Course Solutions And Notes - l10 0d
| ECE412_HW0.pdf Path: New Mexico >> ECE >> 412 Fall, 2009 Description: ECE/CS 433 Introduction to Computer Graphics, Fall 2008 Homework 0 Not to be submitted, but should be completed by September 10 This short practice homework assignment will help you get set up with the necessary infrastructure and software we will b... Date Added: 2009-04-26 07:05:42 |
| ps4-09-typo-and-notes.pdf Path: Washington >> OC >> 512 Fall, 2009 Description: 1 GFD-1 AS509/OC512 Problem Set 4 notes and two typos corrected in green Out: Tuesday 24 February 200 Back: Wednesday 4 March 2009 1. Rossby waves. With a single-layer fluid of constant density, consider Rossby waves forced by wind. The wind appears... Date Added: 2009-04-26 07:06:24 |
| Lab2.pdf Path: UCSD >> CSE >> 022 Fall, 2009 Description: CSE 3 Lab 2 The purpose of this lab section is to 1) 2) 3) 4) 5) 6) Create a new folder for this lab in My Documents/CSE3/Lab2. (Note the capitalization; no spaces!) Perform a couple web searches to learn more about RGB and CMYK color models. Create ... Date Added: 2009-04-26 07:06:55 |
| Handout_antimicrobials.ppt Path: JMU >> BIO >> 280 Fall, 2008 Description: Antimicrobial Drugs I. Terminology of chemotherapy II. Where antimicrobial drugs come from III. How antimicrobials work IV. Drug resistance V. Interactions between drugs and hosts VI. Selecting the right antimicrobial drug I. Terms When a drug is us... Date Added: 2009-04-26 07:07:26 |
| summary.doc Path: Georgia Tech >> ECE >> 4007 Fall, 2008 Description: ECE4884 / 4007 Project Summary Project Title Team Members (names and majors) Reactive Diversity Array Wi-Fi Jammer Joe Barry, CmpE Kettan Bivek, EE Adam McDaniel, EE Jeff Pitcher, EE Advisor / Section Semester Project Abstract (250-300 words) Dr. M... Date Added: 2009-04-26 07:08:20 |
| Solution_03.pdf Path: Georgia Tech >> PHYSICS >> 3201 Spring, 2009 Description: ... Date Added: 2009-04-26 07:10:31 |
| lecture7_1.pdf Path: Michigan >> EECS >> 598 Fall, 2008 Description: UsingSpinImagesforEfficientObjectRecognitioninCluttered3DScenes [A.JohnsonandM.Hebert,1999] Wongun Choi Khuram Sh hid Kh Shahid Outline Localvs.GlobalFeatures DescriptorRequirements D i R i SpinImageDescriptor SpinImageParameters SpinImageCompariso... Date Added: 2009-04-26 07:10:48 |
| ME687HW3F2008.pdf Path: Purdue >> ME >> 687 Fall, 2009 Description: ME 687 Homework #3 Due Thursday, November 20, 2008 Prof. Robert P. Lucht (Email: lucht@purdue.edu) 1. A combustion researcher wants to measure NO using linear LIF at a particular location in a combustor where the temperature is 2200 K and the pressur... Date Added: 2009-04-26 07:12:09 |
| 10-4thinksIthink-31.doc Path: California State University, Monterey Bay >> ENGL >> 102 Fall, 2009 Description: English 102-31 Itai Halevi February 25, 2009 Assignment #10: 4 Thinks I think of when I think of Pollan Now that we have gone through our first reading and discussion of Pollan\'s \"Age of Nutritionism\", I would like to start examining and testing his ... Date Added: 2009-04-26 07:17:20 |
| Math130week9.pdf Path: Allan Hancock College >> MATH >> 130 Fall, 2009 Description: Recapitulation Introduction to integration The definite integral The fundamental theorem of calculus Math 130: Calculus Frank Valckenborgh Department of Mathematics Macquarie University, Sydney fvalcken@maths.mq.edu.au Tuesday, 9 October 2007 incl... Date Added: 2009-04-26 07:19:00 |
| hydrogen_transitions.pdf Path: Embry-Riddle FL/AZ >> PS >> 350 Fall, 2009 Description: ... Date Added: 2009-04-26 07:20:12 |
| lecture17.pdf Path: Michigan State University >> BE >> 825 Fall, 2008 Description: Lecture 17. Properties of nanomaterials - Fundamentals 1. The periodic table From: http:/www.dayah.com/periodic/ The periodic table is an arrangement of the atoms (called elements) that groups them according to similar properties. The vertica... Date Added: 2009-04-26 07:20:25 |
| 31295005954648.pdf Path: Texas Tech >> ETD >> 02262009 Fall, 2009 Description: SYNTHESIS OF NEUTRAL AND PROTON-lONIZABLE CROWN ETHERS by JOSEPH ALOYSIUS MCDONOUGH, B.S. A DISSERTATION IN CHEMISTRY Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PH... Date Added: 2009-04-26 07:20:57 |
| HW2.pdf Path: Texas A&M >> CHEM >> 489 Fall, 2008 Description: CHEM489 Spring2009 1) D.J.Darensbourg HW#2Due:02.10.2009 a. A process has a total atom economy of 87% with a selectivity of 60%. If a competing process producing the same products has a total atom economy of 75%, what selectivity must the process ... Date Added: 2009-04-26 07:21:35 |
| 2007316_f02t_064595.pdf Path: Stanford >> FOXH >> 1036 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 KEKER & VAN NEST, LLP ROBERT A. VAN NEST - #84065 ASIM M. BHANSALI - #194925 PAULA L. BLIZZARD - #207920 BROOK DOOLEY - #230423 710 Sansome Street San Francisco, CA 94111-1704 Telephone: (415) 391-5400 Facsimile: (415) 397-7188 Att... Date Added: 2009-04-26 07:23:11 |
| lecture5_projections_embedding.ppt Path: CSU Channel Islands >> ICS >> 278 Fall, 2009 Description: ICS278:DataMining Lecture5:LowDimensionalRepresentationsof HighDimensionalData DataMiningLecturesLecture5:DimensionReductionPadhraicSmyth,UCIrvine Todayslecture ExtendprojectproposaldeadlinetoMonday,8am:questions? Outlineoftodayslecture: orph... Date Added: 2009-04-26 07:23:14 |
| ehealth-spectrum-integration.pdf Path: UNC >> READ >> 3962583 Fall, 2009 Description: User Guide October 2005 eHealth SPECTRUM Integration Whether you are a large enterprise or a service provider, your operations team faces a significant challenge maintaining critical service levels across complex network environments. eHealth SPECTR... Date Added: 2009-04-26 07:25:37 |
| 563.11.1%20Java%20Card%20Programming.ppt Path: University of Illinois, Urbana Champaign >> CS >> 598 Fall, 2008 Description: 563.11.1 Java Card Programming: Overview Presented by: Raman Sharykin PISCES Group: Soumyadeb Mitra, Sruthi Bandhakavi, Ragib Hasan, Raman Sharikyn University of Illinois Spring 2006 Overview Java Cards Java Card/Terminal System Features of Java... Date Added: 2009-04-26 07:26:54 |
| k517-let.pdf Path: W. Alabama >> KV >> 517 Fall, 2009 Description: Die Alte (KV 517) fr eine Singstimme mit Begleitung des Pianoforte Gedicht von Friedr. von Hagedorn Ein bischen durch die Nase (a bit through the nose). Singstimme. Wolfgang Amadeus Mozart (1756-1791) 2 4 1. Zu mei ner Zeit, zu mei ner Zeit 2. Zu m... Date Added: 2009-04-26 07:27:18 |
| Chang_Hong_200412_phd.pdf Path: Georgia Tech >> ETD >> 11222004 Fall, 2009 Description: Hydraulic Fracturing in Particulate Materials A Thesis Presented To The Academic Faculty by Hong Chang In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the School of Civil and Environmental Engineering Georgia Ins... Date Added: 2009-04-26 07:28:30 |
| ho03.pdf Path: Yale >> CS >> 461 Fall, 2009 Description: YALE UNIVERSITY DEPARTMENT OF COMPUTER SCIENCE CPSC 461b: Foundations of Cryptography Professor M. J. Fischer Handout #3 February 12, 2009 Three Proofs of a Simple Lemma We give three proofs of a claim from the textbook: Claim 2.5.2.1: There exist... Date Added: 2009-04-26 07:30:31 |
| xiao_jiang_200608_phd.pdf Path: Georgia Tech >> ETD >> 05262006 Fall, 2009 Description: Spin-transfer Torque in Magnetic Nanostructures A Thesis Presented to The Academic Faculty by Jiang Xiao In Partial Fulllment of the Requirements for the Degree Doctor of Philosophy School of Physics Georgia Institute of Technology August 2006 S... Date Added: 2009-04-26 07:31:00 |
| datalink-overview.pdf Path: Yale >> CS >> 433 Fall, 2009 Description: Datalink Layer 4/14/2008 Admin Assignment 4 MAC examples survey: GSM/3G Wireless Cable Modem (DOCSIS) Remaining class schedule 2 Recap Recap: The Hourglass Architecture of the Internet Telnet Email FTP WWW TCP UDP IP Ethernet Wireless FDDI... Date Added: 2009-04-26 07:31:05 |
| key9.doc Path: Clarkson >> CM >> 241 Fall, 2009 Description: CM241-01 Key for Hour Exam III 11/25/02 1. Relative concentration of enantiomer: 12 / 24 = 0.5 (optical purity) Percentage of two enantiomers: (1-0.5)/2 = 25%; (1-0.5)/2+0.5 = 75% 2. 3. (a) enantiomers (b) diastereomers Cl H CH3 H 3C H H CH3 H 3C... Date Added: 2009-04-26 07:33:22 |
| smiththesis.pdf Path: Fayetteville State University >> ETD >> 11142005 Fall, 2009 Description: THE FLORIDA STATE UNIVERSITY COLLEGE OF ARTS AND SCIENCES SOCIAL ANXIETY AND SELECTIVE ATTENTION: A TEST OF THE VIGILANCE-AVOIDANCE MODEL By JULIA D. SMITH A Thesis submitted to the Department of Psychology in partial fulfillment of the requirement... Date Added: 2009-04-26 07:33:50 |
| Final_DissPDF.pdf Path: Fayetteville State University >> ETD >> 05162005 Fall, 2009 Description: THE FLORIDA STATE UNIVERSITY COLLEGE OF ARTS AND SCIENCES WRITING FROM THE INSIDE OUT: CONNECTING SELF AND COMMUNITY IN THE FIRST-YEAR WRITING CLASSROOM By AMY HODGES HAMILTON A Dissertation submitted to the Department of English in partial fulfill... Date Added: 2009-04-26 07:34:40 |
| checksum.pdf Path: Wilfrid Laurier >> CPSC >> 441 Fall, 2009 Description: 7 8 2 9 2 \' ! \" \" ) * 4 04 #$ \' ( #$ + , 5 22 6% . 92 r 22 2 #: 6 ; 2 2 \' /0 1 2 2 !0 $ \' . - 03 . 92 0 2 9 2 #: 6 2 ; - 2 0 22 0 ? CPSC 441: 2 < ; => CPSC 441: 1 * ! ! ! ! #: #1 #$ ! ! ) @.7 2 6 22 2 6 2 & \'... Date Added: 2009-04-26 07:37:00 |
| feedcosts.doc Path: Iowa State >> MR >> 0309 Fall, 2009 Description: Iowa Farmer Today 03-03-07 07 looks good despite feed costs By Jeff DeYoung, Iowa Farmer Today Higher feed costs will cut into hog industry profitability, but 2007 is looking more promising than it may have a couple of months ago. Shane Ellis, Iowa S... Date Added: 2009-04-26 07:38:15 |
| T_EX_AVG.txt Path: Michigan State University >> GEO >> 3769 Fall, 2009 Description: DAILY EXTREME AND AVERAGE TEMPERATURES FOR HESPERIA (1948-80) DATE HI LOW AVG HI LOW AVG HI LOW AVG MAX MAX MAX MIN MIN MIN MEAN MEAN MEAN 01/01 049 010 30 028 ... Date Added: 2009-04-26 07:40:12 |
| nppc.doc Path: Iowa State >> PUBLIC >> 0525 Fall, 2009 Description: CattleNetwork.com, KS 05-25-07 NPPC: U.S.-South Korea Trade Deal Best Ever For Pork WASHINGTON, D.C., May 25, 2007 U.S. pork producers will receive an additional $10 per pig once the U.S.-South Korea Free Trade Agreement is fully implemented, accord... Date Added: 2009-04-26 07:40:32 |
| nppc.doc Path: Iowa State >> MR >> 0525 Fall, 2009 Description: CattleNetwork.com, KS 05-25-07 NPPC: U.S.-South Korea Trade Deal Best Ever For Pork WASHINGTON, D.C., May 25, 2007 U.S. pork producers will receive an additional $10 per pig once the U.S.-South Korea Free Trade Agreement is fully implemented, accord... Date Added: 2009-04-26 07:40:32 |
| Leafdevreading.pdf Path: Campbell >> BIOLOGY >> 202 Fall, 2009 Description: Biology 202 Botany Leaf development supplemental reading Introduction Leaves have very specific shape and structure. Each leaf has an origin in a very small group of cells that are derived from the apical meristem. Forming a leaf with the proper sha... Date Added: 2009-04-26 07:41:04 |
| errata_problems.pdf Path: University of Dayton >> ECE >> 562 Fall, 2009 Description: 1 Problem 2.13: The matrix A should be ERRATA in Problems First Printing A = ,0 1 1 0 Problem 3.8: De ne the process xn as follows xn = A cosn! + and, in part c, let ! be a random variable that is uniformly distributed over the interval !0 , ; ... Date Added: 2009-04-26 07:41:10 |
| James.Geomorph.2003.pdf Path: S.F. State >> GEOG >> 312 Fall, 2009 Description: ARTICLE IN PRESS Geomorphology xx (2003) xxx xxx www.elsevier.com/locate/geomorph Glacial erosion and geomorphology in the northwest Sierra Nevada, CA L. Allan James * Department of Geography, University South Carolina, Columbia, SC 29208, USA Rec... Date Added: 2009-04-26 07:43:11 |
| Ex3a_05.pdf Path: ESF >> FOR >> 557 Fall, 2009 Description: FOR557 05 Projections and Datums (Version 1) Overview Exercise 3a This exercise is designed to show you some of the problems you can get into with projections and datums. The most important one is the \"where did my data go\" problem. THE QUESTIONS ... Date Added: 2009-04-26 07:43:17 |
| powerchart.pdf Path: UC Davis >> AGR >> 205 Fall, 2009 Description: ... Date Added: 2009-04-26 07:43:58 |
| assign04.doc Path: Lock Haven >> C >> 460 Fall, 2009 Description: Computer Science 460 Fall 2006 Homework #4 Due Date: Points: Friday, October 13th, at the beginning of class 35 Problem 1 Use the Flex utility on Penguin to create a function that recognizes tokens from the C-Minus (C-) language described in Appendi... Date Added: 2009-04-26 07:44:52 |
| CA-LatticeGases.pdf Path: University of Illinois, Urbana Champaign >> CS >> 498 Fall, 2008 Description: ... Date Added: 2009-04-26 07:45:06 |
| interpreting_regression_analysis_results.pdf Path: Rutgers >> ECON >> 102 Fall, 2009 Description: ... Date Added: 2009-04-26 07:45:28 |
| ME340_Lab04__handout_1_DOF_transient.pdf Path: University of Illinois, Urbana Champaign >> ME >> 340 Fall, 2008 Description: ME340 Lab 4 Handout One Degree-of-Freedom Transient Response Analysis Due in Lab 5 Objectives 1. Understand the differences between underdamped, critically damped, and overdamped systems. 2. Investigate the effect of changing inertia, stiffness, an... Date Added: 2009-04-26 07:46:08 |
| Midterm2008Solution.pdf Path: UNC >> BIOS >> 760 Fall, 2008 Description: Solution to BIOS760 Midterm 2008 1. (a) -ay y=0 e = -a y y=0 (e ) a-1 (1 - e-a ), c2 = a(1 - e-a )-1 . i. Note that = (1 - e-a )-1 . Thus c1 = 1 - e-a . Since 1 -au du 0 e = P (X x) = P (Y > x , X x) + P (Y = x , X x) + P (Y < x , X x) =... Date Added: 2009-04-26 07:49:59 |
| EconomistJan05.doc Path: Middlebury >> ENVS >> 0401 Fall, 2009 Description: The Economist January 22, 2005 U.S. Edition HIGHLIGHT: A sceptical look at corporate social responsibility BODY: Companies today are exhorted to be \"socially responsible\". What, exactly, does this mean? It will no longer do for a company to go quietl... Date Added: 2009-04-26 07:50:55 |
| Lester_rl_1956.pdf Path: Caltech >> ETD >> 03262004 Fall, 2009 Description: ... Date Added: 2009-04-26 07:51:02 |
| G020553-00.pdf Path: Caltech >> G >> 020553 Fall, 2009 Description: Status of LIGO Peter Shawhan (LIGO Lab / Caltech) For the LIGO Scientific Collaboration Gravitational Wave Data Analysis Workshop Kyoto, 17 December 2002 Thanks to Gabriela Gonzlez, Michael Landry, Gary Sanders, and David Shoemaker GWDAW, Kyoto, 17 ... Date Added: 2009-04-26 07:51:30 |
| Schuhmann_r_1924.pdf Path: Caltech >> ETD >> 06252004 Fall, 2009 Description: ... Date Added: 2009-04-26 07:52:47 |
| Dillon_rt_1929.pdf Path: Caltech >> ETD >> 03232005 Fall, 2009 Description: ... Date Added: 2009-04-26 07:52:51 |
| ect_student_social_SP02.pdf Path: NYU >> ELO >> 204 Fall, 2009 Description: New York University A private University in the public service The Steinhardt School of Education Department of Administration, Leadership, and Technology Program in Educational Communication & Technology Presents ECT Student Socials To facilitate th... Date Added: 2009-04-26 07:53:05 |
| lab7b.pdf Path: Delaware >> EE >> 309 Fall, 2009 Description: ... Date Added: 2009-04-26 07:54:09 |
| spring_01.doc Path: University of Iowa >> CEE >> 020 Fall, 2009 Description: 53:010/020 CEE First-Year/Sophomore Seminar Spring 2001 3:30 4:20 Alternate Tuesdays, 1505 SC Prof. Forrest M. Holly Jr.; 205A Brady Building; 5-5229 forrest-holly@uiowa.edu listserve: cee020@list.icaen.uiowa.edu homepage: http:/www.engineering.uio... Date Added: 2009-04-26 07:59:11 |
| ECON402D01.TXT Path: Sveriges lantbruksuniversitet >> ECON >> 20002 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ECON 402-3 D01 LOCATION: SFU TITLE: ADVN MICROECONOMICS SECTION TYPE: SEM SEMESTER: 2000-2 ENROL: 20 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown... Date Added: 2009-04-26 08:00:18 |
| 19991216_f01k_97264.pdf Path: Stanford >> AOL >> 1010 Fall, 2009 Description: US District Court Civil Docket as of 12/16/1999 Retrieved from the court on Thursday, April 4, 2002 US District Court for the Eastern District of Virginia (Alexandria) 1:97cv264 Orman, et al v. America Online, Inc, et al Date Filed: 02/24/1997 Assign... Date Added: 2009-04-26 08:02:55 |
| 2005414_r01o_028560.pdf Path: Stanford >> SCOR >> 1026 Fall, 2009 Description: Case 2:02-cv-08560-LGB-RC Document 144 Filed 04/14/2005 Page 1 of 38 S. ,DISTRICT COURT ORIGINAL I 2 i C\' U.4.4t T1 41r FILED - APR 1 4 2005 CENTRAL BY 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 I. INTRODUCTION UNIT... Date Added: 2009-04-26 08:03:16 |
| 2004218_f01k_021260.pdf Path: Stanford >> WCOM >> 1025 Fall, 2009 Description: US District Court Civil Docket as of 02/18/2004 Retrieved from the court on Wednesday, March 15, 2006 U.S. District Court Southern District of Mississippi (Jackson) CIVIL DOCKET FOR CASE #: 3:02-cv-01260-HTW Longacre Master Fund v. WorldCom, Inc., ... Date Added: 2009-04-26 08:05:22 |
| 3502_lecture_36.pdf Path: Minnesota >> CHEM >> 3502 Fall, 2008 Description: Chem 3502/4502 Physical Chemistry II (Quantum Mechanics) Spring Semester 2006 Christopher J. Cramer Lecture 36, April 28, 2006 3 Credits (Some material in this lecture has been adapted from Cramer, C. J. Essentials of Computational Chemistry, Wile... Date Added: 2009-04-26 08:05:57 |
| lec1_final.pdf Path: Stanford >> EE >> 384 Fall, 2009 Description: Review of Probability Theory Review Session 1 EE384X Winter 2008 EE384x 1 Random Variable A random experiment with set of outcomes Random variable is a function from set of outcomes to real numbers Winter 2008 EE384x 2 Example Indicator rando... Date Added: 2009-04-26 08:08:04 |
| 200498_o01x_031394.pdf Path: Stanford >> SBL >> 1023 Fall, 2009 Description: BERNSTEIN LITOWITZ BERGER & GROSSMANN LL P ATTORNEYS AT LAW NEW YORK CALIFORNIA NEW JERSEY LOUISIAN A Daniel L . Berger d1b@blbglaw.com 212-554-1406 September 8, 2004 VIA FEDEX The Honorable Leonard D . Wexler United States District Judge Unit... Date Added: 2009-04-26 08:08:48 |
| index.pdf Path: Wisconsin Milwaukee >> LIB >> 345 Fall, 2009 Description: MILWAUKEE, rOL. FOUR. For \" VILLAGE OF WAUWATOSA,\" BHKET SHEET SHEET 8HRP:T SHEET see Sheet 455. Cotton Place, \" \" \" \" STREETS. S H E E T County E o a d , A Achilles, 450 Davis, Aldrich, 800-885 355 \" 88(5-959 358 \" Alexander, 945-9G4 359 D... Date Added: 2009-04-26 08:13:31 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2352 Fall, 2009 Description: ,=s=.^r= 21135:43409:8491:110 ,_ 19248:43409:2102:88 - 40976:14698:539:110 37417:40926:539:133 24 14368:7027:1293:775 ; 55641:22414:215:842 ^ 33374:43453:1374:842 a 13155:52587:835:620 13317:47954:754:620 49953:53119:673:687 25744:52787:835:620 about... Date Added: 2009-04-26 08:13:39 |
| As01.pdf Path: San Jose State >> CHEMISTRY >> 178 Fall, 2009 Description: Chem 178 Assignment #1 Least Squares Fitting Due: Thursday, February 5, 2009 Consider the following data to be fit to a polynomial. x 0.234 0.543 1.161 1.470 1.779 2.397 2.706 3.015 3.942 4.251 4.560 4.869 y 28.464 35.893 46.550 52.897 56.754 65.02... Date Added: 2009-04-26 08:15:05 |
| 3719LS09.pdf Path: Youngstown >> CHEM >> 3719 Fall, 2008 Description: Department of Chemistry Chemistry 3719L Lab Instructors: Youngstown State University Organic Chemistry Laboratory Spring 2009 5037 Ward Beecher Hall Ashley DePizzo (andepizzo01@student.ysu.edu): Section 21320, M 11:00 AM -1:50 PM. Aimable Ngendahi... Date Added: 2009-04-26 08:17:01 |
| 08_Roundup_OverviewMap.pdf Path: Texas A&M >> D >> 114 Fall, 2009 Description: 206 West Convent, Victoria, TX 77901 - Google Maps Page 1 of 1 Address 206 W Convent St Notes Nazareth Academy, 206 W Convent St, Victoria D11 4-H ROUNDUP - ENTER SCHOOL ON CHURCH STREET ENTRANCE Victoria, TX 77901 2008 Google - Map data 2008 Le... Date Added: 2009-04-26 08:17:10 |
| sumten.txt Path: Alaska Anch >> CS >> 431 Fall, 2009 Description: 00000000000010110000000100000000#1000010100000100000000010000000010000101000001100000000100000000100001110000001000000100000000001000101000000100000000010000000010000101000001100000000000000000100000110000001100000010000000001000101100000011000001000... Date Added: 2009-04-26 08:17:33 |
| e3ab-s05.pdf Path: Texas A&M >> CHEM >> 101 Fall, 2008 Description: CHEM 101 FORM A 1/2) A 1/2) C S 501-511 5/6) C 5/6) C Dr. Wendy Keeney-Kennicutt 7/8) B 7/8) E 9/10) E 9/10) B SPRING 2005 EXAM 3 3/4) B 3/4) B 11/12) C 13/14) A 15/16) B 17/18) E 19/20) A 21/22) E 23/24) D 11/12) C 13/14) D 15/16) A 17/18) A 19... Date Added: 2009-04-26 08:18:04 |
| hw19.pdf Path: Oregon State >> PH >> 212 Fall, 2008 Description: Ph202H/212H W09 Homework due March 4, 2009 1. Two large parallel sheets of charge with uniform charge densities are separated by a distance that is small compared with their dimensions. One sheet carries a positive charge density of +6.8 C/m2, and... Date Added: 2009-04-26 08:20:16 |
| HW6_Solutions.pdf Path: Caltech >> MA >> 108 Fall, 2009 Description: Problem 1. By Fatou theorem, f + g lim inf R n R fn + gn , which implies f lim inf R n R fn . Also, since gn fn 0, g f lim inf R n R gn fn and R f lim inf ( n R fn ). These two inequalities imply the result. Problem 2. N Notice that... Date Added: 2009-04-26 08:20:36 |
| LLformulationOfEFE.pdf Path: Caltech >> PH >> 236 Fall, 2009 Description: ... Date Added: 2009-04-26 08:21:09 |
| midterm1.doc Path: Wisconsin >> ENGR >> 421 Fall, 2009 Description: Mid term 1 : MSE 421 \"Polymeric Materials\" March 3rd 1.00-2.15 _ Note: Please write only on one side of the answer sheet (not on the question sheet). Make sure your answers are written neatly. There are points for showing your calculations, not just ... Date Added: 2009-04-26 08:21:12 |
| az1408.pdf Path: Arizona >> AZ >> 1408 Fall, 2009 Description: E TENSION ARIZONA COOP E R AT I V E Youth Physical Activity Lesson Plans AZ 1408 May 2007 Youth Physical Activity Table of Contents Youth Physical Activity Lesson Plans Introduction Ages: 3-10 years National Association for Sports and Physical E... Date Added: 2009-04-26 08:22:58 |
| notes.chapter7.pdf Path: Purdue >> STAT >> 301 Fall, 2008 Description: NOTES: CHAPTER 7 Inference for the Mean of a Population: Assumptions for Inference about a mean: 1. Both and are unknown parameters. Because we do not know we use the standard error in place of . n Standard Error: When the standard deviation of ... Date Added: 2009-04-26 08:25:02 |
| ObjectOrientedDesignSEV.pdf Path: Maryland >> CMSC >> 132 Fall, 2005 Description: CMSC 132: Object-Oriented Programming II Object-Oriented Design Department of Computer Science University of Maryland, College Park Applying Object-Oriented Design 1. Look at objects participating in system Find nouns in problem statement (require... Date Added: 2009-04-26 08:26:56 |
| chap7.pdf Path: Washington >> ME >> 354 Fall, 2009 Description: 7. FRACTURE Fracture can be defined as the process of separation (or fragmentation) of a solid into two or more parts under the action of a stress. So-defined, fracture can certainly be identified as one type of engineering failure in which a design ... Date Added: 2009-04-26 08:28:24 |
| moream.ps Path: Maryland >> CS >> 652 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: moream.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMBX12 CMR12 CMMI12 CMSY10 CMSY8 CMMI8 CMR8 CMSY6 CMMI6 %+ CMTI12 CMEX10 CMR6 %EndCo... Date Added: 2009-04-26 08:28:34 |
| mossbauer.pdf Path: Washington >> PHYS >> 431 Fall, 2008 Description: The Mssbauer Effect o 1 Background Any bit of matter (say, an atom or molecule) emitting any type of radiation must recoil in order to conserve energy and momentum. Both the recoil energy and the energy of the emitted photon must come from the energ... Date Added: 2009-04-26 08:29:33 |
| 3_4_2_Correspondence Study.pdf Path: Western Kentucky University >> CHAPTER >> 3 Fall, 2009 Description: WKU Correspondence Study College Division Catalog This is the current listing of college courses offered. For registration information contact the Office of Correspondence Study. To determine if a course meets the General Educational Requirements fo... Date Added: 2009-04-26 08:29:50 |
| DevelopmentofFeelingNorms-SimonEderEvans.pdf Path: Western Kentucky University >> SOC >> 410 Fall, 2009 Description: ... Date Added: 2009-04-26 08:30:17 |
| 34a-Class D - The Next Step.pdf Path: Purdue >> EET >> 257 Fall, 2009 Description: 1 Class D The Next Step Filters again Half Bridge Split Supply Full Bridge Protection Purdue University ECET 257 Power & RF Electronics 2 Output Capacitor High-pass filter f-3dB = 1/(2 Rload C) Ccoupling = ? Voltage rating g g Purdue Unive... Date Added: 2009-04-26 08:30:45 |
| D8 PhasenPhaseDiff.pdf Path: UMBC >> P >> 192 Fall, 2009 Description: Phase and Phase Difference The Phase Angle Suppose a wave has the equation: s = A sin The Phase Difference A. Between Two Points on the Same Wave x2 x1 2 ( x vt ) Called the Phase or Phase Angle At x1: s = A sin 2 ( x vt ) 1 2 2 or = A si... Date Added: 2009-04-26 08:33:56 |
| lecture 34 120108.ppt Path: St. Francis IL >> CHEM >> 355 Fall, 2009 Description: Interplay Between (Receptor) Tyrosine Kinases and G-Proteins Interaction of the Src SH2 Domain with a Typical Target Peptide Phosphotyrosine is involved in salt bridges with Arg A2 and Arg B5. +3 Ile residue surrounded by hydrophobes: Tyr D5, Leu G4... Date Added: 2009-04-26 08:34:21 |
| assignment 4 key.doc Path: St. Francis IL >> CHEM >> 355 Fall, 2009 Description: Chem 355 Advanced Biochemistry Assigment 4 Due: Beginning of the class period, Monday, October 27, 2008 Key McKee and McKee, 4th Edition. Chapter 8 Question 33. Glycogen synthesis requires a short primer chain. Explain how new glycogen molecules are ... Date Added: 2009-04-26 08:34:23 |
| stat201_2002-3.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 201 Fall, 2009 Description: STATISTICS 201-3 STATISTICS FOR THE LIFE SCIENCES Fall 2002 DAY COURSE STATISTICS WORKSHOP Instructor: Madjid Amir Lab Instructor: R. Insley Prerequisite: The student must have 30 semester hours of credit. Students with credit for STAT 101, 102, 203 ... Date Added: 2009-04-26 08:36:26 |
| t01.xls Path: Sveriges lantbruksuniversitet >> GRAD >> 0994 Fall, 2009 Description: TABLE 1 SIMON FRASER UNIVERSITY GRADUATE HEADCOUNT AND FTE BY FACULTY AND DEPARTMENT Headcount Annualized Full-Time Equivalent Faculty/Department 1998-2 1999-2 % Change 1998-2 1999-2 % Change Applied Sciences 351 361 3% 95.9 105.7 10% Communication 7... Date Added: 2009-04-26 08:37:29 |
| economic96.pdf Path: Allan Hancock College >> PDF >> 93 Fall, 2009 Description: 26215656-2652 chshih@mail.tku.edu.tw 2007-11-29 @TKU Libary 1 ? ? 2 1.(virtua) 2. 3. () 3 Step1 Step1 Step2 Step2 GoogleTKU WebPAC GoogleTKU We... Date Added: 2009-04-26 08:39:59 |
| Letter4_Experiential_Learning.pdf Path: LSU >> CF >> 39026 Fall, 2009 Description: Letter 4 The How\'s and Why\'s of Experiential Learning In this letter you\'ll find: An explanation of the Experiential Learning Process Descriptions of each of the five steps in the process Applying experiential learning Applying the cone of exp... Date Added: 2009-04-26 08:42:59 |
| Typos_in_Ashby_Book_2009.pdf Path: Air Force Academy >> ME >> 492 Fall, 2009 Description: Materials Selection in Mechanical Design, 3rd Edition, Identified Typos P. 59 line above Eqn. 4.8 reads: when, taking as 2 x 10-10 m, It should read: when, taking r o as 2 x 10-10 m, Page 123: The equation for the mass of a rotating disk in Eq. 6.1... Date Added: 2009-04-26 08:43:32 |
| 419-sp05-03-IP-v0.pdf Path: Cornell >> CS >> 419 Spring, 2008 Description: CS419: Computer Networks Lecture 3: Feb 2, 2005 IP (Internet Protocol) A hypothetical service CS419 You want a mail delivery service You have two choices: Acme Guaranteed Mail Delivery Service \"We never fail\" Rocko\'s Mail Delivery and Hubcap \"We... Date Added: 2009-04-26 08:45:10 |
| OSP+Cost+Sharing+Guidelines+3-09.pdf Path: LSU >> APPL >> 003 Fall, 2008 Description: OSP COST SHARING GUIDELINES REFERENCES: OMB Circular A-110 OMB Circular A-21 M-01-06 Clarification of OMB A-21 Treatment of Voluntary Uncommitted Cost Sharing. OSP Guide SPA Post Award Manual FASOP: AS-06 DEFINITION: Cost sharing and Matching is defi... Date Added: 2009-04-26 08:45:34 |
| G10wake.pdf Path: Toledo >> EAS >> 320 Fall, 2009 Description: ... Date Added: 2009-04-26 08:46:31 |
| Lab06.pdf Path: Cal Poly >> CS >> 681 Fall, 2008 Description: CS 392/681 Lab 6 Experiencing Buer Overows and Format String Vulnerabilities Due Dec 2 1 Motivation Buer overows and format string vulnerabilities are widespread and as security professionals we should have a good understanding of what they are an... Date Added: 2009-04-26 08:55:07 |
| amd-mmx.pdf Path: University of Illinois, Urbana Champaign >> WEB >> 291 Fall, 2009 Description: Advance Information AMD-K6 Processor Multimedia Extensions (MMX) Publication # 20726 Issue Date: July 1996 Rev: A Amendment/0 This document contains information on a product under development at Advanced Micro Devices (AMD). The information is i... Date Added: 2009-04-26 08:55:27 |
| Chap003-hwk.doc Path: Seattle >> FIN >> 344 Fall, 2009 Description: Chapter 03 - Participating in the Market Solutions Manual Chapter 03 Participating in the Market PROBLEMS Margin purchase 1. Assume you buy 100 shares of stock at $40 per share on margin (50 percent). If the price rises to $55 per share, what is you... Date Added: 2009-04-26 08:58:41 |
| Problems on Plane Wave Propagating At Abritrary Directions.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 450 Fall, 2008 Description: ECE 450 Plane Wave Propagation at Arbitrary Directions Problem 1 The electric field vector of a time-harmonic, uniform plane wave, propagating in a lossless dielectric of magnetic permeability that of free space, is given by the following expression:... Date Added: 2009-04-26 09:05:55 |
| A-401.pdf Path: Penn State >> MOS >> 122 Fall, 2009 Description: ... Date Added: 2009-04-26 09:06:55 |
| final-A01.pdf Path: Uni. Worcester >> A >> 2135 Fall, 2009 Description: b B 9S B5 US WS Y 9 U5u Wtk Bt Y Dkf5 7 tD xf8x5EWPW$9PY`E9qEWV8E5UH8$DPB8Pvx9tx9He9rW`8$Dp8e8w&8Cs qpq$P~E}l{Vpw V2da9HeeEDxBVTSH8TDxRaUH`t`Euq5 ~ |xz yx fF Yt U R WS YS 9 U S q w CqrIdE H$rsHz E E p x$dud$Ee arr... Date Added: 2009-04-26 09:19:03 |
| string_algorithms_slides.pdf Path: Loyola Chicago >> CS >> 447 Fall, 2009 Description: Exact Set Matching Problem Molecular Sequence Algorithms, Spring 2004 In an exact set matching problem we locate occurrences of , in text any pattern of a set Let Lecture 4: Set Matching and Aho-Corasick Algorithm Pekka Kilpelainen Univers... Date Added: 2009-04-26 09:26:43 |
| EB902_Module_handbook.pdf Path: East Los Angeles College >> EB >> 902 Fall, 2009 Description: School of Entrepreneurship and Business University of Essex MODULE HANDBOOK Entrepreneurship Policy, Culture and Regional Development EB902 Module Leader: Dr. Bill Gleave Autumn Term 2007 EB 902 Module Handbook Autumn Term 2007 Content Introd... Date Added: 2009-04-26 09:41:10 |
| L19PL.pdf Path: Duke >> CPS >> 104 Fall, 2009 Description: CPS104 Computer Organization and Programming Lecture 19: Pipelining Robert Wagner cps 104 Pipelining.1 RW Fall 2000 Lecture Overview q A Pipelined Processor : 5 Introduction to the concept of pipelined processor. Reading: Chapters 5, 6 cps 104... Date Added: 2009-04-26 09:41:24 |
| rationalexample.pdf Path: Washington >> M >> 120 Fall, 2009 Description: Rational Function Sketching Example Graph h(x) = 2x2 + 4x 6 . x2 + 3x + 2 It will make things easier if we factor the numerator and denominator rst: h(x) = 2(x + 3)(x 1) . (x + 2)(x + 1) Find the domain: D = {all real x = 2, 1} Once youve foun... Date Added: 2009-04-26 09:44:20 |
| lec03_QM_Review7_GML.pdf Path: Utah >> PHYS >> 7640 Fall, 2008 Description: Application: time independent perturbation theory H = H0 + H1 and we can solve H0 jni = En jni. We treat H1 as a 0 perturbation so it shifts En and jni only slightly to give En and jn0 i: 0 H jn0 i = En jn0 i Note that X jn0i = jmihmjn0 i Lets solve... Date Added: 2009-04-26 09:45:09 |
| HowToCreateILM.pdf Path: Utah State >> CS >> 5070 Fall, 2008 Description: HowtogettheprojectworkingontheWeb A.Beforeyougettoofaronyourdesign,considerEXACTLYwhatyouwantyour interactiontolooklike.Astoryboardisagoodwayofdoingthis. Astoryboardwillshow: 1. Whattheuserinterfacelookslike 2. Whatstepstheuserwillgothrough.Amathex... Date Added: 2009-04-26 09:46:26 |
| 07HGD1-2.pdf Path: Utah State >> CEEFS >> 5230 Fall, 2009 Description: Week 1- Wednesday Introduction to Geometric Highway Design Discussion of Highway Functions (Green Book, Chpt.1) Lecture 1-2. Geometric Highway Design Spring 2007 1 Introduction to Hierarchy of Movement Intermediate facilities are NOT always n... Date Added: 2009-04-26 09:46:38 |
| education_wiczer.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 562 Fall, 2008 Description: Higher education subsidies and heterogeneity: a dynamic analysis Elizabeth Caucutt and Krishna Kumar October 7, 2008 Introduction Motivation Subsidies in higher education Rich countries heavily subsidize higher education: McPherson and Schapiro ... Date Added: 2009-04-26 09:48:13 |
| part3.pdf Path: Maryland >> CMSC >> 722 Fall, 2008 Description: Lecture slides for Automated Planning: Theory and Practice Part III Heuristics and Control Strategies Dana S. Nau CMSC 722, AI Planning University of Maryland, Spring 2008 Dana Nau: Lecture slides for Automated Planning Licensed under the Creative ... Date Added: 2009-04-26 09:50:46 |
| noiseDac.pdf Path: Columbia >> L >> 040122 Fall, 2009 Description: Noise using pedestal DAC measurements Dan Edmunds files from Find_DAC determines for each tower the DAC value to get ADC=8 if no energy deposited For each channel : standard deviation from 13000 readings 27/01/2004 J.Bystricky - Saclay 27/01/200... Date Added: 2009-04-26 09:53:05 |
| Dis07Solution.pdf Path: Wisconsin >> PHYS >> 103 Fall, 2008 Description: 2/7/06 PHYS103: Discussion 7 19. Two blocks are fastened to the ceiling of an elevator as in Figure P4.19. The elevator accelerates upward at 2.00 m/s2. Find the tension in each rope. (Draw FBD for each mass first) Figure P4.19 4.19 Free-body diagr... Date Added: 2009-04-26 09:53:32 |
| cem988w6E2.pdf Path: Michigan State University >> CEM >> 988 Fall, 2008 Description: CEM-988 Winter/2oo6 Take Home Final Exam due: 27 April 2oo6, 09:30am 1. As part of a recent search for neutron-gamma correlations the front face of an intrinsic germanium detector with a radius of 5 cm and a volume of 750 cm3 was placed 12 cm from ... Date Added: 2009-04-26 09:55:32 |
| dilella.pdf Path: Stanford >> C >> 990809 Fall, 2009 Description: Accelerator and Reactor Neutrino Experiments Luigi DiLella CERN Geneva, Switzerland 1 Introduction Since the first detection of the neutrino at reactors [1] and the discovery of the at the Brookhaven AGS [2], accelerators and reactors have been ... Date Added: 2009-04-26 09:59:25 |
| 2005726_r01o_013624.pdf Path: Stanford >> ENE >> 1020 Fall, 2009 Description: IN THE UNITED STATES DISTRICT COURT FOR THE SOUTHERN DISTRICT OF TEXAS HOUSTON DIVISION MARK NEWBY, ET AL., Plaintiffs VS. ENRON CORPORATION, ET AL., Defendants THE REGENTS OF THE UNIVERSITY OF CALIFORNIA, et al., Individually and On B... Date Added: 2009-04-26 09:59:58 |
| 2007831_r11d_021486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: 4:02-cv-01486-CW Document 1385 Filed 08/31/2007 Pa e 1 of 3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Joseph J. Tabacco, Jr. (75484) Christopher T. Heffelfinger (118058) BERMAN DeVALERIO PEASE TABACCO BURT & PUCILLO 425 California Street, Suite ... Date Added: 2009-04-26 10:04:22 |
| L15_security.pdf Path: UC Davis >> EEC >> 274 Fall, 2008 Description: EEC274,Winter2009 DenialofService:Whatisit? Attempttoexhaustresources Network: Bandwidth Transport: TCPconnections Application: Serverresources Typicallyhighrateattacks,butnotalways DoS DDoS Worm.Spam Security:Measuring,Detecting,and Preventing... Date Added: 2009-04-26 10:07:30 |
| matlab.pdf Path: Caltech >> CNS >> 187 Fall, 2008 Description: ... Date Added: 2009-04-26 10:07:34 |
| 2005718_f12o_05cv2042.pdf Path: Stanford >> BRCD >> 1034 Fall, 2009 Description: 1 3 4 5 6 7 8 9 10 11 12 13 14 15 1.6 17 18 19 20 21 22 23 24 25 26 27 28 [PROPOSEDI ORDER APPOINTING THE OKLAHOMA FIREFIGHTERS PENSION & RETIREMENT SYSTEM AS LEAD PLAINTIFF AND APPOINTING LEAD COUNSEL Case No . C-05-2042-CRB UNITED STATES DISTRICT... Date Added: 2009-04-26 10:09:21 |
| 16.pdf Path: Princeton >> COS >> 126 Fall, 2008 Description: Symbol Table 4.4 Symbol Tables Symbol table. Key-value pair abstraction. Insert a key with specified value. Given a key, search for the corresponding value. ! ! Ex. [DNS lookup] Insert URL with specified IP address. Given URL, find corresponding I... Date Added: 2009-04-26 10:10:01 |
| 200742_r04t_0604346.pdf Path: Stanford >> RMBS >> 1036 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 DARRYL P. RAINS (CA SBN 104802) (DRains@mofo.com) STEPHANIE L. ZELLER (CA SBN 223693) MORRISON & FOERSTER LLP 755 Page Mill Road Palo Alto, California 94304-1018 Telephone: 6... Date Added: 2009-04-26 10:11:05 |
| notes4.pdf Path: Stanford >> EE >> 387 Fall, 2009 Description: EE 387, John Gill, Stanford University Notes #4, October 20, Handout #13 Finite elds: motivation Algebraic block codes treat each channel symbol as an element of a nite eld. A linear encoder multiplies symbols by constants and accumulates the produ... Date Added: 2009-04-26 10:12:14 |
| ipod.pdf Path: Cal Poly Pomona >> ECON >> 123 Fall, 2009 Description: Article | Reuters Page 1 of 3 Print | Close this window iPod cheap in Hong Kong, but a Brazil bank-breaker Thu Oct 4, 2007 6:07am EDT By Rob Taylor CANBERRA (Reuters) - In the market for a new video iPod? Head to Hong Kong or, if Europe-bound, st... Date Added: 2009-04-26 10:13:15 |
| delew_laymans_guide.pdf Path: UMass (Amherst) >> ECON >> 340 Fall, 2008 Description: by Nancy De Lew, GeorgeGreenberg,and Kraig Kinchen This articleprovides an overview of the U.S. health care systemand recentproposalsfor health system reform. Preparedfor a 15-nation comparative studyfor the Organizationfor Economic Cooperation and D... Date Added: 2009-04-26 10:19:41 |
| che361_08_exam1.pdf Path: UMass (Amherst) >> CHE >> 361 Fall, 2009 Description: Midterm Exam #1 ChE 361 Spring 2008 Problem 1 (70 pts). Consider a plug ow reactor in which the following series reaction occurs: A B C. The reaction rates per unit volume of the rst and second reactions are r1 = k1 CA and r2 = k2 CB , respectively... Date Added: 2009-04-26 10:19:55 |
| feb9-cs295.txt Path: Vassar >> CS >> 295 Fall, 2008 Description: ; - ; CMPU-295, Spring 2009 ; Code used in class ; Feb. 9, 2009 ; - ; FACTY ; - ; Computes the factorial of its input. ; Prints out a line for each recursive function call. (define facty (lambda (n) (printf \"n = ~A~%\" n) (if (ze... Date Added: 2009-04-26 10:23:29 |
| matlabprimer.pdf Path: Uni. Worcester >> MA >> 574 Fall, 2008 Description: A Matlab Primer C. R. MacCluer February 24, 2004 0 Interactive versus scripts There are two ways to interact with Matlab: interactively and via scripts. At the Matlab prompt, typing a request followed by Enter will return the execution of the reques... Date Added: 2009-04-26 10:25:50 |
| cmiap2004460.pdf Path: Allan Hancock College >> CMIAP >> 2004460 Fall, 2009 Description: Published in Gazette 2.9.2004 p 3543 South Australia Chicken Meat Industry Act (Commencement) Proclamation 2004 1Short title This proclamation may be cited as the Chicken Meat Industry Act (Commencement) Proclamation 2004. 2Commencement of suspend... Date Added: 2009-04-26 10:26:51 |
| umi-uncg-1435.pdf Path: UNC Greensboro >> ETD >> 1435 Fall, 2009 Description: GRETTON, LINDA BURAK, Ph.D. The Rhetorical Helix of the Biotechnology and Pharmaceutical Industries: Strategies of Transformation through Definition, Description and Ingratiation. (2007) Directed by Dr. Nancy Myers. 233 pp. Since the 1980s, the phar... Date Added: 2009-04-26 10:29:38 |
| BASE.pdf Path: UMass (Amherst) >> CS >> 677 Fall, 2009 Description: BASE: Using Abstraction to Improve Fault Tolerance Rodrigo Rodriguest, Miguel Castro, and Barbara Liskovt t MIT Laboratory for Computer Science 200 Technology Sq., Cambridge MA 02139, USA Microsoft Research Ltd. 1 Guildhall St., Cambridge CB2 3NH, UK... Date Added: 2009-04-26 10:30:02 |
| 06_LC3_ISA_markup.pdf Path: UCSC >> CMPE >> 012 Fall, 2009 Description: LC-3 Instruction Set Architecture Textbook Chapter 5 CMPE12 Summer 2008 Instruction set architecture What is an instruction set architecture (ISA)? It is all of the programmer-visible components and operations of the computer The ISA provides all t... Date Added: 2009-04-26 10:30:48 |
| Note_on_Envelope_Theorem.pdf Path: Haverford >> ECON >> 365 Fall, 2008 Description: In class, we learned that when we are solving the maximization problem : max F (x; ) s.t. G(x; ) = c x where x and are both vectors. Then, the change in the maximum value of F when the parameter vector changes slightly, is given by : L0 d where, L i... Date Added: 2009-04-26 10:31:31 |
| q2.pdf Path: Ill. Chicago >> MATH >> 210 Fall, 2008 Description: Math 210 Fall2007 SHOW ALL WORK Quiz 2 Name Score ~e y out of 6 1) Find the equation of a plane which contains the points (1,4,7), (3,6,8) and (2,5,9). The answer should be in the fonn ax + by + cz = d for full credit. p:; C J;) \'1 ) 7) G( =- (... Date Added: 2009-04-26 10:33:22 |
| hw4sol.pdf Path: Maryland >> CMSC >> 452 Fall, 2008 Description: ! \" # $% \' ! ! ( *\"*\" % % % *\"* # # # # # # # # # # # # *\"+ #,##,#,# # - $. /01$/ %2(20 /%21 / %2%/ %2% /%&2 # !# # !# !# #... Date Added: 2009-04-26 10:34:50 |
| mp_bonus.pdf Path: Texas A&M >> MATH >> 251 Fall, 2008 Description: Prove the following: Theorem 1 If f (x, y) satises f = def 2f 2f + 2 = 0, x2 y then the maximum of f over the rectangle R = {(x, y) : 0 x 1, 0 x 1} is achieved on the boundary of R. Follow the following steps: 1. ( +5% Exam2 bonus) Assume f >... Date Added: 2009-04-26 10:35:58 |
| exam01.pdf Path: Texas A&M >> STAT >> 601 Fall, 2008 Description: ... Date Added: 2009-04-26 10:36:04 |
| soln2053.pdf Path: Sveriges lantbruksuniversitet >> ENSC >> 805 Fall, 2009 Description: SIMON FRASER UNIVERSITY School of Engineering Science ENSC 805 Techniques of Digital Communication Solutions to Assignment 2 October, 2005 1. CPM States and Trellis (a) Since h = 2/3 and it\'s binary modulation (M = 2), there are three phase states, ... Date Added: 2009-04-26 10:36:28 |
| 2009_02_16WILeg.090303.pdf Path: Wisconsin >> BIENN >> 0911 Fall, 2009 Description: Legislative Fiscal Bureau One East Main, Suite 301 Madison, WI 53703 (608) 266-3847 Fax: (608) 267-6873 February 16, 2009 TO: Members Wisconsin Legislature Bob Lang, Director FROM: SUBJECT: Budget Adjustment Legislation This document summari... Date Added: 2009-04-26 10:36:32 |
| 480_syllabus_and_module_1.doc Path: Washington >> BUS >> 480 Fall, 2009 Description: 480 BBUS 480 Global Environment of Business University of Washington, Bothell Business Program Autumn 2004 Kevin Laverty office: UW2325 office hours TBA +1 4253525338 laverty@u.washington.edu Course page: http:/faculty.washington.edu/laverty/BU... Date Added: 2009-04-26 10:41:24 |
| Ad_Law_Syllabus_Fall_2007.pdf Path: Washington >> A >> 509 Fall, 2009 Description: ADMINISTRATIVE LAW FALL 2007 SYLLABUS VERSION 1.0 Professor Kathryn A. Watts Office Phone: 206.543.6299 Email: kawatts@u.washington.edu Office Location: Gates Hall 339 Class Times: M, T, W, Th 9:30 a.m. to 10:20 a.m. Office Hours: Thursdays from 10:... Date Added: 2009-04-26 10:41:31 |
| tute8.pdf Path: Allan Hancock College >> COS >> 214 Fall, 2009 Description: COS214 Tutorial 8 Roberto Togneri, 2000 1. (a) Consider a system that supports the strategies of contiguous, linked, and indexed allocation. What criteria should be used in deciding which strategy is best utilized for a particular file? Fragmentation... Date Added: 2009-04-26 10:41:46 |
| practice_concept_questions.pdf Path: Colorado >> CHEN >> 4330 Fall, 2008 Description: 1. You are in charge of operating an isothermal CSTR that produces both a desired and an undesired product, where the undesired product is produced in a series reaction from the desired product. The CSTR is operating at a yield for D of 75%. Because ... Date Added: 2009-04-26 10:42:19 |
| contrapunctusII-a4.pdf Path: W. Alabama >> BWV >> 1080 Fall, 2009 Description: Die Kunst der Fuge Johann Sebastian BACH (1685 - 1750) Contrapunctus II BWV 1080 7 11 15 Public Domain 19 23 27 31 35 39 43 47 51 55 59 63 67 71 75 80 Sheet music from www. MutopiaProject .org Free to download, with the freedo... Date Added: 2009-04-26 10:45:40 |
| 442TA6solns.pdf Path: Acton School of Business >> CHEM >> 442 Fall, 2009 Description: ... Date Added: 2009-04-26 10:45:59 |
| kannan_arumugam_200712_phd.pdf Path: Georgia Tech >> ETD >> 08242007 Fall, 2009 Description: Communication Strategies for Single User and Multi-user Slow Fading Channels A Thesis Presented to The Academic Faculty by Arumugam Kannan In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Electrical Engineering ... Date Added: 2009-04-26 10:48:46 |
| Exercise26_soln.pdf Path: UCSD >> SIO >> 217 Fall, 2009 Description: SIO 217B Atmospheric and Climate Sciences II Exercise #26 Solution 1. a) b) c) Horizontal temperature advection is generally stronger at 850 hPa than it is at 500 hPa, with advection at 700 hPa in between. 2. a) b) c) Horizontal vorticity advec... Date Added: 2009-04-26 10:49:00 |
| Week01Lab.pdf Path: Allan Hancock College >> HSD >> 212 Fall, 2009 Description: Working in the Histology Laboratory. Students often express frustration when working in the histology laboratory. This is entirely avoidable if one has some understanding of the process. Laboratory work in histology aims at being able to observe, und... Date Added: 2009-04-26 10:49:01 |
| 0221.pdf Path: Princeton >> COS >> 511 Spring, 2009 Description: COS 511: Foundations of Machine Learning Rob Schapire Scribe: Berk Kapicioglu Lecture #5 February 21, 2006 1 An Outline of the Lecture In this lecture, we continue to study general conditions under which one could perform learning successfully. In... Date Added: 2009-04-26 10:50:45 |
| sql.ppt Path: Baylor >> MIS >> 4340 Fall, 2008 Description: G. Green DML Controlling Transactions Inserting Data Updating Data Deleting Data Querying Data Single Table Multiple Tables Transaction Control Transaction Control Commit; eg, save NOTE: uncheck \" Autocommit\" for express edition Rollback; eg... Date Added: 2009-04-26 10:51:38 |
| ajsedge1.txt Path: Princeton >> COS >> 325 Fall, 2009 Description: COS 325 AJ Sedgewick - Musical Statement 1 I used my changes to timeshif from part 7, and then srconvrt and the original timeshif on Trumpt44.wav to make my statement. I changed timeshif to reverse the windows when it adds them together. I thought t... Date Added: 2009-04-26 10:51:57 |
| sansone.doc Path: University of Hawaii - Hilo >> LIS >> 601 Fall, 2009 Description: PATHFINDER GREEK MYTHOLOGY Gena Sansone LIS 601 CampbellMeier Summer, 2004 Welcome to the world of Greek Mythology, a topic deeply entrenched in Western civilization. Here you will find powerful gods and goddesses, enchanted landscapes, monsters... Date Added: 2009-04-26 10:52:08 |
| summation.pdf Path: Oregon >> MATH >> 252 Fall, 2008 Description: Summation notation Summation notation is a convenient way to represent the sum of many terms. (It iis also called Sigma notation, since it uses the Greek letter (Sigma). If f is a function, then b f (k) = f (a) + f (a + 1) + f (a + 2) + . . . + f (... Date Added: 2009-04-26 10:54:06 |
| Lavy.pdf Path: Maple Springs >> ECON >> 4369 Fall, 2009 Description: NBER WORKING PAPER SERIES DO GENDER STEREOTYPES REDUCE GIRLS HUMAN CAPITAL OUTCOMES? EVIDENCE FROM A NATURAL EXPERIMENT Victor Lavy Working Paper 10678 http:/www.nber.org/papers/w10678 NATIONAL BUREAU OF ECONOMIC RESEARCH 1050 Massachusetts Avenue C... Date Added: 2009-04-26 10:54:51 |
| gamedesigndoc.doc Path: Ohio State >> CSE >> 788 Fall, 2009 Description: Cse788 Game Design Document -Team B -Star Battles-Game Concept Introduction Our game is a 3d team based game for the PC where players will engage in fast paced spaceship battles trying to defeat the other teams larger, main spacecraft. Genre Our game... Date Added: 2009-04-26 10:55:24 |
| ssmg16.pdf Path: Purdue >> ASM >> 322 Spring, 2008 Description: M. Schlemmer, J. Hatfield, and D.C. Rundquist SSMG-16 Remote Sensing: Photographic vs. Non-Photographic Systems Summary The intention of site-specific management is to optimize grower inputs on areas much smaller than the entire field. These areas ... Date Added: 2009-04-26 10:57:22 |
| WomenWork7.pdf Path: Hiram >> INTD >> 381 Fall, 2009 Description: Economist.com Page 1 of 3 Balancing act Jul 16th 1998 From The Economist print edition Still far from perfect IS NOW a better time to be a woman than 50 years ago? In many ways, the answer has to be yes. Women everywhere in the rich world have got... Date Added: 2009-04-26 10:58:14 |
| lecture5.pdf Path: UC Riverside >> TSTIM >> 001 Fall, 2009 Description: Assessment: Intelligence The History of Assessment Formal testing movement 1904 Binet & Simon Create a test to distinguish learning disordered from behavioral delinquent 1908: Binet-Simon Scale released in France 30 tasks in hierarchy of diffic... Date Added: 2009-04-26 10:59:05 |
| assignment17.doc Path: Youngstown >> ENGR >> 6924 Fall, 2008 Description: Youngstown State University College of Engineering Environmental/Chemical Engineering Program ENGR6924: Computer Based tools for Engineers Problem no. 1 Sketch the direction field for the following differential equation. Sketch ... Date Added: 2009-04-26 10:59:33 |
| MBA270-lec7.ppt Path: CSU Sacramento >> MBA >> 270 Winter, 2009 Description: Lecture VII MNCsCulturalFramework andManagingacross CorporateBoundaries(ch.6) Cultural Complexity Contextual variations [E. T. Hall, The Silent Language, 1973] Lowcontextculture Explicit Morelegalpaperwork Verbalcommunication Highcontextcult... Date Added: 2009-04-26 10:59:37 |
| GDD55.txt Path: Michigan State University >> GEO >> 5452 Fall, 2009 Description: MILFORD GM PROVING GROUNDS DIVISION: 10 STATION #5452 DAT... Date Added: 2009-04-26 11:00:35 |
| Syllabus.astro101a.pdf Path: Haverford >> ASTR >> 101 Fall, 2009 Description: ASTRONOMY 101: ASTRONOMICAL IDEAS Fall Semester 2002 Instructor: Juan Cabanela (co-taught with Froney Crawford and Bruce Partridge) Office: INSC L108 (610-896-1321) E-mail: jcabanel@haverford.edu Lecture: MWF, 11:30 AM 12:30 PM, Stokes Auditorium Of... Date Added: 2009-04-26 11:01:14 |
| ZasadaEtAl1997WeedTech.pdf Path: Texas A&M >> ARSSERV >> 33001 Fall, 2009 Description: ... Date Added: 2009-04-26 11:01:41 |
| syllabus.pdf Path: Washington >> CHEM >> 142 Fall, 2008 Description: CHEMISTRY 142B SYLLABUS, POLICIES AND PROCEDURES WINTER QUARTER, 2005 Lectures: M, W, Th, F 1:30 - 2:20 p.m. 131 BAGLEY Web address: http:/depts.washington.edu/chemcrs/index.html Instructor: Professor William H. Zoller E-mail: zoller@chem.washingto... Date Added: 2009-04-26 11:02:35 |
| rwm_fewtomany.pdf Path: Georgia Tech >> PH >> 274 Fall, 2009 Description: From a few to many electrons in quantum dots under strong magnetic elds: Properties of rotating electron molecules with multiple rings Yuesong Li, Constantine Yannouleas, and Uzi Landman School of Physics, Georgia Institute of Technology, Atlanta, Ge... Date Added: 2009-04-26 11:10:26 |
| ehc113.pdf Path: Columbia >> RW >> 187 Fall, 2009 Description: INTERNATIONAL PROGRAMME ON CHEMICAL SAFETY ENVIRONMENTAL HEALTH CRITERIA 113 FULLY HALOGENATED CHLOROFLUOROCARBONS This report contains experts and does not policy of the United Labour Organisation, the collective views of an international group ... Date Added: 2009-04-26 11:15:12 |
| Project1.pdf Path: Iowa State >> CALCULUS >> 166 Fall, 2009 Description: Math 166 Calculus II Project 1 This project is part of HW 6 and is due Friday Sep. 29, 9 am, at the beginning of class. Using Calculus to find the amount of water flowing in the Mississippi River. Using the pictures below and problem #23 pg. 493, Sec... Date Added: 2009-04-26 11:16:22 |
| apr_22.doc Path: Arizona >> PTYS >> 505 Fall, 2009 Description: More on Tides Calculation of the History of the Moon\'s Orbit Let us calculate the evolution of the Moon\'s orbital radius R under the influence of the torque on the Moon\'s orbit from tides raised on the Earth by the Moon, taking the Moon to have mass... Date Added: 2009-04-26 11:20:44 |
| apr_22.doc Path: Arizona >> SECTION >> 505 Fall, 2009 Description: More on Tides Calculation of the History of the Moon\'s Orbit Let us calculate the evolution of the Moon\'s orbital radius R under the influence of the torque on the Moon\'s orbit from tides raised on the Earth by the Moon, taking the Moon to have mass... Date Added: 2009-04-26 11:20:44 |
| I03_DELHE3_upper_2500.pdf Path: UCSD >> I >> 2500 Fall, 2009 Description: 3He (%) for I03 20S (2500:1) Computer Generated 562 560 555 550 545 540 535 530 525 520 515 510 505 500 495 490 485 480 475 470 465 460 455 450 m 0 200 0 400 0 600 2 6 800 10 12 4 1000 km 0 Lon 50 500 55 1000 60 1500 65 2000 70 2500 75 3000... Date Added: 2009-04-26 11:22:34 |
| XTAL_15MHz.pdf Path: UMBC >> CPATEL >> 310 Fall, 2009 Description: Resistance Weld Thru-Hole Crystal Model: HC49SLF Page 1 of 2 RoHS Compliant / Pb Free Rev. 2/27/2006 http:/www.foxonline.com/need_a_sample.htm FEATURES Low Cost Stocking Standard (see page 2) Fundamental to 50 MHz Resistance Weld OPTIONS ... Date Added: 2009-04-26 11:23:11 |
| 414_spring2005.pdf Path: UMBC >> CMPE >> 414 Spring, 2009 Description: CMPE 414/CMPE 641: Advanced VLSI Design Course: CMPE 414/ CMPE 641: Advanced VLSI Design. Sections 0101. Spring 2005. 3 credits. Course Instructor: Chintan Patel, Research Asst. Prof., Computer Science & Electrical Engineering Office: ITE 322, Teleph... Date Added: 2009-04-26 11:23:23 |
| ss9.pdf Path: Maryland >> ENEE >> 241 Fall, 2008 Description: y X y y y u } p l l l p } t l i m k2$#22mm\'y\'(odk03msw m f3s\'dd2 km2GmP\'q u i i i t l r i y s ... Date Added: 2009-04-26 11:23:25 |
| 11_emotion.pdf Path: UCSB >> PSYC >> 105 Fall, 2009 Description: Emotional Development 1 Overview Emotional expression in infancy and beyond Simple and complex emotions Display rules and the regulation of emotions Recognizing and interpreting emotions Discrimination of emotions Social referencing Understanding ... Date Added: 2009-04-26 11:24:48 |
| minilab1.pdf Path: NSULA >> GEL >> 63639 Fall, 2009 Description: Mini-laboratoire 1: Introduction a WebPACK ` c automne 2008 Sbastien Roy et Isabelle LaRoche, e avec l\'aide de Michel Thriault e Duree : 1 semaine - du 17 septembre au 25 septembre 2008 ` ` rapport a remettre avant le 25 septembre a 16h30 1 Objec... Date Added: 2009-04-26 11:26:00 |
| excel.ppt Path: N.C. State >> AEE >> 526 Spring, 2008 Description: The Joy of Using Excel NCSU Agricultural Extension Education AEE 526 What is Excel ... Date Added: 2009-04-26 11:26:47 |
| threeamigos_finalpresentation.ppt Path: UF >> CEN >> 5035 Fall, 2008 Description: Distributed Airport Ground Traffic Control Simulator Class CEN 5035 Group Name: The Three Amigos Professor: Tuba Yavuz Members: Elias Baaklini John ORourke Carlos Giraldo Identification of the Objects AirportControlTower Junction TaxiWay RunWay Gate... Date Added: 2009-04-26 11:28:10 |
| nutmgtcsrees.pdf Path: Texas A&M >> MEDIA >> 2605 Fall, 2009 Description: State Nutrient Management Information: CSREES Southern Region (AL, AR, FL, GA, KY, LA, MI, NC, NM, OK, SC, TN, TX) CSRRES Nutrient Management Meeting Southern Region, Atlanta, GA, May 3-4, 2004 J. Camberato, M. Daniels, C. Mitchell, T. Obreza, L. Old... Date Added: 2009-04-26 11:28:19 |
| x3a_sols.pdf Path: Texas A&M >> M >> 253 Fall, 2009 Description: Fall 2007 Math 253 Exam 3A: Solutions c 2007 Art Belmonte Mon, 05/Nov 1. The volume is D f (x, y) d A, which well estimate. Recall that f (x, y) = 52 x 2 y 2 . While you are more than welcome to use the relevant TAMUCALC approximate integration fa... Date Added: 2009-04-26 11:28:22 |
| Schwartz_1841.pdf Path: UNC >> BIOCH >> 134 Fall, 2009 Description: REPORTS 10. 11. codon. The same probes were used to identify targeted clones and genotyping. N. Ben-Arie et al., in preparation. Pregnant females were culled, and embryos were dissected in ice-cold phosphate-buffered saline (PBS). The surrounding yol... Date Added: 2009-04-26 11:30:25 |
| power2.pdf Path: UNC >> BIOS >> 662 Fall, 2008 Description: Power and Sample Size III Bios 662 Michael G. Hudgens, Ph.D. mhudgens@bios.unc.edu http:/www.bios.unc.edu/mhudgens 2006-11-20 11:11 BIOS 662 1 Power and Sample Size III Overview Cases often harder to obtain than controls How many controls per ... Date Added: 2009-04-26 11:30:48 |
| ps06s.pdf Path: SUNY Plattsburgh >> MAT >> 426 Spring, 2009 Description: Math 426 Problem Set #6 Solution 12 March 2008 1. Solve the third-order initial value problem y + 3y 4y 12y = 0; y(0) = 6, y (0) = 5, y (0) = 19. Solution: We guess that a solution has the form y = emx for some constant m. Substituting emx , m... Date Added: 2009-04-26 11:31:17 |
| waveguides_and_resonant_cavities_b.doc Path: Rose-Hulman >> PH >> 317 Fall, 2009 Description: 1 Waveguides and Resonant Cavities MJM January 3, 2006 rev Jan 9, 2007 In free space, Maxwells equations lead to wave equations for E and B. In a waveguide or resonant cavity, our solutions will be of the form E(x,y,z,t) = E(x,y) exp(ikzz i t), and... Date Added: 2009-04-26 11:31:46 |
| MyxDemo.pdf Path: CSU Channel Islands >> ICS >> 221 Fall, 2009 Description: http:/www.isr.uci.edu/ Myx Demo Hazel Asuncion hasuncio@ics.uci.edu For Inf 221 February 26, 2009 Demo from Scott Hendricksons Hello World 2 Tutorial http:/tps.ics.uci.edu/svn/projects/archstudio4/documents/HelloWorld_TwoComp.pdf Developing a Simpl... Date Added: 2009-04-26 11:32:08 |
| expend.pdf Path: University of Illinois, Urbana Champaign >> FY >> 250000 Fall, 2009 Description: Print Zoom Find Prev Page Next Page Tables Home Page 1 of 1 ILLINOIS PUBLIC LIBRARY STATISTICS FY 1998-99 Libraries Serving Populations of 250,000 Or More Expenditures Expenditures Location Library Name Population System Served Salaries Benef... Date Added: 2009-04-26 11:34:41 |
| Packages.pdf Path: Georgia Tech >> CS >> 4240 Fall, 2008 Description: Compiling Modules & Packages What do we find in a module or package declaration? A name and components, like in a record Components declared in a new name space Components may include procedures and functions The module/package declares an insta... Date Added: 2009-04-26 11:37:37 |
| calculatornotes.pdf Path: Fayetteville State University >> MAC >> 2233 Summer, 2009 Description: ... Date Added: 2009-04-26 11:39:50 |
| SRAC-181web.pdf Path: Oklahoma State >> DOCUMENT >> 1855 Fall, 2009 Description: Oklahoma Cooperative Extension Service SRAC-181 Feeding Catfish in Commercial Ponds Edwin H. Robinson Meng H. Li Cochran Warmwater Aquaculture Center Cochran Warmwater Aquaculture Center Oklahoma Cooperative Extension Fact Sheets are also availab... Date Added: 2009-04-26 11:41:51 |
| Module1-Intro.pdf Path: Maple Springs >> CSE >> 3461 Fall, 2009 Description: What is the User Interface (UI)? (1) COSC 3461: Module 1 User Interface Computer Program User Overview of User Interfaces The simple view: The user interface is the junction between the user and the computer 2 What is the User Interface (UI)? (2) ... Date Added: 2009-04-26 11:42:01 |
| Midterm_info.pdf Path: Purdue >> CS >> 250 Fall, 2008 Description: CS250 Computer Architecture Spring 2009 Sample Questions for Midterm Exam Review materials posted in the newsgroup! (If you don\'t have enough time, review the lecture notes first) 1. 5-10 \"True or False\" questions Both add and addi are R-type instru... Date Added: 2009-04-26 11:44:46 |
| 8-23-01Final.doc Path: UNC >> READ >> 4843559 Fall, 2009 Description: Town of Macon, NC Minimum Housing Code Be it ordained by the Town Board of the Town of Macon, North Carolina: Section 1. Finding; Purpose. Pursuant to G.S. 160A-441, it is hereby declared that there exists in the Town, dwellings which are unfit for h... Date Added: 2009-04-26 11:46:14 |
| 401_15Gentian.pdf Path: Wisconsin >> BOTANY >> 401 Fall, 2008 Description: Gentianaceae - gentian family Diversity and Evolution of Asterids . . . gentians, milkweeds, and potatoes . . . Cosmopolitan family of 80 genera and nearly 900 species. Herbs to small trees (in the tropics) with opposite leaves. CA (4-5) CO (4-5) A... Date Added: 2009-04-26 11:46:34 |
| hw3F03.pdf Path: Georgia Tech >> ECE >> 6605 Fall, 2008 Description: ECE 6605 HW#3, Assigned Sept 15, Due Sept 24. 1. (10 points) Consider a stationary 3-state Markov chain {Xi } where Xi is an element of X= {1, 2, 3} with probability transition matrix 0 P= 1 p 1-p 0 1-p p 0 0 a) Draw the state transition diagram and... Date Added: 2009-04-26 11:47:02 |
| test3_04c.pdf Path: Texas A&M >> MATH >> 166 Fall, 2008 Description: 1. In Aprils closet, there are 7 red blouses, 5 blue blouses, 9 green blouses and 3 yellow blouses. She is packing to go on a trip and needs a total of 6 blouses. What is the probability she selects exactly 3 blue blouses or exactly 3 red blouses? (a... Date Added: 2009-04-26 11:48:05 |
| plagiarism.ppt Path: San Diego State >> ED >> 791 Fall, 2009 Description: Plagiarism instructional opportunitie s MarcieBobe r De of Educational Te pt. chnology bobe m r@ ail.sdsu.e du 594.0587 Expe ctations Dostudentsknowwhatweexpectofthem,relativeto originalwork? Aretheysavvyresearcherswhentheycometous? Canweassumetheyf... Date Added: 2009-04-26 11:50:31 |
| hw4.pdf Path: Maryville MO >> STAT >> 9640 Fall, 2009 Description: STAT 9640, W2009 1. Solve the following problems. Homework 4 Due: March 9, 2009 (a) Consider a location-scale family with the pdf, p(x | ) = f (x - ), x, I Here f is a R. known density function on I Find the Fisher information of . For a special... Date Added: 2009-04-26 11:53:25 |
| 2008HallM.pdf Path: East Los Angeles College >> PORT >> 444 Fall, 2009 Description: Abstract The websites we use can have an effect on us, both financially and socially. The everchanging internet is supposed to enhance our lives; online shops allow us to buy items without ever leaving our home, whilst social networking sites provide... Date Added: 2009-04-26 11:54:14 |
| jan15.ppt Path: Case Western >> AST >> 202 Fall, 2009 Description: What is science? Discussion Science is a collection of facts Discussion Scientists are trying to discover the truth Discussion Scientists always need to keep an open mind My view Science is a collection of explanations that are useful in scientis... Date Added: 2009-04-26 12:02:49 |
| 360508.pdf Path: Michigan State University >> LIB >> 1936 Fall, 2009 Description: The p\"\';is~nb~it prrvicles a rapid and inexponsive I:l.ethc:1 for ccntrCllling these pests. It uay be used on puttin:; greens as -rrell as apprcaches an~.1\".ir-rrn.ys. By scattering pqiscn bait early in the seastm f \'~nthe turf surroun Iing the putti... Date Added: 2009-04-26 12:05:45 |
| ps6.pdf Path: Wellesley >> CS >> 230 Fall, 2008 Description: CS230 Data Structures Prof. Lyn Turbak Wellesley College Handout # 20 November 3, 2004 Problem Set 6 Due: 6pm Friday, November 12 Exam 2 Notice: On Friday, November 12, the second take-home exam will be posted. It will be due at 6pm on Saturday, No... Date Added: 2009-04-26 12:07:32 |
| map.pdf Path: Western Washington >> EGEO >> 451 Fall, 2009 Description: Pipelines and Fields Around the Amazon # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # Legend # Oil and Gas Fields Political Boundary Pipelines 1:12,500,000 Produced By: Michael Kaminski; March 15, 2007... Date Added: 2009-04-26 12:08:32 |
| practicemidterm1.pdf Path: Washington >> INDE >> 513 Fall, 2009 Description: IND E 513 Practice Midterm 1 February 12, 2009 Question 1 Consider the following linear program. min -10x1 - x2 x1 1 20x1 + x2 100 x1 , x2 0. 1. Draw the feasible region on a piece of paper (this picture would look nicer if you used two different ... Date Added: 2009-04-26 12:10:55 |
| pico-lecture.pdf Path: UCSD >> CSE >> 291 Fall, 2001 Description: Program In Chip Out CSE 291E / EE260C Spring 2002 Overview Quick review of basic architectures What is Single Issue, Super Scalar, VLIW, Overview of Systolic Arrays Overview of PICO Project DataWidth Reduction Algorithm Tim Sherwood 2 Archi... Date Added: 2009-04-26 12:11:03 |
| syllabus.pdf Path: Washington >> BIOA >> 568 Fall, 2009 Description: Darryl Holman 117 Denny Hall 206-543-7586 djholman@u.washington.edu http:/faculty.washington.edu/djholman Human Reproductive Ecology BIO A 568 Spring 2004 Scope: This course examines recent developments in human reproductive biology, human reproduct... Date Added: 2009-04-26 12:13:18 |
| 2005919_r01k_00457.pdf Path: Stanford >> CRDS >> 1015 Fall, 2009 Description: US District Court Civil Docket as of 09/19/2005 Retrieved from the court on Monday, February 27, 2006 U.S. District Court Western District of Texas (Austin) CIVIL DOCKET FOR CASE #: 00-CV-457 In Re Crossroads Sys v. , et al Filed: 07/28/00 Assigned ... Date Added: 2009-04-26 12:13:51 |
| RR87-33.pdf Path: NYU >> ECON >> 1987 Fall, 2009 Description: ... Date Added: 2009-04-26 12:13:52 |
| MidtermReview_F09.pdf Path: Cal Poly >> EL >> 6123 Fall, 2009 Description: EL6123 Video Processing Midterm Summary Spring 09 Yao Wang Polytechnic Institute of NYU Brooklyn, NY 11201 Basics of Video Color representation and perception Camera model: perspective projection Color video capture and display Yao Wang, NYU-Po... Date Added: 2009-04-26 12:16:54 |
| ps3.pdf Path: Cornell >> P >> 651 Fall, 2009 Description: V v \'I { UUV 5 FF(c00)8@e#ECG { B(B8A9S!(wF!F#\'( @ A ! 6 A T 8 6 T % 6 6 { S1(B ( 2FD ... Date Added: 2009-04-26 12:17:01 |
| Lab_recursion.pdf Path: Richmond >> CS >> 221 Fall, 2009 Description: CS221 Lab Recursion You may be familiar with the number placement puzzle Sudoku, which works as follows: a 9 x 9 grid is partially populated with digits from 1 to 9. Ill refer to this grid as the clue. The purpose of the game is to fill in the remai... Date Added: 2009-04-26 12:17:05 |
| Pamplin_Jason_200705_phd.pdf Path: Bowling Green >> ETD >> 04222007 Fall, 2009 Description: FORMAL OBJECT INTERACTION LANGUAGE: MODELING AND VERIFICATION OF SEQUENTIAL AND CONCURRENT OBJECT-ORIENTED SOFTWARE By JASON ANDREW PAMPLIN Under the Direction of Ying Zhu ABSTRACT As software systems become larger and more complex, developers r... Date Added: 2009-04-26 12:17:19 |
| 36.txt Path: Grinnell >> CS >> 152 Fall, 2004 Description: CSC152 2005S, Class 36: Dictionaries Admin: * Moon pies! * Exam! * Prospectives? (Probably not) * Warning: Potential visitor Tuesday Overview: * Generalizing arrays * Key methods * Finishing the ADT * Implementation strategies Background: Arrays ... Date Added: 2009-04-26 12:17:45 |
| 6.pdf Path: Grand Valley State >> EGR >> 693 Fall, 2008 Description: Table of Figures Figure 2.1.1 Figure 2.1.2 Figure 2.1.3 Figure 2.1.4 the hardware required for the Renishaw ballbar test. feed in, out, angular overshoot arcs and the data capture arcs. the data capture range of the ballbar transducer is approximatel... Date Added: 2009-04-26 12:20:50 |
| VLSI08_ZGuo.pdf Path: Berkeley >> EECS >> 903 Fall, 2009 Description: Large-Scale Read/Write Margin Measurement in 45nm CMOS SRAM Arrays Zheng Guo, Andrew Carlson, Liang-Teck Pang, Kenneth Duong, Tsu-Jae King Liu, Borivoje Nikolic Department of Electrical Engineering and Computer Sciences, University of California, Ber... Date Added: 2009-04-26 12:25:02 |
| Applications_NE104A_Spring09.pdf Path: Berkeley >> NE >> 104 Fall, 2009 Description: X. Gamma-Ray Spectroscopy and Applications Most radioisotopes emit gamma rays and almost all elements have isotopes that emit gamma rays Detection, identification, and assay of naturally occurring radioisotopes (e.g. in geology, mining, and oil exp... Date Added: 2009-04-26 12:25:37 |
| has_health_and_safety_procedures_200710.pdf Path: East Los Angeles College >> DOCS >> 20090303 Fall, 2009 Description: HEALTH AND SAFETY POLICY Safety Procedures Oct 07.doc CONTENTS Page No PART 1: HEALTH AND SAFETY POLICY PART 2: ORGANISATION AND... Date Added: 2009-04-26 12:26:52 |
| T1BanswersW09,formA.doc Path: Bates >> PSYC >> 101 Fall, 2009 Description: Answers for Psyc 101B Winter 2009 Test #1 Version A 1. C 2. C 3. B 4. D 5. D 6. A 7. A 8. A 9. A 10. C 11. C 12. C 13. D 14. B 15. C 16. A 17. C 18. B 19. A 20. C 21. C 22. B 23. D 24. C 25. C 26. D 27. C 28. B 29. D 30. D 31. C 32. C 33. B 34. D 35.... Date Added: 2009-04-26 12:27:32 |
| lec14-proj4.pdf Path: Berkeley >> CS >> 150 Fall, 1996 Description: EECS150 - Digital Design Lecture 14 - Project Description, Part 4 of 4 March 5, 2009 John Wawrzynek Spring 2009 EECS150 - Lec14-proj4 Page 1 Project Overview A. MIPS150 pipeline structure B. Memories, project memories and FPGAs C. Project specifi... Date Added: 2009-04-26 12:27:57 |
| 03_worksheet_grammar.pdf Path: East Los Angeles College >> COMS >> 30122 Fall, 2009 Description: Worksheet ALE Grammars Henk Muller October 19, 2005 1. Given C-style comments (that are denoted with /* and */): (a) Define a regular grammar (regular expression) to match those comments. (b) Match the following code using this regular expression: in... Date Added: 2009-04-26 12:28:36 |
| 1960rcs0-591.doc Path: Neumont >> EN >> 1960 Fall, 2009 Description: Supreme Court of Canada International Brotherhood of Electrical Workers v. Town of Summerside et al., [1960] S.C.R. 591 Date: 1960-05-16 Local Union Number 1432 of the International Brotherhood of Electrical Workers (Plaintiff) Appellant; and The Tow... Date Added: 2009-04-26 12:30:18 |
| 410-c22_002.ppt Path: Alabama >> FI >> 410 Spring, 2008 Description: Options Chapter 22 Options (WooWoo!) An option gives the holder the right, but not the obligation, to buy or sell a given quantity of an asset on (or before) a given date, at prices agreed upon today. Exercising the Option Is a limited li... Date Added: 2009-04-26 12:32:31 |
| WPAFB.pdf Path: New Mexico >> CP >> 0702 Fall, 2009 Description: ... Date Added: 2009-04-26 12:34:47 |
| 3850coss2007jo.pdf Path: Laurentian >> PSYC >> 200702 Fall, 2009 Description: Psychology 3850 Applied Child and Adolescent Development July 2007 Overview This course will examine selected aspects of atypical development in childhood and adolescence, with particular emphasis on atypical cognitive development and its implication... Date Added: 2009-04-26 12:35:32 |
| SourcesofInfo.doc Path: Missouri State >> AGH >> 443 Fall, 2008 Description: Sources of Information The greenhouse industry is a fast paced field with changes in marketing trends and new advances in plant materials, equipment, and production techniques occurring daily. The successful business will need to stay abreast of th... Date Added: 2009-04-26 12:37:07 |
| esler-POF-2008.pdf Path: East Los Angeles College >> JGE >> 1000 Fall, 2009 Description: PHYSICS OF FLUIDS 20, 116602 2008 Robust and leaky transport barriers in unstable baroclinic flows J. G. Eslera Department of Mathematics, University College London, 25 Gower Street, London WC1E 6BT, United Kingdom Received 29 April 2008; accepted ... Date Added: 2009-04-26 12:40:19 |
| Fall2008-assignment3.doc Path: USC >> CSCI >> 455 Fall, 2009 Description: Programming Systems Design CSCI 455 FALL 2008 Dr. K. Narayanaswamy Programming Assignment # 3 Due Date: 9/28/2008 (11:59:59 p.m.) Goal This assignment requires you to understand how to declare and use FUNCTIONS, including passing of parameters by va... Date Added: 2009-04-26 12:40:21 |
| vlachos-2001.pdf Path: UPenn >> CSE >> 410 Fall, 2008 Description: Curved PN Triangles Alex Vlachos J rg Peters o Chas Boyd Jason L. Mitchell ATI Research Microsoft Corporation University of Florida Figure 1: Which rendering would you prefer? (from left to right) (a) Input triangulation, (b) Gouraud shaded... Date Added: 2009-04-26 12:41:32 |
| 2007_exam_2_white.pdf Path: Michigan State University >> CEM >> 143 Summer, 2008 Description: EXAM 2 CHEMISTRY 143 SPRING 2007 Monday, March, 26 2007 NAME: _ STUDENT NUMBER: _ SECTION NUMBER: _ This exam has 32 questions on 9 pages. Please make sure that your exam is complete. Write your name, student number, and section number on the front... Date Added: 2009-04-26 12:43:17 |
| 600604.pdf Path: Michigan State University >> LIB >> 1960 Fall, 2009 Description: By GADGETS, GIMMICKS AND GOLF are on the a 575-yard hole. fit fingers into the little YouYou youryour tee ofgripimmediately molds of driver\'s all the parts of your hands are in perfect placement. You adjust your harnessthe one that guarantees you a ... Date Added: 2009-04-26 12:44:21 |
| quaternion.pdf Path: Iowa State >> CS >> 577 Fall, 2009 Description: Quaternions and Rotations Com S 477/577 Sep 11, 2008 1 Introduction The development of quaternions is attributed to W. R. Hamilton in 1843. Legend has it that Hamilton was walking with his wife Helen at the Royal Irish Academy when he was suddenly... Date Added: 2009-04-26 12:46:54 |
| Chapter14notes.doc Path: Iowa State >> MGMT >> 471 Spring, 2008 Description: CHAPTER 14 Collective Bargaining and Labor Relations I. II. Introduction The Labor Relations Framework (text Figure 14.1) A. John Dunlop suggested a labor relations system that consists of four elements: 1. 2. 3. 4. B. An environmental context (techn... Date Added: 2009-04-26 12:47:21 |
| SSC.pdf Path: Michigan State University >> READ >> 1984 Fall, 2009 Description: ... Date Added: 2009-04-26 12:51:48 |
| emacs.pdf Path: Utah >> P >> 6720 Fall, 2009 Description: GNU Emacs Reference Card (for version 18) Starting Emacs To enter Emacs, just type its name: emacs To read in a le to edit, see Files, below. Leaving Emacs suspend Emacs (the usual way of leaving it) exit Emacs permanently C-z C-x C-c Files replac... Date Added: 2009-04-26 12:54:35 |
| 20041123_o02c_04cv4976.pdf Path: Stanford >> TRPH >> 1032 Fall, 2009 Description: ... Date Added: 2009-04-26 12:54:58 |
| inertia.pdf Path: Minnesota >> PHYSICS >> 1301 Fall, 2009 Description: Cylinders Solid cylinder about central axis (CM): M ~ 2 2 I = r dm = r dV = 2 r 2 223 1rhdr R h dV 130 2 R 1 I = MR 2 2 2M 3 2M r = 2 r dr = 2 R 4 R 0 R 4 R 0 2M R 4 1 = 2 = MR 2 R 4 2 I = MR 2 Thin cylinder about central axis: ~ 2 2 2 I ... Date Added: 2009-04-26 12:56:58 |
| 2005422_r18d_04CV2978.pdf Path: Stanford >> NFLX >> 1031 Fall, 2009 Description: EXHIBI T I Janney Montgomery Scott LLC COMPANY UPDATE ` sel l July 2, 2004 EQUITY RESEARCH Film & Entertainment As Expected, Price Hike Slows 2 Q Sub Growth Highlights Alden Mahabir s Slightly weaker than expected sub growth. Although 2Q\'s 1... Date Added: 2009-04-26 12:57:46 |
| CarterSTCletterofintent.doc Path: Texas Tech >> ENGLISH >> 5377 Fall, 2009 Description: Establishing Baseline Data on the Return on Investment of Technical Communication Activities through Comprehensive Analysis of Activity-Based Costing Data in a Representative Sample of Organizations Dr. Locke Carter Texas Tech University Box 43091 Lu... Date Added: 2009-04-26 12:58:07 |
| UM_mou_00.pdf Path: Michigan >> VERSION >> 255 Fall, 2009 Description: U.S. ATLAS MOU NO. 32/00 UM-HE-99-08 Amendment to Memorandum of Understanding between University of Michigan and The U.S. ATLAS Project Office for Fiscal Year FY 2000 September 29, 1999 1. Introduction This Amendment is made to provide details of... Date Added: 2009-04-26 12:58:24 |
| DU-MCS-97-01.pdf Path: Drexel >> TS >> 467 Fall, 2009 Description: Dimensionless Fast Fourier Transforms L. Auslander Department of Mathematics The City University of New York New York, NY 10036 J. R. Johnson Department of Mathematics and Computer Science Drexel University Philadelphia, PA 19104 R. W. Johnson Depart... Date Added: 2009-04-26 13:00:16 |
| 1010READINGSANDEVENTSSCHEDULEFORfall2006.doc Path: Minnesota >> ELED >> 1010 Fall, 2009 Description: WEEKLY PORTFOL IO DATE TENTATIVE READING M =QUIZ AND CLASS ACTIVI T I ES SCHEDULE FOR ELED 1010 MWF 001 syllabus Questions Big Book See school web site. Know about school Copy front p... Date Added: 2009-04-26 13:01:47 |
| Lab9DerivativeTests.pdf Path: MN State >> M >> 261 Fall, 2009 Description: r ){ e \'f J (a) Identify the critical numbers forf ) ./ 2/ .\' 3j ,.r (b) At what value(s) ofx is [\" zero? Lf I (c) Find the intervals on which! increasing. Explain. is (d) Find the intervals on which! decreasing. Explain. is (-(/QJ1] U [2J... Date Added: 2009-04-26 13:02:37 |
| Microsoft_Word_-_Consortium_Agreement.pdf Path: St. Mary NE >> FRAME >> 2678 Fall, 2009 Description: Consortium Agreements A consortium agreement is a written agreement between two schools. The agreement allows students to take courses at another institution and have those courses count toward the degree or certificate at the home institution. The h... Date Added: 2009-04-26 13:04:02 |
| ps7_2008.doc Path: Rutgers >> MS >> 451 Fall, 2004 Description: Name_ Due 10/16/2008 1) A 10 m/s wind blows to the north along a shallow inland bay (such as Barnegat Bay) that is oriented in the North/South direction. The bay is 50 km long and two meters deep. Initially the current in the bay accelerates to the... Date Added: 2009-04-26 13:11:19 |
| MT2_W06.pdf Path: W. Alabama >> ECE >> 100 Fall, 2009 Description: Waterloo Department of Electrical and Computer Engineering E&CE1OO FUNDAMENTALS ELECTRICAL ENGINEERING OF Unlverstty of Midterm Exam Second July8,2005 Instructors: Claudio Caffizares, Hatem Zeineldin Time Allowed: L.5Hours Program (Circle): ELECT... Date Added: 2009-04-26 13:11:27 |
| 1960rcs0-591.doc Path: Neumont >> CSC >> 1960 Fall, 2009 Description: Supreme Court of Canada International Brotherhood of Electrical Workers v. Town of Summerside et al., [1960] S.C.R. 591 Date: 1960-05-16 Local Union Number 1432 of the International Brotherhood of Electrical Workers (Plaintiff) Appellant; and The Tow... Date Added: 2009-04-26 13:12:04 |
| dictionaries-1.txt Path: Grinnell >> CS >> 152 Fall, 2004 Description: CSC152 2005S, Class 36: Dictionaries Admin: * Moon pies! * Exam! * Prospectives? (Probably not) * Warning: Potential visitor Tuesday Overview: * Generalizing arrays * Key methods * Finishing the ADT * Implementation strategies Background: Arrays ... Date Added: 2009-04-26 13:12:42 |
| MultiplicationWorksheet.pdf Path: N. Michigan >> CS >> 255 Fall, 2008 Description: Multiplication Worksheet By Stacey Erskine Name_ Date_ 1. 234 x 9 _ 2. 782 x 6 _ 3. 128 x 5 _ 4. 679 x 3 _ 5. 428 x 25 _ 6. 321 x 83 _ 7. 750 x 18 _ 8. 289 x 74 _ ... Date Added: 2009-04-26 13:13:29 |
| 12-13-storage-overview.pdf Path: UMass (Amherst) >> CS >> 445 Fall, 2009 Description: Overview of Storage and Indexing Fall 2008 Slides Courtesy of R. Ramakrishnan and J. Gehrke 1 DBMS Architecture Query Parser Query Rewriter Query Optimizer Query Executor File & Access Methods Lock Manager Log Manager Buffer Manager Disk Spac... Date Added: 2009-04-26 13:16:02 |
| Lecture16_s03.pdf Path: Berkeley >> EE >> 105 Fall, 2009 Description: EECS 105 Spring 2003 Lecture 16 C. J. Spanos Lecture 16 Last time: MOSFET small-signal model (gm, ro) Today : Complete small-signal model: add capacitors P-channel MOSFET MOSFET Spice Model University of California at Berkeley Dept. of EECS... Date Added: 2009-04-26 13:16:57 |
| Assignment2_CFoster.doc Path: Penn State >> LESSON >> 108 Fall, 2009 Description: Date: January 30, 2007 To: Andrew Korbel From: Carrie Foster cc: Patrick Kennelly Subject: Review of Andrew Korbel\'s write-up for \"New Hires\" packet With the projected growth of the company, the \"New Hires\" packet is being revised to include updated ... Date Added: 2009-04-26 13:23:24 |
| Normalpractice.pdf Path: Wells >> MATH >> 251 Fall, 2009 Description: ... Date Added: 2009-04-26 13:30:14 |
| Homework_12-solutions Path: Texas >> PHY 303L >> 58310 Spring, 2009 Description: toupal (rgt374) Homework 12 Chiu (58295) This print-out should have 25 questions. Multiple-choice questions may continue on the next column or page find all choices before answering. 001 10.0 points The reflecting surfaces of two intersecting fla... Date Added: 2009-04-26 14:56:21 |
| MKT Test 1--Book Notes Path: Texas >> MKT 320F >> 320 Spring, 2009 Description: Marketing Book Notes-Chapter 1 Marketing\'s Value to Consumers, Firms and Society Marketing-What\'s it all about? Marketing is more than selling or advertising. Production is actually making goods or performing services. Marketing provi... Date Added: 2009-04-26 16:31:40 |
| Chapter 2 Path: Colorado >> BCOR >> 1010 Fall, 2007 Description: Chapter 2 Chemistry 1: Atoms and Molecules I. Atoms A. Structure of atoms B. Isotopes C. Radioisotopes II. Chemical Bonds A. Electrons and energy levels B. From atoms to molecules 1. Ionic interactions 2. Covalent bonds 3. Hydrogen bonds 4. Hydrophob... Date Added: 2009-04-26 19:14:34 |
| Chapter 7 PPT Notes Film Path: Baylor >> FDM >> 1303 Spring, 2009 Description: A Silent Film Gallery Le Voyage Dans la Lune A Trip to the Moon (French, 1902) Written and directed by Georges Melies Among the first to use special effects, fantasy and science fiction in film Birth of a Nation (1915) Directed by D.W. Griffith ... Date Added: 2009-04-26 22:45:31 |
| final-P2.pdf Path: Utah >> PHYS >> 7910 Fall, 2008 Description: ... Date Added: 2009-04-27 04:51:55 |
| Economics.3640.Lecture.26.doc Path: Utah >> ECON >> 3640 Fall, 2008 Description: Economics 3640-001 Lecture 26 * Reading Assignment: Ch.6 Inferences: Tests of Hypothesis (6.4) 6.4 Small-Sample Test of Hypothesis about a Population Mean Instructor: Sanghoon Lee The only difference between the small-sample and large-sample test o... Date Added: 2009-04-27 04:52:49 |
| ex1_fall2003_StackA.pdf Path: Alabama >> FI >> 302 Fall, 2008 Description: Fi302, Business Finance Exam 1, Fall 2003 1. (3 points) Choose the one statement that most correctly describes categorization schemes of the financial markets. a. the credit market includes stocks that do not specify repayment schedules but instead... Date Added: 2009-04-27 04:53:20 |
| students_abroad.pdf Path: UPenn >> VPM >> 410 Fall, 2009 Description: South Africa Greg Fleming AVC98 AVC 98 Reselyn All R l Allen Mexico AVC2001 Sarah Proud South Wales AVC2001 South Africa Lela Castaneda and Stacey Thomas AVC2002 Tanya M. ten Broeke Guatemala, AVC2002 Sarah Proud AVC 2001 Wendy Ruigrok Zurich, ... Date Added: 2009-04-27 04:53:52 |
| ErrorCorrection.pdf Path: New Hampshire >> ECE >> 734 Fall, 2008 Description: 3/4/2009 Error Correction detected errors usually require data blocks to be retransmitted not sufficient for some applications When bit error rate is high causing lots of retransmissions. When propagation delay long (satellite) compared with fra... Date Added: 2009-04-27 04:54:01 |
| Fainstein.pdf Path: Pratt >> PLAN >> 657 Fall, 2009 Description: ... Date Added: 2009-04-27 04:57:30 |
| exam1sol.pdf Path: UT Arlington >> MATH >> 3330 Fall, 2008 Description: Matrices and Linear Algebra Solutions to Exam 1 Must show your work! No work no credit even with correct answers! Problem 1. (15 pts) Determine which of the following matrices below are in the reduced row-echelon form, and perform necessary eliminati... Date Added: 2009-04-27 04:58:35 |
| 76SB10.pdf Path: RIT >> CE >> 341 Fall, 2009 Description: Thru-Hole DIP Switches SERIES 76 SPST Rocker 76 FEATURES Raised and Recessed, Rocker and PIANO-DIP Styles Sealed Base Standard Spring and Ball Contact Top Tape Seal Option DIP Switches DIMENSIONS In inches (and millimeters) Side Actuated PIA... Date Added: 2009-04-27 05:00:06 |
| Germ0405color.pdf Path: Iowa State >> NR >> 934 Fall, 2009 Description: May 2004. I count my blessings with the flowers, never with leaves that fall. Lady Bird Johnson Coordinator\'s Comments What a delight to recognize all of the Master Gardeners who have been involved in MG activities this past year. Linn County Extens... Date Added: 2009-04-27 05:00:54 |
| turkey.doc Path: Iowa State >> MR >> 1102 Fall, 2009 Description: Splash, FL 10-31-07 Turkey Frozen? Go Ahead and Cook It, Expert Says If you\'re in charge of cooking the Thanksgiving turkey, you may not have to plan as far ahead as you thought you did, according to Iowa State University Extension food science speci... Date Added: 2009-04-27 05:01:55 |
| assignment03-4.pdf Path: Iowa State >> STAT >> 503 Fall, 2008 Description: STAT503X - Assignment 4 - Databases Due: anytime before 5:00pm May 7 2003. This assignment needs to be handed in by each person instead of one per working group. There cannot be any extensions beyond the due date. This assignment shall practice your ... Date Added: 2009-04-27 05:03:35 |
| quiz7answers.pdf Path: UMBC >> EN >> 699 Fall, 2009 Description: EN 699 Old English Language and Literature Quiz 7, November 12/07 1. (3 points) Give the following forms: help (strong fem. help) accusative singular mi el, dative singular masculine strong m n nama is _ helpa mi lum s ce sacan (strong 6, quarrel)... Date Added: 2009-04-27 05:13:38 |
| Homework2_Key.pdf Path: Michigan State University >> CEM >> 882 Spring, 2008 Description: CEM 882, Problem Set 2 Due Friday, Feb. 6 in class 1. Photosynthetic organisms including green plants have proteins containing pigments which absorb light. The light energy is eventually converted in chemical bond energy. Using the spectra below, de... Date Added: 2009-04-27 05:14:55 |
| BellandNisbetVakil.pdf Path: Rutgers >> ECON >> 102 Fall, 2009 Description: ... Date Added: 2009-04-27 05:18:51 |
| mesh07.txt Path: New Mexico >> ME >> 504 Fall, 2008 Description: 341 300 4 0.0000E+00 0.0000E+00 2 0.0000E+00 0.0000E+00 0.1000E+00 2 0.0000E+00 0.0000E+00 0.2000E+00 2 0.0000E+00 0.0000E+00 0.3000E+00 2 0.0000E+00 0.0000E+00 0.4000E+00 2 0.0000E+0... Date Added: 2009-04-27 05:19:15 |
| quiz0.pdf Path: New Mexico >> ECE >> 437 Fall, 2008 Description: First Name: Last Name: ECE437 Quiz 0 This material is from Computer Architecture and Organization, the Pre-requisite class for ECE437. _ Q1. Multiple Choices Directions: Each of the questions is followed by five suggested answers or completions. S... Date Added: 2009-04-27 05:20:36 |
| lec-10_2.pdf Path: Case Western >> EECS >> 338 Fall, 2009 Description: Banker\'s Algorithm for a Single Resource Deadlocks II EECS 338, Fall 2005 Limin Wang (a) (b) (c) Three resource allocation states Based on the slides by Silberschatz, Galvin and Gagne 2002 1 safe safe unsafe 2 Bankers Algorithm for Multiple Reso... Date Added: 2009-04-27 05:22:38 |
| ImplementingObjects.pdf Path: Case Western >> EECS >> 345 Fall, 2009 Description: Objects Reading: Chapters 9, 10 OOP = Encapsulation + . . . Abstract Data Type Defined only by the operations that can be performed Float: +, -, *, /, sin, . Stack: empty?, push, pop, . Logically separate interface from implementation Except for... Date Added: 2009-04-27 05:22:48 |
| lecture09_10.ppt Path: UWO >> CS >> 2209 Fall, 2009 Description: Computational Logic Lecture 9 Resolution Preliminaries By Prof. Michael Genesereth, Computer Science, Stanford Univ Spring 2005 Modified by Charles Ling. Use with permission Resolution Principle The Resolution Principle is a rule of inference. Usi... Date Added: 2009-04-27 05:27:07 |
| Class1_introduction.pdf Path: Clarkson >> AE >> 427 Fall, 2009 Description: AE/ME 427 Design of Propulsion Systems Dr. Douglas Bohl 239 Camp x6683, dbohl@clarkson.edu www.clarkson.edu/~dbohl/aeme427 Today\'s Outline Introductions Syllabus Expectations Class Goals Semester Topics Review conservation equations (Read Cha... Date Added: 2009-04-27 05:28:08 |
| AE431_HW8.doc Path: Clarkson >> AE >> 431 Fall, 2009 Description: AE431/ME431 Assignment 1 November 2006 Note: Mr. Attilio Milanese is going to lecture next week on the topic of numerical analysis of ordinary differential equations of the type examined in the end-of Chapter 9 Capstone problems. Reading Assignment:... Date Added: 2009-04-27 05:28:09 |
| 023-c150002-landskroner.doc Path: NYU >> C >> 1500 Fall, 2009 Description: NEW YORK UNIVERSITY STERN SCHOOL OF BUSINESS FOUNDATIONS OF FINANCIAL MARKETS (C15.0002.002) Spring 2003 Professor Yoram Landskroner Class: KMC 4-60 Time: MW 2:00- 3:15 pm Office: KMC 8-51 Office Hours: MW 1:00- 2:00 pm Tel: (212) 998 0913 E mail: yl... Date Added: 2009-04-27 05:35:42 |
| Lecture10.pdf Path: UCSB >> ECE >> 155 Fall, 2009 Description: Network Computing Lecture 10 Professor Louise E. Moser E Spring 2008 Java Database Connectivity Java Database Connectivity (JDBC) is a set of APIs that enable Java applications to connect to a Database Management System (DBMS) Using JDBC, an applica... Date Added: 2009-04-27 05:38:57 |
| 04-prob.pdf Path: San Diego State >> LING >> 681 Fall, 2008 Description: Homework Read chapter 1, section 2.1. Do problems 2.1, 2.3, 2.4, 2.5, 2.7 (pp. 5960) Due Wednesday, February 9 Probability so far Classical vs. frequentist vs. subjectivist probability Sum rule: P(A or B) = P(A) + P(B) P(AB) or, for mutually ... Date Added: 2009-04-27 05:40:08 |
| L15.PasswordCracking.pdf Path: Sanford-Brown Institute >> CS >> 166 Fall, 2009 Description: Demo Setup Create guest account for each student Passwords need to be alphanumeric 0123456789 abcdefghijklmnopqrstuvwxyz ABCDEFGHIJKLMNOPQRSTUVWXYZ <15 characters long Crack them! http:/ophcrack.sourceforge.net/ Password Cracking with Rain... Date Added: 2009-04-27 05:42:08 |
| zr.pdf Path: University of Iowa >> ECE >> 195 Fall, 2009 Description: Z, Z and Z-R Relationships G 2 2 Ptc Pr = 1024 ln( 2 ) 2 R 2 = C R 2 Radar equation for distributed targets 5 = z 4 2 z= D Unit Volume 6 Radar reflectivity Radar reflectivity factor (mm6/mm3) Combining these equations, we can write: ... Date Added: 2009-04-27 05:43:14 |
| QuestionsfortheReadings.pdf Path: Minnesota >> HISTORY >> 1095 Fall, 2009 Description: History 1095 Spring 2006 Questions for the Readings [PLEASE NOTE: These questions are being provided in advance so that you may be thinking about some of the broad issues the authors address. You should not read the books only to be able to answer th... Date Added: 2009-04-27 05:43:46 |
| 20010905_f01c_CARSON.pdf Path: Stanford >> CLRN >> 1019 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 MILBERG WEISS BERSHAD HYNES & LERACH LLP REED R. KATHREIN (139304) 100 Pine Street, Suite 2600 San Francisco, CA 94111 Telephone: 415/288-4545 415/288-4534 (fax) - and WILLIAM S. LERACH (68581) DARREN J. ROBBINS (168593... Date Added: 2009-04-27 05:44:19 |
| PSY614_Validitych8-9_website.ppt Path: CSU San Marcos >> PSY >> 614 Fall, 2009 Description: Validity PSY 614 Fall 2007 Instructor: Emily E. Bullock, Ph.D. Validity Validity: how well does a test measure what is purports to measure Validation: process in which the test developer and test user may play a role to gather and evaluate validity ... Date Added: 2009-04-27 05:46:13 |
| 2008630_f01k_0811108.pdf Path: Stanford >> SSYPX >> 1040 Fall, 2009 Description: US District Court Civil Docket as of 10/16/2008 Retrieved from the court on Monday, October 20, 2008 United States District Court District of Massachusetts (Boston) CIVIL DOCKET FOR CASE #: 1:08-cv-11108-JLT Yu v. State Street Corporation et al Date... Date Added: 2009-04-27 05:49:07 |
| 2004118_r05x_04CV00136.pdf Path: Stanford >> MUSEE >> 1029 Fall, 2009 Description: EXHIBIT D Form 8-K -Securities and Exchange Commissio n Washington, D .C . 20549 -FORM 8-K -CURRENT REPOR T Pursuant to Section 13 or 15(d) of the Securities Exchange Act of 1934 Date of Report (Date of earliest event reported) : May 17, 200 4 -MICR... Date Added: 2009-04-27 05:50:44 |
| aut08_7refined2-2x2.pdf Path: Stanford >> CS >> 156 Fall, 2009 Description: Quantifier Elimination (QE) CS156: The Calculus of Computation Zohar Manna Autumn 2008 Algorithm for elimination of all quantifiers of formula F until quantifier-free formula (qff) G that is equivalent to F remains Note: Could be enough if F is equ... Date Added: 2009-04-27 05:55:36 |
| 146-hw5.pdf Path: Stanford >> MATH >> 146 Fall, 2009 Description: Problem 1 (see Problem 5, Section 19, p 168). Consider A an open subset of Rn1 , and regard it as a subset of Rn by letting the last coordinate an be zero. Let p be a point in Rn with positive last coordinate pn . The (open) cone on A and vertex p is... Date Added: 2009-04-27 05:55:39 |
| mills_prat_zangl_stager_neville_werker04.pdf Path: Dallas >> AUD >> 6306 Spring, 2008 Description: Language Experience and the Organization of Brain Activity to Phonetically Similar Words: ERP Evidence from 14- and 20-Month-Olds Debra L. Mills1, Chantel Prat2, Renate Zangl3, Christine L. Stager4, Helen J. Neville5, and Janet F. Werker4 Abstract &... Date Added: 2009-04-27 05:57:12 |
| notes18.pdf Path: N.C. State >> EC >> 202 Spring, 2008 Description: NCSU Department of Economics EC-202 PRINCIPLES OF MACROECONOMICS Summer 2008 CHAPTER 18 The International Financial System and Trade. 1. Exchange Rate Systems An exchange rate system is the method that a country uses to determine the exchange rate ... Date Added: 2009-04-27 06:02:36 |
| 20020114_r04x_011092.pdf Path: Stanford >> ADAP >> 1017 Fall, 2009 Description: http:/securities.milberg.com/mw-cgi-bin./55;E/56;E/57;E/58;E/59;&story_numb=1/12 Plaintiffs\' Opposition to Defendants\' Motion to Dismiss Corrected Consolidated Complaint Source: Milberg Weiss Date: 01/14/02 Time: 9:34 AM MILBERG WEISS BERSHAD HYNES... Date Added: 2009-04-27 06:05:32 |
| alvi-CheckableDomainMngmtWithBiblio.pdf Path: East Los Angeles College >> CL >> 569 Fall, 2009 Description: Checkable Domain Management with Ontology and Rules Atif Alvi and David J. Greaves Computer Laboratory, University of Cambridge, UK {rstname.lastname}@cl.cam.ac.uk Abstract Control of pervasive computing environments is a wellknown problem. Such man... Date Added: 2009-04-27 06:06:01 |
| lecture8.pdf Path: Sanford-Brown Institute >> CS >> 143 Fall, 2009 Description: Introduction to Computer Vision Michael J. Black Sept 2008 Lecture 8: Filtering and features CS143 Intro to Computer Vision Michael J. Black Reading Extra reading on linear models and recognition (ideas for project): http:/www.cs.brown.edu/courses... Date Added: 2009-04-27 06:09:17 |
| zpab2001324.txt Path: Allan Hancock College >> ZPAB >> 2001324 Fall, 2009 Description: Zoological Parks Authority Bill 2001 Executive Summary This Bill repeals and replaces the existing Zoo Act the Zoological Gardens Act, 1972. The priority reasons why a new Bill is required are: The previous Zoo Act was outdated and did not ref... Date Added: 2009-04-27 06:12:05 |
| zweig_fifth.pdf Path: Ohio State >> PS >> 536 Fall, 2009 Description: CHINAS STALLED FIFTH WAVE Zhu Rongjis Reform Package of 19982000 David Zweig In spring 1998, Zhu Rongji became Chinas new prime minister, bringing with him a remarkable and optimistic reform agenda. Two and a half years later, while Zhu has had some ... Date Added: 2009-04-27 06:13:03 |
| Syllabus_lecture.pdf Path: Wisconsin >> G >> 101 Fall, 2009 Description: Geology 101: Elementary Geology Spring, 2004 Instructors: Charles Byers and Brad Singer MWF 11-11:50 am, Weeks Hall AB20 LECTURE SYLLABUS Mo. Date Jan 21 23 26 28 30 Feb. 2 4 6 9 11 13 16 18 20 23 25 27 Mar. 1 3 5 8 10 12 15-19 22 24 26 29 31 Apr. 2 ... Date Added: 2009-04-27 06:14:46 |
| 150ex3f98.pdf Path: Maryville MO >> STAT >> 150 Fall, 2009 Description: Statistics 150, Fall 1998 Exam #3 100 points Form A Name:_ Instructions: I. II. III. IV. V. VI. Show all work. Clearly indicate your final answer. DO NOT write in the right margin line. Carry all computations to at least three decimal places. Y... Date Added: 2009-04-27 06:15:07 |
| tripleex.pdf Path: Arizona >> M >> 223 Fall, 2009 Description: Triple Integration Class Example The integral to be calculated was (x2 + y 2 + z 2 ) dx dy dz R over the region R in the rst octant, bounded by the co-ordinate planes and the plane x + y + z = a. The limits developed in class are shown: a 0 0 ax 0 a... Date Added: 2009-04-27 06:15:10 |
| PepsiCo-SolutionDeliveryTeam2006.pdf Path: East Los Angeles College >> PLACEMENTO >> 0607 Fall, 2009 Description: Corporate Commercial Solution Delivery team The job will involve spending working as a Functional Analyst in the Com... Date Added: 2009-04-27 06:16:22 |
| chap_08.pdf Path: Texas >> BIO >> 366 Fall, 2008 Description: 8 Phage and Lysogeny FIND CHAP TOC Table 8.1 8 Phage and Lysogeny FIND CHAP TOC Table 8.2 8 Phage and Lysogeny Left end FIND CHAP... Date Added: 2009-04-27 06:18:19 |
| 2007125_f01o_0700909.pdf Path: Stanford >> LPL >> 1037 Fall, 2009 Description: Case 1:07-cv-00909-RJS e 1 of 1 UNITED STATES DISTRICT COURT SOUTI-1FRN DISTRICT OF NEW YORK USDS 5DN I DOCUMENT FILED ELECTRONICALLY DOC #: P a, FILED IN RE L. G. PHILIPS LCD Co., LTD. SECURI LITIGATION No. 07 Civ. 00909 (RJS) ORDER RICHARD J.... Date Added: 2009-04-27 06:20:03 |
| 2007115_r01o_021486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: 4:02-cv-01486-CW Document 1781 Filed 11/05/2007 Page 1 of 5 1 2 3 4 5 6 7 8 9 10 11 12 13 [Counsel Listed on Signature Pages] UNITED STATES DISTRICT COURT NORTHERN DISTRICT OF CALIFORNIA OAKLAND DIVISION In re JDS UNIPHASE CORPORATION SECURITI... Date Added: 2009-04-27 06:20:15 |
| ott_reading3.pdf Path: Washington >> CONJ >> 514 Winter, 2008 Description: 0021-972X/07/$15.00/0 Printed in U.S.A. The Journal of Clinical Endocrinology & Metabolism 92(12):4514 4521 Copyright 2007 by The Endocrine Society doi: 10.1210/jc.2007-0646 CLINICAL REVIEW The Role of Receptor Activator of Nuclear Factor- B (RAN... Date Added: 2009-04-27 06:22:09 |
| 13-High_side_MOSFET_Switch_Analysis.pdf Path: Purdue >> EET >> 257 Fall, 2009 Description: 1 High Sid Hi h Side MOSFET Switch Analysis S it h A l i Purdue University ECET 257 Power RF Electronics 3 Voltage Divider Esupply > 20 V Different than Low Side gate divi... Date Added: 2009-04-27 06:25:10 |
| w1d2.pdf Path: Virginia Tech >> CS >> 6704 Fall, 2008 Description: 0 0 E C 127 nw se A D A B E (110, 25) C D (117, 52) (b) ne sw B (95,85) (30,90) 127 (a) (98,35) ... Date Added: 2009-04-27 06:25:24 |
| qb_04.ps Path: Michigan >> MATH >> 105 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.66a (C) 1986-97 Radical Eye Software (www.radicaleye.com) %Title: qb_04.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Helvetica CMR10 CMMI10 CMSY10 CMMI8 CMR8 CMSY8 CMEX10 %+ CMTI10 %EndC... Date Added: 2009-04-27 06:26:39 |
| 06q1 250B k3.pdf Path: UMBC >> MATH >> 250 Fall, 2009 Description: ... Date Added: 2009-04-27 06:27:49 |
| M101t1aw06.pdf Path: UMBC >> MATH >> 101 Fall, 2009 Description: MATH 101 TEST #1a NAME: _ SCORE: _/33 This exam consists of 5 pages. Show all of your work for full credit. The value of each question is given in brackets. 1. Give the domains and ranges of the functions: f ( x ) = arcsin x and g ( x ) = tanh x . 2... Date Added: 2009-04-27 06:27:51 |
| Austrian Economics Readings.doc Path: St. Francis IL >> EC >> 490 Fall, 2009 Description: Austrian Economics Readings Ekelund Text: Austrian Economics (ch. 13?) (on reserve) Friedrich A. Hayek \"Economics and Knowledge\", 1937, Economica. Under Hayek on New School History of Thought web site. Austrian Economics, Neoclassicism, and the Marke... Date Added: 2009-04-27 06:29:09 |
| stat602_2002-1.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 602 Fall, 2009 Description: STATISTICS 602-4 GENERALIZED LINEAR AND NONLINEAR MODELLING Spring 2002 DAY COURSE Instructor: C. Dean Prerequisite: A Practical Knowledge of Multiple Regression and ANOVA. Text: An Introduction to Generalized Linear Models by A. Dobson Chapman and ... Date Added: 2009-04-27 06:30:47 |
| dixit-entry-barriers80.pdf Path: Sveriges lantbruksuniversitet >> ECON >> 400 Fall, 2009 Description: ... Date Added: 2009-04-27 06:31:02 |
| 10-6.pdf Path: Sveriges lantbruksuniversitet >> MATH >> 151 Fall, 2009 Description: Section 10.6 C10S06.002: If the vertex is V (0, 0) and the focus is F (0, -2), then the directrix must be the horizontal line y = 2. Using the definition of parabola, it follows that if (x, y) is a point of the parabola, then x2 + (y + 2)2 = (y - 2)2... Date Added: 2009-04-27 06:31:08 |
| trickledown1.ppt Path: Sveriges lantbruksuniversitet >> ENSC >> 100 Fall, 2009 Description: The Trickle-Down Theory of Engineering September 21, 2007 Scotty, chief engineer, USS Enterprise QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Dilbert What is engineering? `It is the systematic application of s... Date Added: 2009-04-27 06:31:32 |
| Lecture08.pdf Path: Toledo >> PHY >> 357 Fall, 2009 Description: ... Date Added: 2009-04-27 06:31:58 |
| Final_Thesis.pdf Path: Fayetteville State University >> ETD >> 09172003 Fall, 2009 Description: THE FLORIDA STATE UNIVERSITY COLLEGE OF ARTS AND SCIENCES FEMALE AND FEMININE, BUT NOT FEMINIST: IN THE PRINCIPAL WORKS OF CHARLOTTE BRONTE, ELIZABETH GASKELL, AND GEORGE ELIOT By CHRISTIE LEE KORNSTEIN A Thesis submitted to the Department of Engl... Date Added: 2009-04-27 06:34:06 |
| midterm253fall07_L01b.pdf Path: Wilfrid Laurier >> MATH >> 253 Fall, 2009 Description: University of Calgary Department of Mathematics & Statistics MATH 253 (CALCULUS II) MIDTERM Fall semester, 2007, Section L01 Wednesday, October 31, 2007 Time: 10:00-10:55 Place: ICT 122 No calculators, notes, books or formula sheets are allowed Given... Date Added: 2009-04-27 06:34:09 |
| ce06_pp07.ppt Path: U. Houston >> CS >> 1305 Fall, 2009 Description: 7 INPUT AND OUTPUT McGraw-Hill Technology Education Page 150 2006 by the McGraw-Hill Companies, Inc. All rights reserved. CHAPTER Competencies (Page 1 of 2) Define input Describe keyboard entry, pointing devices, & scanning devices Discuss imag... Date Added: 2009-04-27 06:36:18 |
| 415w02_qz6.pdf Path: Wilfrid Laurier >> GLGY >> 699 Fall, 2009 Description: GEOG415 Name: Weekly Quiz #6 ID: March 5, 2002 15 minutes Please write legibly using the space provided. 1. List two driving forces of the flow of soil water. (2 points) A: Gravity and capillary force (soil tension) 2. The height of capillary rise... Date Added: 2009-04-27 06:37:33 |
| Quiz2Sp03Sol.pdf Path: Texas >> EE >> 345 Spring, 2007 Description: EE345L Spring 2003 Quiz 2 Solutions Page 1 of 1 Jonathan W. Valvano April 9, 2003, 1:00pm-1:50pm (30) Question 1. Place one letter A-PP for each. Arm key wakeup J bit 3. T) KWIEJ |= 0x08; Acknowledge key wakeup J bit 7. BB) KWIFJ = 0x80; Enable i... Date Added: 2009-04-27 06:39:38 |
| lect_22ExpectationMaximization.pdf Path: Wisconsin >> MP >> 573 Fall, 2009 Description: MEDICAL PHYSICS/BME 573: IMAGE SCIENCE Fall, 2008 Holden Lecture 37. December 5, 2008 Optimization by Expectation-Maximization. A consistent thread running through our discussion of optimization is known relationships between what we\'ve measured and ... Date Added: 2009-04-27 06:40:13 |
| matlab_differential.pdf Path: CSU Northridge >> ECS >> 350 Fall, 2009 Description: ECE 350 Linear Systems I MATLAB Tutorial #2 This tutorial describes the use of MATLAB to solve differential equations. Two methods are described. The commands in this tutorial should be tried using MATLAB as you read through this document. Using the... Date Added: 2009-04-27 06:42:08 |
| Intro_2009.pdf Path: Allan Hancock College >> PT >> 201 Fall, 2009 Description: Probability Theory 201 Notes to Unit Outline 2009 1 Weekly Short Tests Starts next week Please bring COVER SHEETS 35% of overall assessment 2:00pm-2:25pm every Wednesday Approx 15 min to answer 11 tests (must produce medical certificate, pol... Date Added: 2009-04-27 06:42:18 |
| quiz.pdf Path: DePaul >> ECT >> 433 Fall, 2009 Description: Practice Quiz ECT 433 Autumn 2003 Multiple Choice (Circle the best answer) Name _ 1. You have a form that takes information on a user and puts that information in a bean. You would like to keep and access this information across a series of pages. ... Date Added: 2009-04-27 06:43:33 |
| ht3.pdf Path: NMSU >> CS >> 278 Fall, 2009 Description: CS/MATH 278- Homework #3 on \"Deduction through the Ages: History of Truth\" Follow the separate general guidelines for Parts A,B,C. Be sure to include and label all four standard parts a,b,c,d of Part A in what you hand in. A: To hand in one class per... Date Added: 2009-04-27 06:43:44 |
| 5_EABI_stack.pdf Path: Michigan >> EECS >> 373 Fall, 2005 Description: Procedures Procedures are very important for writing reusable and maintainable code in assembly and high-level languages. How are they implemented? Application Binary Interfaces Calling Conventions Recursive Calls Examples Reference: PowerPC Embe... Date Added: 2009-04-27 06:44:54 |
| AVLIndex.pdf Path: Virginia Tech >> CS >> 2604 Fall, 2000 Description: CS 2604 Major Project 1 DRAFT Summer 2000 AVL Text File Indexing For this project you will implement an AVL tree template and use it to create an index for a text file. The AVL tree will store records containing a word, the number of times it occu... Date Added: 2009-04-27 06:45:11 |
| Chapter7.ppt Path: Bowling Green >> CS >> 8711 Fall, 2009 Description: Chapter 7 Ontology Engineering Grigoris Antoniou Frank van Harmelen 1 Chapter 7 A Semantic Web Primer Lecture Outline 1. 2. 3. 4. 5. Introduction Constructing Ontologies Manually Reusing Existing Ontologies Using Semiautomatic Methods On-To-Kno... Date Added: 2009-04-27 06:50:26 |
| Assignment%203%20-%20Clustering.doc Path: Bowling Green >> MGS >> 8040 Fall, 2009 Description: The procedure is as follows: 1) Creating a new dataset called cluster from the original train dataset which has all the special cases taken care of. This was done by using the following SAS code ods html body = \"C:\\Documents and Settings\\User\\Desktop... Date Added: 2009-04-27 06:50:34 |
| euro200_reading.pdf Path: East Los Angeles College >> EURO >> 200 Fall, 2009 Description: COURSEEURO200 France,GermanyandModernEurope RECOMMENDEDREADING WEEKONE Europe,FranceandGermany19452000:commonpriorities, nationalinterests Thefollowingisrequiredbackgroundreadingrelevanttothecourseasawhole,which canbestudiedforthepurposesofpresen... Date Added: 2009-04-27 06:50:37 |
| firechief.doc Path: Iowa State >> MR >> 1124 Fall, 2009 Description: Associated Press 11-21-06 Fire Chiefs Urge Sprinklers for Greek Chapters in Iowa AMES, Iowa (AP)- Fire officials in Ames and Cedar Falls are pushing fraternities and sororities at Iowa State University and the University of Northern Iowa to get start... Date Added: 2009-04-27 06:51:38 |
| apr_29.doc Path: Arizona >> PTYS >> 505 Fall, 2009 Description: History of Io\'s orbit Scale from the analysis for the Moon: 2 5 GM Moon a Earth 1 -1 / 2 dR GM Earth M Moon R =9 2,tidal , Earth 6 2 dt R or R 11 / 2 dR = 18 G M Earth 5 M Moon a Earth 2,tidal , Earth dt = Kdt. 2 13/ 2 R = Kt. 13 1 k2, Ear... Date Added: 2009-04-27 06:56:28 |
| apr_29.doc Path: Arizona >> SECTION >> 505 Fall, 2009 Description: History of Io\'s orbit Scale from the analysis for the Moon: 2 5 GM Moon a Earth 1 -1 / 2 dR GM Earth M Moon R =9 2,tidal , Earth 6 2 dt R or R 11 / 2 dR = 18 G M Earth 5 M Moon a Earth 2,tidal , Earth dt = Kdt. 2 13/ 2 R = Kt. 13 1 k2, Ear... Date Added: 2009-04-27 06:56:28 |
| hhscoop996.txt Path: UMBC >> POSI >> 603 Fall, 2009 Description: = = = = = Department of Health and Human Services = = = = = H H S c o o p H H S c o o p H H S c o o p = = = = = = = = = = September 19, 1996 = = = = = = ... Date Added: 2009-04-27 06:58:28 |
| 74LS14.pdf Path: UMBC >> CPATEL >> 310 Fall, 2009 Description: DM74LS14 Hex Inverter with Schmitt Trigger Inputs August 1986 Revised March 2000 DM74LS14 Hex Inverter with Schmitt Trigger Inputs General Description This device contains six independent gates each of which performs the logic INVERT function. Each... Date Added: 2009-04-27 06:58:30 |
| 180_Project03.doc Path: UCSB >> GEOG >> 180 Fall, 2009 Description: Geography 180 Fall 2003 Dr. H. Couclelis J. Ritterbeck, TA Discussion Sections: T 10:00-10:50, R 2:00-2:50 Class Project: ICTs and community development in peripheral regions Most of the work on the geography of the information society has so far f... Date Added: 2009-04-27 06:59:30 |
| Chapter5.pdf Path: Portland >> CS >> 494 Fall, 2008 Description: Chapter 5 Link Layer and LANs A note on the use of these ppt slides: Were making these slides freely available to all (faculty, students, readers). Theyre in PowerPoint form so you can add, modify, and delete slides (including this one) and slide co... Date Added: 2009-04-27 07:01:11 |
| sutton.pdf Path: Texas A&M >> ANSC >> 406 Fall, 2008 Description: COUNTY: SUTTON OWNER PROFILE: Retired Lawyer and her family from Oregon have purchased the ranch. She is from Sonora and wants to move closer to her family. She wishes to live on the operation but has little experience with cattle in the region. She ... Date Added: 2009-04-27 07:04:34 |
| AsstBR.pdf Path: Sveriges lantbruksuniversitet >> CS >> 823 Fall, 2009 Description: CMPT 823 Formal Topics in Knowledge Representation Assignment Questions Belief Change Due date: End of classes March 4, 2009 For questions given below I can suggest papers or other references. 1. In the book Nonmonotonic Reasoning by Grigoris Antoni... Date Added: 2009-04-27 07:04:48 |
| A2.pdf Path: UNC >> INLS >> 092 Fall, 2008 Description: INLS 092, Fall 2005 Emerging Issues in Information Science Assignment 2: Documenting Usage of Chosen Artifact OVERVIEW This assignment is for the group to use the ethnographic methods of observation, interviews to document the use of your chosen art... Date Added: 2009-04-27 07:06:17 |
| wlds.txt Path: Wayne State University >> REND >> 386 Fall, 2009 Description: Subj: WLD: Walk in the Park File: PARKWLD.ZIP (32725 bytes) AUTHOR: Joe Gradecki EQUIPMENT: 386 or Better, VGA NEEDS: An UnZIPing Program and REND386 RELEASED WITH THE PERMISSION OF THE AUTHORS. MAY BE REDISTRIBUTED ONLY IF PROPER CREDIT I... Date Added: 2009-04-27 07:09:33 |
| CRIM131D01.TXT Path: Sveriges lantbruksuniversitet >> ARTS >> 20013 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: CRIM 131-3 D01 LOCATION: SFU TITLE: INT CRIM JUSTICE SYS SECTION TYPE: LEC SEMESTER: 2001-3 ENROL: 147 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not sho... Date Added: 2009-04-27 07:11:43 |
| 20051114_r01o_0201486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: Case 4:02-cv-01486 Document 408 Filed 11/14/2005 Page 1 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 [COUNSEL LISTED ON SIGNATURE PAGES] UNITED STATES DISTRICT COURT NORTHERN DISTRICT OF CALIFORNIA OAKLAND DIV... Date Added: 2009-04-27 07:14:54 |
| Mid_Ex_II_Sp2002.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 503 Fall, 2008 Description: Econ 403 Macro Theory S.L. Parente Sp. 2002 Midterm Examination II (100 points) 1. Consider the following Lucas Tree model applied to agriculture to price crop insurance. Assume there is a continuum of measure one of identical households who are c... Date Added: 2009-04-27 07:16:05 |
| ShirleyCheechooEN18feb09.pdf Path: Laurentian >> NR >> 31599 Fall, 2009 Description: For immediate distribution Wednesday, February 18, 2009 Cree Filmmaker Shirley Cheechoo to speak at Laurentian University Sudbury (Ontario) - As part of the Gkendasswin Trail Speakers Series, the Office of Native Student Affairs and the Office of A... Date Added: 2009-04-27 07:18:00 |
| 13Lect08.pdf Path: Caltech >> BI >> 122 Fall, 2008 Description: Three types of maps! Genetic map (cM or mu)! topology preserved! Physical map (Mb)! Metric:! Mb/mu! DNA sequence (bp)! actggtcaaacgtacggatacaggtaattgaccacattatatagaccacgattcgatcgcatac! Sternberg ! Sequencing Strategies! Whole genome shotgun and ... Date Added: 2009-04-27 07:20:28 |
| 021-PacketLeashes.ppt Path: N.C. State >> CSC >> 774 Fall, 2008 Description: Computer Science Packet Leashes: A Defense against Wormhole Attacks in Wireless Networks Authors: Yih-Chun Hu, Adrian Perrig, David B. Johnson Presented by: Qiao Xu 4/30/2004 1 Outline Introduction Temporal Leashes TIK Protocol Performance & ... Date Added: 2009-04-27 07:21:59 |
| class14.pdf Path: Wisconsin >> SOC >> 357 Fall, 2000 Description: Sociology 357: Methods of Sociological Inquiry University of Wisconsin Madison Discussion Questions Reading assignment: Roberts, S. (2001). \"Surprises from Self Experimentation: Sleep, Mood, and Weight.\" Chance 14(2): 7-14. Also read Robert Rosentha... Date Added: 2009-04-27 07:22:59 |
| set10.doc Path: Wisconsin >> ME >> 766 Fall, 2009 Description: Problem set 10 Calculate the radiation heat transfer between two infinite plates separated by a gas-filled space of 1 meter. The gas is fully mixed at 600K and is adiabatic (no net heat transfer). Plate 1 is maintained at 500K and has a reflectance o... Date Added: 2009-04-27 07:25:23 |
| privacy_presentation.pdf Path: Stanford >> CS >> 181 Fall, 2009 Description: Corporate Privacy Policies. online Julie Black Kevin Christopher Nick Miyake jblack@stanford.edu kchristo@stanford.edu nfm02@stanford.edu Brief History DARPA funds ARPANET development World Wide Web & Mosaic FTC Report to Congress 1960 1970 1980 ... Date Added: 2009-04-27 07:26:09 |
| Syllabus.pdf Path: UNL >> MATH >> 208 Fall, 2008 Description: Syllabus: Analytic Geometry and Calculus III Class: Time: Place: Oce Hours: Instructor: email: web-page: Textbook: Math 208 1100-0110P MTWRF AVH 108 1000-1100 WR or by appointment Striuli Janet jstriuli2@math.unl.edu www.math.unl.edu/jstriuli2 Univer... Date Added: 2009-04-27 07:27:44 |
| Abnormal.pdf Path: Washington University in St. Louis >> BIO >> 4181 Fall, 2008 Description: Abnormal Abdomen An example of an integrated molecular, developmental and ecological study of natural selection in Drosophila mercatorum Many retrotransposable elements are found in the Xlinked tandem cluster of rDNA (typically about 200 tandem rep... Date Added: 2009-04-27 07:28:57 |
| Wetlands_ET.pdf Path: Stanford >> CEE >> 261 Fall, 2009 Description: CEE 261 Watershed and Wetlands Hydrology May 20, 2002 Evapotranspiration in Wetlands Florida Marshes and Cypress Strands Evaporation Net flux to vapor phase Evaporative flux, E, [mm day-1] Latent heat of vaporization, , [J kg-1] Vapor pressure,... Date Added: 2009-04-27 07:29:54 |
| 200761_f01c_07715.pdf Path: Stanford >> SHFL >> 1037 Fall, 2009 Description: Case 2:07-cv-00715-KJD-RJJ Document 1 Filed 06/01/2007 Page 1 of 17 G. Mark Albright, Esq. Nevada Bar No. 001394 Martin A. Muckleroy, Esq. Nevada Bar No. 009634 ALBRIGHT STODDARD WARNICK & ALBRIGHT Quail Park I, Building D-4, 801 South Rancho Dri... Date Added: 2009-04-27 07:32:16 |
| 200767_r10d_021486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: 4:02-cv-01486-CW Document 1172 Filed 06/07/2007 Page 1 of 2 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Joseph J. Tabacco, Jr. (75484) Christopher T. Heffelfinger ( 118058) BERMAN DeVALERIO PEASE TABACCO BURT & PUCILLO 425 California Street, Suite 2025 Sa... Date Added: 2009-04-27 07:32:29 |
| 4L15.pdf Path: Duke >> CPS >> 100 Fall, 2009 Description: What is a Binary Search? Analysis: Algorithms and Data Structures Magic! Has been used a the basis for \"magical\" tricks We need a vocabulary to discuss performance and to reason about alternative algorithms and implementations It\'s faster! I... Date Added: 2009-04-27 07:37:13 |
| 03_02_09.ppt Path: Colby >> PS >> 111 Fall, 2009 Description: Perception : How we are aware of properties of world One way to phrase the problem: How to get around the problems of the retinal image? Empiricism: Helmholtz Learning and Inference Nativism: Gestaltism Endowed organizational laws Different is some... Date Added: 2009-04-27 07:38:41 |
| IAR_IOC_S08b_T11_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Iteration Assessment Report (IAR) BID Review System Team No 11 Yuwei Jiang Divyanka Aswani Priyanka Seernam Mithila Rao Velishala Kalyani Soniminde Julie Payne Keith Culling Project Manager Software Architect QFP Programmer Tester IV & V / SRE Cl... Date Added: 2009-04-27 07:40:27 |
| PSPa--DesignV4.DOC Path: USC >> CSCI >> 511 Fall, 2008 Description: Introduction to PSPa Personal Software Process Alternate PSPa Design 1909 A. Winsor Brown BES/MSEE 0dad95830b260b0a9f65bc0b47adbedaa3db8b9c.DOC1 v1.0 - 04/25/09 Introduction to PSPa PSPa Design awbrown@sunset.usc.edu A. Winsor Brown 1909 A... Date Added: 2009-04-27 07:42:00 |
| Starting-BB6.pdf Path: Eastern Washington University >> CSCD >> 320 Fall, 2008 Description: NEW FOR FALL 2003 GETTING STARTED WITH Enrolling in a Blackboard Course Every time you log on to Blackboard the My Blackboard screen will appear. Here you will find a listing of all of the on-line Blackboard courses that you are currently involved ... Date Added: 2009-04-27 07:44:23 |
| M308Formulae_2_SP2009.doc Path: Christian Brothers >> AAAAMATH >> 308 Fall, 2009 Description: Math 308: Formulae for Test 2 Spring 2009 Basic sample statistics: 1. Sample data of n random variables: X 1 , X 2 ., X n 2. Sample mean: X = X i =1 n i n X= For grouped data: fX i =1 i n i n n n 2 2 2 n n X i - X i (Xi - X ) 3. Samp... Date Added: 2009-04-27 07:51:09 |
| Dambrosia.pdf Path: Washington >> FISH >> 492 Fall, 2009 Description: Diversity of bottomfish: Is it higher in marine protected areas than in unprotected areas in the San Juan Islands, WA? Debora Sabina D\'Ambrosio Friday Harbor Laboratories Fish 492 2006 Abstract In an effort to conserve bottomfish species, Marine Pro... Date Added: 2009-04-27 07:52:59 |
| Ch5ProbGian6th.pdf Path: UMBC >> P >> 151 Fall, 2009 Description: CHAPTER 5: Uniform Circular Motion Answers to Problems 1. (a) Find the centripetal acceleration from Eq. 5-1. 2 = v= aR r (1.25 m s ) 2 1.10 m 1.42 m s 2 = (b) The net horizontal force is causing the centripetal motion, and so will be the centrip... Date Added: 2009-04-27 07:55:47 |
| sol.0607.pdf Path: East Los Angeles College >> MAS >> 1301 Fall, 2009 Description: RH Solutions to MAS1301 paper, Semester 1 2006/7 These are what I got. Let me know if you disagree. = A1 x = 3.1 A2(a) A1 , A2 , . . . , An are mutually independent if the probability of the intersection of any subset is the product of their probabi... Date Added: 2009-04-27 08:04:14 |
| Rodriguez-04StateLatinoeducation.pdf Path: Utah >> ALEMAN >> 7960 Fall, 2009 Description: \'Bl\'BIE, ilp dif, , Mffl 44i.P \", .1 - . . . .I. 111.11 1.11 _ Commentary. The State of Latino Education: W~ r X ._X._ A_00 InXXw-_ X w _w -_f-n raXnCe^_r .n S BY States has skyrocketed to approximately 40 million, and they\'ve begun to move into ... Date Added: 2009-04-27 08:05:49 |
| hw3_solutions.pdf Path: UCLA >> STAT >> 110 Spring, 2002 Description: 1 Stat 110B HW 3 Solution Esfandiari Winter 2004 Fifth edition Number 1: Problem 24 on page 428 Source Groups Error Total Since Df 3-1=2 74-3=71 74-1=73 Sixth edition Number 1: Problem 24 on page 436 SS 152.18 970.96 1123.14 MS 76.09 13.68 F 5.56 5... Date Added: 2009-04-27 08:08:34 |
| hw2.pdf Path: Acton School of Business >> COMP >> 527 Fall, 2008 Description: COMP 527 Fall 2000 HW #2 Assigned 10/31/2000 Due 11/7/2000, 2:30pm (in class) 1. What are the tradeoffs between using nonces and using timestamps in protocols? What are some situations where each would be appropriate? 2. Imagine the following propo... Date Added: 2009-04-27 08:10:01 |
| 2005_06_07_DRP.pdf Path: Berkeley >> EECS >> 595 Fall, 2009 Description: Digital Radio Frequency Processor (DRP) Digitally-Intensive Transceiver for GSM/EDGE Robert Bogdan Staszewski Texas Instruments Incorporated Bogdan Staszewski, 7 June 2005 DRPTM Outline Motivation Digitally-Controlled Oscillator (DCO) Ti... Date Added: 2009-04-27 08:10:54 |
| PS4.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: Economics 202a; Problem Set 4 Due Thursday, April 3 (From Romers Advanced Macroeconomics, problems 4.4, 4.8, and 4.15) 1. Suppose that a representative individuals period-t utility function is: b(1 t )1 ut = ln(ct ) + 1 a. Suppose that the represent... Date Added: 2009-04-27 08:11:07 |
| Hsieh_Israel.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: Macroeconomic and Labor Market Impact of Russian Immigration in Israel* Sarit Cohen Tel Aviv University saritc@post.tau.ac.il Chang-Tai Hsieh Princeton University chsieh@princeton.edu April 2000 Abstract From 1990 to 1997, over 710 thousand Russian ... Date Added: 2009-04-27 08:12:22 |
| ch3.pdf Path: Oregon >> MATH >> 607 Fall, 2008 Description: 3. Kac-Moody algebras We are now going to switch to a completely different topic and study representations of some Lie algebras. In this chapter, k will denote an algebraically closed field of characteristic 0. It may as well be the complex numbers s... Date Added: 2009-04-27 08:24:46 |
| week8a.pdf Path: Caltech >> CS >> 175 Fall, 2009 Description: CS 175 Week 8 Bzier Curves Definition, Algorithms CS175 2003 1 Overview polynomial curves monomial basis Lagrange basis Bernstein basis CS175 2003 2 Polynomial Curves Weierstrass Approximation Theorem model curves with polynomials monomial bas... Date Added: 2009-04-27 08:26:29 |
| 0709FieldCampPoster.pdf Path: Laurentian >> E >> 2792 Fall, 2009 Description: BIOL 4016 E/F Field Camp and Report Grundy Provincial Park, September 2007 By D. Lesbarrres and L. J.R. Boileau Plant Ecology Plant diversity is a key to the health of an ecosystem. In Grundy PP, Dr. Campbell exposes the differences that can be enco... Date Added: 2009-04-27 08:26:37 |
| RR87-21.pdf Path: NYU >> ECON >> 1987 Fall, 2009 Description: ... Date Added: 2009-04-27 08:27:01 |
| YU_HW8.pdf Path: USC >> CE >> 529 Fall, 2009 Description: CE529b HW#8 Chihwei Yu 03/21/06 Finite Element Software: MSC Patran + MSC Nastran 2.6.1.1 (a) Finite Element Model: Nodes, Elements, Loads and Boundary Conditions Finite Element Model (Created by MSC Patran) Finite Element Model (Created by MSC... Date Added: 2009-04-27 08:31:06 |
| lecture6.doc Path: USC >> ISE >> 330 Fall, 2008 Description: UniversityofSouthernCalifornia DanielJ.EpsteinDepartmentofIndustrialandSystemsEngineering ISE330:IntroductiontoOperationsResearch Lecture6Outline Read: Review: H & L chapter 4.6-4.7 (up to p.159), 5.1 VariationsinModelForms: Constraints to be sati... Date Added: 2009-04-27 08:31:09 |
| ec05b.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: USC C S E University of Southern California Center for Software Engineering CS 577b Winter/Spring 2007 LeanMBASE (+?) for CSCI577B Review and QM Preview A. Winsor Brown January 19, 2007 USC CSE ec05b=MBASEfor577-ReviewAnd... Date Added: 2009-04-27 08:31:56 |
| SCSOP9aDishMachine1CompartmentHighTemperatureMonit.pdf Path: Iowa State >> NR >> 63222 Fall, 2009 Description: Dish Machine 1-Compartment High Temperature Monitoring Form School: _, Year_ Date Meal Initials Wash Final Rinse Water Press. Thermal Strip Corrective Action B B B B B B B B B B B B B B B B B B B B B B B B L L L L L L L L L L L L L L L L L L L L L ... Date Added: 2009-04-27 08:39:28 |
| legislative_summary.pdf Path: Columbia >> U >> 9231 Fall, 2009 Description: The Digital Bridge Trust Fund Act HR 4477 Part C. Assistance to Bridge the Digital Divide Section. 131 Digital Bridge Trust Fund (a) Establishment- The Treasury of the United States will establish the Digital Bridge Trust Fund. The amounts appropriat... Date Added: 2009-04-27 08:41:57 |
| Student342ab.pdf Path: Acton School of Business >> SEH >> 3954 Fall, 2009 Description: Viability and Proliferation in Human Dermal Fibroblasts (HDF) BIOE 342 1 Objectives The MTT Viability Test seeks to determine the relationship between cell concentration and absorbance after treatment with MTT dye. Proliferation assays seek to dete... Date Added: 2009-04-27 08:43:27 |
| 20010802_o03c_012999.pdf Path: Stanford >> TUTS >> 1019 Fall, 2009 Description: http:/securities.milberg.com/mw-cgi-bin./55;E/56;E/57;E/58;E/59;&story_numb=8/12 Complaint for Violation of the Federal Securities Laws (Atlas v. Tut Systems, Inc., et al., Case No. C-01-2999-MHP) Source: Milberg Weiss Date: 08/02/01 Time: 2:24 PM ... Date Added: 2009-04-27 08:51:26 |
| 2007316_r01o_042561.pdf Path: Stanford >> AGCC >> 1033 Fall, 2009 Description: Case 8:04-cv-02561-SCB-EAJ Document 175 Filed 03/16/2007 Page 1 of 6 UNITED STATES DISTRICT COURT MIDDLE DISTRICT OF FLORIDA TAMPA DIVISION _ DAVIDCO INVESTORS, LLC, ) individually and on behalf of ) all others similarly situated, ) ) Plaintiffs,... Date Added: 2009-04-27 08:52:35 |
| 2007914_r01t_0201486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: 4:02-cv-01486-CW Document 1445 Filed 09/14/2007 Page 1 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 JAMES P . BENNETT (BAR NO . 65179) JORDAN ETH (BAR NO . 121617) TERRI GARLAND (BAR NO . 169563) PHILIP T . BESIROF (BAR NO . 185053) MORRISON & FOERSTER... Date Added: 2009-04-27 08:52:53 |
| lisp-pres.pdf Path: Pittsburgh >> CS >> 1621 Fall, 2008 Description: Lisp : List Processing Language Lisp : List Processing Language = HISTORY = Lisp began as Lisp 1.5 in 1959. Used mostly for solving symbolic algebra problems, such as finding the derivative of a function. Began as a chaotic compilation of dialects,... Date Added: 2009-04-27 08:55:06 |
| DU-CS-02-04.pdf Path: Drexel >> TS >> 467 Fall, 2009 Description: A Reverse Engineering Portal Web Site Congrong Liao and Spiros Mancoridis Technical Report DU-CS-02-04 Department of Computer Science Drexel University Philadelphia, PA 19104 November 2002 1 c Copyright 2002 Congrong Liao. All Rights Reserved. ii... Date Added: 2009-04-27 08:56:40 |
| syllabus.pdf Path: Maryland >> ENPM >> 607 Fall, 2008 Description: i f fe f ~yIf@Rh\'|@ d e d d d d d f e e e fe e v Rh\'R297lb2\'R\'9lVb\'h\'h9@\'lR\'9bhRy{ e d f d d d d f f e f f d f RbRfybb2\'R\'9$b(\'b)9f@\'Rh9@72|B$m d e d x v f x x ... Date Added: 2009-04-27 09:01:32 |
| AA16.pdf Path: Portland >> MTH >> 251 Fall, 2008 Description: r q q w $ u e tt $W e \' 3 w t3\' u Wu Wi\'W %W y w u t w v y w u yv wj u \'W q x gw $ y3w $ u q n e } } l \' } e } n } l \' u x WPWx WWj g\' yW x Wu WB3w\' W w w o o x h v w u y s e re w x d l w y x w w y w u y s w y y q o ... Date Added: 2009-04-27 09:04:36 |
| 0809clubleaders.doc Path: Iowa State >> NR >> 93901 Fall, 2009 Description: Sioux County 4-H Clubs and Leaders Climbing Clovers - Ireton and Hawarden Mary Schmidt: 712-552-2080 Kelly Rehder: 712-552-1247 Flying Eagles - Ireton and Hawarden Russel Gradert: 712-278-2859 Holland Windmills - Orange City, Alton, Maurice Cheryl Pa... Date Added: 2009-04-27 09:05:16 |
| project2.pdf Path: Iowa State >> STAT >> 201 Fall, 2009 Description: Fall 2001 Stat 201A Project 2 40 points Due Thursday November 15, 2001 1. Quality Home Improvement Center (QHIC) operates ve stores in a large metropolitan area. The marketing department at QHIC wishes to study the relationship between x, home va... Date Added: 2009-04-27 09:05:37 |
| 200482_f01o_042680.pdf Path: Stanford >> SCON >> 1030 Fall, 2009 Description: Case 2:04-cv-02680-DT-JTL Document 14 Filed 08/02/2004 Page 1 of FILED CLERK, U.S. DISTRICT COURT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 r AUG - 2 20U4 CENTRAL DISTRICT OF CALIFORNIA BY DEPUTY Priority Send Enter Closed JS-5/JS-6 JS-2/JS... Date Added: 2009-04-27 09:08:50 |
| 2009220_o06k_09108.pdf Path: Stanford >> SGC >> 1042 Fall, 2009 Description: pUS District Court Civil Docket as of 02/20/2009 Retrieved from the court on Monday, February 23, 2009 U.S. District Court Middle District of Louisiana (Baton Rouge) CIVIL DOCKET FOR CASE #: 3:09-cv-00108-JVP-DLD Allen v. Stanford Group Company et a... Date Added: 2009-04-27 09:11:02 |
| 2007330_r03t_010988.pdf Path: Stanford >> ORCL >> 1017 Fall, 2009 Description: 1 LERACH COUGHLIN STOIA GELLER RUDMAN & ROBBINS LLP 2 MARK SOLOMON (151949) DOUGLAS R. BRITTON (188769) 3 VALERIE L. McLAUGHLIN (191916) GAVIN M. BOWIE (235532) 4 STACEY M. KAPLAN (241989) 655 West Broadway, Suite 1900 5 San Diego, CA 92101 Telephone... Date Added: 2009-04-27 09:21:06 |
| palm_lgs_log_070729.pdf Path: Caltech >> ENG >> 070723 Fall, 2009 Description: Caltech Optical Observatories / NASA Jet Propulsion Laboratory Palomar Adaptive Optics Palomar LGSAO Engineering Summary 07/29/07 UT Afternoon: - Laser 7.0W, stable. - BTO tested in 10 min. - Checked performance of HOWFS timing card. Found connector... Date Added: 2009-04-27 09:21:20 |
| 200455_r02k_981537.pdf Path: Stanford >> DAOU >> 1010 Fall, 2009 Description: US District Court Civil Docket as of 5/5/2004 U.S. District Court Southern District of California (San Diego) CIVIL DOCKET FOR CASE #: 98-CV-1537 Brody, et al v. Daou Systems Inc, et al Filed: 08/24/98 Assigned to: Judge M. James Lorenz Jury demand... Date Added: 2009-04-27 09:25:20 |
| Scale_bars_for_Olympus_IX81.doc Path: UCSB >> MCDB >> 103 Fall, 2008 Description: Scale bars for Olympus IX81 100x: 154 pixels = 10 um ... Date Added: 2009-04-27 09:28:54 |
| 1986_PrezSamMat_1-12.pdf Path: UCSB >> EEMB >> 1986 Fall, 2009 Description: ... Date Added: 2009-04-27 09:31:49 |
| hw7_solns.pdf Path: UCSB >> APC >> 514 Fall, 2009 Description: I B l1 oI o h r t t r r t th q r fgytgt ymk Ggk6fIhIjttxbpIi fi j ypymk jggpIg jggpItfgpisqihItfd YvIhfyn r h t r r trh t th Ie fd IIp ... Date Added: 2009-04-27 09:31:59 |
| Incentives_NPS_reductions.pdf Path: UCSB >> ESM >> 224 Fall, 2008 Description: Water Policy 2 (2000) 151173 www.elsevier.com/locate/watpol Green evolution: are economic incentives the next step in nonpoint source pollution control? Terry F. Young*, Joe Karkoski 1 Environmental Defense, 5655 College Avenue, Oakland, CA 94618, ... Date Added: 2009-04-27 09:32:17 |
| 09Introduction.pdf Path: Nevada >> NRES >> 422622 Fall, 2009 Description: SOIL SCIENCE Soil Chemistry Soil Physics Soil Morphology Plant Nutrition Specifically, soil physics deals with the physical properties of soils, their measurement, prediction, and management. Difficult to separate ... Date Added: 2009-04-27 09:36:56 |
| Extrapolation_Example.pdf Path: UPenn >> SYS >> 502 Fall, 2009 Description: ! ! ! # ! ! # ! ! ! ! ! # ! ! ! ! # ! # ! # ! ! ! # ! Example of Extrapolation ... Date Added: 2009-04-27 09:40:21 |
| EPJSplTopics_Nagaraj_Shastry_Vaidya.pdf Path: Penn State >> MCS >> 312 Fall, 2009 Description: on1kh6jh6565 GCC6 DF k m l k d i g d f d e d ~ 6 QES 4 1 G6 D@B@ r F7H9 HQyE r d3 3D 33I r FC 56 6 0 1 1 @sFGdri BATS FE r DFCFE { DDB@87H9 r SE sR~ w P p { 6B@ r QF7rVBc )q\"0 r 1 ec b V Y T 1 Q@ 9 1 36 6 Q 966 6 4 1 @ R v @ ES ... Date Added: 2009-04-27 09:41:42 |
| Lecture02.pdf Path: UCSC >> BIO >> 137 Fall, 2009 Description: Lecture 2 Phylogenetics of Fishes 1. Phylogenetic systematics 2. General Fish Evolution 3. Molecular systematics 4. Genetic approaches Willi Hennig Cladistics A clade: 1. All individuals descend from a single ancestor 2. All descendents of that a... Date Added: 2009-04-27 09:45:09 |
| LABORATORY_3.doc Path: New Mexico >> EECE >> 344 Fall, 2009 Description: LABORATORY 3 EECE344 Summer 2004 UART Due Date: July 1st (Thursday. Exam on the 30th, let\'s discuss this). Work Individually. Purpose: The main objective of this laboratory is to familiarize you with the serial transmission, the use of the UART, and... Date Added: 2009-04-27 09:49:40 |
| wlds.txt Path: UNC >> REND >> 386 Fall, 2009 Description: Subj: WLD: Walk in the Park File: PARKWLD.ZIP (32725 bytes) AUTHOR: Joe Gradecki EQUIPMENT: 386 or Better, VGA NEEDS: An UnZIPing Program and REND386 RELEASED WITH THE PERMISSION OF THE AUTHORS. MAY BE REDISTRIBUTED ONLY IF PROPER CREDIT I... Date Added: 2009-04-27 09:49:55 |
| wsjgoodleadership.doc Path: Nevada >> BADM >> 720 Fall, 2008 Description: Good Leadership Requires Executives To Put Themselves Last April 20, 2004; Page B1 The nation\'s biggest pension fund, California Public Employees\' Retirement System, and other investor-activist groups are mounting more campaigns to oust corporate di... Date Added: 2009-04-27 09:51:52 |
| group6.ppt Path: UF >> CEN >> 5531 Fall, 2008 Description: Sensor Network Simulation Simulators and Testbeds JaehoonKim JeeyoungKim SungwookMoon Contents 1. Introduction 2. Simulators 1. TOSSIM 2. Avrora 3. Viptos 3. Testbeds 1. MoteLab 2. Kansei 4. Conclusion Introduction What is a network simulato... Date Added: 2009-04-27 09:52:19 |
| 19440704_0000035658.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: Telegram No e Dated: J u l y 4, 1944. D ETAT 840 t o I3ourCoin r e q u e s t s f o l l o w i n g droppings: (1) Spino d\'Adiia. RBC message I1 pranzo e s e r v i t o . 0928 E Greenwich 4522 N. 150 men under S p i n e l l i . ( 2 ) C:impo S p o r... Date Added: 2009-04-27 09:55:21 |
| 2007918_r06d_0201486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: 4:02-cv-01486-CW Document 1455 Filed 09/18/2007 Page 1 of 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 JAMES P . BENNETT (BAR NO . 65179) JORDAN ETH (BAR NO . 121617) TERRI GARLAND (BAR NO. 169563) PHILIP T . BESIROF (BAR NO . 185053) MORRISON & FOERSTER ... Date Added: 2009-04-27 09:58:00 |
| 20081222_r01n_0601691.pdf Path: Stanford >> UNH >> 1036 Fall, 2009 Description: UNITED STATES DISTRICT COURT DISTRICT OF MINNESOTA In re UNITEDHEALTH GROUP INCORPORATED) PSLRA LITIGATION This Document Relates To: ALL ACTIONS. ) ) Civil File No. 0:06-cv-01691 -JMR-FLN CLASS ACTION NOTICE OF PENDENCY AND SETTLEMENT OF CLASS ACTIO... Date Added: 2009-04-27 10:05:28 |
| 33WASP_NR07.pdf Path: Ill. Chicago >> CHEM >> 550 Fall, 2008 Description: REVIEWS The WASPWAVE protein network: connecting the membrane to the cytoskeleton Tadaomi Takenawa* and Shiro Suetsugu* Abstract | WiskottAldrich syndrome protein (WASP) and WASP-family verprolinhomologous protein (WAVE) family proteins are scaffol... Date Added: 2009-04-27 10:05:41 |
| LVR_CF252_System_WiringC.pdf Path: Minnesota >> LVRCF >> 252 Fall, 2009 Description: 1 2 3 4 OUTSIDE SHIELD RS232 TO COMPUTER J6 INSIDE SHIELD V/I PCB J5 DB25 LVR PCB D D HP 34901A 2x20 MUX SEE SHT2 FOR CABLE DETAILS V OUT U1,10,11 DGND V OUT U2-8 VOLTAGE SENSE LINES HP 34970A HP 34901A 2x20 MUX AGND INPUT V INPUT GND ... Date Added: 2009-04-27 10:09:55 |
| hw_1.pdf Path: Mississippi State >> EE >> 3724 Fall, 2009 Description: ECE 3724/CS 3124 Homework #1 This homework refers to the SSN processor discussed in Lecture #1 (EE 3724 Introduction). 1. Write and assemble a program for the SSN processor based upon YOUR Student ID number. Your Student ID number: _ Mem Location 00 ... Date Added: 2009-04-27 10:12:16 |
| sykes.pdf Path: UVA >> LAW >> 0708 Fall, 2009 Description: Transnational Forum Shopping as a Trade and Investment Issue Alan O. Sykes* Abstract Plaintiffs regularly bring cases in U.S. courts seeking damages for harms that have occurred abroad, attracted by higher expected returns than are available in the ... Date Added: 2009-04-27 10:15:39 |
| lecture10.pdf Path: UVA >> PHYS >> 831 Spring, 2008 Description: ... Date Added: 2009-04-27 10:16:01 |
| Johnson2005.pdf Path: North-West Uni. >> MMSS >> 532 Fall, 2009 Description: The Effect of Congestion on Flight Delays Experienced by Departing Aircraft at Chicago OHare International Airport and Illustrative Congestion Fees That Could Alleviate the Problem by Tracy Johnson June 6, 2005 Senior Thesis for the Mathematical Met... Date Added: 2009-04-27 10:16:45 |
| direct_na2co3.pdf Path: Mich Tech >> CH >> 2212 Spring, 2008 Description: CH 2212 DIRECT DETERMINATION OF CARBONATE IN SODA ASH INTRODUCTION Soda ash is a commercial product containing Na2CO3, NaHCO3 and NaOH. Standard HCl may be used to titrate a known mass of soda ash to determine its alkalinity. At the equivalence point... Date Added: 2009-04-27 10:19:16 |
| lec11.pdf Path: Harvard >> LIBCS >> 124 Fall, 2009 Description: CS 124 Lecture 11 11.1 Applications: Fingerprinting for pattern matching Suppose we are trying to nd a pattern string P in a long document D. How can we do it quickly and efciently? Hash the pattern P into say a 16 bit value. Now, run through the l... Date Added: 2009-04-27 10:19:59 |
| DASO_000046.txt Path: Harvard >> CFA >> 000000 Fall, 2009 Description: DASO Circular No. 46 Issued: 2006 Jan. 8, 16:13 UT The DISTANT ARTIFICIAL SATELLITES OBSERVATION (DASO) Circulars are a private publication by staff of the Minor Planet Center and are intended to... Date Added: 2009-04-27 10:20:35 |
| Wenbin_DynamicSlice.ppt Path: Kentucky >> CS >> 685 Fall, 2008 Description: Author:ChaoLiu,XiangyuZhang PresentedbyWenbinLi Automatedfailurereportingiswidelyused failureindexing:whichaskshowtoidentifyall failuresduetothesamefault FailurePrioritization DuplicateFailureRemoval PatchSuggestion Crashingfailure: Incur... Date Added: 2009-04-27 10:21:16 |
| m122_f08_handout14.pdf Path: Carnegie Mellon >> MATH >> 122 Fall, 2009 Description: Math 122 Handout 14: Review Problems for Unit Test 3 The topics that will be covered on Unit Test 3 are as follows. Fall 2008 Calculating formulas for partial sums (e.g. for telescoping series). Convergence of infinite series by de... Date Added: 2009-04-27 10:25:02 |
| umi-umt-1035.pdf Path: University of Montana >> ETD >> 09262007 Fall, 2009 Description: COMPARISON OF TREND DETECTION METHODS By Katharine Lynn Gray B.S. University of Montana, Missoula, Montana 1997 M.S. University of Montana, Missoula, Montana 2000 Dissertation presented in partial fulllment of the requirements for the degree of Docto... Date Added: 2009-04-27 10:26:33 |
| 1498.pdf Path: USF >> LIT >> 1498 Fall, 2009 Description: House of Seven Gables NEVER had the old house appeared so dismal to poor Hepzibah as when she departed on that wretched errand. There was a strange aspect in it. As she trod along the foot-worn passages, and opened one crazy door after another, and ... Date Added: 2009-04-27 10:27:09 |
| CSD-83-130.pdf Path: Berkeley >> EECS >> 1983 Fall, 2008 Description: ... Date Added: 2009-04-27 10:29:09 |
| Lecture8-Decoder_LE-2up.pdf Path: Berkeley >> EE >> 141 Fall, 2008 Description: EE141-Fall 2008 Digital Integrated Circuits Lecture 8 LE and Power for Decoders EE141 EECS141 Lecture #8 1 1 Announcements Lab #3 Mon. and Tues., Lab #4 Fri. Homework #4 due Thursday EE141 EECS141 Lecture #8 2 2 Class Material Last lecture... Date Added: 2009-04-27 10:29:12 |
| ROS_guide2.pdf Path: Idaho >> CSS >> 287 Fall, 2008 Description: United States Department of Agriculture Forest Service ROS Users Guide United States Department of Agriculture Forest Service ROS Users Guide Photographs: All photos are Forest Service, USDA This handbook chapter serves as a guide for the recrea... Date Added: 2009-04-27 10:30:28 |
| lect2bw.pdf Path: UC Riverside >> CS >> 170 Fall, 2008 Description: Computational Intelligence Chapter 12, Lecture 2, Page 1 Robot Architectures You dont need to implement an intelligent agent as: Perception Reasoning Action as three independent modules, each feeding into the the next. Its too slow. High-lev... Date Added: 2009-04-27 10:32:04 |
| FW.pdf Path: Michigan State University >> READ >> 1981 Fall, 2009 Description: ... Date Added: 2009-04-27 10:33:35 |
| 530803.pdf Path: Michigan State University >> LIB >> 1953 Fall, 2009 Description: USGA JOURNAL AND TURF MVNACEMENT: AUGUST, 1953 3 Burkemo, an amazingly straight shotmaker, finally won the PGA Championship at the Birmingham Country Club, in his home town, by defeating Felice Torza, 2 and 1, in a surprise final. Ross, who is 59,... Date Added: 2009-04-27 10:37:45 |
| 500205.pdf Path: Michigan State University >> LIB >> 1950 Fall, 2009 Description: USGA JOURNAL:FEBRUARY, 950 1 5 \"Golf House\" By JOSEPH C. DEY, JR. USGA EXECUTIVE SECRETARY When the good members of the Golf Club in Savannah, Ga., held aNew Year\'s Eve B\';lll in 1811, they unwittingly set in motion an odd series of events. The se... Date Added: 2009-04-27 10:38:37 |
| jorge_FFDfRB_fall05.pdf Path: Stanford >> CS >> 468 Fall, 2009 Description: Fast Frictional Dynamics for Rigid Bodies Danny Kaufman Timothy Edmonds Dinesh Pai Rutgers University Rigid Bodies Simplified Model hard to know internal properties of all items Rigid instead More complex simulation Forces instantaneously change ve... Date Added: 2009-04-27 10:39:19 |
| hwk4sol.pdf Path: Texas A&M >> ST >> 302 Fall, 2009 Description: STAT 302H: Principles of Biostatistics Homework 4 Solution (due 10/08/07) Instructor: James A. Calvin TA: Ying Sun 10.3 A p-value is the probability of obtaining a mean as extreme or more extreme than the observe sample mean X, given that the null... Date Added: 2009-04-27 10:42:52 |
| 315_Sec.doc Path: Michigan State University >> STT >> 315 Fall, 2008 Description: STT 315 Spring 2006 Teaching Assignments STT 315 Section 2 Section 4 Section 6 Section 8 Section 10 Section 12 Section 14 Section 16 Section 18 Section 20 Section 22 STT 315 LePage Section 1 Section 3 Section 5 Section 7 Section 9 Section 11 Section ... Date Added: 2009-04-27 10:43:39 |
| history.pdf Path: Cincinnati >> OMICAS >> 175 Fall, 2009 Description: From the Ohio Mechanics Institute to the OMI College of Applied Science Of the University of Cincinnati 1828 2003 The Vision From the free evening lectures at the Ohio Mechanics Institute to the current diversity of faculty, students and programs at... Date Added: 2009-04-27 10:47:26 |
| 19920903.pdf Path: GWU >> NSAEBB >> 257 Fall, 2009 Description: ... Date Added: 2009-04-27 10:50:58 |
| SolHW5.pdf Path: Delaware >> M >> 353 Fall, 2009 Description: Home work 5. (Solutions) Math 353 Sections 10, 13 and 14 - Spring 2009, University of Delaware Exercises. 1. Exercise 5.4.2 (b). Let f (x) = 1 1+x2 . Then Simpsons rule on [0, 1] is 1 (f (0) + 4f (0.5) + f (1) = 0.78333 6 and Simpsons rule on [0, 1... Date Added: 2009-04-27 10:56:08 |
| cd151.hw.txt Path: Washington >> CD >> 151 Fall, 2009 Description: Site Genotype1 AD-pop ED-pop Total-pop Genotype2 AD-pop ED-pop Total-pop Genotype3 AD-pop ED-pop Total-pop AD-chi2 ED-chi2 Total-chi2 000295 CC 11 19 30 CT 1 0 1 ... Date Added: 2009-04-27 10:56:11 |
| Midterm-2-2005.pdf Path: Duke >> CPS >> 104 Fall, 2009 Description: Your Name:_ CPS 104 Midterm II Exam Spring 2005 Prof. Alvin R. Lebeck 10:05am to 11:20pm Closed book, closed notes Answer all questions, state all your assumptions, clearly mark your final answer. Be sure you have all five (5) pages of the exam (inc... Date Added: 2009-04-27 10:59:56 |
| 07-view.pdf Path: Duke >> CPS >> 296 Fall, 2009 Description: Virtual views A view is defined by a query over base tables Incremental View Maintenance CPS 296.1 Topics in Database Systems Example: CREATE VIEW V AS SELECT FROM R, S WHERE ; A view can be queried just as a normal table Example: SELECT * FR... Date Added: 2009-04-27 11:00:08 |
| CompSci4Chap07Sec2.pdf Path: Duke >> CPS >> 004 Fall, 2009 Description: CompSci 4 Chap 7 Sec 2 Oct 25, 2007 Prof. Susan Rodger Announcements Read Chapter 9.1 for next time Assignment 6 due Nov 6 Today Lecture on Chap 7 Sec 2 and Tips and Tech. While loop indefinite loop Event Loops Last time -Loop definite num... Date Added: 2009-04-27 11:00:38 |
| SLCEX1.pdf Path: Duke >> CHEM >> 151 Fall, 2009 Description: ... Date Added: 2009-04-27 11:01:04 |
| hw4_sol.pdf Path: N.C. State >> CSC >> 570 Fall, 2008 Description: Homework 4 Solution Guidelines 1. (a) The string becomes the following string; stuffed zeros have been underlined. 01111011111001111101011111011111011111010010 (b) \"Copy bits as received into the frame. If the last 6 bits to be seen were `015\', then... Date Added: 2009-04-27 11:02:47 |
| 064-PHIL.pdf Path: Arizona >> SCHEDULE >> 064 Fall, 2009 Description: Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # PHILOSOPHY (PHIL) Dr. J. Christopher Maloney, Department Head, Social Scienc... Date Added: 2009-04-27 11:04:40 |
| wwwch10.pdf Path: Virginia Tech >> CS >> 4244 Fall, 2008 Description: 10.1 The Common Gateway Interface - Markup languages cannot be used to specify computations, interactions with users, or to provide access to databases - CGI is a common way to provide for these needs, by allowing browsers to request the execution of... Date Added: 2009-04-27 11:06:16 |
| hw4_4721_2005.pdf Path: Minnesota >> ECON >> 4721 Fall, 2008 Description: Econ4721 Malik Shukayev Problem Set #4, Due by 3 pm on Monday April 11 Instructions: Show all your work. Assignments must be typed, except graphs and calculations, which must be legible. Total 125 points for this Problem Set. Start early. Don\' forget... Date Added: 2009-04-27 11:06:18 |
| Lecture14-Sleep.pdf Path: Berkeley >> EE >> 241 Fall, 2008 Description: EE241 - Spring 2007 Advanced Digital Integrated Circuits Lecture 14: Clock gating, power gating Announcements Project reports are due next Tuesday 2 1 Class Material Last lecture Dynamic voltage scaling Today\'s lecture Clock gating Leakage contr... Date Added: 2009-04-27 11:07:37 |
| old_midterm.pdf Path: University of Illinois, Urbana Champaign >> STAT >> 324 Fall, 2009 Description: STAT 324 Midterm October 17, 1990 Closed Book, Open Calculators The linear model x= X\'Ji+~, where ~- Nn(Q,cr2In)\' will be assumed throughout this exa~. Als~, V = Span {K l\' ., ~p }, where the ~i\'s are the columns of X \" J3i\'s are least squares estim... Date Added: 2009-04-27 11:08:56 |
| DiffEqu.pdf Path: Lawrence >> CMSC >> 110 Fall, 2009 Description: Numerical Solution Methods for Differential Equations A first order ordinary differential equation is an equation of the form d x( t) = f(t,x(t) dt along with initial conditions x(0) = x 0 Solving the equation requires that we find an expression for ... Date Added: 2009-04-27 11:10:38 |
| Scope_Error.txt Path: Allan Hancock College >> COMP >> 1100 Fall, 2009 Description: / PROGLET / / Scope of attributes/variables / / written for COMP1100 at ANU / cae August 2004 /* local packages for input/output */ import au.edu.anu.cs.TextStreamReader; import au.edu.anu.cs.TextStreamWriter; public class Scope_Error { stat... Date Added: 2009-04-27 11:12:54 |
| exam1key.pdf Path: Missouri S&T >> CS >> 347 Fall, 2009 Description: CS347 FS2004 Exam 1 Key This is a closed-book test. The only items not supplied that you are allowed (and required) to use, are writing implements. Mark every sheet of paper you use with your name and the string cs347fs2004 exam1 (omittance, even if ... Date Added: 2009-04-27 11:19:21 |
| 3028-2009_week2_lecture.pdf Path: Allan Hancock College >> ENVS >> 3028 Fall, 2009 Description: Business and the Environment A stock-take: (i) where business is at (ii) What drives business behaviour? Number of Organisations Fast Follower Polluter Committed Complier Reluctant complier Leader The Stages of Environmental Policy 1. Reactive 2... Date Added: 2009-04-27 11:19:41 |
| soluq2.pdf Path: Charleston Law >> MA >> 200 Fall, 2009 Description: ... Date Added: 2009-04-27 11:21:24 |
| SexualityIdentityCultureContempDiscoursesHUM414McClainLS09.pdf Path: UNC Asheville >> HUM >> 414 Fall, 2009 Description: SEXUALITY, IDENTITY AND CULTURE:CONTEMPORARY DISCOURSES Humanities 414, March 6, 2009 Professor McClain Intro: *painting: The Sheer Weight of History by Eric Fischl Lets Go Away For a While, Brian Wilson, Pet Sounds *music: I) Michel Foucault (1926... Date Added: 2009-04-27 11:21:37 |
| p317s09-c6-1.pdf Path: George Mason >> PSY >> 317 Fall, 2009 Description: Chapter 6 Long-Term Memory: Basic Principles (Explicit) (Implicit) Caption: Long-term memory can be divided into declarative memory and implicit memory. We can also distinguish between two types of declarative memory, episodic and semantic. There ... Date Added: 2009-04-27 11:21:40 |
| 9-12.pdf Path: George Mason >> M >> 723 Fall, 2009 Description: Problems 9 - 12 Exercise 9. Find the Mbius function for a linearly ordered set with four o elements, 0 < a < b < 1. (Your answer could be displayed in a 4 4 matrix.) Exercise 10. Let L be the collection of all subsets S of X = {1, 2, . . . , n} havi... Date Added: 2009-04-27 11:22:36 |
| looparound_sovitsky.pdf Path: UC Davis >> MS >> 0708 Fall, 2009 Description: LOOPAROUND INSTRUCTIONS GRADE 5 OR 6 This is a fun and interactive game that can be played with up to 40 players. Each player gets one card and anyone can start off the game. The first person reads their card (ex. Who has 0-11), and the person whose ... Date Added: 2009-04-27 11:26:33 |
| AMOL_KARKHANIS.doc Path: UCF >> CET >> 4748 Fall, 2008 Description: Telecommunications Infrastructure: Getting to the Root of the Problem Introduction to WAN CET 4748 Dr. Motlagh 11/05/2006 Greg Beauchamp Amol Karkhanis Michael Seykoski Table of Contents Introduction.3 Copper Wire Networks.3-6 Optical Networks.6-10... Date Added: 2009-04-27 11:27:22 |
| sbode_pairs_f07.pdf Path: Olin >> ENGR >> 3340 Fall, 2009 Description: Bode Sketching: Pairs and Properties Dynamics (ENGR 3340) Derivative/Integral G(s) = s (a) Transfer Function (b) SketchBode G(s) = 1 s (c) Transfer Fuction (d) SketchBode Figure 1: Bode plot produced using the sketchbode.m function. The red l... Date Added: 2009-04-27 11:28:01 |
| E1seating.pdf Path: Purdue >> MA >> 166 Spring, 2004 Description: ... Date Added: 2009-04-27 11:37:53 |
| 071112.txt Path: U. Houston >> INDE >> 2333 Fall, 2008 Description: AGENDA U Rank Sum Test Linear Regression RANK SUM TEST Alternative to: Independent t test Smith-Satherwaithe test Used when the sample data is either Non-normal To small to determine normality U test Based on the rank order of sorted data sample rat... Date Added: 2009-04-27 11:38:25 |
| draftunitpreparation.doc Path: U. Houston >> CUIN >> 3112 Fall, 2008 Description: Unit Preparation Technology Hardware (Check boxes of all equipment needed) Camera Computer(s) Digital Camera DVD Player Internet Connection Laser Disk Printer Projection System Scanner Television VCR Video Camera Video Con... Date Added: 2009-04-27 11:39:16 |
| studentsample.doc Path: U. Houston >> CUIN >> 3112 Fall, 2008 Description: Timeline: This is an example of how I want your excerpt for the timeline to look. All that is needed is the Inventor/Scientist name, one of their major inventions, date of the invention, and date of life span. Then you need to cut it out and put on t... Date Added: 2009-04-27 11:39:23 |
| studentsample.doc Path: U. Houston >> KMOORE >> 3112 Fall, 2009 Description: Timeline: This is an example of how I want your excerpt for the timeline to look. All that is needed is the Inventor/Scientist name, one of their major inventions, date of the invention, and date of life span. Then you need to cut it out and put on t... Date Added: 2009-04-27 11:39:24 |
| SurfaceOperations.pdf Path: Purdue >> CGT >> 226 Spring, 2008 Description: Introduction to Surfacing Chapter 5: Surface Operations Objectives: Join Operation Split/Trim Operations Extract Operation Extrapolate Operation Transformation Operations 2006 RAND Worldwide Performing Operations Join Split, Trim Surface operat... Date Added: 2009-04-27 11:40:08 |
| hot_topic.pdf Path: U. Houston >> CUIN >> 3111 Fall, 2008 Description: Group One The Classroom Volume 1, Issue 1 November 12, 2008 Classroom Size: A Positive Aspect Does class room size really affect the learning process? After reading many articles, a case study done by Martin and Blatchford (1988), they have found t... Date Added: 2009-04-27 11:43:32 |
| hot_topic.pdf Path: U. Houston >> QUEST >> 3111 Fall, 2009 Description: Group One The Classroom Volume 1, Issue 1 November 12, 2008 Classroom Size: A Positive Aspect Does class room size really affect the learning process? After reading many articles, a case study done by Martin and Blatchford (1988), they have found t... Date Added: 2009-04-27 11:43:33 |
| prog1data.txt Path: CSU Fullerton >> CS >> 131 Fall, 2009 Description: Last Name,First Name,Middle Initial,Pay Rate,Hours Worked Allen,Wilson,R,8,40 Anderson,Jack,L,12.32,22 Bowen,Red,E,20,32.5 Clark,John,C,24,46 Donner,Fred,R,15.5,20 Edwards,Larry,W,12,40 Foulton,Sandy,R,30,40 Green,Rachel,M,15,20 Hyde,Mary,W,14.30,32.... Date Added: 2009-04-27 11:47:40 |
| analytical.pdf Path: CSU Fullerton >> C >> 210 Fall, 2009 Description: ESCI 430 C-T Lee 2003 Statistics Primer A very nice treatment of error analysis is given by John R. Taylor in An introduction to error analysis: the study of uncertainties in physical measurements (University Science Books, Sausalito, California, ... Date Added: 2009-04-27 11:51:20 |
| seng480a-seng520-F04-final.pdf Path: Virgin Islands >> SENG >> 420 Fall, 2009 Description: Uvic ID 0024468 0031229 0034250 0034550 0034553 0034555 0034865 0122912 0124058 0124972 0127243 0130074 0131024 0135352 0135859 0135914 0137205 0226410 0227108 0227637 0233285 0237908 0320364 0325347 0331476 0423559 0431372 0433637 805573 9502348 980... Date Added: 2009-04-27 11:51:33 |
| EnveEss110_20081105.pdf Path: CA Merced >> ENG >> 20081105 Fall, 2009 Description: 1 1. BoundaryValue Problems Consider the simple groundwater flow problems illustrated in Fig. 1 (System 1) and Fig. 2 (System 2). Determine the volumetric flow rate, Q , for each system. Assume steady state conditions and a unit width when... Date Added: 2009-04-27 11:53:50 |
| problem3_solution_step1.pdf Path: Utah State >> MATH >> 1050 Fall, 2008 Description: The Natural Logarithmic Function Problem 3. Solve for x. eln 4x = 16 Solution: x=4 ... Date Added: 2009-04-27 11:54:33 |
| AmpereLaw.pdf Path: Swarthmore >> PHYSICS >> 008 Fall, 2009 Description: Ampere\'s Law Workshop AMPERE\'S LAW \" B( r ) d s = r r r r r r 4# 4# $ Ii = c c i 0 i r r \" J ( r ) da (cgs units) r \" B( r ) d s = $ I STOKES\' THEOREM ! r r r = 0 \" J ( r ) da i (mks units) \" F( r ) d s = \" (# $ F( r ) da C S r r ... Date Added: 2009-04-27 11:55:23 |
| x208_4.pdf Path: Mich Tech >> BL >> 4470 Spring, 2008 Description: Bla70t2008t4 Name ANALYSIS OF BIOLOGICAL DATA: Fourth Examination INSTRUCTIONS: 1) WRITE your nameon eachpageof this examand on any additionalpaper you submit. formatas far as possible working out your answers the 2) FOLLOW Zar\'s \"example\" in to fo... Date Added: 2009-04-27 12:00:10 |
| Mesh.pdf Path: Mich Tech >> CS >> 3621 Fall, 2009 Description: Mesh Basics 1 Definitions: 1/2 A polygonal mesh consists of three kinds of mesh elements: vertices, edges, and faces. The information describing the mesh elements are mesh connectivity and mesh geometry. The mesh connectivity, or topology, describe... Date Added: 2009-04-27 12:03:00 |
| problem5.pdf Path: Utah State >> MATH >> 0900 Fall, 2008 Description: Simplifying Expressions Problem 5. Simplify the expression and give the numerical coefficient of n and n2 . 7(n2 + 4) - 16(n + 2) ... Date Added: 2009-04-27 12:03:09 |
| TCQ.pdf Path: Mich Tech >> HU >> 5003 Fall, 2008 Description: Casey J. Rudkin Journal Mapping for TCQ HU 5003 for Dr. Ann Brady casey@mtu.edu Technical Communication Quarterly Edited by Mary M. Lay and Billie J. Wahlstrom from University of Minnesota They took over from founding editor Donald H. Cunningham of A... Date Added: 2009-04-27 12:06:57 |
| c1083.pdf Path: Midwestern State University >> EM >> 2778 Fall, 2009 Description: C1083 4-H EMBELLISHMENT AND WEARABLE ART SCORECARD Note: Use of points is optional Exhibitors Name/Entry Number: Jr/Int/Sr/Other: Judging Criteria Points (circle one) Class: Score Excellent Good Fair N/A Ribbon: Judges Comments Visual Impact 20... Date Added: 2009-04-27 12:11:45 |
| Neurological System.ppt Path: East Los Angeles College >> GM >> 607 Fall, 2009 Description: Neurological System Mabel Simms October 2006 Neurological System One of the earliest system to develop in embryo 3rd week In the first year the brain enlarges to 3 times its size from birth (craniosynostosis!) Neurological System N.S. format... Date Added: 2009-04-27 12:16:40 |
| CHA 07 Improving health via Community Action.doc Path: East Los Angeles College >> GM >> 6056 Fall, 2009 Description: Improving health via Community Action To what extent does your project undertake : 1. Action which makes individual\'s behaviour change easier ? 2. Action which seeks improvements in the `structures\' within which individuals and communities live ? 3... Date Added: 2009-04-27 12:16:45 |
| 138b.txt Path: Texas >> PSY >> 394 Fall, 2009 Description: Okay, no. When I was in there rrlike, she walked me in I sat down and I started, she told me to look through the red book, read it and it wasn\'t too interested. So I switched read the I don\'t know some yellow book, some psychology book some journal t... Date Added: 2009-04-27 12:18:29 |
| 1958rcs0-399.doc Path: Neumont >> CSC >> 1958 Fall, 2009 Description: Supreme Court of Canada Union Marine General Insurance Company Limited (Defendant) Appellant; and Alex Bodnorchuk and Steve Nawakowsky (Pl... Date Added: 2009-04-27 12:20:42 |
| CS122_4.pdf Path: N. Michigan >> CS >> 122 Winter, 2008 Description: CS 122 Timing Sorts Program #4 Due Fri. March. 27, 2009 A program that times a sort is available on the class web page. You are to add at least three different sorting procedures to this program. One of your sorts must be of the very inefcient O(n... Date Added: 2009-04-27 12:30:43 |
| lect15.pdf Path: Princeton >> PHYS >> 301 Fall, 2009 Description: Physics 301 Examples of Zint 13-Oct-2004 15-1 We have been discussing how to modify our treatment to allow for the internal states and energies of molecules in, for example, an ideal gas To make further progress, we need to consider some specic exa... Date Added: 2009-04-27 12:32:42 |
| Lect8.pdf Path: Trinity U >> CSCI >> 1321 Fall, 2009 Description: ! \" #$ % 0 1 ( ) / 1 2 \" 0 0 11 5 4 4 0 14 #$ %4 n, c m > n, c * f ( m) > g ( m) 6 5 + 7 8 + ,/ ( + , 4 + ,97 ) 4 4 0 0 11 ! : ! (; ) $ \" 4 \" ... Date Added: 2009-04-27 12:53:37 |
| S1n1a-b.pdf Path: UCSD >> PHYSICS >> 130 Fall, 2000 Description: ... Date Added: 2009-04-27 12:57:53 |
| Capacitance-example.pdf Path: Iowa State >> EE >> 201 Fall, 2009 Description: Capacitorexample Wednesday,February11,2009 2:18AM Att=0+ i(t)=900e2500t A Findv0 Att=0+ i(t)=900e2500t A FindV1andV2 Howmuchenergyisdeliveredtotheboxfor0<=t<=infinity? New Section 1 Page 1 Whatistheinitialenergyinthesystem(whichisintheseriescapa... Date Added: 2009-04-27 13:00:08 |
| VAPA.FILM-074.pdf Path: UCCS >> MJRSHEET >> 074 Fall, 2009 Description: Department of Visual & Performing Arts Program Coordinator: Dr. Robert von Dassanowsky, Assoc. Professor U Office Park 100E (719) 262-3562 rvondass@uccs.edu Department Website: http:/web.uccs.edu/vapa/index.shtml Objectives: The Visual and Perform... Date Added: 2009-04-27 13:05:20 |
| OPTI 510L Lecture 4.pdf Path: Arizona >> OPTI >> 510 Fall, 2009 Description: Lab 4 First order design and assembly Lab 4 Cardinal points PP2 Lab 4 Pupils Lab 4 Afocal systems Lab 4 Telescopes Keplerian Inverted image Large angular magnification: M = / = -f0/fe objective eyepiece Intemediate image EYE Image at infin... Date Added: 2009-04-27 13:06:31 |
| MEMORANDUM part 1 opti 421 Hugo A. Casahonda.doc Path: Arizona >> HW >> 421 Fall, 2009 Description: MEMORANDUM From: Hugo Casahonda Date: November 19, 2007 Subject: Adhesives Summary Adhesives are everywhere. A two-part epoxy is a common adhesive that can be applied to wood, plastics and metals. It varies from vendor to vendor, as hey have differe... Date Added: 2009-04-27 13:06:36 |
| 2007628_f01o_066286.pdf Path: Stanford >> MRVL >> 1036 Fall, 2009 Description: 5:06-cv-06286 - RMW Document 134 Filed 06/28/2007 Page 1 of 3 2 4 6 7 8 9 STEVEN M. SCHATZ, State Bar No . 118356 BORIS FELDMAN, State Bar No . 128838 RODNEY G. STRICKLAND, JR., State Bar No . 161934 WILSON SONSINI GOODRICH & ROSATI Profession... Date Added: 2009-04-27 13:06:41 |
| 2008812_f01x_082495.pdf Path: Stanford >> SCGLYPK >> 1039 Fall, 2009 Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK X In re SOCIETE GENERALE SECURITIES LITIGATION 08 Civ. 2495 (GEL) x [^] SCHEDULING ORDER REGARDING: (1) THE APPOINTMENT OF THE VERMONT PENSION INVESTMENT COMMITTEE AS LEAD PLAINTIFF AND ... Date Added: 2009-04-27 13:08:01 |
| chapter6Client.ppt Path: CUNY Baruch >> CS >> 703 Fall, 2009 Description: PF_INET versus AF_INET AF_ - address family PF_ - protocol family Historically the intent was that a single protocol family might support multiple address families PF_ value: to create the socket AF_ value: used in socket address structure. Actu... Date Added: 2009-04-27 13:10:17 |
| jane_healy.pdf Path: S.E. Louisiana >> ETEC >> 660 Fall, 2008 Description: Reflections of Jane M. Healy, Ph.D. Failure to Connect How Computers Effect Our Childrens Minds- For Better and Worse by Keli LeBlanc Freeman for ETEC 695 Dr. Nan Adams 2 In Jane Healys book, Failure to Connect, she expresses her concern as to how s... Date Added: 2009-04-27 13:14:40 |
| quiz2.doc Path: Washington University in St. Louis >> CST >> 310 Fall, 2009 Description: CST 310: Java Quiz 2 (programming) Question: (5 points) Create two instances of the person class giving each a Forename, Surname, age, and gender. Swap Person2\'s Surname and Person1\'s Forename. Also swap their genders and ages. Example: Before swappi... Date Added: 2009-04-27 13:16:36 |
| Dicranaceae phylogeny.pdf Path: Southern Oregon >> BI >> 432 Fall, 2009 Description: Systematic Botany (2002), 27(3): pp. 435452 Copyright 2002 by the American Society of Plant Taxonomists The Circumscription of the Dicranaceae (Bryopsida) Based on the Chloroplast Regions trnLtrnF and rps4 CATHERINE LA FARGE,1,3 A. JONATHAN SHAW,1 a... Date Added: 2009-04-27 13:18:05 |
| Sphagnum phylogenics.pdf Path: Southern Oregon >> BI >> 432 Fall, 2009 Description: Copyright The Bryologist 107(2), pp. 189 196 2004 by the American Bryological and Lichenological Society, Inc. Phylogenetic Relationships Among Sphagnum Sections: Hemitheca, Isocladus, and Subsecunda JONATHAN SHAW,1 CYMON J. COX, AND SANDRA B. BOL... Date Added: 2009-04-27 13:18:07 |
| ME 871 Course Outline January 2009.pdf Path: Air Force Academy >> ME >> 871 Fall, 2009 Description: ME 871 Experimental Fluid Mechanics (January 2009) Department of Mechanical Engineering University of Saskatchewan Instructor David Sumner, Ph.D., P.Eng. Associate Professor Department of Mechanical Engineering Telephone: E-Mail: Office: (306) 966-... Date Added: 2009-04-27 13:20:37 |
| Introduction.pdf Path: East Los Angeles College >> COMP >> 60462 Fall, 2009 Description: COMP60461 The Semantic Web: Ontologies and OWL Bijan Parsia and Sean Bechhofer University of Manchester Manchester, UK {bparsia@cs.man.ac.uk, sean.bechhofer@manchester.ac.uk} Goals of the course Understand the goals of ontologies and their role in... Date Added: 2009-04-27 13:20:55 |
| Fortune-Teller.txt Path: Columbia >> CS >> 4840 Fall, 2009 Description: Abstract for group Fortune-Teller The Concept: Digital version of a 1950\'s-era penny arcade fortune teller machine (see \"Fortune Tellers\" at http:/marvin3m.com/arcade/ for an example). The program will display a graphic of a gypsy (possibly with so... Date Added: 2009-04-27 13:26:01 |
| lab5.pdf Path: Columbia >> CS >> 4840 Fall, 2009 Description: CSEE W4840 Embedded System Design Lab 5 Stephen A. Edwards Due March 4, 2004 Abstract Modify the simple framebuffer we provided to make it display characters instead of a bitmap. Couple this with a simple C program that display \"Hello World.\" 1 Intro... Date Added: 2009-04-27 13:26:58 |
| CH06.ppt Path: Plymouth >> CD >> 1000 Fall, 2009 Description: T-56 Figure6.1 MaslowsHierarchyofNeeds To achieve a healthy understanding of self. SelfActualization SelfRespect BelongingnessSecurity PhysiologicalNeeds Henniger The Teaching Experience: An Introduction to Reflective Practice Co... Date Added: 2009-04-27 13:31:33 |
| opengl_primitives.ppt Path: Iowa State >> CS >> 229 Fall, 2009 Description: 3D Computer Graphics OpenGL David Kabala Why Cool? Computer Graphics Raster Graphics - Images are created from pixel data Images are created from primitives of points, lines, curves, and other shapes Final image is computed by processing this r... Date Added: 2009-04-27 13:32:46 |
| Chapter2b.pdf Path: Allan Hancock College >> COMP >> 2070 Fall, 2009 Description: SONET/SDH (standard for TDM) Synchronous Optical NETwork/Synchronous Digital Hierarchy (controlled by a master clock) Design goals: Make it possible for different carriers to interwork (standard for wavelength, timing, framing structure and other is... Date Added: 2009-04-27 13:34:35 |
| lec13.pdf Path: Iowa State >> CS >> 611 Fall, 2009 Description: Com S 611 Algorithms for Multiprocessor Synchronization Lecture 13: Tuesday, 3rd March 2009 Instructor: Soma Chaudhuri Spring Semester 2009 Scribe: Neeraj Khanolkar 1 Introduction When comparing the relative powers of two dierent kinds of shared... Date Added: 2009-04-27 13:35:23 |
| 2r1ex04.pdf Path: East Los Angeles College >> MATH >> 29671 Fall, 2009 Description: 1. a) Find the Maclaurin series for f (x) = cos3 x up to and including the term in x3 . b) Find the range of convergence of the series 1+ x x2 xn + + . + n + . 3 9 3 What is the sum of this infinite series? c) Find the range of convergence of x + 2... Date Added: 2009-04-27 13:35:25 |
| Midterm3.pdf Path: Georgia Tech >> MATH >> 142 Fall, 2009 Description: ... Date Added: 2009-04-27 13:43:23 |
| Learning Guide 5.doc Path: Wisconsin >> ECONOMICS >> 311 Fall, 2009 Description: University of Wisconsin Department of Economics Economics 311: Intermediate Microeconomic Theory Adv. Treatment Korinna K. Hansen Learning Guide 5 Due Date: Wednesday, Oct. 15, 2008 Reading Assignment: Varian Chapter 16 up to the middle of page 302... Date Added: 2009-04-27 13:45:38 |
| Problem Set 5.doc Path: Wisconsin >> ECONOMICS >> 311 Fall, 2009 Description: Econ 311: Intermediate Microeconomic Theory - Advanced Treatment Korinna K. Hansen Problem Set 5 1). Use a graph (where helpful) and explain if the following statements are true of false: a). Because of the existence of economic rent competitive firm... Date Added: 2009-04-27 13:46:04 |
| Group Assignment 2.doc Path: Wisconsin >> ECONOMICS >> 311 Fall, 2009 Description: University of Wisconsin Department of Economics Economics 311: Intermediate Microeconomic Theory Adv. Treatment Korinna K. Hansen Group Assignment 2 Due Date: Wednesday, September 24, 2008 Reading Assignment: Varian, Chapter 6 Problem Assignment... Date Added: 2009-04-27 13:46:13 |
| handout9_F07.pdf Path: Wisconsin >> ECON >> 101 Fall, 2008 Description: Econ 101-Principles of Microeconomics (Fall 2007) By Hiro Miyamoto Game Theory Game theory is a modeling approach that focuses on strategic interaction by using information on the participants possible actions and incentives to predict the likely pat... Date Added: 2009-04-27 13:47:03 |
| deming07.ppt Path: Arkansas State >> QM >> 3523 Fall, 2009 Description: W.EdwardsDeming InstituteLeadership Presentedby: Courtney Roades MyronAllen BlairBrown CristyHensley ThemanwhodiscoveredTQM s W.EdwardsDeming s Graduatedfromthe UniversityofWyoming withaB.S.inPhysicsin 1921 GraduatedfromYale withaPh.D.in Ma... Date Added: 2009-04-27 13:48:24 |
| FPCounter.xls Path: Rose-Hulman >> CSSE >> 371 Fall, 2009 Description: Complexity Low Medium External Inputs (EI) External Outputs (EO) External inQuiries (EQ) Internal Logical Files (ILF) External Interface Files (EIF) Unadjusted FPs Factors Data communication Distributed data processing Performance Heavily used config... Date Added: 2009-04-27 13:48:57 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
