Course Solutions And Notes - aem120-8-24 0c
| BIOL 2051 - EXAM 3[1] Path: LSU >> BIOL >> 2051 Spring, 2008 Description: Chapter 17- Metabolic Diversity PART I The Phototrophic Way of Life 17.1 Photosynthesis, p. 533 Phototrophs- use light as energy source 2 types of photosynthesis: Anoxygenic- no oxygen is produced Most photosynthetic bacteria are anoxygenic phototr... Date Added: 2008-06-25 07:34:12 |
| RA 11-II answers.pdf Path: San Jose State >> ENGR >> 10 Spring, 2008 Description: Reading Assignment Chapter 11: Solution Thermodynamics: Theory (11.5 - 11.7) 1. How is the Gibbs energy for an ideal gas mixture written? What is i(T)? How do we determine it? G ig = xi i (T ) + RT xi ln xi P The i(T) is the constant of integratio... Date Added: 2009-01-10 17:28:53 |
| ho26.pdf Path: Rutgers >> CALC >> 1 Fall, 2008 Description: Dr. Zs Math151 Handout # 2.6 [Trigonometric Limits] By Doron Zeilberger Problem Type 2.6.1: Use the Squeeze Theorem to prove that limxa GoesT oZero(x) Bounded(x) = 0 Example Problem 2.6.1 : Use the Squeeze Theorem to prove that lim x3 + x2 sin(/x) ... Date Added: 2009-02-04 14:49:34 |
| spins.pdf Path: USF >> CAS >> 4151 Fall, 2009 Description: Physics Z-5156, Fall 2002 Chapter 8: Models of magnetic materials: symmetry in quantum mechanics I will provide in class further information clarifying which parts of these notes we will apply to a computing project. The written exercises and problem... Date Added: 2009-04-16 00:32:49 |
| answer3.pdf Path: Penn State >> ECON >> 480 Fall, 2008 Description: Homework3 1 1. Exercise 6.2 (page 127) (a) y x = 4(x+ x)2 +9 (4x2 9) x = 8x + 4 x (b) dy=dx = f 0 (x) = 8x (c) f 0 (3) = 8 3 = 24 and f 0 (4) = 32 3. (a) y= x = 5; This is a constant function. (b) No dierence. y= x = 5, as x approaches zero. ... Date Added: 2009-01-09 06:24:45 |
| BME301_Spring09_Syllabus Path: Texas >> BME >> 301 Spring, 2009 Description: BME301WorldHealth&Biotechnology UniqueNo.13835 Spring2009 Professor: Dept.ofBiomedicalEngineering UniversityofTexasatAustin Dr.ChristineE.Schmidt ProfessorofBiomedicalEngineeringandChemicalEngineering BME4.202I,4711690 schmidt@che.utexas.edu T 2:00... Date Added: 2009-04-09 11:16:37 |
| 877.pdf Path: Wisconsin Milwaukee >> ENGLISH >> 877 Fall, 2008 Description: GRADUATE FACULTY COUNCIL DOC. NO. 877 Revised May 19, 2008 Approved February 18, 2002 RECOMMENDATION OF THE SUBCOMMITTEE ON GRADUATE COURSE AND CURRICULUM (GCC) TO ESTABLISH POLICIES AND PROCEDURES FOR THE DEVELOPMENT, STRUCTURE, AND REVIEW OF GRAD... Date Added: 2009-02-02 20:42:45 |
| Austral Ecology.pdf Path: UC Davis >> EVE >> 2 Fall, 2008 Description: Austral Ecology (2001) 26, 447457 Benets and risks of biotic exchange between Eucalyptus plantations and native Australian forests SHARON Y. STRAUSS Section of Evolution and Ecology, One Shields Avenue, University of California, Davis, Davis, CA 956... Date Added: 2009-02-06 18:17:41 |
| microtest4 Path: Gustavus >> E/M >> E/M 102 Spring, 2008 Description: Micro Test #4 Lecture Notes 4/16 Elasticity-unit measure of sensitivity Ice cream @ Dairy Queen with 10 degree increase raise price Income elasticity Airlines-high income elasticity people will travel less with less income Cross-price elasticity su... Date Added: 2008-06-09 15:57:12 |
| po-hold-guide.pdf Path: UPenn >> PO >> 2 Fall, 2005 Description: Purchase Order Hold Resolution Guide PO Hold Type Quantity Ordered Invoice is greater (>) then the amount ordered on PO Approve Invoice Place PO Creator Markup on invoice image. Drag and click the maroon markup on to the image. Save the markup by cl... Date Added: 2009-02-06 17:42:00 |
| 13moon4s.ppt Path: Augustana >> AS >> 311 Fall, 2009 Description: The Moon Astronomy 311 Professor Lee Carkner Lecture 13 Which of the following was not a constituent of the Earth\'s original atmosphere? a) b) c) d) a) Water Carbon Dioxide Ammonia Methane Sulfur Dioxide Why do we think the Earth\'s core is liqu... Date Added: 2009-04-16 00:04:01 |
| hw5solutions.pdf Path: UCSD >> CSE >> 101 Winter, 1998 Description: Homework #5 UCSD Winter 2002, CSE 101, 3/9/2002 Question 1. Best-first search is a general search algorithm that always considers (expands) the estimated best partial solution. This is typically implemented with a priority queue. One well-known best-... Date Added: 2009-02-06 18:41:10 |
| The kite Runner Path: Oglethorpe >> COR >> 104 Spring, 2008 Description: Shaikh, Safiya 5/8/2008 1 \"Act only according to that maxim whereby you can at the same time will that it should become a universal law.\" This quote by Emmanuel Kant sums up his idea of categorical imperative. He believes that one should act the way ... Date Added: 2008-05-06 06:11:09 |
| morrissey.pdf Path: Nova Southeastern University >> SSSS >> 11 Fall, 2008 Description: The Qualitative Report Volume 11 Number 1 March 2006 161-181 http:/www.nova.edu/ssss/QR/QR11-1/morrissey.pdf Phenomenological Research and Adolescent Female Sexuality: Discoveries and Applications Gabrielle Morrissey Bond University, Queensland, Aus... Date Added: 2009-02-18 00:01:44 |
| thermodynamics2.ppt Path: FSU >> HEP >> 2 Fall, 2008 Description: First law of thermodynamics q first law of thermodynamics: heat added to a system goes into the internal energy of the system and/or into doing work heat in = work + change in internal energy: Q = W + U is different formulation of energy conserv... Date Added: 2009-02-17 19:03:48 |
| thermodynamics2.ppt Path: S.F. State >> HEP >> 2 Fall, 2008 Description: First law of thermodynamics q first law of thermodynamics: heat added to a system goes into the internal energy of the system and/or into doing work heat in = work + change in internal energy: Q = W + U is different formulation of energy conserv... Date Added: 2009-02-17 19:03:48 |
| Organic Farming Path: University of Toronto >> BIO >> 150 Winter, 2008 Description: Organic Agriculture: Farming for Our Future By: Christie Lynn Moore, S#995148095 L#1W102, TA Rob Colautti, March 2008 Our world\'s population is rapidly growing. Today, there are over 6 billion people living on planet Earth. With our world\'s current ... Date Added: 2008-06-24 08:56:32 |
| Predent_GPA_Calculator.xls Path: BYU >> CHEM >> 107 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:15 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 270 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:04 |
| Predent_GPA_Calculator.xls Path: BYU >> LATIN >> 123 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:03 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 439 Winter, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| Predent_GPA_Calculator.xls Path: BYU >> LATIN >> 123 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 329 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:04 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 139 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:03 |
| Predent_GPA_Calculator.xls Path: BYU >> HLTH >> 439 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| Predent_GPA_Calculator.xls Path: BYU >> PDBIO >> 305 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 399r Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:04 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 227 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:03 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 139 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 439 Winter, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:04 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 229 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:03 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 239 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| Predent_GPA_Calculator.xls Path: BYU >> CHEM >> 106 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:15 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 239 Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-09 19:55:03 |
| Predent_GPA_Calculator.xls Path: BYU >> STDEV >> 399r Fall, 2008 Description: Student Name: Freshman Year _ GPA Calculator: Credit hrs. List courses taken: ourse C Sophomore Year Junior Year Senior Year Total Points: Final GPA: Rounded GPA: 0 #DIV/0! #DIV/0! Grade 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-01-11 20:34:11 |
| constitutional_law.pdf Path: Loyola Chicago >> WWW >> 1 Fall, 2008 Description: Constitutional LawCivil Rights Course Syllabus: Shortened Version Loyola University Chicago Monday-Friday, 9:00 a.m. to 5:00 p.m. June 30 to July 18, 2008 COURSE DESCRIPTION: This course focuses on the study and enforcement of civil rights by studyin... Date Added: 2009-02-17 23:59:33 |
| L63 Path: Texas A&M >> MATH >> 308 Spring, 2008 Description: Spring 2003 Math 308/501502 6 Theory of Higher-Order Linear ODEs 6.3 Method of Undetermined Coeffs c 2003, Art Belmonte Wed, 01/Oct Summary A nonhomogeneous linear ODE of order n with real constant n 1. First obtain a general solution yh of L[y] = 0... Date Added: 2008-03-29 07:21:24 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 355l Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-11 17:49:19 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 305 Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:35:17 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 399v Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:33:40 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 399v Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-11 17:49:19 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 306 Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:35:17 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 598d Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:33:40 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 598d Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-11 17:49:19 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 365t Spring, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:35:17 |
| OnFarm-2003v2.ppt Path: Purdue >> BTNY >> 204 Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:33:40 |
| OnFarm-2003v2.ppt Path: Purdue >> BTNY >> 204 Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-11 17:49:19 |
| OnFarm-2003v2.ppt Path: Purdue >> NRES >> 497 Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:35:17 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 270 Spring, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:35:16 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 210y Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:33:39 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 210y Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-11 17:49:19 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 285 Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:35:16 |
| OnFarm-2003v2.ppt Path: Purdue >> AGRY >> 355l Fall, 2008 Description: sing On-Farm Research: Are Those Real Differences I\'m Seeing? Bob Nielsen Purdue University Email: rnielsen@purdue.edu Web: www.kingcorn.org v112503 2003, Purdue Univ. 1 Purpose and outline The purpose of this presentation is to help growers ... Date Added: 2009-01-09 06:33:39 |
| Dhruva_Duncan.pdf Path: Mississippi State >> ECE >> 4532 Fall, 2009 Description: Kyle D. Duncan kdd29@msstate.edu Current: 200 Catherine St., Apt. 3B Starkville, MS 39759 662-648-9968 Permanent: 32113 Anner Road Carriere, MS 39426 601-799-3958 Education Bachelor of Science in Computer Engineering. Mississippi State University (M... Date Added: 2009-04-15 21:23:16 |
| chow.pdf Path: Ohio State >> WS >> 1 Fall, 2002 Description: A Biophysical model of spiketiming-dependent plasticity J. Rubin, R. Gerkin, G. Bi, CC University of Pittsburgh Questions How does a neuron know who came first? In a train of many spikes, whos on first? Is classical LTP/LTD the same as STDP? Is ... Date Added: 2009-02-17 22:28:48 |
| FSMinutes1-18-06.pdf Path: FSU >> FACSENATE >> 1 Fall, 2008 Description: TheOfficeoftheFACULTYSENATE MINUTES FACULTYSENATEMEETING JANUARY18,2006 DODDHALLAUDITORIUM 3:35P.M. I. RegularSession The regular session of the 200506 Faculty Senate was held on Wednesday, January18,2006.FacultySenatePresidentJamesCobbepr... Date Added: 2009-02-17 18:58:31 |
| FSMinutes1-18-06.pdf Path: S.F. State >> FACSENATE >> 1 Fall, 2008 Description: TheOfficeoftheFACULTYSENATE MINUTES FACULTYSENATEMEETING JANUARY18,2006 DODDHALLAUDITORIUM 3:35P.M. I. RegularSession The regular session of the 200506 Faculty Senate was held on Wednesday, January18,2006.FacultySenatePresidentJamesCobbepr... Date Added: 2009-02-17 18:58:31 |
| FSMinutes1-18-06.pdf Path: FSU >> FASENATE >> 1 Fall, 2008 Description: TheOfficeoftheFACULTYSENATE MINUTES FACULTYSENATEMEETING JANUARY18,2006 DODDHALLAUDITORIUM 3:35P.M. I. RegularSession The regular session of the 200506 Faculty Senate was held on Wednesday, January18,2006.FacultySenatePresidentJamesCobbepr... Date Added: 2009-02-17 18:57:10 |
| FSMinutes1-18-06.pdf Path: S.F. State >> FASENATE >> 1 Fall, 2008 Description: TheOfficeoftheFACULTYSENATE MINUTES FACULTYSENATEMEETING JANUARY18,2006 DODDHALLAUDITORIUM 3:35P.M. I. RegularSession The regular session of the 200506 Faculty Senate was held on Wednesday, January18,2006.FacultySenatePresidentJamesCobbepr... Date Added: 2009-02-17 18:57:10 |
| 060926skyscrap.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / Reports - Super-tall buildings: Symbol of big businessSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.com ReportsSubscription pageCloseSuper-tall buildings: Symbol of big business By Edwin Heathcote Published: ... Date Added: 2009-02-11 18:13:57 |
| 060926skyscrap.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / Reports - Super-tall buildings: Symbol of big businessSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.com ReportsSubscription pageCloseSuper-tall buildings: Symbol of big business By Edwin Heathcote Published: ... Date Added: 2009-02-11 18:15:40 |
| 020828curAct.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: European Internet C E E N e w s News newsgroup: C E E N e w s CEE English, 28.08.2002 13:57:10 Slovakia: Account deficit increased to EUR 948 million in first 6 months Bratislava (BLUeBULL) - Slovakia\'s account deficit increased to EUR 94... Date Added: 2009-02-11 19:12:37 |
| 1intro.ppt Path: CSU East Bay >> STAT >> 6601 Fall, 2008 Description: Data Mining: Concepts and Techniques Slides for Textbook Chapter 1 Jiawei Han and Micheline Kamber Intelligent Database Systems Research Lab School of Computing Science Simon Fraser University, Canada http:/www.cs.sfu.ca January 8, 2009 Data Mini... Date Added: 2009-01-10 02:47:00 |
| 1intro.ppt Path: CSU East Bay >> STAT >> 6872 Winter, 2008 Description: Data Mining: Concepts and Techniques Slides for Textbook Chapter 1 Jiawei Han and Micheline Kamber Intelligent Database Systems Research Lab School of Computing Science Simon Fraser University, Canada http:/www.cs.sfu.ca January 8, 2009 Data Mini... Date Added: 2009-01-10 02:47:01 |
| 011228growth.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: WSJ.com December 28, 2001 Commentary A Radical Idea: The IMF Should Promote Growth By David Malpass, a chief global economist at Bear Stearns. The International Monetary Fund is once again on the hot seat after its latest debacle. Its austerity progr... Date Added: 2009-02-11 17:56:07 |
| 041109fuelEc.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: CSRwire.com - Corporate Social Responsibility Newswire The Corporate Social Responsibility Newswire Service 11/09/2004 Press release from: World Resources Institute Impacts of New Chinese Fuel Economy Standards on Automakers Outlined in New World Re... Date Added: 2009-02-11 18:09:16 |
| chapter2.pdf Path: N. Illinois >> PHYS >> 652 Spring, 2008 Description: oq us x pg d e e qqxsx v eu x h p h qxq x e p vx qu x p h x x eu rxwyqrig\"ArA@yFQ\"wywQtrsQUDyQivrpiwruyixQ(@wcix(ts xx hg q p x xg oqqu g p v ug exs u qgsx ex g eu p x hg xq usx x dx FQyqiig\"yAUwruryn@FwB4ieAfwyi4Bwif@4wSreAQQ... Date Added: 2009-01-09 09:11:38 |
| Ferguson.MindsEye.pdf Path: University of Dayton >> REL >> 360 Fall, 2009 Description: ... Date Added: 2009-04-16 00:08:45 |
| 05_06-Fats+_+Oils Path: UC Davis >> FST >> 10 Winter, 2009 Description: ... Date Added: 2009-02-01 23:57:20 |
| bio2320notemaster.pdf Path: MSCD >> BIO >> 1090 Fall, 2008 Description: BIO 2320 Human Anatomy and Physiology II LABORATORY OBJECTIVES Required Text: Human Anatomy and Physiology Laboratory Manual, 8th Ed. Elaine N. Marieb, R.N., Ph. D. BIO 2310 Dissection Kit. Available in the bookstore; includes a scalpel, a blunt p... Date Added: 2009-01-09 02:50:34 |
| bio2320notemaster.pdf Path: MSCD >> BIO >> 2320 Fall, 2008 Description: BIO 2320 Human Anatomy and Physiology II LABORATORY OBJECTIVES Required Text: Human Anatomy and Physiology Laboratory Manual, 8th Ed. Elaine N. Marieb, R.N., Ph. D. BIO 2310 Dissection Kit. Available in the bookstore; includes a scalpel, a blunt p... Date Added: 2009-01-09 02:50:35 |
| bio2320notemaster.pdf Path: MSCD >> BIO >> 3320 Fall, 2008 Description: BIO 2320 Human Anatomy and Physiology II LABORATORY OBJECTIVES Required Text: Human Anatomy and Physiology Laboratory Manual, 8th Ed. Elaine N. Marieb, R.N., Ph. D. BIO 2310 Dissection Kit. Available in the bookstore; includes a scalpel, a blunt p... Date Added: 2009-01-09 02:50:35 |
| DyeEssay41S09.pdf Path: Colorado >> ORGCHEM >> 41 Fall, 2008 Description: Online edition for students of organic chemistry lab courses at the University of Colorado, Boulder, Dept of Chem and Biochem. (2009) u Supplement to Experiment 9 Essay: Dyes and Dyeing The dyeing of cloth is an ancient art. Prior to 1856, all dyes... Date Added: 2009-02-06 20:47:44 |
| Acceleration Path: UNO >> PHYS >> 2210 Spring, 2008 Description: Sloane Schneider Acceleration September 9, 2008 Laboratory Partners: Taylor Whipple Cory Wilkinson Amy Kalal Purpose: The purpose of this laboratoryis to compare three separate experiments in order to discover the ways in which acceleration relate... Date Added: 2008-11-25 09:42:46 |
| Quiz3_solns Path: Delaware >> CPEG >> 202 Spring, 2008 Description: CPEG202 Quiz 3 Solutions (2 pts) Write out the truth table for a 3-bit gray encoder. A 0 0 0 0 1 1 1 1 B 0 0 1 1 0 0 1 1 C 0 1 0 1 0 1 0 1 X 0 0 0 0 1 1 1 1 Y 0 0 1 1 1 1 0 0 Z 0 1 1 0 0 1 1 0 (4 pts) Write out the k-map for a 3-bit gray encoder. X ... Date Added: 2008-05-19 20:48:46 |
| MCGANN_V.DOC Path: Washington >> M E >> 593 Fall, 2008 Description: McGann / 1 [V: Editorial changes incorporated] Imagining What You Don\'t Know: The Theoretical Goals of The Rossetti Archive Jerome McGann In a trenchant meta-theoretical essay, Lee Patterson investigated what he called The Kane-Donaldson Piers plo... Date Added: 2009-02-02 20:31:19 |
| ss18.ppt Path: JMU >> ACTG >> 494 Fall, 2008 Description: Employee Benefit Plans CHAPTER 18 Postretirement Benefit Plan Encompass all types of retiree health and welfare benefits including . . . Medical coverage, Dental coverage, Life insurance, Group legal services, and Other benefits. Irwin/McGraw-Hil... Date Added: 2009-01-09 02:14:02 |
| IE 361 Exam 2 F2008.pdf Path: Iowa State >> I E >> 361 Fall, 2008 Description: IE 361 Exam 2 Fall 2008 I have neither given nor received unauthorized assistance on this exam. _ Name Signed Date _ Name Printed 1 This exam consists of 20 multiple choice questions. There is a single best answer for each question. Circle EXACT... Date Added: 2009-01-09 02:06:23 |
| examIII_f07 Path: Penn State >> E E >> 350 Fall, 2007 Description: ... Date Added: 2008-03-17 19:44:38 |
| Ch 10_Presentation Path: Cornell >> PAM >> 2000 Fall, 2007 Description: PAM 200 Intermediate Microeconomics Cha pt er 10 Competitive Markets: Applications Efficiency of Competitive Markets In a competitive market equilibrium, all mutually beneficial trades are realized. That is, all consumers who are willing to pay a... Date Added: 2009-02-19 23:10:09 |
| M151groupfinalF05.pdf Path: San Diego State >> MATH >> 151 Fall, 2008 Description: Last Name: First Name: Instructor: Math 151 Group Final (Fall 2005) You are not allowed to use notes, books, calculators, personal stereos or cell phones. You have exactly two hours. Write clearly so that you can avoid mistakes and count on partial c... Date Added: 2009-01-09 10:20:26 |
| M151groupfinalF05.pdf Path: San Diego State >> MATH >> 141 Fall, 2008 Description: Last Name: First Name: Instructor: Math 151 Group Final (Fall 2005) You are not allowed to use notes, books, calculators, personal stereos or cell phones. You have exactly two hours. Write clearly so that you can avoid mistakes and count on partial c... Date Added: 2009-01-12 05:26:37 |
| M151groupfinalF05.pdf Path: San Diego State >> MATH >> 150 Fall, 2008 Description: Last Name: First Name: Instructor: Math 151 Group Final (Fall 2005) You are not allowed to use notes, books, calculators, personal stereos or cell phones. You have exactly two hours. Write clearly so that you can avoid mistakes and count on partial c... Date Added: 2009-01-12 05:26:37 |
| webquiz_2 Path: Texas >> CH >> 304k/305k Fall, 2005 Description: Grodin, Micah Webquiz 2 Due: Mar 3 2006, 11:00 pm Inst: Sara Sutcliffe This print-out should have 5 questions. Multiple-choice questions may continue on the next column or page find all choices before answering. The due time is Central time. 001 ... Date Added: 2008-04-07 00:12:38 |
| finalprog.pdf Path: UC Irvine >> ENG >> 2 Fall, 2008 Description: Final Program for ISORC 2000 The 3rd IEEE International Symposium on Object-Oriented Real-time distributed Computing March 15 - 17, 2000 Sheraton Newport Beach Newport Beach, California, USA Sponsored by: IEEE Computer Society TC on Distributed Proc... Date Added: 2009-02-06 18:49:27 |
| finalprog.pdf Path: UC Irvine >> DREAM >> 2 Fall, 2008 Description: Final Program for ISORC 2000 The 3rd IEEE International Symposium on Object-Oriented Real-time distributed Computing March 15 - 17, 2000 Sheraton Newport Beach Newport Beach, California, USA Sponsored by: IEEE Computer Society TC on Distributed Proc... Date Added: 2009-02-06 18:49:27 |
| psy362.pdf Path: Bates >> X >> 57530 Fall, 2008 Description: Mr. John E. Kelsey Office: Pettingill 359 (6184) Psychopharmacology: 362 How Drugs Affect Behavior Lecture: 9:30 MWF Office Hours: 11-12:30 T Th and by appointment Required Text: Grilly, D. M. (2002) Drugs and Human Behavior, 4th ed., Allyn & Baco... Date Added: 2009-02-06 18:26:18 |
| Contracts I Outline 2 Path: SMU >> LAW >> Contracts Spring, 2008 Description: Contracts Outline Fall 2003 BACKGROUND Contract Formation: Agreement: Offer & Acceptance Mutual Assent Consideration 3 Types of K: 1) Agreement w/ considerations (written or oral) 2) K implied in fact 3) K implied in law (quasi K) General Princ... Date Added: 2008-04-03 23:40:39 |
| ENGR_183_W08_03 - Engineering Teams Path: UCLA >> ENGR >> 183 Winter, 2008 Description: Engineering & Society: Engineering Teams and Teamwork Dr. Gershon Weltman Engineering 183, UCLA SEAS Lecture 3 In Memoriam Dr. Joe Miller seen at right with former SEAS Dean Dr. Steve Jacobsen Lunar Descent Engine Teams Teams for Design, Developm... Date Added: 2008-03-06 15:40:19 |
| 2006-CA-02087-COArt.pdf Path: Santa Monica >> LAWWIN >> 2 Fall, 2009 Description: ... Date Added: 2009-04-15 20:38:51 |
| probset2.pdf Path: UNC Asheville >> ATMS >> 320 Fall, 2009 Description: Meteorological Instruments ATMS 320 Fall 2008 Problem Set #2 Due: Wednesday, 17 September 2008 1. (12 points) Consider a voltage divider where the reference voltage is 12 V and the resistor nearest the reference voltage has a value of 15 k. What valu... Date Added: 2009-04-15 23:53:59 |
| syllabus08s.doc Path: WPUNJ >> CS >> 215 Fall, 2008 Description: WILLIAM PATERSON UNIVERSITY OF NEW JERSEY COLLEGE OF SCIENCE AND HEALTH Computer Science Syllabus and Outline 1. Course: CS215- COMPUTER AND INFORMATION TECHNOLOGY FOR EDUCATORS Course web-site: cs.wpunj.edu/~kaufmanl Follow links to cs 215. Syllabus... Date Added: 2009-02-17 23:38:30 |
| commands.txt Path: Maine >> CS >> 161 Fall, 2008 Description: JOIN David XEROX JOIN Mario XEROX JOIN John Digital JOIN Fred Digital JOIN Phil IBM CHANGE Fred NEC JOIN Miriam Digital JOIN Sharon Microsoft JOIN Harvey Digital CHANGE Miriam Borland PAYDAY EMPLOYEES Digital JOIN Marge Borland JOIN Lesley Microsoft ... Date Added: 2009-02-17 23:46:07 |
| 051102daily.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: From: INA [support@inadaily.com] Sent: Wednesday, November 02, 2005 12:42 AM To: Bove, Roger Even Subject: INA The Daily Star Headline Service _ _ INA | The Daily Star Headline Service Wednesday, November 2, 2005 + SPECIAL PROMOTION + Interested in r... Date Added: 2009-02-11 19:04:55 |
| clns.ps Path: Cornell >> LNS >> 96 Fall, 1996 Description: CLNS 96/1454 CLEO 96-23 The Inclusive Decays B ! DX and B ! D X CLEO collaboration (March 5, 1997) Abstract We report new measurements of the di erential and total branching ratios for inclusive B decay to D0 , D+ and D + and the rst measurement of... Date Added: 2009-02-17 21:35:35 |
| AAD 201.8 Lec 14 handout word.pdf Path: UNLV >> ART >> 201 Fall, 2008 Description: AAD 201 Fall 2008 Lecture 14: Modern Urbanism Tony Garnier Contemporary City for 3 Million 1923; Le Corbusier Unit dHabitation Marseilles, FR; 1945; Le Corbusier Master Pl... Date Added: 2009-02-02 19:50:08 |
| GBNEP31_cover-contents.pdf Path: TAMU Galveston >> GBIC >> 31 Fall, 1931 Description: Trends and Status of Wetland and Aquatic Habitats in the Galveston Bay System, Texas Galveston Bay National Estuary Program GBNEP-31 April 1993 Trends and Status of Wetland and Aquatic Habitats in the Galveston Bay System, Texas i printed on recyc... Date Added: 2009-02-11 21:29:04 |
| assign2.pdf Path: YCP >> CS >> 340 Fall, 2007 Description: CS 340, Spring 2007 - Assignment 2 Due Thursday, February 8th by 11:59 PM Note: in the definition of a language, the symbol is used to denote the empty string. Question 1. Lemma: All regular languages are context-free languages. By answering parts... Date Added: 2009-04-16 00:28:31 |
| HON 301 syllabus fall 2008 final.doc Path: Southern Miss. >> ACT >> 301 Fall, 2008 Description: HON 301 PROSPECTUS WRITING Fall 2008 Instructors: Dr. Robert Bateman TEC 430 Robert.Bateman@usm.edu 266-4701 Office hours by appointment Dr. Frank Moore JST 710 Frank.Moore@usm.edu 266-4748 Office hours by appointment COURSE DESCRIPTION: This course... Date Added: 2009-02-02 20:15:45 |
| new_technologies.pdf Path: St. John Fisher >> MEM >> 07949 Fall, 2009 Description: The Leapster L Max Learning Game System Background: The Leapster L-Max Learning Game System from Leap Frog is one of the new additions to the Leap Frog Leapster Family. This Game System is an updated version of the original Leapster. This system is... Date Added: 2009-04-15 19:46:56 |
| new_technologies.pdf Path: St. John Fisher >> MEM >> 231 Fall, 2009 Description: The Leapster L Max Learning Game System Background: The Leapster L-Max Learning Game System from Leap Frog is one of the new additions to the Leap Frog Leapster Family. This Game System is an updated version of the original Leapster. This system is... Date Added: 2009-04-15 19:46:56 |
| Batch_Reactions.ppt Path: Auburn >> CHEN >> 4860 Fall, 2008 Description: Reactions Engineering Lab Part 1: Batch Reactions Setup Apparatus Detail Transmission Dip Probe Reactions Fast (indicator)Reaction: Ph + 2 OH- Ph2- (colorless to pink) Slow reaction we are studying: Ph2- + OH- Ph3- Pho = 2 x 10-5 ; OH- ... Date Added: 2009-01-09 18:23:36 |
| Final Paper Assignment Path: University of Iowa >> LIT >> 8G:001 Fall, 2007 Description: Interpretation of Literature Final Paper Assignment 12/14/07 Accomplished Women In The 18th Century In the novel Pride and Prejudice, art is very important in determining how accomplished a woman is. Art is the line that is drawn between the educate... Date Added: 2008-03-26 19:17:56 |
| ch10.ppt Path: Washington State >> MIS >> 322 Fall, 2008 Description: Chapter 10 Systems Implementation and Operation This lecture is based on materials in Essentials of Systems Analysis and Design by Valacich, George, and Hoffer and the summary slides available on their website. However, some material herein also repr... Date Added: 2009-02-18 13:51:05 |
| ch10.ppt Path: Martin Luther >> MIS >> 322 Fall, 2008 Description: Chapter 10 Systems Implementation and Operation This lecture is based on materials in Essentials of Systems Analysis and Design by Valacich, George, and Hoffer and the summary slides available on their website. However, some material herein also repr... Date Added: 2009-02-18 13:51:05 |
| prac1A Path: MIT >> 18 >> 18.02 Fall, 2008 Description: 18.02 Practice Exam 1 A z Problem 1. (15 points) A unit cube lies in the first octant, with a vertex at the origin (see figure). - - - - O a) Express the vectors OQ (a diagonal of the cube) and OR (joining O to the center of a face) in terms of... Date Added: 2008-04-18 07:49:00 |
| 460.pdf Path: University of Louisiana at Lafayette >> CMPS >> 460 Spring, 2008 Description: COURSE DESCRIPTION DEPARTMENT NUMBER Course Title AND COURSE CMPS 460 Course Coordinator Jim Etheredge Total Credits Introduction to relational database design and implementation http:/www.ucs.louisiana.edu/~jne1390/cs460/cs460.html 3 URL Sem... Date Added: 2009-02-02 19:27:48 |
| The%20Long%20Reach%20of%20King%20Cotton%20New%20York%20Times%20August%205.doc Path: Wagner >> FILESTORE >> 2 Fall, 2009 Description: The Long Reach of King CottonNew York TimesAugust 5, 2003 If it weren\'t killing them, people in Burkina Faso might get a good laugh at America\'s unprofitable cotton-growing fetish. Burkinabe, after all, are known for their sense of humor. And what c... Date Added: 2009-04-15 19:48:46 |
| pracmid2.doc Path: UC Davis >> ECS >> 60 Fall, 2008 Description: ECS 60 Topics: ADTs, heaps, and graphs. Preparation for Midterm #2 1. (30 points) Programs Problem. This question will attempt to determine whether you wrote the code for programming assignment #3 and #4. There is no need for you to see sample ques... Date Added: 2009-01-10 01:30:49 |
| trendswsanswers Path: UNL >> CHEM >> 109 Spring, 2008 Description: Chem 109 Periodic Trends \"You\'ve been taken, but you don\'t know it yet\" N.W.O. - Ministry Atomic Size List the elements from smallest to largest: F Cl Br I Br, Cl, F, I as \"n\" increases, size increases In, Rb, Sn, List these elements from smalle... Date Added: 2008-04-12 14:06:40 |
| 1030Ch4.pdf Path: ETSU >> PHYS >> 1030 Fall, 2008 Description: Ch 4 Why things move Force external influence that causes a body to accelerate A force is an action that one object does to another. examples: Pulling on a rope produces a tension force. The mass of the earth pulls down on you, producing your we... Date Added: 2009-02-17 23:43:52 |
| hw4.pdf Path: UC Davis >> ARE >> 240a Winter, 2008 Description: MATH 240A HOMEWORK 4 SOLUTIONS Exercise 4. a) The idea is simple: if U is (strongly) convex, and p U , we dene a contraction map c : U [0, 1] U by (q, t) q,p (t), where q,p is the (unique) geodesic passing through q at t = 0 and p at t = 1. This... Date Added: 2009-01-09 19:33:38 |
| frenchmatrix1.pdf Path: Oakland University >> FRH >> 215 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 115 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 371 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 457 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 301 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 355 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 114 Winter, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 214 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 381 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 314 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 370 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 115 Winter, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 215 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 408 Winter, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 316 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 380 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 214 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 314 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> EED >> 310 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:44:09 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 420 Winter, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 318 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 408 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 215 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 316 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> EED >> 455 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:44:09 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 457 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 355 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 420 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| frenchmatrix1.pdf Path: Oakland University >> GRM >> 300 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:37 |
| frenchmatrix1.pdf Path: Oakland University >> SPN >> 318 Fall, 2008 Description: Content Guidelines/Standards Matrix College/University Oakland University Michigan State Board of Education, 2001 Code Program/Subject Area French FA Source of Guidelines/Standards DIRECTIONS: List required courses on matrix and provide additiona... Date Added: 2009-01-09 05:47:38 |
| regressf.xls Path: Maryland >> ENCH >> 250 Fall, 2008 Description: Sheet1 Find an equation that fits through the data points. Instructor: Nam Sun Wang Raw Data: Engine Speed NOx Conc. (X1000 rpm) 0.05 0.20 1.60 1.80 2.00 2.50 (ppm) 50 47 30 32 34 39 x 0.05 0.20 1.60 1.80 2.00 2.50 x 0.003 0.040 2.560 3.240 4.000 6.2... Date Added: 2009-02-06 19:06:18 |
| February 1 Path: UF >> CLA >> 2120 Spring, 2008 Description: February 1, 2008 Rome, Theater of Pompey Differences from the Greeks o Semi-circular orchestra o Permanent stage backdrop (stage building) o Velarium (awning over acting area and seats) Theater of Marcellus oldest preserved theater in Rome o Also fr... Date Added: 2008-04-11 19:23:00 |
| DSC00544 Path: UC Riverside >> ECON >> 003 Spring, 2008 Description: ... Date Added: 2008-04-13 17:41:44 |
| Chapter 1 Slides Path: SUNY Stony Brook >> ESE >> 124 Spring, 2008 Description: Engineering Problem Solving with C Chapter 1 Introduction 1 Chapter 1 Computing Systems: Hardware and Software Computer Device capable of performing computations and making logical decisions Computers process data under the control of sets of in... Date Added: 2008-09-26 01:12:10 |
| z2365.pdf Path: N.C. State >> ARE >> 412 Fall, 2008 Description: ... Date Added: 2009-01-09 04:42:39 |
| z2365.pdf Path: N.C. State >> ANT >> 512 Fall, 2008 Description: ... Date Added: 2009-01-09 04:42:39 |
| Sum08-Glencoe-gr8.pdf Path: Wisconsin Milwaukee >> YR >> 5 Fall, 2009 Description: Milwaukee Public Schools Summer Suggested Curriculum Guide for Glencoe Time Lesson/Activity MathScape, Looking Behind the Numbers 1 Day 2 Days 2 Days 2 Days Lesson 9 On Tour (p. 26-27) Lesson 10 Lunch Specials (p. 28-29) Lesson 11 The Battle of the B... Date Added: 2009-04-16 00:39:22 |
| Sum08-Glencoe-gr8.pdf Path: Wisconsin Milwaukee >> YR >> 4 Fall, 2009 Description: Milwaukee Public Schools Summer Suggested Curriculum Guide for Glencoe Time Lesson/Activity MathScape, Looking Behind the Numbers 1 Day 2 Days 2 Days 2 Days Lesson 9 On Tour (p. 26-27) Lesson 10 Lunch Specials (p. 28-29) Lesson 11 The Battle of the B... Date Added: 2009-04-16 00:39:22 |
| chp5.pdf Path: Texas >> CE >> 5 Fall, 2008 Description: Chapter 5 Results and Discussion 5.1 RAINFALL/RUNOFF AND RAINFALL/FLOW CORRELATION Newell, et al. (1992) stated that the development of a rainfall/runoff relationship in the Houston area was difficult due to the watersheds high amount of urbanizat... Date Added: 2009-02-17 18:16:44 |
| chp5.pdf Path: Caribbean >> CE >> 5 Fall, 2008 Description: Chapter 5 Results and Discussion 5.1 RAINFALL/RUNOFF AND RAINFALL/FLOW CORRELATION Newell, et al. (1992) stated that the development of a rainfall/runoff relationship in the Houston area was difficult due to the watersheds high amount of urbanizat... Date Added: 2009-02-17 18:16:44 |
| Ind. 2008 Chap. 11 Path: University of Phoenix >> ACCT >> 45089 Spring, 2008 Description: Chapter I:11 Accounting Periods and Methods Discussion Questions I:11-1 I:11-2 I:11-3 I:11-4 I:11-5 I:11-6 I:11-7 I:11-8 I:11-9 I:11-10 I:11-11 I:11-12 I:11-13 I:11-14 I:11-15 I:11-16 I:11-17 I:11-18 I:11-19 I:11-20 I:11-21 I:11-22... Date Added: 2008-11-18 01:22:54 |
| 276.pdf Path: University of Illinois, Urbana Champaign >> MUS >> 276 Fall, 2008 Description: Course Schedule - Summer 2008 Music 276 Summer Band credit: 1 hours. Maintains the instrumentation of the standard band for the study and performance of all types of band literature. Open to all students who have been accepted by audition, with assig... Date Added: 2009-02-02 18:21:08 |
| ma430_hwk_18_27.pdf Path: N.C. State >> MA >> 430 Fall, 2008 Description: ... Date Added: 2009-01-09 04:44:25 |
| ma430_hwk_18_27.pdf Path: N.C. State >> MA >> 241 Fall, 2008 Description: ... Date Added: 2009-01-11 16:58:48 |
| sentence.PPT Path: Glendale Community College >> ENG >> 071 Fall, 2008 Description: Sentence Clarity and Combining A workshop brought to you by The Purdue University Writing Lab Purdue University Writing Lab Sentence Clarity Why do we need to be concerned with sentence clarity? To communicate effectively to the reader To make w... Date Added: 2009-01-10 17:06:30 |
| sentence.PPT Path: Glendale Community College >> ENG >> 100aa Fall, 2008 Description: Sentence Clarity and Combining A workshop brought to you by The Purdue University Writing Lab Purdue University Writing Lab Sentence Clarity Why do we need to be concerned with sentence clarity? To communicate effectively to the reader To make w... Date Added: 2009-01-10 17:06:30 |
| sentence.PPT Path: Glendale Community College >> ENG >> 200 Fall, 2008 Description: Sentence Clarity and Combining A workshop brought to you by The Purdue University Writing Lab Purdue University Writing Lab Sentence Clarity Why do we need to be concerned with sentence clarity? To communicate effectively to the reader To make w... Date Added: 2009-01-10 17:06:30 |
| Golds Glitter Path: Arizona >> SOC >> 315 Spring, 2008 Description: FOREIGN DESK Behind Gold\'s Glitter: Torn Lands and Pointed Questions By JANE PERLEZAND KIRK JOHNSON; SOMINI SENGUPTA CONTRIBUTED REPORTING FROM NEW DELHI FOR THIS ARTICLE. (NYT) 5745 words Published: October 24, 2005 In the early 1500\'s, King Ferdi... Date Added: 2008-08-19 00:31:12 |
| 25.academiclanguage.doc Path: UCSB >> THTR >> 25 Winter, 2008 Description: CharlesBazermanandJosephLittle UniversityofCaliforniaSantaBarbara ProfessorGunnarssonispartofaninternationalclusteroflanguageresearchers examiningthewritingpracticesinacademicdisciplines.Theirinquiryisinpartdrivenby curiosityaboutthewaylanguageworks... Date Added: 2009-02-02 17:41:29 |
| 252grass3-071.doc Path: Chester >> ECO >> 252 Fall, 2008 Description: 252grass3-071 3/08/07 (Open this document in \'Page Layout\' view!) Name: Class days and time: Please include this on what you hand in! Graded Assignment 3 Part 1. In your outline there are 6 methods to compare means or medians, methods D1, D2, D3, D4... Date Added: 2009-02-11 17:17:22 |
| Memorandum_writing_assignment.pdf Path: Mich Tech >> UN >> 2002 Fall, 2008 Description: The Memorandum by Vaclav Havel World Cultures Writing Assignment Directions: 1. Attend a showing of the play. Stay for both acts. 2. Read the script. It is available on electronic reserve through the library. 3. Select a question below and write a 3-... Date Added: 2009-01-11 16:43:18 |
| asee.w-mary-russell.pdf Path: Penn State >> M E >> 561 Spring, 2008 Description: Session 2525 Integrating Design Research into the Classroom: An Experiment in Two Graduate Courses Mary Frecker, Timothy W. Simpson, Joseph H. Goldberg, Russell R. Barton, Britt Holewinski, and Gary Stump The Pennsylvania State University Abstract ... Date Added: 2009-01-09 09:39:38 |
| asee.w-mary-russell.pdf Path: Penn State >> M E >> 101s Fall, 2008 Description: Session 2525 Integrating Design Research into the Classroom: An Experiment in Two Graduate Courses Mary Frecker, Timothy W. Simpson, Joseph H. Goldberg, Russell R. Barton, Britt Holewinski, and Gary Stump The Pennsylvania State University Abstract ... Date Added: 2009-01-09 09:39:38 |
| asee.w-mary-russell.pdf Path: Penn State >> M E >> 480 Fall, 2008 Description: Session 2525 Integrating Design Research into the Classroom: An Experiment in Two Graduate Courses Mary Frecker, Timothy W. Simpson, Joseph H. Goldberg, Russell R. Barton, Britt Holewinski, and Gary Stump The Pennsylvania State University Abstract ... Date Added: 2009-01-09 09:39:38 |
| The Communist Specter (11-8) Path: Texas A&M >> HIST >> 106 Fall, 2006 Description: 1. The Red Scare 2. Fuel for the Fire 3. McCarthyism Two Superpowers: US and USSR Some evidence that the USSR was sending spies to the US Russia was stealing military secrets Cold War created fear of communism at home Repubs see political advantages ... Date Added: 2008-03-31 10:31:51 |
| The Communist Specter (11-8) Path: Texas A&M >> HIST >> 106 Fall, 2008 Description: 1. The Red Scare 2. Fuel for the Fire 3. McCarthyism Two Superpowers: US and USSR Some evidence that the USSR was sending spies to the US Russia was stealing military secrets Cold War created fear of communism at home Repubs see political advantages ... Date Added: 2008-04-08 10:04:32 |
| Chapter6B.pdf Path: Virginia Tech >> LIB >> 2598 Fall, 2008 Description: 6.9 Sample Case 8 Normal mode C-A, - fault on Line 512 Hidden failure: Line 504 PCB scheme low set fault detector picked up This case illustrates the security of the line. With the low set fault detector of the PCB scheme picked up, the scheme operat... Date Added: 2009-02-18 01:26:11 |
| Marshall_2005.pdf Path: Washington >> N SCI >> 301 Fall, 2008 Description: NEWS FEATURE NATURE|Vol 437|15 September 2005 J. MARSHALL Megacity, mega mess The creaking infrastructure of Indonesias capital is overwhelmed by people, vehicles and pollution. As urbanization gathers pace across the developing world, Jessica Mar... Date Added: 2009-02-02 20:33:15 |
| 190.pdf Path: University of Iowa >> 01J >> 190 Fall, 2008 Description: Am. J. Hum. Genet. 72:15361543, 2003 Report Association of Specic Language Impairment (SLI) to the Region of 7q31 Erin K. OBrien,1 Xuyang Zhang,2 Carla Nishimura,3 J. Bruce Tomblin,2,* and Jeffrey C. Murray3,* Departments of 1Otolaryngology, 2Speec... Date Added: 2009-02-02 18:54:02 |
| AAR91-02.pdf Path: Embry-Riddle FL/AZ >> AMELIA >> 91 Fall, 2008 Description: T PB91-910402 NTSB/AAR-9 l/O2 NATIONAL TRANSPORTATION SAFETY BOARD AIRCRAFIACCIDENT REPORT MARKAIR, INC. BOEING 737-2X6C, N670MA CONTROLLED FLIGHT INTO TERRAIN UNALAKLEET, ALASKA JUNE 2, 1990 5358A NTSB Report No.: NTIS No. : Report Date: Notatio... Date Added: 2009-02-06 19:57:50 |
| ps1.pdf Path: Syracuse >> PHY >> 200 Spring, 2008 Description: PHY212 - Solutions to Problems in Set #1 1 Problem 21.96 Divide the semicircle into innitesimal segments. Find the electric eld dE due to each segment and integrate over the semicircle to nd the total electric eld. The x components of the electric... Date Added: 2009-01-11 18:22:20 |
| Falk2006_Con BIO ECOL-GEOS 406r-506Rx6.pdf Path: Arizona >> ECOL >> 406r Fall, 2008 Description: Elements of talk Elements of restoration ecology Conservation Biology Fall 2006 ECOL/GEOS 406R/506R Don Falk Laboratory of Tree-Ring Research University of Arizona Why restore? Restoration ecology cf. Ecological Restoration Restoring ecological c... Date Added: 2009-02-02 16:27:14 |
| property.txt Path: Old Dominion >> CS >> 300 Fall, 2008 Description: Intellectual Property Chapter 5 What is Intellectual Property? ? Intangible creative work embodied in physical form ? comes from the creativity, ideas, research, skills, labor, and nonmaterial efforts provided by creators Property rights to physical ... Date Added: 2009-02-17 19:13:28 |
| 156.pdf Path: UC Davis >> ENT >> 156 Fall, 2008 Description: ... Date Added: 2009-02-02 17:12:22 |
| bonita.pdf Path: Arizona >> SGA >> 1 Fall, 2008 Description: Bonita Small Grain Advisory Jun 1, 2003 Crop Development Planted Feb 1 Early-maturing Barley Late-maturing Barley Early-maturing Durum Late-maturing Durum Bonita Projected to June 14 Calculated to May 31 Planted Mar 1 Early-maturing Barley Late-mat... Date Added: 2009-02-04 13:51:05 |
| bonita.pdf Path: Arizona >> SGA >> 2003 Fall, 2008 Description: Bonita Small Grain Advisory Jun 1, 2003 Crop Development Planted Feb 1 Early-maturing Barley Late-maturing Barley Early-maturing Durum Late-maturing Durum Bonita Projected to June 14 Calculated to May 31 Planted Mar 1 Early-maturing Barley Late-mat... Date Added: 2009-02-04 13:51:05 |
| 407n102008.pdf Path: Alabama >> ME >> 407 Fall, 2008 Description: ... Date Added: 2009-01-11 18:26:11 |
| Week4_Warren Path: UCLA >> HIST >> 3C Winter, 2008 Description: ... Date Added: 2008-08-20 18:46:30 |
| hw1-ans.pdf Path: UPenn >> CIS >> 550 Fall, 2009 Description: Fall, 2004 CIS 550 Database and Information Systems Solutions to Homework 1 The first two problems concern the Penn Ebay (PBAY) System, which is represented by the following schema: Sellers(sellerID:int, rating:char[2], email :string) Items(itemID:... Date Added: 2009-04-15 20:44:02 |
| fall.txt Path: Minnesota >> PH >> 6415 Fall, 2008 Description: 1 1 0 45 70 1 1 0 62 66 2 1 1 43 64 0 1 1 76 48 2 1 0 51 72 1 1 1 73 39 0 1 1 40 54 0 1 0 66 37 2 1 1 80 81 2 1 1 56 60 2 1 1 59 64 3 1 1 81 44 2 1 1 28 68 3 1 1 76 66 1 1 0 37 46 2 1 1 45 34 4 1 0 80 55 3 1 0 41 78 1 1 0 32 64 2 1 1 48 77 3 1 0 81 5... Date Added: 2009-02-17 21:05:25 |
| 04.pdf Path: Virginia Tech >> LIB >> 03052000 Fall, 2008 Description: The structure of ribonucleotide reductase complex The three-dimensional structure of the large subunit of Class I RNR in E. coli has been determined, and it serves as the model of RNR in E. coli and eukaryotes (Figure 5)(Nordlund et al. 1990; Nordlu... Date Added: 2009-02-18 01:11:16 |
| OB CH 16 outline Path: Cornell >> ILROB >> 1220 Fall, 2008 Description: Kristin Chen CH 16 OB Outline MANAGING ORGANIZATIONAL CHANGE: STRATEGIC PLANNING & ORGANIZATIONAL DEVELOPMENT 1. The Prevalence of Change in Organizations a. b. c. a. Organizational change = planned or unplanned transformations in an organization\'s ... Date Added: 2008-02-13 13:53:08 |
| pracf.pdf Path: San Diego State >> STAT >> 350a Fall, 2008 Description: Stat 350A Fall 2008 Dr. Fan Practice Final For questions 1-14, choose one correct answer from A, B, C, D and E; or choose between T (for True) and F (for False). (7 12 = 84 points) 1. The tail of the t(4) distribution is fatter than the tail of the... Date Added: 2009-01-09 07:01:26 |
| www.geo.cornell.edu-220_08Summary25 Path: Cornell >> EAS >> 2200 Spring, 2008 Description: EAS 220 The Earth System The Greenhouse Effect Spring 2008 Lecture 25 Lecture 25: Global Climate Change I CO2 and CH4 absorb outgoing long wavelength radiation. The effect is to warm the planet. Do we have evidence of this? Earth is 32 C warmer tha... Date Added: 2008-07-09 23:49:55 |
| Fall 2007 - Newhouse\'s Class - Exam 1 Path: UCSD >> ECON >> 171 Fall, 2007 Description: Economics 171: Decisions Under Uncertainty Midterm 1 Solutions 1. (12 pts) Imagine that you\'re preparing for an Economics exam next week. The exam will either be straight-forward or challenging. If you don\'t study you\'ll receive a D if the exam is s... Date Added: 2008-04-23 12:13:59 |
| Econ171-Fall2007-Midterm1-sols.pdf Path: UCSD >> ECON >> 171 Fall, 2008 Description: Economics 171: Decisions Under Uncertainty Midterm 1 Solutions 1. (12 pts) Imagine that you\'re preparing for an Economics exam next week. The exam will either be straight-forward or challenging. If you don\'t study you\'ll receive a D if the exam is s... Date Added: 2009-01-11 21:38:40 |
| Econ171-Fall2007-Midterm1-sols.pdf Path: UCSD >> ECON >> 235c Spring, 2008 Description: Economics 171: Decisions Under Uncertainty Midterm 1 Solutions 1. (12 pts) Imagine that you\'re preparing for an Economics exam next week. The exam will either be straight-forward or challenging. If you don\'t study you\'ll receive a D if the exam is s... Date Added: 2009-01-11 21:38:40 |
| Econ171-Fall2007-Midterm1-sols.pdf Path: UCSD >> ECON >> 171 Fall, 2008 Description: Economics 171: Decisions Under Uncertainty Midterm 1 Solutions 1. (12 pts) Imagine that you\'re preparing for an Economics exam next week. The exam will either be straight-forward or challenging. If you don\'t study you\'ll receive a D if the exam is s... Date Added: 2009-02-06 18:43:33 |
| memocritique.doc Path: Caribbean >> ME >> 333 Fall, 2008 Description: ME 333T Memo Critique Writer _ Critiquer _ After you have read your partners memo and marked grammatical and mechanical problems on the page, please respond to questions listed below. When you and your partner have finished writing your critiques, sp... Date Added: 2009-03-19 00:24:58 |
| Chapter 5 Path: Lehigh >> ACCT >> 151 Spring, 2008 Description: CHAPTER 5 5-1 No. All public companies report it because the statement of cash flows is a required statement with a required format. A cash flow statement shows the sources of changes in cash balances and: a) b) c) aids in predicting future cash flow... Date Added: 2008-05-20 05:03:58 |
| G4_2.pdf Path: Minnesota >> G >> 4 Fall, 2001 Description: 4.5. Recreation and tourism 4.5.1. Supply and demand 4.5.1.1. Roads Table 4.17. shows the total mileage of roads in Minnesota from 19891999. The following route systems are included in the mileage total: interstate trunk, U.S. trunk, Minnesota trunk,... Date Added: 2009-02-17 21:01:01 |
| hw6-3413-f06.pdf Path: Oklahoma >> MATH >> 3413 Fall, 2008 Description: MATH 3413 Homework 6 Due Thu, Oct 12 Sec. 7.1: problems 3, 8, 12, 14, 19, 20, 25, 28, 38 (after you nd the solution of this problem for general a and b, nd it for a = 1, b = 2 and compare with your result in problem 7.1/8). Sec. 7.2: problems 2, 5... Date Added: 2009-02-02 20:02:10 |
| technicolor surpise.doc Path: Illinois State >> KNR >> 171 Spring, 2008 Description: Title: # of players: Ages: Equipment: How to play: Technicolor Surprise Unlimited depending on how much supplies the instructor has 6-12 Piece of paper, colored markers, black crayon, a coin or something to scrape with The children will take their p... Date Added: 2009-01-12 03:20:45 |
| Premchaud_LuXun Path: VCCS >> ENG >> 252 Fall, 2007 Description: Name Status Score Questions on Premchand/Lu Xun Completed 25 out of 25 points Instructions Answer each question in one or more well thought out paragraphs (Blackboard doesn\'t show paragraphs, unfortunately, which is not a big concern, but you can w... Date Added: 2008-05-27 20:00:07 |
| hausdorff-learn.pdf Path: Cornell >> CS >> 664 Spring, 2008 Description: Learning Models for Object Recognition Pedro F. Felzenszwalb Articial Intelligence Laboratory Massachusetts Institute of Technology Cambridge, MA 02139 p@ai.mit.edu Abstract We consider learning models for object recognition from examples. Our method... Date Added: 2009-01-11 20:39:24 |
| rp2004-024.pdf Path: DeAnza College >> INTL >> 024 Winter, 2008 Description: Research Paper No. 2004/24 Income-based Measures of Average Well-being Steve Dowrick* March 2004 Abstract Internation comparisons of average national incomes omit important information about leisure, home production, health, etc. They are also bedevi... Date Added: 2009-02-02 14:00:59 |
| Ioannis.pdf Path: Washington State >> T >> 1 Fall, 2008 Description: ... Date Added: 2009-02-18 13:47:32 |
| Ioannis.pdf Path: Martin Luther >> T >> 1 Fall, 2008 Description: ... Date Added: 2009-02-18 13:47:32 |
| syllabus.pdf Path: Iowa State >> ECON >> 496 Spring, 2008 Description: Agricultural Production, Business, and Trade in Spain and France ECON 496 Course Syllabus: Spring 2003 Instructors: Dr. Ebby Luvaga 174A Heady Hall Phone: 294-5765 Email: luvaga@iastate.edu Eduarda Becerra Global Ag Programs 104 Curtiss Phone: 294-39... Date Added: 2009-01-09 02:10:35 |
| What Is The Nature of Florigen Path: Maryland >> PLSC >> 400 Spring, 2008 Description: Florigen and Flower Stimulus By: Matthew Flack A long running question in the field of Plant Biology is the chemical nature of flowering. Many theories have come forth over the years, but the most promising is the discovery of the Florigen and more r... Date Added: 2008-05-14 18:07:49 |
| 390.pdf Path: University of Illinois, Urbana Champaign >> LA >> 390 Fall, 2008 Description: ... Date Added: 2009-02-02 18:09:59 |
| FacSym07.pdf Path: Smith >> SCIENCE >> 07 Fall, 2008 Description: the Annual Five-College Geology Faculty Symposium THURS D AY, SEPTEMBER 27TH AT 4:30 pm CLEVEL AND L1 (Mount Ho lyok e College) Rec ep tion to follow in t he k endade atrium Proudly hosted by the Department of Geology and Geography Mount Holyoke Co... Date Added: 2009-02-06 20:21:06 |
| Chapter 17 Terms Path: USC >> BUAD >> 304 Spring, 2008 Description: Chapter 17 -Organizational Culture: A system of shared meaning held by members that distinguishes the organization from other organizations 1. Innovation and Risk Taking: The degree to which employees are encouraged to be innovative and take risks. 2... Date Added: 2008-04-14 18:39:28 |
| quiz2.pdf Path: Clarkson >> ES >> 340 Fall, 2009 Description: Thennodynamics Name: (ES 340) Quiz 2 June 1, 2005 (1 Hour) Problem 1 (8 points): A piston/cylinder arrangement has the piston loaded with outside atmospheric pressure and the piston mass to a pressure of 150 kPa, shown here. It contains water at ... Date Added: 2009-04-15 22:05:27 |
| 98.aips.sched.pdf Path: Cornell >> VIVO >> 23530 Fall, 2008 Description: X uw$8 uX $ (C$ S u7 s\'a w B $ $(u\' $2$@A29@98) u|\' $%ruH|6$ H uu43 21u s u2u v u\' (u#\" t!u ( v& $ 5 H 0 q g xf k o ot pjopttjp}t pqw2wt k q g x k l } k q d pi tx jt tsnd tfk wf $g o pjopttof j ttgu epqi e jt upqke e... Date Added: 2009-02-17 22:03:42 |
| finalexampractice.pdf Path: HWS >> PHYSICS >> 150 Fall, 2009 Description: Physics 150 Practice Final Exam Problem I II III IV V VI VII VIII Points 25 25 25 25 25 25 25 25 Topic Quick Questions I Quick Questions II Dynamics Work-Energy Momentum Periodic Motion Fluids Waves & Sound Score TOTAL You may have two sheets ... Date Added: 2009-04-15 21:37:25 |
| S-2005-2006.doc Path: LSU >> ANTH >> 2423 Fall, 2008 Description: Faculty Senate Student Aid & Scholarships Committee 2005-06 Members: David Kurpius (chair), Alan Rutherford, John Anderson, Bhaba Sarker, Sukhamay Kundu, Lois Kuyper-Rushing, Fakhri Al-Bagdadi The committee only met once this year for an appeals hear... Date Added: 2009-01-11 16:30:08 |
| 030505politics.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Prague Business Journal - Article Last updated: 7th May 2003, 8:44 Banking Politics Industry Telecom Communications Real Estate Law & Order Social Services Business Life This week\'s PBJ Enter keyword(s): Advanc... Date Added: 2009-02-11 19:51:09 |
| BedSt2_30 Path: USF >> EGN >> 3311 Fall, 2008 Description: Problem 2.30 (a) Express the position vector from point A of the front-end loader to point B in terms of components. (b) Express the position vector from point B to point C in terms of components. 55 in. y 98 in. 45 in. C A 35 in. B 50 in. x 50 in. ... Date Added: 2008-04-19 13:30:41 |
| BedSt2_30 Path: USF >> EGN >> 3311 Spring, 2008 Description: Problem 2.30 (a) Express the position vector from point A of the front-end loader to point B in terms of components. (b) Express the position vector from point B to point C in terms of components. 55 in. y 98 in. 45 in. C A 35 in. B 50 in. x 50 in. ... Date Added: 2008-04-08 19:13:55 |
| BedSt2_30 Path: SUNY Buffalo >> EAS >> 207 Spring, 2008 Description: Problem 2.30 (a) Express the position vector from point A of the front-end loader to point B in terms of components. (b) Express the position vector from point B to point C in terms of components. 55 in. y 98 in. 45 in. C A 35 in. B 50 in. x 50 in. ... Date Added: 2008-04-09 18:16:16 |
| BedSt2_30 Path: Washington >> A A >> 210 Spring, 2008 Description: Problem 2.30 (a) Express the position vector from point A of the front-end loader to point B in terms of components. (b) Express the position vector from point B to point C in terms of components. 55 in. y 98 in. 45 in. C A 35 in. B 50 in. x 50 in. ... Date Added: 2008-04-16 18:27:18 |
| he_2339.pdf Path: Caltech >> ME >> 071 Spring, 2008 Description: ... Date Added: 2009-01-09 07:40:04 |
| March11 Path: Virginia Tech >> ART >> 2386 Spring, 2008 Description: March 11, 2008 Romanticism is about an individual response. This Painting is neo-baroque- dramatic lighting, diagonals, needs an audience, the instability with the raft, political undertones, Caravaggio- chiaroscuro, idealized figures although they h... Date Added: 2008-04-08 09:26:26 |
| c1s1.ps Path: ETSU >> MATH >> 1710 Fall, 2008 Description: 1.1 Rectangular Coordinates 1 Chapter 1. Graphs 1.1. Rectangular Coordinates Note. In preparation for this section, you may need to review Sections A.1 and A.2. Note. Recall that the real number line is represented by a line on which each point is ... Date Added: 2009-02-17 23:44:04 |
| lec6-c Path: Arizona >> ECE >> 175 Fall, 2007 Description: ECE 175 Program Design How to analyze your problem to elementary tasks How to write pseudocode How to declare, access and write arrays Declare Initialize Access via a for loop Use array elements as variables ECE 175, Fall 2007 4/6/2008 ... Date Added: 2008-04-06 11:20:52 |
| HW__5_P213_S08 Path: Cornell >> PHYS >> 2213 Spring, 2007 Description: Physics 213 Homework #5 Spring 2008 * This assignment will be covered on Prelim Exam #1. * Read: Chapter 23, all; Chapter 26, sections 26.2 and 26.5 Chap. 23: Q\'s #Q23.2, 4, 5, 6, 7, 8, 9, 10, 11, 15, 16, 17, 19, 20, 21 E\'s & P\'s: #23.3, 5, 13, 19... Date Added: 2008-09-09 11:28:52 |
| 590.pdf Path: University of Illinois, Urbana Champaign >> ACCY >> 590 Spring, 2008 Description: Course Schedule - Spring 2005 Accountancy 590 Adv Prof Internship in ACCY Credit: 0 to 4 hours. (ACCY 490) A formalized learning experience in combination with practice of accounting while engaged in an internship with a public accounting firm, busin... Date Added: 2009-02-02 18:00:32 |
| CHI05LBRTomlinson.pdf Path: UC Irvine >> ICS >> 05 Fall, 2008 Description: Multiple Virtual Rafts: A Multi-User Paradigm for Interacting with Communities of Autonomous Characters 1 Bill Tomlinson1, Jesse Gray2 and Man Lok Yau1 2 Arts Computation Engineering program Robotic Life Group University of California, Irvine MIT Me... Date Added: 2009-02-06 18:57:30 |
| Fairchildl-CD4007.pdf Path: UF >> EEL >> 6323 Spring, 2008 Description: CD4007C Dual Complementary Pair Plus Inverter October 1987 Revised January 1999 CD4007C Dual Complementary Pair Plus Inverter General Description The CD4007C consists of three complementary pairs of Nand P-channel enhancement mode MOS transistors s... Date Added: 2009-01-12 06:16:34 |
| 322 sp08 6 ecol lit w plants.pdf Path: Washington >> ENGR >> 322 Fall, 2008 Description: LARC 322 INTR OD UCTI O N TO PLA NTI NG D ESI GN Iain M Robertson LECT URE N OT ES: EC OLO GIC AL L ITER ACY : TH E PLANT CH APT ER being the most compelling, diverse, all-pervasive, engaging, and informative chapter in the entire oeuvre of ecologica... Date Added: 2009-02-02 20:36:55 |
| ideology.pdf Path: UCLA >> ANDERSON >> 14567 Fall, 2008 Description: Program in Law and Public Affairs Princeton University Strategic Plaintiffs and Ideological Judges in Telecommunications Litigation John M. de Figueiredo Princeton University, Program in Law and Public Affairs Princeton Law and Public Affairs Wor... Date Added: 2009-02-11 22:05:18 |
| disordersnewborn.pdf Path: South Plains College >> SPCH >> 1321 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> HUDV >> 1100 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> GOVT >> 2301 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> HUMA >> 2319 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> GOVT >> 2302 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> PSYC >> 2319 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> VNSG >> 1122 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> RSPT >> 1429 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> HITT >> 1305 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| disordersnewborn.pdf Path: South Plains College >> SOCI >> 2320 Fall, 2008 Description: HYDROCEPHALUS Increased cerebrospinal fluid in the ventricles of the brain which causes increase in head size and pressure change in brain S/S rapid growth in head circumference, bulging anterior fontanel, suture separation, shrill hipitched cry, s... Date Added: 2009-01-11 18:17:43 |
| MCM.ppt Path: Duke >> FINANCE >> 453 Fall, 2008 Description: Earnings Surprises and Signal Analysis M idas matt mcConnell David Nabwangu Eskil Sylwan Johnson Yeh M Agenda Background Hypothesis Methodology Data Fitting Explanatory Variables Regression Results Conclusion M 1.3 1.25 1.2 We expect stoc... Date Added: 2009-01-10 18:13:07 |
| Soln12030 Path: UCF >> EGN >> 3321 Spring, 2008 Description: COSMOS: Complete Online Solutions Manual Organization System Chapter 12, Solution 30. Let yA, yB, and yC be the position coordinates of blocks A, B, and C respectively measured downward from the upper support. Then the corresponding velocities and a... Date Added: 2008-05-07 01:29:01 |
| 041108ElQ.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: The New York Times > Washington > Evolving Nature of Al Qaeda Is Misunderstood, Critic Says November 8, 2004 Evolving Nature of Al Qaeda Is Misunderstood, Critic Says By JAMES RISEN ASHINGTON, Nov. 7 - The Bush administration has failed to recognize... Date Added: 2009-02-11 18:07:24 |
| BiofuelsRepublicBrazil.pdf Path: Rutgers >> 508 >> 364 Fall, 2008 Description: Institute of Science in Society 18December 2006 French Version Biofuels Republic Brazil Brazils rapidly expanding biofuels industry pose serious threats to the survival of people and planet. Dr. Mae-Wan Ho A fully referenced version of this article ... Date Added: 2009-01-11 18:00:50 |
| BiofuelsRepublicBrazil.pdf Path: Rutgers >> 180 >> 364 Spring, 2008 Description: Institute of Science in Society 18December 2006 French Version Biofuels Republic Brazil Brazils rapidly expanding biofuels industry pose serious threats to the survival of people and planet. Dr. Mae-Wan Ho A fully referenced version of this article ... Date Added: 2009-01-11 18:00:50 |
| BiofuelsRepublicBrazil.pdf Path: Rutgers >> 510 >> 631 Spring, 2008 Description: Institute of Science in Society 18December 2006 French Version Biofuels Republic Brazil Brazils rapidly expanding biofuels industry pose serious threats to the survival of people and planet. Dr. Mae-Wan Ho A fully referenced version of this article ... Date Added: 2009-01-12 04:45:22 |
| BiofuelsRepublicBrazil.pdf Path: Rutgers >> 510 >> 637 Fall, 2008 Description: Institute of Science in Society 18December 2006 French Version Biofuels Republic Brazil Brazils rapidly expanding biofuels industry pose serious threats to the survival of people and planet. Dr. Mae-Wan Ho A fully referenced version of this article ... Date Added: 2009-01-12 04:45:22 |
| 061006cola.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Cola Wars in Mexico - In These Times Skip navigation. Support the independent news that you need. Make a tax-deductible donation to In These Times today! donate newsletter store members radio blog links Features > October 6, 200... Date Added: 2009-02-11 17:45:30 |
| 061006cola.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Cola Wars in Mexico - In These Times Skip navigation. Support the independent news that you need. Make a tax-deductible donation to In These Times today! donate newsletter store members radio blog links Features > October 6, 200... Date Added: 2009-02-11 18:28:20 |
| 1057.pdf Path: University of Illinois, Urbana Champaign >> LA >> 314 Fall, 2008 Description: Radial segregation patterns in rotating granular mixtures: Waviness selection K. M. Hill, G. Gioia, and D. Amaravadi Department of Theoretical and Applied Mechanics, University of Illinois, Urbana, IL 61801 (Dated: December 13, 2004) Abstract We mod... Date Added: 2009-02-02 18:09:46 |
| L11-RiskSafetyLiability Path: Texas A&M >> PHIL >> 482 Fall, 2002 Description: Risk, Safety and Liability ENGR 482 Ethics and Engineering Required reading: o Harris, Pritchard and Rabins, Engineering Ethics: Concepts and Cases, 2nd ed. Chapter 7, \"Risk, Safety and Liability in Engineering\" An Engineering Responsibility o Cod... Date Added: 2008-03-26 23:19:30 |
| ApprovedMinutes-2002-06-07.doc Path: Alaska Pacific >> X >> 9051 Fall, 2008 Description: STAFF ADVISORY COUNCIL REVISED MINUTES June 7, 2002 In Attendance: Theresa DiMaggio, Lesley Hipolito, Jennifer Sexton, Shary Trent, Wendy Cornwall, Wendy Pryschuk, Katrina Jaggears, Tania Walden, Sara Kleinert, Jo Thompson, Kitty Gilbert, Ginger Huds... Date Added: 2009-02-18 13:56:42 |
| ApprovedMinutes-2002-06-07.doc Path: Alaska Pacific >> CMSPROD >> 9051 Fall, 2008 Description: STAFF ADVISORY COUNCIL REVISED MINUTES June 7, 2002 In Attendance: Theresa DiMaggio, Lesley Hipolito, Jennifer Sexton, Shary Trent, Wendy Cornwall, Wendy Pryschuk, Katrina Jaggears, Tania Walden, Sara Kleinert, Jo Thompson, Kitty Gilbert, Ginger Huds... Date Added: 2009-02-18 14:00:12 |
| license_en-US Path: Webster >> COMP >> 1100 Spring, 2008 Description: This product is made available subject to the terms of GNU Lesser General Public License Version 2.1. A copy of the LGPL license can be found at http:/www.openoffice.org/license.html -Third Party Code. Additional copyright notices and license terms a... Date Added: 2008-04-08 18:06:48 |
| HW-10-17-08s-Ch19 Path: Lehigh >> IE >> 215 Spring, 2008 Description: IE 215 Solutions for Problems due Oct 17, 2008 (Ch 19) 19.15 A cylindrical workpart with D = 2.5 in and h = 2.5 in is upset forged in an open die to a height = 1.5 in. Coefficient of friction at the die-work interface = 0.10. The work material has a ... Date Added: 2008-10-21 09:44:06 |
| 02acknowledgement.pdf Path: Virginia Tech >> LIB >> 05062002 Fall, 2008 Description: ACKNOWLEDGEMENT Graduate research assistantship was provided by a grant from the National Corporation Service through the Service-Learning Center and the Virginia Water Resources Research Center at Virginia Tech. I would like to thank: My co-chairs, ... Date Added: 2009-03-19 00:07:40 |
| lecture_15_genetic_eng Path: Michigan State University >> IAH >> 206 Spring, 2008 Description: Genetic Engineering Matt Ferkany IAH 206 A Question Are there gene technologies we should forbid or limit the use of? Some background to the question Social: eugenics Scientific/medical Ethical considerations Scientific background Gregor M... Date Added: 2008-03-30 15:34:36 |
| HRUG_DOFv9.pdf Path: Princeton >> PS >> 9 Fall, 2008 Description: PeopleSoft: Human Resources HR Updates User Guide DOF Updated: 8/2008 for PeopleSoft 9.0 Copyright 2008 by the Trustees of Princeton University Created by the Training & Documentation group of OIT Information Systems, in partnership with the Peo... Date Added: 2009-02-11 21:04:50 |
| Copy of Fall 2008 Section B -- Nov 12 -- posted.xls Path: Iowa State >> MKT >> 444 Fall, 2008 Description: UNIV ID 313806493 28712684 986094109 195290095 888279392 86241155 817767951 923962039 802427626 362279918 982997015 969213245 920339420 992806815 140427287 617213597 285676391 522184663 617953336 449330882 984690707 45386341 792215424 187259072 73475... Date Added: 2009-01-10 17:10:06 |
| Lecture_Thirty___Prophets_and_Prophetism Path: Gordon MA >> OT >> Bi104 Fall, 2007 Description: Lecture 30: Prophets and Prophetism I. pray for sara hunt-had liver cancer Introduction A. Review and preview the people that have been called by God. The children of Abraham, called and set apart for his plans. They have the Torah as the statemen... Date Added: 2008-04-16 06:43:44 |
| PPCh09.ppt Path: Trinity Valley Community College >> IMED >> 1316 Fall, 2008 Description: Chapter 9 Purchasing and Financing a Home Copyright 2004 Pearson Education, Inc. All rights reserved. Chapter Objectives Explain how to select a home to purchase Explain how to conduct a valuation of a home Describe the transaction costs of purc... Date Added: 2009-01-09 15:39:16 |
| 222-45.pdf Path: Duke >> LAW >> 222 Fall, 2008 Description: Clinical Ethics 222.01 Fall 2005 Allison Rice Thursdays, 1:20 - 2:50 Room 4060 Course Overview: This course is designed to provide an overview of issues of professional ethics for students in Duke\'s live-client clinics. In combination with one of Duk... Date Added: 2009-02-02 14:07:33 |
| Atm_Optics.pdf Path: Hawaii >> A >> 281 Fall, 2008 Description: Atmospheric Optics Karen J. Meech, Astronomer Institute for Astronomy Electromagnetic Radiation Characterized by , f, c Speed c = 3x105 km/s in vacuum Velocity not constant in other media Because of charge separation slowing Index of refraction: n ... Date Added: 2009-02-17 19:23:38 |
| pdf_KM12.pdf Path: UCLA >> ANDERSON >> 985 Fall, 2008 Description: A Decision Analysis Tool for Evaluating Fundraising Tiers Kevin F. McCardle, Kumar Rajaram Christopher S. Tang1 UCLA Anderson School of Management 110 Westwood Plaza Los Angeles, CA 90095 August 14, 2008 Abstract This paper presents a utility functi... Date Added: 2009-02-11 21:58:36 |
| Lab6.pdf Path: Minnesota >> ECE >> 2006 Fall, 2008 Description: ECE 2006 University of Minnesota Duluth Lab 6 ASTABLE MULTIVIBRATOR INTRODUCTION The student will analyze and construct an astable multivibrator. The circuit will be simulated using nominal component values selected by the student to provide for s... Date Added: 2009-02-17 21:15:42 |
| Women in the Modern Period.ppt Path: UF >> AMH >> 4317 Fall, 2008 Description: Women in the Modern Period Economy (19th) A-39 Rural/agricultural Industrial/textile Private household Economy (20th) A-39 decline in agricultural Industrial/service Decline in private Politics Voluntary associations Politics suffrage ... Date Added: 2009-01-10 03:38:02 |
| Women in the Modern Period.ppt Path: UF >> AMH >> 5930 Fall, 2008 Description: Women in the Modern Period Economy (19th) A-39 Rural/agricultural Industrial/textile Private household Economy (20th) A-39 decline in agricultural Industrial/service Decline in private Politics Voluntary associations Politics suffrage ... Date Added: 2009-01-10 03:38:03 |
| Women in the Modern Period.ppt Path: UF >> AMH >> 3562 Spring, 2008 Description: Women in the Modern Period Economy (19th) A-39 Rural/agricultural Industrial/textile Private household Economy (20th) A-39 decline in agricultural Industrial/service Decline in private Politics Voluntary associations Politics suffrage ... Date Added: 2009-01-11 22:40:45 |
| answer1 Path: Berkeley >> ECON >> 100B Spring, 2008 Description: Name: _ SID: _ Discussion Section: _ Problem Set #1 ANSWERS Due Tuesday, February 12, 2008 Problem Sets MUST be word-processed except for graphs and equations. QUESTIONS A. Multiple Choice Questions. Circle the letter corresponding to the best answ... Date Added: 2008-04-20 10:13:33 |
| HW1 answers Path: Berkeley >> ECON >> 100B Spring, 2008 Description: Name: _ SID: _ Discussion Section: _ Problem Set #1 ANSWERS Due Tuesday, February 12, 2008 Problem Sets MUST be word-processed except for graphs and equations. QUESTIONS A. Multiple Choice Questions. Circle the letter corresponding to the best answ... Date Added: 2008-04-01 19:59:24 |
| 164-8th-handout-2-may-07.doc Path: San Jose State >> HIST >> 164 Fall, 2008 Description: Hist 164, 9th handout, for 2 May 07 Terms: Marxism Guerrilla warfare Guerrilleros Ideological pluralism Counterinsurgency Foco Primary goods Western hemisphere Antipolitical, anonymous Family dynasty Tyrannical Southern Cone Military (National Securi... Date Added: 2009-02-02 16:08:25 |
| exam_4 sample solutions Path: Cornell >> MATH >> 2130 Spring, 2008 Description: Fourth Preliminary Exam Math 213 - Spring 2008 Name: Solutions This exam has 5 questions on 11 pages, for a total of 50 points. You have 50 minutes to answer all questions. This is closed book, closed notes exam. Use of calculators and other electron... Date Added: 2008-05-09 15:56:26 |
| quiz6solutions.pdf Path: UPenn >> MATH >> 104 Fall, 2008 Description: MATH 104 QUIZ VI SOLUTIONS CLAY SHONKWILER In each problem, determine whether the sequence or series converges or diverges. If it converges, determine the limit or sum. (1) The sequence {an } where ln n an = . cos2 n Answer: Since | cos n| 1 for al... Date Added: 2009-04-15 21:18:00 |
| baumeisteretal2005.pdf Path: FSU >> PSY >> 2005 Fall, 2008 Description: ATTITUDES AND SOCIAL COGNITION Social Exclusion Impairs Self-Regulation Roy F. Baumeister and C. Nathan DeWall Florida State University Natalie J. Ciarocco Florida Atlantic University Jean M. Twenge San Diego State University Six experiments showe... Date Added: 2009-02-17 18:54:31 |
| baumeisteretal2005.pdf Path: S.F. State >> PSY >> 2005 Fall, 2008 Description: ATTITUDES AND SOCIAL COGNITION Social Exclusion Impairs Self-Regulation Roy F. Baumeister and C. Nathan DeWall Florida State University Natalie J. Ciarocco Florida Atlantic University Jean M. Twenge San Diego State University Six experiments showe... Date Added: 2009-02-17 18:54:31 |
| Exam 2 Solutions Path: CSU Fullerton >> MATH >> 350 Spring, 2008 Description: ... Date Added: 2008-04-16 07:50:18 |
| 390_PrelimI_solution Path: Cornell >> CHEM >> 3900 Spring, 2008 Description: ... Date Added: 2008-02-23 11:09:38 |
| Ergonomics_and_OSHA_24-Apr-2006.ppt Path: Berkeley >> IND ENG >> 170 Spring, 2008 Description: Office Ergonomics and OSHA Cecilia R. Aragon IEOR 170 UC Berkeley Spring 2006 Acknowledgments Jeffrey Chung, Lawrence Berkeley National Laboratory ergonomics program manager Cathy Rothwell, US Navy ergonomics program manager Spring 2006 IEOR 17... Date Added: 2009-01-12 05:03:13 |
| LargeNumberLibrary.pdf Path: CUNY John Jay >> MAT >> 379 Spring, 2008 Description: Cluster Computing for Large-Scale Computational Problems Components n Gigabit Ethernet Message Passing Interface Distributed Memory computers n n Boris Bondarenko Hardware Architectures n Possible solutions n 32-Bit architecture 2 32 Expand ... Date Added: 2009-01-09 02:17:10 |
| LargeNumberLibrary.pdf Path: CUNY John Jay >> FCM >> 745 Fall, 2008 Description: Cluster Computing for Large-Scale Computational Problems Components n Gigabit Ethernet Message Passing Interface Distributed Memory computers n n Boris Bondarenko Hardware Architectures n Possible solutions n 32-Bit architecture 2 32 Expand ... Date Added: 2009-01-09 02:17:27 |
| LargeNumberLibrary.pdf Path: CUNY John Jay >> FCM >> 791 Spring, 2008 Description: Cluster Computing for Large-Scale Computational Problems Components n Gigabit Ethernet Message Passing Interface Distributed Memory computers n n Boris Bondarenko Hardware Architectures n Possible solutions n 32-Bit architecture 2 32 Expand ... Date Added: 2009-01-11 16:22:18 |
| LargeNumberLibrary.pdf Path: CUNY John Jay >> MAT >> 141 Fall, 2008 Description: Cluster Computing for Large-Scale Computational Problems Components n Gigabit Ethernet Message Passing Interface Distributed Memory computers n n Boris Bondarenko Hardware Architectures n Possible solutions n 32-Bit architecture 2 32 Expand ... Date Added: 2009-01-09 02:17:04 |
| pset9 Path: Rutgers >> MATH >> 250 Spring, 2008 Description: 18.06 Problem Set 9 Due Friday, 9 May 2008 at 4 pm in 2-106. Problem 1: Do problem 4 in section 6.7 (pg. 360) in the book. Problem 2: Do problem 7 in section 6.7 (pg. 360). Problem 3: Do problem 9 in section 6.7 (pg. 361). Problem 4: a) Do problem 1... Date Added: 2008-08-10 12:03:57 |
| Other parties Path: Oxford University >> PPE >> PPE Summer, 2008 Description: (1998) We reject the bland conformism of the mainstream parties who accept without question an economic system built on privilege, inequality and greed. The SSP is an anti-capitalist party which has refashioned socialism for the new Scotland of the 2... Date Added: 2008-04-29 06:49:05 |
| Final415practice_sol Path: UIllinois >> MATH >> 415 Spring, 2009 Description: Math 415 Final practice solutions Problem 1: Lets start by writing 11 1 0 1 2 11 the augmented matrix 2 1 2 0 2 1 1 0 1 1 10 to get 1 2 1 1/3 0 2/3 0 0 We now use Gauss-Jordan reduction 100 0 1 0 0 0 1 000 Therefore w is a free variable... Date Added: 2009-02-10 13:00:24 |
| cast.pdf Path: South Plains College >> HITT >> 1305 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> SOCI >> 2320 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> SPCH >> 1321 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> HUDV >> 1100 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> GOVT >> 2301 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> HUMA >> 2319 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> GOVT >> 2302 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> PSYC >> 2319 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> VNSG >> 1122 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| cast.pdf Path: South Plains College >> RSPT >> 1429 Fall, 2008 Description: ... Date Added: 2009-01-09 07:15:16 |
| 1 Path: UC Davis >> ECN >> 001B Spring, 2008 Description: Ecn 1B Answer Key: Problem set #1 1. When y changes, x stays the same. The line depicting this relationship would be a. Vertical b. Horizontal c. Linear with a negative slope d. Linear with a positive slope Answer: (a) Vertical lines have the relatio... Date Added: 2008-05-18 15:11:24 |
| Exhibit-Topic-7.1.xls Path: Clemson >> ECON >> 397 Fall, 2008 Description: $300.00 $275.00 $250.00 $225.00 $200.00 $175.00 $150.00 $125.00 $100.00 $75.00 $50.00 $25.00 $0.00 -$25.00 0 25 50 75 100 125 150 175 P(Qd) P(Qs) P(Qd) P(Qs) FILE IDENTIFICATION AREA Filename: Consumer and Producer Surplus #6 Designer: Mike Duke I... Date Added: 2009-01-09 07:43:14 |
| 060706polyg.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Polygamy Fosters Culture Clashes (and Regrets) in Turkey - New York Times July 10, 2006 Isiklar Journal Polygamy Fosters Culture Clashes (and Regrets) in Turkey By DAN BILEFSKY ISIKLAR, Turkey, July 6 With his 5 wives, 55 children and 80 grandchild... Date Added: 2009-02-11 19:37:19 |
| 060706polyg.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Polygamy Fosters Culture Clashes (and Regrets) in Turkey - New York Times July 10, 2006 Isiklar Journal Polygamy Fosters Culture Clashes (and Regrets) in Turkey By DAN BILEFSKY ISIKLAR, Turkey, July 6 With his 5 wives, 55 children and 80 grandchild... Date Added: 2009-02-11 20:31:43 |
| 05-dtd.ppt Path: UPenn >> CIT >> 597 Fall, 2009 Description: DTDs Document Type Definitions Apr 10, 2009 Schemas XML documents are designed to be processed by computer programs If you can put just any tags in an XML document, in any order, its very hard to write a program that knows how to process the ta... Date Added: 2009-04-15 20:55:57 |
| CI 401 Classroom discipline and assessment.pdf Path: University of Illinois, Urbana Champaign >> CI >> 401 Fall, 2008 Description: Dominique Davis CI 401 3-14-07 Classroom Discipline Plan for Algebra II/Trigonometry (Black print is for students; red italics is for my reference) One of the most important things for me to do as a teacher is to remain consistent in my expectations... Date Added: 2009-02-02 18:27:13 |
| 280.pdf Path: USF >> V >> 15 Fall, 2009 Description: Risk factors, genetic syndromes, screening modalities, and screening studies of pancreatic cancer are reviewed. Sofa Cceres. El Reptil y la Fruta (The Reptile and the Fruit). Mixed media on canvas, 30 46. Early Detection of Pancreatic Cancer: Why,... Date Added: 2009-04-16 00:40:03 |
| chapter 12 notes Path: USC >> ECON >> 203 Spring, 2006 Description: Monopolistic Competition and Oligopoly CHAPTER TWELVE MONOPOLISTIC COMPETITION AND OLIGOPOLY LECTURE NOTES I. II. Review Table 23-1. Monopolistic Competition: Characteristics and Occurrence A. Monopolistic competition refers to a market situation in... Date Added: 2007-10-22 00:17:01 |
| CRIJ 1301.doc Path: South Plains College >> CRIJ >> 1301 Fall, 2008 Description: COURSE TITLE: CRIJ 1301 INTRODUCTION TO CRIMINAL JUSTICE GENERAL COURSE INFORMATION: A. Course Description: This course is an overview of the criminal justice system. Topics include the history and philosophy of criminal justice, the definition of ... Date Added: 2009-02-02 16:14:54 |
| Hw4.pdf Path: NMT >> HW >> 4 Fall, 2008 Description: Math 430, Fall 2008. Homework 4 Due Sept. 29 NAME _ Problem 1 Problem 3.15 (p. 104) Problem 2 Problem 3.23 (p. 108) Problem 3 Using data from the Problem 8.12 (however outdated, p. 292), t the linear regression equation using the minimum mean abs... Date Added: 2009-02-11 21:34:37 |
| Hw4.pdf Path: NMT >> HW >> 430 Fall, 2008 Description: Math 430, Fall 2008. Homework 4 Due Sept. 29 NAME _ Problem 1 Problem 3.15 (p. 104) Problem 2 Problem 3.23 (p. 108) Problem 3 Using data from the Problem 8.12 (however outdated, p. 292), t the linear regression equation using the minimum mean abs... Date Added: 2009-02-11 21:34:37 |
| MOSPHYnew Path: Stanford >> EE >> 214 Fall, 2004 Description: T. H. Lee EE214 A Review of MOS Device Physics 1.0 Introduction This chapter focuses attention on those aspects of transistor behavior that are of immediate relevance to the RF circuit designer. Separation of first-order from higher-order phenomena... Date Added: 2008-04-17 16:25:39 |
| TUExchangeApplicationForm.pdf Path: Towson >> SOCI >> 370 Fall, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-11 21:09:52 |
| TUExchangeApplicationform.pdf Path: Towson >> KNES >> 494 Spring, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:05:44 |
| TUExchangeApplicationForm.pdf Path: Towson >> PHIL >> 219 Fall, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:06:54 |
| TUExchangeApplicationform.pdf Path: Towson >> KNES >> 285 Spring, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:05:44 |
| TUExchangeApplicationform.pdf Path: Towson >> KNES >> 594 Spring, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:05:44 |
| TUExchangeApplicationForm.pdf Path: Towson >> RLST >> 357 Fall, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:06:54 |
| TUExchangeApplicationform.pdf Path: Towson >> KNES >> 470 Fall, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:05:44 |
| TUExchangeApplicationForm.pdf Path: Towson >> ENGL >> 494 Spring, 2008 Description: TOWSON UNIVERSITY EXCHANGE PROGRAM Tel: 410-704-2451 / Fax: 410-704-4703 Please include with this completed and signed application form: 1. Typed essay (see PART B) 2. Official transcript from the institution of current enrollment (minimum GPA varies... Date Added: 2009-01-10 01:06:49 |
| CHE222_solutions3 Path: SDSMT >> CHE >> 222 Spring, 2008 Description: ChE 222: Problem Set #3 Due: February 1 I, 2008 (8:OO am) lay) (y) 1 .) Koretsky, Problem 2.1 1 2.) Koretsky, Problem 2.13 3.) Koretsky, Problem 2.16 19 ) 17 ) 4.) Koretsky, Problem 2.17 Path B (ii) . Since internal energy is a function of tem... Date Added: 2008-04-18 10:55:14 |
| ag032000.pdf Path: Texas >> AG >> 032000 Fall, 2008 Description: 338 DOCUMENTS OF THE GENERAL FACULTY FOURTH REGULAR MEETING OF THE FACULTY COUNCIL FOR 1999-2000 The University of Texas at Austin Main Building, Room 212 ORDER OF BUSINESS I. II. REPORT OF THE SECRETARY (D 341-348) John R. Durbin. APPROVAL OF MIN... Date Added: 2009-02-17 18:13:20 |
| ag032000.pdf Path: Caribbean >> AG >> 032000 Fall, 2008 Description: 338 DOCUMENTS OF THE GENERAL FACULTY FOURTH REGULAR MEETING OF THE FACULTY COUNCIL FOR 1999-2000 The University of Texas at Austin Main Building, Room 212 ORDER OF BUSINESS I. II. REPORT OF THE SECRETARY (D 341-348) John R. Durbin. APPROVAL OF MIN... Date Added: 2009-02-17 18:13:21 |
| fall01.doc Path: Dallas >> POEC >> 5319 Fall, 2008 Description: Fall 2001 8/21/2001 Dr Ronald Briggs GR 3.608/GR3.206 GR 3.212 Tues 7:00-9:45 GR 2.508 972-883-6877 (o), 972-690-3442 (h) http:/www.utdallas.edu/~briggs/poec6381.html e-mail:briggs@utdallas.edu Office hours (in GR 3.212 or 3.206): Wed 2:00-4:00; Tues... Date Added: 2009-02-18 02:19:53 |
| Lecture5 Path: Virginia Tech >> EDHL >> 1514 Spring, 2007 Description: NOTE: This material will be on Test # 2. Alcohol BEVERAGE ALCOHOL IS ETHYL ALCOHOL PERMEABLE MOLECULE QUICKLY ABSORBED INTO THE BLOOD How Alcohol is Produced Fermentation Distillation PHYSIOLOGY OF ALCOHOL NERVOUS SYSTEM CEREBRUM CER... Date Added: 2008-04-23 10:44:24 |
| 333_practice_final_partA.pdf Path: S.F. State >> NURS >> 0730 Fall, 2008 Description: 1 Name: _ Organic Chemistry I FINAL EXAM 1.1 CHEM 333 May 21, 2003 Student ID# _ Read all questions carefully . Proofread your work. Be clear in your drawings; artwork is important, especially for partial credit. Count your carbons. You may use the ... Date Added: 2009-01-09 07:01:39 |
| 333_practice_final_partA.pdf Path: S.F. State >> CHEM >> 0351 Spring, 2008 Description: 1 Name: _ Organic Chemistry I FINAL EXAM 1.1 CHEM 333 May 21, 2003 Student ID# _ Read all questions carefully . Proofread your work. Be clear in your drawings; artwork is important, especially for partial credit. Count your carbons. You may use the ... Date Added: 2009-01-09 07:01:39 |
| 333_practice_final_partA.pdf Path: S.F. State >> CHEM >> 0470 Fall, 2008 Description: 1 Name: _ Organic Chemistry I FINAL EXAM 1.1 CHEM 333 May 21, 2003 Student ID# _ Read all questions carefully . Proofread your work. Be clear in your drawings; artwork is important, especially for partial credit. Count your carbons. You may use the ... Date Added: 2009-01-09 07:01:39 |
| Econ102_Exam2_V4_Winter08_ Path: Michigan >> ECON >> 102 Winter, 2008 Description: Winter Semester 2008 Economics 102 Principles of Economics II Department of Economics University of Michigan Examination No. 2 Section 100 Circle the correct answer for each of the following questions. 1. Your form number is A) 1 B) 2 C) 3 D) 4 2.... Date Added: 2008-04-04 19:12:33 |
| Labsyl2008 Path: Suffolk >> BIO >> 114 Spring, 2008 Description: Bio L114 - Zoology Lab Dr. Peter Burn - A507 Phone - (617) 573-8248 Office Hours - MWF 10-11, or by appt. Objectives: Spring 2008 Email - pburn@suffolk.edu To introduce you to the process of science, and to the evolutionary and morphological divers... Date Added: 2008-04-07 21:48:04 |
| Political Documents Path: NYU >> CONWEST >> 101 Fall, 2005 Description: Conversations of the West: Antiquity and the Enlightenment December 5, 2005 11:00-12:15 TA Menachem Session 18 Political Documents The United States Declaration of Independence and the U.S. Constitution show a lot about the history and willpower of t... Date Added: 2008-04-17 20:09:38 |
| 2001-03MTSU-UCat-actg.pdf Path: MTSU >> UNIV >> 2001 Fall, 2008 Description: BUSINESS Accounting 161 Department of Accounting Ken Harmon, Chair Business and Aerospace Building N425C Boyd, Brandon, Burton, Bush, Colvard, Dawkins, Farmer, B. Harper, P. Harper, Harrington, Hopper, James, Johns, Jones, Olibe, Reynolds, Rezaee,... Date Added: 2009-02-02 14:56:52 |
| PTI_1.pdf Path: Texas A&M >> CVEN >> 436 Fall, 2008 Description: ... Date Added: 2009-02-03 13:26:34 |
| CHEM 1211 Chapter2.ppt Path: Armstrong >> CHEM >> 1211 Spring, 2008 Description: Chapter 2 Atoms, Molecules, and Ions 1 Atoms and Atomic Structure Daltons Atomic Theory - 1808 -Elements are composed of small, nondivisible particles called atoms -Atoms of an element have identical properties and differ from those of ot... Date Added: 2009-01-09 18:15:26 |
| 9-130.pdf Path: Grossmont >> ART >> 130 Fall, 2008 Description: Table of Contents Chapter 1: The District Chapter 2: Governing Board Chapter 3: General Institution Chapter 4: Academic Affairs Chapter 5: Student Services Chapter 6: Business and Fiscal Affairs Chapter 7: Human Resources Chapter 1 The District Pol... Date Added: 2009-02-02 14:24:47 |
| midterm2-solutions-228-06.pdf Path: Maine >> MAT >> 228 Fall, 2008 Description: MidTerm II: MAT 228 Spring 2006 Solutions William O. Bray NAME Instructions Work the following problems in the space provided. Be neat, clear, and orderly in all computations and explainations! 1. Three variables P, V, and determine a formula ... Date Added: 2009-02-02 19:28:12 |
| 1-18-08 anatomy notes Path: TCU >> BIOL >> 20204 Fall, 2007 Description: 1-18-08 anatomy notes 1. Organ Systems 2. Nervous System a. Neuroglial Cells (found in CNS and PNS) i. Schwann cells (PNS only)-produce myelinated axons (mostly) and myelinated dendrites ii. Oligodendricytes (CNS only, are largely in the brain)-produ... Date Added: 2008-04-02 16:45:33 |
| hw6-soln.pdf Path: Rochester >> PHY >> 402 Fall, 2009 Description: Homework 6 March 8, 2006 Physics 402 Probability Solution prepared by Tobin Fricke Prof. S.G. Rajeev, Univ. of Rochester 16. Let 1 , 2 be two independent Gaussian random variables, both of zero mean and unit variance. What 2 2 are the probability... Date Added: 2009-04-15 22:26:41 |
| Hertz_App.pdf Path: Berkeley >> MUSIC >> 145 Fall, 2008 Description: Department of Music #1200 University of California Berkeley, CA 94720-1200 Application for an Alfred Hertz Memorial Traveling Scholarship For the academic year _to_ The Alfred Hertz Memorial Traveling Scholarship is awarded to persons who have manife... Date Added: 2009-01-11 21:19:39 |
| Hertz_App.pdf Path: Berkeley >> MUSIC >> 144 Fall, 2008 Description: Department of Music #1200 University of California Berkeley, CA 94720-1200 Application for an Alfred Hertz Memorial Traveling Scholarship For the academic year _to_ The Alfred Hertz Memorial Traveling Scholarship is awarded to persons who have manife... Date Added: 2009-01-10 01:23:12 |
| FNR-260.pdf Path: Purdue >> ABE >> 285 Fall, 2008 Description: PURDUE EXTENSION FNR-260 Natural Oak Regeneration Following Clearcutting on the Hoosier National Forest John R. Seifert, Extension Forester, Forestry and Natural Resources, Purdue University; Marcus F. Selig, Research Associate, Forestry and Natural... Date Added: 2009-01-09 06:30:14 |
| CollegePublisher2008.doc Path: Glasgow Caledonian University >> PHY >> 2 Fall, 2008 Description: Many Worlds in One engaging, thought-provoking 4/5 stars Alison Harman Issue date: 2/7/08 Section: A&E Society, history reveals, tenaciously wards off ideological change. Many astrophysicists have, or almost have, been ousted from society for their ... Date Added: 2009-02-17 23:05:56 |
| CollegePublisher2008.doc Path: Tufts >> PHY >> 2 Fall, 2008 Description: Many Worlds in One engaging, thought-provoking 4/5 stars Alison Harman Issue date: 2/7/08 Section: A&E Society, history reveals, tenaciously wards off ideological change. Many astrophysicists have, or almost have, been ousted from society for their ... Date Added: 2009-02-17 23:05:56 |
| iui-97.pdf Path: Colorado >> L3D >> 97 Fall, 2008 Description: Using Agents to Personalize the Web Christoph G. Thomas HCI Research Division GMD FIT D-53754 Sankt Augustin, Germany +49 2241 14 2640 christoph.thomas@gmd.de ABSTRACT Users build personal information spaces (stored as bookmarks, hotlists, or as a pe... Date Added: 2009-02-06 20:49:35 |
| Business Law Exam 1 Review Sheet Path: Parkland >> BUSINESS >> 214 Spring, 2008 Description: Business 205 J Gohl-Noice Review Sheet Exam 1- Feb. 8th 70 true false and multiple choice questions 1 Bonus short answer Vocabulary: Sources of Law Administrative agencies Precedent Ethics Duty Based Jurisdiction In rem Federal question Justiciable... Date Added: 2008-04-07 18:48:36 |
| 5-14 and 15 Path: Oklahoma State >> ACCT >> cost Spring, 2008 Description: E5-14 and 15 Consolidation Workpaper for Majority-Owned Subsidiary no differential Actual entries for 2003: Investment in S Income from S NI: $30,000 x 80% = $24,000 Cash Investment in S Dividends 24,000 24,000 8,000 8,000 a. Eliminating entries: ... Date Added: 2008-04-18 18:16:33 |
| exam1-fall2006 Path: Stanford >> ECON >> 1A Fall, 2007 Description: Exam 1 - Econ 1A October 16, 2006 Instructions You have 50 minutes to answer the following questions. Total points = 50 Answer each question in a separate bluebook as indicated below. Please note that you will need three bluebooks. Label your... Date Added: 2008-04-08 01:07:17 |
| 041130migrants.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: KAZAKHSTAN: Migration conference opens in Almaty - OCHA IRIN Thursday 2 December 2004 Search Central Asia Country Profile Latest News Afghanistan Central Asia Iran Kazakhstan Kyrgyzstan Pakistan Tajikistan Turkmenistan Uzbekistan Weekly Themes Childr... Date Added: 2009-02-11 19:35:56 |
| ps3.pdf Path: George Mason >> ECE >> 220 Fall, 2008 Description: ECE 220 Signals and Systems I Problem Set 3 Spring 2008 Issued: Wednesday, February 6, 2008 Reading in Oppenheim/Willsky/Nawab 2/11/08 Sections 2.3 2/13/08 Sections 2.4.1 and 2.4.3 EXAM ANNOUNCEMENT Exam 1 is Monday, February 25. This exam will co... Date Added: 2009-04-16 01:22:46 |
| Exam_1_S07_Solutions Path: ASU >> IEE >> 300 Fall, 2007 Description: IEE 300 Spring 2007 Exam #1 Name: _ Questions 1 through 5 are worth 10 points each. They are short answer and partial credit may be given. Question 1 (10 points) Explain what minimum attractive rate of return is: The rate of return that must be equ... Date Added: 2008-05-05 17:17:19 |
| Workshop_Philp.pdf Path: Tulsa >> IPEC >> 2007 Fall, 2008 Description: Utilization of Stable Isotopes in Environmental and Forensic Geochemistry Studies 14th International Petroleum Environmental Conference Monday, November 6, 2007, 1:30pm 4:30pm Instructed by: Paul Philp, University of Oklahoma, Norman, OK Stable carb... Date Added: 2009-02-11 20:54:08 |
| 2005spring-midterm01-KEY Path: UCSD >> CHEM >> 140C Spring, 2008 Description: Name: _ ID# _ 04-19-05 1. Treatment of the chiral ketone 1 with 18O labeled water under acidic conditions gives a racemic mixture of the labeled ketones 2 and 3: . O H H218O, H318O+ 18O 18O H H 1 2 3 Write a detailed stepwise mechanism th... Date Added: 2008-06-07 21:07:32 |
| degreelist.pdf Path: CSU Fresno >> GME >> 193 Fall, 2008 Description: Degree Programs, Majors, and Minors California State University, Fresno offers majors for the baccalaureate degrees, minors, and graduate degree programs as indicated on these pages. Undergraduate and graduate options are listed under the programs. R... Date Added: 2009-01-10 02:47:39 |
| degreelist.pdf Path: CSU Fresno >> PLANT >> 194 Fall, 2008 Description: Degree Programs, Majors, and Minors California State University, Fresno offers majors for the baccalaureate degrees, minors, and graduate degree programs as indicated on these pages. Undergraduate and graduate options are listed under the programs. R... Date Added: 2009-01-10 02:47:39 |
| Lec 9 Path: Berkeley >> E >> 124 Spring, 2007 Description: University of California, Berkeley Engineering 124 Professor Kastenberg Impacts of Technology on Society Engineering 124 Lecture 9 Feb. 15, 2007 \"An Inconvenient Truth\" Part II Ocean Conveyor o Flow of warm and cold water in the world\'s oceans o... Date Added: 2008-04-02 22:46:33 |
| hickmanandgeller.ppt Path: Western Michigan >> AUSTIN >> 540 Fall, 2008 Description: Self-management to increase safe driving among short-haul truck drivers Hickman & Geller, in press Overview Economic impact of vehicle crashes was about $230 billion in 2000 Speeding was a contributing factor in 29% of fatal crashes in 2000 Self ... Date Added: 2009-02-18 02:19:24 |
| hickmanandgeller.ppt Path: Southwestern Michigan College >> AUSTIN >> 540 Fall, 2008 Description: Self-management to increase safe driving among short-haul truck drivers Hickman & Geller, in press Overview Economic impact of vehicle crashes was about $230 billion in 2000 Speeding was a contributing factor in 29% of fatal crashes in 2000 Self ... Date Added: 2009-02-18 02:19:24 |
| CO7.pdf Path: UF >> POS >> 6453 Spring, 2008 Description: This article appears as part of a special PSOnline e-Symposium organized by guest editors J. Quin Monson and David B. Magleby of Brigham Young University. Printed abstracts appear in the July 2003 issue of PS: Political Science & Politics and complet... Date Added: 2009-01-11 22:46:03 |
| CO7.pdf Path: UF >> POS >> 6453 Spring, 2008 Description: This article appears as part of a special PSOnline e-Symposium organized by guest editors J. Quin Monson and David B. Magleby of Brigham Young University. Printed abstracts appear in the July 2003 issue of PS: Political Science & Politics and complet... Date Added: 2009-01-12 06:16:50 |
| Douglas_22.pdf Path: Tulsa >> IPEC >> 2006 Fall, 2008 Description: CONTINUED SUCCESS WITH COOL-OX TREATMENTS OF PETROLEUM AND COMMENGLED HALOGENATED HYDROCARBONS AT PETROEUM SITES IN NORTHWEST FLORIDA Thomas D. Douglas* Advanced Environmental Technologies (AET), LLC 9160 Roe Street Pensacola, FL 32514 Voice: 850-471... Date Added: 2009-02-11 20:53:42 |
| M90_HO_Translating English-Algebra.doc Path: Grossmont >> MATH >> 090 Fall, 2008 Description: TranslatingEnglishintoAlgebra VerbalPhrase Addition Thesumofanumberand9 Anumberplus7 Fiveisaddedtoanumber Twomorethananumber Anumberincreasedby3 Subtraction Fourissubtractedfromanumber Threelessthananumber Anumberless5 Thedifferencebetween7andanumber... Date Added: 2009-01-11 05:01:20 |
| so12.pdf Path: Maryland >> PHYS >> 622 Fall, 2006 Description: 1.20) 2 2 2 Because Sx = Sy = h/4, < Sx > < Sx >2 = h/4 < Sx >2 is largest when < Sx >2 2 2 vanishes, and similarly for < Sy > < Sy > . The product reaches its maximum, h2 /16 if there is a state for which both < Sx > and < Sy > vanish. But clea... Date Added: 2009-02-18 00:18:25 |
| B1510F07_mt2v2_key_with_revision_explanations Path: Georgia Tech >> BIOL >> 1510 Fall, 2007 Description: Biology 1510 Fall 2007: Exam 2 (version 2) General Instructions: Read these instructions. Do not open this exam until instructed to do so. Note the version of this exam, which is shown in the header to each page. Bubble in the version number in Col... Date Added: 2008-04-07 16:34:40 |
| LTIB.pdf Path: Arizona >> OPTI >> 200 Spring, 2008 Description: The Arizona Daily Star Around the nation Tucson, Arizona | Published: 02.01.2007 CALIFORNIA Legislator targets incandescent bulbs SACRAMENTO How many people does it take to change a light bulb? In California, the answer could be a majority of the L... Date Added: 2009-01-11 19:56:54 |
| LTIB.pdf Path: Arizona >> OPTI >> 200 Spring, 2008 Description: The Arizona Daily Star Around the nation Tucson, Arizona | Published: 02.01.2007 CALIFORNIA Legislator targets incandescent bulbs SACRAMENTO How many people does it take to change a light bulb? In California, the answer could be a majority of the L... Date Added: 2009-01-11 19:56:54 |
| index.txt Path: Arizona >> DRG >> 024 Fall, 2009 Description: FILE: DRG_LIST.TXT DATE: March 6, 1997 * FILE LISTING AND DESCRIPTION OF THE DATA SETS This section contains a full file listing and size description of the data. There is a one-to-one correspondence between data files and their respective world ... Date Added: 2009-04-15 22:47:18 |
| sm2_86 Path: Clarkson >> ES >> 340 Spring, 2009 Description: Excerpts from this work may be reproduced by instructors for distribution on a not-for-profit basis for testing or instructional purposes only to students enrolled in courses for which the textbook has been adopted. Any other reproduction or translat... Date Added: 2009-01-27 20:15:31 |
| homework8.pdf Path: Delaware >> CIEG >> 675 Fall, 2008 Description: CIEG 305 Homework #8 Due Friday November 7, 2008 1. P3.130 White 2. P3.131 White 3. P3.136 White 4. P3.137 White 5. P3.154 White 6. FE3.6 White EC. P3.153 white. ... Date Added: 2009-01-10 03:32:33 |
| Wax Arguement Path: UC Riverside >> PHIL >> 30i Spring, 2008 Description: John Tomberlin October 13. 2008 In Response to Descartes\' Meditations on Wax Descartes uses wax as a tool to explore our understanding of the outside world, our perceptions of the world. As he begins speaking about the wax; listing its color, smell ... Date Added: 2008-04-07 16:44:34 |
| pjm-v218-n1-p10-p.pdf Path: Berkeley >> JOURN >> 218 Spring, 2008 Description: Pacic Journal of Mathematics GENERIC BEHAVIOR OF ITERATED FUNCTION SYSTEMS WITH OVERLAPS MICHA RAMS Volume 218 No. 1 January 2005 PACIFIC JOURNAL OF MATHEMATICS Vol. 218, No. 1, 2005 GENERIC BEHAVIOR OF ITERATED FUNCTION SYSTEMS WITH OVERLAPS M... Date Added: 2009-02-02 16:58:42 |
| coogan.pdf Path: Arizona >> MATH >> 443 Fall, 2008 Description: Backward Static Program Slicing Kevin Coogan Math 543 12/8/08 Program Slicing slice an executable program that is obtained from the original program by deleting zero or more statements. Program Slicing static slice criterion consists of a pai... Date Added: 2009-01-11 19:54:37 |
| coogan.pdf Path: Arizona >> MATH >> 543 Fall, 2008 Description: Backward Static Program Slicing Kevin Coogan Math 543 12/8/08 Program Slicing slice an executable program that is obtained from the original program by deleting zero or more statements. Program Slicing static slice criterion consists of a pai... Date Added: 2009-01-11 19:54:37 |
| freewriteideas.doc Path: UNC Greensboro >> ENG >> 2 Fall, 2008 Description: Free Write Ideas Cut out ads from the classifieds in the newspaper and give one to each student. Have them construct a little creative story as a freewrite from the information in the ad. This takes a typically dry and boring description and allows t... Date Added: 2009-02-18 02:23:14 |
| 1731.210.ps Path: Hawaii >> SOEST >> 1731 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207370613.0388276 Float: 1731 Profile: 210 Location: 34.3N 173.3E Date: 05/01... Date Added: 2009-02-17 20:03:53 |
| 245-254InterdisciplinaryProg.pdf Path: University of Hawaii, Manoa >> WS >> 245 Fall, 2008 Description: Aging and Gerontology Degrees and Certificates Offered: Undergraduate Certificate in Aging, BA in interdisciplinary studies (emphasis on aging), Advanced Certificate in Gerontology See the School of Medicine section of the Catalog for more informatio... Date Added: 2009-02-02 17:58:22 |
| Bean Lab Path: Wells >> BIOL >> 152 Spring, 2008 Description: Bean Lab Questions 1. Which seed phenotypes were selected for or against in each habitat? Seed Type Habitat: Naked (rate=50) Generation 5 Habitat: Homogenous Generation 5 Habitat: Patchy Generation 5 Habitat Naked (rate=75) Generation 5 BB 0 BP GP G... Date Added: 2008-04-07 16:38:02 |
| AMH3562lec1.ppt Path: UF >> AMH >> 4317 Fall, 2008 Description: AMH3562 US WOMENS HISTORY READING IMAGES Mill Girl, c. 1850 Hampton c. 1900 Chinese immigrant c. 1892 WTUL Emblem c. 1903 Migrant Mother c. 1936 ... Date Added: 2009-01-10 03:38:03 |
| AMH3562lec1.ppt Path: UF >> AMH >> 5930 Fall, 2008 Description: AMH3562 US WOMENS HISTORY READING IMAGES Mill Girl, c. 1850 Hampton c. 1900 Chinese immigrant c. 1892 WTUL Emblem c. 1903 Migrant Mother c. 1936 ... Date Added: 2009-01-11 22:40:47 |
| AMH3562lec1.ppt Path: UF >> AMH >> 3562 Spring, 2008 Description: AMH3562 US WOMENS HISTORY READING IMAGES Mill Girl, c. 1850 Hampton c. 1900 Chinese immigrant c. 1892 WTUL Emblem c. 1903 Migrant Mother c. 1936 ... Date Added: 2009-01-10 03:38:02 |
| notes.pdf Path: Southern Utah >> MUS >> 395 Fall, 2009 Description: Native American Church and Christian Church in Navajo music culture 1. Native American Church, a.k.a. Peyote Church (informal name) a) history of the church -exact origins are murky -1890s - peyote religion spread -peyote religion banned by the gover... Date Added: 2009-04-15 20:41:25 |
| HADM_174_EX3 Path: Cornell >> HADM >> 1174 Fall, 2006 Description: ID 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 Restaurant Contact Phone Address City Alcohol Served? Mexican Restaurants Inc Edgebrook 5.96E+09 1135 Houston No Alcohol Shells Seafood Restaurn... Date Added: 2008-02-09 16:42:43 |
| cm5_blondel.ppt Path: Illinois Tech >> CM >> 5 Fall, 2008 Description: Changing the absorbers: how does it fit in the MICE experimental programme? Besides the requirement that the amount of multiple scattering material be minimum, the physics request from MICE on the absorbers is also that of variability Which materia... Date Added: 2009-02-17 23:24:18 |
| Homework 5, Solutions.pdf Path: UCLA >> MATH >> 5 Fall, 2008 Description: Problem Set 5 Solutions Mathematical Logic Math 114L, Spring Quarter 2008 1. Very similar to the proof that for any term t we have K(t) = 1, and if t is a proper initial segment of a term, then K(t ) < 1. (More details shall be given in the discussi... Date Added: 2009-02-02 17:18:12 |
| asia1980s.pdf Path: Ohio State >> AEDE >> 597 Fall, 2009 Description: ASIA IN THE 1980s 1) China transforms itself from a slow growth, centrally planned communist economy to a dynamic market oriented economy from early 1980s onwards. a. Functional property and profit rights established (i.e. long term leases) for agric... Date Added: 2009-04-16 00:56:30 |
| SOCW 5322 Test 5.doc Path: UT Arlington >> ME >> 5322 Fall, 2008 Description: SOCW 5322 Test 5 1. Paired sample t-test (20 points) a. Please develop a hypothetical data for pre-test and post-test for 10 participants and enter the data into SPSS (Provide a hard copy of your data-If your data are same as any other classmates, yo... Date Added: 2009-02-03 14:12:00 |
| Portfolio Suggestions.doc Path: VCU >> CLED >> 603 Fall, 2008 Description: Suggestions for Portfolio CLED 603: Group Counseling Personal Information Resume Awards, Diplomas, Degrees, Certificates, and Licenses Memberships/Offices of Professional Organizations Philosophy Statement Counseling Experience Group Counselin... Date Added: 2009-02-02 20:50:56 |
| old250Amt2.pdf Path: Berkeley >> MATH >> 250 Fall, 2001 Description: Math 250A Professor Kenneth A. Ribet Second Midterm Exam November 16, 1992 All modules below are left modules. 1 5 points Let A be an entire principal ring (principal ideal domain). Explain carefully what it means for an element of A to be an irred... Date Added: 2009-04-16 02:04:52 |
| Homework #1 Path: Wisconsin >> AOS >> 100 Spring, 2008 Description: AOS 100 Homework #1 1. Kinetic energy is defined as a measure of an object\'s ability to do work in motion. The formula to calculate kinetic energy is KE= (1/2) x Mass x Velocity2 . There is a big difference between wind in speeds of 18ms -1 and 25ms-... Date Added: 2008-04-02 15:00:26 |
| 2004-Hao-Nei-ratLy49.pdf Path: Penn State >> BIOL >> 601 Spring, 2008 Description: ratLy49 >gene1 ATGAGTGAGCAGGAGGTCACTTACACCACTGTGAGATTTCATAAGTCTCCAGGGTTGCAG AACCAAGTGAGGCCTGAGGAGACTCAAAGGCCCAGGAAAGCTGGCCACAGAGAGTGTTCG GTCACCTGGAAGCCCATTGTGATAGTTCTCGGAATCCTCTGTTCCCTTCTCCTGGTAACT GTGGCAGTATTGTTGACACACATTTTTCAGTCCAGACAAGAGAAACATGAAC... Date Added: 2009-01-09 09:38:21 |
| 2004-Hao-Nei-ratLy49.pdf Path: Penn State >> BIOL >> 611 Fall, 2008 Description: ratLy49 >gene1 ATGAGTGAGCAGGAGGTCACTTACACCACTGTGAGATTTCATAAGTCTCCAGGGTTGCAG AACCAAGTGAGGCCTGAGGAGACTCAAAGGCCCAGGAAAGCTGGCCACAGAGAGTGTTCG GTCACCTGGAAGCCCATTGTGATAGTTCTCGGAATCCTCTGTTCCCTTCTCCTGGTAACT GTGGCAGTATTGTTGACACACATTTTTCAGTCCAGACAAGAGAAACATGAAC... Date Added: 2009-01-09 09:38:21 |
| 2008Sp61C-L16-km-FloatingPointII-6up Path: Berkeley >> CS >> 61c Summer, 2008 Description: UC Berkeley CS61C : Machine Structures Lecture 16 Floating Point II 2008-02-29 inst.eecs.berkeley.edu/~cs61c Review Exponent tells Significand how much (2i) to count by (., 1/4, 1/2, 1, 2, .) Floating Point lets us: Represent numbers containing... Date Added: 2008-07-02 23:25:58 |
| ehrenberg1.pdf Path: UCSD >> CHEM >> 219c Fall, 2008 Description: Previews 155 Molecular Cell 22, April 21, 2006 2006 Elsevier Inc. DOI 10.1016/j.molcel.2006.04.004 Two-Step Selection of mRNAs in Initiation of Protein Synthesis In a recent issue of Molecular Cell, Studer and Joseph (2006) claried the molecular b... Date Added: 2009-01-10 01:51:32 |
| 5th Homework Solution Path: San Jose State >> ME >> 114 Spring, 2008 Description: ... Date Added: 2008-04-15 15:05:33 |
| JRC_PhD_V2.pdf Path: Virginia Tech >> LIB >> 04182003 Fall, 2008 Description: AN APPLICATION OF ANTI-OPTIMIZATION IN THE PROCESS OF VALIDATING AERODYNAMIC CODES By Juan R. Cruz A DISSERTATION SUBMITTED TO THE FACULTY OF THE VIRGINIA POLYTECHNIC INSTITUTE AND STATE UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE D... Date Added: 2009-02-18 00:52:46 |
| 2020-hw-p5.doc Path: UF >> PHY >> 2020 Fall, 2008 Description: ... Date Added: 2009-01-10 18:19:44 |
| 2020-hw-p5.doc Path: UF >> PHY >> 2020 Fall, 2008 Description: ... Date Added: 2009-01-11 22:43:48 |
| 2020-hw-p5.doc Path: UF >> PHY >> 2020 Fall, 2008 Description: ... Date Added: 2009-01-11 22:43:54 |
| 2020-hw-p5.doc Path: UF >> PHY >> 2020 Fall, 2008 Description: ... Date Added: 2009-01-11 22:43:55 |
| pstr 1340 NEW SYLLAUS FALL2007.O07.doc Path: St. Philips College >> PSTR >> 1340 Fall, 2008 Description: ST. PHILIPS COLLEGE 1801 MARTIN LUTHER KING DRIVE SAN ANTONIO, TX 78203-2098 210-531-3315 DEPARTMENT OF TOURISM, HOSPITALITY AND CULINARY ARTS SYLLABUS FOR THE COURSE PLATED DESSERTS PSTR 1340 INSTRUCTOR: PHONE: Cynthia Dela Fuente Office: CC-202E ... Date Added: 2009-02-02 16:17:49 |
| 060731risky.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: seeurope.net : View StorySEEUROPE Google HOMENEWS TODAYNEWSLETTERABOUT USCONTACTSAD INFOTOP 100 INVESTMENT GUIDE COUNTRY RATINGS EVENTS CALENDAR SEE COUNTRIES SEE HOLIDAYS USEFUL LINKS DISCUSSION BOARD SIGHT SEEING ROMANIA: Romania Witnesses Risky... Date Added: 2009-02-11 19:29:18 |
| 060731risky.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: seeurope.net : View StorySEEUROPE Google HOMENEWS TODAYNEWSLETTERABOUT USCONTACTSAD INFOTOP 100 INVESTMENT GUIDE COUNTRY RATINGS EVENTS CALENDAR SEE COUNTRIES SEE HOLIDAYS USEFUL LINKS DISCUSSION BOARD SIGHT SEEING ROMANIA: Romania Witnesses Risky... Date Added: 2009-02-11 20:06:55 |
| CH5DP Path: Pacific >> ECPE >> 41 Spring, 2008 Description: Design Problems DP5-1 The equation of representing the straight line in Figure DP 5-1b is v = - R t i + voc . That is, the slope of the line is equal to -1 times the Thevenin resistance and the \"v - intercept\" is equal to the 0-5 open circuit voltage... Date Added: 2008-04-07 11:22:33 |
| HW4 Path: UC Irvine >> MAE >> 146 Spring, 2009 Description: ... Date Added: 2009-03-10 15:28:01 |
| Slides4up.pdf Path: UC Irvine >> HISTORY >> 131 Spring, 2008 Description: Acknowledgements and caveat Informatics 131 Human-Computer Interaction David G. Kay kay@uci.edu http:/www.ics.uci.edu/~kay/courses/131/Slides.pdf These slides draw liberally, with permission, from the Informatics 131 slides of Prof. Alfred Kobsa, ava... Date Added: 2009-02-02 17:16:03 |
| paper2.doc Path: Pace >> BIO >> 125 Fall, 2008 Description: Chemical Warfare- Detection of Chemical Weapons 1. ABSTRACT The threat of chemical warfare instills acute fear in both individuals and nations. Since the first significant use of chemical warfare in World War 1, issues surrounding chemical warfare... Date Added: 2009-01-11 19:14:41 |
| paper2.doc Path: Pace >> BIO >> 343 Fall, 2008 Description: Chemical Warfare- Detection of Chemical Weapons 1. ABSTRACT The threat of chemical warfare instills acute fear in both individuals and nations. Since the first significant use of chemical warfare in World War 1, issues surrounding chemical warfare... Date Added: 2009-01-11 19:14:41 |
| paper2.doc Path: Pace >> SOC >> 116 Fall, 2008 Description: Chemical Warfare- Detection of Chemical Weapons 1. ABSTRACT The threat of chemical warfare instills acute fear in both individuals and nations. Since the first significant use of chemical warfare in World War 1, issues surrounding chemical warfare... Date Added: 2009-01-11 19:14:41 |
| paper2.doc Path: Pace >> BIO >> 306 Fall, 2008 Description: Chemical Warfare- Detection of Chemical Weapons 1. ABSTRACT The threat of chemical warfare instills acute fear in both individuals and nations. Since the first significant use of chemical warfare in World War 1, issues surrounding chemical warfare... Date Added: 2009-01-12 04:41:24 |
| paper2.doc Path: Pace >> BIO >> 113 Fall, 2008 Description: Chemical Warfare- Detection of Chemical Weapons 1. ABSTRACT The threat of chemical warfare instills acute fear in both individuals and nations. Since the first significant use of chemical warfare in World War 1, issues surrounding chemical warfare... Date Added: 2009-01-11 19:14:41 |
| precept1 Path: Princeton >> COS >> 340 Fall, 2007 Description: Computer Science 340 Reasoning about Computation Precept 1 Problem 1 Discuss the unstacking game from the Lehman Leighton notes, Section 3.3. Problem 2 Show that if you pick a subset S of size 501 from the set {1, 2, . . . , 1000} then there must ex... Date Added: 2008-01-29 15:48:05 |
| lec26questions.pdf Path: Arizona >> NATS >> 101 Fall, 2008 Description: Hurricane Quiz The hurricanes eye is a region of a. updrafts x b. downdrafts Air flow from the center toward the outer edges occurs x a. At the top of the hurricane b. At the bottom of the hurricane c. In the middle of the hurricane Hurricane Quiz ... Date Added: 2009-01-10 17:46:35 |
| lec26questions.pdf Path: Arizona >> ATMO >> 199 Fall, 2008 Description: Hurricane Quiz The hurricanes eye is a region of a. updrafts x b. downdrafts Air flow from the center toward the outer edges occurs x a. At the top of the hurricane b. At the bottom of the hurricane c. In the middle of the hurricane Hurricane Quiz ... Date Added: 2009-01-12 04:56:18 |
| FinalReviewlist.doc Path: Texas Tech >> MATH >> 1351 Fall, 2008 Description: Proposed List of Review Problems for Calculus I MATH 1351 March 30, 2006 Disclaimer: This is what I consider a good review for the final exam and it is no indication of the actual problems that will be on the final. Most likely, none of these problem... Date Added: 2009-04-15 20:05:45 |
| Livestock Waste Testing Lab 0504.pdf Path: UF >> ABE >> 5707c Fall, 2008 Description: University of Florida/IFAS Livestock Waste Testing Laboratory Justin Jones and George Hochmuth North Florida Research and Education Center Suwannee Valley The Livestock Waste Testing Lab was created in 1990 through a USDA Hydrologic Unit Area Proj... Date Added: 2009-01-11 22:39:49 |
| Livestock Waste Testing Lab 0504.pdf Path: UF >> ABE >> 5707c Fall, 2008 Description: University of Florida/IFAS Livestock Waste Testing Laboratory Justin Jones and George Hochmuth North Florida Research and Education Center Suwannee Valley The Livestock Waste Testing Lab was created in 1990 through a USDA Hydrologic Unit Area Proj... Date Added: 2009-01-11 22:39:49 |
| Livestock Waste Testing Lab 0504.pdf Path: UF >> ABE >> 5707c Fall, 2008 Description: University of Florida/IFAS Livestock Waste Testing Laboratory Justin Jones and George Hochmuth North Florida Research and Education Center Suwannee Valley The Livestock Waste Testing Lab was created in 1990 through a USDA Hydrologic Unit Area Proj... Date Added: 2009-01-10 03:36:54 |
| BS_EnvironStudScience.pdf Path: Keene State >> PE >> 150 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:55 |
| BS_EnvironStudScience.pdf Path: Keene State >> SPED >> 460 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:56 |
| BS_EnvironStudScience.pdf Path: Keene State >> PE >> 460 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:55 |
| BS_EnvironStudScience.pdf Path: Keene State >> SPED >> 465 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:56 |
| BS_EnvironStudScience.pdf Path: Keene State >> PSYC >> 470 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:55 |
| BS_EnvironStudScience.pdf Path: Keene State >> PPS >> 0304 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-02-18 01:39:46 |
| BS_EnvironStudScience.pdf Path: Keene State >> PSYC >> 496 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:56 |
| BS_EnvironStudScience.pdf Path: Keene State >> PSYC >> 499 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:56 |
| BS_EnvironStudScience.pdf Path: Keene State >> ESEC >> 465 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:55 |
| BS_EnvironStudScience.pdf Path: Keene State >> SPED >> 401 Fall, 2008 Description: 2003-2004 Catalog Bachelor of Science ENVIRONMENTAL STUDIES Environmental Science Name: KEENE STATE COLLEGE Note: For advising support only. See catalog for full degree requirements. ID#: GENERAL EDUCATION ENGLISH LANGUAGE COMPETENCE: English 101-... Date Added: 2009-01-09 02:21:56 |
| 416.pdf Path: Maryland >> ECON >> 416 Fall, 2008 Description: Department of Special Education University of Maryland COURSE: SEMESTER: INSTRUCTOR: TEXT: EDSP 416/616(3 credits) Reading and Writing Instruction in Special Education I Spring, 2003 Steve Graham, College of Education (301-405-6493) sg23@umail.umd.... Date Added: 2009-02-03 13:58:23 |
| 2006winter homework 5 Path: UCLA >> CHEM >> 110a Spring, 2006 Description: ... Date Added: 2008-10-05 01:01:46 |
| ELECTRIC Path: Wisconsin >> STAT >> stat 200 Spring, 2009 Description: Time Period Year 1: Jan/Feb Year 1: March/Apr Year 1: May/June Year 1: July/Aug Year 1: Sept/Oct Year 1: Nov/Dec Year 2: Jan/Feb Year 2: March/Apr Year 2: May/June Year 2: July/Aug Year 2: Sept/Oct Year 2: Nov/Dec Year 3: Jan/Feb Year 3: March/Apr Ye... Date Added: 2009-04-14 22:51:27 |
| 345HandoutSober.pdf Path: Colorado State >> E >> 345 Fall, 2008 Description: Philosophy 345 Prof. Katie McShane Fall Term 2008 Sober\'s \"Philosophical Problems for Environmentalism\" \"Environmentalism,\" in Sober\'s usage, means a view that - cares about wholes (species, ecosystems) - neednt care about whether individuals suffer... Date Added: 2009-01-11 20:38:14 |
| AIClecturenotes.pdf Path: UGA >> FORS >> 8360 Fall, 2008 Description: Models Versus Full Reality: A review Fundamental assumption: there is no true model that generates biological data Truth in biological sciences has essentially infinite dimension; hence, full reality cannot be revealed with finite samples. Model se... Date Added: 2009-02-06 19:42:01 |
| Lecture5.ppt Path: Dallas >> BXT >> 043000 Fall, 2008 Description: Data and Applications Security Developments and Directions Dr. Bhavani Thuraisingham The University of Texas at Dallas Lecture #5 Assignment #1 on Access Control and Policies February 1, 2006 References q Lecture Notes q Text Book for Class q Additi... Date Added: 2009-02-18 02:20:36 |
| mt2_03key.pdf Path: Arizona >> ECON >> 518 Fall, 2008 Description: ... Date Added: 2009-01-11 19:58:58 |
| quiz5.pdf Path: Columbia SC >> MATH >> 511 Fall, 2008 Description: ... Date Added: 2009-02-02 20:10:49 |
| cds2006.pdf Path: Maine >> UMM >> 2006 Fall, 2008 Description: Common Data Set 2006-2007 GENERAL INFORMATION A0. Respondent Information (Not for Publication) Name Mary Stover Title Registrar Office Registrars Office Mailing Address, City/State/Zip 9 OBrien Avenue, Machias, ME 04654 Phone 207.255.1330 Fax 207.25... Date Added: 2009-02-11 21:38:11 |
| Quiz1sol.pdf Path: UGA >> MATH >> 1 Fall, 2004 Description: ... Date Added: 2009-02-06 19:52:46 |
| end-of-empire.ppt Path: Skidmore >> HI >> 202 Fall, 2009 Description: Diocletian,Constantineand theEndoftheRomanEmpire CapitolineMuseums PalazzodeiConservatoriMuseum:Courtyard ColossalstatueofConstantine:head Marble,cm260(=86) inv.MC0757 313324AD SourcesfortheEndofthe th RomanEmpire:4 5thc. Apologists Proponentso... Date Added: 2009-04-15 21:04:07 |
| sec2_w00.pdf Path: George Mason >> DPARKER >> 3 Fall, 2009 Description: ARE 155, Week 2 A Cost Minimization Example January 10, 2000 This part is true (Davis enterprise, 10/7/98): Packer fans just cant go to work Janesville Wis. (AP) Looks like the green-and-gold u has struck again. So many people called in sick to the... Date Added: 2009-04-16 01:26:04 |
| Lecture_3_-_2009 Path: Michigan State University >> MMG >> 433 Spring, 2009 Description: ... Date Added: 2009-02-15 18:35:43 |
| ch2b.ppt Path: Alabama Huntsville >> CS >> 413 Fall, 2008 Description: Control Flow We have: beq, bne, what about Branch-if-less-than? New instruction: if $s1 < $s2 then $t0 = 1 slt $t0, $s1, $s2 else $t0 = 0 Compiling a While Loop in C, Eg. Assume that i and k correspond to registers $s3 and $s5 and the base of t... Date Added: 2009-02-11 21:07:28 |
| MAE147-lecture 7 Path: UC Irvine >> MAE >> 147 Winter, 2008 Description: MAE 147 \"Vibrations\" Lecture 7 Instructor: Professor Andrei Shkel Email: ashkel@uci.edu Office: EG4208 Before we get started For next week Finishing Chapter 4 and starting Chapter 5 Quiz on Monday, Feb 4 Reading: Sections 4.3, 4.4, 4.5 (due Feb. 4th... Date Added: 2008-04-07 11:55:20 |
| phy664-20 Path: Ohio State >> PHYS >> 664 Fall, 2004 Description: ... Date Added: 2008-07-17 17:23:15 |
| anth142week9-2 Path: UCSB >> ANTH >> 142 Spring, 2006 Description: Week 9: Final Batch of Questions 1. According to Metcalf and Metcalf (\'India in the Nineties\'), what is Huntington\'s premise for \"The Clash of Civilizations,\" and why is it incorrect? There was deep & enduring differences/characteristics of Islam, In... Date Added: 2008-04-15 17:21:49 |
| Chapters 1- 5 Path: The University of Akron >> PSYCH >> 230 Spring, 2008 Description: Review Questions for Chapters 1 5 Chapter 1 1. What\'s the difference between a sample and a population? What do we call a characteristic of a sample? What do we call a characteristic of a population? 2. What is sampling error? 3. What is the diffe... Date Added: 2008-04-18 18:40:54 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 471 Spring, 2008 Description: ... Date Added: 2009-01-12 03:20:53 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 104 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:52 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 472 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:53 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 162 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:52 |
| Wind and Song.pdf Path: Illinois State >> THE >> 261 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:53 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 195 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:52 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 261 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:52 |
| Wind and Song.pdf Path: Illinois State >> MUS >> 452 Spring, 2008 Description: ... Date Added: 2009-01-12 03:20:53 |
| Wind and Song.pdf Path: Illinois State >> ART >> 261 Fall, 2008 Description: ... Date Added: 2009-01-12 03:20:52 |
| hw5f06 Path: Ohio State >> ECON >> 520 Fall, 2006 Description: Print name_ Sign name _ Econ 520 F 06 Section Day and Hour _ Homework 5 10/19, 10/24, 10/26, due 10/27 For full credit, show your calculations on each computational problem. 5.1 (24 homework points) Identify the lowest monetary aggregate that each... Date Added: 2008-07-17 15:38:49 |
| 050322economy.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Economy in Spotlight at EU Summit | Europe | Deutsche Welle | Search language selector German English Arabic Russian Chinese Portuguese for Brasil Spanish Albanian Amharic Arabic Bengali Bosnian Bulgarian Chinese Croatian Dari English French German ... Date Added: 2009-02-11 17:42:44 |
| Lec10.pdf Path: Delaware >> PHYS >> 133 Fall, 2008 Description: Assignments Read Ch. 5, Do Online Quiz #3 Written HW#3 now available online; due Mon. Reading & Online HWs updated on calendar. After class office hours today 5. Universal Laws of Motion If I have seen farther than others, it is because I have ... Date Added: 2009-01-11 22:38:27 |
| Lec10.pdf Path: Delaware >> PHYS >> 133 Fall, 2008 Description: Assignments Read Ch. 5, Do Online Quiz #3 Written HW#3 now available online; due Mon. Reading & Online HWs updated on calendar. After class office hours today 5. Universal Laws of Motion If I have seen farther than others, it is because I have ... Date Added: 2009-01-12 06:13:16 |
| ECE_5360_lab__4 Path: Cornell >> ECE >> 5360 Fall, 2008 Description: Lab # 4 Patterning the Source/Drain Ion Implant In this lab, you will receive your wafers back in the same condition as you left them in Lab # 3. You will then apply photoresist on top of your patterned Field Oxide using the spinner and then pattern ... Date Added: 2009-04-04 16:15:06 |
| USEM Creation Essay Path: Brandeis >> USEM >> 18A Fall, 2006 Description: Matthew Zabinsky Page 1 4/18/2008 The doctrine of creation is not an ambiguous aspect of the Bible. The first four chapters of Genesis contain the primary biblical information on creation; therefore they provide the basis of the biblical doctrine.... Date Added: 2008-04-17 19:25:51 |
| wright87.pdf Path: Humboldt State University >> ECON >> 3 Fall, 2009 Description: ... Date Added: 2009-04-16 01:03:50 |
| wright87.pdf Path: Humboldt State University >> ECON >> 323 Fall, 2008 Description: ... Date Added: 2009-04-16 01:03:50 |
| 03spex3a Path: Wisconsin >> MATH >> 113 Spring, 2007 Description: ... Date Added: 2008-08-08 14:58:50 |
| RethinkingProgramReviewIntro.pdf Path: Texas Tech >> ENGL >> 5390 Fall, 2008 Description: Introduction SUMMARY Considers the nature of academic program review and assessment in technical communication Examines the themes represented in the articles published in this issue Acknowledging Complexity: Rethinking Program Review and Assessme... Date Added: 2009-02-03 13:35:29 |
| Transition to Bebop Path: LSU >> MUS >> 2000 Spring, 2008 Description: Transition from Swing to Bebop Charlie Christian - Breakfast Feud Charlie Christian w/ Goodman sextet. Blues form. This is a compilation of several solos. Each solo is introduced by a 4 bar phrase. First example of amplified electric guitar. Django R... Date Added: 2008-04-17 17:33:37 |
| 122.pdf Path: Berkeley >> ART >> 122 Fall, 2008 Description: Recognition by Association via Learning Per-exemplar Distances Tomasz Malisiewicz Alexei A. Efros The Robotics Institute, Carnegie Mellon Universtity {tmalisie,efros}@cs.cmu.edu Abstract We pose the recognition problem as data association. In this s... Date Added: 2009-02-02 16:59:15 |
| Lec3_07 Path: Cornell >> BIOAP >> 3110 Fall, 2007 Description: Lec3- 2007 INTRODUCTORY ANIMAL PHYSIOLOGY BIOAP 311/VETBM 346 FALL 2007 OUTLINE - LECTURE 3 Energy, Gradients and the 2nd Law of Thermodynamics (Readings - Chapter 1,pp.8-9, Lecture notes) I. Major Topics/Concepts to be covered: 1. 2. 3. 4. The need... Date Added: 2008-08-31 13:54:54 |
| 336.pdf Path: Cal Poly >> MATH >> 336 Winter, 2008 Description: September 2008 MATH 336 1. Combinatorial Mathematics Catalog Description MATH 336 Combinatorial Mathematics (4) Methods of enumerative combinatorics: sum, product, and division rules, bijective and recursive techniques, inclusion and exclusion, g... Date Added: 2009-02-02 13:47:08 |
| PS 3 Sol Path: Wisconsin >> ECON >> 101 Spring, 2008 Description: Problem Set 3 Solutions ECON 101-Spring 2008 Problem 1 i. Beef The slope of this budget line is (-20/100)=-1/5. 20 100 ii. Beef 30 25 20 Chicken Note that the indifference curves are in fact straight lines, as Ben has constant linear preferences ... Date Added: 2008-07-13 03:20:37 |
| ps308sol Path: Wisconsin >> ECON >> 101 Spring, 2008 Description: Problem Set 3 Solutions ECON 101-Spring 2008 Problem 1 i. Beef The slope of this budget line is (-20/100)=-1/5. 20 100 ii. Beef 30 25 20 Chicken Note that the indifference curves are in fact straight lines, as Ben has constant linear preferences ... Date Added: 2008-08-08 16:28:21 |
| 6 summary Path: Temple >> ANTHRO >> rj Spring, 2009 Description: Summary 5&6 Race and Judaism 2/8/09 In Michael Bantons Racial Theories, the idea of race as a status is discussed. The effects of whites on blacks and the effects of blacks on whites in social situations is looked at from the aspect of caste and cla... Date Added: 2009-04-11 22:10:32 |
| FLF401Marguerite.pdf Path: N.C. State >> FLF >> 401 Fall, 2008 Description: ... Date Added: 2009-01-10 17:53:43 |
| Soln05061 Path: Lehigh >> MECH >> 003 Spring, 2007 Description: COSMOS: Complete Online Solutions Manual Organization System Chapter 5, Solution 61. (a) Note that in the free-body diagram: R1 = 1 ( 4.2 m )( 600 N/m ) = 1260 N, 2 and R2 = 1 ( 4.2 m )( 240 N/m ) = 504 N 2 R = 1764 N Then for the equivalence of... Date Added: 2008-02-26 12:47:12 |
| MultReg01.pdf Path: Virginia Tech >> STAT >> 5606 Fall, 2008 Description: Multiple Linear Regression Multiple linear regression analyzes the relationship between one quantitative response, Y, and multiple quantitative explanatory variables, X1, X2, ., Xk. 1. The model has the form Y = 0 + 1X1 + 2X2 + + kXk + e 2. k hypoth... Date Added: 2009-02-18 00:42:08 |
| 1727.148.ps Path: Hawaii >> SOEST >> 1727 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207369349.0388276 Float: 1727 Profile: 148 Location: 32.2N 148.9E Date: 05/19... Date Added: 2009-02-17 20:03:07 |
| Pratica_Exam Path: Cornell >> PORT >> 2090 Fall, 2008 Description: Preencher usando uma forma do Perfeito / Imperfeito/ Mais-que-Perfeito ou Infinito Pessoal Ateno sequncia dos tempos verbais. Quando houver mais de uma possibilidade, por exemplo o pefeito ou imperfeito, etc., sem mudar o significado, escreva ambas ... Date Added: 2009-02-01 20:01:19 |
| Bradfords_law_JDoc.pdf Path: Arizona >> DLIST >> 2123 Fall, 2008 Description: The current issue and full text archive of this journal is available at www.emeraldinsight.com/0022-0418.htm Practical potentials of Bradfords law: a critical examination of the received view Jeppe Nicolaisen and Birger Hjrland Royal School of Libra... Date Added: 2009-02-04 13:58:01 |
| Physics 559 Lec_2.pdf Path: Washington >> ATM S >> 559 Spring, 2008 Description: Physics 559 Lecture 2 The Strong Interactions II: The QCD Improved Parton Model As we did for the case of the electroweak theory, we can use the QCD Lagrangian noted at the end of the last lecture to define the Feynman rules for the interaction of q... Date Added: 2009-02-02 20:31:59 |
| ma010.pdf Path: Ohio State >> MATH >> H162 Fall, 2008 Description: MA 010 Tutor Room Schedule WI 09 Monday TIME 9:30-10:30 10:30-11:30 11:30-12:30 12:30-1:30 1:30-2:30 2:30-3:30 3:30-4:30 MA 010 Tuesday MA 010 Wednesday MA 010 Thursday MA 010 Friday MA 010 This room is open during normal MSLC hours. Math 148 and 1... Date Added: 2009-01-10 03:12:11 |
| Chapter 15 Decision Making.ppt Path: UCF >> MAN >> 4240 Fall, 2008 Description: Please Silence Your Cell Phone Questions and Announcements Chapter 15 Decision Making Reminders Compare Two Types of Decisions Differentiate Two Main Models of Decision Making Identify Main Sources of Errors in Decision Making Describe Advantages a... Date Added: 2009-01-10 02:29:26 |
| lect_6_1113_volcanoes_1_07.ppt Path: Arkansas >> GEOL >> 1113h Fall, 2008 Description: Chapter4Volcanism&ExtrusiveRocks Photo Credit: S. Young Quiz #1 GEOL1113H - Chapter 3 Tuesday, September 11, 2007 1. Mafic magma is generated at divergent boundaries because of water under pressure magmatic underplating melting in the lithosph... Date Added: 2009-01-11 21:16:50 |
| 041103budget.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Interfax : Slovakia 03.11.2004 06:58:00 GMT Slovak budget deficit tops SKK 30 bn in October Slovakia\'s state budget deficit rose to SKK 30.53 bn in October, up from SKK 29.4 bn at the end of September, according to figures released by the Slovak Fin... Date Added: 2009-02-11 20:23:44 |
| 060404skills.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: business.iafrica.com | business news Loss of white skills threatens SAClose Window | Print this story business.iafrica.com MORE BUSINESS NEWS:Govt plans property disposals House price growth slowest in 4 years LeisureNet man \'shocked\' at kickback Mit... Date Added: 2009-02-11 19:31:46 |
| 060404skills.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: business.iafrica.com | business news Loss of white skills threatens SAClose Window | Print this story business.iafrica.com MORE BUSINESS NEWS:Govt plans property disposals House price growth slowest in 4 years LeisureNet man \'shocked\' at kickback Mit... Date Added: 2009-02-11 20:30:07 |
| suggactionspol.pdf Path: Rutgers >> CWGL >> 08 Fall, 2008 Description: 16 Dni Akcji Przeciwko Przemocy ze Wzgldu na Pe 25 listopada 10 grudnia, 2008 Przewodnik dla nowych dziaaczy/dziaaczek, chccych zaangaowa si Kampani Jeli nie braa/brae dotd udziau w Kampanii 16 Dni, w niniejszym dokumencie znajdziesz kilka sugestii ... Date Added: 2009-02-04 14:56:21 |
| F06_7103_Assgt2.doc Path: LSU >> CSC >> 7103 Fall, 2008 Description: CSC 7103 Fall 2006 Assignment 2 (Due: Dec 1) We will modify the previous experimental setup to develop an updated clustering and distributed transaction management system. Assume the following: 1. Each node has a battery characterized by residual ... Date Added: 2009-01-11 16:32:22 |
| IDS 420 Syllabus Fall 2006.pdf Path: Ill. Chicago >> IDS >> 420 Fall, 2008 Description: IDS 420 Fall 2006 Business Models Simulation Prof. James K. Ho http:/www.uic.edu/~jimho e-mail: jimho @ uic.edu Section # 25394/25395 TR 9:30-10:45 SCE408 Blackboard Site: IDS420F06 Office: UH 2407 Scope: With advances in information technology and ... Date Added: 2009-02-03 13:49:37 |
| Ag Econ Misc notes 1 Path: Colorado State >> AREC >> 202 Spring, 2008 Description: Ag Econ Extra notes If marginal utility is positive, the consumer must be buying too little to maximize use total utility marginal utility price = positive (not buying enough) no consumer will rationally purchase where the marginal utility is nega... Date Added: 2008-04-07 11:20:11 |
| chem 211 exam Path: Cornell >> CHEM >> 211 Spring, 2002 Description: ... Date Added: 2008-03-05 15:51:59 |
| History of Evolutionary Thought Path: LSU >> ANTH >> 1001 Spring, 2008 Description: History of Evolutionary Thought Principal individuals in the history of evolutionary thought: -Karl von Linn aka Carolus Linnaeus -Principle of the Fixity of Species -All species were created by God, and species were unchangeable. -Jean Baptiste Lama... Date Added: 2008-04-17 21:19:42 |
| econ2.2ndmid.eudey.S06.pdf Path: UPenn >> ECON >> 002 Fall, 2008 Description: Suggested Answers to Second Midterm Exam, Econ 2, Spring 2006 Part 1: International Markets (8 points, 16 minutes) 1. (6 points, 12 minutes) a. (2 points, 4 minutes) On the following page, show the international capital market graphs with the world ... Date Added: 2009-02-06 17:41:30 |
| econ2.2ndmid.eudey.S06.pdf Path: UPenn >> ECON >> 2 Fall, 2008 Description: Suggested Answers to Second Midterm Exam, Econ 2, Spring 2006 Part 1: International Markets (8 points, 16 minutes) 1. (6 points, 12 minutes) a. (2 points, 4 minutes) On the following page, show the international capital market graphs with the world ... Date Added: 2009-02-06 17:41:30 |
| Hwk4Solns Path: Columbia >> PHYS >> 1402 Spring, 2008 Description: Assignment 4 Solutions Chpt 26 1. (a) The charge that passes through any cross section is the product of the current and time. Since t = 4.0 min = (4.0 min)(60 s/min) = 240 s, q = it = (5.0 A)(240 s) = 1.2 103 C. (b) The number of electrons N is give... Date Added: 2008-04-08 07:46:34 |
| 1739.201.ps Path: Hawaii >> SOEST >> 1739 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207373314.0388276 Float: 1739 Profile: 201 Location: 40.3N 160.2E Date: 03/18... Date Added: 2009-02-17 20:21:31 |
| 344final00.pdf Path: Idaho >> GEOL >> 344 Spring, 2008 Description: GEOL/GEOE 444: EARTHQUAKES AND SEISMIC HAZARDS (SPRING 2000) FINAL EXAM NAME: _ TIME AVAILABLE: 120 MINUTES TOTAL POINTS: 150 Instructions: There are several pages of questions. Take a minute or so now to leaf through the entire exam and to get a... Date Added: 2009-02-06 20:40:16 |
| cm6_barber_scifi.ppt Path: Illinois Tech >> CM >> 6 Fall, 2008 Description: Plans for Sci-Fi Prototyping. Contents:- Mechanical Layout of Sci-Fi Design of the Fibre Optic Connectors Design Issues Still to be Addressed Future Plans This work is being undertaken by Imperial College and Liverpool University physics Department ... Date Added: 2009-02-17 23:24:15 |
| cse543-f07-net.pdf Path: Penn State >> CSE >> 543 Fall, 2008 Description: CSE 543/Fall 2007 - Homework Due: Thursday, December 6, 2007 Professor Trent Jaeger Please read the instructions and questions carefully. You will be graded for clarity and correctness. Write legibly and check your answers before handing it in. Do y... Date Added: 2009-01-11 17:43:13 |
| MPDnotesv1.0.pdf Path: Arizona >> CS >> 422 Spring, 2009 Description: CSc 422 - MPD Notes Version 1.0 March 13, 2008 MPD Notes These notes are general. They contain items that are specific to assignments this semester and items that may not directly apply. Since I have notes that I have included with assignments fro... Date Added: 2009-04-15 23:00:32 |
| chap018 Path: American Dubai >> BUSINESS >> mgmt313 Spring, 2009 Description: 1 McGraw-Hill/Irwin 2006 The McGraw-Hill Companies, Inc., All Rights Reserved. 2 Chapter 18 Synchronous Manuf acturin g and Theor y of Cons traint s McGraw-Hill/Irwin The McGraw-Hill Companies, Inc., 2006 3 OBJECTIVES Goldratts Rules Goldr... Date Added: 2009-04-08 12:18:11 |
| TR_96-29.pdf Path: Maryland >> TOMOS >> 5830 Fall, 2008 Description: TECHNICAL RESEARCH REPORT Hybrid Network Management by J.S. Baras, M. Ball, R.K. Karne, D. Whitefield, etc. CSHCN T.R. 96-11 (ISR T.R. 96-29) The Center for Satellite and Hybrid Communication Networks is a NASA-sponsored Commercial Space Center al... Date Added: 2009-02-06 19:30:50 |
| TR_96-29.pdf Path: Maryland >> LIB >> 1903 Fall, 1920 Description: TECHNICAL RESEARCH REPORT Hybrid Network Management by J.S. Baras, M. Ball, R.K. Karne, D. Whitefield, etc. CSHCN T.R. 96-11 (ISR T.R. 96-29) The Center for Satellite and Hybrid Communication Networks is a NASA-sponsored Commercial Space Center al... Date Added: 2009-02-06 19:18:01 |
| TR_96-29.pdf Path: Maryland >> LIB >> 5830 Fall, 2008 Description: TECHNICAL RESEARCH REPORT Hybrid Network Management by J.S. Baras, M. Ball, R.K. Karne, D. Whitefield, etc. CSHCN T.R. 96-11 (ISR T.R. 96-29) The Center for Satellite and Hybrid Communication Networks is a NASA-sponsored Commercial Space Center al... Date Added: 2009-02-06 19:18:01 |
| TR_96-29.pdf Path: Maryland >> TOMOS >> 1903 Fall, 1920 Description: TECHNICAL RESEARCH REPORT Hybrid Network Management by J.S. Baras, M. Ball, R.K. Karne, D. Whitefield, etc. CSHCN T.R. 96-11 (ISR T.R. 96-29) The Center for Satellite and Hybrid Communication Networks is a NASA-sponsored Commercial Space Center al... Date Added: 2009-02-06 19:30:50 |
| 6 Path: Texas Tech >> ARCH >> 2351 Spring, 2008 Description: Thursday, September 6, 2007 Http:/www.arch.ttu.edu/people/faculty/PowellR/Classes/2007/Fall/2351 Chapter 3: Loads on Buildings Load Types- Gravity Loads, Lateral Loads Units of Measurement: Pounds Kips; a kip = 1,000 pounds Loads even distributed ove... Date Added: 2008-04-07 22:22:41 |
| BardhanMook2006EcJ.pdf Path: BU >> SED SE >> 598 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-12 04:22:25 |
| BardhanMook2006EcJ.pdf Path: BU >> SED DE >> 690 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-12 04:22:25 |
| BardhanMook2006EcJ.pdf Path: BU >> SAR HP >> 839 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-09 07:37:12 |
| BardhanMook2006EcJ.pdf Path: BU >> SED SE >> 807 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-12 04:22:25 |
| BardhanMook2006EcJ.pdf Path: BU >> SED DE >> 691 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-12 04:22:25 |
| BardhanMook2006EcJ.pdf Path: BU >> SAR HP >> 870 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-09 07:37:12 |
| BardhanMook2006EcJ.pdf Path: BU >> SMG LA >> 346 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-12 04:22:26 |
| BardhanMook2006EcJ.pdf Path: BU >> SED DE >> 692 Fall, 2008 Description: The Economic Journal, 116 (January), 101127. Royal Economic Society 2006. Published by Blackwell Publishing, 9600 Garsington Road, Oxford OX4 2DQ, UK and 350 Main Street, Malden, MA 02148, USA. DECENTRALISATION AND ACCOUNTABILITY IN INFRASTRUCTURE ... Date Added: 2009-01-12 04:22:25 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
