Course Solutions And Notes - doc.portability 08
| ch09slide.pdf Path: MSOE >> CS >> 285 Fall, 2009 Description: Data Structures in C+ 1 Data Structures in C+ Chapter 9 Tim Budd Oregon State University Corvallis, Oregon USA Lists Chapter 9 Data Structures in C+ Outline { Chapter 9 Lists Concept of linked-list Variations 2 { Head and Tail Pointers { Doub... Date Added: 2009-06-07 17:39:38 |
| mat343_08f_post.xls Path: ASU >> MAT >> 267 Fall, 2009 Description: Post ID 1089 759 9660 361 8371 613 0821 262 7736 166 4873 853 9109 513 5317 256 2061 481 7517 775 6951 484 7454 844 7352 374 4046 844 9546 066 4777 217 6755 499 9322 853 7993 777 1434 025 9551 077 1516 836 5526 690 4859 831 49... Date Added: 2009-06-07 17:41:29 |
| lecture16.ppt Path: Cleveland State >> EEC >> 584 Fall, 2009 Description: EEC-484/584 Computer Networks Lecture 16 Wenbing Zhao wenbing@ieee.org Outline Reminder Quiz#5 (take home exam) will be emailed to you around noon 5/13 or earlier. It is due by noon 5/14. Email submission of a scanned or typed copy is encouraged ... Date Added: 2009-06-07 17:57:13 |
| 02-etPartners_Call_Fall04.doc Path: UC Davis >> ATT >> 0406 Fall, 2009 Description: ET Partners Fall Quarter 2004 Call For Proposals to Faculty Mediaworks is pleased to announce the Fall 2004, call for proposals, for the Educational Technology (ET) Partners Program. This program pairs faculty members and academic departments with ... Date Added: 2009-06-07 18:01:05 |
| Week2Handout.pdf Path: Portland >> SBA >> 495 Fall, 2009 Description: $ % #\" # $+ # # # # # - , . / !0 1 ! 2 2 ! + 1 1+ + 2 \"3 + 4 * \' ( * \"1 ! ! ) 2( ! ! # # 5 # * \"1 ! * 6\' !-! ! \"; 0 ; 2 ! ; 1 -; + # ; \" 3 +; 1 7\' 8 0 ): 9 ; \' - \"; 1+; ; - \"% ; % # ; # ; # ! 5-\" ; 1 - -! \" <3 ! ; 31... Date Added: 2009-06-07 18:01:46 |
| Lec6_Transformation.pdf Path: Portland >> GEOG >> 481 Fall, 2008 Description: Image Transforms Single band: spatial domain to frequency domain Multiple bands: spectral enhancement The enhancement techniques that require more than one band of data. Purposes: extract new bands of data that are more interpretable to the eye ... Date Added: 2009-06-07 18:02:02 |
| final.doc Path: Rose-Hulman >> CSSE >> 200930 Fall, 2009 Description: CSSE 432 - Computer Networks - Spring 2005 Final Exam May 23, 2005 Name:_ Campus Mailbox:_ 1 2 3 4 5 6 7 8 9 10 11 Total 15 15 15 15 15 10 7 9 20 9 70 20 0 1 CSSE 432 - Computer Networks - Spring 2005 Final Exam 1. [15 points] DNS a) A new inter... Date Added: 2009-06-07 18:02:24 |
| dcmiterms.xls Path: UNC >> INLS >> 520 Fall, 2008 Description: 1. Element Name: Title 2. Element Name: Creator 3. Element Name: Subject 4. Element Name: Description 5. Element Name: Publisher 6. Element Name: Contributor 7. Element Name: Date 8. Element Name: Type 9. Element Name: Format 10. Element Name: Identi... Date Added: 2009-06-07 18:03:29 |
| dcmiterms.xls Path: UNC >> INLS >> 150 Fall, 2008 Description: 1. Element Name: Title 2. Element Name: Creator 3. Element Name: Subject 4. Element Name: Description 5. Element Name: Publisher 6. Element Name: Contributor 7. Element Name: Date 8. Element Name: Type 9. Element Name: Format 10. Element Name: Identi... Date Added: 2009-06-07 18:03:33 |
| cs350_HOMEWORK5.doc Path: Portland >> CS >> 350 Fall, 2008 Description: CS 350 Algorithms and Complexity HOMEWORK #3 Due On: August 5th, 2003 Read Chapter 8 (assigned sections) and 23, 24 and 25(assigned sections) of Introduction to Algorithms by T. Cormen, C. Leiserson and R. Rivest. Try to be as clear as possible in yo... Date Added: 2009-06-07 18:05:21 |
| syllabus.pdf Path: Portland >> M >> 667 Fall, 2009 Description: Stochastic Processes and Probability Theory I MTH 667 (14360) MWF 9:009:50, Rm: NH 346 Course Information Instructor: Prof. Gerardo Laerriere Oce: M313 Neuberger Hall (Mezzanine) Phone: 725-3662 E-mail: gerardoL@pdx.edu Web page: http:/www.mth.pdx.e... Date Added: 2009-06-07 18:12:34 |
| PDF_BeefCowsSpringCalving_HayRation.pdf Path: Virginia Tech >> PUBS >> 446 Fall, 2009 Description: 2008 PUBLICATION 446-047 Beef Cows Spring Calving - Hay Ration 100 COWS Heifers Cull Bull 2. TOTAL GROSS RECEIPTS 3. VAR... Date Added: 2009-06-07 18:15:37 |
| trading.doc Path: San Diego State >> BUS >> 416 Fall, 2009 Description: Futures Trading Location Futures trading is done on organized exchanges. Two prominent ones are the Chicago Board of Trade (CBOT) and the Chicago Mercantile Exchange (CME). The Floor of the Exchanges Traders meet in physical \"pits\" on the floor of th... Date Added: 2009-06-07 18:19:21 |
| Week12_s09 [Compatibility Mode].pdf Path: Minnesota >> FR >> 3131 Fall, 2008 Description: Raster Analysis Raster cells store data (nominal, ordinal, interval/ratio) Complex constructs built from raster data Connected cells can be formed in to networks Related cells can be grouped into neighborhoods or regions p Examples: Predict fate of p... Date Added: 2009-06-07 18:20:26 |
| emailAug22nd2007.txt Path: UNI >> CNS >> 080 Fall, 2009 Description: Date: Wed, 22 Aug 2007 18:06:54 -0500 (CDT) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-080-02-fall@uni.edu Subject: Handout for Thursday class #2 (Aug 23rd) Discrete Hi 080 discrete structures students, Recall that a... Date Added: 2009-06-07 18:23:40 |
| moviestabsplit.txt Path: UNI >> CNS >> 088 Fall, 2009 Description: famousLine film LeadActor LeadActress Category A lot of people go to school for seven years. They\'re called Doctors. Tommy Boy Chris Farley Bo Derek Comedy A woman\'s heart is a deep ocean of secrets. Titanic Leonardo DeCaprio Kate Winslet Drama All ... Date Added: 2009-06-07 18:25:55 |
| e209s.pdf Path: SUNY Albany >> MATH >> 220 Fall, 2009 Description: Math 220 Exam 2 Spring \'09 1. Let v1 , . . . , vk Rn , let A = [v1 | . . . |vk ] and let A reduce to the reduced row echelon matrix R. a) What property about R is equivalent to the linear independence of v1 , . . . , vk ? b) If v1 , . . . , vk ar... Date Added: 2009-06-07 18:29:24 |
| 430-019.pdf Path: Virginia Tech >> PUBS >> 430 Fall, 2009 Description: publication 430-019 Selection and Use of Mulches and Landscape Fabrics Bonnie Appleton , Extension Horticulturist Kathy Kauffman, Graduate Student, Hampton Roads AREC Why Mulch? The term \"mulch\" refers to materials spread or left on the soil surfa... Date Added: 2009-06-07 18:30:11 |
| introd484.pdf Path: UWI Mona >> WEB >> 0364484 Fall, 2009 Description: DEPARTMENT OF PHYSICS Physics 64-484: Design and Application of Lasers Instructor: Dr. W. Kedzierski Office: 289-5 Essex Hall Office Hours: Tuesday 1:30-3:30, or just \"try-it\" phone Extension 2684, 2676 or 2654 E-mail: wladek@uwindsor.ca - Homepa... Date Added: 2009-06-07 18:30:26 |
| 14apr.pdf Path: UCSC >> AMS >> 005 Fall, 2009 Description: ... Date Added: 2009-06-07 18:32:04 |
| 448-063.pdf Path: Virginia Tech >> PUBS >> 448 Fall, 2009 Description: publication 448-063 Building Your Financial Team: Financial Planners Alex White, Assistant Professor, Family Financial Management, Department of Apparel, Housing, and Resource Management, Virginia Tech Managing Prosperity: Estate and Retirement Pla... Date Added: 2009-06-07 18:36:22 |
| a_tale_of_two_deficits.pdf Path: UC Davis >> ECN >> 160 Fall, 2009 Description: Stiglitz_4.qxd 30/12/05 1:18 pm Page 85 A tale of two deficits A The richest country in the world is living beyond its means, says Joseph Stiglitz. The question is not when, but how hard, the landing will be merica has been borrowing abroad at th... Date Added: 2009-06-07 18:37:59 |
| 4001_02X1_results.txt Path: Allan Hancock College >> GENS >> 4001 Fall, 2009 Description: GENS 4001 Astronomy Summer Session (X1) 2002 Student ID Tutorial Assignment Essay Mini Project Total Grade 2161940 17 28 20 13 79 DN 2189637 AF 2191114 13 22 25 10 71 CR 2192081 AF 2192281 10 21 16 12 59 PS 2203987 AF 2206834 11 ... Date Added: 2009-06-07 18:38:45 |
| hw4 Solution.pdf Path: CUNY Baruch >> EES >> 5571 Fall, 2009 Description: G7100 HW 4 Solution *Read Chapters 6 & 8 in advance. 1. The Ethernet protocol, e.g. IEEE 802.11 CSMA/CD is absolutely the dominant MAC protocol in wired networking. Explain why the CD (collision detection) is not possible for wireless environment. So... Date Added: 2009-06-07 18:39:54 |
| Chapter11_biologyCLASS.pdf Path: CSU Sacramento >> PSYC >> 104 Winter, 2009 Description: Chapter 11: Biological Dispositions in Learning Chapter Outline Preparedness & Conditioning Pavlovian conditioning Operant conditioning Operant-Pavlovian interactions Instinctive drift Sign tracking Adjunctive behavior Procedure and defini... Date Added: 2009-06-07 18:40:37 |
| william_graded.pdf Path: Purdue >> ECE >> 301 Fall, 2008 Description: ... Date Added: 2009-06-07 18:42:26 |
| WorksCited.doc Path: North Texas >> TAC >> 4100006 Fall, 2009 Description: Website http:/www.worldwildlife.org This website has information about the World Wildlife Organization (WWF). They have been protecting endangered species since 1961. Website http:/www.animal.discovery.com/ This website has information about all type... Date Added: 2009-06-07 18:45:07 |
| 430-402.pdf Path: Virginia Tech >> PUBS >> 430 Fall, 2009 Description: publication 430-402 Ecological Turf TipsTo Protect The Chesapeake Bay David R. Chalmers, Associate Professor and Extension Agronomist, Department of Crop and Soil Environmental Sciences, Virginia Tech Judy Booze-Daniels, Research Associate, Departm... Date Added: 2009-06-07 18:46:02 |
| mod6.1.pdf Path: UCSC >> CS >> 111 Fall, 2009 Description: Module 6: Process Synchronization Background The Critical-Section Problem Synchronization Hardware Semaphores Classical Problems of Synchronization Critical Regions Monitors Synchronization in Solaris 2 Atomic Transactions Operating System... Date Added: 2009-06-07 18:46:20 |
| category.txt Path: Allan Hancock College >> CSEE >> 341712967 Fall, 2009 Description: 6 ... Date Added: 2009-06-07 18:48:00 |
| midterm_answer.pdf Path: UCSC >> AMS >> 211 Fall, 2008 Description: ... Date Added: 2009-06-07 18:51:55 |
| S2009_04_20.ppt Path: Skidmore >> CS >> 102 Fall, 2009 Description: CS 102 Computers In Context (Multimedia) 04 / 20 / 2009 Instructor: Michael Eckmann Today\'s Topics Questions/comments? Making movies, animations Michael Eckmann - Skidmore College - CS 102 - Spring 2009 A movie can be thought of as an array (or... Date Added: 2009-06-07 18:54:50 |
| YDR214W.t2k.str2-logo.pdf Path: UCSC >> YDR >> 214 Fall, 2009 Description: YDR214W.t2k STR2 4 3 2 1 CC S B S T C SSSGTSCCCGSTTHTT S T CSC Z G G S XX X X X X XXXX X X XXGGX CCCTTC CS X X T C X CCC SS HHH X X 1 10 20 30 40 H T Z Z T Y A Z E Z Z 4 3 2 1 CSCCZC Z C C Y S SA Z S C S AACTCC SZCCTSBSYAZSMMMSS... Date Added: 2009-06-07 18:56:51 |
| YGL038C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YGL >> 038 Fall, 2009 Description: YGL038C.t2k DSSP-EHL2 2 1 EEE H HHHH CCCCCCC HHHHHHHHHHH C C MS RKL SHLIATRK SKTIVVTVLLIYSL L T F HL S N KR L L SQ F YP SK DD F KQ H H C C C C E C C E C C C C C C H C C C C C H C C C C H C X X E E E X X X C X X X X X X X C H H X X X X X X X X X H H... Date Added: 2009-06-07 19:00:17 |
| Chopin_Harpers.pdf Path: Middlebury >> AL >> 260 Fall, 2009 Description: ... Date Added: 2009-06-07 19:00:50 |
| YKL223W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YKL >> 223 Fall, 2009 Description: YKL223W.t2k DSSP-EHL2 1 H H CCHCEE C C C H E E X X C C X X X X X 10 20 30 40 E 1 H E H E H E T G T E E CCECCCCCEC CE EEC X X X X X X 51 60 70 80 90 E 1 C C CCC E X H H H X T G E T G E E T E ECCC EECEEEC X X X X X E 101... Date Added: 2009-06-07 19:04:42 |
| composites.pdf Path: Allan Hancock College >> AERO >> 1560 Fall, 2009 Description: AERO1600 -1 Composites-Fibreglass-GFRP Aircraft Composites (GFRP) Fibreglass Composites are used in many aspects of aircraft construction, for examples of where composites are used on commercial aircraft refer to the composite handout provided. It... Date Added: 2009-06-07 19:06:23 |
| ch24_solutions.pdf Path: MN State >> CHEM >> 480 Fall, 2009 Description: CHAPTER 24: SUPPLEMENTARY SOLUTIONS GAS CHROMATOGRAPHY log(6.45) log(6.12) S24-1. I = 100 6 + (7 6) log(7.20) log(6.12) 111 [ ] = 632 S24-2. (a) hexane < benzene < heptane < nitropropane < pyridine < octane < nonane (b) hexane < heptane < ben... Date Added: 2009-06-07 19:12:00 |
| 06spm3k.doc Path: Drake >> ECON >> 107 Fall, 2009 Description: Introduction to Econometrics (Econ 107) Drake University, Spring 2006 William M. Boal MIDTERM EXAMINATION #3 ANSWER KEY Multiple Regression With Cross-Sectional Data March 30, 2006 VERSION A I. MULTIPLE CHOICE: [2 pts each28 pts total] (1)a. (2)d. (... Date Added: 2009-06-07 19:15:07 |
| 582_L14.pdf Path: Mich Tech >> EE >> 582 Fall, 2009 Description: ... Date Added: 2009-06-07 19:15:47 |
| repeatmatch.pdf Path: Rutgers >> MATH >> 338 Fall, 2008 Description: ... Date Added: 2009-06-07 19:18:30 |
| CourseOverview.pdf Path: RIT >> SE >> 362 Fall, 2009 Description: Engineering of Software Subsystems Course Overview Component operation Concrete Component operation() Decorator operation() component component->operation() Concrete Dec #1 addedState operation() Concrete Dec #2 addedBehavior() operation() Dec... Date Added: 2009-06-07 19:20:31 |
| 2007summer-3 Exer-04.pdf Path: CSU Long Beach >> SOC >> 320 Fall, 2009 Description: Soc.320 / Hicks Marlowe Note Taker: Discussion Exercise #4 Group Mem bers: (5 pts.each) Chap. 3: M arriage and the Fam ily: Disciplinary and Theoretical Approaches 1. What are the main differences between the psychological, social psychological, and... Date Added: 2009-06-07 19:20:36 |
| affine+homography.ppt Path: Delaware >> CIS >> 689 Spring, 2009 Description: Assignment Program-1 info-Link Data Computer Vision : CISC 4/689 Applications of RANSAC: Solution for affine parameters Affine transform of [x,y] to [u,v]: Rewrite to solve for transform parameters: Computer Vision : CISC 4/689 Automatic Ho... Date Added: 2009-06-07 19:22:55 |
| Press+Release+IEDC+City+of+Asheville+Award+10+08.doc Path: UNC >> READ >> 4856251 Fall, 2009 Description: For Immediate Release October 19, 2008 Contact: Erin Way, Media Relations (202) 942-9474, eway@iedconline.org CITY OF ASHEVILLE RECEIVES ECONOMIC DEVELOPMENT AWARD North Carolina Municipality Recognized for New Media Initiative Acknowledging the Ci... Date Added: 2009-06-07 19:23:46 |
| chi_square_gof_test_341.pdf Path: Wisc La Crosse >> MATH >> 341 Fall, 2009 Description: Math 341 - Probability and Statistics April 11, 2007 Chi-square (2) Tests Common Uses of the 2 -test. 1. Testing Goodness-of-fit. 2. Testing Equality of Several Proportions. 3. Homogeneity Test. 4. Testing Independence. Testing Goodness-of-fit of... Date Added: 2009-06-07 19:25:39 |
| frec615_14_auto.pdf Path: Delaware >> FREC >> 615 Fall, 2008 Description: 4/20/2009 Assumption #5 FREC 615 Autocorrelation No autocorrelation between the disturbances E(ui, uj) = 0, i j Violation called Autocorrelation Only a concern with time series models Nature Look at: ut = utt-1+t with 1 < < 1 1 This is an AR(... Date Added: 2009-06-07 19:29:39 |
| lecture04.pdf Path: Delaware >> CISC >> 849 Fall, 2008 Description: Computational Photography and Videos Jingyi Yu Department of Computer and Information Science Jean Baptiste Joseph Fourier (1768-1830) had crazy idea (1807): Any periodic function can be rewritten as a weighted sum of sines and cosines of differe... Date Added: 2009-06-07 19:31:36 |
| RUF+Constitution+-+UNC+(dirty).doc Path: UNC >> READ >> 3939497 Fall, 2009 Description: Constitution of Reformed University Fellowship PREAMBLE In order to better regulate the affairs of the organization and to pursue its distinctive role in furthering the mission and purpose of the University of North Carolina at Chapel Hill (UNC-CH), ... Date Added: 2009-06-07 19:34:48 |
| hw1.pdf Path: CSU Channel Islands >> ICS >> 151 Fall, 2009 Description: HOMEWORK 1 ICS 151 Digital Logic Design Spring 2004 Due 17:00 PM, April 23 2004 at the Distribution Center NAME:_ ID #:_ 1. Number Conversion (20 points) 1.1.Convert (1234)10 to binary and hexadecimal (show all the steps, for hex, convert directly ... Date Added: 2009-06-07 19:37:00 |
| 7_casestudy_reading1.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: Case Study The Wall Street Journal N e w s I n fo g ra p h i c s ( A tt e n t i o n t o D e t a i l ) p . 16 8 Two Sides of the Same Brain \"You have to do your own research,\" she says. \"It\'s when I pore over the data that I start to picture the pres... Date Added: 2009-06-07 19:41:06 |
| exam2.pdf Path: Minnesota >> LIB >> 8152 Fall, 2009 Description: CHEM 8152 Fall 2006 Christy L. Haynes EXAM II Problem # 1 2 3 4 5 6 7 8 Total Points Possible 15 15 5 15 15 15 15 5 100 Name _ Points Earned You may only use your calculator, your single sheet of notes, and exam-issue scratch paper while completi... Date Added: 2009-06-07 19:45:12 |
| Julie_Hewitt_task7b.doc Path: Sierra Nevada >> ONLINE >> 1132885220 Fall, 2009 Description: Julie Hewitt May 1, 2009 Task 7b My portfolio student, Alyssa, read The Show and Tell Surprise. It is a Scholastic book with a reading level of 2.0, appropriate for ages 68. Alyssa is in the first grade. She silently read the book to herself and... Date Added: 2009-06-07 19:45:53 |
| submit.txt Path: Washington >> V >> 11700 Fall, 2009 Description: executable = allgamma_11700.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11500-11999/11... Date Added: 2009-06-07 19:50:46 |
| lai2.pdf Path: Oregon State >> ECE >> 679 Fall, 2008 Description: 1 Advances in Modular Inverse Implementations G. Lai Abstract- Here is my template file that you requested. I had a lot of trouble trying to install MiKTeX on my Windows PC. Compiling the files I found on the ECE679 webpage gave some errors for not ... Date Added: 2009-06-07 19:54:11 |
| Page292_13.pdf Path: Westmont >> MA >> 108 Fall, 2009 Description: Page 292 Problem 13 In the statement of Theorem 31.5 we require that f be integrable on [a, b]. Show that this requirement is necessary. That is, nd a dierentiable function f such that f is not integrable. Solution We rst point out that the statement... Date Added: 2009-06-07 19:54:26 |
| s02.ppt Path: UNI >> CNS >> 062 Fall, 2009 Description: Computer Science II Session 02 Cyber-Pets Vocabulary Interpreting the \"Magic Line\" The anatomy of an OO program \"In Java, the main thing you do is write class definitions.\" (R. Morelli) A class definition encapsulates two (three actually) things: ... Date Added: 2009-06-07 20:01:25 |
| normal.table.pdf Path: Iowa State >> STAT >> 495 Fall, 2008 Description: Standard Normal Distribution z-value -3.4 -3.3 -3.2 -3.1 -3.0 -2.9 -2.8 -2.7 -2.6 -2.5 -2.4 -2.3 -2.2 -2.1 -2.0 -1.9 -1.8 -1.7 -1.6 -1.5 -1.4 -1.3 -1.2 -1.1 -1.0 -0.9 -0.8 -0.7 -0.6 -0.5 -0.4 -0.3 -0.2 -0.1 0.0 area to left of z-value .0003 .0005 .00... Date Added: 2009-06-07 20:05:36 |
| PE15ComplexNumbersWorksheet.pdf Path: Naval Academy >> EE >> 301 Fall, 2008 Description: PE Complex Numbers Worksheet A Practical Exercise (Updated 17 OCT 2008) 15 Name:_ Section: _ I. Purpose. 1. 2. 3. 4. 5. 6. Review sinusoidal voltage and current equations. Review phasors and their use in representing sinusoidal voltages and cu... Date Added: 2009-06-07 20:08:50 |
| M303W08E3Key.pdf Path: BYU >> MATH >> 303 Winter, 2008 Description: ... Date Added: 2009-06-07 20:10:35 |
| CH11.NOTES.ppt Path: Kent State >> MKTG >> 45045 Fall, 2008 Description: Chapter 11 The Creative Side of Advertising Outline What is creative advertising? Creative thinking Creative strategy and execution The creative brief Effective creativity What is Creative Advertising? 1. 2. 3. Chapter 11: The Creative Sid... Date Added: 2009-06-07 20:11:09 |
| pg6 Path: Georgia Perimeter >> MATH >> 2652 Spring, 2008 Description: ... Date Added: 2009-06-07 23:15:16 |
| PreTest0002 Path: Georgia Perimeter >> MATH >> 2652 Spring, 2008 Description: ... Date Added: 2009-06-07 23:16:10 |
| 1_27_09_NoiseAnalysis Path: USC >> BME >> 575L Spring, 2009 Description: The K+ channel has one open and four closed states with probabilistic transitions given by an and bn from the Hodgkin-Huxley model. Long voltage pulses under K+-channel blockade cause fluctuating Na+ currents. Single-event Responses Time (ms) The... Date Added: 2009-06-08 02:05:54 |
| kdegames-3.5.9-1.el5.i386.rpm.txt Path: LSU >> I >> 386 Fall, 2009 Description: -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 SHORT PACKAGE INFO Name: kdegames-3.5.9-1.el5 Summary:K Desktop Environment - Games Group: Amusements/Games CHANGELOG (recent): * Fri Feb 15 2008 Rex Dieter <rdieter@fedoraproject.org> 6:3.5.9-1 - - kde-3.5.9 ... Date Added: 2009-06-08 06:26:35 |
| AM02.pdf Path: Cornell >> FS >> 430 Fall, 2009 Description: Fining,Filtra+on,andClarica+on Whatcausescloudinessinwine? Grapesolids Deadyeastcells Tartrates Proteins Browningagents Excessphenols FS4300: Understanding Beer and Wine Anna Katharine Mansfield 16 April 2009 NONE ARE HARMFUL TO HUMANS. Whatcanwe... Date Added: 2009-06-08 06:27:28 |
| hw5s05.pdf Path: Uni. Worcester >> CS >> 503 Fall, 2008 Description: Homework #5 1. (5 Points) True or False: a) Regular Languages are always Context-Free Languages b) Context Free Languages are always Regular Languages c) The grammar S 0S |0S1S | is ambiguous d) The language {anbncn} is regular e) The language {anbn... Date Added: 2009-06-08 06:28:48 |
| eng_maths_tut_10.pdf Path: Allan Hancock College >> MATH >> 11218 Fall, 2009 Description: MATH11218 Engineering Foundation Mathematics Tutorial Sheet 10 Autumn Term 2004 1. The speeds of thirty vehicles travelling on an isolated stretch of a major highway with a 100 kph limit are recorded as follows 85 106 98 93 102 94 88 102 76 95 99 9... Date Added: 2009-06-08 06:32:01 |
| 0rcs49-430.pdf Path: Neumont >> EN >> 1914 Fall, 2009 Description: Supreme Court of Canada Vancouver Power Co. v. Hounsome, 49 S.C.R. 430 Date: 1914-02-23 The Vancouver Power Company (Defendants) Appellants; and James Hounsome (Plaintiff) Respondent. 1914: February 10, 23. Present: Sir. Charles Fitzpatrick C.J. and ... Date Added: 2009-06-08 06:32:09 |
| withdrawal.pdf Path: Pine Manor College >> FILES >> 526883 Fall, 2009 Description: PINE MANOR COLLEGE OFFICE OF INSTITUTIONAL RESEARCH, RECORDS & REGISTRAR REQUEST FOR WITHDRAWAL Name: _ Permanent Address: _ Street Student ID #: _ __ City State Zip Code Country: _ Circle One: Resident or Commuter Village House Room # Reside... Date Added: 2009-06-08 06:32:40 |
| Sim3.pdf Path: MSOE >> EE >> 3210 Fall, 2009 Description: EE3210 Electromagnetic Waves SIMULATION #3 Prof. Jevti Transmission Line Fields We\'ll use a numerical solution of Maxwell\'s equations inside a transmission line to illustrate guided propagation of electromagnetic waves. In particular, we will: a. ... Date Added: 2009-06-08 06:36:22 |
| hoharass.pdf Path: Syracuse >> FACULTY >> 500 Fall, 2009 Description: ECN 500/WSP 500 (001) - HANDOUT - FALL 2007 K. Basu, The Economics and Law of Sexual Harassment in the Workplace Journal of Economic Perspectives 17 (3), Summer 2003, 141-57 POSITIVE PORTION OF THE MODEL ASSUMPTIONS 1. Competitive labor markets. 2. ... Date Added: 2009-06-08 06:36:44 |
| sld-9.pdf Path: Contra Costa College >> COMP >> 6411 Fall, 2009 Description: Donald Knuth, The Art of Computer Programming 1962 DK decides to write a text book in 12 chapters DK decides that an \"in depth\" approach will require seven volumes 1968 1969 1973 1977 197789 1980 Volume I, Fundamental Algorithms Volume II, Seminumeri... Date Added: 2009-06-08 06:39:15 |
| 19900204.txt Path: Minnesota >> CC >> 1990 Fall, 2009 Description: Title: Hourly weather readings Project: E080 Data: Weather Notes: This data is from the first Cedar Creek Campbell weather station. See \"weather1.txt\" for a complete description ... Date Added: 2009-06-08 06:43:25 |
| ML_And_FunctionalProgramming.ppt Path: UMBC >> USERPAGES >> 331 Spring, 2001 Description: UMBC ML and Functional Programming Shon Vick CMSC 331 UMBC Functions Function are a mapping from a Domain set to a Range set Denoted as m: A -> B in SML Created via fun in SML Example f: color -> Boolean consists of the set of all functions ... Date Added: 2009-06-08 06:52:59 |
| S98fexm.doc Path: Youngstown >> CHEM >> 5832 Spring, 2008 Description: Chemistry 832 - Spring 1998 Final Exam, Take Home Name:_ Student Number:_ This is a closed book exam. You have two hours to answer the questions. Clearly show all of your work. If you have any questions, please ask me for clarification. On question... Date Added: 2009-06-08 06:56:03 |
| BE305Final.doc Path: Penn State >> MNC >> 5027 Fall, 2009 Description: Description & Background An EKG or ECG, as it is also called, and stands for electrocardiography. This type of cardiogram shows the electrical activity of the heart over time. It uses electrodes that are placed on the skin, making this type of cardio... Date Added: 2009-06-08 07:03:43 |
| Bremer_pres.pdf Path: Michigan State University >> PHY >> 971 Spring, 2008 Description: Magnetism in Solids Marshall Bremer Physics 971 April 27, 2009 Outline Diamagnetism Paramagnetism Ferromagnetism/Antiferromagnetism Exchange Interactions Curie-Weiss Law Spin Hamiltonians More Magnetic Structure Conduction Electrons Diamag... Date Added: 2009-06-08 07:06:17 |
| Bremer_pres.pdf Path: Michigan State University >> PHY >> 871 Fall, 2009 Description: Magnetism in Solids Marshall Bremer Physics 971 April 27, 2009 Outline Diamagnetism Paramagnetism Ferromagnetism/Antiferromagnetism Exchange Interactions Curie-Weiss Law Spin Hamiltonians More Magnetic Structure Conduction Electrons Diamag... Date Added: 2009-06-08 07:06:37 |
| Renormalization.pdf Path: SMU - Cox School of Business >> PHYSICS >> 7360 Fall, 2009 Description: ... Date Added: 2009-06-08 07:06:49 |
| chgrp.txt Path: University of Baltimore >> HOME >> 751 Fall, 2009 Description: chgrp students /users/students/mis001 chgrp students /users/students/mis002 chgrp students /users/students/mis003 chgrp students /users/students/mis004 chgrp students /users/students/mis005 chgrp students /users/students/mis006 chgr... Date Added: 2009-06-08 07:10:49 |
| IST220lab2assign.pdf Path: Penn State >> IST >> 104 Fall, 2009 Description: Spring 2007 Angsana A. Techatassanasoontorn IST 220 Networking and Telecommunications Network Lab Assignment 2 Constructing a Local Area Network Due date: Mar. 9, 2007 Acknowledgements: This lab assignment was developed by Dr. Peng Liu and Hai Wan... Date Added: 2009-06-08 07:12:14 |
| L6-ActivityTrends.ppt Path: Minnesota >> PA >> 8202 Spring, 2008 Description: Understanding Activity Patterns and Trends David Levinson Introduction Travel and Activity are Two Sides of the Same Coin Time in Travel is inseparable from Time at Activity Activities Considered (Home, Work, Shop, Other) Daily Activity... Date Added: 2009-06-08 07:12:27 |
| Between_a_rock_FINAL.pdf Path: Pittsburgh >> AEI >> 6365 Fall, 2009 Description: Forthcoming in REVIEW OF AFRICAN POLITICAL ECONOMY (2006) Between a Rock and a Hard Place: North Africa as a region of emigration, immigration and transit migration Martin Baldwin-Edwards The prevailing Eurocentric perspective on Mediterranean migrat... Date Added: 2009-06-08 07:26:51 |
| sockets.pdf Path: George Mason >> CS >> 475 Spring, 2008 Description: Network Programming using sockets TCP/IP layers Layers Application Message Messages (UDP) or Streams (TCP) Transport UDP or TCP packets Internet IP datagrams Network interface Network-specific frames Underlying network Network Programming 2 1 ... Date Added: 2009-06-08 07:29:22 |
| BodePlot.pdf Path: Bucknell >> ELEC >> 32004 Fall, 2009 Description: ... Date Added: 2009-06-08 07:31:31 |
| FASHION.DOC Path: N. Colorado >> ENG >> 495 Fall, 2009 Description: Fashion Women Men Hair Feathered Hair Rave, tons of it Stick-up bangs Multicolored Crimped Side Ponytails Ultra-Teased Platinum Blonde Glitter Rainbow Mohawks Long & Layered Slightly Teased Long Frizzy w/Bangs Curly Face Vivid Makeup Light Pink Lips ... Date Added: 2009-06-08 07:31:32 |
| web.ppt Path: Boise State >> EDUC >> 573 Fall, 2009 Description: WORLD WI DE WEB Click here to access and print notes for presen Boise State Educational Technology Outreach Program WORLD WIDE WEB -WWW Less than 2000 days olds (as of Nov 2000) 1 billion webpages and 50 million websites Hypertext - links to ot... Date Added: 2009-06-08 07:39:34 |
| Hunt_modulepattern_section2_comp3.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: 241 : Sample 3 2 4 1 4 2 3 1 2 4 3 1 2 4 3 1 3 2 4 1 241_Graphic Design I : Term : Your Name 2 1 4 3 4 2 1 3 1 4 2 3 4 2 1 3 2 1 4 3 4 3 1 2 1 4 3 2 3 4 1 2 4 1 3 2 4 3 1 2 1 2 3 4 2 3 1 4 1 2 3 4 3 2 1 4 1 2 3 4 3 2 4 1 4 2 3 1 2 4 3 1 2 4 3 1 ... Date Added: 2009-06-08 07:40:46 |
| AddSubLst.txt Path: Wisc Superior >> MCS >> 324 Fall, 2009 Description: Microsoft (R) Macro Assembler Version 6.15.8803 06/02/02 23:22:56 Add and Subtract (AddSub.asm) Page 1 - 1 TITLE Add and Subtract (AddSub.asm) ; This program adds and subtracts 32-bit integers. ; La... Date Added: 2009-06-08 07:55:29 |
| 003109_1.pdf Path: Pittsburgh >> AEI >> 5710 Fall, 2009 Description: ... Date Added: 2009-06-08 07:56:05 |
| CriticalIncidentsLog.xls Path: Berkeley >> I >> 213 Spring, 2009 Description: Priority 1 1 1 1 1 1 2 2 2 3 3 3 Change Five Forces image in homepage not clear Search options confusing Search Results Industry categories Industry Page Map Five Forces City Page Company Page content Quality of News Consistent layout for entire sit... Date Added: 2009-06-08 07:57:40 |
| 003478_1.pdf Path: Pittsburgh >> AEI >> 6306 Fall, 2009 Description: ... Date Added: 2009-06-08 07:57:49 |
| e3Soln.pdf Path: Colorado >> EXAM >> 2350 Fall, 2009 Description: ... Date Added: 2009-06-08 07:58:16 |
| charge2massratio.pdf Path: Colorado >> HEP >> 2150 Fall, 2009 Description: l.t Universlry af Colorado Experlnenc No. I Physlcs 2150 Laborarory Charge-to-llass Ratio of the Eleciron Boch the charge and the nass of the eLeclron sle fuadaoenial consiants of conslderable luportance. Houever, Elnce the force on a charged par... Date Added: 2009-06-08 07:58:29 |
| sp08web_syllabus.pdf Path: Oklahoma State >> AGCM >> 3223 Fall, 2008 Description: AGCM 3223 Web Design for Agricultural Organizations Spring Semester 2008 M 10:30 - 11:20 a.m., W 10:30 12:20p.m., F 11:30 1:20p.m. AGH 266 Instructor J. Tanner Robertson Department of Agricultural Education, Communications and Leadership 437 Agri... Date Added: 2009-06-08 07:59:25 |
| cv_markov.pdf Path: Dallas >> SXM >> 079200 Fall, 2009 Description: STANIMIR MARKOV Associate Professor of Accounting The University of Texas at Dallas School of Management 800 West Campbell Road Richardson, TX 75080-3021 Tel: 972.883.4426 Fax: 972.883.6811 E-mail: stan.markov@utdallas.edu ACADEMIC EMPLOYMENT Associ... Date Added: 2009-06-08 08:01:36 |
| NewcombPashleyStasko-MobileComputingRetail-CHI2003.pdf Path: CSU Channel Islands >> ICS >> 235 Fall, 2009 Description: Ft. Lauderdale, Florida, USA April 5-10, 2003 Paper: Designing Applications for Handheld Devices Mobile Computing in the Retail Arena Erica Newcomb, Toni Pashley, John Stasko College of Computing/GVU Center Georgia Institute of Technology Atlanta,... Date Added: 2009-06-08 08:02:35 |
| 1992_beyond.pdf Path: Pittsburgh >> AEI >> 1551 Fall, 2009 Description: What is the European Community? What makes it so unique yet so astonishingly diverse? One face of Europe di~plays diversity and universality; the other reveals common basic values and a striving for unity. On the one side , we see a disparate family... Date Added: 2009-06-08 08:03:12 |
| Cps3-00.pdf Path: Toledo >> ECO >> 327 Fall, 2009 Description: ERINDALE COLLEGE University of Toronto at Mississagua ECO 327Y - APPLIED ECONOMETRICS COMPUTER PROBLEM SET 3 Prof. A. Melino 2000/2001 Since 1992, the Bank of Canada has adopted inflation targeting. The current target band is 1-3%. That means that ... Date Added: 2009-06-08 08:04:26 |
| 104ahw1.pdf Path: UCSD >> MATH >> 104 Fall, 2009 Description: Math 104A Fall 2005 Homework #1 Will Garner A04528276 Pg 13 #2: Prove the following: (a) If a | b and b | c, then a | c. Suppose that a | b and b | c (and that a, b, and c are integers). That means that b = am for some integer m and c = bn for some ... Date Added: 2009-06-08 08:07:44 |
| figure4.doc Path: Georgia Tech >> ECE >> 4006 Fall, 2008 Description: Figure 4. 50 dB attenuated K28.5 eye diagram ... Date Added: 2009-06-08 08:08:04 |
| proj_summary_final.doc Path: Georgia Tech >> ECE >> 4007 Fall, 2008 Description: ECE4007 Project Summary Project Title Team Members (names and majors) Medication Tracking System Hank Bowden (E.E.) John Bowen (E.E.) Tyler Howell (E.E.) Kent Mustoe (E.E.) Laura Nguyen (E.E.) Robert Ussery (E.E.) Dr. Art Koblasz / L05 2009 Spring Th... Date Added: 2009-06-08 08:08:55 |
| FinAid.pdf Path: LSU >> APPL >> 027 Fall, 2008 Description: Office of Offi f Undergraduate U d d t Admissions Student Aid TOPICS TO BE DISCUSSED LSU Scholarships & Institutional Aid The Louisiana State TOPS Program Federal Financial Aid Th FAFSA The Fi... Date Added: 2009-06-08 08:13:31 |
| 4853_3.txt Path: Georgia Tech >> CS >> 4440 Fall, 2008 Description: CS4440 Course Reading Summaries Paper #: 1.26 Title: Learning and Inferring Transportation Routines (1) Problem Statement In this paper, the authors put forth a model that predicts a person\'s travel destination goals as well as aberrant behavior i... Date Added: 2009-06-08 08:23:17 |
| label.pdf Path: San Diego State >> ART >> 240 Fall, 2008 Description: Vector Morph Six Objects Sarah Bailey Project #1 February 9, 2009 Art 240 Digital Media MW 1pm Professor Prior San Diego State University ... Date Added: 2009-06-08 08:24:50 |
| BusLine-20030709-000-hublog.txt Path: Carnegie Mellon >> CS >> 20030709 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>08d0b93a8ef01523971de1f9428147557b72cfcb.txt</Key><RequestId>3871D3569E661E9C</RequestId><HostId>2dX2v1L+7nZUxsxWyai6VWgbZJI1... Date Added: 2009-06-08 08:25:19 |
| lab7b.pdf Path: Purdue >> ECE >> 438 Fall, 2008 Description: Purdue University: ECE438 - Digital Signal Processing with Applications 1 ECE438 - Laboratory 7: Discrete-Time Random Processes (Week 2) October 9, 2008 1 Bivariate Distributions In this section, we will study the concept of a bivariate distribu... Date Added: 2009-06-08 08:29:56 |
| 7seg_LED_1.pdf Path: UF >> EEL >> 4712 Fall, 2009 Description: The Seven-Segment LED Display Mechanical a f +5V b a b g f e c g c d d e dec Display +5V a Ra b Rb c Rc d Rd e Re RPack f Rf g Rg Electrical . ... Date Added: 2009-06-08 08:31:23 |
| McKee.pdf Path: Stanford >> ERE >> 1975 Fall, 2009 Description: PREDICTING EXPLOSION-GENERATED PERMEABILITY AROUND GEOTHERMAL WELLS C . R. McKee and M. E. Hanson Lawrence L i v e r m o r e L a b o r a t o r y U n i v e r s i t y of C a l i f o r n i a Livermore, C a l i f o r n i a 94550 The problem o f s t i m ... Date Added: 2009-06-08 08:35:05 |
| Chapter6_Part3.pdf Path: Mt. Marty >> PH >> 1725 Fall, 2009 Description: Chapter 6 Part 3 October 21, 2008 Bootstrapping From the internet: The bootstrap involves repeated re-estimation of a parameter using random samples with replacement from the original data. Because the sampling is with replacement, some items in the... Date Added: 2009-06-08 08:38:57 |
| chapter8.txt Path: CSU San Bernardino >> CS >> 201 Fall, 2009 Description: Background = Background : modules. Objects are a development of program \'modules\', modular (structured) programming. As we have seen, ensuring the correctness of programs is an extremely difficult task, that becomes more difficult as programs grow ... Date Added: 2009-06-08 08:40:57 |
| BusLine-20031025-003-hublog.txt Path: Carnegie Mellon >> CS >> 20031025 Fall, 2009 Description: LOGFILE_FORMAT_VERSION: 1.0 SESSION_ID: Default :BEGIN_UTT (-01) [Timestamp (-01): read:GAL_REPLY_MSG_TYPE Builtin(<Builtin>:-1) 342 new_session at 10:54:11.31 on 25-OCT-2003] [Timestamp (-01): send:GAL_MESSAGE_MSG_TYPE sphinx(localhost:11000) 3... Date Added: 2009-06-08 08:41:03 |
| HardDriveEvidence.ppt Path: Santa Clara >> COEN >> 252 Fall, 2009 Description: COEN 252: Computer Forensics Hard Drive Evidence Disk Overview Hard Drives Removable Devices Hard Drive Overview Data is stored in sectors of 512B, sectors are completely written and read. Data stays, unless it is overwritten. Hard Drive S... Date Added: 2009-06-08 08:52:33 |
| syl002.doc Path: Drake >> ECON >> 002 Fall, 2009 Description: Principles of Microeconomics Economics 2 Spring 2001 Required Text: K.Case and R.Fair: Principles of Microeconomics Suggested Supplement: Wall Street Journal Instructor: Dr. R.S. Hewett OfficePhone: 271.3834 Office Hours: T&R : 3:15-4:45 Meredith 109... Date Added: 2009-06-08 08:52:34 |
| hw6.pdf Path: Clemson >> ECE >> 801 Fall, 2009 Description: ... Date Added: 2009-06-08 09:01:04 |
| lecture10.ppt Path: Oakland University >> CSE >> 60833 Fall, 2009 Description: Embedding meshes and tori 9/19/07 Review We would like to embed different source network topologies in a target hypercubic permutation model. To embed a ring, we have previously used binary reflected grey codes. Binary Reflected Grey Codes Decima... Date Added: 2009-06-08 09:01:06 |
| agenda20051117s.pdf Path: Arkansas >> DEPTS >> 20051117 Fall, 2009 Description: ATTACHMENT S ADD, CHANGE OR DELETE PROGRAM OR UNIT Complete this form consistent with the instructions in Academic Policy 1622.20. Use the form to add, change, or delete a program or unit. Proposed additions and changes must be consistent with Academ... Date Added: 2009-06-08 09:01:19 |
| 02 - Slides - Part 1.pdf Path: Oakland University >> CSE >> 40547 Fall, 2009 Description: CMOS Transistor Theory (and its effects on scaling) Michael Niemier (Some slides based on lecture notes by David Harris) 1 Lecture 02 - CMOS Transistor Theory & the Effects of Scaling - CSE 40547/60547 Nanowire-based Gates Can make very small pn ... Date Added: 2009-06-08 09:03:57 |
| F_alcohol_nmr.doc Path: Alabama >> CH >> 237 Fall, 2008 Description: ... Date Added: 2009-06-08 09:15:06 |
| IEPform.pdf Path: Wisc Stevens Point >> LMEYE >> 699 Fall, 2009 Description: Individualized Education Program Plan Wishing/Hopeful School District of Central Wisconsin Evaluation Report and IEP Cover Sheet Form I-3 Name of Student: Lorraine Smith DOB: 05/10/99 Sex: Female Grade: 3 Parent or Legal Guardian: Sarah Smith Telepho... Date Added: 2009-06-08 09:15:26 |
| 30915mensoccer-weekly.pdf Path: Seattle Pacific >> MEDIA >> 0304 Fall, 2009 Description: S p ort s I n f or m at io n Of f i c e Frank MacDonald, SID FOR IMMEDIATE RELEASE: SEPTEMBER 15, 2003 2003 men\'s soccer 206/281-2772 voice | 206/281-2266 fax | frmacdon@spu.edu | www.spu.edu/falconsonline Home Remedy: Men\'s Soccer Returns To Inter... Date Added: 2009-06-08 09:17:03 |
| 1 key_grid.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: width 9\" ... Date Added: 2009-06-08 09:18:16 |
| Esthetics.pdf Path: Eastern Oregon >> MM >> 315 Fall, 2009 Description: Introduction You have learned how to manage forward and backward navigation through a series of screens, how to make hierarchical links using markers, and how to use puppetTransitions to associate visual effects with buttons. You have probably figure... Date Added: 2009-06-08 09:21:19 |
| Lecture14-ProportionalMaps.pdf Path: Colorado >> GEOG >> 3040 Fall, 2009 Description: Lecture 14 Proportional Symbol Maps Proportional point symbol mapping = variation in symbol size from place to place in proportion to the quantities it represents Also called graduated point maps or variable symbol maps When to use a PSM When d... Date Added: 2009-06-08 09:23:01 |
| license.txt Path: Humboldt State University >> DSPACE >> 338 Fall, 2009 Description: License granted by Jennifer Bidaurreta (jbid@charter.net) on 2007-05-29T20:50:07Z (GMT): Humboldt Digital Scholar NON-EXCLUSIVE DISTRIBUTION LICENSE By submitting this license, you (the author(s) or copyright owner) grant to Humboldt Digital... Date Added: 2009-06-08 09:23:42 |
| ch10-dma.pdf Path: Colorado >> ECEN >> 4002 Fall, 2009 Description: Chapter 10 DMA Controller Direct Memory Access (DMA) is one of several methods for coordinating the timing of data transfers between an input/output (I/O) device and the core processing unit or memory in a computer. DMA is one of the faster types of ... Date Added: 2009-06-08 09:24:37 |
| ss685-001w05.pdf Path: Michigan >> SSW >> 20053 Fall, 2009 Description: SW 685 Methods of Program Evaluation Winter 2005 T H E U N I V E R S I T Y O F M I C H I G A N SCHOOL OF SOCIAL WORK COURSE TITLE: DIVISION NUMBER: COURSE NUMBER: CREDIT HOURS: PREREQUISITES: LOCATION: Methods of Program Evaluation 782 685 3 522... Date Added: 2009-06-08 09:25:50 |
| bit_operations.xls Path: Maryland >> LECTURE >> 311 Fall, 2009 Description: Low-level operations in C C was invented as a high-level systems programming language Higher than assember, but still close to the machine Low-level operations in C C was invented as a high-level systems programming language Higher than assember, bu... Date Added: 2009-06-08 09:29:55 |
| YMR065W.t2k.alpha-logo.pdf Path: UCSC >> YMR >> 065 Fall, 2009 Description: YMR065W.t2k ALPHA 2 1 E G H EIH I B C F T I H B B B DDD E E H F E E E A B B T S X XXXHHHEXXEXHHXHXXXIHXXXHIIIX X X X X X X X X XX X X X X XXXXXSCXXXHIIIXIG X X X X X X X X X E H HHHHH D S E B H H HHH H H XX EEAC B AAE A HS E H E H HH... Date Added: 2009-06-08 09:37:43 |
| YMR004W.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YMR >> 004 Fall, 2009 Description: YMR004W.t2k CB_BURIAL_14_7 3 2 1 AAA X X 10 20 30 40 A 3 2 1 D A D B D B A B A D A B A AABBBAAAAAABBA BBA BB B B A A B B B B B C C C C C C C C C C C C C C C C D D D D D D D D D D D D D D D X X X X X X X X X X X X X X X AAA A A A A A ... Date Added: 2009-06-08 09:38:22 |
| Week5_notes.doc Path: Washington >> WEEK >> 590 Fall, 2009 Description: Hi allwe hope you are all hard at work on creating Polya \'check lists\' for climate and earth sciences. We\'ll have lists too. Please email them to both of us before class tomorrow so that we can print them up and share them among the group. Secondly, ... Date Added: 2009-06-08 09:42:13 |
| Chapter_NIPA.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 509 Fall, 2008 Description: National Income and Product Accounts Motivation We begin by studying the system of National Income and Product Accounts, referred to as NIPA. A thorough understanding of the NIPA is needed to complete Step 3 of the calibration method. Recall that Ste... Date Added: 2009-06-08 09:45:50 |
| NPDE14p4.pdf Path: University of Illinois, Urbana Champaign >> CS >> 455 Spring, 2008 Description: Numerical Methods for Partial Differential Equations Eric de Sturler University of Illinois at Urbana-Champaign The trial space W kr is the set of functions v(x, t ) defined on W % I such that the restriction v| Sn of v to the space-time slab S n is... Date Added: 2009-06-08 09:50:57 |
| trace1_decode.txt Path: Allan Hancock College >> INFT >> 081 Fall, 2009 Description: - Packet 1 TIME: 10:41:32.533638 LINK: 00:B0:D0:D3:D3:AD -> 00:00:0C:07:AC:00 type=IP IP: henry -> minnie hlen=20 TOS=00 dgramlen=44 id=5976 MF/DF=0/1 frag=0 TTL=64 proto=TCP cksum=C932 TCP: port 1479 -> 21 seq=1449154503 ack=0000000000 hlen=24 ... Date Added: 2009-06-08 10:12:51 |
| ema201mastergradeslist-spring2009.pdf Path: Wisconsin >> ENGR >> 201 Fall, 2009 Description: EMA 201 - Statics Master Grades List out of 10 PIN # 1050 1065 1109 1150 1155 1166 1174 1180 1209 1251 1260 1264 1282 1291 1362 1373 1390 1469 1493 1512 1525 1561 1564 1568 1572 1614 1621 HW 1 10 10 10 10 9 9 10 9 10 10 9 10 7 10 9 8 9 10 10 10 10 10... Date Added: 2009-06-08 10:16:18 |
| CompleatCladist.pdf Path: University of Alaska Fairbanks >> ZOOL >> 575 Fall, 2009 Description: THE UNIVERSITY OF KANSAS MUSEUM OF NATURAL HISTORY SPECIAL PUBLICATION No. 19 THE COMPLEAT CLADIST A Primer of Phylogenetic Procedures E. O. WILEY D. SIEGEL-CAUSEY D. R. BROOKS V. A. FUNK LAWRENCE October 1991 THE UNIVERSITY OF KANSAS MUSEUM OF... Date Added: 2009-06-08 10:17:41 |
| hw10.pdf Path: Virginia Tech >> MATH >> 5126 Spring, 2008 Description: Math 5126 Friday, April 4 Tenth Homework Due 9:05 a.m., Friday April 11 1. Essentially Exercise 15.1.10 on p. 668. Let k be a field and let R denote the subring k[x, x2 y, x3 y2 , . . . ] of k[x, y]. Prove that the ideal (x, x2 y, x3 y2 , . . . ) o... Date Added: 2009-06-08 10:20:49 |
| aptec_ge_23.pdf Path: Fayetteville State University >> PHY >> 4822 Fall, 2009 Description: ... Date Added: 2009-06-08 10:21:38 |
| DrillCalipersVs.Depth-TwoDays-current.pdf Path: Wisconsin >> MEDIA >> 1214 Fall, 2009 Description: Drill Calipers Vs. Depth From 12/11/2007 9:59:59 to 12/14/2007 9:59:59 1 Calipers 0.8 Caliper (m) 0.6 0.4 0.2 0 -50 0 50 100 150 Depth (m) 200 250 300 350 IceCube ehwd plot, Sat Dec 15 05:32 2007 ... Date Added: 2009-06-08 10:30:24 |
| H10.ps Path: Duke >> X >> 130 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: H10.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR17 CMR10 CMTI12 CMR8 CMR12 CMR7 CMMI12 %EndComments %DVIPSWebPage: (www.radicaleye.co... Date Added: 2009-06-08 10:31:47 |
| H19-solution.pdf Path: Duke >> X >> 130 Fall, 2009 Description: ... Date Added: 2009-06-08 10:31:57 |
| info_Bagley_131_seating_chart.pdf Path: Washington >> CHEM >> 162 Fall, 2008 Description: 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 261 262 263 264 265 266 237 238 239 240 241 242 213 214 215 216 217 218 189 190 191 192 193 194 165 166 167 168 169 170 141 142 143 144 145 146 117 118 119 120 121 122 93 69 94 70 95... Date Added: 2009-06-08 10:41:40 |
| 04_075.txt Path: UPenn >> VHM >> 801 Fall, 2009 Description: Exercise 4.75 - Two scales for measuring weight. For an item with true weight of 2g, the scales give results: X with mean 2.000g and std.dev. 0.002g, Y with mean 2.001g and std.dev. 0.001g. Also, X and Y are independent. (a) Z = Y-X. EZ = E... Date Added: 2009-06-08 10:41:54 |
| aaq6a.pdf Path: CSU Stanislaus >> SCIENCE >> 2090 Fall, 2009 Description: Biochemistry for Nurses Winter 2003 Dr. Stone Structure Name three letter code One letter code pKa O O NH3+ O O NH3+ O O NH3+ O O NH3+ O O NH3+ O O NH3+ O O N NH3+ S O O NH3+ O O N H O HS NH3+ O HO NH3+ OH O O O O NH3+ O O NH2... Date Added: 2009-06-08 10:42:12 |
| hw2.doc Path: Colorado >> APPM >> 3310 Fall, 2008 Description: Homework #2 1. Section 1.3, page 19: #22c (For this problem, find the elementary matrices E1, E2 and E3 and the corresponding matrices L1, L2 and L3. Verify that (i) E3E2E1 A=U, (ii) L1L2L3=L and (iii) LU=A.) 2. Section 1.3, page 22: #31 (Use the LU... Date Added: 2009-06-08 10:44:39 |
| 06.09.20.Behavior(4)Msrment(5).ppt.pdf Path: U. Houston >> PSYC >> 6036 Fall, 2009 Description: Methods and Measurement Week of September 18, 2006 Quiz Administrative stuff Orientation grades not done yet Journal reviews due today HW #2 next week Possible topic for I/O students Issues with groups? 1 Apply to group topics Describe... Date Added: 2009-06-08 10:49:06 |
| razor-tcp-congest.pdf Path: Duke >> X >> 214 Spring, 2009 Description: Congestion Adolfo Rodriguez CPS 214 February 19, 2004 Congestion Control Router Congestion 1.5 Mb ps ps 10 Mb ps 10 Mb 10 Mb ps What if rate of packets arriving > rate of packets departing Congestion Control Overview Challenge: how do we effic... Date Added: 2009-06-08 10:54:44 |
| mems_overview.ppt Path: Duke >> X >> 210 Fall, 2009 Description: Outline for today Topic: MEMStore paper Administrative: No class on Wednesday! MEMS-based Storage David Nagle, Greg, Ganger, Steve Schlosser, and John Griffin http:/www.chips.ece.cmu.edu/ What if a disk drive could Storage 10 Gbytes of data I... Date Added: 2009-06-08 10:54:52 |
| math445_spring06_syllabus.pdf Path: Acton School of Business >> MATH >> 445 Fall, 2009 Description: MATH 445 Algebraic Topology Instructor: Oce: E-mail: TA: Oce phone: Stefan Friedl Herman Brown 426 friedl@rice.edu Andrew Elliott (elord@rice.edu) (713) 348 4896 Time: Location: Course webpage: Oce Hours: Spring 2006 MWF 1:00 1:50 Herman Brown Hall... Date Added: 2009-06-08 10:55:16 |
| YDL141W.t2k.str2-logo.pdf Path: UCSC >> YDL >> 141 Fall, 2009 Description: YDL141W.t2k STR2 5 4 3 2 1 C Q ZQQ A S Z Q PY Z CST M Z Y C C X XXCYQYXXXZBHXXXX X X X X S S X X X 1 10 20 30 40 Q A 5 4 3 2 1 T H Q Z H G T S Q CMMQCQSCCCC TT QM G ST H H Y EXXXMXXXXSSXXGXTXX T C G G TT X X X T X QP P QC P Q CS... Date Added: 2009-06-08 11:04:09 |
| pixmap.pdf Path: Duke >> X >> 006 Fall, 2009 Description: Test #2 Topics Parameter passing value, reference, const reference Classes Documentation/Class design interface vs. implementation Free vs. member functions Structs Enumerated Types Vectors Basic methods Size vs. capacity Searching Sorted insertion &... Date Added: 2009-06-08 11:07:41 |
| 421Pres02.ppt Path: Western Washington >> MIS >> 421 Fall, 2008 Description: This presentation prepared for MIS 421 at Western Washington University. Material in this presentation drawn from Richard T. Watson, Data Management: Databases and Organization, 5th Ed., the instructor\'s experience, and other sources as noted. Some... Date Added: 2009-06-08 11:23:55 |
| hamlet.txt Path: Colorado State >> CS >> 156 Summer, 2008 Description: HAMLET DRAMATIS PERSONAE CLAUDIUS king of Denmark. (KING CLAUDIUS:) HAMLET son to the late, and nephew to the present king. POLONIUS lord chamberlain. (LORD POLONIUS:) HORATIO friend to Hamlet. LAERTES son to Polonius. LUCIANUS nephew to t... Date Added: 2009-06-08 11:26:06 |
| B A.pdf Path: San Diego State >> GB >> 0506 Fall, 2009 Description: Business Administration OFFICE: Student Services 3428 TELEPHONE: 619-594-8073 FAX: 619-594-1863 E-MAIL: gradbus@mail.sdsu.edu http:/www.rohan.sdsu.edu/~cba/request.html Accredited by AACSB InternationalThe Association to Advance Collegiate Schools o... Date Added: 2009-06-08 11:35:11 |
| ENGL.pdf Path: San Diego State >> GB >> 0506 Fall, 2009 Description: English TELEPHONE: 619-594-5443 FAX: 619-594-4998 E-MAIL: Adams Humanities 4158 OFFICE:EandCL@mail.sdsu.edu http:/literature.sdsu.edu In the Depar tment of English and Comparative Literature In the College of Arts and Letters Faculty Sherry B. Litt... Date Added: 2009-06-08 11:35:17 |
| Chapter-11-A.ppt Path: Texas Brownsville >> BLUE >> 1325 Fall, 2009 Description: LIMITS (pages 598-599) With this presentation, I will try to explain why and how the authors did what they did. Some of it is not evident because you are reading the results not the order of the results. (1) 2 - 4 1 - 4 - 3 x2 - 4 = = = 3. Given f ( ... Date Added: 2009-06-08 11:36:49 |
| chapter10.pdf Path: UCSC >> CSE >> 111 Fall, 2009 Description: Deadlock Example Process 1 Process 1 Process 2 Process 2 Resource 1 Resource 1 Resource 2 Resource 2 Example Process 1 Process 1 Process 2 Process 2 Process 3 Process 3 Resource 1 Resource 1 Resource 2 Resource 2 Resource 3 Resource 3 Address... Date Added: 2009-06-08 11:39:59 |
| mod6.1.pdf Path: UCSC >> CSE >> 111 Fall, 2009 Description: Module 6: Process Synchronization Background The Critical-Section Problem Synchronization Hardware Semaphores Classical Problems of Synchronization Critical Regions Monitors Synchronization in Solaris 2 Atomic Transactions Operating System... Date Added: 2009-06-08 11:40:44 |
| ComputerFraudAbuseAct.pdf Path: Columbia >> MR >> 2651 Fall, 2009 Description: COMPUTER FRAUD AND ABUSE ACT, 18 U.S.C. 1030(A)-(H) Sec. 1030. Fraud and related activity in connection with computers (a) Whoever (1) having knowingly accessed a computer without authorization or exceeding authorized access, and by means of such con... Date Added: 2009-06-08 11:45:05 |
| YLR390W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YLR >> 390 Fall, 2009 Description: YLR390W.t2k DSSP-EHL2 2 1 C C C C E X X X X X C CCCCCCCCCCCCCCCCC E E X X X X X X X E 1 10 20 30 40 S E 2 1 E E H E H C C H C C H C C C X X X X X X X X X C C X X X T E T E H E 51 60 70 80 90 T 2 1 E E H T T S E CCCCCCCC... Date Added: 2009-06-08 11:47:13 |
| DDI.ANU.CS_Presentation.ppt Path: Allan Hancock College >> COMP >> 4300 Fall, 2009 Description: Enabling the Efficient Use of SMP Clusters The GAMESS / DDI Approach Ryan M. Olson Iowa State University Overview Trends in Supercomputers and Beowulf Clusters. DistributedMemory Programming Distributed Data Interface (DDI) SMP\'s and Cluste... Date Added: 2009-06-08 11:48:49 |
| k97.pdf Path: Global >> ECGA >> 5015 Fall, 2009 Description: ... Date Added: 2009-06-08 11:49:20 |
| Gen. Manip 290107.pdf Path: Allan Hancock College >> HB >> 308 Fall, 2009 Description: Genetic Manipulation of Mice Anke van Eekelen, PhD Telethon Institute for Child Health Research 100 Roberts Rd Subiaco, WA 6008 9489 7886, ankev@ichr.uwa.edu.au WHY would you make a genetically manipulated animal ? * To study the gene identity - ... Date Added: 2009-06-08 11:49:54 |
| te.txt Path: Mt. Holyoke >> PHYS >> 302 Fall, 2009 Description: 7016.06 10 7039.13 10 7191.1 15 7236.62 10 7263.5 20 7280.9 8 7289.26 10 7445.39 10 7460.98 12 7468.75 15 7481.26 10 7556.8 10 7688.61 6 7759.1 15 7818.79 8 7861.61 8 7921.69 15 7943.14 15 7950.34 10 7972.9 20 8056.15 6 8061.4 30 8082.5 10 8122.44 10... Date Added: 2009-06-08 11:50:43 |
| hw6.5.pdf Path: ECCD >> CS >> 334 Fall, 2009 Description: Homework 6.5 Due 14 April CSCI 334: Spring, 2005 7 April Handout 16 Reading 1. Guy Steele, \"Growing A Language\", http:/homepages.inf.ed.ac.uk/wadler/steele-oopsla98.pdf (Available from the \"Readings\" web page.) Problems 1. (15 points) . . . . . .... Date Added: 2009-06-08 11:53:05 |
| CMN_12_10_F08a_T06.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Client Meeting Notes CSCI 577a: Fall 08 Software EngineeringI Team #6 The IGM Online Art Gallery Date: Venue: Start time: 10th December,2008 Roles Project Manager Operational Concept Engineer/Shaper Feasibility Analyst ... Date Added: 2009-06-08 12:01:20 |
| ch2.ppt Path: N.E. Illinois >> CS >> 300 Fall, 2009 Description: Chapter 2 Web Site Design Principles Principles of Web Design, 4th Edition Objectives Design for the computer medium Create a unified site design Design for the user Design for accessibility Design for the screen Principles of Web Design, 4t... Date Added: 2009-06-08 12:02:06 |
| EWW_LCA_F06a_T11_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: EASY WINWIN REPORT Team 11 NEW ECONOMICS FOR WOMEN Raghava Aditya Ravula Swarag Segu Tejaswi Chadalavada Nitin Bandi Adil Fulara Veena Movva IV & V: Abbey .S. 1. Stakeholders STAKEHOLDER 1. Customer : The clients for whom we are building the system... Date Added: 2009-06-08 12:08:22 |
| 12_factorialANOVA.ppt Path: UCM >> PSY >> 5520 Fall, 2009 Description: FACTORIAL ANOVA Overview of Factorial ANOVA Factorial Designs Types of Effects Assumptions Analyzing the Variance Regression Equation Fixed and Random Effects FACTORIAL DESIGNS All combinations of levels of two or more independent variables ... Date Added: 2009-06-08 12:08:41 |
| swb_fit_zhang.txt Path: Berkeley >> ASTRO >> 00177533 Fall, 2009 Description: Ep=57.75 Chi/nu= 60.63/57 (1.064) ... Date Added: 2009-06-08 12:10:51 |
| SpreadSpectrum.ppt Path: New Hampshire >> ECE >> 734 Fall, 2008 Description: ECE734/834 Network Data Communications Spread Spectrum Modulation Spread Spectrum Spread data over wide bandwidth Makes jamming and interception harder Frequency hoping Direct Sequence - Narrow band signal broadcast over seemingly random series... Date Added: 2009-06-08 12:11:08 |
| hw09.ps Path: Maryland >> CMSC >> 250 Fall, 2007 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw09.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hw09 %DVIPSParameters: dpi=60... Date Added: 2009-06-08 12:11:50 |
| NLGRIDhw.xls Path: WVU >> PS >> 602 Fall, 2009 Description: An example of a grid search Actual True Model y = a +(1-c)x a b Guess 4.2 0.82 x y yhat SSE - - - -1 2.4 4.38 3.94 2 4.94 4.56 0.14 3 3.79 4.74 0.89 4 2.62 4.92 5.27 5 5.83 5.1 0.54 6 5.09 5.28 0.04 7 6.75 5.46 1.66 8 6.12 5.64 0.23 9 5.98 5.82 0.03... Date Added: 2009-06-08 12:12:06 |
| LECON_13_01decembre.doc Path: Université du Québec à Montréal >> A >> 7550 Fall, 2009 Description: valuation des apprentissages l\'enseignement suprieur FPE 7550 Politique d\'valuation des apprentissages et rglements Cours 13 Plan de leon Gilles Rache Dpartement d\'ducation et pdagogie 1e dcembre 2004 PLAN DE LEON : COURS 13, 1e dcembre 2004 1. ... Date Added: 2009-06-08 12:12:46 |
| Plague.pdf Path: Laurentian >> HLSC >> 3003 Fall, 2009 Description: PLAGUE YERSINIA PESTIS CAUSES ENZOOTIC VECTOR-BOURNE DISEASE INFECTING RODENTS AND FLEAS; HUMANS ARE INFECTED WHEN EXPOSED TO ZOONOTIC RESERVOIRS. INFECTION IN HUMANS USUALLY OCCURS AS BUBONIC PLAGUE WHEN FLEAS HAVE FLED ON PLAGUE INFECTED RODENTS ... Date Added: 2009-06-08 12:19:26 |
| summer2002-final.pdf Path: Bowling Green >> MATHSTAT >> 2215 Fall, 2009 Description: Math 2215 Multivariable Calculus Georgia State University (This paper consists of 11 pages.) Final Exam 1 August , 2001 Last name: First name: POINTS Show all of your work. Calculators are not needed or permitted. Write neatly. Place answers in ... Date Added: 2009-06-08 12:20:54 |
| day3.ppt Path: Cal Poly >> STAT >> 217 Fall, 2009 Description: Stat217Day3 DrawingConclusions Preliminaries (p. 32) Do you believe Elvis is still alive? Guess the percentage of adult Americans who believe Elvis faked his death. Would you say you consume candy rarely, sometimes, or often? LastTime Need tool... Date Added: 2009-06-08 12:22:30 |
| lab9.ps Path: Minnesota >> STAT >> 3011 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: lab9.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMBX12 CMCSC10 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLin... Date Added: 2009-06-08 12:23:01 |
| Ch1 S09.doc Path: Southern Oregon >> CH >> 411 Fall, 2009 Description: Chemistry 411 Chapter 1 Homework (revised) Due Tuesday, 4/7/09 1. a. Confirm the high density of the nucleus by calculating the density of the hydrogen nucleus using information in the text. b. Calculate the density of the hydrogen atom using the Bo... Date Added: 2009-06-08 12:23:49 |
| COIS20026_Tutorial3_Updated.rtf Path: Allan Hancock College >> COIS >> 20026 Fall, 2009 Description: #C#COIS20026_Tutorial3_Updated.rtf#=k8#?#{#6#z? v>#2,xWE=,b-;IIX\"W/Gc#tj }#xx<q0e1J4P#\'Uy7N<#EPPqh)8\">k_ # gD#Oq>1N~g#c1r\" 1_ _ ? #W <#7K,8#@#T66# I# #Dw t#A^(#T622 # C*#O hA7(G!c ##F3h[#h)^7jkmMcmMMmEbhs*Z#5q... Date Added: 2009-06-08 12:25:48 |
| Week8-References.pdf Path: Texas A&M >> AGCJ >> 404 Fall, 2008 Description: Authors AGCJ 404: Communicating Agricultural Information to the Public Invert all authors names; give surnames and initials for only up to and including 6 authors Use commas to separate authors See page 224-225 of APA manual for additional guidelines... Date Added: 2009-06-08 12:26:06 |
| Ass7.pdf Path: Acton School of Business >> CHEM >> 515 Fall, 2008 Description: Assignment 7 Chem 515 P&S 5.3 To derive the formula for k, first apply the steady state approximation to cisbut-2ene*, and then determine the overall reaction rate as d [trans-but-2-ene]/dt using equation 17. (The formula in the problem is incorrec :... Date Added: 2009-06-08 12:27:56 |
| 1038CGR.TXT Path: Texas A&M >> ODP >> 1038 Fall, 2009 Description: Sheet1 SiteHoleCoreTypeSectionPosition (cm)Depth (mbsf)Gamma Density g/cm3 1038C1R1001.275 1038C1R120.021.65 1038C1R140.041.527 1038C1R160.061.558 1038C1R180.081.575 1038C1R1100.11.558 1038C1R1120.121.481 1038C1R1140.141.45 1038C1R1160.161.541 1038C1... Date Added: 2009-06-08 12:29:15 |
| p111t115.pdf Path: ECCD >> DOE >> 315 Fall, 2009 Description: 97.315 Course Notes Page 111 Winter 2001 This work done on a +1 C test charge moving around the loop is the EMF in the loop. This work done is also the negative of the rate of change of flux through the loop! We can try a different thought exper... Date Added: 2009-06-08 12:31:55 |
| page019.pdf Path: ECCD >> DOE >> 315 Fall, 2009 Description: 97.315 Course Notes Page 19 Winter 2001 In our parallel plate example, equipotential surfaces are simply parallel planes as well, as shown below. +s C/m2 -s C/m2 Equipotential Surfaces +V If we have a projection or a hollow in one of the plates... Date Added: 2009-06-08 12:32:00 |
| page096.pdf Path: ECCD >> DOE >> 315 Fall, 2009 Description: 97.315 Course Notes Page 96 Winter 2001 We can choose any shape we like for our magnetic dipole loop; here, a square is convenient. Suppose our dipole vector forms an angle with the B field, as shown below in side view. F I m B a I F The total ... Date Added: 2009-06-08 12:32:11 |
| Design.ppt Path: Duke >> ECE >> 4006 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>08420cd146efe2d729de3db5cf385c4be0c32818.ppt</Key><RequestId>4 BE2D0A5B429C1A1</RequestId><HostId>zSEO8avN3iV5TArEQMZCcbB14iH... Date Added: 2009-06-08 12:33:44 |
| 170fa06practicefinalwxamkey.pdf Path: Idaho >> MATH >> 170 Fall, 2008 Description: ... Date Added: 2009-06-08 12:35:11 |
| sample_binary_1.txt Path: UF >> PROJECT >> 5155 Fall, 2009 Description: 00100000000000010000000000001010 10101100000000010000000100001000 00100000000101000000000000000010 10001100000000010000000100001000 00000100001000000000000000001100 00000000000000010101010100000000 10001101010000110000000010101100 1000110101000100000... Date Added: 2009-06-08 12:35:27 |
| 10.pdf Path: Virginia Tech >> MATH >> 3034 Fall, 2008 Description: Set #10 12 points (1) Compute the greatest common divisor, gcd(15428, 13079), and express it as a linear combination of 15428 and 13079. In other words, find a, b Z such that gcd(15428, 13079) = a15428 + b13079 (2) Prove/Disprove: (a) n Z+ , gcd(... Date Added: 2009-06-08 12:37:41 |
| Lab1.doc Path: Bergen CC >> CS >> 150 Fall, 2009 Description: EECS 150 Fall 2005 UNIVERSITY OF CALIFORNIA AT BERKELEY COLLEGE OF ENGINEERING DEPARTMENT OF ELECTRICAL ENGINEERING AND COMPUTER SCIENCE Lab 1 Lab 1 FPGA CAD Tools 1.0 Motivation In this lab you will take a simple design through the FPGA Computer A... Date Added: 2009-06-08 12:39:13 |
| E2.doc Path: Texas A&M >> STAT >> 303 Fall, 2008 Description: Exam 2 Outline DATE: March 27th 2009 COVERAGE: Chapter 4-6. Total Points: 100 The test constitutes 15% of your grade. What to bring to the test -1 page Formula Sheet -Calculator -Pencil and eraser -Z-table -Picture ID Chapter 4: Probability rules, W... Date Added: 2009-06-08 12:39:54 |
| Lecture02C.pdf Path: Fayetteville State University >> LECTURE >> 3002 Fall, 2009 Description: Lecture 2. Energy, Work, and Heat: The First Law of Thermodynamics Read sections 12.3 - 12.6 in your Intro to ME textbook. Thermodynamics is the study of the conversion of energy from one form to another. Let us examine some of the more common forms ... Date Added: 2009-06-08 12:40:32 |
| lesson11.pdf Path: Utah >> MATH >> 2280 Summer, 2008 Description: ... Date Added: 2009-06-08 12:40:38 |
| 08 Homework 4.doc Path: Acton School of Business >> MECH >> 401 Fall, 2008 Description: MECH 401 MECHANICAL DESIGN APPLICATIONS Homework #4 Failures Resulting from Static Loading Due: 5:00 PM, Thursday, February 7, 2008 Start each problem on a new page. Drawings should be neat use a straightedge! Box your final answers. Neatness count... Date Added: 2009-06-08 12:40:48 |
| intwkst.pdf Path: Evansville >> MATH >> 134 Fall, 2009 Description: Math 134 Integral Worksheet Spring 2007 Name: Due: Wednesday, April 25 Each problem is worth one point. You must show your work to receive full credit; partial credit will be awarded where appropriate. Evaluate the integral. 1. x(2x2 + x1/2 ) dx 2... Date Added: 2009-06-08 12:52:52 |
| old_t1.pdf Path: Alabama >> MA >> 238 Fall, 2009 Description: MATH238 OLD TEST 1 NOTE. This is andication of the length and the difficulty of the test. Students are responsible for all materials related to the actual test. 1. Classify each of the following differential equations: ODE or PDE, its order, linear o... Date Added: 2009-06-08 12:53:42 |
| NSCQNRI_Factors.pdf Path: East Los Angeles College >> GREE >> 1434 Fall, 2009 Description: NSCQ Nurse Self-Concept Questionnaire NSCQ FACTORS FACTOR Nurse General Self-Concept Caring DESCRIPTION An inclusive sense of self-esteem that is not specific to any area of the profession but encompasses a positive regard of the self within nur... Date Added: 2009-06-08 13:13:35 |
| Band Th.361.ppt Path: Rutgers >> CHEM >> 361 Fall, 2009 Description: Band Theory for Chemists MO\'s for arrays of 2 to infinite Li atoms Bands of MO\'s of metallic electrical conductors Mechanism of metallic conduction Band structures of insulators Band structures of semiconductors Doped semiconductors Photoconductors ... Date Added: 2009-06-08 13:14:47 |
| M458CH4.doc Path: RIC >> M >> 458 Fall, 2009 Description: Math 458 Homework Assignment 4 (Corresponds to Ch. 4 of Burton and related topics) Read Ch. 4, with the following comments: In 4.2, you can skip the details of the geometric solution of quadratic equations on pp. 161 163. In 4.3, understand the Divi... Date Added: 2009-06-08 13:16:37 |
| lecture10a.pdf Path: UF >> ECE >> 4744 Fall, 2009 Description: ... Date Added: 2009-06-08 13:17:41 |
| Exemplar.pdf Path: UMass (Amherst) >> SOM >> 497 Fall, 2009 Description: Page 1 of 32 BUSINESS PLAN Kelly Kalus and Ashley Kalus H2Om Inc. 115 Glades Rd. Scituate, MA 02066 781-545-0844 akalus@comcast.net Page 2 of 32 I. I. II. III. IV. V. VI. VII. VIII. Table of Contents Table of Contents..2 Executive Summary .3 Ge... Date Added: 2009-06-08 13:19:48 |
| Popcorn Lab Individual Score Sheet.pdf Path: Wisc Stevens Point >> JDICK >> 525 Fall, 2009 Description: Consumer Awareness Lab Rating Popcorn Score Sheet Lab 1. All members participating, staying on task, and completing the worksheet. 2. Work area cleaned. 3. Equipment put away. Poster 1. Neatness. 2. Colorful, creative design. 3. Easy to understand. 4... Date Added: 2009-06-08 13:20:04 |
| NS407 Divine Command lesson 11.ppt Path: New Mexico >> NS >> 407 Fall, 2009 Description: Divine Command -Explanation -Two opposing viewpoints -Interpretations -Valid Moral basis? Divine Command EXPLANATION: Divine Command is.? Divine Command What is it? Divine Command is looking at the will of God for moral direction (don\'t steal becau... Date Added: 2009-06-08 13:21:19 |
| game14.ppt Path: Duke >> CPS >> 006 Fall, 2009 Description: Graphical User Interfaces GUIs CompSci4 Graphical User Interfaces 14.1 The Plan Components FlatLayouts HierarchicalLayouts DesigningaGUI CodingaGUI CompSci4 Graphical User Interfaces 14.2 Components JLabel text/imagedisplay JT... Date Added: 2009-06-08 13:23:42 |
| china revalue 6a.pdf Path: Washington >> ARTICLES >> 472 Fall, 2009 Description: July 22, 2005 CREDIT MARKETS Treasury Yields Climb Amid Decision on Yuan Many Questions Remain About Long-Term Effects On U.S. Cost of Borrowing By MARK WHITEHOUSE Staff Reporter of THE WALL STREET JOURNAL DOW JONES REPRINTS This copy is for your ... Date Added: 2009-06-08 13:23:49 |
| q02.pdf Path: MN State >> C >> 160 Fall, 2009 Description: Chemistry 160 Fall 2004 Quiz #2 Key Name: _ For each row of the following table, assume all the properties/values not listed remain constant and circle the correct answer: As the _ of an ideal gas _, the __ of the gas _. As the: Volume Amount Pres... Date Added: 2009-06-08 13:24:02 |
| table48rawlinenequivalentofusimports.xls Path: Cornell >> ERS >> 89004 Fall, 2009 Description: Appendix table 48-Raw-linen-equivalent of U.S. imports of linen-containing textile manufactures, 2001-2003 1/ Yarn, thread, and fabric Apparel Year Yarn, Narrow, and thread, Broadindustrial, month cordage, woven and Suits and (inc. pile) Knit misc. a... Date Added: 2009-06-08 13:24:31 |
| trees_1015.pdf Path: UNC >> LING >> 101 Fall, 2008 Description: Practice trees for M Oct 15 lecture (1) What is the syntactic category of your? How do we know? (2) Note that category N cant directly be incorporated into VP or IP; we need to build NP (3) An example of a modifier remember to use the modifier s... Date Added: 2009-06-08 13:25:30 |
| ahs93.ps Path: UConn >> CSE >> 268 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 Copyright 1986-91 Radical Eye Software %Title: big.dvi %Pages: 37 1 %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: tex.pro /TeXDict 200 dict def TeXDict begin /N /def load def /B{bind def}N /S /exch load def... Date Added: 2009-06-08 13:28:38 |
| lecture 30.pdf Path: Southern Oregon >> METR >> 3123 Fall, 2009 Description: 1 METR 3123, Atmospheric Dynamics II Alan Shapiro, Instructor Monday, 31 March 2008 (lecture 30) reading: 4.2 3rd exam: April 25 Mass conservation eqn in isobaric coords p0 + p [where p < 0] p0 an infinitesimal air parcel bounded by two isobaric sfc... Date Added: 2009-06-08 13:32:57 |
| Ch_8_questions.pdf Path: Roanoke >> CHEM >> 101 Fall, 2009 Description: ... Date Added: 2009-06-08 13:34:16 |
| fact1.pdf Path: Idaho >> STAT >> 507 Fall, 2008 Description: 1 Factorial Experiments, Treatment Structure, and Analysis An experiment with more than one factor is a factorial experiment if all factorlevel combinations are used. Two advantages of this approach are i) the ability to detect interactions between... Date Added: 2009-06-08 13:39:31 |
| tedge.pdf Path: Michigan >> E >> 101 Fall, 2009 Description: The edges in an image can be identified using the following formula. For each point in the image, find the differences in both the horizontal and vertical directions, compute the square root of the sum of the squares of these differences, and place i... Date Added: 2009-06-08 13:41:03 |
| R_11_6_08.pdf Path: UCSB >> CHEM >> 117 Fall, 2009 Description: ... Date Added: 2009-06-08 13:42:03 |
| Analyse-portee.rtf Path: East Los Angeles College >> LW >> 107 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>08e7a03d6d46e6868c5a3593fe9307e20995e0ec.rtf</Key><RequestId>6 D78323114E35257</RequestId><HostId>aJ7ujIKeoCz4rJUwquKbUiEsQLf... Date Added: 2009-06-08 13:44:37 |
| Subprime.ppt Path: W. Alabama >> AFM >> 371 Fall, 2009 Description: An Introduction to the Subprime Crisis in the U.S. Acknowledgement: Finance professors Ranjini Jha, Ken Vetzal, and numerous internet resources. The American Dream House Price Soure: Office of Federal Housing Enterprise Oversight Real Salary Gro... Date Added: 2009-06-08 13:46:12 |
| WSSP2009.pdf Path: Penn State >> SUB >> 194 Fall, 2009 Description: Synopses Generation for Specialized Document-Element Search Engines Sumit Bhatia Computer Science and Engineering The Pennsylvania State University University Park, PA-16802, USA Prasenjit Mitra College of Information Sciences and Technology The Pen... Date Added: 2009-06-08 13:57:16 |
| ass11f.txt Path: Texas A&M >> M >> 401 Fall, 2009 Description: HOMEWORK, WEEK 11 (Fulling\'s section) Do the problem assigned to you as author, and one other problem from this list (not one that you are assigned to review). Exercise Author Reviewers... Date Added: 2009-06-08 14:03:48 |
| G10.100.044.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >G10.100.044 Chr10 contig 100 bases 224348.225074 AAAATTTCTAAAGAATTTTGCTGTTGTTGGCAATTCACCGCTTGCTCTAT CAGAAATTAGCTTTAAATAATAGTATAGTCTCTCGTGTTTGGAAGAATGC TTTAATTCTTTCCAATCTTTGGTTACAAAACCTTTTTGGCATAGGATTGG CGTAACAAATTGAGGAAATATACCATTCTCTGGATTATGGAAAATC... Date Added: 2009-06-08 14:06:11 |
| Exercise_&_heart_disease.txt Path: Yale >> LR >> 288 Fall, 2009 Description: AHA Comment: Leisure-Time Activity and the Risk of Primary Cardiac Arrest A study, published in the April 12, 1999 issue of the Archives of Internal Medicine, reports that regular, moderate-intensity exercise can protect you from sudden cardiac... Date Added: 2009-06-08 14:08:03 |
| LycidasBoesky.pdf Path: Hudson VCC >> ENGS >> 320 Fall, 2009 Description: The Maternal Shape of Mourning: A Reconsideration of \"Lycidas\" Amy Boesky Modern Philology, Vol. 95, No. 4. (May, 1998), pp. 463-483. Stable URL: http:/links.jstor.org/sici?sici=0026-8232%28199805%2995%3A4%3C463%3ATMSOMA%3E2.0.CO%3B2-W Modern Philolo... Date Added: 2009-06-08 14:20:36 |
| Exam1F01.ps Path: Purdue >> EE >> 648 Spring, 2001 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: Exam1F01.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: cmbx12 cmr12 cmmi12 cmr8 cmsy10 cmti12 cmsy8 cmmi8 cmr6 %+ cmmi6 cmex10 cmsy6 ... Date Added: 2009-06-08 14:21:25 |
| 18_honorifics-syntax.pdf Path: UNC >> LING >> 563 Fall, 2008 Description: LING/JAPN 563 - Structure of Japanese Spring 2009 The syntax of honorific verb forms I. Background on politeness markers (1) Two dimensions of politeness marking (a) (Harada 1976) Expressing politeness (social distance) toward your interlocutors: ... Date Added: 2009-06-08 14:34:49 |
| doj interrogtn memo.pdf Path: Washington University in St. Louis >> POLSCI >> 3254 Fall, 2009 Description: ... Date Added: 2009-06-08 14:35:53 |
| Sketch1.pdf Path: San Diego State >> ART >> 240 Fall, 2008 Description: ... Date Added: 2009-06-08 14:43:25 |
| 200033_r01x_971360.pdf Path: Stanford >> CHK >> 1002 Fall, 2009 Description: IN THE UNITED STATES DISTRICT COURT FOR WESTERN DISTRICT OF OKLAHOMA T MAR 3 200 0 ROBE U.S. DISL COU D ENNIS, CLER K T, STERN DIST OF OKLA BY IN RE CHESAPEAKE ENERGY ) DEPUTY CORPORATION SECURITIES ) No . CIV-97-1360-L LITIGATION ) JUDGMEN T Pur... Date Added: 2009-06-08 14:54:14 |
| 2_7702_06_2.pdf Path: IUPUI >> CSC >> 7702 Fall, 2009 Description: A Review of Key Networking Concepts Dr. Arjan Durresi Louisiana State University Durresi@CSC.LSU.Edu These slides are available at: http:/www.csc.lsu.edu/~durresi/csc7702-06/ Louisiana State University 2- A Review of Key Networking Concepts - 1 CSC... Date Added: 2009-06-08 15:02:06 |
| Given.doc Path: UT Chattanooga >> ENGR >> 435 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|25 Sep 1998 15:49:02 -0000 vti_extenderversion:SR|5.0.2.6738 vti_cacheddtm:TX|25 Sep 1998 15:49:02 -0000 vti_filesize:IR|22016 vti_cachedtitle:SR|Given: vti_title:SR|Given: vti_assignedto:SR| vti_approv... Date Added: 2009-06-08 15:02:35 |
| alpha2001.txt Path: Loyola Chicago >> COMP >> 3480 Fall, 2009 Description: #include <GL/glut.h> #include <stdlib.h> #include \"gmu.h\" int obj=0, perspective=0; float fAspect; float transblue[4]={0.0,0.0,1.0,0.5}; void grid(void) { int i; glDisable(GL_DEPTH_TEST); /otherwise grid will be pixelated glColor4f(0.9,0.9,... Date Added: 2009-06-08 15:03:35 |
| ComputeFigure.txt Path: CSU Chico >> CSCI >> 111 Fall, 2009 Description: /* /Program name: /Problem Desrciption: / /Name: /Date: /class: /* import java.awt.*; import java.applet.*; import java.awt.event.*; /* / class that handles mouse events / / keeping track of the mouse location and whether / or not a button is pres... Date Added: 2009-06-08 15:10:08 |
| Calculator.txt Path: NJIT >> CIS >> 602 Fall, 2009 Description: /* * Calculator.java * * Created on April 25, 2006, 6:07 AM * * To change this template, choose Tools | Template Manager * and open the template in the editor. */ import java.awt.*; import java.applet.Applet; import java.awt.event.*; /* * * ... Date Added: 2009-06-08 15:14:56 |
| 01Lecture1.doc Path: UT Arlington >> DMW >> 2350 Fall, 2009 Description: Chapter 1: New World Encounters and the Columbian Exchange I. Native American Origins A. Environment, Change, and Human History 1. Human evolution has proceeded against a backdrop of great Ice Ages. The latest one occurring only 20,000 BCE years ago... Date Added: 2009-06-08 15:14:58 |
| extension.doc Path: East Los Angeles College >> ACE >> 0335 Fall, 2009 Description: The Institute for Lifelong Learning 196198 West Street Sheffield S1 4ET Tel (0114) 222 7000 Fax (0114) 222 7001 Application for Extension Form Module Code . Module Title .. Name of Award Bearing Course Name of Student . .. Reason for extension... Date Added: 2009-06-08 15:20:44 |
| test3-summer06.DOC Path: Kentucky >> BIO >> 350 Fall, 2008 Description: MC= SA/ essay= NAME_ 7/28/06 BIO 350 EXAM #3 SUMMER 2006 (2 points each for multiple choice) 1. The primary force driving fluids to leak from capillaries (on the arterial side of the capillary) into the interstitial tissue is: A. hydrostatic pressure... Date Added: 2009-06-08 15:25:41 |
| slides10.ppt Path: Duke >> X >> 100 Fall, 2009 Description: Inheritance and Observers Animated postfix program shows observer pattern, multiple observers \"viewing\" the same thing inheritance and pointers used to facilitate the pattern Postfix parse() addObserver() 0.n PostObserver init() update() Parsing: r... Date Added: 2009-06-08 15:26:42 |
| ME.pdf Path: Kentucky >> BULL >> 0506 Fall, 2009 Description: ME Mechanical Engineering ME 101 ORIENTATION TO MECHANICAL ENGINEERING (Freshman and Transfer Students). (1) Introduction to the profession of mechanical engineering: its history, practice, and methods of analysis. ME 151 MANUFACTURING ENGINEERING.... Date Added: 2009-06-08 15:30:19 |
| Lecture6-07.pdf Path: Iowa State >> ASTRO >> 120 Fall, 2008 Description: Jorgensen 2005 Lecture 6 - Coordinates II -More on the equatorial system -Combining coordinate systems -Using a star wheel Last time Seasons, Coordinates I What does not cause the seasons What does cause the seasons Equatorial coordinates S... Date Added: 2009-06-08 15:40:26 |
| Objectives-Campy-Ecoli-Sal.doc Path: Washington >> ZEPI >> 526 Fall, 2009 Description: Campylobacteriosis-E. coli-Salmonellosis Questions 1. E. coli O157:H7 outbreaks are often associated with produce or hamburger. What are the different sources of contamination for these different foods and why is this a public health problem? 2. What... Date Added: 2009-06-08 15:44:03 |
| 220ln08.pdf Path: UConn >> EE >> 220 Fall, 2009 Description: ... Date Added: 2009-06-08 15:44:14 |
| SuperposCircVDCVDC_CTBnr.doc Path: Utah >> ECE >> 2260 Fall, 2008 Description: CONCEPTU A L TOOLS By: Neil E. Cotter Ref: Nilsson & Riedel, Rev 6, Prob 6.17 SUPERPOSITION CIRCUITS VDC + VDC EXAMPLE 1 CONCEPTU A L TOOLS By: Neil E. Cotter EXAMPLE 1 (CONT.) SUPERPOSITION CIRCUITS VDC + VDC CONCEPTU A L TOOLS By: Neil E. C... Date Added: 2009-06-08 15:45:43 |
| Area1_map2_2007_scores.pdf Path: UMKC >> MAPARCHIVE >> 0607 Fall, 2009 Description: ! ! BENNINGTON RR UP R R ! ! HOLMES ST ! BEACON MAIN ST 35TH ! ! ASHLAND RIDGE FREMONT E 17TH ST E TR N RD UMA BLUE RIDGE BLVD S STERLING AVE LEEDS ay O BL VD S HARDY AVE HUNTER BNS F FULLER EK ! ! ighw ! SW PE US HWY 1... Date Added: 2009-06-08 15:54:15 |
| 221 vocab list Nov 14.pdf Path: Hudson VCC >> JAPN >> 221 Fall, 2009 Description: ! ! !\"# $% %(! \"#! $%! <=>! ?@A! BCD! EFD! GH! IJK! L\"M! INO;! IH1! P! QR >! %STO! ! !\"# $%... Date Added: 2009-06-08 15:54:26 |
| Chap7n.ppt Path: Penn State >> HRIM >> 350 Fall, 2008 Description: Locating Manufacturing Facilities (Qualitative Factors) Local Infrastructure Worker Education and Skills Product Content Requirements Political/Economic Stability 74 Irwin/McGrawHill TheMcGrawHillCompanies,Inc.,1999 Locating Manufacturing Faci... Date Added: 2009-06-08 15:56:08 |
| ec908_2009_ps5_solutions.pdf Path: East Los Angeles College >> EC >> 908 Fall, 2009 Description: 1 1.1 EC908. 2009. PS5. Double Moral Hazard. Effort and risk taking.1 In this variation of the Moral Hazard model, the agent can also choose to affect the distribution of outcomes in terms of risk. the goal is to show that debt contracts have good ... Date Added: 2009-06-08 15:56:24 |
| B0723Salzburg_16_dem.txt Path: Washington University in St. Louis >> MER >> 0723 Fall, 2009 Description: The file B723_Salzburg16_dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0242893 2) Add -6.19377 The x & y scales are 0.030 mm / pixel. Maximum value for DEM, co... Date Added: 2009-06-08 16:02:08 |
| Q2-2009.pdf Path: Arizona >> POL >> 435 Fall, 2008 Description: POL 435 Spring 2009 Question Set 2 Name: _ Discussion Questions due February 5. Must submit electronic copy to D2L dropbox by 3:15 p.m. on February 5 to receive credit. Bring a printed copy to class on February 5 to use in the discussion. You shou... Date Added: 2009-06-08 16:04:49 |
| brianresume.doc Path: WVU >> EE >> 180 Fall, 2009 Description: Brian C. Launer Current Address 1911 District Dr. Morgantown, WV 26506 (814) 5121719 Objective Education Permanent Address 642 Dill Hill Rd Johnsonburg, PA 15845 (814) 9655166 Email Address blauner@mix.wvu.edu To obtain a full time position in a fi... Date Added: 2009-06-08 16:35:16 |
| 12-anns_part1_6up.pdf Path: Cornell >> CS >> 472 Fall, 2007 Description: Restaurant Data Set Neural Networks CS472/CS473 Fall 2005 Limited Expressiveness of Preceptrons Neural Networks Rich history, starting in the early forties (McCulloch and Pitts 1943). Two views: Modeling the brain \"Just\" representation of com... Date Added: 2009-06-08 16:39:30 |
| Assignment5.pdf Path: Eastern Oregon >> CS >> 121 Fall, 2009 Description: CS 121 Assignment Programming Languages and Authoring Objectives The purpose of this assignment is to help you develop a sense of perspective about the evolution of different types of programming. Task Research the answers to three of the following q... Date Added: 2009-06-08 16:39:43 |
| HW-solution_10.pdf Path: E. Kentucky >> EECS >> 512 Fall, 2009 Description: Additional problem: For a normalized n-th order Bessel-Thomson filter, the transfer function is, b0 Tn ( ) = n n -1 s + bn -1s + bn - 2 s n - 2 + .b1s + b0 (2n - k )! Where, bk = n - k 2 k!(n - k )! Filters of different orders will have different 3-d... Date Added: 2009-06-08 16:40:18 |
| hmwk2.txt Path: University of Louisiana at Lafayette >> CS >> 420 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_backlinkinfo:VX| vti_extenderversion:SR|3.0.2.926 vti_timelastmodified:TR|19 Sep 1998 18:45:43 -0500 ... Date Added: 2009-06-08 16:40:35 |
| Tallman poetry gs.doc Path: SUNY Cortland >> AED >> 404 Fall, 2009 Description: MariaTallman Genre:Poetryfor10thgrade Rationale: Focusingonparticulargenrebenefitsstudentsasitisaninclusiveanddetailed explorationofacertainformofliterature.Teachingstudentspoetrynotonlyexpandstheir creativitybutimmersestheminliteraryconventionsaswel... Date Added: 2009-06-08 16:42:19 |
| diode.pdf Path: BYU >> ECE >> 313 Fall, 2008 Description: ... Date Added: 2009-06-08 16:42:20 |
| lect4.ppt Path: UNF >> CEN >> 4533 Fall, 2009 Description: Wireless LAN Technology Chapter 13 Wireless LAN Applications LAN Extension Cross-building interconnect Nomadic Access Ad hoc networking LAN Extension Wireless LAN linked into a wired LAN on same premises Wired LAN Backbone Support... Date Added: 2009-06-08 16:43:43 |
| Lect4.pdf Path: Fayetteville State University >> PHY >> 2053 Fall, 2009 Description: PHY 2053C College Physics A Spring 2005 Motion, Forces, Energy, Heat, Waves Dr. Ingo Wiedenhver Dr. J. Liendo Dr. H.K. Ng Today: 1) Force 2) Newton\'s laws Force Most of you intuitively know the effect of forces: To set an object in motion or chan... Date Added: 2009-06-08 16:43:47 |
| ECE 351 Exam 2 Fall 2002.doc Path: Rose-Hulman >> ECE >> 351 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|10 Nov 2002 17:57:16 -0000 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|HERNITER-1\\herniter vti_modifiedby:SR|HERNITER-1\\herniter vti_timecreated:TR|10 Nov 2002 17:57:16 -0000 vti_cacheddtm:TX|10 Nov... Date Added: 2009-06-08 16:44:06 |
| notes.ps Path: Kentucky >> CS >> 471 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96.1 Copyright 2007 Radical Eye Software %Title: notes.dvi %CreationDate: Mon Feb 25 00:23:08 2008 %Pages: 25 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 595 842 %DocumentFonts: CMBX12 CMR10 CMSY10... Date Added: 2009-06-08 16:44:28 |
| grades_sp08.xls Path: FIU >> EEL >> 5718 Fall, 2008 Description: Bastin,Vineeth Bermudez,Heberto R Betancur,Andres Felipe Bilgen,Amac Bojji,Raghavendra Bruzon,Juan M. Chen,Kai Dhing,Siddharth Fan,Xueyan S Ferrari,Enzo Gaddam,Venkat Howard,Wayne E Immatty Joy,Lygio Kanumuri,Mourya Karimi,Masoumeh Kore,Santosh Kumar... Date Added: 2009-06-08 16:44:43 |
| Expt70.doc Path: CSU LA >> ME >> 413 Fall, 2009 Description: ME413-Expt#5 Aerodynamic Characteristics of Solar Car Designs Purposes 1. To compare the aerodynamic characteristics of two typical solar-powered car configurations. 2. To investigate the instability due to side wind gusts on these configuration de... Date Added: 2009-06-08 16:51:06 |
| acctest.pdf Path: WVU >> EE >> 481 Fall, 2008 Description: WEST VIRGINIA UNIVERSITY COLLEGE OF ENGINEERING AND MINERAL RESOURCES Lane Department of Computer Science and Electrical Engineering EE/CpE 480 SENIOR DESIGN SEMINAR Spring 2003 Acceptance Tests March 22, 2004 Team 16: Remote Fire Alarm Nick Rymer J... Date Added: 2009-06-08 16:54:09 |
| notes.pdf Path: SUNY Canton >> IT >> 501 Fall, 2009 Description: { z z y w j r p m j fh e d 7HF3ljj r xvut k f sqo nlkei g7Hra7H v x y xv Bieiwu s2f 6 A 4 hf b c b 0 6 Y A W U 2 C 2 S Q G C2 4 6 A G 0 D C A 0 8 6 42 0 trqH7pigedBa`HBXC9V3TBRBPIHBFEB@97531) #( \' ! # # l ... Date Added: 2009-06-08 16:54:36 |
| Ochs-Gross-Tics_reply.pdf Path: Columbia >> KO >> 2132 Fall, 2009 Description: DTD 5 ARTICLE IN PRESS TRENDS in Cognitive Sciences Vol.xx No.xx Monthxxxx TICS 353 Update Letters Response Putting the I and the Me in emotion regulation: Reply to Northoff Kevin N. Ochsner1 and James J. Gross2 1 2 Department of Psychology, Co... Date Added: 2009-06-08 16:54:57 |
| Airwaves Auction Still Faces Challenge.doc Path: CSU San Marcos >> HTM >> 430 Spring, 2008 Description: Airwaves Auction Still Faces Challenge By JOHN DUNBAR The Associated Press Friday, October 26, 2007; 6:55 PM WASHINGTON - Verizon Wireless has dropped its court challenge against the government\'s consumer-friendly rules governing an upcoming airwave... Date Added: 2009-06-08 16:55:11 |
| balanced scorecard assignment.doc Path: Wright State >> MBA >> 710 Fall, 2008 Description: MBA 710 Strategic Cost Management Spring 2009 Dr. Dave Bukovinsky PERFORMANCE MEASUREMENT AND BALANCED SCORECARD ASSIGNMENT REQUIREMENTS: Answer the following questions about performance measurements and balanced scorecards: 1. Why must strategy be t... Date Added: 2009-06-08 17:01:26 |
| 003693_1.pdf Path: Pittsburgh >> AEI >> 6848 Fall, 2009 Description: ... Date Added: 2009-06-08 17:01:58 |
| T0416.t04.dssp-ebghstl-logo.pdf Path: UCSC >> T >> 0416 Fall, 2009 Description: T0416.t04 dssp-ebghstl 3 2 1 1 10 20 30 40 E 3 2 1 T S H T E T H T 51 60 70 80 90 S 3 2 1 H T E T S H T E 101 110 120 130 140 H 3 2 1 T H H 151 160 170 180 190 H 3 2 1 T H T H H E 201 210 220 230 240... Date Added: 2009-06-08 17:02:54 |
| 25_Lg_thought.ppt Path: Washington >> COURSES >> 200 Fall, 2009 Description: Language and thought LING 200 Winter 2009 Plan for today Language and thought Summary of course Course evaluations Please turn off your cell phone. Concepts Every human language is `fully expressive\' translation possible exceptions might be ... Date Added: 2009-06-08 17:06:44 |
| hw2.doc Path: Washington >> COURSES >> 200 Fall, 2009 Description: LING 200 Homework #2 Due Thursday, April 13 in section at the beginning of class. Spring 2006 General instructions: We will not require you to type this homework, but please write very clearly. Like other homework assignments in this class, this ho... Date Added: 2009-06-08 17:06:46 |
| 31735055263994_1.pdf Path: Pittsburgh >> AEI >> 8695 Fall, 2009 Description: ... Date Added: 2009-06-08 17:07:48 |
| lecture-5.txt Path: Michigan State University >> CSE >> 491 Fall, 2008 Description: Lecture 5 Outline / September 23rd, 2008 = Homework stuff = HTTP protocol, query: : <method> <url> <protocol>\ \ <header line>\ \ <header line>\ \ [ . ] \ \ <content> method can be GET, POST; protocol is usually HTTP/1.0 or 1.1. ... Date Added: 2009-06-08 17:08:06 |
| output_mar_9.txt Path: Colorado State >> AT >> 541 Fall, 2009 Description: Forecast results from 9 March 2004 Campus Weather Station (FCL) error points Pereira 59 33 0 2 McDonough 55 32 0 7 Hidalgo 53 33 0 8 Rogers 53 ... Date Added: 2009-06-08 17:08:40 |
| slac-pub-2692.pdf Path: Stanford >> PUBS >> 2500 Fall, 2009 Description: SLAC-PUB-2692 February 1981 0) - RENORMALIZATION GROUP FOR MANY PARTICLE EXCLUSIVE AND EXCLUSIVE SEMI-INCLUSIVE PROCESSES* Subhash Gupta Stanford Linear Accelerator Center Stanford University, Stanford, California 94305 ABSTRACT In this of high... Date Added: 2009-06-08 17:09:36 |
| lect1.ppt Path: SUNY Albany >> CSI >> 445 Fall, 2009 Description: Object-Oriented Programming in Java Mei-Hwa Chen mhc@cs.albany.edu TTH: 1:30 2:30 http:/www.cs.albany.edu/~mhc/csi445R.shtm l Course Overview Lab. Assignments: 40% s Midterm Exam: 20% s Final Exam: 20% s Projects: 20% s Books Introductory s Java G... Date Added: 2009-06-08 17:10:58 |
| samplemidterm.pdf Path: Colorado >> ECON >> 4211 Fall, 2008 Description: Econ 4211 Sample Midterm exam Spring 2008 1. Assume there are three villagers who seek protection from bandits. Each samurai agreed to protect the village for at least 2 bags of rice. (a) Construct the tables indicating their marginal individual will... Date Added: 2009-06-08 17:12:45 |
| political_union_Com_opinion_COM_90_600.pdf Path: Pittsburgh >> AEI >> 941 Fall, 2009 Description: COMMISSION OF THE EUROPEAN COMMUNITIES POLITICAL UNION COMMISSION OPINION COM (90) 600 21 October 1990 Blank pages not reproduced: 4 , 6 This publication is also available in the following languages: ES ISBN 92- 826- 1975DA ISBN 92- 826- 1976- ... Date Added: 2009-06-08 17:14:37 |
| 11-4.ppt Path: CSU Northridge >> BMW >> 90457 Fall, 2009 Description: Math 310 Section 11.4 Surface Area Surface Area For a polygon, the surface area is the sum of all the areas of all the faces of the polygon. In this way it is similar to what you have already done for area, because each face will be a recogniza... Date Added: 2009-06-08 17:14:39 |
| BMB170c_Finals_Instructions.pdf Path: Caltech >> BI >> 170 Fall, 2008 Description: BMB170c Finals Instructions The final for BMB 170c will be an oral presentation from each student. Each presentation will be 20 minutes, including questions and answers. So please time your presentations, and try to leave ~ 5 minutes for Q & A. Pleas... Date Added: 2009-06-08 17:15:04 |
| SSO3078.t06.str2-logo.pdf Path: UCSC >> SSO >> 3078 Fall, 2009 Description: SSO3078.t06 str2 4 3 2 1 P CC X X X 1 10 20 30 40 Q 4 3 2 1 P Q S H S H S Q H TCCCHH HS S C X X H T TSXXXXX T S H C H X 51 60 70 80 90 T 4 3 2 1 H T Q H T T H HHHHHHHHH X X X X X X X X X X X T QQQ C TTCCPP MC S G CZP ... Date Added: 2009-06-08 17:15:14 |
| sample_exam_midterm_answers.pdf Path: Washington >> CHEM >> 110 Fall, 2008 Description: ... Date Added: 2009-06-08 17:15:53 |
| Lecture 13 as presentation.pdf Path: Allan Hancock College >> ELEC >> 3601 Fall, 2009 Description: ELEC3601/7608 Introduction to Image Formation ELEC3601/ELEC7608 Introduction to Image Formation Lecture 13 Filtering in the frequency domain I Introduction Introduction and background The Fourier transform and the frequency domain The Fourier tra... Date Added: 2009-06-08 17:16:04 |
| Sketch1.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: ... Date Added: 2009-06-08 17:16:39 |
| mt1reviewprobs.ps Path: Berkeley >> CS >> 174 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: mt1reviewprobs.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMMI12 CMSY10 CMR8 CMMI8 CMEX10 %EndComments %DVIPSWebPage: (www... Date Added: 2009-06-08 17:18:30 |
| slac-pub-1037.pdf Path: Stanford >> PUBS >> 1000 Fall, 2009 Description: SLAC-PUB-1037 (TH) and (EXP) COMPOSII\'E THEORY OF LARGE ANGLE SCATTERING AND NEW TESTS OF PARTON CONCEPTS J. F. Gunion, S. J. Brodsky and R. Blankenbecler Stanford Linear Act eleratbr Center Stanford University, Stanford, California 94305 ERRATA... Date Added: 2009-06-08 17:18:55 |
| Hellrung0905.doc Path: Uni. Westminster >> JIH >> 0329 Fall, 2009 Description: Westminster will kick off the Fall theater season with the state\'s first performance of the musical Urinetown. The triple Tony award winning production is about a fictional city in which a twenty-year drought leads to the outlaw of private toilets. W... Date Added: 2009-06-08 17:20:18 |
| Lecture 8.pdf Path: Alabama >> CS >> 357 Fall, 2008 Description: Outline Data Structures CS 357 Lecture 8 Phillip G. Bradford The University of Alabama Exceptions Exceptions Unexpected Conditions Throw-Catch Paradigm Alternatives: Abort program Self-built handling Careful of call stack, etc. Exceptions: Hierar... Date Added: 2009-06-08 17:30:16 |
| Lecture 14.pdf Path: Alabama >> CS >> 357 Fall, 2008 Description: Announcements Data Structures CS 357 Lecture 14 Phillip G. Bradford The University of Alabama The question/answer portion of Alumni Networking Night this Thursday September 29, is open to all engineering and computer science students. Heritage Room... Date Added: 2009-06-08 17:30:17 |
| strength02.doc Path: Idaho >> ME >> 262 Fall, 2009 Description: Strength Measurement Lab Exercise Introduction The intent of this laboratory is to introduce you to a couple of devices that have been designed to test your \"strength\" characteristics. The hopes are that not only will you study the apparatus you will... Date Added: 2009-06-08 17:34:45 |
| arch478_bldg_sketch.pdf Path: Washington >> ARCH >> 478 Fall, 2008 Description: ... Date Added: 2009-06-08 17:38:44 |
| TZD2Pr13_34.pdf Path: St. Lawrence >> MYSLU >> 222 Fall, 2009 Description: ... Date Added: 2009-06-08 17:41:56 |
| Chapter3Lecture.doc Path: WVU >> ACCT >> 431 Fall, 2008 Description: ACCT431 Spring 2006 Chapter 3 DeGeorge Page 1 of 3 Cost Accumulation for Job/Shop and Batch Production Operations Different types of operations lend themselves to different Cost Systems Job-Order Costing each job/product/order is unique and costs... Date Added: 2009-06-08 17:42:14 |
| 17Jan08_UNH.pdf Path: Dartmouth >> DMH >> 0708 Fall, 2009 Description: 2007-08 Men\'s Hockey Game Notes DARTMOUTH Weekend Spotlight (7-8-1, 3-7-1 ECAC Hockey, 0-3-0 Ivy) 2007-2008 SchEdulE/RESultS GAME 17 Dartmouth Big Green 7-8-1, 3-7-1 ECAC Hockey vs. #5 New Hampshire 13-6-1, 9-4-1 Hockey East Saturday, Jan. 1... Date Added: 2009-06-08 17:42:35 |
| quiz1s.pdf Path: UMass (Amherst) >> ECE >> 609 Fall, 2009 Description: ... Date Added: 2009-06-08 17:43:12 |
| EXAMIV.tort.doc Path: MSCD >> BIO >> 3600 Fall, 2008 Description: BIO 3600: Genetics Exam IV Dr George Cornwall Spring 2006 Directions: Write your name in big letters on your answer sheet in the BIG WHITE AREA and check that your answer sheet version matches the exam version you have. Using a #2 pencil completely d... Date Added: 2009-06-08 17:43:23 |
| terrmgmt.xls Path: Auburn >> MT >> 437 Fall, 2009 Description: Territory Management Example Sales Revenue P1 P2 P3 1 0 0 5000 2 475 1700 0 3 0 7950 0 4 4325 0 0 5 0 0 8900 6 1275 0 0 7 2750 550 0 8 7275 0 0 9 0 0 2500 10 0 0 3900 11 5275 0 0 12 0 1950 1000 13 5825 0 0 14 0 0 9700 15 3325 1150 0 16 0 3750 0 17 68... Date Added: 2009-06-08 17:44:38 |
| Math_Lecture_Questions.pdf Path: Evergreen >> WEEK >> 0708 Fall, 2009 Description: Group Questions Work with you neighbors to answer the following questions. 1. A pea plant with genotype Dd is crossed with another pea plant with the same genotype. Suppose 3 seeds are taken from such a cross and successfully grown. Let X be the nu... Date Added: 2009-06-08 17:44:58 |
| mgp00001.txt Path: Cal Poly >> CS >> 903 Fall, 2009 Description: Multi-Paradigm Design from James Coplien [Coplien98] Herve Bronnimann Polytechnic Univ. ... Date Added: 2009-06-08 17:49:11 |
| spreadr.txt Path: BU >> CS >> 551 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|22 Dec 1994 16:33:58 -0000 vti_extenderversion:SR|6.0.2.6353 vti_cacheddtm:TX|22 Dec 1994 16:33:58 -0000 vti_filesize:IR|512 vti_backlinkinfo:VX| vti_syncwith_localhost\\c\\:\\obelisk\\webs\\bestavroshome\\co... Date Added: 2009-06-08 17:49:54 |
| user-testing.ps Path: Berkeley >> CS >> 160 Fall, 1931 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - user-testing.ppt %Creator: Windows NT 4.0 %CreationDate: 9:31 11/12/1998 %Pages: (atend) %BoundingBox:... Date Added: 2009-06-08 17:51:09 |
| LectureNotes04.pdf Path: Utah >> MATH >> 5620 Spring, 2008 Description: ... Date Added: 2009-06-08 17:52:02 |
| LectureNotes10.pdf Path: Utah >> MATH >> 5620 Spring, 2008 Description: ... Date Added: 2009-06-08 17:52:03 |
| SisoTool Tutorial.pdf Path: Georgia Tech >> ME >> 3015 Fall, 2008 Description: SisoTool Quick Tutorial To start, you type sisotool (lower case) in the command prompt. You should get the screen on the right. The plot on the left is the root locus, and the plots on the right are the magnitude and phase plots of the Bode diagram.... Date Added: 2009-06-08 17:52:13 |
| slac-pub-5109.pdf Path: Stanford >> PUBS >> 5000 Fall, 2009 Description: SLAC-PUB-5109 October 1989 T/E Standard Model Predictions for CP Violation in B\" Meson Decay* CLAUDIO 0. Dru: ISARD DUNIETZ, FREDERICK J. GILMAN, Center 94309 AND YOSEF NIR Stanford Linear Accelerator Stanford University, Stanford, Californ... Date Added: 2009-06-08 17:53:16 |
| lecture10.pdf Path: WVU >> CS >> 470 Fall, 2008 Description: Computer Graphics CS 470 Computer Science and Electrical Engineering Dept. West Virginia University 17th September 2007 CS 470 (West Virginia University) Computer Graphics 17th September 2007 1 / 17 Outline 1 Review 2 Rotation 3 Matrix co... Date Added: 2009-06-08 17:56:48 |
| se27.ps Path: East Los Angeles College >> SE >> 21101 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: se27p.sdd %Creator: Windows NT 4.0 %CreationDate: 17:13 11/3/2000 %Pages: (atend) %BoundingBox: 14 13 581 829 %LanguageLevel: 2 %DocumentNeededFonts: (... Date Added: 2009-06-08 17:56:55 |
| Markopoulou.pdf Path: Montana >> EE >> 548 Fall, 2008 Description: Assessment of VoIP Quality over Internet Backbones Athina P. Markopoulou, Fouad A. Tobagi, Mansour J. Karam Abstract- As the Internet evolves into a ubiquitous communication infrastructure and provides various services including telephony, it will be... Date Added: 2009-06-08 17:56:56 |
| Notes-17.pdf Path: Texas >> M >> 427 Fall, 2008 Description: ... Date Added: 2009-06-08 18:15:00 |
| Notes-26.pdf Path: Texas >> M >> 427 Fall, 2008 Description: ... Date Added: 2009-06-08 18:15:02 |
| exam4c.pdf Path: Wisc Stout >> MATH >> 120 Fall, 2009 Description: Math 120 Timothy Zick Exam #4C Name: Directions: Follow all directions carefully. Show all work (where applicable). Problems without work may not receive full credit. Do not round any solution unless directed to by the problem. Print your first name ... Date Added: 2009-06-08 18:15:54 |
| 1010.txt Path: Virginia Tech >> CS >> 4804 Fall, 2003 Description: Oct 10, 2003 - - More on learning - learning requires bias - bias-variance dilemma holds - even within a bias, many solutions exist => Occam\'s razor - bias can be too limiting - Learning tasks - regression - classification - Learning meth... Date Added: 2009-06-08 18:30:06 |
| FallSchool.pdf Path: N. Michigan >> UAW >> 1950 Fall, 2009 Description: May 1 , 2006 TO: ALL LOCAL UNION PRESIDENTS, FINANCIAL SECRETARIES, RECORDING SECRET ARIES, UNIT CHAIRPERSONS, BARGAINING COMMITTEE CHAIRPERSONS, EDUCATION COMMITTEE CHAIRPERSONS, RETIRED AREA COUNCIL CHAIRPERSONS, RETIRED INTERNATIONAL COUNCIL CHA... Date Added: 2009-06-08 18:31:37 |
| TOP1.pdf Path: N. Michigan >> UAW >> 1950 Fall, 2009 Description: TO THE UAW TECHNICAL, OFFICE AND PROFESSIONAL LEADERSHIP CONFERENCE May 14-18, 2007 Walter & May Reuther UAW Family Education Center at Black Lake Onaway, Michigan February 21\' 2007 To: Presidents, Recording Loca1 Unions Secretaries, and Finan... Date Added: 2009-06-08 18:31:39 |
| Sudnow-NormalCrimes-SocialProblems.pdf Path: CSU Channel Islands >> ICS >> 235 Fall, 2009 Description: ... Date Added: 2009-06-08 18:31:51 |
| aPRELAB 8.pdf Path: Maryville MO >> CHEM >> 1320 Fall, 2009 Description: Name Date Lab Instructor Lab Section Experiment Eight Solution Conductivity Covalent and Ionic Solutes and Ions in Solution Prelaboratory Questions 1.) What is the difference between a molecular compound and an ionic compound?. 2.) How do you di... Date Added: 2009-06-08 18:33:54 |
| aPOSTLAB 7.pdf Path: Maryville MO >> CHEM >> 1320 Fall, 2009 Description: Name Date Lab Instructor Lab Section Experiment Seven The VSEPR Model Predicting the Shapes of Molecules Postlaboratory Questions 1.) Draw all of the resonance structures for N2O5. 2.) Which of these are the major resonance contributors? 3.) C6... Date Added: 2009-06-08 18:33:54 |
| ishs-1981summerinsidebackcover.pdf Path: N. Illinois >> ISHS >> 1981 Fall, 2009 Description: ... Date Added: 2009-06-08 18:34:32 |
| IntroRTLComp.pdf Path: Utah State >> ECE >> 5460 Spring, 2008 Description: RTL Compiler (rc) ECE 5530 Alan W Shaw 2005 The Linux Initial File (.bashrc) !Each linux user has an initialization file in their home directory ! This directory is named .bashrc. It is hidden. !You can open it by typing kedit .bashrc (You must ... Date Added: 2009-06-08 18:35:03 |
| labnotes_08_4.pdf Path: Allan Hancock College >> ELEC >> 3607 Fall, 2009 Description: ... Date Added: 2009-06-08 18:38:43 |
| handout13.pdf Path: Oakland University >> PDF >> 20204 Fall, 2009 Description: CHEM 20204 Lecture 13 Fossil Fuels March 10, 2008 http:/www.nd.edu/~pkamat/chem20204.html Topics covered Fossil Fuels Energy content Energy balance Gasoline additives and environmental impact Alternate Fuels: Biodiesel and ethanol Keypoints ... Date Added: 2009-06-08 18:40:26 |
| p25.pdf Path: Michigan State University >> LECT >> 232 Fall, 2009 Description: ... Date Added: 2009-06-08 18:46:00 |
| Team_6_Skills1.doc Path: Penn State >> MMJ >> 5023 Fall, 2009 Description: Team 6 Skills Team Members: Bryan Krawiec Jared Wineberg Michelle Jackson Stacey Triplett Radar Plot: 1 100 80 60 40 20 4 0 N 2 E O A C 3 On graph: 1 corresponds to Stacey 2 corresponds to Michelle 3 corresponds to Bryan 4. corresponds to Jared... Date Added: 2009-06-08 18:48:06 |
| p28-barilanOutsiderViewBlogs.pdf Path: University of Baltimore >> IDIA >> 620 Fall, 2009 Description: An Outsider\'s View on \"Topic-oriented\" Blogging Judit Bar-Ilan School of Library, Archive and Information Studies The Hebrew University of Jerusalem, Jerusalem, 91904, Israel and Department of Information Science, Bar-Ilan University Ramat Gan, 52900... Date Added: 2009-06-08 18:48:46 |
| 9Assimilation of mineral Nutrients.ppt Path: MN State >> PLANTPHY >> 347 Fall, 2009 Description: Assimilation and fixation of nitrogen Remember, Plants are: Capable of making all necessary organic compounds from inorganic compounds and elements in the environment (autotrophic) Required to compete with other organisms for these nutrients Requ... Date Added: 2009-06-08 18:53:26 |
| 1D Motion Lab.doc Path: Alabama >> CH >> 105 Spring, 2008 Description: One Dimensional Motion In this lab you will use a motion sensor (sonic ranger) and software to study motion in 1-D. The motion sensor sends out ultra-sonic pulses that are reflected from an object and detected by the sensor. The distance from the sen... Date Added: 2009-06-08 18:53:48 |
| hw1.pdf Path: Oakland University >> HW >> 60563 Fall, 2009 Description: EE 60563: Random Vectors, Detection and Estimation Fall 2007 Homework 1, due 10 September, in class From Stark and Woods: 1.6, 1.10, 1.13, 1.16, 1.21, 1.27(assume that all the packets are distinct and that all packets have the same probability of lan... Date Added: 2009-06-08 18:57:52 |
| ex1_89.ps Path: Oakland University >> EX >> 60563 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.78 Copyright 1998 Radical Eye Software (www.radicaleye.com) %Title: ex1.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o ex1.ps ex1 %DV... Date Added: 2009-06-08 18:57:58 |
| abstractclasses.pdf Path: UMBC >> PUB >> 331 Fall, 2009 Description: Abstract methods You can declare an object without defining it: Person p; Abstract Classes and Interfaces 30-Oct-03 Similarly, you can declare a method without defining it: public abstract void draw(int size); Notice that the body of the method is ... Date Added: 2009-06-08 19:07:00 |
| SampleResume2.doc Path: Cal Poly >> ME >> 134 Fall, 2008 Description: William Blazejowski, E.I.T. University Address 8882 Georgetown Circle, Apt H San Luis Obispo, CA 93401 (805) 555-5555 billyblaze@calpoly.edu Permanent Address 211 34rd Street Bakersfield, CA 95722 (916) 555-5555 Objective Education To perform Mech... Date Added: 2009-06-08 19:14:30 |
| Lecture9-CoordinationAgreement.pptx Path: Sveriges lantbruksuniversitet >> CMPT >> 431 Spring, 2009 Description: Lecture IX: Coordination And Agreement CMPT 431 Dr. Alexandra Fedorova CMPT 431 A. Fedorova 1 A Replicated Service client servers W networ k slave R maste R r W W slave client CMPT 431 A. Fedorova W write data W replicatio n R read 2 A ... Date Added: 2009-06-08 19:16:49 |
| hw10_key.pdf Path: Minnesota >> MATH >> 4601 Fall, 2008 Description: Spring 2005 Stat 4601 Homework 10 Solutions Name: 1. A stepwise or careful model selection in SAS gives the predictors used below. A careful analysis in R would yield similar results. > > > + > pbcjon<-read.csv(\"pbc_mod.csv\",header=T) attach(pbcjon) ... Date Added: 2009-06-08 19:18:18 |
| LOR_LM.pdf Path: Wisc Stevens Point >> KMCHU >> 768 Fall, 2009 Description: ... Date Added: 2009-06-08 19:21:04 |
| Hunt_modulepattern_section2_comp3.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: 241 : Sample 3 2 4 1 4 2 3 1 2 4 3 1 2 4 3 1 3 2 4 1 241_Graphic Design I : Term : Your Name 2 1 4 3 4 2 1 3 1 4 2 3 4 2 1 3 2 1 4 3 4 3 1 2 1 4 3 2 3 4 1 2 4 1 3 2 4 3 1 2 1 2 3 4 2 3 1 4 1 2 3 4 3 2 1 4 1 2 3 4 3 2 4 1 4 2 3 1 2 4 3 1 2 4 3 1 ... Date Added: 2009-06-08 19:21:17 |
| wachsmuth-et-al-lwm03.ps Path: Toledo >> CS >> 2520 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: camera.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Bold Symbol Times-Roman Times-Italic Helvetica %EndComments %DVIPSWebPage: (www... Date Added: 2009-06-08 19:22:08 |
| Group1_Lab3.pdf Path: UCLA >> EE >> 181 Fall, 2009 Description: ... Date Added: 2009-06-08 19:27:24 |
| 03-13-2006-week.txt Path: Fayetteville State University >> COP >> 5611 Fall, 2009 Description: James S. Gonzalez, Kelley C. Jones, Cory J. Fox COP5611 - Advanced Operating Systems Date: Week of March 13, 2006 Current Project Status: Cory is currently struggling with getting the system call that turns on logging to work. This week, Kelley wa... Date Added: 2009-06-08 19:28:29 |
| Thursday Jan 24.pdf Path: Washington >> OCEAN >> 450 Fall, 2008 Description: I will call for volunteers to explain this diagram. This is an opportunity for you to fulfill your obligation to explain a diagram for the quarter. Figure 1. Carbon and oxygen isotope records from Ocean Drilling Program Site 690 (data from Kennett ... Date Added: 2009-06-08 19:30:57 |
| Getting to MavDISK.pdf Path: MNSU >> ISYS >> 101 Fall, 2008 Description: Click here to go to https:/vpn.mnsu.edu/ In the upper right corner of the screen you will see a little set of icons (see the arrow) Choose the middle one (Show Toolbar) and this popup will appear Change the \"File Servers\" choice to \"MavDISK Staff F... Date Added: 2009-06-08 19:31:32 |
| 18746-s08-proj1.ps Path: Carnegie Mellon >> ECE >> 746 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: 18746-s08-proj1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Times-Bold Times-Roman Times-Italic Symbol Courier %EndComments %DVIPSWebPag... Date Added: 2009-06-08 19:32:14 |
| 20-dbs-sql.pdf Path: Iowa State >> STAT >> 480 Fall, 2008 Description: Databases & SQL Stat 480 Heike Hofmann Tuesday, March 31, 2009 1 Outline Relational Databases Select Query Language Linking R to a database Tuesday, March 31, 2009 2 Normal Forms The Key, the Whole Key, and Nothing but the Key Increasingly N... Date Added: 2009-06-08 19:35:02 |
| ETS OX.doc Path: Indiana State >> TCA >> 432 Fall, 2009 Description: ETS OX-PHOS LOCATION In all cells with mitochondria ETS ELECTRON CARRIERS/ACCEPTORS organic CoQ (UQ), NADH, FADH2 proteins iron sulfur proteins, cytochromes Cu, Fe oxygen ... Date Added: 2009-06-08 19:37:48 |
| 002527_1.pdf Path: Pittsburgh >> AEI >> 2387 Fall, 2009 Description: ... Date Added: 2009-06-08 19:42:52 |
| PDD601_exam01.doc Path: Cleveland State >> UST >> 601 Fall, 2009 Description: EXAM I PAD/PDD/UST 601, Applied Quantitative Reasoning I, Fall 2006 Dr. Sugie Lee CSU ID: Name: Question 1 (total 3 pts). Name and briefly explain three basic o... Date Added: 2009-06-08 19:50:53 |
| boxplot_article.pdf Path: Cleveland State >> UST >> 601 Fall, 2009 Description: PRACTICAL DATA HANDLING Visual Presentation of Data by Means of Box Plots aVrije D.L. Massart,a J. Smeyers-Verbeke,a X. Caprona and Karin Schlesierb Universiteit Brussel, Belgium bBundesinstitut fr Risikobewertung (Federal Institute for Risk Assess... Date Added: 2009-06-08 19:51:00 |
| spas_lab02_compte_rs_zscore.pdf Path: Cleveland State >> UST >> 601 Fall, 2009 Description: PDD/PAD/UST 601 Applied Quantitative Reasoning I College of Urban Affairs, Cleveland State University Instructor: Dr. Sugie Lee SPSS : Exercise 02 - Using Compute, Random Sample and Z-Score. Q1. You are going to use SPSS data OhioCounties2000.sav da... Date Added: 2009-06-08 19:51:02 |
| 0892.pdf Path: USF >> LIT >> 800 Fall, 2009 Description: There Is a Young Lady Whose Nose by Edward Lear There is a Young Lady whose nose Continually prospers and grows; When it grew out of sight, she exclaimed in a fright, \"Oh! Farewell to the end of my nose!\" Created for Lit2Go on the web at fcit.usf.e... Date Added: 2009-06-08 19:52:03 |
| pressrelease-0001.doc Path: Valdosta >> MLIS >> 7240 Fall, 2008 Description: Press release March 13 April 27th The E-Library along with the LAMP, which is a part of the Southern Collation against homelessness, will be collecting cell phones to distribute to those in need of a way to contact emergency services. Note: a flyer ... Date Added: 2009-06-08 19:57:00 |
| MO theory p.1.pdf Path: Sveriges lantbruksuniversitet >> C >> 333 Fall, 2009 Description: Covalent Bonding (Molecular Orbital Theory): Only one year after Schrdinger published his work on the wave equation, Heitler and London applied the approach to the H2 molecule. This approach provided the long sought after theoretical interpretation o... Date Added: 2009-06-08 19:59:15 |
| FriedmanThe Battle\'sHalfWon.doc Path: Western Kentucky University >> ECON >> 420 Fall, 2008 Description: \'); clickSet = 1; } /-> COMMENTARY The Battle\'s Half Won By MILTON FRIEDMAN December 9, 2004; Page A16 advertisement <a><img></a><br> An Online Journal Giveaway: In the almost six decades since the end of World War II, intellectual opinion in the U... Date Added: 2009-06-08 20:14:19 |
| BaseAudit_durh044w-zip.txt Path: UNC >> GEOG >> 594 Fall, 2008 Description: /DATA PREPARATION/ Audit file name: N:\\loys\\lab5\\Base\\COOP_CORS, Durham, NC\\BaseAudit_durh044w-zip.txt Software version: MCORR400 v4.83 W32 Processing date: March 26, 2008 Data start, GPS week: 1466 GPS day: Wednesday GPS time: 22:00:... Date Added: 2009-06-08 20:14:28 |
| lecture14.pdf Path: Montana >> PHYS >> 311 Fall, 2008 Description: Lecture 14 Introduction to the Sun Homework 10 Due Dec 9 Tuesday Chap 16: Q6, Q13, Chap 12, Q51 A1: Explain how the nebular hypothesis can account for the following properties of the solar system: (a) the terrestrial planets orbiting close to the S... Date Added: 2009-06-08 20:16:28 |
| prelab7.pdf Path: N.C. State >> MEA >> 444 Spring, 2008 Description: Pre-lab 7: Complete analysis by start of class on Thursday, 23 March -Contour T (5F), Td (5F), MSLP (4 mb); draw symbols for synoptic boundaries 1800 UTC sfc chart ... Date Added: 2009-06-08 20:16:38 |
| abalone.txt Path: UMBC >> CMSC >> 691 Summer, 1998 Description: = Predicting the age of abalone from physical measurements The age of abalone is determined by cutting the shell through the cone, staining it, and counting the number of rings through a microscope - a boring and time-consuming task. Other measure... Date Added: 2009-06-08 20:20:04 |
| 233_how_to_google_docs.pdf Path: CSU Sacramento >> DOCS >> 233 Fall, 2009 Description: Collaborate: Google Docs search q College of Education Department of Teacher Education COE Forum resources schedule syllabus home Google Docs and Spreadsheets How to Collaboratively Create and Share Online; Documents, Spreadsheets, and Presentati... Date Added: 2009-06-08 20:25:11 |
| GVPT170A80086508.doc Path: MD University College >> ASIA >> 2088 Fall, 2009 Description: Syllabus for GVPT170 - A820 - American Government Instructor: Mr. Alex Blonna - Adjunct Associate Prof. - Gvpt/Engl Course Description A comprehensive study of government in the United States, including the basic principles of American government and... Date Added: 2009-06-08 20:30:16 |
| Kruse_Chapter_8.pdf Path: CSU Chico >> CSCI >> 151 Fall, 2009 Description: Chapter 8 SORTING 1. Introduction and Notation 2. Insertion Sort 3. Selection Sort 4. Shell Sort 5. Lower Bounds 6. Divide-and-Conquer Sorting 7. Mergesort for Linked Lists 8. Quicksort for Contiguous Lists 9. Heaps and Heapsort 10. Review: Compariso... Date Added: 2009-06-08 20:30:50 |
| class_Feb25.txt Path: Auburn >> STAT >> 2610 Fall, 2008 Description: Last Name First Name User ID Section ProjTeam# Exm1-2/07 Exm2-2/28 Exm3-4/18 Final Exam Homework&Quizzes Project-4/28 Course % quiz1 quiz2 quiz3 quiz4 quiz5 quiz6 quiz7 quiz8 quiz9 quiz10 quiz11 quiz12 quiz13 quiz14 Hw1-1/17 Hw2-1/19 Hw3-1/24 Hw4-1/2... Date Added: 2009-06-08 20:33:09 |
| wagelos.xls Path: Auburn >> STAT >> 2610 Fall, 2008 Description: SUMMARY OUTPUT: Regression using PredInt.xls Regression Statistics Multiple R 0.35 R Square 0.12 Adjusted R Square 0.11 Standard Error 82.23 = Standard Deviation of Residuals Observations 59 ANOVA Regression Residual Total df SS 1 55034.36 57 385453... Date Added: 2009-06-08 20:33:16 |
| Chap-09.ppt Path: Auburn >> STAT >> 2610 Fall, 2008 Description: Chapter 9 Statistical Inferences Based on Two Samples McGrawHill/Irwin Copyright 2007 by The McGrawHill Companies, Inc. All rights reserved. Statistical Inferences Based on Two Samples 9.1 9.2 Comparing Two Population Means by Using In Compar... Date Added: 2009-06-08 20:33:17 |
| sav_ch04.pdf Path: University of Louisiana at Lafayette >> CACS >> 150 Fall, 2009 Description: Copyright 2002 Pearson Education, Inc. Slide 1 Chapter 4 Parameters and Overloading Created by Frederick H. Colclough, Colorado Technical University Copyright 2002 Pearson Education, Inc. Slide 2 Learning Objectives Parameters Call-by-value Ca... Date Added: 2009-06-08 20:45:54 |
| RPC Example.ppt Path: CSU San Marcos >> CS >> 539 Fall, 2009 Description: Lab RPC Distributed Program Generation (RPCGEN Example) CS539 Client/Server Computing 1 Ilustrated Rpcgen Example Dictionary Operations Simple database implementation Four basic operations Initialize initialize the database Insert ins... Date Added: 2009-06-08 20:46:08 |
| lec14_oct_16.pdf Path: University of Illinois, Urbana Champaign >> CS >> 476 Fall, 2008 Description: Program Verication: Lecture 14 Jos Meseguer e Computer Science Department University of Illinois at Urbana-Champaign 1 Verication of Functional Modules We are now ready to consider a general methodology for verifying declarative programs. We will... Date Added: 2009-06-08 20:50:30 |
| Renormalization06.pdf Path: SMU - Cox School of Business >> PHYSICS >> 7314 Fall, 2009 Description: ... Date Added: 2009-06-08 20:52:02 |
| damagePercentile-10.pdf Path: Harvard >> CS >> 263 Fall, 2009 Description: Proportion of replicas damaged 0.8 0.7 0.5 0.3 0.2 0.1 0 0.1 initial damage irrecoverable damage 0.15 0.2 0.25 0.3 0.35 Proportion of peers initially subverted 0.4 8.7 6.2 0.4 7.2 0.6 6.1 2.9 3.7 ... Date Added: 2009-06-08 20:53:02 |
| dtx00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090201 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09020112_upa.wxp Date: 1200Z 1 FEB 09 Searching for KDTX. Searching the city database file for: KDTX . Date:1200Z 1 FEB 09 Station: KDTX... Date Added: 2009-06-08 20:58:11 |
| ms122NW19921104d.pdf Path: Southern Utah >> MS >> 122 Fall, 2009 Description: MANY THINGS HURT OWENS\' SENATE BID, POLLSTER SAYS Bob Bernick Jr. Political Editor\\ Staff writers Jay Evensen and Marianne Funk contributed to this report. The Deseret News. Salt Lake City, Utah: Nov 4, 1992. pg. A.1 Copyright The Deseret News Nov. 4... Date Added: 2009-06-08 20:58:42 |
| 1115-cohen-longlivecp.pdf Path: Allan Hancock College >> USA >> 1919 Fall, 2009 Description: Cohen: Long Live the Communist Party! [Nov. 15, 1919] 1 Long Live the Communist Party! 2,500 Seized in Raids [events of Nov. 7 to 11, 1919] by Maximilian Cohen Unsigned article in The Communist World [New York: CPA], v. 1, no. 3 (Nov. 15, 1919), pp... Date Added: 2009-06-08 20:58:44 |
| index38.txt Path: Berkeley >> ASTRO >> 00180977 Fall, 2009 Description: chi^2/nu= 3176.0845 / 1387 The fit is rejectable at 100.00000 % Confidence 1.9499969 9.7699890 7.0701802 -0.070255301 1602.9816 9.7699890 13.679993 9.6351583 -1.1121997 67... Date Added: 2009-06-08 21:04:44 |
| index50.txt Path: Berkeley >> ASTRO >> 00180977 Fall, 2009 Description: chi^2/nu= 3390.8456 / 1386 The fit is rejectable at 100.00000 % Confidence 1.9499969 9.7699890 6.7406417 0.12552540 167.94335 9.7699890 13.679993 9.9888580 -1.1939638 61... Date Added: 2009-06-08 21:04:46 |
| YPL081W.t2k.alpha-logo.pdf Path: UCSC >> YPL >> 081 Fall, 2009 Description: YPL081W.t2k ALPHA 5 4 3 2 1 E E S E H B I C B B C EEEECB BB C E D BBBBE E XXXCXXXXXXAAXXXXXXXXHHH X XX XXX E B H E S A B S E E C C E D A A E T E A H A H C I HHHHHH I X I XXIIXHXXX X X X H H H S S C BC C E XXXXXXEXXXX X E H C H A B E G S... Date Added: 2009-06-08 21:06:05 |
| The GSMP Framework.pdf Path: Berkeley >> IEOR >> 261 Fall, 2008 Description: The GSMP Framework A generalized semi-Markov process (GSMP) model is the common framework for which IPA results are derived. We construct GSMPs following the developments of Fu and Hu (1997), and Glasserman (1991). Define the following: S countable s... Date Added: 2009-06-08 21:06:07 |
| YGL102C.t2k.w0.5-logo.pdf Path: UCSC >> YGL >> 102 Fall, 2009 Description: YGL102C.t2k w0.5 2 1 M L Y E V I I K I V V Q S W F 1 10 20 30 40 H 2 1 H T H E E W F Y L V N N I A W F XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX Y I I K V V K FLR L S S S LL Y RLQVVV I I I I V L F V V L S F LVL I I I V... Date Added: 2009-06-08 21:08:20 |
| UNESCO Loucks ch-7 Prob - Stat.pdf Path: UCF >> CWR >> 6102 Fall, 2008 Description: VII Concepts in Probability, Statistics and Stochastic Modeling 1 2 INTRODUCTION . 1 PROBABILITY CONCEPTS AND METHODS .. 3 2.1 Random variables and distributions . 3 2.2 Expectation operator.. 6 2.3 Quantiles, moments, and their estimators. 7 2.4 L... Date Added: 2009-06-08 21:10:06 |
| LING_414_Plan_of_Study.doc Path: N.E. Illinois >> LING >> 414 Fall, 2009 Description: Thomas Hobbs LING 414 Mondays Fall 2002 September 11, 2002 Plan of Study It is my hope that from this class I will learn to incorporate a variety of tried methods into my own style (though I do not presently teach). It is interesting to me to consi... Date Added: 2009-06-08 21:11:07 |
| Chapter 6.ppt Path: Gordon MA >> CPS >> 212 Fall, 2009 Description: The List Container and Iterators Shifting blocks of elements. Model of a list object. Sample list The list ADT CLASS list Constructors CLASS list Operations (7 slides) CLASS list:iterator Operations Inserting an element into a list Removing an eleme... Date Added: 2009-06-08 21:11:25 |
| herd018.txt Path: Iowa State >> ANS >> 352 Fall, 2009 Description: Herd: 18 CALF CROP SUMMARY Herd: 18 Calf Crop: 10 Calf Crop: 10 HERD 18 NO MATINGS - HERD KEPT - NO MATINGS ... Date Added: 2009-06-08 21:11:32 |
| Chapter9cor1-3.ppt Path: UVA >> CLASS >> 209 Fall, 2009 Description: Introduction to Materials Science, Chapter 9, Phase Diagrams Chapter Outline: Phase Diagrams Microstructure + Phase Transformations in Multicomponent Systems Definitions and basic concepts Phases and microstructure Binary isomorphous systems (com... Date Added: 2009-06-08 21:18:46 |
| YDR169C-A.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YDR >> 169 Fall, 2009 Description: YDR169C-A.t2k EBGHTL 3 2 1 C TCCHH HHCC H X X T X X X HHHXHH XXXH H X X X X X X X C H C H H X X H T C C H T C C C T C T T T C C C E C C T C H H H H E C H E H E E T G G T X X X X X X X X X X X X X X X X X X X X X X X X X X X X X E X EHHHH E... Date Added: 2009-06-08 21:22:21 |
| qpIII.pdf Path: North Texas >> CSE >> 5360 Fall, 2009 Description: Query Processing 1/14/2005 Yan Huang - CSCI5330 Database Implementation Query Processing Hybrid Merge-join If one relation is sorted, and the other has a secondary B+-tree index on the join attribute Merge the sorted relation with the leaf entrie... Date Added: 2009-06-08 21:23:00 |
| The Invisible Heart.ppt Path: UNC Wilmington >> PLS >> 316 Fall, 2009 Description: The Invisible Heart: Economics and Family Values Nancy Folbre The Economics of Care: The Milk of Human Kindness Milk as a metaphor for Kindness Motherhood represents both Social Change 1969: keep female achievements secret 1977: 2/3rds agree It... Date Added: 2009-06-08 21:24:16 |
| L10.ppt Path: LSU >> EE >> 7730 Fall, 2008 Description: EE 7730 Morphological Image Processing Example Two semiconductor wafer images are given. You are supposed to determine the defects based on these images. Bahadir K. Gunturk 2 Example Bahadir K. Gunturk 3 Example Absolute value of the differ... Date Added: 2009-06-08 21:25:59 |
| YNL224C.t2k.w0.5-logo.pdf Path: UCSC >> YNL >> 224 Fall, 2009 Description: YNL224C.t2k w0.5 5 4 3 2 1 L X X X A K XXXXXXXXXX F Q R K R H K P P S G S X A X XXXX P K R N D G K XXXXXXXXXXXXXX R S K N KG R P A S R G R R K G A E E A X XXXXXXXX P L P T S S E K P K XXXX D N S E S XXXX S H K I ... Date Added: 2009-06-08 21:27:45 |
| YNL223W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YNL >> 223 Fall, 2009 Description: YNL223W.t2k DSSP-EHL2 2 1 C H H H X 1 10 20 30 40 H 2 1 E H E S E EEEEEC CC C C E X X X X X X X 51 60 70 80 90 H 2 1 H H E H H T H HHHHHH X X X H H E C E E C C C C X C X X X E 2 1 CCC E E E X X X X T E T S T H T ... Date Added: 2009-06-08 21:28:26 |
| 21-Women and Cities reading.pdf Path: Penn State >> GEOG >> 120 Spring, 2008 Description: ... Date Added: 2009-06-08 21:30:20 |
| 27-Internal Structure of TW Cities & Migration.pdf Path: Penn State >> GEOG >> 120 Spring, 2008 Description: Internal Structure of TW CitiesLatin America Downtown and Inner City Commercial spine and elite residential sector Industry Perifrico Other residential zones Zone of maturity Zone of in situ accretion Middle class residential tracts Zone of periphera... Date Added: 2009-06-08 21:30:21 |
| JRN 2220 Assignment 1 Target Audience.doc Path: Troy >> JRN >> 2220 Fall, 2009 Description: JRN 2220 ASSIGNMENT 1: TARGET AUDIENCE EXERCISE The product category is athletic shoes. Athletic shoes have various brands (Reebok, Nike, Adidas, New Balance, etc) Your assignment is to locate a college student (not someone from this class) who has a... Date Added: 2009-06-08 21:30:41 |
| brainard2000.pdf Path: Yale >> NSCI >> 590 Fall, 2009 Description: letters to nature . Interruption of a basal ganglia forebrain circuit prevents plasticity of learned vocalizations Michael S. Brainard & Allison J. Doupe Keck Center for Integrative Neuroscience, Departments of Physiology and Psychiatry, University ... Date Added: 2009-06-08 21:31:16 |
| EMBPapstInterfaces.pdf Path: Nevada >> MECH >> 322 Fall, 2009 Description: Katalog englisch repro 08.09.2003 9:30 Uhr Seite 73 Interfaces for blowers with EC internal-rotor motor BG3612/3633 24 VDC control Gasmodul compatible 1 +12.38 VDC Restwelligkeit 3,5% +12 VDC 15K speed feedback 1K speedsignal 2 Pulse 2 pro ... Date Added: 2009-06-08 21:38:20 |
| AGENDA0708.doc Path: UNC >> READ >> 1396271 Fall, 2009 Description: AGENDA: SEANC DISTRICT 25 ANNUAL MEETING Tuesday, July 8, 2003 5:30 PM UNC Law School Marion Caldwell Board Room Camilla Crampton, Chair Social Time 5:45pm Call to Order & Welcome: Recognition of District Officers and Guests Minutes: Treasurers Repor... Date Added: 2009-06-08 21:49:05 |
| YNL191W.t2k.str2-logo.pdf Path: UCSC >> YNL >> 191 Fall, 2009 Description: YNL191W.t2k STR2 4 3 2 1 S Y C CCYZ X X P PMCY C C Z Z P Z ZEQMPMTCS H Y C Z Y A S S Q C H H Q Q H M Q A AAAAA Z Z YY Z 10 20 30 40 A 4 3 2 1 H T H T S A AAA X A Y C MZYC TTSC YMZZCGGCSSSSS CQZCYCCC QMCYZ Q S P CCTTCCC M C Z Y T S P ... Date Added: 2009-06-08 21:51:52 |
| Computation.ppt Path: Creighton >> CHM >> 576 Fall, 2009 Description: Molecular Mechanics and Molecular Dynamics Protein Simulations Protein Folding Christian Anfinsen Thermodynamic Hypothesis native structure of a protein is the thermodynamically most stable form in its native environment kinetically accessible?... Date Added: 2009-06-08 21:54:31 |
| Ixodes scapularis.doc Path: University of Illinois, Urbana Champaign >> IB >> 109 Fall, 2008 Description: Ixodes scapularis Black-Legged or Deer Tick The deer tick is found in the eastern United States from Florida to New England, westward to Iowa and Texas. Deer ticks feed mainly on deer and rodents, but will feed on humans if populations are large eno... Date Added: 2009-06-08 21:56:10 |
| Possible+Intern+Opps.doc Path: UNC >> READ >> 4280055 Fall, 2009 Description: Potential Summer 2008 Internship Opportunities with Enterprise Development Analyst Intern Syndication Possible Locations: Columbia, MD; New York, NY; Portland, OR Intern will assist in underwriting affordable housing projects across the country. En... Date Added: 2009-06-08 21:56:40 |
| midtsol.pdf Path: Clemson >> ECE >> 874 Fall, 2009 Description: ... Date Added: 2009-06-08 21:58:38 |
| Attachment security in couple relationships.rtf Path: CSU Northridge >> HHD >> 542 Fall, 2009 Description: Attachment security in couple relationships: a systemic model and its implications for family dynamics. Family Process, Fall, 2002, by Mario Mikulincer, Victor Florian, Philip A. Cowan, Carolyn Pape Cowan Fam Proc 41:405434, 2002 Theory and resea... Date Added: 2009-06-08 22:01:15 |
| 69A.5S2.pdf Path: Arkansas Little Rock >> CASE >> 069 Fall, 2009 Description: ... Date Added: 2009-06-08 22:07:27 |
| Assignment 3.docx Path: Texas State >> CS >> 1319 Fall, 2008 Description: Max Thaxton 551404 Alice Assignment 3 Monday/Wednesday 2:00-3:15 Assignment 3 Problem 1\'s Code Created by: Max world Events When the world starts Do: world.my first method Methods world.my first method ( ) MPH = 1 , stomachSize = 1 , MPB = 1 / Get ... Date Added: 2009-06-08 22:24:22 |
| 2025MGT Lecture 8 0802 Path: Griffith >> MANAGEMENT >> 2025MGT Fall, 2008 Description: Chapter 12 Basic approaches to leadership Learning Objectives Lecture Objectives: 2. Contrast leadership and management. 3. Summarise the conclusions of trait theories. 4. Describe Fiedlers contingency model. 5. Explain Hersey and Blanchards situati... Date Added: 2009-06-09 22:44:27 |
| cwa9l_PPT_0802 Path: Pasco-Hernando Community College >> MAC >> 1147 Spring, 2009 Description: ... Date Added: 2009-06-10 17:03:50 |
| final_solutions.pdf Path: Texas State >> MC >> 1235 Fall, 2009 Description: Name: Final Exam Written Component Write your name at the top of this sheet. Answer the following questions on this sheet. When youre done with this written portion of the exam, turn it in and get the coded part of the exam. Youll probably want to ... Date Added: 2009-06-11 14:27:29 |
| YDL201W.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YDL >> 201 Fall, 2009 Description: YDL201W.t2k CB_BURIAL_14_7 3 2 1 AAAAA B X X BBBB ACBBAABC BCC BCB CCCCC D C A X AA AA X B B D D D D D D D D D X X X X X X X X X C C AB AB A AD C B AA AAA A B B BB ADBCBBBB B BB A B B C C C CDX D D D D D D D D D D D D D D D D D D D XCCXXXDCC... Date Added: 2009-06-11 14:49:43 |
| 7_casestudy_reading1.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: Case Study The Wall Street Journal N e w s I n fo g ra p h i c s ( A tt e n t i o n t o D e t a i l ) p . 16 8 Two Sides of the Same Brain \"You have to do your own research,\" she says. \"It\'s when I pore over the data that I start to picture the pres... Date Added: 2009-06-11 14:50:51 |
| Chapter 6.ppt Path: Gordon MA >> CS >> 212 Fall, 2009 Description: The List Container and Iterators Shifting blocks of elements. Model of a list object. Sample list The list ADT CLASS list Constructors CLASS list Operations (7 slides) CLASS list:iterator Operations Inserting an element into a list Removing an eleme... Date Added: 2009-06-11 15:20:41 |
| lecture7.ppt Path: Duke >> X >> 296 Fall, 2009 Description: CompSci 296.2 Self-Managing Systems Shivnath Babu Reminder Slides and 2-page writeup due by next Tuesday Feb 21: 3-minute talk 2 Correlating Instrumentation Data to System States Collect performance data, with SLA violations Build models: Tree... Date Added: 2009-06-11 15:38:04 |
| Tableau A.10.rtf Path: Université du Québec à Montréal >> STAT >> 3080 Fall, 2009 Description: Tableau A.10 Rgion Afrique PaysDev PaysDev AmLatine Asie Asie AmLatine AmLatine Afrique AmLatine PaysDev Afrique Afrique PaysDev Afrique Afrique AmLatine Asie AmLatine AmLatine Afrique PaysDev Asie PaysDev AmLatine Afrique AmLatine Afrique Oceanie Pa... Date Added: 2009-06-11 15:51:37 |
| YOL149W.t2k.alpha-logo.pdf Path: UCSC >> YOL >> 149 Fall, 2009 Description: YOL149W.t2k ALPHA 3 2 1 H S D B S C XXX H X HHXXHHHXXII X XI XXXI I HH HHH I I X X X X X X X X 1 10 20 30 40 S B S H 3 2 1 H HH I I XXXX H S H B E H S B H E S E A B A H X XXXXXXXAB X E E B GE AEFB EA CA A S S D B I T E H T B ... Date Added: 2009-06-11 15:58:21 |
| OCD_FCP_F08a_T09_V3.0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: OperationalConceptDescription Version3.0 OPERATIONALCONCEPTDESCRIPTION(OCD) INFORMATIONORGANIZATIONSYSTEM TEAM9 DonHainesworth JagpalSinghGill RomaliRobertDsouza HarsimranSingh NiharikaThotapalli RamanpreetSinghDhunna VincentKl... Date Added: 2009-06-11 15:59:12 |
| YBR010W.t2k.w0.5-logo.pdf Path: UCSC >> YBR >> 010 Fall, 2009 Description: YBR010W.t2k w0.5 3 2 1 M L V I XX A 1 10 20 30 40 H 3 2 1 H T T H Y I EVR YQ KE L T RLV LK L XXXXXXXXXXXXXXXXXXXXXXXXXXXXXX K D Q I A T Q R F I K E T F LP N A V S I E I P V V D R LASQ K G L S K L PF S R L D QKI S L V N Q A F L... Date Added: 2009-06-11 16:12:53 |
| midterm1_micro1_summer08_AKEY.pdf Path: SHSU >> FXG >> 001 Fall, 2009 Description: Sam Houston State University PRINCIPLES OF MICROECONOMICS EXAM I ANSWER KEY Fidel Gonzalez Answer all the questions using a scantron. All questions are worth one point. Questions 1 to 48 are required. Questions 49 and 50 are bonus. Good luck! MULTI... Date Added: 2009-06-11 16:26:39 |
| PHY615_L9.pdf Path: Syracuse >> PHY >> 615 Fall, 2008 Description: A bit more about the forces and AFM Lecture #9 September 27th Outline: Forces in molecular biology. A bit more about AFM How does an optical tweezer work? Why is this so popular? Basic principles and the main idea What are its applications? Sometime... Date Added: 2009-06-11 16:27:21 |
| morafka.pdf Path: Syracuse >> YEARBOOK >> 1989 Fall, 2009 Description: An Interdisciplinary Definition of North America\'s Chihuahuan Desert: Is It Desirable and Obtainable? David J. Morafka Department of Biology California State University Dominguez Hills Carson, California 90747 ABSTRACT Contemporary maps of the Chihua... Date Added: 2009-06-11 16:27:32 |
| syllabus.pdf Path: Oregon >> MATH >> 243 Fall, 2008 Description: Math 243: Introduction to Probability and Statistics Instructor: CRN: Location: Time: Office: Office Hours: Phone: Web: Email: Textbook: Prerequisites: Chris Phan 44021 205 Deady MondayFriday, 12:0012:50 p.m. 4 Deady 10:0011:00 a.m. (541)346-0985 htt... Date Added: 2009-06-11 17:08:38 |
| swb_fit0.txt Path: Berkeley >> ASTRO >> 00106415 Fall, 2009 Description: Spectra Extracted from tstart=-7.125 tstop=38.125 (Trigger Time, GPS=792852014.000000, Redshift, z=0.0) Power-Law Model Fit Norm@15keV 4.6279e-02 (4.2314e-02 5.0429e-02) alpha -1.2865 (-1.3474 -1.2253) Energy Fluence (15-350 keV) 8.9544e-06 (8.6291... Date Added: 2009-06-11 17:14:37 |
| ee392m_HW6.pdf Path: Stanford >> EE >> 392 Fall, 2009 Description: HW #6 1-Repeat the problem 3 of HW#3 with a fractionally spaced equalizer wit 3 forward and one feedback tap using LMS and RLS. Compare the results. Impulse response 0.3887,1,0.3887 0.3887,1,0.3887 Case # Eigenvalue Spread #taps 3,1 3,1 Step size ... Date Added: 2009-06-11 17:34:42 |
| CHAP15.ppt Path: UNF >> COP >> 4610 Fall, 2008 Description: Security Chapter 15 Computer and Network Security Requirements Confidentiality Requires information in a computer system only be accessible for reading by authorized parties Integrity Assets can be modified by authorized parties only Availabi... Date Added: 2009-06-11 17:47:53 |
| SNA-SDLC-MIB.txt Path: UMKC >> CS >> 590 Fall, 2009 Description: Network Working Group J. Hilgeman, Chair Request for Comments: 1747 Apertus Technologies, Inc. Category: Standards Track S. Nix ... Date Added: 2009-06-11 17:47:58 |
| slide2.ppt Path: Southern Oregon >> CS >> 200 Fall, 2008 Description: Definition:Avariableisaplaceinmemorythatcanholdavalue DeclaringVariables Youmustfirstdeclareavariablebeforeyoucanuseit! Declaringinvolves: Establishingthevariablesspotinmemory Specifyingwhatkindofdataitwillcontain(itstype) Giveitaname(itsiden... Date Added: 2009-06-11 18:01:22 |
| YLR136C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YLR >> 136 Fall, 2009 Description: YLR136C.t2k DSSP-EHL2 1 CC 1 C C E E E X X X X X X 10 20 30 40 T S 1 C C H T T S C C C C C C C C C C C C C C C C C C C C C X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X CCC CCC C CCC... Date Added: 2009-06-11 18:21:47 |
| YDR280W.t2k.alpha-logo.pdf Path: UCSC >> YDR >> 280 Fall, 2009 Description: YDR280W.t2k ALPHA 3 2 1 E E XXXXX H E B H H X X X H H H H B I I XXX H 1 10 20 30 40 E 3 2 1 H E H B S B E B S B I H A B E B D H B D E A DD EEAEEAEAB FF CGS B X C HE HHE G C G T B EFEAD T B G S EE B E H B CH S I ABBCH D E H H ... Date Added: 2009-06-11 18:25:15 |
| 302Chapter 13 notes Path: St. Leo >> ACC >> 302 Spring, 2009 Description: CHAPTER 13 I Investments in Noncurrent Operating Assets-Utilization and Retirement I LEARNING OBJECTIVES 1. Use straight-line, accelerated, use-factor, and group depreciation methods to compute annual depreciation expense. C Four factors are consider... Date Added: 2009-06-11 18:43:28 |
| ACC-302-Ch-20-Solutions-practice Path: St. Leo >> ACC >> 302 Spring, 2009 Description: EXERCISES 2023. Year Double-Declining-Balance 2001 $50,000 0.20 = $10,000 2002 40,000 0.20 = 8,000 2003 32,000 0.20 = 6,400 2004 25,600 0.20 = 5,120 $29,520 Book value, January 1, 2005: $50,000 $29,520 = $20,480 1. 2005 Depreciation Expense [($2... Date Added: 2009-06-11 18:43:46 |
| exam3b.pdf Path: Virginia Tech >> STA >> 2023 Fall, 2009 Description: QB Q Q 3 9 X BQI dbA9Dmt@AAWdDQ rG 8 5G sQ r ST STGTr 9 3 QBQ 8 r 9 X y y 9 9T S Q S 9 8c 9 3 Q IG 8 f 96 e 3 3 Sr S 5 B f uHdgWUcqbUrqbl@VD@xlAU6gieAmVirPWUcA@gAPH(Ad@dGAU9Vbira@A9 v 3 e 3 f9r S 8T 3rQ 9 r ST STGTr QTG 8 9 8 r Qr 9 8T Q IGr... Date Added: 2009-06-11 18:53:29 |
| ppt_ch3 Path: University of Hawaii, Manoa >> SOC >> 100 Summer, 2009 Description: CHAPTER 3: CULTURE CULTURE AND SOCIETY Culture-the learned and shared behaviors, beliefs, attitudes, values, and material objects that characterize a particular group or society 1 Society Society-a group of people that has lived and worked toget... Date Added: 2009-06-11 18:58:21 |
| 161-161SGF05FinalExamKey.pdf Path: Rutgers >> CHEM >> 161 Fall, 2009 Description: Q 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 v1(White) v2(Pink) v3(Yellow) v4(Blue) D B B A C D B A E C E E C E B B A B A D B D D C B C A C D E B C C D D E E B D B E B D B D A D E E... Date Added: 2009-06-11 19:00:51 |
| csce522-lect16.ppt Path: Los Angeles Southwest College >> CSCE >> 522 Fall, 2009 Description: CSCE 522 Lecture 16 Electronic Mail Security Electronic Mail Most heavily used network-based application Used across different architectures and platforms Send e-mail to others connected directly or indirectly to the Internet regardless of hos... Date Added: 2009-06-11 19:01:30 |
| M-15-1.pdf Path: N.C. State >> ST >> 516 Fall, 2008 Description: Nonnormal Responses We have usually assumed that experimental data are at least approximately normally distributed, with at least approximately constant variance. When either assumption is violated, we can try transforming the response to remo... Date Added: 2009-06-11 19:03:46 |
| soundslide.txt Path: UT Arlington >> NEW >> 030707 Spring, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>08c35ef33c2bbb42c1c19014ac00c3c888017b98.txt</Key><RequestId>C6EE7DE9965EA259</RequestId><HostId>NyU5fHlVTHc5ACeRPfiwc1Gn8Cf8... Date Added: 2009-06-11 19:04:37 |
| CEM251_Q6_SS05.pdf Path: Michigan State University >> CEM >> 251 Fall, 2008 Description: Spring 2005 CEM 251, Quiz 6 (White) Section NO. Name: 1. (4 Points total, 2 points each) Give the systematic (IUPAC) name for each of the following molecules. OH a) O b) 2. (4 Points total, 2 points each) Give the correct structure for the follo... Date Added: 2009-06-11 19:16:56 |
| lab1rev.pdf Path: Lake City CC >> ENG >> 2453 Fall, 2009 Description: Eng 3553 Networking Lab #1 Overview In a shared Ethernet network, end systems are typically connected together using a hub. The hub retransmits any incoming frames on all outgoing lines creating a single broadcast domain for all the devices. Within ... Date Added: 2009-06-11 19:18:03 |
| 11%20Exam%201%202002.pdf Path: Alaska Pacific >> BIOL >> 011 Fall, 2009 Description: BIOL 11 EXAM 1 Fall 2002 Name _ Multiple choice: select the single most correct answer to each question and mark the letter corresponding to that answer on the SCANMARK card provided. (2 points each) 1. The normal pathway that a new protein will fo... Date Added: 2009-06-11 19:18:38 |
| Stor155-09-04-02.ppt Path: UNC >> UNCSTOR >> 155 Fall, 2009 Description: Last Time Margin of Error, key to: Confidence Intervals Add reflection of variation to estimates For Normal Means For proportions (Binomial) Choice of sample size For Normal Mean For proportions (Binomial) Administrative Matters Midterm II,... Date Added: 2009-06-11 19:19:27 |
| s3.pdf Path: Maple Springs >> PHYS >> 3050 Fall, 2009 Description: PHYSICS 3050 Total - 35 marks Solutions to Problem Set 3 was due February 17, 2008 The wireless music box has no imaginable commercial value. Who would pay for a message sent to nobody in particular? David Sarnos associates in response to his urgin... Date Added: 2009-06-11 19:23:14 |
| Physics 228_09 HW II.pdf Path: Washington >> PHYS >> 2278 Fall, 2009 Description: Physics 228 - Winter 2009 HW II Due Thursday 1/15/09 All problems are in the class text by Boas, except as noted. Example problems: Not to be turned in solutions can be found in the back of the text, or in Appendix B. 8.5: 8.6: 8.13: 7.5: 7.7: 7.8: ... Date Added: 2009-06-11 19:23:30 |
| assignments2009-13.pdf Path: UMass (Amherst) >> BE >> 640 Fall, 2009 Description: Assignment 13 Review of Logistic Regression (see esb08p15.sas for example problem) Problems (Note: Any SAS output should include program documentation.) As part of a neighborhood study in Boston, a random sample of subjects in each of three areas (l... Date Added: 2009-06-11 19:25:07 |
| Thu_Apr_24.txt Path: Auburn >> RH >> 370 Fall, 2009 Description: ziegljs smb6891 131.204.14.146 Thu Apr 24 23:45 still logged in citrojc smb3330 131.204.14.117 Thu Apr 24 23:39 - 23:41 (00:02) caytosn smb3322 131.204.14.115 Thu Apr 24 23:39 - 23:49 (00:10) burkern smb1953 131.... Date Added: 2009-06-11 19:26:00 |
| log.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: 000 (56763.000.000) 02/10 19:21:24 Job submitted from host: <128.95.94.28:1098> . 001 (56763.000.000) 02/10 23:29:11 Job executing on host: <172.25.101.87:2338> . 006 (56763.000.000) 02/10 23:49:19 Image size of job updated: 449796 . 005 (56763.000.0... Date Added: 2009-06-11 19:27:25 |
| prob key.pdf Path: UCSC >> BIO >> 105 Fall, 2009 Description: 1. An origin of replication so the plasmid can be maintained (i.e. replicated) in the appropriate host cell. A selectable marker (i.e. Ampicillin resistance) so that plasmid-containing cells can be distinguished from non-plasmid containing cells. A s... Date Added: 2009-06-11 19:30:34 |
| phillips_hall_lighting_worksheet.xls Path: Wisc Eau Claire >> UNIT >> 268 Fall, 2009 Description: Phillips Hall Before bulbs watts per bulb total watts ballast adjusted total watts hours per day total watt hours total kilowatt hours price per kwh cost per day cost per year (365 days) 8,047 32 257,504 0.88 226,604 8 1,812,828 1,812.8 $0.07 $126.90... Date Added: 2009-06-11 19:31:33 |
| spec_wt_bat_pha.txt Path: Berkeley >> ASTRO >> 00285653 Fall, 2009 Description: ; Instrument bat ; Exposure 35.067000 ; xunit keV ; bintype counts 0.00000 10.0000 0.0043832801 0.0087248518 10.0000 12.0000 0.0085679491 0.013538012 12.0000 14.0000 0.0073193869 0.013571... Date Added: 2009-06-11 19:32:32 |
| Book25_02.txt Path: N.C. State >> ST >> 610 Fall, 2008 Description: /* This code is shown in Chapter 25 on page 369. */ /* The SAS data set YEAR_SALES was created earlier */ /* in Chapter 25 on page 369. */ /* Run the following DATA Step to... Date Added: 2009-06-11 19:37:02 |
| 333f06e2.pdf Path: CSU Northridge >> HCCHM >> 007 Fall, 2009 Description: Chemistry 333 Examination #2 November 6, 2006 Professor Charonnat Name: _ Be certain that your examination has five (5) pages including this one. Put your name on each page of this examination booklet. By putting your name on this examination boo... Date Added: 2009-06-11 19:38:48 |
| p210_13e.ppt Path: N. Illinois >> PHYS >> 210 Summer, 2008 Description: Convection Material Flow Objects at different temperatures may not be in direct thermal contact. An intermediate mechanism is needed to transfer heat. If the heat transfer is through the motion of a fluid, then it is called convection. Fluid ... Date Added: 2009-06-11 19:39:14 |
| Lecture 3-3.pdf Path: Utah >> BIOLOGY >> 2030 Fall, 2009 Description: Lecture 2/19 BIOL 2030, Spring `08 Ch. 8: 31-38 Ch. 20: read pp. 721-729 Recovery and characterization of mutations: There are almost always surprises! All biological processes are open to investigation by analysis of mutants: development, biosynthes... Date Added: 2009-06-11 19:42:46 |
| Test 3.pdf Path: Mississippi State >> ECE >> 3724 Fall, 2009 Description: ECE 3724-0Section Microprocessors EXAM #3 You may use a non-programming calculator only. You may use only the provided reference materials. Recall that the `d\' bit in a machine word indicating a destination is `0\' if the destination is W, is `1\' if... Date Added: 2009-06-11 19:43:19 |
| cir-4-16-2.xls Path: Fayetteville State University >> STA >> 5167 Fall, 2009 Description: mean rev rate long term avg sigm dt dz r0 simulations paths t a b sigma 1month 0.5 4.69% long term averga 8.42% from Garch 0.01 time 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 4... Date Added: 2009-06-11 19:44:18 |
| quiz4.pdf Path: UAB >> MA >> 227 Fall, 2009 Description: STUDENT NAME: Quiz 4 Calculus III - MA 227 7B February 19, 2007 Time : 10 min Instructions 1. Calculators are NOT permitted on this quiz. 2. Correct answers without any justification will earn no credit. Question 1. Find all the first partial deriva... Date Added: 2009-06-11 19:44:32 |
| mm515053113.053012.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.971 107.922 -72.093 41.638 -72.251 43.433 1.829 -72.172 42.536 67.669 IJD CNH ... Date Added: 2009-06-11 19:46:35 |
| mm545080720.080506.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.609 107.727 -73.967 46.225 -71.392 46.48 6.744 -72.679 46.353 2... Date Added: 2009-06-11 19:47:45 |
| mm545041421.041200.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dgfk[nmi] dduluth[nmi] 120.000 28.562 -90.248 46.251 -89.998 45.807 24.800 -90.130 46.041 310.168 93.174 60.000 29.717 -90.492 45.845 -89... Date Added: 2009-06-11 19:48:39 |
| Macrophage responsiveness to therapeutic ultrasound.pdf Path: UC Riverside >> EGARC >> 014 Fall, 2009 Description: Ultrasound in Med. & BioL Vol. 16, No. 8, pp. 809-816, 1990 Printed in the U.S.A. 0301-5629/90 $3.00 + .00 1990 Pergamon Press plc OOriginal Contribution MACROPHAGE RESPONSIVENESS TO THERAPEUTIC ULTRASOUND S. R. YOUNG a n d M . DYSON Tissue Repai... Date Added: 2009-06-11 19:51:30 |
| PBTS3600.dat.txt Path: Ill. Chicago >> IDS >> 594 Fall, 2008 Description: 685.500 685.500 686.735 698.500 698.500 698.500 691.240 686.500 686.500 691.575 715.500 715.500 715.500 698.100 686.500 686.500 688.710 699.500 699.500 699.500 700.850 701.500 701.500 704.220 717.500 717.500 717.500 715.74... Date Added: 2009-06-11 19:52:42 |
| evaluate.doc Path: Ill. Chicago >> IDS >> 594 Fall, 2008 Description: Documentation of Program EVALUATE in CLUSPAC CMS DSN = EVALUATE CLUSPAC VERSION 1.4 30-JAN-90 COPYRIGHT PROGRAMMED BY: DR. STANLEY L. SCLOVE 312/996-2681 INFORMATION AND DECISION SCIENCE DEPT. M/C 294 COLLEGE OF BUSINESS ADMINISTRATION UNIVERSITY OF ... Date Added: 2009-06-11 19:52:46 |
| sample test 4.pdf Path: Pima CC >> MAT >> 092 Fall, 2008 Description: Sample Test 4 Simplify, if possible. 2x + 6 1) x2 + 3x 2) -2y + 4 -14y 4m 2 + 4m 12m 2 + 16m y2 + 12y + 36 y2 + 15y + 54 x2 - 4x - 21 x2 + 2x - 63 t2 + 3t - 18 t2 + 12t + 36 MAT 092 FALL 2005 3) 4) 5) 6) Multiply and, if possible, si... Date Added: 2009-06-11 19:54:34 |
| bei04_ppt_r04_06.ppt Path: Pima CC >> MAT >> 092 Fall, 2008 Description: Copyright 2006 Pearson Education, Inc. Publishing as Pearson Addison-Wesley Slide R- 1 R.4 Polynomials Exponents Polynomials Addition and Subtraction of Polynomials Multiplication of Polynomials Division of Polynomials Copyright 2006 Pear... Date Added: 2009-06-11 19:54:39 |
| m3720t1f05.pdf Path: Youngstown >> M >> 3720 Fall, 2009 Description: Oct 7,2005 Math. 3720 1.) Let A be an nxn matrix. i.) Define the \"inverse of A\". ii.) Prove that (AB)-1 = B -1 A-1 Hint: Use uniqueness of the inverse. 2.) Let X be the following collection of vectors. {x1 , x2 , x3 } in Rn . i.) Define the span(X)... Date Added: 2009-06-11 19:54:49 |
| pr2solM.pdf Path: Cornell >> P >> 214 Fall, 2009 Description: ... Date Added: 2009-06-11 19:56:10 |
| Homework 11.pdf Path: Iowa State >> CPRE >> 381 Fall, 2009 Description: Cpr E 381 Homework 11 1. Problem 7.11 Given the following pseudocode: int array[10000,100000]; for each element array[i][j]{ array[i][j] = array[i][j] * 2; } Write two C programs that implement this algorithm: one should access the elements of the ar... Date Added: 2009-06-11 19:56:48 |
| Integrated risk.doc Path: Creighton >> FIN >> 340 Fall, 2009 Description: Concept of Integrated Risk Management Ryan OConnor December 4, 2000 Table of Contents Executive Summary. . . . . . . . . . . . . . . . . page i Introduction. . . . . . . . . . . . . . . . . . . page 1 Non-traditional, Alternative Risk Transfers. .... Date Added: 2009-06-11 19:57:13 |
| gcnR_flux.txt Path: Berkeley >> ASTRO >> 00334112 Fall, 2009 Description: -25.94 1 1 ... Date Added: 2009-06-11 19:57:53 |
| gcnR_flux_ul.txt Path: Berkeley >> ASTRO >> 00334112 Fall, 2009 Description: -25.94 1 1 ... Date Added: 2009-06-11 19:57:54 |
| HW4_08.pdf Path: Utah >> ECE >> 2280 Spring, 2008 Description: ECE2280 1. Homework #4 Spring 2008 a) Draw the cross section of a mosfet. b) Explain in your own words and drawings as needed how, when(under what conditions), and in what direction the current flows in the mosfet. c) Explain in your own words all... Date Added: 2009-06-11 20:00:03 |
| P3_08.pdf Path: Utah >> ECE >> 2280 Spring, 2008 Description: UNIVERSITY OF UTAH DEPARTMENT OF ELECTRICAL AND COMPUTER ENGINEERING ECE 2280 A. Rasmussen 1/08 Project #3 Multistage Amplifiers DUE: PSpice Simulations Circuit Demonstration Friday 4/17/2009 by 5pm Week of 4/20/2009 by end of lab session Do your o... Date Added: 2009-06-11 20:00:08 |
| cs411-LA-07-PHP.RelAlgebra.ppt Path: University of Illinois, Urbana Champaign >> CS >> 411 Fall, 2008 Description: CS411 Database Systems 07: PHP Introduction Relational Algebra 1 PHP http:/www.phpexamples.net/content/view/14/27/ <?php #A typical shell script comment /Another style of comment /*A third style of comment, which can span multipl lines of code, re... Date Added: 2009-06-11 20:00:21 |
| 6.04.pdf Path: Roosevelt >> M >> 347 Fall, 2009 Description: Chapter 6, Section 4 Transformations of Variables Method of Transformations Univariate Distributions John J Currano, 03/22/2009 1 Method of Transformations Univariate Discrete Case Given: Y ~ pY (y) with support A = { a1, a2, a3, . . . } U = h... Date Added: 2009-06-11 20:00:27 |
| measuring_effects_of_stakeholder_participations.pdf Path: Texas A&M >> PLAN >> 641 Fall, 2008 Description: Effects Brody of Stakeholder Participation 10.1177/0739456X03253022 ARTICLE Measuring the Effects of Stakeholder Participation on the Quality of Local Plans Based on the Principles of Collaborative Ecosystem Management Samuel D. Brody I n respons... Date Added: 2009-06-11 20:00:50 |
| divorce.txt Path: UF >> STA >> 6127 Fall, 2008 Description: county division divper1k Douglas, CO 8 4.8 Allegany, MD 5 2.6 Marion, OR 9 3.9 Winnebago, WI 3 4.1 Bergen, NJ 2 3.3 Boone, IL 3 ... Date Added: 2009-06-11 20:01:24 |
| CastingEx.txt Path: CSU Fullerton >> IPC >> 144 Fall, 2009 Description: Example of Implicit and Explict Casting of Numeric Data and effect on Results main() { int n, m; double d; n = 5; m = 2; d = n/m; /* n and m are integer so n/m or 5/2 will be 2, which will then be implicitly cast double ... Date Added: 2009-06-11 20:02:06 |
| Cx1-cpp.pdf Path: UNF >> COP >> 3601 Fall, 2008 Description: The C Preprocessor: an example program exercising its main features main() /* Whether or not you provide preprocessor commands, the preprocessor does a few things for you automatically: 1. by default it replaces all C comments by single spaces 2. all... Date Added: 2009-06-11 20:04:38 |
| Example-problems2.ans.pdf Path: UNF >> COP >> 3601 Fall, 2008 Description: COP 3601: Introduction to Systems Software Homework problems tracing execution: Solutions Given the Symbol Table symbol ONE TWO THREE loc 12225 13224 14635 assemble each of the following using standard SIC/XE assembly conventions (PC-relative takes... Date Added: 2009-06-11 20:05:21 |
| assgn2-Demo.pdf Path: UNF >> COP >> 3601 Fall, 2008 Description: sicasm <student-id>-2.A.src.lst Loc -002D0 002D0 002D3 002D6 002D9 002DC 002DF 002E2 002E5 002E8 002EB 002EE 002F1 002F4 002F7 002FA 002FD 00300 00303 00306 Object -172054 072039 032042 2B2033 33202A 232033 0F2039 03A042 2B2024 372003 232027 1B202D 0... Date Added: 2009-06-11 20:06:01 |
| 1725i04.pdf Path: East Los Angeles College >> MATH >> 1725 Fall, 2009 Description: June04: MATH1725 grade vs. number of risk factors MATH1725 grade 0 0 20 40 60 80 100 1 2 Number of risk factors 3 4 ... Date Added: 2009-06-11 20:09:33 |
| chap21.pdf Path: Uni. Westminster >> PHY >> 211 Spring, 2009 Description: ... Date Added: 2009-06-11 20:10:04 |
| prop0.doc Path: Florida A&M >> COP >> 2532 Fall, 2009 Description: Summary Security is a system problem, specifically an interoperability problem. It is hard to separate application security from system security. This proposal will take a system reliablity approach to security analysis and testing. The system will b... Date Added: 2009-06-11 20:11:08 |
| outline_jan22.doc Path: Washington >> FISH >> 101 Fall, 2009 Description: Fish 101 - Lecture 7 Mixed or not mixed, that is the question 22 January. In my opinion the bluefin tuna remains the most purposely mismanaged large animal in the world. How does emigration and immigration affect productivity? Why is migration and... Date Added: 2009-06-11 20:12:24 |
| FREN.pdf Path: Messiah >> LANG >> 0708 Fall, 2009 Description: French Minor (21 credits beyond [FREN 102]) - Department of Modern Languages [FREN 201] Intermediate French (3) [FREN 206] French Culture and Language (3) Two of the following: [FREN 301] Contemporary French Culture (3) [FREN 320] Selected Topics in ... Date Added: 2009-06-11 20:13:06 |
| 4350.hw2.pdf Path: UGA >> TERRY >> 4350 Fall, 2009 Description: Homework #2 ECN 4350/6350 Name Professor Atkinson Spring, 2009 1. State sec. 1 and sec. 2 of the Sherman Act. 2. Summarize the Clayton Act. 1 3. What are the exemptions to the Sherman anti-trust Act as specied in the Clayton Act? Is there an econo... Date Added: 2009-06-11 20:14:10 |
| 8070.hexam.02.pdf Path: UGA >> TERRY >> 8070 Fall, 2008 Description: Econometrics 8070 Hour Exam Name Professor Atkinson Fall 2002 1. Prove or disprove: If P [A|B] = P [A|B], then A and B are independent. 2. If AB = and p(A and p(B). B) > 0, express the probability p(A|A B) in terms of p(A) 1 3. A theorem state... Date Added: 2009-06-11 20:14:13 |
| error.txt Path: Washington >> V >> 12186 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Jan 31 08:34:19 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Jan 31 10:03:18 2008 ( 5339 s elapsed) ... Date Added: 2009-06-11 20:17:30 |
| submit.txt Path: Washington >> V >> 12351 Fall, 2009 Description: executable = allgamma_12351.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-11 20:18:50 |
| submit.txt Path: Washington >> V >> 12086 Fall, 2009 Description: executable = allgamma_12086.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-11 20:19:34 |
| output.txt Path: Washington >> V >> 12495 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS10 - local directory - Volume in drive C has no label. Volume Serial Number is 7A81-82A4 Directory of C:\\condor\\execute\\dir_1392 01/31/2008 07:00 PM <DIR> . 01/31/2008 07:00 PM <... Date Added: 2009-06-11 20:20:04 |
| log.txt Path: Washington >> V >> 12249 Fall, 2009 Description: 000 (45749.000.000) 01/31 07:10:39 Job submitted from host: <128.95.94.28:1098> . 001 (45749.000.000) 01/31 08:51:23 Job executing on host: <172.25.101.185:1063> . 006 (45749.000.000) 01/31 09:11:31 Image size of job updated: 404200 . 006 (45749.000.... Date Added: 2009-06-11 20:20:10 |
| log.txt Path: Washington >> V >> 12044 Fall, 2009 Description: 000 (45544.000.000) 01/31 07:09:48 Job submitted from host: <128.95.94.28:1098> . 001 (45544.000.000) 01/31 07:11:59 Job executing on host: <172.25.101.90:1056> . 006 (45544.000.000) 01/31 07:32:07 Image size of job updated: 362292 . 005 (45544.000.0... Date Added: 2009-06-11 20:20:27 |
| log.txt Path: Washington >> V >> 12158 Fall, 2009 Description: 000 (45658.000.000) 01/31 07:10:17 Job submitted from host: <128.95.94.28:1098> . 001 (45658.000.000) 01/31 08:27:45 Job executing on host: <172.25.101.68:1057> . 006 (45658.000.000) 01/31 08:47:53 Image size of job updated: 464432 . 010 (45658.000.0... Date Added: 2009-06-11 20:21:31 |
| log.txt Path: Washington >> V >> 12347 Fall, 2009 Description: 000 (45847.000.000) 01/31 07:11:19 Job submitted from host: <128.95.94.28:1098> . 001 (45847.000.000) 01/31 14:46:41 Job executing on host: <172.25.101.93:1056> . 006 (45847.000.000) 01/31 15:06:49 Image size of job updated: 467956 . 010 (45847.000.0... Date Added: 2009-06-11 20:22:23 |
| submit.txt Path: Washington >> V >> 12313 Fall, 2009 Description: executable = allgamma_12313.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-11 20:22:27 |
| lec01 software life cycle 062405.pdf Path: Western Michigan >> CS >> 1120 Fall, 2008 Description: CS112: Computer Science II SummerII 2005 Software Quality Software engineering is the production of quality software External quality May be detected by its users Internal quality Perceptible only to computer professionals who have access to t... Date Added: 2009-06-11 20:23:28 |
| lec02.pdf Path: Allan Hancock College >> COMP >> 1110 Fall, 2009 Description: Review of Objects and Classes Object-oriented programming: q programs are modelled by objects q an object is an instance of a particular class q the class describes the . . . s state: captured by attributes (variables) s behaviour : described by ro... Date Added: 2009-06-11 20:23:52 |
| HW 8 2005 solution.doc Path: U. Memphis >> PUBLIC >> 7300 Fall, 2009 Description: HW 8, 45 pts, by T, Nov 8. 1 . (20 pts) These questions concern a market for used cars. There are 1,500 used cars, 600 of which are bad and 900 of which are good. The current owners of the used cars (each of whom owns one car) know their cars\' types.... Date Added: 2009-06-11 20:24:16 |
| Geog473Spring2008_Section02_Lab3-2Instruction.doc Path: Maryland >> GEOG >> 473 Fall, 2008 Description: University of Maryland Geog473: GIS and Spatial Analysis Lab 3.2, April 1, 2008 Section 0201 Instructor: Naijun Zhou TA: Jeremy Mirmelstein Lab Description: This lab introduces using ArcGIS to create a road network and do network analysi... Date Added: 2009-06-11 20:25:00 |
| course.pdf Path: UMass Lowell >> FACULTY >> 431 Fall, 2009 Description: qF\"# $8lRg mIw2#A@8k\"8# A)IA(8Ya8kF )2)3!)0F %F o @ @ 1 oh R v# 7 # F U#h v # 7 F U F 7 o 1 | qff F%#( R gm m U x f 8e#IF 8ew!8#lw!#!Qi\'A@A@1AH)tm$8Q)0!)0F93~R!peI # ~Rm!pYeIID$!8g 8$n8 \'De!e! k)Y08Wi m x p h w B q x ... Date Added: 2009-06-11 20:27:13 |
| A15.ps Path: UMass Lowell >> FACULTY >> 491 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: A15.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMTI12 CMMI12 CMMI8 CMR8 CMSY10 CMSY8 CMTT12 %+ CMEX10 %EndComments %DVIPSWebPage:... Date Added: 2009-06-11 20:27:26 |
| T05.AVLTrees.pdf Path: Virginia Tech >> CS >> 2606 Fall, 2006 Description: Balanced Binary Trees AVL Trees 1 Binary search trees provide O(log N) search times provided that the nodes are distributed in a reasonably \"balanced\" manner. Unfortunately, that is not always the case and performing a sequence of deletions and in... Date Added: 2009-06-11 20:27:41 |
| Bongo Bob Bernstein.doc Path: Belmont >> ETP >> 6500 Fall, 2009 Description: Bongo Bob Bernstein Bob is a recovering political junkie and journalist. At 10 he volunteered on a congressional campaign and decided he wanted to be president. At 22 he worked on a presidential campaign and decided he\'d rather be a journalst. He th... Date Added: 2009-06-11 20:28:29 |
| Hatry,_Program_Analysis_for_State_and_Local_Governments,_Chap._4-5.pdf Path: Washington >> PBAF >> 513 Fall, 2009 Description: ... Date Added: 2009-06-11 20:28:53 |
| Notes7_fixed.pdf Path: UCSB >> ECE >> 215 Fall, 2009 Description: ECE215A/Materials206A Fundamentals of Solids for Electronics E.R. Brown/Winter 2008 NOTES 7: Energy of Lattice Waves and their Quantization (Phonons) Classical Analysis So far we have addressed only the mechanical behavior of lattice waves the d... Date Added: 2009-06-11 20:30:20 |
| modl.txt Path: Berkeley >> ASTRO >> 00143708 Fall, 2009 Description: chi^2/nu= 137.15009 / 62 The fit is rejectable at 99.999987 % Confidence -6.89500 -5.97500 788.11298 -5.97500 -5.74500 983.26775 -5.74500 -5.28500 1090.1946 -5.28500 -4.5950... Date Added: 2009-06-11 20:31:06 |
| 1ECC_MIP_P.txt Path: UWO >> CD >> 00352 Fall, 2009 Description: 74 77 0.61803 0.81133 0.97737 0.45199 Y A 0.129166618073448 0.45199 7.87242695362215e-05 0.0198407286531603 6.5062073102517 0.0794416388821774 77 74 0.81133 0.61803 0.97737 0.45199 A Y 0.129166618073448 0.45199 7.87242695362215e-05 0.0198407286531603... Date Added: 2009-06-11 20:35:46 |
| 1RK2_avgMI_P.txt Path: UWO >> COG >> 0524 Fall, 2009 Description: 164 168 0.64477 0.66457 0.96427 0.34508 A A 0.128407895357986 0.34508 -2.19238474738872e-16 0.0200609427986687 6.40089035927601 0.0802437711946747 168 164 0.66457 0.64477 0.96427 0.34508 A A 0.128407895357986 0.34508 -2.19238474738872e-16 0.020060942... Date Added: 2009-06-11 20:35:51 |
| 1CKA2_P0.3.txt Path: UWO >> CD >> 00174 Fall, 2009 Description: c d H_c H_d H_cd MI_cd aa_c aa_d MI/Hcd raw_MI mean_MI SD Z 3Z 39 49 0.40205 0.43613 0.68497 0.15321 A I 0.223674029519541 0.15321 0.0923762298379525 0.0256380958537392 5.12119934454645 0.16929051739917 49 39 0.43613 0.40205 0.68497 0.15321 I A 0.223... Date Added: 2009-06-11 20:36:16 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


