 731 Fall, 2009 Description: Copyright 2007 by BBN Technologies and University of Maryland (UMD) BBN and UMD grant a nonexclusive, source code, royalty-free right to use this Software known as Translation Error Rate COMpute (the \"Software\") solely for research purposes. Provide... Date Added: 2009-06-04 14:53:23 |
| mt.ps Path: UC Davis >> CS >> 120 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: mt.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -D 600 -o mt.ps mt.dvi %DVIPSParam... Date Added: 2009-06-04 14:53:37 |
| iteration.doc Path: Penn State >> ME >> 540 Fall, 2009 Description: Iterative Solution of Linear Equations Preface to the existing class notes At the risk of mixing notation a little I want to discuss the general form of iterative methods a general level. We are trying to solve a linear system Ax=b, in a situation wh... Date Added: 2009-06-04 14:54:23 |
| wrapping-up.txt Path: Iowa State >> COMS >> 342 Fall, 2009 Description: Com S 342 meeting -*- Outline -*- * wrapping up the first class * explain where the course documents are $PUB/docs * last minute reminders Get your Com S login ASAP! it takes a day to be activated (see HW0) * write most important point, w... Date Added: 2009-06-04 14:55:12 |
| problem21_08.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 21.8: a) The total number of electrons on each sphere equals the number of protons. ne np 13 NA 0.0250 kg 0.026982 kg mol 7.25 10 24. b) For a force of 1.00 10 4 N to act between the spheres, F 104 N 1 q2 40 r 2 10 q ne 40 (104 N) (0.08 m)2 q e ... Date Added: 2009-06-04 14:55:41 |
| problem32_32.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 32.32: a) f = c 3.0 108 m s = = 6.0 10 4 Hz. 5000 m b) f = c) f = d) f = c 3.0 108 m s = = 6.0 10 7 Hz. 5.0 m c 3.0 108 m s = = 6.0 1013 Hz. 6 5.0 10 m c 3.0 108 m s = = 6.0 1016 Hz. 9 5.0 10 m ... Date Added: 2009-06-04 14:56:04 |
| output.txt Path: Washington >> V >> 17000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-81WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2248 02/06/2008 02:29 AM <DIR> . 02/06/2008 02:29 ... Date Added: 2009-06-04 14:56:48 |
| submit.txt Path: Washington >> V >> 17000 Fall, 2009 Description: executable = allgamma_17021.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs17000-17499/17... Date Added: 2009-06-04 14:58:45 |
| submit.txt Path: Washington >> V >> 17496 Fall, 2009 Description: executable = allgamma_17496.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs17000-17499/17... Date Added: 2009-06-04 14:59:18 |
| output.txt Path: Washington >> V >> 17000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS1 - local directory - Volume in drive C has no label. Volume Serial Number is 5692-E1E5 Directory of C:\\condor\\execute\\dir_3476 02/06/2008 01:17 AM <DIR> . 02/06/2008 01:17 AM <D... Date Added: 2009-06-04 14:59:26 |
| Lect32.ppt Path: Trinity U >> CSCI >> 1321 Fall, 2009 Description: Dynamic Programming 4-10-2002 Opening Discussion Do you have any questions about the quiz? What did we talk about last class? Do you have any questions about the assignments? What elements of the assignments are causing you problems at this... Date Added: 2009-06-04 15:00:48 |
| quotestouse2.txt Path: Penn State >> KRG >> 5035 Fall, 2009 Description: Quotes to use for paper ][ - -Screens to hide porn at libraries \"Pornography is harmful,\" he said. \"That\'s why we take steps to keep it out of the hands of children. We shouldn\'t be supporting it with our tax dollars or with our public policy.... Date Added: 2009-06-04 15:00:57 |
| error.txt Path: Washington >> JOBS >> 30000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 08:41:17 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 09:25:29 2008 ( 2652 s elapsed) ... Date Added: 2009-06-04 15:03:27 |
| log.txt Path: Washington >> JOBS >> 30402 Fall, 2009 Description: 000 (55399.000.000) 02/10 07:49:51 Job submitted from host: <128.95.94.28:1098> . 001 (55399.000.000) 02/10 10:01:13 Job executing on host: <172.25.101.47:1056> . 006 (55399.000.000) 02/10 10:21:21 Image size of job updated: 449372 . 006 (55399.000.0... Date Added: 2009-06-04 15:06:38 |
| log.txt Path: Washington >> JOBS >> 30313 Fall, 2009 Description: 000 (55310.000.000) 02/10 07:49:07 Job submitted from host: <128.95.94.28:1098> . 001 (55310.000.000) 02/10 09:23:04 Job executing on host: <172.25.101.171:1061> . 006 (55310.000.000) 02/10 09:43:12 Image size of job updated: 389544 . 005 (55310.000.... Date Added: 2009-06-04 15:06:40 |
| Answers_to_fall07_tests.doc Path: N.C. State >> ST >> 370 Fall, 2008 Description: Solutions to Fall 2007 Test1, Test2, Final exam Test1: 1a. True 1b. False 1c. False 1d. True 1e. True 1f. False 1g. False 1h. True 1i. False 1j. False 1k. True 1l. 25, 31, 36, 42, 56 2a. False 2b. False 2c. True 2d. False 2e. False 2f. True th 3a. Th... Date Added: 2009-06-04 15:08:07 |
| exam2.doc Path: UF >> STA >> 6167 Summer, 2008 Description: STA 6167 Exam 2 Spring 2008 _ PRINT Name A study is conducted to measure the relationship between breaking strength of concrete (Y) and the amounts of 2 key ingredients: A (X1) and B (X2). The relationship is believed to be nonlinear, and of the ... Date Added: 2009-06-04 15:09:23 |
| LEDPeakMaximaRun0454.txt Path: Yale >> RUN >> 0454 Fall, 2009 Description: Run number 0454 tower 1 column 4 row 0 LED max 106.5 mean 106.476 RMS 4.39224 number of entries 1585 rms/mean tower 2 column 5 row 0 LED max 132.5 mean 132.319 RMS 5.41195 number of entries 1585 rms/mean tower 5 column 4 row 1 LED max 132.5 mean 132.... Date Added: 2009-06-04 15:10:26 |
| final operation manual.doc Path: RIT >> P >> 08004 Fall, 2009 Description: [Type the company name] Winter072 & Spring73 P08004 Adaptable Bocce Ball Launcher Assembly Manual Table of Contents Base..3 Frame and Base Components Assembled.3 Base Frame With top Plate Assembly..4 SubAssemblies.5 All TSlotted Connection... Date Added: 2009-06-04 15:11:13 |
| 2202-2008-sem2-def-sup-coversheet.rtf Path: Allan Hancock College >> LAW >> 2202 Fall, 2009 Description: Office Use Only Monash University Semester Two Deferred noting time THIS PAPER IS ... Date Added: 2009-06-04 15:11:29 |
| submit.txt Path: Washington >> JOBS >> 80034 Fall, 2009 Description: executable = pass6_6_80034.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/800... Date Added: 2009-06-04 15:12:45 |
| output.txt Path: Washington >> JOBS >> 80432 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_272 02/20/2008 12:54 AM <DIR> . 02/20/2008 12:54 A... Date Added: 2009-06-04 15:13:00 |
| submit.txt Path: Washington >> JOBS >> 80149 Fall, 2009 Description: executable = pass6_6_80149.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/801... Date Added: 2009-06-04 15:15:10 |
| error.txt Path: Washington >> JOBS >> 80012 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 19 20:48:43 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 19 22:10:42 2008 ( 4919 s elapsed) ... Date Added: 2009-06-04 15:15:20 |
| gray_dbos.ps Path: UMass (Amherst) >> CS >> 677 Fall, 2009 Description: #%-12345X@PJL COMMENT HP LaserJet 4Si @PJL SET PAGEPROTECT=OFF @PJL SET PAGEPROTECT=AUTO @PJL SET RET=ON @PJL SET RESOLUTION=600 @ @PJL ENTER LANGUAGE=PCL #E#*t600R#l0o1E#l0H#l1X#&l1G#*b0 M #*c1G#*c2... Date Added: 2009-06-04 15:16:53 |
| output.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS8 - local directory - Volume in drive C has no label. Volume Serial Number is B020-E7D5 Directory of C:\\condor\\execute\\dir_3696 02/19/2008 10:00 PM <DIR> . 02/19/2008 10:00 PM <D... Date Added: 2009-06-04 15:17:19 |
| output.txt Path: Washington >> JOBS >> 80191 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-8T51PB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_4016 02/19/2008 10:19 PM <DIR> . 02/19/2008 10:19 ... Date Added: 2009-06-04 15:18:25 |
| 021205-AGU-LEFT.ppt Path: Ithaca College >> IC >> 030038 Fall, 2009 Description: Michael Rogers Department of Physics Oregon State University Corvallis, Oregon 97331 rogersm@ucs.orst.edu James Cassidy, Maria Dragila Department of Crop and Soil Science Oregon State University Corvallis, Oregon 97331 james.cassidy@orst.edu ... Date Added: 2009-06-04 15:18:49 |
| Ipsecurity.ppt Path: UH Clear Lake >> CSCI >> 5234 Spring, 2008 Description: I P S curity e - Chapter 6 of William Stallings. Network Security Essentials (2nd edition). Prentice Hall. 2003. S s by He Johnson lide nric Ble kingeI nstituteof Te chnology, S de we n http:/www.its.bth.se /staff/hjo/ he nric.johnson@ bth.se Re d b... Date Added: 2009-06-04 15:21:13 |
| THE ROMANTICS06.ppt Path: Allan Hancock College >> EDU >> 1121 Fall, 2009 Description: THE ROMANTICS Jean-Jacques Rousseau [Chapter 8 in text] and A.S. Neill [Reading 5] Focus on \"The Free Child And hello to all at Wide Bay! 1 1. The Romantic Movement Background to the Romantic Movement A reaction to the Age of Empiricism, the Age ... Date Added: 2009-06-04 15:21:58 |
| BVP with Finite Differences.ppt Path: W. Alabama >> CHE >> 323 Fall, 2009 Description: Finite Difference Method Major: All Engineering Majors Authors: Autar Kaw, Charlie Barker http:/numericalmethods.eng.usf.edu Numerical Methods for STEM undergraduates 05/18/09 http:/numericalmethods.eng.usf.edu 1 Finite Difference Method An examp... Date Added: 2009-06-04 15:22:30 |
| A Course Buisness.ppt Path: W. Alabama >> CHE >> 562 Fall, 2009 Description: Fermentation Engineering Instructor Eric Jervis Department of Chemical Engineering Bldg. E1, Rm. 2545 Email: ericjj@cape.uwaterloo.ca Course Scope Concepts of transport phenomena, reactor engineering, and unit operations are explored with respect to ... Date Added: 2009-06-04 15:22:47 |
| l7.ps Path: W. Alabama >> CHE >> 720 Fall, 2009 Description: %!PS-Adobe-2.0%Creator: dvips 5.522 Copyright 1986, 1993 Radical Eye Software% %Title: l7.dvi%CreationDate: Tue Oct 4 14:06:10 1994%Pages: 12%PageOrder: Ascend%BoundingBox: 0 0 612 792%EndComments%DVIPSCommandLine: /vol/PACK/tex/bin/bin5/dvips -f l7.... Date Added: 2009-06-04 15:23:18 |
| 09 Synaptic Release last.ppt Path: Dallas >> MXA >> 049000 Fall, 2009 Description: Short-term Synaptic plasticity Two responses to the SAME stimulus are not necessarily the same probably because of the accumulation of Ca+2 in the presyn terminal following one or more APs Calcium Regulation Neuromuscular Junction Large postsynap... Date Added: 2009-06-04 15:24:32 |
| 05 Protein sorting ma.ppt Path: Dallas >> MXA >> 049000 Fall, 2009 Description: Protein Synthesis and Trafficking Animation illustrating the variety and mobility of the intracellular elements http:/multimedia.mcb.harvard.edu/anim_innerlife_hi.html Proteins are synthesized from mRNA synthesized in the nucleus and translocated ... Date Added: 2009-06-04 15:24:34 |
| 30scene-segmented.txt Path: Colorado >> CSCI >> 5832 Fall, 2008 Description: January 30, 2009 Blagojevich Makes a Day of It on Way Out By MONICA DAVEY CHICAGO - As the nine-seat airplane raced through the skies on Thursday somewhere between Springfield and here, an onboard telephone began to ring. Rod R. Blagojevich the s... Date Added: 2009-06-04 15:26:31 |
| WebDesign1.ppt Path: Ithaca College >> CS >> 205 Fall, 2009 Description: Plan the site and its structure Plan the display and navigation Design the look Test Planning the site Identify the audience Determine the site\'s purpose Plan the structure Planning the site Identify the audience Determine the site\'s purpo... Date Added: 2009-06-04 15:26:32 |
| hw9-solutions-08.doc Path: Auburn >> MECH >> 3130 Spring, 2008 Description: ... Date Added: 2009-06-04 15:27:07 |
| all_freq.txt Path: SDSMT >> CS >> 492 Fall, 2009 Description: .082 .015 .028 .043 .127 .022 .020 .061 .070 .002 .008 .040 .024 .067 .075 .019 .001 .060 .063 .091 .028 .010 .023 .001 .020 .001 ... Date Added: 2009-06-04 15:27:22 |
| syllabus.doc Path: Maryland >> NRSC >> 484 Fall, 2009 Description: NRSC 484 Environmental Plant Physiology Tu/TH, 9:30 to 10:20, Laboratory Friday at 12 Room 1146, PLS COURSE GOALS: An introduction to the basic physical and physiological principles necessary for understanding in the interactions between plants and ... Date Added: 2009-06-04 15:27:57 |
| linear-programming.xls Path: Washburn >> BU >> 347 Fall, 2009 Description: Enter Here a description of the problem and its objectives. X1 X2 X3 X4 X5 X6 X7 X8 X9 X10 X11 X12 Z 0 CONSTRAINT 1 CONSTRAINT 2 CONSTRAINT 3 CONSTRAINT 4 CONSTRAINT 5 CONSTRAINT 6 CONSTRAINT 7 CONSTRAINT 8 CONSTRAINT 9 CONSTRAINT 10 CON... Date Added: 2009-06-04 15:28:14 |
| output.txt Path: Washington >> V >> 16958 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5V4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2512 02/05/2008 09:04 PM <DIR> . 02/05/2008 09:04 ... Date Added: 2009-06-04 15:29:20 |
| log.txt Path: Washington >> V >> 16514 Fall, 2009 Description: 000 (50009.000.000) 02/05 08:51:35 Job submitted from host: <128.95.94.28:1098> . 001 (50009.000.000) 02/05 08:53:02 Job executing on host: <172.25.101.166:1061> . 006 (50009.000.000) 02/05 09:13:10 Image size of job updated: 468124 . 006 (50009.000.... Date Added: 2009-06-04 15:29:47 |
| log.txt Path: Washington >> V >> 16972 Fall, 2009 Description: 000 (50467.000.000) 02/05 08:56:30 Job submitted from host: <128.95.94.28:1098> . 001 (50467.000.000) 02/05 21:14:09 Job executing on host: <172.25.101.173:1056> . 006 (50467.000.000) 02/05 21:34:17 Image size of job updated: 467052 . 010 (50467.000.... Date Added: 2009-06-04 15:30:36 |
| submit.txt Path: Washington >> V >> 16779 Fall, 2009 Description: executable = allgamma_16779.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:30:37 |
| output.txt Path: Washington >> V >> 16767 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2796 02/05/2008 05:24 PM <DIR> . 02/05/2008 05:24 ... Date Added: 2009-06-04 15:30:57 |
| submit.txt Path: Washington >> V >> 16681 Fall, 2009 Description: executable = allgamma_16681.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:31:28 |
| LoanModel.txt Path: Illinois State >> MAT >> 146 Fall, 2008 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Worksheet> <Version major=\"11\" minor=\"0\"/> <Label-Scheme value=\"2\" prefix=\"/> <View-Properties presentation=\"true\"></View-Properties> <MapleNet-Properties warnlevel=\"3\" longdelim=\"true\" plotoptions=\" echo=\"1\" e... Date Added: 2009-06-04 15:33:21 |
| error.txt Path: Washington >> V >> 16730 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 16:14:47 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 17:41:47 2008 ( 5220 s elapsed) ... Date Added: 2009-06-04 15:33:37 |
| requirements.ppt Path: Duke >> CPS >> 109 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|20 Oct 2003 17:47:59 -0000 vti_extenderversion:SR|4.0.2.7802 vti_filesize:IR|521216 vti_title:SR|IIT and SWE vti_backlinkinfo:VX| vti_cacheddtm:TX|20 Oct 2003 17:47:59 -0000 vti_cachedlinkinfo:VX| vti_c... Date Added: 2009-06-04 15:34:32 |
| cppChap08.ppt Path: Bellevue >> CIS >> 400 Fall, 2009 Description: 1 Chapter 8 - Operator Overloading Outline 8.1 Introduction 8.2 Fundamentals of Operator Overloading 8.3 Restrictions on Operator Overloading 8.4 Operator Functions as Class Members vs. as friend Functions 8.5 Overloading Stream-Insertion and Strea... Date Added: 2009-06-04 15:34:54 |
| Chap8.ppt Path: Bellevue >> CIS >> 400 Fall, 2009 Description: 1 Chapter 8 - Operator Overloading Outline 8.1 Introduction 8.2 Fundamentals of Operator Overloading 8.3 Restrictions on Operator Overloading 8.4 Operator Functions as Class Members vs. as friend Functions 8.5 Overloading Stream-Insertion and Strea... Date Added: 2009-06-04 15:35:16 |
| Ch 01 Mgmt Basics.ppt Path: CSU Sacramento >> HROB >> 101 Fall, 2008 Description: Managing in Turbulent Times Chapter 1 Chapter Objectives y y y y y Define the term management and explain the managerial significance of the terms effectiveness and efficiency. Identify and summarize five major sources of change for today\'s manag... Date Added: 2009-06-04 15:35:25 |
| Lloyd079.ps Path: Allan Hancock College >> CCP >> 079 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: CCPsummaryhe.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips CCPsummaryhe.dvi %DVI... Date Added: 2009-06-04 15:35:49 |
| Hammura175.ps Path: Allan Hancock College >> CCP >> 175 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.83 (MiKTeX 1.20b) Copyright 1998 Radical Eye Software %Title: CCP2K_20000720_1.dvi %CreationDate: Fri Jul 21 15:08:55 2000 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radica... Date Added: 2009-06-04 15:36:00 |
| error.txt Path: Washington >> JOBS >> 32296 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 02:31:07 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 03:13:39 2008 ( 2552 s elapsed) ... Date Added: 2009-06-04 15:38:39 |
| error.txt Path: Washington >> JOBS >> 32000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 03:09:23 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 03:51:58 2008 ( 2555 s elapsed) ... Date Added: 2009-06-04 15:40:37 |
| Texas Powerpoint.ppt Path: NMSU >> EDUC >> 518 Fall, 2009 Description: TEXAS \"The State Where Everything\'s BIGGER\" BIG Texas Enjoyment Golf through the Great Texas Plains, Hills, and Beaches. www.touringtexas.com/golf/ Shop your Heart Out \"Deep in the Heart of Texas\"! www.shopacrosstexas.com Enjoy the Exci... Date Added: 2009-06-04 15:43:40 |
| poems_Teacher_cc3.doc Path: NMSU >> EDUC >> 518 Fall, 2009 Description: Teacher Driven Enthusiastic Singing Dancing Thinking Joy Purposeful Coordinator Teacher Underpaid Overworked Coloring Sculpting Transforming Exhorter Architect Demolishing Diminishing Ridiculing Discourager Destructor Dictator FACTS model in 25 words... Date Added: 2009-06-04 15:44:52 |
| grades_template.xls Path: NMSU >> EDLT >> 368 Fall, 2009 Description: Teacher: Subject: Year: Grading Scale 100-98% A+ 97-93% A 92-90% A- 89-88% B+ 87-83% B 82-80% B- Grade Student Names 1 2 3 4 5 6 7 8 9 10 9/4 9/12 9/13 9/16 9/20 9/23 9/24 9/30 10/1 10/1 89 95 75 65 29 79-78% C+ 69-68% D+ 77-73% C 67-63% D 72-7... Date Added: 2009-06-04 15:45:39 |
| Green is Green, Pearl Harbor.doc Path: NMSU >> ELT >> 36804 Fall, 2009 Description: Pearl Harbor; What Happened? Thematic Unit Planning Matrix Content Area EPSS-Focus Area Thematic Questions Centers Technology Assessment Student Products NM Content Integration and/or or Portfolio Standards (References, Rubric Scale with Software Ben... Date Added: 2009-06-04 15:45:57 |
| LESSON 2 MEASURING IN THE KITCHEN.doc Path: NMSU >> ELT >> 36802 Fall, 2009 Description: Lesson 2 ! ! !THIS LESSON WILL REQUIRE A TRIP TO THE GROCIERY STORE PRIOR TO THIS LESSON! ! ! MEASURING IN THE KITCHEN INGREDIENTS FRUIT SALAD 1 1/2 cups apples 2 cups oranges 1/2 tsp resins 1/4 tsp cinnamon 1/4 tsp ginger * 1 cantaloupe * 1/2 cup ... Date Added: 2009-06-04 15:46:27 |
| noteprob.ps Path: Berkeley >> CS >> 172 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: noteprob.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMBX12 CMBX10 CMTI10 CMMI10 CMSY10 CMR8 CMMI8 %+ MSBM10 CMSY8 CMCSC10 CMMI6 M... Date Added: 2009-06-04 15:46:46 |
| 03 002.xls Path: East Los Angeles College >> UKHR >> 0304 Fall, 2009 Description: Table 2 Average male and female earnings in Great Britain 1970 per week All fulltime men All fulltime women Fulltime manual men Fulltime manual women Percentages All women\'s earnings as a % of all men\'s earnings All manual women\'s earnings as a % of... Date Added: 2009-06-04 15:49:09 |
| 03 096.xls Path: East Los Angeles College >> UKHR >> 0304 Fall, 2009 Description: Table 96 Local authority dwelling stock, new dwellings and lettings in England Thousands 1982/83 1983/84 1984/85 1985/86 1986/87 1987/88 1988/89 1989/90 1990/91 Stock of dwellings1 Vacant dwellings1 Vacant dwellings as % of stock Completions Lettings... Date Added: 2009-06-04 15:49:24 |
| DFS_DSM_URLs.txt Path: UMass Lowell >> CS >> 515 Fall, 2009 Description: The URLs below provide excellent information on distributed file systems and distributed shared memory short subject papers from Paul Krzyzanowski http:/www.cs.rutgers.edu/~pxk/rutgers/notes/content/05-dfs.pdf http:/www.cs.rutgers.edu/~pxk/ru... Date Added: 2009-06-04 15:52:09 |
| error.txt Path: Washington >> JOBS >> 11500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:37:35 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:48:47 2008 ( 672 s elapsed) ... Date Added: 2009-06-04 15:54:02 |
| error.txt Path: Washington >> JOBS >> 11812 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 06:08:09 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 06:19:51 2008 ( 702 s elapsed) ... Date Added: 2009-06-04 15:54:38 |
| Browsing Vulnerabilities.doc Path: Georgia Tech >> ECE >> 4112 Fall, 2008 Description: ECE 4112: Internetwork Security Lab 12: Internet Browsing Vulnerabilities and Security Group Number: _ Member Names: _ _ Please read the entire lab and any extra materials carefully before starting. Be sure to start early enough so that you will ... Date Added: 2009-06-04 15:55:38 |
| error.txt Path: Washington >> JOBS >> 11500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:58:51 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 06:17:28 2008 ( 1117 s elapsed) ... Date Added: 2009-06-04 15:57:31 |
| 01 - Introduction and Class Overview.ppt Path: Presbyterian >> CSC >> 242 Fall, 2009 Description: CSC 242 Program Design II Introduction and Overview Dr. Paige H. Meeker Computer Science Presbyterian College, Clinton, SC Lecture 1 Introduction and Class Overview Syllabus Expectations Important Dates Contact Information Name: Office: Pho... Date Added: 2009-06-04 15:58:28 |
| log.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: 000 (57787.000.000) 02/11 10:25:36 Job submitted from host: <128.95.94.28:1098> . 001 (57787.000.000) 02/11 13:59:30 Job executing on host: <172.25.101.41:1057> . 006 (57787.000.000) 02/11 14:19:38 Image size of job updated: 408404 . 005 (57787.000.0... Date Added: 2009-06-04 15:59:44 |
| submit.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: executable = pass6_40277.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40277... Date Added: 2009-06-04 15:59:48 |
| log.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: 000 (57871.000.000) 02/11 10:26:11 Job submitted from host: <128.95.94.28:1098> . 001 (57871.000.000) 02/11 16:08:47 Job executing on host: <172.25.101.49:1056> . 006 (57871.000.000) 02/11 16:28:53 Image size of job updated: 359124 . 005 (57871.000.0... Date Added: 2009-06-04 16:00:10 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 19:17:46 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 20:27:45 2008 ( 4199 s elapsed) ... Date Added: 2009-06-04 16:00:38 |
| submit.txt Path: Washington >> JOBS >> 40258 Fall, 2009 Description: executable = pass6_40258.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40258... Date Added: 2009-06-04 16:00:41 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 19:19:30 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 20:31:09 2008 ( 4299 s elapsed) ... Date Added: 2009-06-04 16:02:16 |
| rfc342.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group Ellen Westheimer NIC #10421 BBN RFC #342 15 May 1972 Categories: F. G.3 Updates: RFC #332 Obsoletes: None ... Date Added: 2009-06-04 16:06:54 |
| rfc2053.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group E. Der-Danieliantz Request for Comments: 2053 AM Network Information Center Category: Informational October 1996 ... Date Added: 2009-06-04 16:07:00 |
| rfc3853.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group J. Peterson Request for Comments: 3853 Neustar Updates: 3261 July 2004 Category: Standards Track... Date Added: 2009-06-04 16:07:16 |
| rfc230.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group T. N. Pyke, Jr. Request for Comments 230 NBS NIC 7647 24 September 1971 Category: C5 Reference #203 TOWARD RE... Date Added: 2009-06-04 16:08:00 |
| rfc2347.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group G. Malkin Request for Commments: 2347 Bay Networks Updates: 1350 A. Harkin Obsoletes: 1782 ... Date Added: 2009-06-04 16:09:07 |
| rfc1083.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group Internet Activities Board Request for Comments: 1083 December 1988 IAB OFFICIAL PROTOCOL STANDARDS Status of this Memo This memo describe... Date Added: 2009-06-04 16:09:44 |
| rfc800.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group J. Postel Request for Comments: 800 J. Vernon ISI ... Date Added: 2009-06-04 16:10:40 |
| rfc1197.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group M. Sherman Request for Comments: 1197 CMU December 1990 Using ODA f... Date Added: 2009-06-04 16:11:00 |
| Exam #3 Part II S2003.xls Path: WPUNJ >> CS >> 130 Fall, 2008 Description: CS201-01 Computer Literacy and Microcomputer Applications Spring, 2003 Name Student #1 Student #2 Student #3 Student #4 Student #5 Student #6 Student #7 Student #8 Student #9 Student #10 Student #11 Student #12 Student #13 Student #14 Student #15 Cla... Date Added: 2009-06-04 16:12:41 |
| log.txt Path: Washington >> V >> 13348 Fall, 2009 Description: 000 (27993.000.000) 12/04 12:05:28 Job submitted from host: <128.95.94.28:4757> . 001 (27993.000.000) 12/04 17:41:28 Job executing on host: <172.25.101.175:1062> . 006 (27993.000.000) 12/04 18:01:36 Image size of job updated: 412876 . 005 (27993.000.... Date Added: 2009-06-04 16:15:01 |
| output.txt Path: Washington >> V >> 13267 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-895QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3764 12/04/2007 04:34 PM <DIR> . 12/04/2007 04:34 ... Date Added: 2009-06-04 16:15:27 |
| output.txt Path: Washington >> V >> 13000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-135QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is F8FE-2FC1 Directory of C:\\condor\\execute\\dir_972 12/04/2007 02:04 PM <DIR> . 12/04/2007 02:04 P... Date Added: 2009-06-04 16:19:17 |
| Project 2.06.doc Path: Fayetteville State University >> MCB >> 5505 Fall, 2009 Description: VIROLOGY SECOND ASSIGNMENT DUE BY 5:00 PM, APR 10, 2006 I WOULD LIKE YOU TO WRITE ON THE TOPIC OF PREVENTION AND TREATMENT OF VIRAL INFECTIONS. YOUR PAPER CAN BE A CRITIQUE OF A RESEARCH PAPER OR IT CAN BE ON A NARROW TOPIC RELATED TO VACCINES AND AN... Date Added: 2009-06-04 16:21:49 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05102477 Fall, 2009 Description: 05102477... Date Added: 2009-06-04 16:24:58 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05102477 Fall, 2009 Description: 05102477... Date Added: 2009-06-04 16:24:58 |
| Csp1994.fmt.sas.txt Path: NSULA >> SHERLOCK >> 10018 Fall, 2009 Description: FORMAT PUPID26c V001_F. FANST25c V002_F. EYOB26c V003_F. EAGE26c V004_F. AGE2G26c V005_F. SEX21 V006_F. MARST26c V007_F. MARMO26c V008_F. MOTN2G15 V009_F. BCNT2G15 V... Date Added: 2009-06-04 16:25:28 |
| Untitled-10.ps Path: Allan Hancock College >> ARHT >> 1002 Fall, 2009 Description: %!PS-Adobe-3.0%Title: (Untitled-1)%Creator: (Adobe Photoshop 7.0 \\244: LaserWriter 8 Z2-8.7)%CreationDate: (8:26 PM Thursday, September 12, 2002)%For: (philpott)%Pages: 1%DocumentFonts: %DocumentNeededFonts: % %DocumentSuppliedFonts: %DocumentData: C... Date Added: 2009-06-04 16:26:43 |
| Chapter 4.doc Path: Trinity U >> EXAM >> 5341 Fall, 2009 Description: Chapter 4 The Economics of Financial Reporting Regulation TRUE/FALSE 1. Financial reporting for publicly-listed companies in the United States was first regulated in the 1950s. ANS: F Congress empowered the Securities and Exchange Commission to regu... Date Added: 2009-06-04 16:27:15 |
| qryOurTableUses.xls Path: VCU >> INFO >> 463 Fall, 2001 Description: Sheet1 vti_encoding:SR|utf8-nl vti_timelastmodified:TR|24 Feb 2003 21:59:54 -0000 vti_extenderversion:SR|4.0.2.7802 vti_filesize:IR|16384 vti_assignedto:SR| vti_approvallevel:SR| vti_backlinkinfo:VX|classes/info463/2001fall/bcp\\ international/bcpi120... Date Added: 2009-06-04 16:28:45 |
| output.txt Path: Washington >> V >> 14000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-2W4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3252 02/02/2008 03:53 PM <DIR> . 02/02/2008 03:53 ... Date Added: 2009-06-04 16:29:37 |
| output.txt Path: Washington >> V >> 14000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-725QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2844 02/02/2008 02:45 PM <DIR> . 02/02/2008 02:45 ... Date Added: 2009-06-04 16:31:37 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 14:49:22 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 16:01:42 2008 ( 4340 s elapsed) ... Date Added: 2009-06-04 16:31:38 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14012.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:32:18 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14398.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:32:34 |
| fact1.txt Path: UMBC >> CS >> 202 Fall, 1997 Description: Factorial(0) = 1 Factorial(1) = 1 Factorial(2) = 2 Factorial(3) = 6 Factorial(4) = 24 Factorial(5) = 120 Factorial(6) = 720 Factorial(7) = 5040 Factorial(8) = 40320 Factorial(9) = 362880 ... Date Added: 2009-06-04 16:33:42 |
| fact4.txt Path: UMBC >> CS >> 202 Fall, 1997 Description: Factorial(0) = 1 Factorial(1) = 1 Factorial(2) = 2 Factorial(3) = 6 Factorial(4) = 24 Factorial(5) = 120 Factorial(6) = 720 Factorial(7) = 5040 Factorial(8) = 40320 Factorial(9) = 362880 ... Date Added: 2009-06-04 16:33:43 |
| index2.txt Path: UMBC >> CS >> 313 Fall, 2008 Description: Script started on Fri Sep 19 13:19:22 2003 linux3% nasm -f elf index2.asm linux3% ld index2.o linux3% linux3% gdb a.out GNU gdb Red Hat Linux (5.2-2) Copyright 2002 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Publ... Date Added: 2009-06-04 16:33:44 |
| log.txt Path: Washington >> V >> 10330 Fall, 2009 Description: 000 (43326.000.000) 01/29 07:24:23 Job submitted from host: <128.95.94.28:1098> . 001 (43326.000.000) 01/29 07:46:50 Job executing on host: <172.25.101.42:1057> . 005 (43326.000.000) 01/29 07:57:07 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 16:36:15 |
| error.txt Path: Washington >> V >> 10000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Jan 29 22:13:32 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Jan 29 23:19:48 2008 ( 3976 s elapsed) ... Date Added: 2009-06-04 16:37:15 |
| error.txt Path: Washington >> V >> 10000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Jan 29 22:45:36 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Jan 29 23:46:49 2008 ( 3673 s elapsed) ... Date Added: 2009-06-04 16:37:39 |
| output.txt Path: Washington >> V >> 10085 Fall, 2009 Description: = running on = COMPUTERNAME=PHYS-B7B7D6D83B - local directory - Volume in drive C has no label. Volume Serial Number is 3AC1-C3C4 Directory of C:\\condor\\execute\\dir_2852 01/29/2008 12:08 PM <DIR> . 01/29/2008 12:08 ... Date Added: 2009-06-04 16:37:42 |
| submit.txt Path: Washington >> V >> 10141 Fall, 2009 Description: executable = allgamma_10141.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs10000-10499/10... Date Added: 2009-06-04 16:38:14 |
| Solid Rockets.ppt Path: Benjamin Franklin Institute of Technology >> MY >> 4262 Fall, 2009 Description: MAE 4262: ROCKETS AND MISSION ANALYSIS Overview of Solid Rockets April 3, 2008 Mechanical and Aerospace Engineering Department Florida Institute of Technology D. R. Kirk 1 SOLID PROPELLANT ROCKETS Solid fuel rockets rely on controlled explosion... Date Added: 2009-06-04 16:38:49 |
| Lecture_09_03.doc Path: San Jose State >> CS >> 157 Fall, 2009 Description: An Overview of Database Management Systems A. Shifting in the Pradign: 1. Data Processing to Data Mining OLTP to OLAP 2. OLTP: 2 second rules Jim Grey 3. System Reliability IBM MainFrame: Unix: 8 hour/yr hours unexpected DT 24 minutes/yr Scheduled Do... Date Added: 2009-06-04 16:39:19 |
| Glasses and registration activity diagrams-in class.doc Path: DePaul >> DGRANT >> 674 Fall, 2009 Description: Glasses Appointment : <unspecified> Patient info : <unspecified> Schedule Patient test reqs : <unspecified> old new Create Patient record Perform Vision Test Prescription : <unspecified> updated info : <unspecified> Update Patient record Se... Date Added: 2009-06-04 16:39:38 |
| readme.rtf Path: Wisc La Crosse >> CS >> 431 Fall, 2009 Description: to compile: (from the main directory) javac -classpath \".\" SoccerBots/League/TeamHunt/*.java to run: (from the main directory) java SoccerBots.Simulation.SoccerBotProgram ... Date Added: 2009-06-04 16:39:54 |
| hw1.ps Path: Stanford >> CS >> 255 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMR17 CMR10 CMMI10 CMMI8 CMSY10 CMR6 CMR8 CMMI6 %+ CMEX10 CMSS10 CMSY8 CMTI10 CM... Date Added: 2009-06-04 16:40:08 |
| hw1.ps Path: Stanford >> CS >> 355 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.66a Copyright 1986-97 Radical Eye Software (www.radicaleye.com) %Title: hw1.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips hw1.dvi -ohw1.ps %DVIPSParameters: dpi=600,... Date Added: 2009-06-04 16:40:10 |
| lecture16.doc Path: Midwestern State University >> ME >> 316 Fall, 2009 Description: ME 316 Spring 2000 Project Management Notes Lecture 16 and Lecture 17 March 8 and March 20, 2000 Refer to the project management notes that I passed out on March 6. Plan, Organize, Delegate, Lead, Monitor, Support, Report, Adjust, Finish ... Date Added: 2009-06-04 16:42:32 |
| chap-08v2.ppt Path: UMBC >> CMSC >> 621 Fall, 2008 Description: DISTRIBUTED SYSTEMS Principles and Paradigms Second Edition ANDREW S. TANENBAUM MAARTEN VAN STEEN Chapter 8 Fault Tolerance Tanenbaum & Van Steen, Distributed Systems: Principles and Paradigms, 2e, (c) 2007 Prentice-Hall, Inc. All rights reserved. ... Date Added: 2009-06-04 16:42:49 |
| chap-08v2.ppt Path: UMBC >> CSEE >> 621 Fall, 2009 Description: DISTRIBUTED SYSTEMS Principles and Paradigms Second Edition ANDREW S. TANENBAUM MAARTEN VAN STEEN Chapter 8 Fault Tolerance Tanenbaum & Van Steen, Distributed Systems: Principles and Paradigms, 2e, (c) 2007 Prentice-Hall, Inc. All rights reserved. ... Date Added: 2009-06-04 16:42:50 |
| fact4.txt Path: UMBC >> M >> 202 Fall, 2009 Description: Factorial(0) = 1 Factorial(1) = 1 Factorial(2) = 2 Factorial(3) = 6 Factorial(4) = 24 Factorial(5) = 120 Factorial(6) = 720 Factorial(7) = 5040 Factorial(8) = 40320 Factorial(9) = 362880 ... Date Added: 2009-06-04 16:44:46 |
| fact1.txt Path: UMBC >> M >> 202 Fall, 2009 Description: Factorial(0) = 1 Factorial(1) = 1 Factorial(2) = 2 Factorial(3) = 6 Factorial(4) = 24 Factorial(5) = 120 Factorial(6) = 720 Factorial(7) = 5040 Factorial(8) = 40320 Factorial(9) = 362880 ... Date Added: 2009-06-04 16:44:46 |
| class8.ps Path: Delaware >> CIS >> 659 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - class8 %Creator: PScript5.dll Version 5.2 %CreationDate: 3/10/2005 10:58:35 %For: Administrator %BoundingBox: (atend) %Pages: (... Date Added: 2009-06-04 16:45:23 |
| lec_0822.ppt Path: Arizona >> NATS >> 101 Fall, 2006 Description: NATS 101 Lecture 2 Atmospheric Composition and Vertical Structure Atmospheric Composition Permanent Gases rd Ahrens, Table 1.1, 3 Ed. N2 and O2 are most abundant gases Percentages hold constant up to 80 km Ar, Ne, He, and Xe are chemically iner... Date Added: 2009-06-04 16:45:28 |
| graphics.txt Path: Trinity U >> J >> 601 Fall, 2009 Description: directory: examples\\graphics Subdirectories contain graphics example scripts. isigraph - isigraph demos - see isigraph.txt plot - plot demos - see plot.txt ... Date Added: 2009-06-04 16:50:31 |
| log.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: 000 (53216.000.000) 02/07 04:21:19 Job submitted from host: <128.95.94.28:1098> . 001 (53216.000.000) 02/07 04:52:41 Job executing on host: <172.25.101.163:1059> . 005 (53216.000.000) 02/07 05:06:20 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 16:51:59 |
| submit.txt Path: Washington >> JOBS >> 11190 Fall, 2009 Description: executable = pass6_11190.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11000-11499/11190... Date Added: 2009-06-04 16:52:00 |
| log.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: 000 (53082.000.000) 02/07 04:20:24 Job submitted from host: <128.95.94.28:1098> . 001 (53082.000.000) 02/07 04:37:25 Job executing on host: <172.25.101.161:1061> . 005 (53082.000.000) 02/07 04:50:55 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 16:54:00 |
| log.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: 000 (53154.000.000) 02/07 04:20:56 Job submitted from host: <128.95.94.28:1098> . 001 (53154.000.000) 02/07 04:45:30 Job executing on host: <172.25.101.86:1057> . 005 (53154.000.000) 02/07 04:59:25 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 16:54:24 |
| submit.txt Path: Washington >> JOBS >> 11320 Fall, 2009 Description: executable = pass6_11320.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11000-11499/11320... Date Added: 2009-06-04 16:54:46 |
| output.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-50WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3164 02/07/2008 04:45 AM <DIR> . 02/07/2008 04:45 ... Date Added: 2009-06-04 16:56:17 |
| LiShen0505.ps Path: Dartmouth >> CS >> 188 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 (RS/6000 1.0) Copyright 1986-91 Radical Eye Software %Title: pap.dvi %Pages: 13 1 %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: tex.pro /TeXDict 250 dict def TeXDict begin /N /def load def /B{bind def}N /S ... Date Added: 2009-06-04 16:57:05 |
| 20081019-00z-925.ps Path: San Jose State >> ARCHIVE >> 925 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: %Creator: GEMPAK %EndComments %DocumentsFont:(atend) %Pages:(atend) /M {moveto} def /L {lineto} def /N {newpath} def /LW {setlinewidth} def /A {arc} def /AF {arc fill} def /MS {makefont setfont} def /FF {findfont} def /CF {curr... Date Added: 2009-06-04 17:01:00 |
| 20081014-00z-700.ps Path: San Jose State >> ARCHIVE >> 700 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: %Creator: GEMPAK %EndComments %DocumentsFont:(atend) %Pages:(atend) /M {moveto} def /L {lineto} def /N {newpath} def /LW {setlinewidth} def /A {arc} def /AF {arc fill} def /MS {makefont setfont} def /FF {findfont} def /CF {curr... Date Added: 2009-06-04 17:01:11 |
| 2mass_radec.txt Path: Berkeley >> ASTRO >> 00349592 Fall, 2009 Description: #ra dec hmag dhmag RAJ2000 DEJ2000 2MASS Jmag 196.412581 -75.814842 13053901-7548534 14.428 196.479677 -75.819786 13055512-7549112 11.992 196.449277 -75.815819 13054782-7548569 16.486 196.440155 -75.817871 13054563-7549043 14.448 196.447591 -75.81260... Date Added: 2009-06-04 17:02:46 |
| arf_pc.txt Path: Berkeley >> ASTRO >> 00336489 Fall, 2009 Description: ;instrument XRT ;exposure 57622.436 ;xunit kev ;bintype counts 0.0000000 0.0049999999 13.837683 1.00000 0.0049999999 0.0099999998 13.887056 1.00000 0.0099999998 0.015000000 13.936429 1.0... Date Added: 2009-06-04 17:03:01 |
| swb15-350lc.txt Path: Berkeley >> ASTRO >> 00152113 Fall, 2009 Description: # t-809072303.000000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -300.000000 -0.000015 0.007550 -0.028810 0.007339 -0.009586 0.006712 -0.008131 0.006639 -299.000000 -0.005960 0.007506 0.002073 0.00788... Date Added: 2009-06-04 17:05:02 |
| radvt.txt Path: Berkeley >> ASTRO >> 00332516 Fall, 2009 Description: # t1 t2 dt rad_min rad_max cts err scl bg bg_rat wt 0.078050 0.079209 0.001159 0. 16. 10.44 3.34 0.817710 2.000000 0.279570 1 0.079209 0.080834 0.001624 0. 16. 9.72 ... Date Added: 2009-06-04 17:05:19 |
| spec_pc.txt Path: Berkeley >> ASTRO >> 00315080 Fall, 2009 Description: # tmin tmax 10.0000 610.583 [ksec] ;instrument XRT ;exposure 52197.871 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.000000 0... Date Added: 2009-06-04 17:06:28 |
| swb_timeinfo.txt Path: Berkeley >> ASTRO >> 00201487 Fall, 2009 Description: #file=swbz_15-350lc.txt dt=0.02 tstart=0.120 tstop=1.200 #t90 dt90 t50 dt50 rt90 drt90 rt50 drt50 rt45 drt45 tav dtav tmax dtmax trise dtrise tfall dtfall cts cts_err pk_rate dpk_rate band 0.900 0.048 0.480 0.026 0.760 ... Date Added: 2009-06-04 17:06:41 |
| swbz_15-350lc.txt Path: Berkeley >> ASTRO >> 00332516 Fall, 2009 Description: # t-908862802.860000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -0.360000 -0.025142 0.034214 -0.008799 0.031431 0.027737 0.030987 -0.027084 0.030478 -0.340000 -0.062190 0.035226 0.022939 0.03518... Date Added: 2009-06-04 17:07:17 |
| swb_trig.txt Path: Berkeley >> ASTRO >> 00176918 Fall, 2009 Description: # S/N T1 T2 T90 T50 # Estimated T100 Interval: -5.750 73.450 T90= 60.720 19.8 -3.110 62.890 60.060 21.120 ... Date Added: 2009-06-04 17:08:54 |
| hist146d01.txt Path: Sveriges lantbruksuniversitet >> HIST >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 146-3 D01 LOCATION: SFU TITLE: AFRICA/RECENT HIST. SECTION TYPE: LEC SEMESTER: 1997-1 ENROL: 54... Date Added: 2009-06-04 17:11:57 |
| error.txt Path: Washington >> V >> 13000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Fri Feb 01 13:49:38 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Fri Feb 01 15:09:20 2008 ( 4782 s elapsed) ... Date Added: 2009-06-04 17:15:16 |
| submit.txt Path: Washington >> V >> 13462 Fall, 2009 Description: executable = allgamma_13462.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs13000-13499/13... Date Added: 2009-06-04 17:16:23 |
| error.txt Path: Washington >> JOBS >> 70529 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 02:11:54 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 03:34:09 2008 ( 4935 s elapsed) ... Date Added: 2009-06-04 17:17:03 |
| kamara.ppt Path: George Mason >> IT >> 862 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|21 Apr 2005 21:44:20 -0000 vti_extenderversion:SR|6.0.2.6551 vti_author:SR|LIST-7EB547307B\\Min vti_modifiedby:SR|LIST-7EB547307B\\Min vti_timecreated:TR|21 Apr 2005 21:44:20 -0000 vti_cacheddtm:TX|21 Apr... Date Added: 2009-06-04 17:18:28 |
| log.txt Path: Washington >> JOBS >> 70548 Fall, 2009 Description: 000 (60430.000.000) 02/16 21:25:12 Job submitted from host: <128.95.94.28:1092> . 001 (60430.000.000) 02/17 02:15:51 Job executing on host: <172.25.101.45:1056> . 006 (60430.000.000) 02/17 02:35:59 Image size of job updated: 479520 . 006 (60430.000.0... Date Added: 2009-06-04 17:19:18 |
| output.txt Path: Washington >> JOBS >> 70601 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-22WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1164 02/17/2008 02:32 AM <DIR> . 02/17/2008 02:32 ... Date Added: 2009-06-04 17:20:48 |
| d05-Enlace.ppt Path: Tulane >> SPAN >> 426 Fall, 2008 Description: Da 5 Cap. 4: El enlace entre Vs y entre Cs y Vs Fontica y fonologa espaolas SPAN 426 Harry Howard Tulane University Prueba 1 Tipografa/Fuentes AIP Bajar Doulos SIL (gratis) http:/scripts.sil.org/cms/scripts/page.php? site_id=nrsi&item_id=Doulo... Date Added: 2009-06-04 17:21:20 |
| IS 3950 proposal AW.docx Path: Kennesaw >> IS >> 3950 Fall, 2009 Description: KENNESAW STATE UNIVERSITY UNDERGRADUATE PROPOSAL New Course (Not General Education) I. Proposed Information Course Prefix and Number: IS 3950 Course Title: Global Technology Strategy Credit Hours (format should be # - # - #): 3 Prerequisites: Junior ... Date Added: 2009-06-04 17:21:34 |
| hist322d01.txt Path: Sveriges lantbruksuniversitet >> HIST >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 322-4 D01 LOCATION: SFU TITLE: ATLANTIC MIGRATION SECTION TYPE: SEM SEMESTER: 1998-1 ENROL: 24... Date Added: 2009-06-04 17:24:47 |
| hist375d01.txt Path: Sveriges lantbruksuniversitet >> HIST >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 375-0 D01 LOCATION: SFU TITLE: PRACTICUM II SECTION TYPE: SEC SEMESTER: 1998-1 ENROL: 1 ... Date Added: 2009-06-04 17:24:48 |
| 00000107.pdf Path: Carnegie Mellon >> TERA >> 31007295 Fall, 2009 Description: ... Date Added: 2009-06-04 17:25:36 |
| 00000107.pdf Path: Carnegie Mellon >> DISK >> 31007295 Fall, 2009 Description: ... Date Added: 2009-06-04 17:25:36 |
| 00000198.pdf Path: Carnegie Mellon >> TERA >> 31006254 Fall, 2009 Description: ... Date Added: 2009-06-04 17:26:26 |
| 00000198.pdf Path: Carnegie Mellon >> DISK >> 31006254 Fall, 2009 Description: ... Date Added: 2009-06-04 17:26:26 |
| log.txt Path: Washington >> V >> 16000 Fall, 2009 Description: 000 (49686.000.000) 02/05 03:00:06 Job submitted from host: <128.95.94.28:1098> . 001 (49686.000.000) 02/05 04:22:11 Job executing on host: <172.25.101.71:1055> . 006 (49686.000.000) 02/05 04:42:20 Image size of job updated: 407744 . 005 (49686.000.0... Date Added: 2009-06-04 17:26:55 |
| log.txt Path: Washington >> V >> 16000 Fall, 2009 Description: 000 (49882.000.000) 02/05 03:02:32 Job submitted from host: <128.95.94.28:1098> . 001 (49882.000.000) 02/05 06:42:58 Job executing on host: <172.25.101.168:1062> . 006 (49882.000.000) 02/05 07:03:06 Image size of job updated: 461596 . 005 (49882.000.... Date Added: 2009-06-04 17:27:10 |
| error.txt Path: Washington >> V >> 16000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 04:22:24 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 05:29:03 2008 ( 3999 s elapsed) ... Date Added: 2009-06-04 17:29:00 |
| submit.txt Path: Washington >> V >> 16000 Fall, 2009 Description: executable = allgamma_16027.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:29:14 |
| error.txt Path: Washington >> V >> 16000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 05:35:45 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 06:48:37 2008 ( 4372 s elapsed) ... Date Added: 2009-06-04 17:29:37 |
| log.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: 000 (61198.000.000) 02/17 07:26:55 Job submitted from host: <128.95.94.28:1092> . 001 (61198.000.000) 02/17 10:03:07 Job executing on host: <172.25.101.82:1057> . 006 (61198.000.000) 02/17 10:23:16 Image size of job updated: 390132 . 005 (61198.000.0... Date Added: 2009-06-04 17:33:04 |
| submit.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: executable = pass6_71321.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71000-71499/71321... Date Added: 2009-06-04 17:33:56 |
| log.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: 000 (60964.000.000) 02/17 07:25:30 Job submitted from host: <128.95.94.28:1092> . 001 (60964.000.000) 02/17 07:28:49 Job executing on host: <172.25.101.190:1057> . 006 (60964.000.000) 02/17 07:48:58 Image size of job updated: 16912 . 006 (60964.000.0... Date Added: 2009-06-04 17:34:58 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-1W4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3928 02/17/2008 10:03 AM <DIR> . 02/17/2008 10:03 ... Date Added: 2009-06-04 17:35:04 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-895QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2424 02/17/2008 08:44 AM <DIR> . 02/17/2008 08:44 ... Date Added: 2009-06-04 17:36:57 |
| The Design Process - Cassie Kennett.ppt Path: New Hampshire >> CS >> 502 Fall, 2008 Description: The Design Process By Cassandra Kennett What is a \"design process\"? A design process is a logical method of setting up for, designing, and implementing a website. Why is a process important? Helps prevent problems further down the road Helps to d... Date Added: 2009-06-04 17:39:45 |
| v04-n535.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From: Cdn-Firearms Digest [owner-cdn-firearms-digest@sfn.saskatoon.sk.ca] Sent: Monday, 11 February, 2002 11:28 To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Digest V4 #535 Cdn-Firearms Digest Monday, February 11 20... Date Added: 2009-06-04 17:39:54 |
| midxword-soln.txt Path: Midwestern State University >> CS >> 355 Fall, 2009 Description: * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * I R * * I N T E R R U P T P P E * * H C O N S T R U C T O R... Date Added: 2009-06-04 17:39:59 |
| BUSN3025 Seminar 5 Comparative HR.ppt Path: Allan Hancock College >> BUSN >> 3025 Fall, 2009 Description: The role of HR Copyright 20032006, Chris Chan Competitive advantage through people If you are planning for one year, grow rice. If you are planning for 20 years grow trees. If you are planning for centuries, grow men. Chinese Proverb .virtually a... Date Added: 2009-06-04 17:40:12 |
| McKusick - LDA.ppt Path: CSU Mont. Bay >> STAT >> 6601 Fall, 2009 Description: Linear Discriminant Analysis Two approaches Fisher & Mahalanobi For two-group discrimination essentially equivalent to multiple regression For multiple groups - essentially a special case of canonical correlation JBR 1 LDA Fishers Approach Bas... Date Added: 2009-06-04 17:40:20 |
| ps9.ps Path: Washington >> STAT >> 521 Fall, 2008 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>0659e9c20fed3ec2b9598ab121eeb70d0593eccf.ps</Key><RequestId>77 0E1FAF086C26DB</RequestId><HostId>uc1dE1Wz3iCZ3gYLqn3nx/3Qq8Zg... Date Added: 2009-06-04 17:40:54 |
| hist145quiz7ans.doc Path: Western Michigan >> HIST >> 145 Fall, 2009 Description: History 145 Quiz #7 (Fall 2003) (Answers are in bold after the questions) 1. The most powerful of all the \"lawyer-popes\" was Innocent III, who ruled the Church from 1198-1216. 2. True or False: Our primary source readings from Pope Innocent III (two ... Date Added: 2009-06-04 17:44:44 |
| INFO.TXT Path: UCLA >> CACHE >> 5001 Fall, 2009 Description: Sheet1 PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2004-02-01 NOTE = \"Text describes the directory contents.\" END_OBJECT = TEXT END This data set includes full resolution electric and magnetic wave spectra obtained dur... Date Added: 2009-06-04 17:44:58 |
| GehaniPsyOrf322S05Paper.doc Path: Princeton >> PSYORF >> 322 Fall, 2009 Description: Memory Tasks with Variations and Distractions: Implications of Experiments in PowerPoint with Respect to Systems of the Model Human Processor Abstract Our primary focus in this project was to examine the functions of certain processes of the Model H... Date Added: 2009-06-04 17:45:13 |
| LAXDialog.doc Path: USC >> CSCI >> 201 Fall, 2009 Description: TYPICAL TRANSMISSIONS FOR ARRIVALS AT LOS ANGELES TOWER SWA111/112-Southwest One Eleven/Twelve LC-2-Local Control Two (North Tower) GC-2-Ground Control Two (North Ground) CD-Clearance Delivery SWA111 Los Angeles Tower, this is Southwest One Eleven fi... Date Added: 2009-06-04 17:46:59 |
| FED_FC_ExitCriteria_IIVV_F08a_T04_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Reviewer: Xu Chu Lin Team: 4 Project: UNO Web Tools FED Exit Criteria Description Exit Criteria # 1 2 3 4 5 6 Introduction of Feasible Evidence Description Documentation Purpose of the Feasible Evidence Description shall be presented Status of the... Date Added: 2009-06-04 17:47:46 |
| CryptoVoting-Mehmud.ppt Path: Pittsburgh >> CS >> 2530 Fall, 2008 Description: CRYPTOGRAPHIC VOTING PROTOCOLS: A SYSTEMS PERSPECTIVE Chris Karlof, Naveen Sastry, David Wagner Presented by: Mehmud Abliz Motivation Trustworthy voting system is crucial part of building democracy. Popular voting protocols by Neff and Chaum pr... Date Added: 2009-06-04 17:50:10 |
| group4.des1.1.txt Path: N.C. State >> PAGES >> 330 Fall, 2009 Description: Group 4: Hide Me Strengths: Cube is a nice metaphor. Profiles are nice, a nice segmentation of who, what and how. Weaknesses: Seems that watch I/O is mostly for picking profiles. Might I want to change a person\'s group, or special case ... Date Added: 2009-06-04 17:54:45 |
| 31SPassign271.doc Path: MSCD >> AES >> 271 Fall, 2009 Description: 2710 Class Period 31 Tuesday May 12th The Final Flying Portion 14:30 16:30 Simulator assignments: 157K 180E 148J 179B 120H 177D 182G 178C 181F 147A Part I Navigation & Approach Flight: Today we will take off from Raton Muni (KRTN) Runway 20 ... Date Added: 2009-06-04 17:55:19 |
| marc.txt Path: Carnegie Mellon >> TERA >> 31003206 Fall, 2009 Description: * FORM=MARC .000. |aamI c .001. |aocm00865748 820525 .008. |a740424|1852| |eng u .010. |a 05034378 .035. |a(Sirsi) o00865748 .049. |aPMCC|c1|v1 [!38482001260963\"]|v2 [!38482001260971\"]|v3 [!38482001260989\"]|v4 [!38482001260997\"] .092... Date Added: 2009-06-04 17:56:14 |
| marc.txt Path: Carnegie Mellon >> DISK >> 31003206 Fall, 2009 Description: * FORM=MARC .000. |aamI c .001. |aocm00865748 820525 .008. |a740424|1852| |eng u .010. |a 05034378 .035. |a(Sirsi) o00865748 .049. |aPMCC|c1|v1 [!38482001260963\"]|v2 [!38482001260971\"]|v3 [!38482001260989\"]|v4 [!38482001260997\"] .092... Date Added: 2009-06-04 17:56:15 |
| class2.ppt Path: Pittsburgh >> IS >> 1044 Fall, 2009 Description: Research Methods Data collection Independent variables Systems vs. Features Validity vs. Generalizability Statistical vs. Practical Validity Experimental means Cause & Effec... Date Added: 2009-06-04 17:56:32 |
| HW4.doc Path: SUNY Fredonia >> CSIT >> 413 Fall, 2009 Description: HW#4, CSIT413 Computer Architecture Fall 2002 Semester SUNY at Fredonia, Fredonia, New York Maximum Marks 5 This is a Group/Individual Assignment Assigned: 3rd December Due: 10th December Q1. a. b. Q2 Page 299 Textbook1 Q8 Page 299 Textbook1 2 Ma... Date Added: 2009-06-04 17:57:40 |
| SPCH100A26024775.doc Path: MD University College >> ASIA >> 2092 Fall, 2009 Description: UNIVERSITY OF MARYLAND UNIVERSITY COLLEGE ASIAN DIVISION, GUAM SPEECH 100 Foundations of Speech Communication Spring Term, Session 2 March 22 - May 16, 2009 Mon. & Wed. 1645-1930 Andersen AFB Syllabus Instructor: Jefferson Cronin, Collegiate Assoc... Date Added: 2009-06-04 17:58:37 |
| preface.txt Path: Colgate >> PAGES >> 248 Fall, 2009 Description: PREFACE Kamma concerns everyone. We make it, a great deal of it, every day while we are awake. We decide whether or not to get up - kamma. (Good kamma if one gets up vigorously, bad kamma if slothfull... Date Added: 2009-06-04 17:59:03 |
| guenther.pdf Path: Wisconsin >> WEB >> 861 Fall, 2009 Description: Preserving the personal touch of library services in a digital world Kim Guenther Computers in Libraries; Sep 2000; 20, 8; Research Library Core pg. 57 Reproduced with permission of the copyright owner. Further reproduction prohibited without permis... Date Added: 2009-06-04 18:00:21 |
| assignment3.doc Path: Rutgers >> LIU >> 322 Fall, 2009 Description: Econometrics: Assignment 3 Due Tuesday, Nov 7 Download the data set from the course website. The cross-sectional data set contains three variables Wage, Educ and Exper. It takes only one command line to run the linear regression on a model Y = 0 + 1... Date Added: 2009-06-04 18:01:44 |
| Prog5File4.txt Path: MD University College >> CS >> 221 Fall, 2009 Description: Welcome to the AFDB Homepage! This non-commercial site is dedicated to spreading the word about the Aluminum Foil Deflector Beanie and how it can help the average human. Here you will find a description of AFDBs, how to make and use them, and general... Date Added: 2009-06-04 18:02:28 |
| critiques.doc Path: Boise State >> COMM >> 101 Fall, 2008 Description: PERSUASIVE SPEECH CRITIQUE Speaker Time Each criterion rates as follows: 1 = superior 3 = average Topic Critic 2 = above average 4 = needs special attention COMMENTS 1 1 1 1 1 1 1 1 1 1 2 2 2 2 3 3 3 4 4 4 4 4 4 4 4 4 CRITERIA INTRODUCTION: gained a... Date Added: 2009-06-04 18:02:42 |
| 2409.pdf Path: UPenn >> FINANCE >> 2400 Fall, 2009 Description: 2409 Retroactive Pay Effective: December 1986 Revised: July 2006 Last Reviewed: May 2007 Responsible Office: Comptroller Approval: Comptroller View PDF Version Purpose To establish policy for the payment of retroactive salary adjustments as the resu... Date Added: 2009-06-04 18:04:22 |
| 00000019.pdf Path: Carnegie Mellon >> TERA >> 05101977 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:28 |
| 00000019.pdf Path: Carnegie Mellon >> DISK >> 05101977 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:28 |
| 00000024.pdf Path: Carnegie Mellon >> DISK >> 05102107 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:23 |
| 00000026.pdf Path: Carnegie Mellon >> DISK >> 05102107 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:23 |
| 00000003.pdf Path: Carnegie Mellon >> DISK >> 05101222 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:35 |
| 00000054.pdf Path: Carnegie Mellon >> DISK >> 05101975 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:19 |
| 00000054.pdf Path: Carnegie Mellon >> TERA >> 05101975 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:19 |
| 00000013.pdf Path: Carnegie Mellon >> TERA >> 05102225 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:48 |
| 00000013.pdf Path: Carnegie Mellon >> DISK >> 05102225 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:48 |
| 00000055.pdf Path: Carnegie Mellon >> DISK >> 05101950 Fall, 2009 Description: ... Date Added: 2009-06-04 18:09:34 |
| 00000022.pdf Path: Carnegie Mellon >> DISK >> 05102124 Fall, 2009 Description: ... Date Added: 2009-06-04 18:11:16 |
| 00000038.pdf Path: Carnegie Mellon >> DISK >> 05102124 Fall, 2009 Description: ... Date Added: 2009-06-04 18:11:19 |
| 00000043.pdf Path: Carnegie Mellon >> DISK >> 05101576 Fall, 2009 Description: ... Date Added: 2009-06-04 18:11:43 |
| 00000029.pdf Path: Carnegie Mellon >> DISK >> 05101979 Fall, 2009 Description: ... Date Added: 2009-06-04 18:12:35 |
| 00000033.pdf Path: Carnegie Mellon >> TERA >> 05102861 Fall, 2009 Description: ... Date Added: 2009-06-04 18:12:49 |
| 00000033.pdf Path: Carnegie Mellon >> DISK >> 05102861 Fall, 2009 Description: ... Date Added: 2009-06-04 18:12:49 |
| 00000048.pdf Path: Carnegie Mellon >> DISK >> 05102109 Fall, 2009 Description: ... Date Added: 2009-06-04 18:13:17 |
| 00000009.pdf Path: Carnegie Mellon >> DISK >> 05101288 Fall, 2009 Description: ... Date Added: 2009-06-04 18:13:52 |
| p3.txt Path: Utah State >> CS >> 6670 Fall, 2008 Description: TTGACGGATCAAAAGAAAAAAAAACTACCTTCCCCTTGAATGATTT... Date Added: 2009-06-04 18:14:48 |
| chapter6.pdf Path: UCSC >> CS >> 111 Fall, 2009 Description: Chapter 6: File Systems File systems Files Directories terabytes -> petabyte... Date Added: 2009-06-04 18:15:33 |
| a15.rtf Path: UWO >> INSTRUCT >> 281 Fall, 2009 Description: Psychology 281(001) Assignment #15 February 12, 2007 1. Subjects were randomly assigned to one of four groups in an exploratory study of the effect of different drugs on motion sickness. The data provided below were subjected to an analysis of va... Date Added: 2009-06-04 18:16:49 |
| make_stars.txt Path: Harvard >> MAR >> 3103 Fall, 2009 Description: ./make_stars.pl -starcat starcat.dat.04245 -ra 217.846823 -dec 33.456837 -roll 140.783557 -si ACIS-I ./make_stars.pl -starcat starcat.dat.04229 -ra 217.846964 -dec 33.864225 -roll 140.783301 -si ACIS-I ./make_stars.pl -starcat starcat.dat.03656 -ra... Date Added: 2009-06-04 18:21:32 |
| CIS 388 Syllabus.doc Path: Benedictine IL >> CIS >> 388 Winter, 2009 Description: CIS 388 / MIS 683 / MBA 683 Project Management Syllabus Winter 2005 1. Instructor: Office: Office Hours: Dr. John Kevin Doyle SL 154 Tuesday: Noon 4:00pm Wednesday: Noon 4:00pm or by appointment Phone: (630) 829-6578 Fax: (630) 829-6226 (please us... Date Added: 2009-06-04 18:22:54 |
| Project Requirements.doc Path: Benedictine IL >> CMSC >> 398 Spring, 2009 Description: CMSC 398 Capstone Project Project Requirements Assigned January 23, 2006; Due February 20, 2006 As a team, develop, review and submit the Requirements Specification for your team project. Reproduced below is the description of the Requirements Speci... Date Added: 2009-06-04 18:23:18 |
| The Rail Gun 2.pdf Path: CSU Sacramento >> EEE >> 244 Fall, 2008 Description: The Rail Gun Basic Design and Principles of Operation Rail Gun Design The fundamental rail gun design derives from the concept of a linear electromagnetic motor. A conducting bar (the armature) slides along two parallel conducting rails placed in a ... Date Added: 2009-06-04 18:23:20 |
| GradComAgenda042806.doc Path: CSU Sacramento >> INDIV >> 42806 Fall, 2009 Description: EEE Graduate Committee Meeting Agenda 4/28/06 1. 2. 3. 4. Information Items Graduate Course Offerings for next Fall Final Review Communications area Core Courses: EEE 211 and EEE 260 Discussion, Kumar Proposed Changes to EEE 201: Assessment of Tec... Date Added: 2009-06-04 18:23:28 |
| python_intro_followup.pdf Path: Bucknell >> PH >> 211 Fall, 2008 Description: Followup to Introductory Python/VPython Exercises By the end of class today I think that most of you had a simulation of a red ball traveling at constant speed in a path perpendicular to two blue plates, and most of you had the ball bouncing off of a... Date Added: 2009-06-04 18:23:54 |
| ABC Analysis in class.xls Path: Texas A&M >> IDIS >> 344 Fall, 2008 Description: IDIS 344 : ABC Inventory Analysis Lab Name : ItemNo AA BB CC DD EE FF GG HH II JJ KK LL MM NN OO PP QQ RR SS TT UoM EA EA EA EA EA RL EA EA EA EA EA EA EA EA EA EA EA EA EA EA Total Hits 63 96 86 69 78 34 84 220 45 109 19 67 39 92 74 75 97 65 57 36... Date Added: 2009-06-04 18:24:30 |
| Imp-1.doc Path: UMKC >> CS >> 590 Fall, 2009 Description: Implementation Phase I eQuotes Group members: Arpan Biswas Gaurav Sharma Ajay Mansata Sameer Yeolekar eQuotes Introduction eQuotes aims to establish an application delivered as a service that can be integrated with other Web Services using Inter... Date Added: 2009-06-04 18:26:35 |
| quiz2-fall2004-B-sol.pdf Path: UCSC >> CMPE >> 110 Winter, 2008 Description: ( \'\" %#2 d 2 \'d( ! @ He9 A 9 8 (#m lm k ) 3 ) 7 d4243 1 m 5 ) 3 1 ) 64%20 22D029HlpeD9A jjDA8l9%(nj42%29(%i(%9%09p8%9DyP8 ) i x 7 5 ) ) 1 & ... Date Added: 2009-06-04 18:26:52 |
| HIST156A36026861.doc Path: MD University College >> ASIA >> 2092 Fall, 2009 Description: University of Maryland University College Asia History of the United States to 1865 (HIST156) Instructor: Class Meeting: Dates: Email: Laird J. Small Tuesday and Thursday 1930-2210 March 31 through May 16, 2009 laird_small@hotmail.com Course Descri... Date Added: 2009-06-04 18:27:14 |
| typography essay.doc Path: Texas >> E >> 603 Fall, 2008 Description: Ashley Powell Bump E603A A Self-Reflection After close analysis of my answers to the many random inquiries into my personal thoughts and habits, the computer finds me to possess the personality type of an intuitive, feeling, and judging extrovert (h... Date Added: 2009-06-04 18:27:35 |
| List questions 09A.pdf Path: Maryland >> BSCI >> 410 Fall, 2008 Description: BSCI 410-Liu/SP09 Supplementary questions & terms in preparation for Exm#1 1.Translate following mRNA into a protein (remember from START codon to STOP codon). 5\'aaccauggauacaccagauaagaaccgcaucuccgccguuuccuucugcaacuucgaggauucuccaguuuucaaaua accuu3\'... Date Added: 2009-06-04 18:28:33 |
| lecture3.ppt Path: Arkansas >> CSCE >> 5723 Fall, 2009 Description: IP and Errors IP Best Effort Datagrams can be: Lost Delayed Duplicated Delivered out of order Corrupted Internet Control Message Protocol (ICMP) Separate Protocol for Errors and Information Part of IP Sends Error Messages to Original Sourc... Date Added: 2009-06-04 18:29:24 |
| are100b-sample-midterm-1-key.pdf Path: UC Davis >> ARE >> 100 Fall, 2009 Description: ... Date Added: 2009-06-04 18:30:15 |
| sgf00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090123 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09012312_upa.wxp Date: 1200Z 23 JAN 09 Searching for KSGF. Searching the city database file for: KSGF . Date:1200Z 23 JAN 09 Station: KSGF... Date Added: 2009-06-04 18:31:56 |
| sgf12z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20081220 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/08122000_upa.wxp Date: 0000Z 20 DEC 08 Searching for KSGF. Searching the city database file for: KSGF . Date:0000Z 20 DEC 08 Station: KSGF... Date Added: 2009-06-04 18:33:08 |
| bis12z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090322 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.49-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09032200_upa.wxp Date: 0000Z 22 MAR 09 Searching for KBIS. Searching the city database file for: KBIS . Date:0000Z 22 MAR 09 Station: KBIS W... Date Added: 2009-06-04 18:34:06 |
| testBook.txt Path: Oregon State >> CS >> 440 Fall, 2008 Description: The Project Gutenberg Etext of Leaves of Grass, by Walt Whitman #1 in our series by Walt Whitman Copyright laws are changing all over the world, be sure to check the copyright laws for your country before posting these files! Please take a look at... Date Added: 2009-06-04 18:35:28 |
| hw4_sol.ps Path: Southern Oregon >> AME >> 3623 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw4.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMR17 CMR12 CMBX12 CMTI12 CMMI12 CMSY10 CMBXTI10 %DocumentPaperSizes: a4 %EndComments %... Date Added: 2009-06-04 18:36:05 |
| schedule.pdf Path: Arizona >> SPS >> 091603 Fall, 2009 Description: NCURA A Primer on Intellectual Property for the Research Administrator 2003 Video Workshop Series Broadcast live on September 16, 2003 from Washington, DC 11:30 AM to 3:30 PM Eastern. SCHEDULE FOR THE DAY 11:30 - 11:35 am 11:35 - 11:45 am 11:45 - 12:... Date Added: 2009-06-04 18:37:12 |
| RugbyQuiz.ppt Path: Slippery Rock >> PETE >> 3318 Fall, 2009 Description: Rugby Quiz By: Matthew May Directions: Answer the following questions Select the correct answer by clicking on the answer Click Action button to advance Which of the following is not a rugby position? Hooker Fullback Flanker Guard Oops! So... Date Added: 2009-06-04 18:40:01 |
| Compint.ppt Path: Illinois State >> MATH >> 119 Fall, 2009 Description: Compound interest Section 6.6 Compound interest Deposit P dollars in account at beginning of time. Account earns interest, then interest is added to account balance. Next time the interest is calculated, you earn interest, not only on the original a... Date Added: 2009-06-04 18:41:22 |
| Chem 144 B6 Synth Word.pdf Path: UCLA >> CHEM >> 144 Fall, 2008 Description: Organic Synthesis Chem 144 M. E. Jung Retrosynthetic Scheme OH OH OH CHO RNH OR OR O Me N Pyridoxine Vitamin B6 Me Me RO O OR NHR O NHR Me O NHR RO OR RO OR Me Synthesis MeO2C Me O NH2 1) E 2) H2/cat 3) E = CO2Me OH AcO Br2 MeOH KOAc Me MeO O OMe ... Date Added: 2009-06-04 18:41:31 |
| output.txt Path: Washington >> JOBS >> 20442 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3204 02/09/2008 05:01 PM <DIR> . 02/09/2008 05:01 ... Date Added: 2009-06-04 18:44:17 |
| output.txt Path: Washington >> JOBS >> 20132 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-725QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1964 02/09/2008 04:37 PM <DIR> . 02/09/2008 04:37 ... Date Added: 2009-06-04 18:44:19 |
| submit.txt Path: Washington >> JOBS >> 20181 Fall, 2009 Description: executable = pass6_20181.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs20000-20499/20181... Date Added: 2009-06-04 18:44:26 |
| output.txt Path: Washington >> JOBS >> 20329 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-325QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3076 02/09/2008 04:53 PM <DIR> . 02/09/2008 04:53 ... Date Added: 2009-06-04 18:44:46 |
| output.txt Path: Washington >> JOBS >> 20388 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS2 - local directory - Volume in drive C has no label. Volume Serial Number is EE42-0B89 Directory of C:\\condor\\execute\\dir_2184 02/09/2008 04:57 PM <DIR> . 02/09/2008 04:57 PM <D... Date Added: 2009-06-04 18:44:54 |
| log.txt Path: Washington >> JOBS >> 20316 Fall, 2009 Description: 000 (54312.000.000) 02/09 15:00:41 Job submitted from host: <128.95.94.28:1098> . 001 (54312.000.000) 02/09 15:12:08 Job executing on host: <172.25.101.163:1093> . 005 (54312.000.000) 02/09 15:13:26 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 18:45:11 |
| output.txt Path: Washington >> JOBS >> 20484 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-83WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1444 02/09/2008 05:05 PM <DIR> . 02/09/2008 05:05 ... Date Added: 2009-06-04 18:45:42 |
| submit.txt Path: Washington >> JOBS >> 20453 Fall, 2009 Description: executable = pass6_20453.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs20000-20499/20453... Date Added: 2009-06-04 18:46:22 |
| error.txt Path: Washington >> JOBS >> 20002 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 09 16:41:27 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Application failed, returning error code 1 Current time: Sat Feb 09 16:43:12 2008 ( ... Date Added: 2009-06-04 18:47:07 |
| screenbuffers.ppt Path: Syracuse >> ECS >> 102 Fall, 2008 Description: char sb[5][8]; /* 5 rows, 8 columns*/ sb MEMORY 0 1 2 3 4 5 6 7 0 1 2 3 4 MONITOR Welcome to my cluttered computer screen char sb[5][8]; /* 5 rows, 8 columns*/ sb MEMORY 0 1 2 3 4 5 6 7 0 1 2 3 4 void clearbuffer(char sb[][8]) { int row,col; f... Date Added: 2009-06-04 18:50:45 |
| Lect30.ppt Path: Trinity U >> CSCI >> 1320 Fall, 2009 Description: Strings and Command Line Arguments 11-15-2002 Opening Discussion What did we talk about last class? Do you have questions about the assignment? Questions on Minute Essays How to initialize and array of structures. What is \">\"? Why use struct... Date Added: 2009-06-04 18:52:15 |
| hmwk10.pdf Path: Iowa State >> STAT >> 101 Fall, 2008 Description: STATISTICS 101 - Homework 10 Due Friday, April 24, 2009 This is the last homework assignment you will turn in for credit this semester. 1. Hallux abducto valgus (call it HAV) is a deformation of the big toe that is not common in youth and often requ... Date Added: 2009-06-04 18:53:10 |
| Should Dinosaurs Be.doc Path: VMI >> HNS >> 376 Fall, 2009 Description: Should Dinosaurs Be \"Cloned\" from Ancient DNA? by Constance M. Soja, Department of Geology, and Deborah Huerta, Science Library, Colgate University PART I: INTRODUCTION The year is 2020. You have pursued various careers in science, business, medicine... Date Added: 2009-06-04 18:53:19 |
| proposal-david.ps Path: Berkeley >> CS >> 252 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: 252-proposal.dvi %CreationDate: Tue Mar 15 05:14:56 2005 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMR10 CMBX12 CMTI10 CMSY10 CMMI10 %Doc... Date Added: 2009-06-04 18:54:59 |
| syllabus fall 2006.pdf Path: Wisconsin >> PHILOSOPHY >> 211 Fall, 2009 Description: Philosophy 211: Elementary Logic-Fall 2006 Instructor: Joel Velasco (jdvelasc@wisc.edu) Class Website: http:/philosophy.wisc.edu/velasco/211 Office: 5166 Helen C. White Phone: 263-0776 (no voice mail) Office Hours: Tuesday at 6:30 pm and Thursday at ... Date Added: 2009-06-04 18:55:27 |
| StringBrakeDynoInstructions.pdf Path: North Texas >> MEEN >> 1110 Fall, 2008 Description: String Brake Dynamometer Instructions 1. Attach motor or transmission system with clamp. 2. Use supplied rubber coupling to connect your motor or transmission to the Dynamometer axle 3. Adjust tension screw so that each spring scale reads approximate... Date Added: 2009-06-04 18:56:14 |
| chapter6.pdf Path: UCSC >> CSE >> 111 Fall, 2009 Description: Chapter 6: File Systems File systems Files Directories terabytes -> petabyte... Date Added: 2009-06-04 18:58:14 |
| intro.ppt Path: UMBC >> CMSC >> 0101 Fall, 2009 Description: CS 331, Principles of Programming Languages Introduction Objectives To introduce several different paradigms of programming But isn\'t one language pretty much like another? No! To gain experience with these paradigms by using example programming... Date Added: 2009-06-04 19:04:30 |
| Poultry8st.pdf Path: Penn State >> SOILS >> 418 Fall, 2008 Description: (814) 863-0841 Fax (814) 863-4540 Agricultural Analytical Services Laboratory The Pennsylvania State University University Park PA 16802 http:/www.aasl.psu.edu SOIL TEST REPORT FOR: MR. C. M. BYRD RD 3 HALIFAX PA 17032 DATE LAB # S02-02620 SERIAL #... Date Added: 2009-06-04 19:10:31 |
| HW06Solutions.pdf Path: N.C. State >> MAE >> 412 Fall, 2008 Description: ... Date Added: 2009-06-04 19:15:56 |
| MAE316NotesNonSymmStressDefl.pdf Path: N.C. State >> MAE >> 316 Fall, 2008 Description: ... Date Added: 2009-06-04 19:16:04 |
| lecture02.ppt Path: Arizona >> NATS >> 101 Fall, 2006 Description: NATS 101 Lecture 2 Atmospheric Composition and Vertical Structure Atmospheric Composition Permanent Gases rd Ahrens, Table 1.1, 3 Ed. N2 and O2 are most abundant gases Percentages hold constant up to 80 km Ar, Ne, He, and Xe are chemically iner... Date Added: 2009-06-04 19:17:13 |
| L17.ppt Path: UMBC >> CS >> 104 Fall, 2009 Description: Functions, Part 3 of 3 Topics: Coding Practice o o In-Class Project: The Box In-Class Project: Drawing a Rectangle Reading: None 1 L17 Coding Practice Let\'s take the algorithms that we developed in \"Algorithms, Part 3 of 3\", modularize them, ... Date Added: 2009-06-04 19:25:45 |
| intro.ppt Path: UMBC >> CS >> 0101 Fall, 2009 Description: CS 331, Principles of Programming Languages Introduction Objectives To introduce several different paradigms of programming But isn\'t one language pretty much like another? No! To gain experience with these paradigms by using example programming... Date Added: 2009-06-04 19:26:11 |
| syl5636-spring09-Tue.doc Path: UH Clear Lake >> ISAM >> 5636 Spring, 2008 Description: ISAM 5636 Advanced Computer Networking Tuesdays, 16:00 18:50 Spring 2009 Instructor: Gokhan Gercek Classroom: SSB 2306 Office: SSB 3.202.8 Office Hours: Mon.: 15:00 16:00, Wed.: 16:00 17:15, Sat.: 12:00 14:00 Phone: 281-283-3178 E-mail: gercek@u... Date Added: 2009-06-04 19:30:27 |
| chap-08v2.ppt Path: UMBC >> CS >> 621 Fall, 2009 Description: DISTRIBUTED SYSTEMS Principles and Paradigms Second Edition ANDREW S. TANENBAUM MAARTEN VAN STEEN Chapter 8 Fault Tolerance Tanenbaum & Van Steen, Distributed Systems: Principles and Paradigms, 2e, (c) 2007 Prentice-Hall, Inc. All rights reserved. ... Date Added: 2009-06-04 19:42:04 |
| assn-1.doc Path: UNC >> COMP >> 110 Fall, 2007 Description: COMP 110 Spring 2008 Assignment 1: My very first web page Due: Mon. Jan 21 at 4:00 pm For this assignment you will create three web pages and store them in the University file system so that they may be retrieved via www.unc.edu/~yourOnyen. (p1) The ... Date Added: 2009-06-04 19:50:13 |
| E421-N-Resonance1.pdf Path: Dickinson State >> EE >> 421 Fall, 2009 Description: EE 421/621 1. Series Resonant Circuit Resonant Circuits Yuvarajan Vi is the rms value of input voltage whose frequency is varied. The looking-in impedance is given by 1 Z s ( j ) = R s + j L = R s + jX C Resonant Frequency At resonance ( ... Date Added: 2009-06-04 20:08:22 |
| AcidBase.pdf Path: Washburn >> CH >> 151 Fall, 2009 Description: 1. CH121 acid/base worksheet A solution contains 10.0 g of KOH in 500. mL. Calculate its expected pH.(13.6) _ 2. Calculate the hydrogen ion concentration in a 0.00500 M Mg(OH)2 solution.(1.00x10-12) _ 3. Calculate the hydrogen ion concentration in... Date Added: 2009-06-04 20:10:48 |
| CSM12C32_UG.pdf Path: Montana >> EE >> 475 Fall, 2008 Description: DOC-0328-010, REV D CSM12C32 Educational Module for Freescale MC9S12C32 Axiom Manufacturing 2813 Industrial Lane Garland, TX 75041 Email: Sales@axman.com Web: http:/www.axman.com CSM12C32 JUNE 8, 2005 CONTENTS CAUTIONARY NOTES ..4 FEATURES... Date Added: 2009-06-04 20:18:05 |
| lecture8.ppt Path: Duke >> X >> 296 Fall, 2009 Description: CompSci 296.2 Self-Managing Systems Shivnath Babu Reminder Slides and 2-page writeup due today Thursday: Control-theory paper Student presentations from next month Feb 21 (next Tuesday): Progress talk, <= 5 minutes Feb 23: Speaker from Cisco F... Date Added: 2009-06-04 20:24:05 |
| sec-I-1.pdf Path: Duke >> X >> 296 Fall, 2009 Description: 2 I Graphs I.1 Connected Components A theme that goes through this entire book is the transfer back and forth between discrete and continuous models of reality. In this first section, we compare the notion of connectedness in discrete graphs and... Date Added: 2009-06-04 20:24:33 |
| lshort.pdf Path: Duke >> X >> 234 Fall, 2009 Description: The Not So Short A Introduction to L TEX 2 A Or LTEX 2 in 129 minutes by Tobias Oetiker Hubert Partl, Irene Hyna and Elisabeth Schlegl Version 4.12, 13 April, 2003 ii Copyright 1995-2002 Tobias Oetiker and all the Contributers to LShort. All rights... Date Added: 2009-06-04 20:26:31 |
| lshort.pdf Path: Duke >> X >> 296 Fall, 2009 Description: The Not So Short A Introduction to L TEX 2 A Or LTEX 2 in 129 minutes by Tobias Oetiker Hubert Partl, Irene Hyna and Elisabeth Schlegl Version 4.12, 13 April, 2003 ii Copyright 1995-2002 Tobias Oetiker and all the Contributers to LShort. All rights... Date Added: 2009-06-04 20:26:37 |
| jason.ppt Path: Duke >> X >> 049 Fall, 2009 Description: The anatomy of a LargeScale Hypertextual Web Search Engine What we want from a search engine. Speed Quantity of Results Efficient Storage Space Quality of Results Google attempts to bring us all of these aspects from search. Precision of resu... Date Added: 2009-06-04 20:27:31 |
| final2007s.pdf Path: Carnegie Mellon >> CS >> 10701 Fall, 2009 Description: 10-701 Final Exam, Spring 2007 1. Personal info: Name: Andrew account: E-mail address: 2. There should be 16 numbered pages in this exam (including this cover sheet). 3. You can use any material you brought: any book, class notes, your print outs... Date Added: 2009-06-04 20:31:36 |
| VisualClusters-RSTB.pdf Path: Washington >> PSYCH >> 460 Fall, 2008 Description: Phil. Trans. R. Soc. B doi:10.1098/rstb.2005.1628 Published online Visual eld map clusters in human cortex Brian A. Wandell1,2,3,*, Alyssa A. Brewer2 and Robert F. Dougherty3 Psychology Department, 2Neurosciences Program, Psychology Department, and ... Date Added: 2009-06-04 20:34:36 |
| Figures_for_Lecture_05.pdf Path: Bard >> BIO >> 310 Fall, 2009 Description: Biology 310: Prokaryotic and Viral Genetics Conjugation Figure 5-1. Map of the F plasmid. Periplasmic space Cell exterior Ribbon representation of the complete TrwB, including a model for the transmembrane part (in gray), based on two consecutiv... Date Added: 2009-06-04 20:36:53 |
| Lecture_14.pdf Path: Bard >> BIO >> 303 Fall, 2009 Description: Biology 303: Microbiology Archaea I: Halophiles and Methanogens WOESE, CARL R., ROGER Y. STANIER, eds. The Bacteria: A Treatise on Structure and Function. New York: Academic Press, 1985. ... Date Added: 2009-06-04 20:37:12 |
| lecture5Inked.pdf Path: UMass (Amherst) >> CHEM >> 112 Fall, 2008 Description: . 1 What is standard atmospheric pressure? 1. 2. 3. 4. 5. 6. 7. The air pressure at sea level. 760 mm Hg 76.0 mm Hg 1 atm 0.1 atm The air pressure in Amherst, MA. The air pressure in Lander, WY. . 2 Which letter represents the normal boiling poi... Date Added: 2009-06-04 20:51:59 |
| 708aexam2.doc Path: Maryland >> EXAMS >> 796 Spring, 2009 Description: LBSC 708A Exam December 18, 2001 You have 2 hours to complete this exam, which will begin after we have read through it together. You may use any materials that you have brought to class and any program on the teaching theater computer. You may not t... Date Added: 2009-06-04 20:56:34 |
| MA0902_Exam-1_2004-11-01.pdf Path: Cal Poly >> MA >> 0914 Fall, 2009 Description: MA 0902 Exam 1: Polytechnic University Exam 1 November 1, 2004 Print Name: Signature: Exam 2: ID #: Grade: Instructor/Section: Directions: You have 90 minutes to answer the following questions. You must show all your work as neatly and clearly as p... Date Added: 2009-06-04 20:57:00 |
| 3310.pdf Path: Ohio State >> OHIOLINE >> 3000 Fall, 2008 Description: FACT SHEET Agriculture and Natural Resources Rosa E. Raudales and Brian B. McSpadden Gardener Department of Plant Pathology The Ohio State University HYG-3310-08 Microbial Biopesticides for the Control of Plant Diseases in Organic Farming O rgani... Date Added: 2009-06-04 21:03:25 |
| IR+Examples.pdf Path: Rochester >> VERSION >> 28584 Fall, 2009 Description: 5/26/2005 Susan Gibbons (prepared for LITA Regional Institute Establishing Institutional Repositories) *DSpace institutions not listed here- majority as listed at http:/wiki.dspace.org/DspaceInstances Institution Australian National University Aust... Date Added: 2009-06-04 21:06:24 |
| 08generalinfo.doc Path: Cornell >> WEB >> 102 Fall, 2009 Description: Professor Kyle Warren Hall 249 5-2104 - email sck5@cornell.edu Economics 102 Introduction to Macroeconomics Spring 2008 Tue./Thurs 9:05 1. There are two lectures each week, from 9:05 to 9:55 on Tuesdays and Thursdays. There is one section per week.... Date Added: 2009-06-04 21:13:36 |
| vlaev chater.pdf Path: Colorado >> CS >> 7782 Fall, 2009 Description: Journal of Experimental Psychology: Learning, Memory, and Cognition 2006, Vol. 32, No. 1, 131149 Copyright 2006 by the American Psychological Association 0278-7393/06/$12.00 DOI: 10.1037/0278-7393.32.1.131 Game Relativity: How Context Influences St... Date Added: 2009-06-04 21:13:50 |
| CmpE202-11-UC-Template-Cockburn-L3-3f.doc Path: San Jose State >> LECTURE >> 131 Fall, 2009 Description: Cockburn\'s Use Case Template USE CASE # Goal in Context Scope the name is the goal as a short active verb phrase> <a longer statement o... Date Added: 2009-06-04 21:13:59 |
| CmpE202-usecases-2.pdf Path: San Jose State >> LECTURE >> 131 Fall, 2009 Description: UML Use Case Diagrams Engineering Notebook C+ Report Nov-Dec 98 An important part of the Unified Modeling Language (UML) is the facilities for drawing use case diagrams. Use cases are used during the analysis phase of a project to identify and parti... Date Added: 2009-06-04 21:14:03 |
| Glycerol.pdf Path: CofC >> RM >> 205 Fall, 2009 Description: SIGMA-ALDRICH MATERIAL SAFETY DATA SHEET Date Printed: 09/26/2005 Date Updated: 05/16/2005 Version 1.11 Section 1 - Product and Company Information Product Name Product Number Brand Company Street Address City, State, Zip, Country Technical Phone: Em... Date Added: 2009-06-04 21:19:53 |
| quantum194.pdf Path: Colorado State >> PH >> 452 Fall, 2008 Description: VIII. 3. HARMONIC OSCILLATOR IN MATRIX REPRESENTATION The classical total energy of the harmonic oscillator is : p2 1 H= + m 2 x 2 2m 2 The equation of motion is: mn + 2 x mn = 0 x Conditions for translating into QM : 1) The Hamilt... Date Added: 2009-06-04 21:20:03 |
| homework9sol.pdf Path: Cornell >> ECE >> 303 Fall, 2008 Description: ... Date Added: 2009-06-04 21:26:22 |
| hw1 solution.pdf Path: Purdue >> ECE >> 321 Fall, 2008 Description: Homework 1, Problem 1 Let the elements of the vector correspond to the x, y, and z components 1 H := 0 0 Now 1 Point1 := 1 1 2 Point2 := 5 1 Since the H-field is constant Point2 H dl = H ( Point2 Point1) Point1 Thus the MM... Date Added: 2009-06-04 21:38:00 |
| chap03.pdf Path: Penn State >> STAT >> 414 Fall, 2008 Description: Some Answers to Even-numbered Exercises in Chapter 3 Section 3.1 4a. f (x) = 4b. x 0 1 2 3 4 5 6 7 8 9 10a. 10b. 39 98 221 245 1 10 for x = 0; 1; : : : ; 9 fd (x) 11 150 14 150 13 150 12 150 16 150 13 150 22 150 16 150 18 150 15 150 f (x) 0:1 0:1 0... Date Added: 2009-06-04 21:40:00 |
| W09_lecture13.pdf Path: UCSC >> BIO >> 175 Fall, 2009 Description: February 6, 2009 Bioe 109 Winter 2009 Lecture 13 Linkage disequilibrium and the evolution of sex - there are really only two features that distinguish sexual from asexual reproduction: meiosis and syngamy. - meiosis is the process by which a diploid ... Date Added: 2009-06-04 21:40:46 |
| 3357_Apr8.pdf Path: UWO >> CS >> 3357 Fall, 2009 Description: Review Not comprehensive I am going to ask you to name 2 link layer protocols Beyond that, dont study anything before the midterm C You will be asked to code in C on the exam 2 functions, totalling 19 lines Nothing evil, nothing really C-spec... Date Added: 2009-06-04 21:43:03 |
| chapter18-6pp.pdf Path: CSU Chico >> CSCI >> 681 Fall, 2009 Description: Learning agents Performance standard Learning from Observations Critic Sensors feedback changes Learning element learning goals Problem generator Environment Chapter 18, Sections 14 knowledge Performance element experiments Agent Effectors... Date Added: 2009-06-04 21:46:49 |
| FIG03_43.TXT Path: Auburn >> CSE >> 360 Fall, 2009 Description: *fig3_43.txt* /* 1*/ template <class Element_Type> /* 2*/ inline const Element_Type Element_Type>: /* 4*/ Top( ) const /* 5*/ { /* 6*/ if( Is_Empty( ) ) /* 7*/ Error( \"Empty stack\" ); /* 8*/ return Stack_Top->Element... Date Added: 2009-06-04 22:01:32 |
| irisdisc.txt Path: Ill. Chicago >> IDS >> 470 Fall, 2009 Description: Worksheet size: 100000 cells Saving file as: C:\\MyFiles\\DATA\\IRISES\\minitab.MTW Discriminant Analysis Linear Method for Response: CLASS Predictors: F1 F2 F3 F4 Group 1 2 3 Count 50 50 50 Summary ... Date Added: 2009-06-04 22:03:33 |
| directions08.doc Path: Ill. Chicago >> NR >> 1866 Fall, 2009 Description: Directions to the Chicago Graduate and Professional School Fair UIC FORUM 725 W Roosevelt Rd., Chicago, IL 60607, Phone (312) 413-9875 UIC Office of Career Services (312) 996-2300 Employers can drop off materials at this point on Union Ave. STAY T... Date Added: 2009-06-04 22:03:34 |
| Me451_exam1.pdf Path: Michigan State University >> ME >> 451 Fall, 2008 Description: ME 451: Control Systems Fall 2007 Monday Oct 08, 2007 Exam 1: Modeling and Time Response Oct 08, 2007 All work must be shown to receive full credit. Problem 1. (25 pts.) In the system of fig. 1, x(t) is the input displacement and y(t) is the output... Date Added: 2009-06-04 22:06:08 |
| chapter6.pdf Path: UCSC >> SOE >> 111 Fall, 2009 Description: Chapter 6: File Systems File systems Files Directories terabytes -> petabyte... Date Added: 2009-06-04 22:08:10 |
| chkpt1.pdf Path: Bergen CC >> CS >> 150 Fall, 2009 Description: University of California at Berkeley College of Engineering Department of Electrical Engineering and Computer Science EECS 150 Spring 2001 R. H. Katz P. Yan Project Checkpoint 1 Controller Interface Controller Specifications The Nintendo 64 contro... Date Added: 2009-06-04 22:13:27 |
| exp19.pdf Path: Laurentian >> PHYS >> 200501 Fall, 2009 Description: ... Date Added: 2009-06-04 22:17:20 |
| practice_test_all.pdf Path: Penn State >> MATSE >> 443 Fall, 2008 Description: MULTIPLE CHOICE QUESTIONS Chapter 1 1. I mentioned in class that you dont need to know the difference between a racemic and meso diad. I lied! Alright, I suppose thats not fair. Below is figure 1.5 from the book, showing these diads. racemic diad r... Date Added: 2009-06-04 22:21:07 |
| lec17-cache.pdf Path: San Jose State >> EE >> 176 Fall, 2008 Description: CS152: Computer Architecture and Engineering Caches and Virtual Memory October 31, 1997 Dave Patterson (http.cs.berkeley.edu/~patterson) lecture slides: http:/www-inst.eecs.berkeley.edu/~cs152/ cs 152 L1 7 .1 DAP Fa97, U.CB Recap: Who Cares Abou... Date Added: 2009-06-04 22:22:36 |
| MonthlyEval.doc Path: Gonzaga >> CPSC >> 491 Fall, 2009 Description: CPSC 491-2 Project Team Evaluation Form Team# For the month of Your name: Meeting attendance Task completed Cordiality Team support Extra effort Comments: Score (0-4) Team member name: Meeting attendance Task completed Cordiality Team support Extra ... Date Added: 2009-06-04 22:23:31 |
| naive.pdf Path: UCSC >> CSE >> 185 Fall, 2009 Description: Chapter 8 Naive-user documentation 8.1 Goals-better paragraphs and writing for non-technical audiences This assignment has two purposes-to improve your paragraph structure and to make you appreciate how difficult writing for an ignorant audience is... Date Added: 2009-06-04 22:25:38 |
| adamday.doc Path: WVU >> EE >> 180 Fall, 2009 Description: Campus Address: 3500 Collins Ferry Rd Morgantown, WV 26506 Permanent Address: 120 Fernwood Dr. Accident, MD 21520 Cell Phone: 301-616-6083 E-mail: aday2@mix.wvu.edu Adam C. Day Work Experience Summer 2005/2006 Lockheed Martin Clarksburg, WV Inter... Date Added: 2009-06-04 22:38:47 |
| lecture_17_visual_design.pdf Path: W. Alabama >> SE >> 382 Fall, 2009 Description: CS 349 / SE 382 Visual Design Professor Michael Terry Valentines Day Eve, 2009 Todays Agenda Midterm redux A3 overview Visual Design CS 349 / SE 382 / 2 Midterm Any comments? CS 349 / SE 382 / 3 A3 Overview Code is now up on the web This ... Date Added: 2009-06-04 22:40:04 |
| chodarr0335.pdf Path: Sveriges lantbruksuniversitet >> LIB >> 3614 Fall, 2009 Description: Senate CANADA S6nat REPORTOF THE SENATESPECIAL COMMITTEE ILLEGAL ON DRUGS VOLUME : PART AND CONCLUSIONS 111 IV Senate CANADA Sdnat REPORT OF THE SENATESPECIAL COMMITTEE ILLEGAL ON DRUGS REPORT OF T H E SENATE SPECIAL COMMITTEE O N ILLEGAL DRUGS... Date Added: 2009-06-04 22:40:30 |
| remote-windows.pdf Path: Sanford-Brown Institute >> CS >> 017 Fall, 2009 Description: Working from home on a PC akruckma Fall 2008 Introduction Fun fact: It is possible to remotely log in to the CS department\'s Linux machines from anywhere, using a system called ssh. This means that, using only your ingenuity and the techonology at y... Date Added: 2009-06-04 22:43:47 |
| lecture16.pdf Path: UCSD >> CSE >> 150 Spring, 2007 Description: ... Date Added: 2009-06-04 22:51:48 |
| ach22.doc Path: Laurentian >> MGT >> 200501 Fall, 2009 Description: Chapter Twenty Two ANSWERS TO QUESTIONS 1. The objective is the temporary removal of some or all the market risk associated with a portfolio. Portfolio protection techniques are generally more economic in terms of commissions and managerial time tha... Date Added: 2009-06-04 22:54:19 |
| ch25.ppt Path: Laurentian >> MGT >> 200501 Fall, 2009 Description: Chapter 25 Contemporary Issues in Portfolio Management 1 Life is my college; may I graduate well and earn some honors. - Louisa May Alcott 2 Outline x x x x x x x x Introduction Tactical asset allocation Stock lending Program trading Role of der... Date Added: 2009-06-04 22:54:21 |
| Mental_illness_stats.pdf Path: Laurentian >> HLSC >> 200501 Fall, 2009 Description: ... Date Added: 2009-06-04 22:55:21 |
| pid.pdf Path: Sanford-Brown Institute >> CSCI >> 1480 Fall, 2009 Description: CS148 Building Intelligent Robots Week 5 : PID Control Preliminary Tasks Out: 25 Feb 2003 before 27 Feb 2003, 9am The purpose of this week\'s lab and project is implement a simple but powerful control system called a PID controller. You will be implm... Date Added: 2009-06-04 23:01:56 |
| Homework1.doc Path: Harvard >> COMP >> 231 Fall, 2009 Description: Wentworth Institute of Technology Division of Professional and Continuing Studies COMP231 Section 71 - Computer Programming with Java I - Spring, 2004 Homework Number 1 Instructor: Bob Goldstein (617) 912-2592 bobg@vision.eri.harvard.edu http:/users... Date Added: 2009-06-04 23:04:22 |
| 0400-minor-fostertrial.pdf Path: Allan Hancock College >> USA >> 1923 Fall, 2009 Description: Minor: The Trial of William Z. Foster [April 1923] 1 The Trial of William Z. Foster by Robert Minor Published in The Liberator, v. 6, no. 4, whole no. 60 (April 1923), pp. 8-12. \"Do you realize,\" asks the County Prosecutor, \"that the Declaration o... Date Added: 2009-06-04 23:05:12 |
| CBET000598.txt Path: Harvard >> IAU >> 000500 Fall, 2009 Description: Electronic Telegram No. 598 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E... Date Added: 2009-06-04 23:07:43 |
| chap-08v2.ppt Path: DePaul >> PPT >> 435 Fall, 2009 Description: DISTRIBUTED SYSTEMS Principles and Paradigms Second Edition ANDREW S. TANENBAUM MAARTEN VAN STEEN Chapter 8 Fault Tolerance Tanenbaum & Van Steen, Distributed Systems: Principles and Paradigms, 2e, (c) 2007 Prentice-Hall, Inc. All rights reserved. ... Date Added: 2009-06-04 23:10:45 |
| 1530 c1s2.doc Path: MTSU >> MTSU >> 1530 Fall, 2009 Description: Descriptive and Inferential Statistics Section 1.2 Objectives Know your definitions! Flash cards will probably be a good idea. Know the difference between descriptive and inferential statistics. I. Definitions A. Variable 1. A characteristic or attri... Date Added: 2009-06-04 23:23:13 |
| LecNote04_07.pdf Path: East Los Angeles College >> PHY >> 207 Fall, 2009 Description: The Ising Model Collection of magnetic particles with up and down spin Each spin interacts with each of its nearest neighbors Interaction energy between parallel spins is -J, for antiparallel spins is +J Consider a square two-dimensional lattice ... Date Added: 2009-06-04 23:25:17 |
| chap5_3.pdf Path: Maple Springs >> ITEC >> 3230 Fall, 2009 Description: Chapter 5: Affective aspects Main aims of this chapter. Explain what expressive interfaces are and the affects they can have on people. Outline the nature of user frustration and how to reduce it. Debate the pros and cons of applying anthropomorp... Date Added: 2009-06-04 23:27:28 |
| q430_170_2.pdf Path: Boise State >> PDF >> 170 Fall, 2009 Description: MATH 170 Quiz Answers 4/30/08 Mon May 5 09:37:55 MDT 2008 1 /m170.sp08/handouts170/q430/q430 170 These are alleged answers. For each error herein, you get extra-credit points for being the first to report it by e-mail. 1 Check problem 41 on Assi... Date Added: 2009-06-04 23:27:58 |
| q608_2.pdf Path: Boise State >> PDF >> 170 Fall, 2009 Description: MATH 170 030 Quiz Answers 6/8/05 Wed Jun 8 13:52:58 MDT 2005 1 /m170.su05/handouts170/q608/q608 These are alleged answers. For each error herein, you get extra-credit points for being the first to report it by e-mail. 1 (a) Here\'s a diagram: c ... Date Added: 2009-06-04 23:29:02 |
| sample_test_2_2005.pdf Path: Alabama Huntsville >> CS >> 390 Fall, 2008 Description: CS390 1. Sample Test #2 What is the \"find\" command that will delete all files in the current directory AND its subdirectories that end in \".tmp\"? 2. What is a \"makefile\"? 3. What is the different between \"object code\" and \"executable code\"? 4. ... Date Added: 2009-06-04 23:33:05 |
| 8clst.pdf Path: Allan Hancock College >> CS >> 9318 Fall, 2009 Description: COMP9318: Data Warehousing and Data Mining - L8: Clustering - Modified from Prof. Jiawei Han\'s Slides COMP9318: Data Warehousing and Data Mining 1 Chapter 8. Cluster Analysis What is Cluster Analysis? Types of Data in Cluster Analysis A Categorizat... Date Added: 2009-06-04 23:33:46 |
| sq-all.rtf Path: Minnesota >> HAUSE >> 011 Fall, 2009 Description: Fourth Congressional District DFL Candidate Responses to a Short Questionnaire on Transportation, Environment & Related Issues Candidates were asked to respond to seven questions on transportation, energy, environment, housing, and wilderness/park is... Date Added: 2009-06-04 23:34:29 |
| page-308.pdf Path: Texas Tech >> MATH >> 1352 Fall, 2008 Description: ... Date Added: 2009-06-04 23:34:44 |
| offer_lecturer_convertible.doc Path: Yale >> APTS >> 0405 Fall, 2009 Description: Appendix K Sample letter of offer to LECTURER CONVERTIBLE (Ph.D. not completed) Dear Mr./Ms. _: I write to confirm our telephone conversation. The Department of _ is planning to recommend your appointment as Assistant Professor of __ for a term of _ ... Date Added: 2009-06-04 23:35:00 |
| Outline.doc Path: Utah >> U >> 0367858 Fall, 2009 Description: Introduction Attention Step: Relate to Audience: Thesis Statement (What are you specifically going to persuade audience of?): _ Preview of Main Points_ (transition) Body Main Point #1: __ Evidence (fact, value, or policy?): supporting claim (trans... Date Added: 2009-06-04 23:35:35 |
| YDR452W.t2k.alpha-logo.pdf Path: UCSC >> YDR >> 452 Fall, 2009 Description: YDR452W.t2k ALPHA 4 3 2 1 E B A A A B EE B S H XXXXX E E XX E C H H I A H H H T H H X X X X X H X XX B SBB E C E C XXXXXXI E A E B B H H 10 20 30 40 E 4 3 2 1 T I H S S B H S B H B H B A E B H S C C S S I E C BB EE EBB B T S... Date Added: 2009-06-04 23:36:31 |
| hw5.pdf Path: Nevada >> CPE >> 201 Spring, 2008 Description: CPE 201 Introduction to Computer Engineering Homework 5 Due April 23 1. [25 points] Draw a state diagram for a sequential circuit with one input I, and three outputs x, y, and z. The output xyz should always follow the following sequence: 000, 001,... Date Added: 2009-06-04 23:38:23 |
| homework2.pdf Path: Texas San Antonio >> CS >> 5633 Fall, 2008 Description: CS 5633 Analysis of Algorithms Spring 05 2/3/05 Due 2/10/05 before class 1. Guessing and induction (10 points) For each of the following recurrences find a good guess of what it could solve to (make your guess as tight as possible). You can use eit... Date Added: 2009-06-04 23:38:40 |
| cubicSplineParametricDiagram.pdf Path: Cal Poly >> CS >> 3734 Spring, 2009 Description: Parametric Cubic Spline in Two-Dimension 1 0.9 0.8 0.7 y 0.6 0.5 0.4 0.3 0.2 0.1 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 x ... Date Added: 2009-06-04 23:39:56 |
| maple.pdf Path: Pittsburgh >> MATH >> 1270 Fall, 2008 Description: SOME COMMENTS ON MAPLE - 1/9/2008 - MATH 1270 - RUBIN Maple distinguishes between expressions and functions. We can define expressions and manipulate them as follows: Below, f and g are two expressions. The `;\' means output will be shown and the `:\'... Date Added: 2009-06-04 23:41:16 |
| week7-8.pdf Path: Pittsburgh >> MATH >> 0280 Fall, 2008 Description: Weeks 7-8 Math 0280 Introduction to Matrices and Linear Algebra - RUBIN - Fall \'07 SCHEDULE: EXPLORATION ASSIGNMENT #2 is available at www.math.pitt.edu/rubin and is due on Tuesday, October 23rd. The homework problems on this handout are also due i... Date Added: 2009-06-04 23:41:27 |
| s08q02sol.pdf Path: Iowa State >> STAT >> 305 Fall, 2008 Description: Statistics 305C Name Quiz 2 March 6, 2008 _ Instructor: Dr. Wu Points for each question are indicated in the left margin in square brackets. 1. The data used in creating the attached one page of JMP output are collected in order to relate the res... Date Added: 2009-06-04 23:43:27 |
| Assignment2.pdf Path: Allan Hancock College >> ENGN >> 2228 Fall, 2009 Description: ENGN2228 Assignment #2 AUSTRALIAN NATIONAL UNIVERSITY Department of Engineering ENGN2228 Signal Processing Assignment #2 Due Date: 10am Monday 27th October 2008 40 marks (15% of subject total) 1. Show that the DC value of a signal, v(t), is equal to... Date Added: 2009-06-04 23:44:05 |
| lect06.pdf Path: Allan Hancock College >> LECTURE >> 3214 Fall, 2009 Description: 6.897 Algorithmic Introduction to Coding Theory September 25, 2002 Lecture 6 Lecturer: Madhu Sudan Scribe: Vitaly Feldman 1 Overview Simplified review of Wozencraft ensemble Codes from other codes: Parity, Puncturing, Restriction, Direct produ... Date Added: 2009-06-04 23:44:31 |
| error.txt Path: Washington >> V >> 15500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 17:02:51 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 18:14:50 2008 ( 4319 s elapsed) ... Date Added: 2009-06-04 23:46:37 |
| error.txt Path: Washington >> V >> 15500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 17:22:59 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 18:31:38 2008 ( 4119 s elapsed) ... Date Added: 2009-06-04 23:47:58 |
| log.txt Path: Washington >> V >> 15591 Fall, 2009 Description: 000 (49086.000.000) 02/04 05:45:44 Job submitted from host: <128.95.94.28:1098> . 001 (49086.000.000) 02/04 13:38:37 Job executing on host: <172.25.101.51:1055> . 006 (49086.000.000) 02/04 13:58:46 Image size of job updated: 386176 . 005 (49086.000.0... Date Added: 2009-06-04 23:49:42 |
| log.txt Path: Washington >> V >> 15500 Fall, 2009 Description: 000 (49383.000.000) 02/04 05:47:41 Job submitted from host: <128.95.94.28:1098> . 001 (49383.000.000) 02/04 16:44:35 Job executing on host: <172.25.101.64:1055> . 006 (49383.000.000) 02/04 17:04:43 Image size of job updated: 466332 . 005 (49383.000.0... Date Added: 2009-06-04 23:50:32 |
| log.txt Path: Washington >> V >> 15500 Fall, 2009 Description: 000 (49237.000.000) 02/04 05:46:41 Job submitted from host: <128.95.94.28:1098> . 001 (49237.000.000) 02/04 15:15:00 Job executing on host: <172.25.101.166:1061> . 006 (49237.000.000) 02/04 15:35:09 Image size of job updated: 357052 . 005 (49237.000.... Date Added: 2009-06-04 23:50:42 |
| error.txt Path: Washington >> V >> 15500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 13:13:02 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 14:23:34 2008 ( 4232 s elapsed) ... Date Added: 2009-06-04 23:50:47 |
| log.txt Path: Washington >> V >> 15500 Fall, 2009 Description: 000 (49480.000.000) 02/04 05:48:17 Job submitted from host: <128.95.94.28:1098> . 001 (49480.000.000) 02/04 17:48:40 Job executing on host: <172.25.101.47:1056> . 006 (49480.000.000) 02/04 18:08:49 Image size of job updated: 378336 . 005 (49480.000.0... Date Added: 2009-06-04 23:51:41 |
| log.txt Path: Washington >> V >> 15554 Fall, 2009 Description: 000 (49049.000.000) 02/04 05:45:33 Job submitted from host: <128.95.94.28:1098> . 001 (49049.000.000) 02/04 13:15:01 Job executing on host: <172.25.101.190:1055> . 010 (49049.000.000) 02/04 13:23:13 Job was suspended. Number of processes actually su... Date Added: 2009-06-04 23:51:47 |
| submit.txt Path: Washington >> V >> 15500 Fall, 2009 Description: executable = allgamma_15569.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15500-15999/15... Date Added: 2009-06-04 23:51:51 |
| 4allcps.pdf Path: Duke >> CPS >> 006 Fall, 2009 Description: Topics since last test z z z The exams z z z z z z More invariants Pixmap Sorting & Templates Selection sort Insertion sort Quicksort Loop invariants Complexity Function templates Operator overloading z z Dynamic data Pointers The new a... Date Added: 2009-06-04 23:52:43 |
| Project Timeline version2.doc Path: Ill. Chicago >> CS >> 426 Fall, 2008 Description: Short Term 9/16 Finalize Game Concept 9/23 Create preliminary website 9/23 Models: Motorcycle Stadium Segment 10/07 Blocks (for the Nov Demo): Motorcycle Stadium Segment 10/07 Documentation: Design Document (Julia) Storyboard (Cole) Globa... Date Added: 2009-06-04 23:53:12 |
| hello.txt Path: Duke >> V >> 108 Fall, 2009 Description: a b c d e f ... Date Added: 2009-06-04 23:53:25 |
| 06_Hazards.pdf Path: UCSD >> CSE >> 141 Winter, 1998 Description: Hazards 1 Today Quiz recap Quiz 2 correction memory Flash Hazards Data Watch for announcement about signing up for a project interview. There is midterm next Tuesday Remember! everythinga through this Thursday that covers Review session: Ne... Date Added: 2009-06-04 23:54:07 |
| 20-Refactoring-And-Patterns-6up.pdf Path: UMass (Amherst) >> CS >> 220 Fall, 2009 Description: Refactoring and Patterns CMPSCI 220 (291A) Programming Methodology Spring 2009 20 - Refactoring and Patterns \"Design patterns are targets for refactoring\" Not so obvious in most refactorings seen so far Particularly clear in following refactorings:... Date Added: 2009-06-04 23:54:29 |
| Unit_Plan_Template_SS.doc Path: NMSU >> EDLT >> 36802 Fall, 2009 Description: Unit Plan Template Note: Type in the gray areas. Click on any descriptive text, then type your own. Unit Author First and Last Name Author\'s Email Address Course Name(s) Course Number(s) Course Section(s) Instructor(s) Name(s) Unit Overview Uni... Date Added: 2009-06-04 23:54:46 |
| 00000031.pdf Path: Carnegie Mellon >> TERA >> 05101931 Fall, 2009 Description: ... Date Added: 2009-06-04 23:55:59 |
| 00000031.pdf Path: Carnegie Mellon >> DISK >> 05101931 Fall, 2009 Description: ... Date Added: 2009-06-04 23:56:00 |
| 00000063.pdf Path: Carnegie Mellon >> DISK >> 31003939 Fall, 2009 Description: ... Date Added: 2009-06-04 23:56:18 |
| 00000046.pdf Path: Carnegie Mellon >> DISK >> 31004068 Fall, 2009 Description: ... Date Added: 2009-06-04 23:57:47 |
| 00000133.pdf Path: Carnegie Mellon >> TERA >> 31004638 Fall, 2009 Description: ... Date Added: 2009-06-04 23:59:03 |
| 00000133.pdf Path: Carnegie Mellon >> DISK >> 31004638 Fall, 2009 Description: ... Date Added: 2009-06-04 23:59:04 |
| 00000104.pdf Path: Carnegie Mellon >> DISK >> 31004122 Fall, 2009 Description: ... Date Added: 2009-06-05 00:00:55 |
| 00000080.pdf Path: Carnegie Mellon >> DISK >> 05101327 Fall, 2009 Description: ... Date Added: 2009-06-05 00:02:04 |
| 00000052.pdf Path: Carnegie Mellon >> TERA >> 31004956 Fall, 2009 Description: ... Date Added: 2009-06-05 00:02:51 |
| 00000052.pdf Path: Carnegie Mellon >> DISK >> 31004956 Fall, 2009 Description: ... Date Added: 2009-06-05 00:02:51 |
| 00000290.pdf Path: Carnegie Mellon >> DISK >> 31005038 Fall, 2009 Description: ... Date Added: 2009-06-05 00:03:48 |
| 00000170.pdf Path: Carnegie Mellon >> TERA >> 31004376 Fall, 2009 Description: ... Date Added: 2009-06-05 00:04:47 |
| 00000170.pdf Path: Carnegie Mellon >> DISK >> 31004376 Fall, 2009 Description: ... Date Added: 2009-06-05 00:04:47 |
| 00000258.pdf Path: Carnegie Mellon >> DISK >> 31003882 Fall, 2009 Description: ... Date Added: 2009-06-05 00:06:22 |
| 00000083.pdf Path: Carnegie Mellon >> DISK >> 31005037 Fall, 2009 Description: ... Date Added: 2009-06-05 00:06:48 |
| 00000099.pdf Path: Carnegie Mellon >> DISK >> 31005037 Fall, 2009 Description: ... Date Added: 2009-06-05 00:06:51 |
| 00000166.pdf Path: Carnegie Mellon >> DISK >> 31005037 Fall, 2009 Description: ... Date Added: 2009-06-05 00:07:05 |
| 00000331.pdf Path: Carnegie Mellon >> DISK >> 31004633 Fall, 2009 Description: ... Date Added: 2009-06-05 00:08:55 |
| 00000339.pdf Path: Carnegie Mellon >> DISK >> 31004633 Fall, 2009 Description: ... Date Added: 2009-06-05 00:08:57 |
| 00000324.pdf Path: Carnegie Mellon >> DISK >> 31005040 Fall, 2009 Description: ... Date Added: 2009-06-05 00:10:27 |
| 00000086.pdf Path: Carnegie Mellon >> DISK >> 31004125 Fall, 2009 Description: ... Date Added: 2009-06-05 00:13:42 |
| 00000145.pdf Path: Carnegie Mellon >> DISK >> 31004199 Fall, 2009 Description: ... Date Added: 2009-06-05 00:15:01 |
| 00000070.pdf Path: Carnegie Mellon >> DISK >> 31003905 Fall, 2009 Description: ... Date Added: 2009-06-05 00:16:04 |
| 00000232.pdf Path: Carnegie Mellon >> DISK >> 31003905 Fall, 2009 Description: ... Date Added: 2009-06-05 00:16:37 |
| 00000415.pdf Path: Carnegie Mellon >> DISK >> 31003905 Fall, 2009 Description: ... Date Added: 2009-06-05 00:17:15 |
| 00000069.pdf Path: Carnegie Mellon >> DISK >> 31003875 Fall, 2009 Description: ... Date Added: 2009-06-05 00:17:45 |
| 00000158.pdf Path: Carnegie Mellon >> DISK >> 31003875 Fall, 2009 Description: ... Date Added: 2009-06-05 00:18:05 |
| 00000349.pdf Path: Carnegie Mellon >> DISK >> 31003875 Fall, 2009 Description: ... Date Added: 2009-06-05 00:18:46 |
| 00000013.pdf Path: Carnegie Mellon >> DISK >> 31005039 Fall, 2009 Description: ... Date Added: 2009-06-05 00:18:55 |
| 00000019.pdf Path: Carnegie Mellon >> DISK >> 31004118 Fall, 2009 Description: ... Date Added: 2009-06-05 00:20:52 |
| 00000281.pdf Path: Carnegie Mellon >> DISK >> 31004118 Fall, 2009 Description: ... Date Added: 2009-06-05 00:21:42 |
| 00000002.pdf Path: Carnegie Mellon >> DISK >> 31004924 Fall, 2009 Description: ... Date Added: 2009-06-05 00:22:03 |
| 00000204.pdf Path: Carnegie Mellon >> DISK >> 31004924 Fall, 2009 Description: ... Date Added: 2009-06-05 00:22:43 |
| 00000216.pdf Path: Carnegie Mellon >> DISK >> 31004924 Fall, 2009 Description: ... Date Added: 2009-06-05 00:22:46 |
| 00000149.pdf Path: Carnegie Mellon >> TERA >> 31003934 Fall, 2009 Description: ... Date Added: 2009-06-05 00:23:49 |
| 00000149.pdf Path: Carnegie Mellon >> DISK >> 31003934 Fall, 2009 Description: ... Date Added: 2009-06-05 00:23:49 |
| 00000072.pdf Path: Carnegie Mellon >> DISK >> 05102638 Fall, 2009 Description: ... Date Added: 2009-06-05 00:24:23 |
| 00000003.pdf Path: Carnegie Mellon >> DISK >> 05101432 Fall, 2009 Description: ... Date Added: 2009-06-05 00:24:26 |
| 00000214.pdf Path: Carnegie Mellon >> DISK >> 31003327 Fall, 2009 Description: ... Date Added: 2009-06-05 00:25:16 |
| 00000182.pdf Path: Carnegie Mellon >> DISK >> 31003504 Fall, 2009 Description: ... Date Added: 2009-06-05 00:26:39 |
| 00000192.pdf Path: Carnegie Mellon >> DISK >> 31003504 Fall, 2009 Description: ... Date Added: 2009-06-05 00:26:41 |
| 00000382.pdf Path: Carnegie Mellon >> DISK >> 31003504 Fall, 2009 Description: ... Date Added: 2009-06-05 00:27:17 |
| 00000196.pdf Path: Carnegie Mellon >> TERA >> 31004123 Fall, 2009 Description: ... Date Added: 2009-06-05 00:28:28 |
| 00000196.pdf Path: Carnegie Mellon >> DISK >> 31004123 Fall, 2009 Description: ... Date Added: 2009-06-05 00:28:28 |
| 00000322.pdf Path: Carnegie Mellon >> TERA >> 31004123 Fall, 2009 Description: ... Date Added: 2009-06-05 00:29:06 |
| 00000322.pdf Path: Carnegie Mellon >> DISK >> 31004123 Fall, 2009 Description: ... Date Added: 2009-06-05 00:29:06 |
| 00000005.pdf Path: Carnegie Mellon >> TERA >> 31003900 Fall, 2009 Description: ... Date Added: 2009-06-05 00:29:24 |
| 00000005.pdf Path: Carnegie Mellon >> DISK >> 31003900 Fall, 2009 Description: ... Date Added: 2009-06-05 00:29:24 |
| 00000192.pdf Path: Carnegie Mellon >> DISK >> 31003818 Fall, 2009 Description: ... Date Added: 2009-06-05 00:33:15 |
| 00000389.pdf Path: Carnegie Mellon >> DISK >> 31003818 Fall, 2009 Description: ... Date Added: 2009-06-05 00:33:54 |
| 00000483.pdf Path: Carnegie Mellon >> DISK >> 31003818 Fall, 2009 Description: ... Date Added: 2009-06-05 00:34:16 |
| 00000134.pdf Path: Carnegie Mellon >> DISK >> 31004925 Fall, 2009 Description: ... Date Added: 2009-06-05 00:34:47 |
| 00000166.pdf Path: Carnegie Mellon >> DISK >> 31004925 Fall, 2009 Description: ... Date Added: 2009-06-05 00:34:53 |
| 00000251.pdf Path: Carnegie Mellon >> DISK >> 31003748 Fall, 2009 Description: ... Date Added: 2009-06-05 00:35:55 |
| 00000092.pdf Path: Carnegie Mellon >> DISK >> 31006020 Fall, 2009 Description: ... Date Added: 2009-06-05 13:41:50 |
| 00000094.pdf Path: Carnegie Mellon >> DISK >> 31006020 Fall, 2009 Description: ... Date Added: 2009-06-05 13:41:50 |
| 00000291.pdf Path: Carnegie Mellon >> DISK >> 31006020 Fall, 2009 Description: ... Date Added: 2009-06-05 13:42:25 |
| 00000289.pdf Path: Carnegie Mellon >> DISK >> 31006020 Fall, 2009 Description: ... Date Added: 2009-06-05 13:42:25 |
| 00000050.pdf Path: Carnegie Mellon >> DISK >> 31003509 Fall, 2009 Description: ... Date Added: 2009-06-05 13:42:44 |
| 00000241.pdf Path: Carnegie Mellon >> DISK >> 31003509 Fall, 2009 Description: ... Date Added: 2009-06-05 13:43:19 |
| 00000028.pdf Path: Carnegie Mellon >> DISK >> 05101308 Fall, 2009 Description: ... Date Added: 2009-06-05 13:45:40 |
| 00000005.pdf Path: Carnegie Mellon >> DISK >> 05101134 Fall, 2009 Description: ... Date Added: 2009-06-05 13:46:02 |
| 00000006.pdf Path: Carnegie Mellon >> DISK >> 05101134 Fall, 2009 Description: ... Date Added: 2009-06-05 13:46:03 |
| 00000024.pdf Path: Carnegie Mellon >> TERA >> 05101352 Fall, 2009 Description: ... Date Added: 2009-06-05 13:49:55 |
| 00000024.pdf Path: Carnegie Mellon >> DISK >> 05101352 Fall, 2009 Description: ... Date Added: 2009-06-05 13:49:56 |
| 00000040.pdf Path: Carnegie Mellon >> DISK >> 05101309 Fall, 2009 Description: ... Date Added: 2009-06-05 13:51:22 |
| 00000398.pdf Path: Carnegie Mellon >> DISK >> 05101198 Fall, 2009 Description: ... Date Added: 2009-06-05 13:52:42 |
| 00000011.pdf Path: Carnegie Mellon >> TERA >> 05100971 Fall, 2009 Description: ... Date Added: 2009-06-05 13:53:50 |
| 00000011.pdf Path: Carnegie Mellon >> DISK >> 05100971 Fall, 2009 Description: ... Date Added: 2009-06-05 13:53:50 |
| 00000043.pdf Path: Carnegie Mellon >> DISK >> 05101351 Fall, 2009 Description: ... Date Added: 2009-06-05 13:54:03 |
| 00000130.pdf Path: Carnegie Mellon >> DISK >> 05101351 Fall, 2009 Description: ... Date Added: 2009-06-05 13:54:18 |
| 00000098.pdf Path: Carnegie Mellon >> DISK >> 05100903 Fall, 2009 Description: ... Date Added: 2009-06-05 13:54:46 |
| 00000036.pdf Path: Carnegie Mellon >> DISK >> 05101296 Fall, 2009 Description: ... Date Added: 2009-06-05 13:55:22 |
| 00000097.pdf Path: Carnegie Mellon >> DISK >> 05101101 Fall, 2009 Description: ... Date Added: 2009-06-05 13:55:42 |
| 00000100.pdf Path: Carnegie Mellon >> DISK >> 05101101 Fall, 2009 Description: ... Date Added: 2009-06-05 13:55:43 |
| 00000076.pdf Path: Carnegie Mellon >> DISK >> 05101180 Fall, 2009 Description: ... Date Added: 2009-06-05 13:58:31 |
| 00000138.pdf Path: Carnegie Mellon >> DISK >> 05101180 Fall, 2009 Description: ... Date Added: 2009-06-05 13:58:42 |
| 00000204.pdf Path: Carnegie Mellon >> DISK >> 05100884 Fall, 2009 Description: ... Date Added: 2009-06-05 14:00:07 |
| 00000051.pdf Path: Carnegie Mellon >> TERA >> 05101307 Fall, 2009 Description: ... Date Added: 2009-06-05 14:00:31 |
| 00000051.pdf Path: Carnegie Mellon >> DISK >> 05101307 Fall, 2009 Description: ... Date Added: 2009-06-05 14:00:31 |
| lab_syllabus.doc Path: UNC Wilmington >> CHM >> 435 Fall, 2009 Description: Chemistry 435 Laboratory Schedule Texts: Chemistry Experiments for Instrumental Methods by Sawyer, Heineman, and Beebe; and Principles of Instrumental Analysis, 6th edition by Skoog, Holler, and Crouch (lecture text - LT) Lab Date Report Due Exp. Top... Date Added: 2009-06-05 14:02:26 |
| Lecture 2 - Expressions.ppt Path: Millersville >> CS >> 161 Fall, 2009 Description: Building Java Programs Primitive Data and Definite Loops 1 Outline data concepts primitive types, expressions, and precedence variables: declaration, initialization, assignment mixing types: casting, string concatenation modifyandreassign ... Date Added: 2009-06-05 14:04:18 |
| lab2TableView.pdf Path: Eastern Washington University >> CSCD >> 379 Winter, 2008 Description: tblAgent PK AgentID AgentName OperationID Specialty tblOperation PK OperationID OperationName OpeartionDesc OperationLoc ... Date Added: 2009-06-05 14:05:12 |
| YCR057C.t2k.str2-logo.pdf Path: UCSC >> YCR >> 057 Fall, 2009 Description: 1 10 20 30 40 H 6 5 4 3 2 1 T S Z Y A T S A Y T A T S Z E Z YZ A C X T S A ZCTCSSC CC S Y X Z Z G CTTTSA E Z CCYZX S SS C XXXXTYSXMCCXX XXX Z S E ZYZAA C SCAZY ZZT SZZ Y CZA A Y AZ ST Z ZY SSTA E X X ZYZ TT M Y Z X X X C T YZ ... Date Added: 2009-06-05 14:06:02 |
| YCR020W-B.t2k.str2-logo.pdf Path: UCSC >> YCR >> 020 Fall, 2009 Description: YCR020W-B.t2k STR2 3 2 1 CC S C H H H C T C S H C S X 10 20 30 40 T 3 2 1 C H H T S Z C H C XXXXTTGHHHHXXXX X X C G C G T CSHHH C X X X C X X 51 60 H 70 SI INP ERQRMSLE EMKKMLDALKNERK K HHHHHHHHHHHH T C T H T T C S T X X X X ... Date Added: 2009-06-05 14:06:45 |
| output.txt Path: Washington >> JOBS >> 40500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-90WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_4040 02/11/2008 08:58 PM <DIR> . 02/11/2008 08:58 ... Date Added: 2009-06-05 14:10:18 |
| output.txt Path: Washington >> JOBS >> 40500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-83WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3968 02/12/2008 12:51 AM <DIR> . 02/12/2008 12:51 ... Date Added: 2009-06-05 14:11:54 |
| submit.txt Path: Washington >> JOBS >> 40500 Fall, 2009 Description: executable = pass6_40789.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40500-40999/40789... Date Added: 2009-06-05 14:12:51 |
| submit.txt Path: Washington >> JOBS >> 40500 Fall, 2009 Description: executable = pass6_40985.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40500-40999/40985... Date Added: 2009-06-05 14:12:55 |
| submit.txt Path: Washington >> JOBS >> 40976 Fall, 2009 Description: executable = pass6_40976.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40500-40999/40976... Date Added: 2009-06-05 14:13:31 |
| market dynamics citation sheet.docx Path: Uni. Westminster >> RTM >> 0701 Fall, 2009 Description: Seeing through the bubble: an overview of Utah\'s housing situation. (2008, September). The Enterprise, 38(12), S3. Retrieved October 31, 2008, from ABI/INFORM Dateline database. (Document ID: 1569485071). Debbi Olson (2008, July). Ivory, Castlewood,... Date Added: 2009-06-05 14:18:16 |
| IRONlab.xls Path: Uni. Westminster >> RTM >> 0701 Fall, 2009 Description: Tommy Mitchell Data Analysis: Iron Oxide #246 KMnO4 Blank correction (mL) KMnO4 (M) 0.0245 0.05 Iron Oxide Unknown # 246 Mass (g) 1 2 3 Moles of Initial Volume Corrected Final Volume Corrected Final Corrected Volume KMnO4 Moles of Wt % Iron in (mL) V... Date Added: 2009-06-05 14:18:19 |
| PosterPresintiation.doc Path: Uni. Westminster >> RTM >> 0701 Fall, 2009 Description: Introduction In 2004, 16,694 Americans were killed from alcohol-related automobile accidents, which accounts for 39% of auto related deaths and averages out to one alcohol-related death every 31 minutes. In the same year 1.4 million Americans were ci... Date Added: 2009-06-05 14:18:23 |
| Lab Summary Free Energy.doc Path: Uni. Westminster >> RTM >> 0701 Fall, 2009 Description: Tommy Mitchell Lab Summary Free Energy The investigation of free energy is important because it is an easier way to perform experiments with constant temperature or pressure than trying to control work or heat flow at the boundaries of the system. Mo... Date Added: 2009-06-05 14:18:32 |
| problem1a.xls Path: Uni. Westminster >> RTM >> 0701 Fall, 2009 Description: Energy Level Diagram of Li-7F-19 0 0 0 0 0 0 0 0 E(v,j) [J] Column I Column I E(v,j) [J] Column I Column I 0 0 0 0 0 0 0 0.8 1 1.2 1.4 1.6 1.8 2 Re (m) Ke (N/m) Li-6 (amu) F-19 (amu) Li-6 (Kg) F-19(Kg) Re^2 (m^2) Ie Be 0 250 6.02 19 0 0 ... Date Added: 2009-06-05 14:18:44 |
| Join Exercises.doc Path: Arkansas >> CISQ >> 4283 Fall, 2009 Description: In Class Exercise Below are two small tables. PC TagNbr 32808 37691 57772 59836 77740 80269 CompID M759 B121 C007 B221 M759 C007 EmplNbr 611 124 567 124 567 852 Employee EmplNbr 124 258 567 611 EmpName Alvarez, Ramon Lopez, Maria Feinstein, Betty Di... Date Added: 2009-06-05 14:24:07 |
| cpsc36011.pdf Path: Clemson >> CS >> 0808360 Fall, 2009 Description: Motivation We often need to be able to monitor multiple descriptors: CpSc 360: Distributed and Network Programming I/O Multiplexing James Wang Textbook Chapter 6 a generic TCP client (like telnet) A server that handles both TCP and UDP Client that... Date Added: 2009-06-05 14:24:07 |
| math2221_F06_A6_solution.pdf Path: Mt. Aloysius >> MATH >> 2221 Fall, 2009 Description: ... Date Added: 2009-06-05 14:24:28 |
| 2AHS001sub.pdb2FBL.txt.filter.txt Path: UConn >> VKK >> 06001 Fall, 2009 Description: USING SAPE_WINDOW_SIZE=30 A total of 1 chains found A total of 2 chains found P1 has 1 and P2 has 2 chains Creating a cost matrix of 3 x 1180 Comparing [SUSAN/2AHS001sub-X] with [SUSAN/DataSet/2FBL-B] with SAPE - Eigen Distance = 2.392463 at window... Date Added: 2009-06-05 14:26:06 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05102936 Fall, 2009 Description: 05102936... Date Added: 2009-06-05 14:26:37 |
| 00000018.pdf Path: Carnegie Mellon >> DISK >> 05102072 Fall, 2009 Description: ... Date Added: 2009-06-05 14:28:37 |
| 00000003.pdf Path: Carnegie Mellon >> DISK >> 05102611 Fall, 2009 Description: ... Date Added: 2009-06-05 14:31:00 |
| 00000130.pdf Path: Carnegie Mellon >> DISK >> 05101574 Fall, 2009 Description: ... Date Added: 2009-06-05 14:32:26 |
| 00000007.pdf Path: Carnegie Mellon >> TERA >> 05101183 Fall, 2009 Description: ... Date Added: 2009-06-05 14:32:41 |
| 00000007.pdf Path: Carnegie Mellon >> DISK >> 05101183 Fall, 2009 Description: ... Date Added: 2009-06-05 14:32:41 |
| 00000028.pdf Path: Carnegie Mellon >> TERA >> 05101183 Fall, 2009 Description: ... Date Added: 2009-06-05 14:32:47 |
| 00000028.pdf Path: Carnegie Mellon >> DISK >> 05101183 Fall, 2009 Description: ... Date Added: 2009-06-05 14:32:47 |
| 00000006.pdf Path: Carnegie Mellon >> DISK >> 05102624 Fall, 2009 Description: ... Date Added: 2009-06-05 14:35:19 |
| 00000044.pdf Path: Carnegie Mellon >> DISK >> 05101267 Fall, 2009 Description: ... Date Added: 2009-06-05 14:36:02 |
| 00000001.pdf Path: Carnegie Mellon >> DISK >> 05101575 Fall, 2009 Description: ... Date Added: 2009-06-05 14:36:31 |
| 00000010.pdf Path: Carnegie Mellon >> TERA >> 05103090 Fall, 2009 Description: ... Date Added: 2009-06-05 14:38:24 |
| 00000010.pdf Path: Carnegie Mellon >> DISK >> 05103090 Fall, 2009 Description: ... Date Added: 2009-06-05 14:38:24 |
| 00000055.pdf Path: Carnegie Mellon >> DISK >> 05103090 Fall, 2009 Description: ... Date Added: 2009-06-05 14:38:34 |
| 00000055.pdf Path: Carnegie Mellon >> TERA >> 05103090 Fall, 2009 Description: ... Date Added: 2009-06-05 14:38:34 |
| 00000028.pdf Path: Carnegie Mellon >> DISK >> 05103086 Fall, 2009 Description: ... Date Added: 2009-06-05 14:42:15 |
| 00000041.pdf Path: Carnegie Mellon >> DISK >> 05103086 Fall, 2009 Description: ... Date Added: 2009-06-05 14:42:17 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 05101765 Fall, 2009 Description: ... Date Added: 2009-06-05 14:43:48 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 05101765 Fall, 2009 Description: ... Date Added: 2009-06-05 14:43:48 |
| 00000054.pdf Path: Carnegie Mellon >> DISK >> 05102994 Fall, 2009 Description: ... Date Added: 2009-06-05 14:44:33 |
| 00000001.pdf Path: Carnegie Mellon >> DISK >> 05102220 Fall, 2009 Description: ... Date Added: 2009-06-05 14:45:14 |
| 00000016.pdf Path: Carnegie Mellon >> TERA >> 05101391 Fall, 2009 Description: ... Date Added: 2009-06-05 14:45:20 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


