Course Solutions And Notes - lecture4_spr09 0d
| HW5.pdf Path: Saint Louis >> HW >> 193 Fall, 2009 Description: EAS193 Introduction to Earthquakes Assignment 5 Wednesday April 1, 2009 1. Some of the enigmatic features of the seafloor are the fracture zones that extend beyond the midocean ridges. A topographic view of the ocean floor looks like. These can be ... Date Added: 2009-05-21 15:19:42 |
| _Portfolio Problems_1 and 2.doc Path: Wisc La Crosse >> MTH >> 280 Fall, 2009 Description: Problem Solving Portfolio Problem 1: The Vice-President\'s Defense Budget Some senators were sitting around discussing the latest Defense Department budget. Several of them asked the vice president how much the latest battle in the War on Terror would... Date Added: 2009-05-21 15:20:29 |
| Exam1 - Constructions - Answers.pdf Path: Wisc La Crosse >> MTH >> 171 Fall, 2009 Description: ... Date Added: 2009-05-21 15:20:41 |
| AMIS 211 - Autumn 2003 - Greenberg.pdf Path: Ohio State >> FISHER >> 211 Fall, 2008 Description: ... Date Added: 2009-05-21 15:25:46 |
| CreatingACareerMarketingPlan.pdf Path: Ohio State >> FISHER >> 4278 Fall, 2009 Description: C REATING A CAREER MARKETING P LAN MARKETING P LAN A Marketing Plan is designed to launch a product effectively. Here, the product is you and your career. This document will help you focus your strategy by articulating several key elements outli... Date Added: 2009-05-21 15:27:19 |
| IntroToCaseInterviews.pdf Path: Ohio State >> FISHER >> 4278 Fall, 2009 Description: An Introduction to Case Interviews OFFICE OF CAREER MANAGEMENT An Introduction to Case Interviews Overview Historically used by consulting firms to assess a candidate\'s ability to handle real-life business problems, casetype interview questions are ... Date Added: 2009-05-21 15:27:20 |
| rcviexer.xls Path: Ohio State >> MODULE >> 212 Fall, 2009 Description: Introduction to Managerial Accounting Income and Cost Analysis Exercise R V CM F I BER V CM F I CMR 40 80 50 Income and Cost Analysis Exercise Solution R V CM F I BER V CM F I CMR $120 $40 $80 $30 $50 $45 $15 $30 $30 $0 0.6667 GIVEN IN PROBLEM Not... Date Added: 2009-05-21 15:28:01 |
| extension_request.doc Path: East Los Angeles College >> PC >> 0207 Fall, 2009 Description: DIABETES MASTERS PROGRAMME Request for Extension Student Name: Name of Module: Date Coursework Due: _ Organisation and Delivery of Diabetes Care (Feb 07) Monday 4 June 2007 I am unable to submit my course assignment by the due date for the following... Date Added: 2009-05-21 15:34:14 |
| dxforce.pdf Path: Wisconsin >> ECE >> 355 Fall, 2009 Description: ... Date Added: 2009-05-21 15:34:19 |
| What is Design.ppt Path: Maine >> ELE >> 401 Fall, 2009 Description: What is Design? Engineering design is the communication of a set of rational decisions obtained with creative problem solving for accomplishing certain stated objectives within prescribed constraints. (E. Lumsdaine et al. ASEE 1999, Session 2225, re... Date Added: 2009-05-21 15:38:06 |
| exercise-3-soln.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 547 Fall, 2008 Description: ECE547 Image Processing Sept 25, 2008 Exercise 3 Lecturer: Prof. Thomas Huang Due: Oct 9, 2008 Problem 1 Compression Ratio (2 points) Compute the compression ratio that you achieved in MP3. Assume that it takes the original image was 128 128 with... Date Added: 2009-05-21 15:38:18 |
| 34206H6-SSAmpSimulation.pdf Path: Maine >> ELE >> 342 Fall, 2009 Description: ELE 342 Dr. M.G. Guvench 1. ELECTRONICS I Homework Fall \'06 11/20/06 _ _ Use the results of the \"Common-Emitter AC Coupled BJT Amplifier Design\" given in the file \"SS-CE-D1-y.pdf\" on the ELE342 web page to build and test the amplifier, a. For S... Date Added: 2009-05-21 15:38:50 |
| Queue Analysis.doc Path: Syracuse >> CSE >> 681 Fall, 2008 Description: QueuingAnalysis Version3.0 JimFawcett CSE681SoftwareModelingandAnalysis Summer2003 TableofContents BasicModels . 3 InfiniteQueues . 6 FiniteQueues . 8 IV. PracticalAnalysis . V. PriorityQueues . 10 VI. FeedbackQueues . VII. References . VIII. Appen... Date Added: 2009-05-21 15:41:11 |
| MT4Sp04InstrSol.doc Path: Syracuse >> CSE >> 687 Spring, 2008 Description: CSE687ObjectOrientedDesign Midterm#4 Spring2004 Midterm#4InstructorsSolution Name:_SUID:_ This is a closed bookexamination. Please placeall yourbookson the floor besideyou.Youmaykeeponepageofnotesonyourdesktopinadditiontothis exampackage. Allexa... Date Added: 2009-05-21 15:42:10 |
| E_lect04.pdf Path: Syracuse >> CSE >> 681 Fall, 2008 Description: J. Virtamo 38.143 Queueing Theory / Stochastic processes 1 STOCHASTIC PROCESSES Basic notions Often the systems we consider evolve in time and we are interested in their dynamic behaviour, usually involving some randomness. the length of a queue ... Date Added: 2009-05-21 15:42:16 |
| CoverSheet.doc Path: Syracuse >> CSE >> 687 Spring, 2008 Description: Handouts/CSE687/code/VSHelpSp09 Visual Studio Help Session Code Spring 2009 Purpose: Illustrate how Visual Studio works by creating example code that also is useful for Project #1. Jim Fawcett CSE687 Object Oriented Design Spring 2009 ... Date Added: 2009-05-21 15:43:06 |
| formulaire_offre_demploi_temps_partiel.doc Path: CUNY Queens >> AD >> 60489 Fall, 2009 Description: OFFRES D\'EMPLOI TEMPS PARTIEL Nom et site Internet de l\'entreprise Personne contacter Adresse complte Adresse courriel Titre du poste Programme d\'tudes cibl Date d\'entre en fonction Lieu de travail Quart de travail Jour Soir ... Date Added: 2009-05-21 15:43:12 |
| ReadMe.txt Path: Syracuse >> CSE >> 687 Spring, 2008 Description: = CONSOLE APPLICATION : B2.5 Project Overview = AppWizard has created this B2.5 application for you. This file contains a summary of what you will find in each of the files that make up your B2.5 application. B2.5.vcproj This is the main... Date Added: 2009-05-21 15:44:04 |
| OVERHEADS TO KEEP.doc Path: Oregon State >> BA >> 465 Fall, 2008 Description: OVERHEADS TO KEEP \"Higher Education\" Stupid 1-4 \"Games People Play\" ... Date Added: 2009-05-21 15:45:20 |
| Sample Balance sheet.doc Path: Oregon State >> BA >> 215 Fall, 2008 Description: Sample Balance sheet to illustrate the classified balance sheet format, and some typical accounts Franklin Corporation Balance Sheet October 31, 2005 Assets Current assets Cash Short-term investments Accounts receivable Inventories Supplies Prepaid i... Date Added: 2009-05-21 15:46:28 |
| Chapter 3 Solutions.doc Path: Oregon State >> BA >> 215 Fall, 2008 Description: Chapter 3 - Financial Statement Analysis Answers to True/False Questions 17. 18. 19. 20. 21. 22. 23. F F F T F T T 24. 25. 26. 27. 28. 29. 30. F T T F F T F Answers to Multiple-Choice Questions 31. 32. 33. 34. 35. b c e d b 36. 37. 38. 39. c e d a ... Date Added: 2009-05-21 15:46:29 |
| Shay.doc Path: Oregon State >> BA >> 350 Fall, 2008 Description: Shay and his father had walked past a park where some boys Shay knew were playing baseball. Shay asked, \"Do you think they will let me play?\" Shay\'s father knew that the boys would not want him on their team. But the father understood that if his son... Date Added: 2009-05-21 15:46:43 |
| Mc Makeover.ppt Path: Oregon State >> BA >> 495 Fall, 2008 Description: MickeyD\'sMcMakeover 30,000worldwide restaurantsbeing completelyredesigned at unprecedentedscale After30yearswithout anyrenovation, McDonaldsplans makeover Wanttocreatean ipodlook Goodbyetothered roof RonaldMcDonald andgoldenarches... Date Added: 2009-05-21 15:46:48 |
| brook-questions.rtf Path: Cal Poly >> CSC >> 520 Fall, 2009 Description: Brook for GPUs Questions. 1. What is stream programming? How is it different from vector programming? 2. What is Brook? 3. Name two limitations of current graphics hardware and describe how Brook deals with them. 4. Why doesn\'t the Brook GPU implemen... Date Added: 2009-05-21 15:47:46 |
| TheNumberE.pdf Path: Salisbury >> MATH >> 100 Spring, 2008 Description: Exponential Growth An initial amount of A grows at rate r per year compounded n times per year. The amount after t years, denoted by V(t) is given by . r V (t ) = A(1 + ) nt n Which is equivalent to . LM OP 1 P V ( t ) = AM1 + nI P MM FG J P N H ... Date Added: 2009-05-21 15:49:14 |
| Assn1notes.pdf Path: Salisbury >> MATH >> 465 Spring, 2008 Description: ... Date Added: 2009-05-21 15:49:23 |
| Figurate3.pdf Path: Salisbury >> MATH >> 230 Spring, 2008 Description: ... Date Added: 2009-05-21 15:49:30 |
| joe06.pdf Path: Columbia >> SN >> 2294 Fall, 2009 Description: ARTICLE IN PRESS Journal of Econometrics 131 (2006) 507537 www.elsevier.com/locate/econbase Evaluating latent and observed factors in macroeconomics and finance$ Jushan Baia,b, Serena Ngc, b a Department of Economics, 269 Mercer St., New York Unive... Date Added: 2009-05-21 15:50:06 |
| lecture906.ppt Path: Washington >> BIOC >> 440 Fall, 2008 Description: BIOCHEMISTRY 440 Lecture #9 (Oct. 16, 2006) Binding release by Hb Assigned Reading: Chap. 5, p. 157-162 On you... Date Added: 2009-05-21 15:50:20 |
| U5.5.ppt Path: UF >> STA >> 6166 Summer, 2008 Description: Multiple Regression: Part II (12.4 - 12.7) Testing hierarchical models. Model building and variable selection. Checking model assumptions. Dummy variables. The Peruvian Indian Data a complete example. 15-1 Testing Hierarchical Models Suppose... Date Added: 2009-05-21 15:51:18 |
| 4000MW.pdf Path: Maple Springs >> ECON >> 4000 Fall, 2009 Description: Advanced Microeconomic Analysis (ECON4000) January 2005 Instructor: Professor Kin Chung Lo Office: Vari Hall 1070 Phone Number: 736-2100 Ext. 77032 E-mail: kclo@yorku.ca Web Page: Any announcement made (or material distributed) in class will be post... Date Added: 2009-05-21 15:51:32 |
| L4a.ppt Path: Columbia >> KF >> 2119 Fall, 2009 Description: BBSQ5116 Language Disorders in Adults Lecture 4 assessment and intervention in Brocas aphasia Planning intervention What person can do cannot do does do closing the gap What person needs to do wants to do Planning intervention What person cannot ... Date Added: 2009-05-21 15:51:49 |
| hernandez.doc Path: Calvin >> IDIS >> 110 Fall, 2009 Description: Juan Antonio Hernandez RIT January 11, 2003 SQ3R 1. Why was the graphical user interface popular in the 1980s? The windowed interfaces made popular by the apple Macintosh and Microsoft and has had enormous impact on the culture of information technol... Date Added: 2009-05-21 15:53:24 |
| Coastal-Shore.doc Path: Georgia Tech >> EAS >> 4300 Fall, 2008 Description: OceanographyFinalExamQuestions Topic5:Lectures25an26 Q1: a)Theequationforshearstressis=u2.Describeeachvariableandhow eachaffectstheshearstress. b)Whathappenswhentheshearstressreachesthecriticalshearstress? c)Explainthedifferencebetweensaltationandsus... Date Added: 2009-05-21 15:54:01 |
| s0032.pdf Path: Georgia Tech >> ECE >> 2030 Fall, 2008 Description: Reverse Engineering a State Machine Part A S1 S0 Y X NS1 NS0 0 0 0 0 0 0 0 0 0 0 0 0 1 1 1 1 0 0 1 1 0 0 1 1 0 1 0 1 0 1 0 1 0 1 0 1 0 1 1 1 1 0 1 0 0 0 0 0 B 0 0 0 0 0 1 0 1 A 0 0 0 0 0 0 0 0 S1 S0 Y X NS1 NS0 1 1 1 1 1 1 1 1 0 0 0 0 1 1 1 1 0 0 ... Date Added: 2009-05-21 15:57:30 |
| lect19_4_10_08_3D_viewing_projection.pdf Path: Binghamton >> CS >> 460 Fall, 2009 Description: Binghamton University EngiNet State University of New York EngiNet Thomas J. Watson School of Engineering and Applied Science WARNING All rights reserved. No Part of this video lecture series may be reproduced in any form or by any electronic or m... Date Added: 2009-05-21 15:57:56 |
| 1table.pdf Path: Oregon State >> SR >> 1060 Fall, 2009 Description: WEATHER INFORMATION: 2004 WATER YEAR, POWELL BUTTE, OREGON (SOURCE: AGRIMET) AIR TEMPERATURE (oF) Avg. Maximum Avg. Minimum Mean AIR TEMP (no. of days) Max. 90oF or Above Max. 32oF or Below Min. 32oF or Below Min. 0oF or Below SOIL TEMP (oF at 4 in.)... Date Added: 2009-05-21 15:58:28 |
| sis022ac.pdf Path: Colorado State >> SIS >> 022 Fall, 2009 Description: SIS022ac SM94 Office of Budgets and Institutional Analysis Student Credit Hour Distribution Summer 1994 03/23/01 10:14 Page: 1 Non Resident Totals Student Level Lower Div Upper Div Undergrad Grad I Grad II Graduate Total Education and General ... Date Added: 2009-05-21 16:00:27 |
| hw6.pdf Path: Georgia Tech >> PHYS >> 6124 Fall, 2008 Description: Phys. 6124 Assignment 6 Problem 1 a) Determine the eigenvalues and eigenvectors of 1 1 . 0. Note that the eigenvalues are degenerate for = 0, but the eigenvectors are orthogonal for all nonzero b) Determine the eigenvalues and eigenvectors of 1 2... Date Added: 2009-05-21 16:02:36 |
| FinalExamSoln.doc Path: U. Houston >> ECE >> 3455 Fall, 2008 Description: ... Date Added: 2009-05-21 16:04:52 |
| notes19 1100.ppt Path: U. Houston >> ECE >> 1100 Fall, 2008 Description: ECE 1100: Introduction to Electrical and Computer Engineering Spring 2008 David R. Jackson Professor, ECE Dept. Notes 19 Resistors Resistors Resistors (cont.) i + R v - Note: passive sign convention is assumed here. v Ri i units of R are Ohms [... Date Added: 2009-05-21 16:05:45 |
| gold_rush.doc Path: Uni. Westminster >> MLA >> 1121 Fall, 2009 Description: Record: 1 Title: \'Gold Has Been Found.\'. Source: American History; Dec2006, Vol. 41 Issue 5, p4451, 8p Document Type: Article Subject Terms: *GOLD mines & mining *MINERAL industries *HISTORY YUKON Territory Geographic Terms: ALASKA YUKON Territory N... Date Added: 2009-05-21 16:05:56 |
| Lecture1August25or26.pdf Path: University of Illinois, Urbana Champaign >> CHEMISTRY >> 102 Fall, 2009 Description: Chemistry 102 Instructor Office E-mail: Office Hours Website Dr. Erin Elliott 2 Chemistry Annex elelliot@illinois.edu Mondays - 2:00-2:50 pm Tuesdays - 1:00-1:50 pm http:/www.chem.uiuc.edu Required Materials: Chemistry, 7th ed. by Zumdahl Interactiv... Date Added: 2009-05-21 16:07:32 |
| HoNotes1-4.pdf Path: Georgia Tech >> MATH >> 2403 Fall, 2008 Description: Page 1 Section 1.4 Nonhomogeneous Systems Method of variation of parameters We will develope a formula for a particular solution of the system WZ W ! % y (% ] W Suppose a fundamental matrix < (t) has been found so (E) W % y < ! W Following the s... Date Added: 2009-05-21 16:08:23 |
| Respiratory2.ppt Path: Allegheny >> BIO >> 380 Fall, 2009 Description: Fig. 16.4 Fig. 16.21 Fig. 16.14 Fig. 16.15a Fig. 16.15b Fig. 16.15c Fig. 16.29 Fig. 16.25 Fig. 16.26 Fig. 16.30 Fig. 16.16 Fig. 16.33a Fig. 16.33b Fig. 16.36b Fig. 16.38 Fig. 16.39 Fig. 16.40 Fig. 16.34 Fig. 16.35 Fig. 16.37 Fig. ... Date Added: 2009-05-21 16:08:49 |
| HW8.pdf Path: University of Illinois, Urbana Champaign >> ME >> 310 Fall, 2008 Description: ME 310 Introductory Gas Dynamics Spring 2009 Homework #8 Due Date: Friday, April 3, 2009 From the Munson, Young and Okiishi book, do the following problems 1. Problem 6.5 in page 334 2. Problem 6.8 in page 334/335 3. Problem 6.71 in page 342 4. Prob... Date Added: 2009-05-21 16:09:03 |
| 2009Lecture5.pdf Path: Washington >> STAT >> 391 Fall, 2008 Description: The Expectation What would be a good guess for the average of a sequence of observations from the same distribution? A common-sense answer would be a weighted average of the relevant r.v.s values (weighted by probabilities) This is known as the d... Date Added: 2009-05-21 16:09:21 |
| CHEM 172 - Homework 5 Solutions.pdf Path: UCLA >> CHEM >> 172 Fall, 2009 Description: CHEM 172/273 HOMEWORK #5 Key 1. The reaction of CrCl3 with liquid NH3 normally gives [Cr(NH3)5Cl]2+ 2 Cl-. If a trace of KNH2 is present, the main product is [Cr(NH3)6]3+ 3 Cl-. Explain. This is an example of a base catalyzed displacement reaction.... Date Added: 2009-05-21 16:11:22 |
| Exercise_04.docx Path: Coker >> CS >> 111 Fall, 2009 Description: CS111 - Exercise 04 Wednesday and Friday, January 14 and 16, 2009 HW: 1) Read through Chapter 3: Expressions and In teractivity 2) Complete the Exercises starting on Page 145: 1-15, 25, 26, and 27. 3) Page 152, programming challenge, 3 : How Much Ins... Date Added: 2009-05-21 16:13:28 |
| chapter01_1.ppt Path: Coker >> CS >> 110 Fall, 2009 Description: Objectives Learn why today almost everyone is a computer operator Learn about the predecessors of modern computer hardware and software Trace the development of computer hardware and software through several generations Connecting with Computer S... Date Added: 2009-05-21 16:13:30 |
| virtual.ppt Path: Oregon State >> BA >> 457 Fall, 2008 Description: Virtual Supply Chains A Look at Nike Presenters: Owen Tucker Eric Stutzman Michael Kempton Randy Fernando Nick Smith Virtual Supply Chain Defined Any chain (or network) connected through electronic links can be considered virtual. However, a virtua... Date Added: 2009-05-21 16:16:40 |
| Edison and Erorita.ppt Path: Oregon State >> BA >> 493 Fall, 2008 Description: Events, Sponsorships Melody Erorita Event Marketing Event marketing is a promotional occasion designed to attract and involve a brands target audience. Benefits Allows customers to participate in events... Date Added: 2009-05-21 16:18:15 |
| 2003_SalarySurvey.pdf Path: Washington >> TC >> 400 Fall, 2009 Description: $10.00 2003 TECHNICAL COMMUNICATOR SALARY SURVEY 2003 TECHNICAL COMMUNICATOR SALARY SURVEY T he Society for Technical Communication recently surveyed a random sample of its members regarding their current salaries and benefits. Questionnaires w... Date Added: 2009-05-21 16:21:02 |
| EE123_Lec4.pdf Path: Berkeley >> EE >> 123 Fall, 2009 Description: ... Date Added: 2009-05-21 16:22:55 |
| CSE535_02_03.pdf Path: ASU >> CSE >> 535 Fall, 2008 Description: ... Date Added: 2009-05-21 16:23:49 |
| Using and developing on the Android Dev Phone.ppt Path: ASU >> CSE >> 494 Fall, 2008 Description: Using and developing on the Android Dev Phone 1 Setup At the gmail credentials screen, skip the step Go to Settings->Wireless Controls Enable Wi-Fi Go to a google app (gmail, calendar, etc) and then give your @gmail.com credentials Downloa... Date Added: 2009-05-21 16:24:29 |
| v142.pdf Path: University of Hawaii - Hilo >> BOTANY >> 142 Fall, 2009 Description: PACIFIC COOPERATIVE STUDIES UNIT UNIVERSITY OF HAWAI`I AT MNOA Dr. David C. Duffy, Unit Leader Department of Botany 3190 Maile Way, St. John #408 Honolulu, Hawaii 96822 Technical Report 142 HAWAII\'S STATEWIDE AQUATIC WILDLIFE CONSERVATION STRATEGY ... Date Added: 2009-05-21 16:29:43 |
| 08.pdf Path: University of Hawaii - Hilo >> BOTANY >> 135 Fall, 2009 Description: Chapter 4 ASSESSMENT Scope of Assessment In the following chapter the report shifts from reviewing to synthesizing and assessing previous research. In essence, the first section asks the question: What have we learned through these projects about t... Date Added: 2009-05-21 16:30:16 |
| Math1132s09Quiz2.pdf Path: UConn >> MATH >> 1132 Fall, 2009 Description: Name Date Math 1132: Section 9 Quiz 2 Directions: If a particular method is specified to solve the problem, USE that method. Express each answer as an integral only. DO NOT evaluate the integral! (6 pts.) 1. Let R be the region bounded by y = x an... Date Added: 2009-05-21 16:32:53 |
| NWF_MSJ_Reply.pdf Path: Washington >> E >> 597 Fall, 2009 Description: TODD D. TRUE (WSB #12864) ttrue@earthjustice.org STEPHEN D. MASHUDA (WSB #36968) smashuda@earthjustice.org Earthjustice 705 Second Avenue, Suite 203 Seattle, WA 98104 (206) 343-7340 (206) 343-1526 [FAX] DANIEL J. ROHLF (OSB #99006) rohlf@lclark.edu P... Date Added: 2009-05-21 16:34:00 |
| lab6a.pdf Path: Washington >> B >> 536 Fall, 2009 Description: EXAMPLE: MATCHING IN CASE-CONTROL STUDIES Biostat/Epi 536 Discussion Session November 18, 2008 The following is based on a homework assignment from Dr. Norm Breslow\'s Autumn 2006 Biostat/Epi 536 course. A case-control study of esophageal cancer was c... Date Added: 2009-05-21 16:34:16 |
| pab590_syl.doc Path: Washington >> PBO >> 590 Fall, 2009 Description: SYLLABUS Pathobiology 590B/590D*: Scientific Writing Workshop Spring 2008; 4/21/2008 5/9/2008; M/W/F 8:30 9:30 * Students can sign up for the course as either Credit/No Credit (590B) or graded (590D) Course Organizers: Jaisri Lingappa, M.D., Ph.D.,... Date Added: 2009-05-21 16:35:09 |
| HuBio523Tumor ImmunologyFinal 3_3_09.ppt Path: Washington >> LEC >> 523 Fall, 2009 Description: HuBio 523 3/3/09 Tumor Immunology Phil Greenberg 1 Greenberg, 3/3/09 Tumor Immunology Study of the interactions between the immune system and cancer - antigenic properties of tumor cells - host immune response to tumor cells - immunologic impact ... Date Added: 2009-05-21 16:35:20 |
| sols_4.pdf Path: SUNY Purchase >> CS >> 440 Fall, 2009 Description: Introduction to Automata Theory, Languages, and Computation Solutions for Chapter 4 Solutions for Section 4.1 Exercise 4.1.1(c) Let n be the pumping-lemma constant (note this n is unrelated to the n that is a local variable in the definition of the l... Date Added: 2009-05-21 16:36:18 |
| Exam4FA04.pdf Path: Fayetteville State University >> COMM >> 5331 Fall, 2009 Description: COM5331 Exam 4 Part 1: Access December 7th & 9th, 2004 Be sure to do this assignment in the prescribed order. Your test will be graded using the following criteria: accuracy, completeness, appearance. Download an access file called DVDRENTALSTORE ... Date Added: 2009-05-21 16:36:36 |
| syllabus.pdf Path: Washington >> CHEM >> 317 Winter, 2008 Description: Chemistry 317 Inorganic Chemistry Laboratory Spring Quarter 2008 Syllabus Instructor: Professor Michael Heinekey, CHB 304 F, 543-7522, e-mail: heinekey@chem.washington.edu Discussion Sections: (first meeting April 1, 2008) AA, AB & AC sections: discu... Date Added: 2009-05-21 16:39:04 |
| Lect15.ppt Path: Trinity U >> CSCI >> 1320 Fall, 2009 Description: Introduction to Pointers 10-6-2003 Opening Discussion What did we talk about last class? Do you have any questions about the assignment? Loops are critical to this class. Differences between loops and recursion. Making while impersonate dowhi... Date Added: 2009-05-21 16:39:45 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 276 Fall, 2009 Description: tjt 25417:10760:4488:2499... Date Added: 2009-05-21 16:39:54 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 333 Fall, 2009 Description: tjt 25417:10760:4488:2499... Date Added: 2009-05-21 16:39:59 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 451 Fall, 2009 Description: (se 29817,58069,1350,5187 45 56995,5384,1254,2410 69. 41134,58149,1747,4062 ; 8699,51144,1111,298 ? 28325,54623,1000,619 ? 49788,54638,1032,619 a 9342,45569,825,1193 afterwards 7965,41852,778,12349 also 15654,49270,841,4407 and 3810,47412,841,4108 an... Date Added: 2009-05-21 16:40:35 |
| quiz06a.pdf Path: Penn State >> STAT >> 100 Fall, 2008 Description: Quiz#6 Writeyourname,ID 1. ritedownyourheightin W inches. 2. ssumingthatthepopula9on A hasameanof68inchesanda standarddevia9onof4inches, calculateyourZscore(show yourwork). ... Date Added: 2009-05-21 16:43:54 |
| infection2.txt Path: Penn State >> STAT >> 502 Spring, 2008 Description: Hospital Stay InfctRisk Region Age MedSchl 1 7.13 4.1 West 55.7 No 2 8.82 1.6 Central 58.2 No 3 8.34 2.7 South 56.9 No 4 8.95 5.6 West 53.7 No ... Date Added: 2009-05-21 16:44:45 |
| mtb_desc.pdf Path: Penn State >> STAT >> 250 Fall, 2008 Description: Minitab Cheat Sheet for Descriptive Statistics All of the following procedures assume you have already entered your data correctly into one (or more) of the columns in the Minitab Data Window. To produce a one-way distribution table for categorical (... Date Added: 2009-05-21 16:45:18 |
| lab-oct13.doc Path: Penn State >> STAT >> 501 Fall, 2008 Description: Stat 501 Lab Oct. 13 Name _ PSU e-mail _ Use the dataset C-senic.mtw dataset at www.stat.psu.edu/~rho/501data/ For this activity, Y = InfctRisk, the risk of infection at a hospital X1 = Stay, average length of stay at the hospital X2 = Cultures = a... Date Added: 2009-05-21 16:47:02 |
| Hwk4cSol.doc Path: Penn State >> STAT >> 511 Fall, 2008 Description: Statistics 511 Homework 4c Due:Friday Oct. 13 More matrices Fall 2006 1 x1 1 x X = 2 1 x3 1 x 4 0 + 1 x1 + x 0 1 2 a) X= 0 + 1 x3 0 + 1 x 4 b) (AA)-1AY= Y = 0 1 1 A = 1 n1 y1 Y = y n n1 ... Date Added: 2009-05-21 16:47:22 |
| ws2001-french.pdf Path: Columbia >> AH >> 297 Fall, 2009 Description: Nations Unies A/AC.105/766 Distr.: Gnrale 4 dcembre 2001 Franais Original: Anglais Assemble gnrale Comit des utilisations pacifiques de l\'espace extra-atmosphrique Rapport du dixime Atelier Organisation des Nations Unies/Agence spatiale europenne... Date Added: 2009-05-21 16:48:58 |
| Episode_Four.pdf Path: Washington >> HIST >> 472 Fall, 2009 Description: EPISODE IV The Rocket Craze History 217 The Space Age Our Story So Far Two of the founders, Tsiolkovsky and Goddard, were isolated figures: one by necessity and one by choice. Yet in the interwar period, rocketry became organized under government co... Date Added: 2009-05-21 17:58:35 |
| 35020050405.pdf Path: Los Angeles Southwest College >> CSCE >> 350 Fall, 2009 Description: 350 2005-04-05 ... Date Added: 2009-05-21 19:13:37 |
| ABI Register and Stack Usage Essentials.pdf Path: Michigan >> EECS >> 373 Fall, 2005 Description: ABI Register and Stack Usage Convention 2/13/07 Register Usage Register R0 R1 R2 R3 R4 R5 R10 R11 R12 R13 R14 R31 F0 F31 CR2 CR4 CR fields except CR2-CR4 Type Volatile Dedicated Dedicated Volatile Volatile Volatile Dedicated Non volati... Date Added: 2009-05-21 19:16:35 |
| L14Slides.pdf Path: Michigan >> EECS >> 452 Fall, 2008 Description: Lecture 14 Today: Comments relative to projects Continue with IIR filters printed copy of today\'s lecture slides about FIR and IIR filters Handouts: Read: References: Please keep the lab clean and organized. Last one out should close the lab door! ... Date Added: 2009-05-21 19:16:56 |
| EERDproblems.pdf Path: Bentley >> CS >> 350 Fall, 2009 Description: EERD\'s - Chapter 4 1) Farmer brown wants to track information about all of his animals. He wants to know such things as how many eggs per day each chicken lays, how much milk each cow produces, what color of wool each sheep grows and the weight of ea... Date Added: 2009-05-21 19:17:04 |
| conf2.pdf Path: Western Michigan >> STAT >> 561 Fall, 2008 Description: Confidence Region for Compounds Transformed Microwave Oven Data 0.06 q 0 = (0.6,0.06) T2 = 10.1295 P value = 0.0121 2 1 0.04 X = (0.564,0.039) + 0.02 Simultaneous 0.00 0.50 0.52 0.54 0.56 1 0.58 0.60 0.62 ... Date Added: 2009-05-21 19:19:25 |
| hw10prob.doc Path: Auburn >> E >> 6200 Fall, 2009 Description: ELEC 5200-001/6200-001 Computer Architecture and Design Spring 2007 Homework 10 Problems Assigned 4/24/07, due 4/30/07 Problem 1: (a) Consider a processor connected directly to the main memory. Each memory access (read or write) requires 50 cycles. B... Date Added: 2009-05-21 19:20:34 |
| Acetone_results_test.xls Path: Auburn >> MANS >> 486 Fall, 2009 Description: ACETONE 35 f(x) = 0x + 15.26 R = 0.25 30 25 20 Column H Linear Regression for Column H RHS 15 10 5 0 0 10000 20000 30000 40000 50000 60000 70000 80000 90000 time (s) time 0 72 time 0 8398.8 21.55 77580 m (g) m (kg) Delta m (kg) Delta L (m) Zt (... Date Added: 2009-05-21 19:23:04 |
| Semester Reading Guide.xls Path: Idaho >> STATISTICS >> 251 Fall, 2009 Description: Week 1 Week 2 Week 3 Week 4 Week 5 Week 6 Week 7 Week 8 Week 9 Week 10 Week 11 Week 12 Week 13 Week 14 Week 15 Week 16 Week 17 Week 18 Month_week 1_7-11 1_14-18 1_21-25-21 1_28-01 2_4-8 2_11-15 2_18-22-18 2_25-29 3_3-7 3_10-14 3_17-21 3_24-28 3_31-4... Date Added: 2009-05-21 19:23:52 |
| handout2.ps Path: Stanford >> CS >> 348 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.58 Copyright 1986, 1994 Radical Eye Software %Title: hw1.dvi %CreationDate: Mon Jan 23 10:00:23 1995 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Times-Italic %EndComme... Date Added: 2009-05-21 19:24:35 |
| notes_on_using_excel.pdf Path: UMBC >> PHYS >> 112 Fall, 2004 Description: ... Date Added: 2009-05-21 19:24:39 |
| hw1.pdf Path: UMBC >> CS >> 441 Spring, 1995 Description: CMSC 441, section 0101 Spring 2002 Design and Analysis of Algorithms Homework 1 Homework 1, Due Thursday February 7, 60 points total 1. (10 points each) Prove that the following statements are true: (a) 4n 6 n = (n) (b) 7n = O(n!) (c) n1.3 + n lo... Date Added: 2009-05-21 19:26:45 |
| forensicanthro.pdf Path: N. Illinois >> ILAS >> 490 Fall, 2008 Description: 1 ILAS 490: INTRODUCTION TO FORENSIC SCIENCES 2/17/04 FORENSIC ANTHROPOLOGY I. Discipline practiced by physical anthropologists in skeletal analysis, one of the main traditional methods of forensic study A. Assess all aspects of skeletonized human ... Date Added: 2009-05-21 19:27:32 |
| 070729generala.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: From: gw@guardian.co.uk Sent: Friday, August 31, 2007 11:42 PM To: Bove, Roger Even Subject: Majordomo file: list \'guardian-weekly\' file \'gw-international/2007.7.29/8.2.txt\' - Woman dies after 20 years as a male \'general\' / Giles Tremlett The prot... Date Added: 2009-05-21 19:29:18 |
| pres_marking_05.doc Path: Allan Hancock College >> ELEC >> 4707 Fall, 2009 Description: ELEC4707 4th Year Engineering Project 2005 Thesis Presentation Marking Form Student Name:_ Topic Code:_ SID:_ (Students can fill out the above information before the session and hand a copy to each marker) Please circle your decisions, and write ... Date Added: 2009-05-21 19:29:33 |
| NYT_2004_In_a_Word_selections.pdf Path: UVA >> PLAP >> 324 Fall, 2008 Description: Retrieved from Lexis-Nexis The New York Times December 26, 2004 HEADLINE: 2004: In a Word SECTION: Section 4; Column 1; Week in Review Desk THE YEAR OF (YOUR CATCHPRASE HERE) By Charles McGrath IF languages are living things, as the philologists like... Date Added: 2009-05-21 19:30:50 |
| lect.14.SpaceTimeII.pdf Path: Sanford-Brown Institute >> CSCI >> 2560 Fall, 2009 Description: CS256 Applied Theory of Computation Space-Time Tradeoffs II John E Savage Overview Space-time tradeoffs using flow properties Definition of flow properties of functions Flow property of matrix multiplication Grigoriev\'s lower bound Application to co... Date Added: 2009-05-21 19:31:13 |
| s12a.pdf Path: Idaho >> ECE >> 101 Spring, 2008 Description: ECE 101 Intro. to ECE Understanding and Application of the Response of a Series RL Circuit to a Constant Source Voltage Session 12a Part II.B & HW 10 Solution Part II. Inductor Current, V S = Constant, B. Including Resistance t=0 R + vR - i + vL... Date Added: 2009-05-21 19:31:54 |
| A5 sol.pdf Path: Idaho >> ECE >> 101 Spring, 2008 Description: ... Date Added: 2009-05-21 19:32:05 |
| L31.pdf Path: Idaho >> ECE >> 240 Fall, 2008 Description: ECE 240: Session 31; Page 1/5 ECE 240: Lecture 31 Characteristic Equations -The characteristic (next-state) equation for a flip-flop is derived as follows: 1. Construct a truth table that gives Q+ as a function of Q and any other inputs. Treat ille... Date Added: 2009-05-21 19:32:12 |
| yongxing_fastphase.pdf Path: Sanford-Brown Institute >> CS >> 2950 Fall, 2009 Description: Phasing HMM HMM Phasing A Fast and Flexible Statistical Model for Large-Scale Population Genotype Data: Applications to Inferring Missing Genotypes and Haplotypic Phase Yongxing Guo CS295-2 Final Project 20th December 2007 Department of Computer Sc... Date Added: 2009-05-21 19:32:18 |
| SGI_Origin.pdf Path: Evansville >> ECE >> 757 Fall, 2009 Description: The SGI Origin: A ccNUMA Highly Scalable Server James Laudon and Daniel Lenoski Silicon Graphics, Inc. 2011 North Shoreline Boulevard Mountain View, California 94043 laudon@sgi.com lenoski@sgi.com Abstract The SGI Origin 2000 is a cache-coherent non-... Date Added: 2009-05-21 19:32:46 |
| summativeevalwholething.pdf Path: Wisc Stevens Point >> JWRIG >> 119 Fall, 2009 Description: University of Wisconsin - Stevens Point Student / Intern Teaching Summary Evaluation Report Teacher Candidate: Jessica Wright Grade/Subjects Taught: Third Grade School: Roosevelt Elementary School City: Plover Cooperating Teacher: Sherry Terpstra, ... Date Added: 2009-05-21 19:33:13 |
| finalprogress2_mcl208.pdf Path: Penn State >> GEOG >> 208 Fall, 2009 Description: GEOG 586 Geographic Information Analysis- Fall 2008 Michelle Lazar (mcl208) Final Project Part 2 Progress Buck Creek Watershed 0.90 0.80 0.70 0.60 0.50 0.40 0.30 0.20 0.10 0.00 77 7 82 5 83 5 98 3 10 35 11 26 11 54 13 33 14 80 15 83 18 10 18 92 71 ... Date Added: 2009-05-21 19:33:26 |
| finalprogress2_mcl208.pdf Path: Penn State >> GEOG >> 586 Fall, 2009 Description: GEOG 586 Geographic Information Analysis- Fall 2008 Michelle Lazar (mcl208) Final Project Part 2 Progress Buck Creek Watershed 0.90 0.80 0.70 0.60 0.50 0.40 0.30 0.20 0.10 0.00 77 7 82 5 83 5 98 3 10 35 11 26 11 54 13 33 14 80 15 83 18 10 18 92 71 ... Date Added: 2009-05-21 19:33:27 |
| 01-summer_fieldwork_in_the_Sierra_Nevada.pdf Path: UC Davis >> LOG >> 0705 Fall, 2009 Description: Undergraduate research assistant needed: Work in the Sierra Nevada Mountains this summer studying plant ecology! (Cypripedium montanum) Graduate student is seeking a field assistant for a project studying the effects of prescribed fire on two rare ... Date Added: 2009-05-21 19:35:40 |
| 2 - Processes (colorless).pdf Path: Sanford-Brown Institute >> CSCI >> 1380 Fall, 2009 Description: CS 138 Networked Information Systems Uur etintemel Lecture 2: Processes Copyright 2006 1 1 Overview Processes Code Migration 2 Uur etintemel 2 Processes A process is a program with an execution state Process table maintains context for each p... Date Added: 2009-05-21 19:36:25 |
| cred_bal_chk_req.pdf Path: Seattle Pacific >> VERIFY >> 0506 Fall, 2009 Description: Student Financial Services 3307 Third Avenue West Seattle, Washington 98119 Phone: 206-281-2061 Toll Free: 1-800-737-8826 Fax: 206-281-2835 www.spu.edu/sfs Credit Balance Check Request Please allow 24 hours to process your check STUDENT: __ ID: 9_... Date Added: 2009-05-21 19:39:10 |
| equation4_nexted_loop.txt Path: Coker >> CS >> 110 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|03 Oct 2005 17:53:57 -0000 vti_extenderversion:SR|5.0.2.2623 vti_thicketsupportingfile:BW|true ... Date Added: 2009-05-21 19:39:13 |
| lab9.pdf Path: Penn State >> STAT >> 510 Spring, 2008 Description: Stat 510, Lab 9 March 27, 2009 1 In Class Lets look at the Australian labour data which was seen in previous labs. We would like to estimate the spectral density of the data. We may generate the raw periodogram using the following code: labour<-s... Date Added: 2009-05-21 19:39:38 |
| defenseschedule_09.doc Path: Wisconsin >> AOS >> 453 Fall, 2009 Description: CROSS SECTION DEFENSE SCHEDULE Tuesday, March 3rd 1000-Jake Beitlich 1015-Sarah Monette 1030- Melissa Peterson 1045- Michael Phillips 1100111511301145- Joe Zagrodnik 1200- Hunter Straus 1215- Dianelle Triolo 1230- Joe Hoechst 1245- Bryan Heth Thursda... Date Added: 2009-05-21 19:40:42 |
| wifi-deluxe2.pdf Path: FAU >> ISM >> 4220 Fall, 2008 Description: Smart Buildings: A Look into the Future By: Group Wi-Fi Deluxe Geoffrey Gross Scott McDermott Charles Rayside For: Professor J. Goo ISM 4220 November 22, 2006 Executive Summary A building should create a productive and profitable environment. It s... Date Added: 2009-05-21 19:41:03 |
| proposal_DRAFT.doc Path: NJIT >> ENG >> 275 Fall, 2009 Description: WHAT IS YOUR FINANCIAL FUTURE? Empowering our youth for financial gain Dear Ernest P. Lepore: NJ Department of Education PO Box 500 Trenton, NJ 08625-0500 The Edgewater Banking Center of Bank of America (the bank) is proposing the idea to the high s... Date Added: 2009-05-21 19:44:02 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 05102646 Fall, 2009 Description: ... Date Added: 2009-05-21 19:44:26 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 05102646 Fall, 2009 Description: ... Date Added: 2009-05-21 19:44:26 |
| ee434rpt_grd.pdf Path: Maryland >> EE >> 434 Spring, 2002 Description: file: c:\\temp\\courses\\spring2006\\434\\ee434rpt_grd.doc RWN 04/14/06 ENEE 434 Base Paper Report Grading Form Student: Paper Title: Base Paper: 1. Historical framework; 10 points 2. Comprehension and intuitive explanation of neural network operation; ... Date Added: 2009-05-21 19:44:53 |
| 06.txt Path: CSU San Bernardino >> CS >> 489 Fall, 2009 Description: .Open 06 .Open Vilayvone Khousakoun - AJAX - Asynchronous JavaScript and XML How to use AJAX. Pearson Education AdobePress 2008 .See http:/www.adobepress.com/articles/article.asp?p=425820&seqNum=9 Almost all resources used were articles. The info... Date Added: 2009-05-21 19:48:12 |
| SexDifs.xls Path: Texas >> PSY >> 394 Fall, 2009 Description: Aging Aging Aging Aging NZ 98 NZ 98 Suzy EAR Lori Lori Sample Adjusted Emotion writing Control writing Emotion talking write Emo Control write Natur talk Who am SOC write I write Text/person 3.8 3.8 3.8 3.8 3 3 2 1 1 N 1841 935 434 368 33 33 20 27 35... Date Added: 2009-05-21 19:48:14 |
| Loftus Make-believe.pdf Path: Texas >> PSY >> 394 Fall, 2009 Description: Loftus, E. F., Ketcham, K. (1994). The myth of repressed memory. New York: St. Martin\'s Press. Loftus, E. F., & Loftus, G. R. (1980). On the permanence of s... Date Added: 2009-05-21 19:49:15 |
| 212b.txt Path: Texas >> PSY >> 394 Fall, 2009 Description: Hmm, nope. No, I didn\'t take your dollar. I sat and I sat and I sat some more, cause I thought someone was coming in there to get me soon. So, I just sat. Um there\'s a bunch of TVs and VCRs across one wall; the back wall is all psychology manuals... Date Added: 2009-05-21 19:49:40 |
| Williams -Rec Mems.pdf Path: Texas >> PSY >> 394 Fall, 2009 Description: ... Date Added: 2009-05-21 19:50:06 |
| Turner94.pdf Path: Texas >> PSY >> 394 Fall, 2009 Description: Page 14 of 14 http:/spider.apa.org/ftdocs/ccp/1994/april/ccp622350.html 10/8/2000 Page 13 of 14 Neuropsychopharmacology, 2, 2129.) Versiani, M., Nardi, A. E., Mundim, F. D., Alves, A. B., Liebowitz, M. R. & Amrein, R. (1992). Pharmacotherapy of s... Date Added: 2009-05-21 19:50:10 |
| ISM50_lecture9_slides.pdf Path: UCSC >> ISM >> 050 Fall, 2009 Description: ISM 50 - Business Information Systems Lecture 9 Instructor: John Musacchio UC Santa Cruz May 2, 2006 Class announcements Assignment 3 due Thursday Reading for next class Messerschmitt Ch 5, Sun Case Suggestion: Read Messerschmitt Ch5 first. Student... Date Added: 2009-05-21 19:52:52 |
| ISM50_lecture14_handouts.pdf Path: UCSC >> ISM >> 050 Fall, 2009 Description: Class announcements ISM 50 - Business Information Systems Lecture 14 Instructor: John Musacchio UC Santa Cruz May 18, 2006 Assignment 4 out! Due next Tuesday (May 23) Reading for Tuesday (May 23): MySQL Database Case Student Presentations Tuesday (n... Date Added: 2009-05-21 19:52:53 |
| thall_FinalExam.pdf Path: Santa Clara >> ENGR >> 019 Fall, 2009 Description: ENGR019/301 Thursday, March 11, 2004 Final Exam Winter 2004 This exam should take you approximately 2 hours to complete. Do not make it your weeks work. Do not stress over it. Relax, grab a soda and something to eat, sit down, spend 2 hours and be... Date Added: 2009-05-21 19:55:31 |
| sjackson_hw14.pdf Path: Santa Clara >> COEN >> 001 Fall, 2009 Description: 85 Spencer Jackson CO EN 001 November 7, 2002 Ch. 14 1.) The conversations from Los Angeles to New York and one side of Los Angeles to the other are not significantly impaired by the speed of light. However, the conversation from New York to Tokyo ... Date Added: 2009-05-21 19:56:05 |
| Group_01_UseCase.pdf Path: Santa Clara >> GROUP >> 120 Fall, 2009 Description: Pump Report on Configuration DefaultConfig PACKAGES Pump The money eater accepts cash or credit from the customer. If the customer chooses credit then it talks to the bank to verify their eligibility to get gas. USE CASE DIAGRAMS: The use case. Bla... Date Added: 2009-05-21 19:57:14 |
| Mapping Robots.ppt Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: Mapping Robot Bernard Farrales and Francis Chan School of Computer Engineering Santa Clara University, Santa Clara CA Introduction OBJECTIVE To map a room using Activemedia\'s Amigobot Software Objectives Autonomous navigation in ... Date Added: 2009-05-21 19:57:30 |
| MMarzullo_Proposal.pdf Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: Matt Marzullo Coen 120 1/24/2002 I would like to design an embedded system that could be used in a green house. For many years my grandparents have raised orchids as a pastime, essentially trying to create the perfect climate for the plant,but indoo... Date Added: 2009-05-21 19:58:37 |
| tetra.ps Path: Kentucky >> MA >> 341 Fall, 2008 Description: %!PS-Adobe-2.0 %Title: tetra.ms - [Server 1] %Creator: Maple V Release 4 HP RISC UNIX %DocumentFonts: Times-Roman Courier Times-Italic Symbol Times-Bold %Pages: 2 %EndComments % /sc { setrgbcolor } def % color % /stc { setrgbcolor } def % color /sc {... Date Added: 2009-05-21 20:00:13 |
| Homework6.doc Path: Harvard >> COMP >> 231 Fall, 2009 Description: Wentworth Institute of Technology Division of Professional and Continuing Studies COMP231 Section 71 - Computer Programming with Java I - Summer, 2002 Homework Number 6 - Poker Hand Instructor: Bob Goldstein (617) 912-2592 bobg@vision.eri.harvard.ed... Date Added: 2009-05-21 20:00:15 |
| x119bb.pdf Path: Texas >> X >> 117 Fall, 2009 Description: methyl octalindione F2 (ppm) 1.6 1.8 2.0 2.2 2.4 2.6 2.8 3.0 3.0 2.8 2.6 2.4 2.2 F1 (ppm) 2.0 1.8 1.6 1.4 1.2 ... Date Added: 2009-05-21 20:00:29 |
| Diagram of Process Emulator.ppt Path: Oregon State >> CHE >> 415 Winter, 2008 Description: Process Emulator Data Processing Device (Computer) Pneumatic Controller Pressure Transducer Manual Valve Control Box Pump Water Tank ... Date Added: 2009-05-21 20:00:39 |
| problemset8.pdf Path: Texas >> EE >> 362 Fall, 2008 Description: The University of Texas at Austin Department of Electrical and Computer Engineering EE362K: Introduction to Automatic Control-Spring 2009 Problem Set Eight C. Caramanis Due: Wednesday, April 1, 2009. This problem set focuses on the new concepts intr... Date Added: 2009-05-21 20:01:33 |
| lecture 8 cont.pdf Path: Arizona >> AREC >> 514 Fall, 2008 Description: Welfare Effects of Sales Tax (Distortion) P CS0=abc a S PC f P c Pp h PS0=cbd B0=0 CS1=aef e b Unit Tax D d Q Q D Q PS1=hgd B1=fehg CS=-febc PS=-cbgh B=+fehg Net=-ebg g ... Date Added: 2009-05-21 20:01:47 |
| lec7-2.pdf Path: George Mason >> INFS >> 767 Fall, 2009 Description: Binding Identities and Attributes Using Digitally Signed Certificates Joon S. Park, NRL/ITT Ravi Sandhu, George Mason Univ. Introduction n In this paper, we Analyze the basic structure of digital certificates and classify the nature of the informa... Date Added: 2009-05-21 20:06:19 |
| MATH5180-syl.pdf Path: Valdosta >> MATH >> 3180 Fall, 2008 Description: MATH 5180 Mathematics for Middle School Teachers 3.0 Semester Hours (3-0-3) Department of Mathematics and Computer Science College of Arts and Sciences Valdosta State University Instructor Office Phone Email Office Hours Options Section A: TR 9:30-... Date Added: 2009-05-21 20:08:54 |
| MEB_Pump-Turbine_Example.pdf Path: Rose-Hulman >> ES >> 202 Fall, 2009 Description: ... Date Added: 2009-05-21 20:09:51 |
| doc.pdf Path: BYU >> HASH >> 2507 Fall, 2009 Description: N. LAMM THE JEWISH CENTER \"A DEFINITION OF ANIVUT\" BEHAALOTEKHA June 8 , 1 9 6 3 Our Sidra of this morning introduces us,rather casually and incidentally, to one of the most important and highly celebrated virtues^ in the arsenal of religion^that o... Date Added: 2009-05-21 20:10:56 |
| ch5.ppt Path: University of Montana >> CS >> 344 Fall, 2008 Description: Chapter 5: Threads s Overview s Multithreading Models s Threading Issues s Pthreads s Solaris 2 Threads s Windows 2000 Threads s Linux Threads s Java Threads Operating System Concepts 5.1 Silberschatz, Galvin and Gagne 2002 Single and Multithre... Date Added: 2009-05-21 20:10:57 |
| 20UnitConversionI.pdf Path: Cardinal Stritch >> CED >> 519 Fall, 2009 Description: ASSIGNMENT _ NAME _ HOUR _ UNIT CONVERSION WORKSHEET I SOLVE THE FOLLOWING USING THE FACTOR LABEL METHOD (DIMENSIONAL ANALYSIS). SHOW YOUR SETUP BELOW THE PROBLEM. PUT THE ANSWER ON THE BLANK. PLEASE BE SURE TO COMPLETE BOTH SIDES OF THIS WORKSHEET... Date Added: 2009-05-21 20:12:06 |
| CS240A01.ppt Path: UCSB >> CS >> 240 Fall, 2009 Description: CS 240A Applied Parallel Computing John R. Gilbert gilbert@cs.ucsb.edu http:/www.cs.ucsb.edu/~cs240a Thanks to Kathy Yelick and Jim Demmel at UCB for use of their slides. Why do we need powerful computers? Simulation: The Third Pillar of Science T... Date Added: 2009-05-21 20:12:25 |
| firstmidtermfall2000.doc Path: Wisconsin >> ECON >> 330 Fall, 2008 Description: Economics 330 First Midterm Lecturer: Elizabeth Kelly October 2, 2000 INSTRUCTIONS: 1. Put your name, UW ID number, and discussion section on each of the two bluebooks. 2. Write \"short answers\" on the cover of one bluebook. 3. In this bluebook, ans... Date Added: 2009-05-21 20:12:41 |
| 0815.4.K.pdf Path: Caltech >> PH >> 136 Fall, 2009 Description: Contents 15 Waves and Convection 15.1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . 15.2 Gravity Waves on the Surface of a Fluid . . . . . . . 15.2.1 Deep Water Waves . . . . . . . . . . . . . . . 15.2.2 Shallow Water Waves . . . . . . .... Date Added: 2009-05-21 20:12:47 |
| Hand08S301.pdf Path: Wisconsin >> ST >> 301 Fall, 2008 Description: STATISTICS 301 Spring 2008 INSTRUCTOR: OFFICE: OFFICE HOURS: R. Johnson 1217 MSC 2:15-3:25 MW Web address www.stat.wisc.edu Click of Department, click on Courses, click on Spring 2008 course listing. Finally, click on Stat301-005. TA: Qi Tang qita... Date Added: 2009-05-21 20:13:17 |
| prog2_output3.txt Path: UCSB >> CS >> 130 Fall, 2009 Description: (1,2) : Added to MST. (1,1) : Self-loop. (2,3) : Added to MST. (1,3) : Not added to MST due to a cycle. (6,5) : Added to MST. (5,-4): Invalid node ID. (3,4) : Added to MST. (5,7) : Added to MST. Program Terminated! MST not Found ... Date Added: 2009-05-21 20:14:32 |
| Lecture26.4up.pdf Path: Wisconsin >> CS >> 701 Fall, 2008 Description: We\'ll need some standard data flow analyses we\'ve seen before: AvIni = Available In for block i = 0 (false) for b0 = AND AvOutp p Pred(i) We anticipate an expression if it is very busy: AntOuti = VeryBusyOuti = 0 (false) if i is an exit block = AND... Date Added: 2009-05-21 20:15:13 |
| Our Lady of Assumption Schenectady.pdf Path: Nazareth >> DOCS >> 20052006 Fall, 2009 Description: JustinoFlores Res101 Dr.Shafiq IhavebeengoingtothesamechurcheveryweeksinceImovedtoNewYorkat theageoffive.However,Ineverwenttherebeforeforthepurposeofresearch.Ilearned someveryinterestingstuffaboutmychurchthatIneverknewbefore,andIgottoknow mypastoral... Date Added: 2009-05-21 20:15:33 |
| qz3f00.pdf Path: Wisconsin >> ECE >> 352 Fall, 2008 Description: Last (family) name: _ First (given) name: _ Student I.D. #: _ Circle section: Kaminski Hu Department of Electrical and Computer Engineering University of Wisconsin - Madison ECE/CS 352 Digital System Fundamentals Quiz #3 Thursday, November 16, 2000... Date Added: 2009-05-21 20:15:42 |
| 5311_ExamTips2.doc Path: UMDNJ >> BINF >> 5311 Fall, 2009 Description: Question 1 Look at the information in the following UML class diagram for the MonsterTruck class. MonsterTruck Color color boolean running int Cylinders void start () void stop () (a) (b) (c) Write the source code for MonsterTruck Class, including ... Date Added: 2009-05-21 20:16:48 |
| lecture4.ppt Path: UMDNJ >> BINF >> 5220 Fall, 2009 Description: Outline Quick Review Drug Design Process Server Client UNIX Secure Protocol SSH/SFTP How to start SYBYL VNC Cygwin/Xfree86 Lecture 4 UMDNJ - School of Health Re... Date Added: 2009-05-21 20:18:20 |
| lecture4.ppt Path: UMDNJ >> LECT >> 5220 Fall, 2009 Description: Outline Quick Review Drug Design Process Server Client UNIX Secure Protocol SSH/SFTP How to start SYBYL VNC Cygwin/Xfree86 Lecture 4 UMDNJ - School of Health Re... Date Added: 2009-05-21 20:18:20 |
| HIPAA_factsheet.pdf Path: UMDNJ >> BINF >> 5075 Fall, 2009 Description: 2001.07.06: (Fact Sheet) Protecting the Privacy of Patients\' Health Information July 6, 2001 Contact: HHS Press Office (202) 690-6343 PROTECTING THE PRIVACY OF PATIENTS\' HEALTH INFORMATION Overview: Each time a patient sees a doctor, is admitted t... Date Added: 2009-05-21 20:18:50 |
| HW7.pdf Path: UCSB >> PHYS >> 110 Fall, 2009 Description: Phys 110B: Problems for HW 7 C. Gwinn February 12, 2009 1 HW7 Problem 1 A large piece of iron has uniform magnetization M = M0 z . Inside the iron, far from any surface, the magnetic eld is B = 0 M . No free currents or other magnetized objects a... Date Added: 2009-05-21 20:20:42 |
| aov2.ps Path: Penn State >> STAT >> 401 Fall, 2008 Description: ... Date Added: 2009-05-21 20:22:02 |
| VersionsXilinx2004.pdf Path: Sanford-Brown Institute >> EN >> 163 Fall, 2009 Description: Xilinx Software Engineering 163: Fall 2004 10/9/2004 Version Issues with Xilinx Software in Engineering 163 Fall 2004 You will need to use the Xilinx ISE software package to program the XC9572XL CPLDs used in labs 3, 4, 5, 7, A, and B and to prog... Date Added: 2009-05-21 20:23:39 |
| Activity3.5.doc Path: Penn State >> STAT >> 401 Fall, 2008 Description: Stat 401 Lab 4 I. Fall 2004 A Comparison of Confidence Intervals Overview the symmetric of different distributions: Normal (0,1), logistic (0,1), t-2, laplace (0,1), Cauchy (0,1) and lognormal (0,1,0). 1. Generate pattern data for different distrib... Date Added: 2009-05-21 20:23:44 |
| handout_Exam_Answers_Key_-_Test 2.pdf Path: Washington >> CHEM >> 221 Spring, 2008 Description: ... Date Added: 2009-05-21 20:24:37 |
| Lance Allred.doc Path: Penn State >> EYK >> 5003 Fall, 2009 Description: Lance Allred at Penn State By Eden Kassa The first deaf NBA player spoke to about fifty Penn State students and staff Monday morning, September 22, at the Bryce Jordan Center. Cleveland Cavalier\'s Lance Allred addressed many topics including his st... Date Added: 2009-05-21 20:25:16 |
| Evan_Barna Resume.doc Path: Penn State >> EWB >> 5000 Winter, 2009 Description: Evan W. Barna 209 Ridge Road Sewickley, PA 15143 (412) 334 9476 ewb5000@psu.edu Objective: Education: To obtain a summer internship in Plastics Engineering. Penn State, The Behrend College, Senior Bachelor of Science in Plastic Engineering Technolo... Date Added: 2009-05-21 20:25:18 |
| 6.ppt Path: Delaware >> ELEG >> 240 Fall, 2008 Description: Electrical Oscillator: Natural Response Q-factor Harmonically Driven Motion http:/www.phys.hawaii.edu/~teb/java/ntnujava/springWave/springWave.html General Forced LCR Oscillator ... Date Added: 2009-05-21 20:25:48 |
| dtn091304.pdf Path: George Mason >> NCLC >> 244 Fall, 2008 Description: Beats, Rhyme and Culture Droppin the Needle September 13, 2004 (spoken) I shall not fear no man but God Though I walk through the valley of death I shed so many tears (if I should die before I wake) Please God walk with me (grab a nigga and take me t... Date Added: 2009-05-21 20:29:58 |
| feinter.pdf Path: George Mason >> ECON >> 310 Fall, 2008 Description: ECON 310 009 Money & Banking Fall 2001 J. Scott Sperling jsperlin@gmu.edu Foreign Exchange Intervention Central banks engage in international transactions by buying foreign denominated assets and selling their currency or by selling foreign assets ... Date Added: 2009-05-21 20:30:03 |
| lecture_04.2009_orographic_precip.ppt Path: Wisconsin >> AOS >> 453 Fall, 2009 Description: II. Local Mesoscale Circulation Systems Upslope Precipitation Orographically enhanced Convection Downslope Wind Storms Upslope Precipitation Simple Orographic Storms Cold-Air Damming Upslope Systems Orogenic Convection Neutral Atmosphere Con... Date Added: 2009-05-21 20:33:10 |
| lect25.pdf Path: Lincoln U. CA >> BIOL >> 4415 Fall, 2009 Description: Lichens: associations between a phycobiont (an alga; usually a green alga but occasionally something else) and a mycobiont (a fungus, usually an ascomycete) Symbiosis in Evolution BIOL 4415 Its sometimes possible to cultivate a lichen fungus and it... Date Added: 2009-05-21 20:33:15 |
| 00000030.pdf Path: Carnegie Mellon >> TERA >> 05102233 Fall, 2009 Description: ... Date Added: 2009-05-21 20:34:57 |
| 00000030.pdf Path: Carnegie Mellon >> DISK >> 05102233 Fall, 2009 Description: ... Date Added: 2009-05-21 20:34:57 |
| hw19.pdf Path: Oregon State >> PH >> 202 Winter, 2008 Description: Ph202H/212H W09 Homework due March 4, 2009 1. Two large parallel sheets of charge with uniform charge densities are separated by a distance that is small compared with their dimensions. One sheet carries a positive charge density of +6.8 C/m2, and... Date Added: 2009-05-21 20:37:11 |
| murphy.txt Path: Penn State >> LA >> 283 Fall, 2009 Description: These were contributed by Kurt Tappe for your enjoyment: _ MURPHY\'S COMPUTER LAWS - 1 2 Murphy Never Murphy Would Would Have ... Date Added: 2009-05-21 20:42:54 |
| 12-06.doc Path: UMass Lowell >> FACULTY >> 192 Fall, 2009 Description: TODAY: Reciprocity: The Ehrhart summation convention The polytope reciprocity theorem Application to binomial coefficients Application to Stirling numbers Application to chromatic polynomials Domino-tiling reciprocity Mention Yuval Peres\' talk at 4:3... Date Added: 2009-05-21 20:59:40 |
| amd-mmx.pdf Path: Washington University in St. Louis >> CS >> 306 Fall, 2009 Description: Advance Information AMD-K6 Processor Multimedia Extensions (MMX) Publication # 20726 Issue Date: July 1996 Rev: A Amendment/0 This document contains information on a product under development at Advanced Micro Devices (AMD). The information is i... Date Added: 2009-05-21 21:04:55 |
| polar.pdf Path: Oregon State >> MTH >> 254 Winter, 2008 Description: ... Date Added: 2009-05-21 21:11:01 |
| polar.pdf Path: Oregon State >> MTH >> 255 Fall, 2008 Description: ... Date Added: 2009-05-21 21:11:01 |
| Starting-BB6.pdf Path: Eastern Washington University >> CSCD >> 327 Fall, 2009 Description: NEW FOR FALL 2003 GETTING STARTED WITH Enrolling in a Blackboard Course Every time you log on to Blackboard the My Blackboard screen will appear. Here you will find a listing of all of the on-line Blackboard courses that you are currently involved ... Date Added: 2009-05-21 21:20:07 |
| MACM101C01.TXT Path: Sveriges lantbruksuniversitet >> APSC >> 20023 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: MACM 101-3 C01 TITLE: DISCRETE MATH I SEMESTER: 2002-3 LOCATION: SFU SECTION TYPE: SEC ENROL: 35 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown se... Date Added: 2009-05-21 21:27:47 |
| v03.n231.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Digest V3 #231 Reply-To: cdn-firearms-digest@sfn.saskatoon.sk.ca Sender: owner-cdn-firearms-digest@sf... Date Added: 2009-05-21 21:27:56 |
| v03.n231.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Digest V3 #231 Reply-To: cdn-firearms-digest@sfn.saskatoon.sk.ca Sender: owner-cdn-firearms-digest@sf... Date Added: 2009-05-21 21:27:56 |
| 327ass1b.doc Path: Allan Hancock College >> ITC >> 327 Fall, 2009 Description: ... Date Added: 2009-05-21 21:28:18 |
| Reflective_writing_guide_S12005.doc Path: Allan Hancock College >> ENG >> 1101 Fall, 2009 Description: Page 1 of 20 Page 2 of 20 Aim.3 Introduction..3 Completion checklist and time lines.3 Assessment guidelines..4 Submission Information.4 About Problem Based Learning..4 What is reflection?.7 Why reflect - what are the benefits to the student?.8 How ... Date Added: 2009-05-21 21:28:39 |
| paterson-2004.doc Path: Allan Hancock College >> FET >> 8602 Fall, 2009 Description: Karyn Paterson d1111385 FET8602 Assignment 3 Proposal to Evaluate The Level 2 Registered Nurse Clinical Management Program Princess Alexandra Hospital February 2005 2 TABLE OF CONTENTS 1.0 Introduction 1.1 Need for Evaluation 1.2 Aims of the Eval... Date Added: 2009-05-21 21:28:47 |
| SNMP.ppt Path: Allan Hancock College >> CPE >> 5013 Fall, 2009 Description: Simple Network Management Protocol Ref: \"SNMP.\" by Stallings (Chapter 4+) MIB data is input in encoded form. Information is then compiled into the central MIB in the NCS. 28/04/09 CPE5013 (c) Monash University 2 Manageable Devices Router Br... Date Added: 2009-05-21 21:29:04 |
| SNMP.ppt Path: Allan Hancock College >> WEEK >> 5013 Fall, 2009 Description: Simple Network Management Protocol Ref: \"SNMP.\" by Stallings (Chapter 4+) MIB data is input in encoded form. Information is then compiled into the central MIB in the NCS. 28/04/09 CPE5013 (c) Monash University 2 Manageable Devices Router Br... Date Added: 2009-05-21 21:29:04 |
| vanguard.txt Path: Allan Hancock College >> INFO >> 1903 Fall, 2009 Description: 2006-03-30 2.0392 2.0330 2006-03-29 2.0293 2.0231 2006-03-28 2.0275 2.0213 2006-03-27 2.0281 2.0219 2006-03-24 2.0068 2.0006 2006-03-23 2.0046 1.9984 2006-03-22 1.9963 1.9903 2006-03-21 1.9877 1.9817 2006-03-20 1.9904 1.9844 2006-03-17 1.9792 1.9732 ... Date Added: 2009-05-21 21:29:34 |
| Week10_2.ppt Path: Allan Hancock College >> NETS >> 3303 Fall, 2009 Description: IP Quality of Service NETS3303/3603 Weeks 10-11 School of Information Technologies Outcomes Understanding components of IP QoS What they do Why they are used or proposed Have knowledge of some case study technologies Understanding the relevan... Date Added: 2009-05-21 21:29:51 |
| 13hierarchical_glimmix.doc Path: UCLA >> BIOSTAT >> 411 Fall, 2008 Description: Random Effect Models: Bernoulli, Poisson and continuous outcomes. * Dichotomizing soma and creating a positive integer-valued variable; data bsi2; set bsi; somabinary = 0; if bsi_soma >0 then somabinary = 1; somainteger = bsi_soma*7; run; title glimm... Date Added: 2009-05-21 21:31:36 |
| test1Normal.txt Path: Allan Hancock College >> ASSIGNMENT >> 1002 Fall, 2009 Description: add MtewyEwurJPKlMdyIMYw contains u getcompletions fa contains Uf contains scEp add HwdFantzo add JYeTimTKwsxEdBlTb ... Date Added: 2009-05-21 21:33:16 |
| test1Normal.txt Path: Allan Hancock College >> SOFT >> 1002 Fall, 2009 Description: add MtewyEwurJPKlMdyIMYw contains u getcompletions fa contains Uf contains scEp add HwdFantzo add JYeTimTKwsxEdBlTb ... Date Added: 2009-05-21 21:33:16 |
| ims1907tutorial10ss.doc Path: Allan Hancock College >> IMS >> 1907 Fall, 2009 Description: IMS1907 Tutorial 10, Summer Semester, 2004/5 Monash University School of Information Management and Systems IMS1907 Database Systems Summer Semester 2004/5 Tutorial 10 Structured Query Language (SQL) Tutorial Objectives to develop an understanding... Date Added: 2009-05-21 21:33:45 |
| jdf.sydney2003.ppt Path: Allan Hancock College >> IAU >> 221 Fall, 2009 Description: The Structures and Kinematics of Protoclusters James Di Francesco (NRC-HIA) IAU Symposium 221 Sydney, Australia July 23, 2003 Defining Protoclusters Most stars form within clustered environments (e.g., Lada ... Date Added: 2009-05-21 21:33:47 |
| hrcorb2003425.txt Path: Allan Hancock College >> HRCORB >> 2003425 Fall, 2009 Description: 2002-2003 The Parliament of the Commonwealth of Australia HOUSE OF REPRESENTATIVES Presented and read a first time HIH Royal Commission (Transfer of Records) Bill 2003 No. , 2003 (Treasury) A Bill for an Act to provide for ... Date Added: 2009-05-21 21:34:19 |
| grapb2007399.txt Path: Allan Hancock College >> GRAPB >> 2007399 Fall, 2009 Description: PARLIAMENT OF VICTORIA Gambling Regulation Amendment (Review Panel) Bill 2007 TABLE OF PROVISIONS Clause Page 1 Purpos... Date Added: 2009-05-21 21:34:38 |
| Week1.doc Path: Allan Hancock College >> COIT >> 13143 Fall, 2009 Description: # #ZnC#Week1.doc#[M $GV] p xL8#^,uy{#wY#1=;n deFUtVf:V{OnX#[s#B X#7aL#@#0#$k v{# Y5#[#p=Y0# #O#ckL[?| r w #h]# <yB# 7\']+ j7/Z_V+ #\'[#|{^CZ#_R ZoWl^mCK#wO H7#6(oL)h[ s#o_ # Z.j=LW^k>ky { %krQxk 1:#w#ykG\\j^# 6yy HN/Zy7Yjmf#rqLk5#w?A#iq# /}vN7Z {u%G... Date Added: 2009-05-21 21:35:04 |
| mar20052n76o2005417.txt Path: Allan Hancock College >> MAR >> 20052 Fall, 2009 Description: [pic] Migration Amendment Regulations 2005 (No. 2)1 Select Legislative Instrument 2005 No. 76 I, JOHN LANDY, Administrator of the Commonwealth of Australia, acting with the advice of the Federal Executive Council, make the foll... Date Added: 2009-05-21 21:35:09 |
| AlgebraReviewS09soln.pdf Path: Minnesota >> ZIMM >> 0230 Fall, 2009 Description: ... Date Added: 2009-05-21 21:38:47 |
| Quiz1KeySp09.pdf Path: IUPUI >> CHEM >> 101 Fall, 2008 Description: ... Date Added: 2009-05-21 21:38:49 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 381 Fall, 2009 Description: 72 60746:60202:815:513 a 54888:14438:891:790 50227:22516:509:493 48724:21311:509:493 accomplishments 44369:23701:9831:513 acquainting 49437:13509:6698:691 all 34257:13509:1095:493 23789:17065:1120:493 already 44292:17065:4279:730 among 35480:23425:42... Date Added: 2009-05-21 21:40:24 |
| Chapter2SG.doc Path: Frostburg >> MCOM >> 105 Fall, 2008 Description: MCOM 105 - Chapter 2 Study Guide ~ Perspectives on Mass Communication Role of mass communication: Functions of Mass Communication for Society Macroanalytic view: Surveillance: Interpretation: Linkage: Transmission of Values: Entertainment: Microanal... Date Added: 2009-05-21 21:40:26 |
| federal.doc Path: Iowa State >> MR >> 0615 Fall, 2009 Description: Des Moines Register 06-11-07 Federal grants give a lift to small Iowa businesses Government to offer more than $2.2 billion this year to research and develop products By PATT JOHNSON REGISTER BUSINESS WRITER Steve Shivvers\' chance at making a differe... Date Added: 2009-05-21 21:40:42 |
| federal.doc Path: Iowa State >> PUBLIC >> 0615 Fall, 2009 Description: Des Moines Register 06-11-07 Federal grants give a lift to small Iowa businesses Government to offer more than $2.2 billion this year to research and develop products By PATT JOHNSON REGISTER BUSINESS WRITER Steve Shivvers\' chance at making a differe... Date Added: 2009-05-21 21:40:42 |
| ee2303T.doc Path: UT Arlington >> EE >> 2303 Fall, 2008 Description: SYLLABUS EE2303 Electronics I SPRING 2002 8:00 - 9:20 AM, TUESDAY, THURSDAY NEDDERMAN HALL, ROOM 105 Instructor: Wei-Jen Lee, Ph.D., PE Professor of the Electrical Engineering Office: ENGINEERING ANNEX, RM 204 Office Hours: 9:30 AM 11:00 AM, TUESDAY... Date Added: 2009-05-21 21:40:51 |
| The Final Push!.ppt Path: Idaho >> PLSC >> 470 Fall, 2008 Description: The Final Push! The President\'s Residence The Frostad Landscape Heres what we gonna do! Class Project so; Whole class participates Presidents Residence Power point presentation to President Michael At facilities conference room Thursday Dece... Date Added: 2009-05-21 21:40:54 |
| ps1.pdf Path: Harvard >> CS >> 225 Fall, 2009 Description: CS 225: Pseudorandomness Problem Set 1 Assigned: Tue. Feb. 3, 2009 Prof. Salil Vadhan Due: Wed. Feb. 18, 2009(1 PM) Recall that your problem set solutions must be typed. You can email your solutions to cs225-hw@eecs.harvard.edu, or turn in it to ... Date Added: 2009-05-21 21:41:20 |
| CabriJrInvestigation.pdf Path: N. Arizona >> SMG >> 224 Fall, 2009 Description: Cabri Jr. Investigation Cabri and Cabri Jr. are dynamic geometry software programs (similar to Sketchpad). Cabri Jr. is specifically designed to be used on TI graphing calculators. For class on Tuesday April 29, you will need to complete the attached... Date Added: 2009-05-21 21:42:50 |
| AC230JK_syl08s.pdf Path: CUNY Baruch >> AC >> 230 Fall, 2009 Description: AC 230 JK Teaching with Multimedia Technology Spring 2008, Academic Computing, York College, CUNY Danyang (Dan) Zhang Office: 4G04c Phone: (718)262-2749 E-mail: dzhang@york.cuny.edu Website: http:/www4.york.cuny.edu/~dzhang/ac230.htm Time: M, W 4:00-... Date Added: 2009-05-21 21:43:42 |
| 00000010.pdf Path: Carnegie Mellon >> TERA >> 05100971 Fall, 2009 Description: ... Date Added: 2009-05-21 21:48:28 |
| 00000010.pdf Path: Carnegie Mellon >> DISK >> 05100971 Fall, 2009 Description: ... Date Added: 2009-05-21 21:48:28 |
| 00000015.pdf Path: Carnegie Mellon >> TERA >> 05102090 Fall, 2009 Description: ... Date Added: 2009-05-21 21:49:12 |
| 00000015.pdf Path: Carnegie Mellon >> DISK >> 05102090 Fall, 2009 Description: ... Date Added: 2009-05-21 21:49:12 |
| 00000034.pdf Path: Carnegie Mellon >> TERA >> 05102745 Fall, 2009 Description: ... Date Added: 2009-05-21 21:50:37 |
| 00000034.pdf Path: Carnegie Mellon >> DISK >> 05102745 Fall, 2009 Description: ... Date Added: 2009-05-21 21:50:37 |
| s10b.pdf Path: Idaho >> ECE >> 504 Spring, 2008 Description: ECE 504 Law, J.D. & A.S. PSS Spring 2007 Session 10b Page 1/3 S TEADY S TEADY, DQ , S YNCHRONOUS M ACHINE E QUATIONS , P HYSICAL U NITS 0. Stator Voltages: va t ~ Va Vm coset V m e j 2 Vm cos r0 Vm sin r0 Vd jVq Vm e j r0 ~ Va Vd Vq ^ ... Date Added: 2009-05-21 21:53:46 |
| lec2.pdf Path: Ill. Chicago >> MCS >> 320 Fall, 2008 Description: MCS 320 Introduction to Symbolic Computation Fall 2005 Maple Lecture 2. Getting Started and Getting Help In this lecture we show how to use Maple as a calculator and explore the extensive help facilities. The material in this note corresponds to t... Date Added: 2009-05-21 21:53:49 |
| s30a.pdf Path: Idaho >> ECE >> 523 Fall, 2008 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>InternalError</Code><Message>We encountered an internal error. Please try again.</Message><RequestId>EBA27910F57C82A8</RequestId><HostId>z52DHt4oRrQcir5+xGQvaBUU17JK4pLTIEQ7PAuvoAHektNpRWp1ockllN9/1... Date Added: 2009-05-21 21:54:12 |
| s15a.pdf Path: Idaho >> ECE >> 523 Fall, 2008 Description: ECE 523 Law, J.D. Symmetrical Components Fall 2007 Session 15a 1/2 PARK \' S T RANSFORMATION fr odq RP0fabc P0 1 1 1 2 2 2 2 3 1 0 1 1 2 2 3 2 abc odqs 3 2 R 1 0 0 0 cos sin 0 sin cos P odqs odqr Rotation RP0 fr odq Pfab... Date Added: 2009-05-21 21:54:15 |
| RL Circuit.pdf Path: Idaho >> ECE >> 404 Fall, 2008 Description: ECE 404 Introduction to Power Systems RL Circuit Session 05 b r := 0.1 Vrms := 120 v f ( t) := L := 0.005 fe := 50 Te := 1 fe Tau := L r Tau = 0.05 e := -90 deg e := 2 fe 2 Vrms cos e t + e ( ) im0 := 0 T0 := 0 Tfinal := 5 Tau 200 ... Date Added: 2009-05-21 21:54:29 |
| Law 9-34.xlsx Path: Idaho >> ECE >> 423 Fall, 2008 Description: Fault Data Generators Number of Bus 1 Name of Bus 1 Phase Cur A 2.51 Phase Cur B 1.79 Phase Cur C 0.78 Phase Ang A -49.47 Phase Ang B 139.13 Phase Ang C 110.59 Fault Data - Lines From Number 1 2 To Number 2 3 Xfrmr Yes No Phase Cur A From 2.51 0.03 ... Date Added: 2009-05-21 21:54:40 |
| ece423-s14.pdf Path: Idaho >> ECE >> 423 Fall, 2008 Description: U) ~ z (V\') ~ <t: ~ ~ <t: 0 U.J N U) . C u W w ~ en > U) 0 Z ~ S 0 W ~ U) U) U) W a. 1 .J: 0 - \"U ta r-\' ~ - ~ :) ~ -c: ~ ~, . .J ~ - t ~ \" :t-.- -, ~ ~ .~ ~ ~ ~ ~ ~ ~ ~ l 0 ~ t -+ 0 . -... Date Added: 2009-05-21 21:54:44 |
| ee321lect25.pdf Path: Minnesota >> ECE >> 321 Fall, 2009 Description: ... Date Added: 2009-05-21 21:57:14 |
| comp3420info.pdf Path: Allan Hancock College >> COMP >> 3420 Fall, 2009 Description: Australian National University Department of Computer Science COMP3420 Advanced Databases and Data Mining 2009-S1 Basic Course Information 1 Course Description This course examines the design of databases and data warehouses and their use for data ... Date Added: 2009-05-21 21:59:01 |
| e-trading-1-1up.ppt Path: Allan Hancock College >> COMP >> 3410 Fall, 2009 Description: COMP 3410 / 6341 I.T. in eCommerce 1. ETrading Conceptual Foundations Roger Clarke Xamax Consultancy, Canberra Visiting Professor, A.N.U., U.N.S.W. and Uni. of Hong Kong http:/www.anu.edu.au/people/Roger.Clarke/. .EC/ETIntro.html, OhdsET1.pp... Date Added: 2009-05-21 21:59:12 |
| lessonplan2.doc Path: SUNY Plattsburgh >> HEBE >> 1511 Fall, 2009 Description: George Hebert EDU 395 Date: 1/31/07 Subject: Mathematics/rounding decimals/larger decimals Anticipatory Set: Which pairs are the same: 1.) .07, .7 2.) .43, .34 3.) .8, 0.8 4.).13 x 10^2, 130 5.)The finishing times for women swimmers is China 59.14, U... Date Added: 2009-05-21 22:05:29 |
| bin_p_5.txt Path: Bowling Green >> M >> 648 Fall, 2009 Description: MTB > # summarizing a beta density MTB > # MTB > # suppose I want to learn about p=Prob(coin lands heads) MTB > # I use a uniform prior and toss the coin 100 times, getting MTB > # 108 heads and 92 tails MTB > # MTB > # posterior density is beta(109,... Date Added: 2009-05-21 22:05:32 |
| 2007_massloss_ApJLett2007.pdf Path: Arizona >> PTYS >> 505 Fall, 2009 Description: The Astrophysical Journal, 658: L59L62, 2007 March 20 2007. The American Astronomical Society. All rights reserved. Printed in U.S.A. A MASS FUNCTION CONSTRAINT ON EXTRASOLAR GIANT PLANET EVAPORATION RATES W. B. Hubbard and M. F. Hattori Lunar and P... Date Added: 2009-05-21 22:06:14 |
| 2007_massloss_ApJLett2007.pdf Path: Arizona >> SECTION >> 505 Fall, 2009 Description: The Astrophysical Journal, 658: L59L62, 2007 March 20 2007. The American Astronomical Society. All rights reserved. Printed in U.S.A. A MASS FUNCTION CONSTRAINT ON EXTRASOLAR GIANT PLANET EVAPORATION RATES W. B. Hubbard and M. F. Hattori Lunar and P... Date Added: 2009-05-21 22:06:14 |
| lecture9_lcd.pdf Path: George Mason >> ECE >> 447 Fall, 2008 Description: ECE 447: Lecture 9 LCD display Init_control Begin Set E to 0 Set RS to 0 (instruction code) end LCD_clear Begin Set D7-D0 to Display_Clear_Code Set E to 1 Set E to 0 Wait for LCD to process the instruction End LCD_write (char c) Begin Set RS to 1 ... Date Added: 2009-05-21 22:08:32 |
| CellPhoneUse.pdf Path: McGill >> C >> 634 Fall, 2009 Description: FIGURE LEGENDS Figure 1. Schematic of driver_use_time and driver_non-use_time that form the denominators of incidence densities. Shown are when, and for how long 100 different motor vehicle drivers drove while using or not using cellular telephones, ... Date Added: 2009-05-21 22:12:10 |
| topic 3(c).ppt Path: Allan Hancock College >> IMS >> 5401 Fall, 2009 Description: IMS5401 Web-based Systems Development Topic 3: Development for the web 3(c) Information Architecture www.monash.edu.au Agenda 1. 2. 3. 4. 5. 6. 7. 8. The nature of the problem Organisation schemes for information Organisation structures for inform... Date Added: 2009-05-21 22:20:55 |
| 125-8.txt Path: UCCS >> CS >> 591 Fall, 2009 Description: Rule - Sid 125-8 - Summary: This event is generated when an attempt is made to exploit a known vulnerability in Unixware. - Impact: Denial of Service. Information disclosure. Loss of integrity. - Detailed Information: FTP servers can allow an at... Date Added: 2009-05-21 22:23:02 |
| stoichiometrylimiting_05_111.pdf Path: UMBC >> CHEM >> 111 Fall, 2009 Description: Chem 111 Dr. C. Doige Chem 111 Simple Stoichiometry limiting reagent problems In the stoichiometry problems that you have done up to now, you have been told which one of the reactants is in excess. What is actually a more typical situation for a c... Date Added: 2009-05-21 22:24:12 |
| BA_Classical_Civ_0405.pdf Path: Bowling Green >> AS >> 0405 Fall, 2009 Description: College of Arts and Sciences 205 Administration Bldg. 372-2015 CLASSICAL CIVILIZATION 2004/05 JUNIOR AUDIT PID# BACHELOR OF ARTS 203 Shatzel Hall 372-2667 Name Return Address Phone Number Expected Date of Graduation General Education Requirement... Date Added: 2009-05-21 22:25:28 |
| Prb11-9.xls Path: Carroll MT >> BA >> 409 Fall, 2009 Description: Holt\'s Method Base Level 283 288 336 388 406 412 416 435 428 435 462 452 474 476 497 487 523 528 532 552 -Predicted Sales -283.0 288.7 343.0 401.1 419.8 424.7 427.5 447.5 437.9 444.5 473.9 460.9 484.7 485.5 508.1 495.2 535.0 539.0 542.1 563.42 574.84... Date Added: 2009-05-21 22:26:09 |
| bone_terms.pdf Path: UT Arlington >> HENRY >> 2457 Fall, 2009 Description: BONE TERMS: Ramus convert ram to arm Trochanter large and knobby , like a rock (roch) Tuberosity not as large as a trochanter, sticks out like a but (tub backwards) Tubercle a little but Condyle usually paired with a fossa or sulcus Sulcus sunk... Date Added: 2009-05-21 22:27:13 |
| 1312.7.OUTWARD.doc Path: UT Arlington >> HIST >> 1312 Fall, 2008 Description: The University of Texas at Arlington Instructor: Dr. Allen Repko HIST 1312_ AMERICA LOOKS OUTWARD, 1881-1900 #7 I. REVOLUTIONARY CHANGES THAT TRANSFORMED THE UNITED STATES INTO A GLOBAL POWER A. GROWING SURPLUSES OF AGRICULTURAL & MANUFACTURED PRODU... Date Added: 2009-05-21 22:27:47 |
| 2301.13B.IRP PROPOSAL.doc Path: UT Arlington >> INTS >> 2301 Fall, 2008 Description: Unit #13: THE INTERDISCIPINARY RESEARCH PROPOSAL I. HOW THE IRP PROPOSAL RELATES TO THE COURSE LEARNING OUTCOMES: Learning outcome #6 states, \"Students will be able to develop a proposal for an interdisciplinary research paper (IRP).\" This part of th... Date Added: 2009-05-21 22:27:51 |
| Denotational context.pdf Path: NMSU >> CS >> 571 Fall, 2009 Description: A LANGUAGE WITH CONTEXT A crucial feature of all modern languages is the support for nested contexts in which names, whether of variables, types or subprograms, can be re-used. This gives the programmer much more flexibility when it comes to breaking... Date Added: 2009-05-21 22:28:39 |
| 07Area 45.pdf Path: Purdue >> CE >> 361 Spring, 2008 Description: ... Date Added: 2009-05-21 22:29:53 |
| Easy.pdf Path: U. Memphis >> MATH >> 4361 Fall, 2008 Description: MATH 4-6361 COMPLEX VARIABLES SPRING 2007 Constructing Analytic Functions Using Series: Two Easy Pieces The beauty in mathematics is seeing the truth without eort. George Polya (18871985) The following theorem is basic. Theorem 1. Suppose each term... Date Added: 2009-05-21 22:30:10 |
| fellsQSAR.pdf Path: U. Memphis >> CHEM >> 4315 Spring, 2008 Description: The Next Generation of Antidepressants James Fells Organic Medicinal Chemistry Spring 2005 Outline Depression as a disease Treatment Past, Present, and Future Determining the target QSAR model Proposed lead Synthetic method Conclusions & Ques... Date Added: 2009-05-21 22:32:26 |
| PS 467G Drop Course.pdf Path: Kentucky >> NEW >> 20060420 Fall, 2009 Description: Approved by Graduate Council/Jeannine Blackwell 3/10/06 ... Date Added: 2009-05-21 22:35:03 |
| spr04-sample-q1.pdf Path: Stanford >> CS >> 240 Fall, 2009 Description: CS 240 Quiz Questions 2002 - 2004 Stanford University Computer Science Department April 19, 2004 These quizes were all open-book exams. In general you were asked to answer somewhere between 8 out of 10 to 10 out of 12 given questions. The questions b... Date Added: 2009-05-21 22:37:07 |
| RTworksheet.pdf Path: UNL >> ARCH >> 334 Spring, 2008 Description: ... Date Added: 2009-05-21 22:40:17 |
| 2004_ARCH334_Syllabus.pdf Path: UNL >> ARCH >> 334 Spring, 2008 Description: Building Environment Technical Systems II Syllabus University of Nebraska Lincoln ARCH 334, Spring 2004, 3 credits INSTRUCTORS: Dr. Lily Wang 200B PKI Building, Omaha, (402) 554-2065, lwang4@unl.edu Dr. Dale Tiller 205B PKI Building, Omaha, (402) 5... Date Added: 2009-05-21 22:40:17 |
| lec26.ppt Path: East Los Angeles College >> CSC >> 424 Spring, 2009 Description: Software for Embedded Systems Todays Agenda Mechanistic Design - Collaboration Diagrams, Patterns Detailed Design - Operations: Data Structures and Algorithms April 26, 2009 BITS, Pilani. CS C424 / IS C424 Collaboration Diagrams Collaboratio... Date Added: 2009-05-21 22:40:18 |
| 2007627_o01x_053395.pdf Path: Stanford >> MERQE >> 1035 Fall, 2009 Description: Case 5:05-cv-03395-JF Document 325 Filed 06/27/2007 Page 1 of 3 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Jeffrey S. Facter (State Bar No. 123817) Patrick D. Robbins (State Bar No. 152288) Azadeh Gowharrizi (State Bar No. 239938) SHEARMAN & STERLING LLP ... Date Added: 2009-05-21 22:40:54 |
| Day19.pdf Path: NYU >> MA >> 401 Spring, 2009 Description: 6 April 2007 Paul E. Hand hand@cooper.edu MA 401 Day 19 Sturm-Liouville Problems and Eigenfunctions of the Laplacian Objectives: As a result of this day of class, you should be able to: I.) Compute the eigenfunctions for the Laplacian and Sturm-Liou... Date Added: 2009-05-21 22:43:01 |
| erinns resume.pdf Path: Wartburg >> BA >> 325 Fall, 2009 Description: 100 Wartburg Blvd. Box 1219 Objective: Waverly, IA 50677 To obtain an internship to enhance my leadership, communication and (952) 201-3540 (cell) teamwork skills and knowledge in the Marketing and Sport Management areas. erinn.north@wartburg.edu Edu... Date Added: 2009-05-21 22:43:04 |
| hw4.pdf Path: Nevada >> CPE >> 201 Spring, 2008 Description: CPE 201 Introduction to Computer Engineering Homework 4 Due April 9 1. [25 points] Problem 4.25 (page 178). 2. [25 points] Problem 4.28 (page 178). 3. [25 points] Problem 4.31 (page 179). 4. [25 points] Using a combination of four half or full a... Date Added: 2009-05-21 22:44:17 |
| HW2_soln.pdf Path: Michigan State University >> ME >> 451 Fall, 2008 Description: ... Date Added: 2009-05-21 22:45:27 |
| HW10_soln.pdf Path: Michigan State University >> ME >> 451 Fall, 2008 Description: ... Date Added: 2009-05-21 22:45:31 |
| Trial Particular Solutions.pdf Path: Michigan State University >> ME >> 391 Fall, 2008 Description: ... Date Added: 2009-05-21 22:47:25 |
| pre-lab.pdf Path: Michigan State University >> ME >> 412 Fall, 2008 Description: Spring 2009 ME 412 Heat Transfer Laboratory Thermocouple Experiment Pre-Lab Assignment Name:_ 1. How many thermocouple pairs will be made for each lab setup? 2. The time constant can be estimated by the value of. a. = 0.37 b. the time at which =... Date Added: 2009-05-21 22:48:02 |
| GEA_project.pdf Path: Michigan State University >> BS >> 110 Spring, 2008 Description: BS110 Lab Name _ Fall 2008 Group Name _ Group Effort Analysis (GEA) Science Public Service Announcement Analyze the contributions of your team members toward the research and development of your science public service announcement project. Name Qua... Date Added: 2009-05-21 22:51:15 |
| final-hw.pdf Path: Michigan State University >> CSE >> 830 Fall, 2008 Description: CSE 830 Final HW Due: Thursday, May 2, 2002, 12:45 PM Consider the following list of problems 1. Max-Jobs Input Set of jobs {1, . . . , n} with deadlines dj and processing times pj Task Find a schedule of these jobs on a single machine that maxi... Date Added: 2009-05-21 22:53:13 |
| Noethercont-2182004.pdf Path: Michigan State University >> PHY >> 854 Fall, 2008 Description: ... Date Added: 2009-05-21 22:53:19 |
| 0048_07s_syllabus.pdf Path: NYU >> GSAS >> 0048 Fall, 2009 Description: Linguistics as Cognitive Science Instructor: Professor Alec Marantz Meyer 751 (Psychology) X8393 marantz@nyu.edu Office Hours: By appointment (send e-mail to set a meeting). Wednesdays are best. Course Description: This course examines the place of L... Date Added: 2009-05-21 22:53:22 |
| 2_data_collection.07.pdf Path: Michigan State University >> PAGES >> 874 Fall, 2009 Description: AEC 874 (2007) Field Data Collection & Analysis in Developing Countries II. DATA COLLECTION METHODS Richard H. Bernsten Agricultural Economics Michigan State University 1 Overview: Approaches to Data Collection o Selecting an approach Method must... Date Added: 2009-05-21 22:53:31 |
| 2_data_collection.07.pdf Path: Michigan State University >> AEC >> 874 Summer, 2008 Description: AEC 874 (2007) Field Data Collection & Analysis in Developing Countries II. DATA COLLECTION METHODS Richard H. Bernsten Agricultural Economics Michigan State University 1 Overview: Approaches to Data Collection o Selecting an approach Method must... Date Added: 2009-05-21 22:53:31 |
| Exam-example.pdf Path: Michigan State University >> ECE >> 418 Fall, 2008 Description: NAME: Exam 1 ECE 410 Fall 2002 During this exam you are allowed to use a calculator and the equations sheet provided. You are not allowed to speak to or exchange books, papers, calculators, etc. with other students. Total Points: 100 Time: 60 minu... Date Added: 2009-05-21 22:55:02 |
| ENGL015.SU07.pdf Path: Penn State >> KVW >> 108 Fall, 2009 Description: ThePennsylvaniaStateUniversity English15RhetoricandComposition SyllabusandCoursePolicies Instructor:K.V.(KarlysVanessa)White SemesterandSession:Summer2007,Session201 101WagnerBuilding Email address:kv.white@psu.edu CourseDescription Ihavedesignedthis... Date Added: 2009-05-21 22:57:10 |
| assg9-sol.pdf Path: ECCD >> MATH >> 114 Fall, 2009 Description: ... Date Added: 2009-05-21 22:57:49 |
| noise1.pdf Path: Villanova >> ECE >> 8566 Fall, 2009 Description: Microwave Journal http:/www.mwjournal.com/default.asp?journalid=1pa. AUGUST 2002 : CURRENT ISSUE August 2002 Issue Artech House Books Email article Print Article Contact Editor Reprint Options Ads by Goooooogle Technical Feature ... Date Added: 2009-05-21 22:58:54 |
| 880308.pdf Path: Michigan State University >> LIB >> 1988 Fall, 2009 Description: IT\'S A MATTER OF OPINION This segment of the Green Section\'s Annual Educational Program is devoted to the expression of opinions not necessarily widely held. The purpose is to stimulate, to challenge, to create, and to encourage a greater exchange of... Date Added: 2009-05-21 23:00:07 |
| midterm.pdf Path: Toledo >> CS >> 324 Fall, 2009 Description: GGg g33 { t x v %v Quw h7Vs { vz v w#ps h { u z v tw hdhV7 T { uzt s hhhpt } % | | w } 6 5 4 4 5 1 6 w$E$3$%E$E7%q370... Date Added: 2009-05-21 23:00:51 |
| 4400.pdf Path: Michigan State University >> ISP >> 215 Spring, 2008 Description: 4400 Series Studio Monitors Distortion: The levels of distortion will have a definite impact on clarity, articulation, imaging and listener fatigue. In order for a loudspeaker to be an accurate reproducer, it should exhibit the lowest possible harmon... Date Added: 2009-05-21 23:01:18 |
| NeyerPresentation.pdf Path: UNC >> COMP >> 790 Fall, 2008 Description: Influence and Correlation in Social Networks Aris Anagnostopoulos, Ravi Kumar, and Mohammad Mahdian, with Yahoo! Research Mark P Neyer Motivation Social Networks are growing Facebook has 175 million users as of March 2009 As they grow, lots of da... Date Added: 2009-05-21 23:02:58 |
| 511128.pdf Path: Michigan State University >> LIB >> 1951 Fall, 2009 Description: 28 USGA JOURNAL AND TURF MANAGEMENT: NOVEMBER, 1951 FROM THE GOLF COURSE SUPERINTENDENTS The Golf Course Budget Before the end of the year, in many, many cases, the golf course superintendent will present his 1952 operating budget, covering ... Date Added: 2009-05-21 23:05:20 |
| 2505109.pdf Path: Michigan State University >> LIB >> 1925 Fall, 2009 Description: May 16, 1925 UNITED STATES GOLF ASSOCIATION 1 109 The Needs of the Green Section By Walter S. Harban I have enjoyed this entertainment for the last couple of days because I have been sitting in the audience al~d listening. to other people talk... Date Added: 2009-05-21 23:06:18 |
| training_F08_2_sol.pdf Path: Kentucky >> MS >> 085 Fall, 2009 Description: [Topology Prelim Training { Fall 08 { November 14 { Solutions] 1 Let X be a normal space and K X be any subspace homeomorphic to [0, 1]. Prove that there is a retraction r : X K . What if [0, 1] is replaced with the T -space T = ([0, 1] {0}) ({0}... Date Added: 2009-05-21 23:09:19 |
| Exa_02sol.pdf Path: WVU >> EE >> 221 Fall, 2008 Description: EE 221 Exam #2 10/17/2002 _ / 100 pts Name: _ You need to show all of your steps in detail to get full credit! 1. Use nodal analysis to determine current I (10 pts) number of unknown node voltage(s) R1=40 Vs=40V V IS=2A R2=40 (GND) + _1_(2)_... Date Added: 2009-05-21 23:11:18 |
| ch17_20.pdf Path: WVU >> STAT >> 111 Fall, 2008 Description: Chapter 17 Thinking About Chance Chapter 17 2 What does the word probability mean? For the probability of winning a lottery based on buying a single ticket - we can quantify the chances exactly. (relative frequency) For the probability that we w... Date Added: 2009-05-21 23:11:36 |
| readings7.pdf Path: WVU >> BIO >> 105 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>InternalError</Code><Message>We encountered an internal error. Please try again.</Message><RequestId>2FCEE82C3321C320</RequestId><HostId>CaCFtLKg4Ttxy62runm6mpNOA46oCcgDetf+LlbRdWyFWwf/jx6ElVG8Gb7BT... Date Added: 2009-05-21 23:11:39 |
| ToRecreate.pdf Path: W. Carolina >> CS >> 340 Fall, 2008 Description: 1 1.1 Section 6.1: Linear Systems of Equations Applications Let i represent the current in amperes, and r the resistance an ohms then the voltage drop E for each resistor is given by Ohms law: E = iR Kirchos current and voltage rules indicate 1. At... Date Added: 2009-05-21 23:11:59 |
| Day42.pdf Path: HWS >> MATH >> 204 Fall, 2009 Description: Math 204. http:/math.hws.edu/mitchell/Math204F08/index.html Page 1 Math 204: Day 42 Oce Hours. Monday: 2:004:30; Tuesday 11:002:00, Wednesday 11:301:30, 4:006:00. 1. a) Review Sections 5.3 and 4.9. b) Previously suggested Practice. Try Page 3256 #... Date Added: 2009-05-21 23:12:21 |
| submit.txt Path: Washington >> V >> 15350 Fall, 2009 Description: executable = allgamma_15350.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-05-21 23:12:51 |
| output.txt Path: Washington >> V >> 11500 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS10 - local directory - Volume in drive C has no label. Volume Serial Number is 7A81-82A4 Directory of C:\\condor\\execute\\dir_3892 01/30/2008 06:18 PM <DIR> . 01/30/2008 06:18 PM <... Date Added: 2009-05-21 23:13:06 |
| log.txt Path: Washington >> JOBS >> 40500 Fall, 2009 Description: 000 (58563.000.000) 02/11 20:58:37 Job submitted from host: <128.95.94.28:1092> . 001 (58563.000.000) 02/12 00:59:02 Job executing on host: <172.25.101.84:1066> . 006 (58563.000.000) 02/12 01:19:11 Image size of job updated: 378152 . 005 (58563.000.0... Date Added: 2009-05-21 23:17:05 |
| output.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS10 - local directory - Volume in drive C has no label. Volume Serial Number is 7A81-82A4 Directory of C:\\condor\\execute\\dir_2152 02/13/2008 04:51 PM <DIR> . 02/13/2008 04:51 PM <... Date Added: 2009-05-21 23:17:14 |
| submit.txt Path: Washington >> V >> 12271 Fall, 2009 Description: executable = allgamma_12271.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-05-21 23:17:53 |
| submit.txt Path: Washington >> JOBS >> 31333 Fall, 2009 Description: executable = pass6_31333.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31000-31499/31333... Date Added: 2009-05-21 23:21:12 |
| output.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-8T51PB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3256 02/07/2008 02:24 AM <DIR> . 02/07/2008 02:24 ... Date Added: 2009-05-21 23:22:45 |
| submit.txt Path: Washington >> JOBS >> 20068 Fall, 2009 Description: executable = pass6_20068.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs20000-20499/20068... Date Added: 2009-05-21 23:23:12 |
| error.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 13 19:56:49 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 13 21:20:20 2008 ( 5011 s elapsed) ... Date Added: 2009-05-21 23:24:06 |
| error.txt Path: Washington >> V >> 10500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Jan 30 04:34:59 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 05:51:35 2008 ( 4596 s elapsed) ... Date Added: 2009-05-21 23:25:38 |
| submit.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: executable = pass6_41291.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs41000-41499/41291... Date Added: 2009-05-21 23:29:21 |
| output.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-90WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3472 02/07/2008 04:31 AM <DIR> . 02/07/2008 04:31 ... Date Added: 2009-05-21 23:29:55 |
| log.txt Path: Washington >> V >> 12402 Fall, 2009 Description: 000 (45902.000.000) 01/31 07:11:47 Job submitted from host: <128.95.94.28:1098> . 001 (45902.000.000) 01/31 16:54:20 Job executing on host: <172.25.101.161:1061> . 006 (45902.000.000) 01/31 17:14:28 Image size of job updated: 454848 . 006 (45902.000.... Date Added: 2009-05-21 23:29:56 |
| output.txt Path: Washington >> V >> 11852 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-725QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3392 12/03/2007 06:08 PM <DIR> . 12/03/2007 06:08 ... Date Added: 2009-05-21 23:30:40 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 12:56:56 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 14:12:09 2008 ( 4513 s elapsed) ... Date Added: 2009-05-21 23:31:42 |
| submit.txt Path: Washington >> JOBS >> 50145 Fall, 2009 Description: executable = pass6_50145.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs50100-50199/50145... Date Added: 2009-05-21 23:32:42 |
| error.txt Path: Washington >> JOBS >> 71500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 13:44:09 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 14:57:00 2008 ( 4371 s elapsed) ... Date Added: 2009-05-21 23:33:22 |
| submit.txt Path: Washington >> JOBS >> 20065 Fall, 2009 Description: executable = pass6_20065.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs20000-20499/20065... Date Added: 2009-05-21 23:33:28 |
| output.txt Path: Washington >> JOBS >> 40500 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS2 - local directory - Volume in drive C has no label. Volume Serial Number is EE42-0B89 Directory of C:\\condor\\execute\\dir_3116 02/11/2008 11:52 PM <DIR> . 02/11/2008 11:52 PM <D... Date Added: 2009-05-21 23:33:49 |
| log.txt Path: Washington >> JOBS >> 10152 Fall, 2009 Description: 000 (51148.000.000) 02/06 08:19:59 Job submitted from host: <128.95.94.28:1098> . 001 (51148.000.000) 02/06 08:34:28 Job executing on host: <172.25.101.93:1056> . 005 (51148.000.000) 02/06 08:46:51 Job terminated. (1) Normal termination (return valu... Date Added: 2009-05-21 23:33:53 |
| log.txt Path: Washington >> JOBS >> 80500 Fall, 2009 Description: 000 (63805.000.000) 02/19 21:11:47 Job submitted from host: <128.95.94.28:1092> . 001 (63805.000.000) 02/20 06:08:30 Job executing on host: <172.25.101.87:1064> . 006 (63805.000.000) 02/20 06:28:38 Image size of job updated: 389788 . 005 (63805.000.0... Date Added: 2009-05-21 23:34:49 |
| log.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: 000 (51128.000.000) 02/06 08:19:44 Job submitted from host: <128.95.94.28:1098> . 001 (51128.000.000) 02/06 08:31:13 Job executing on host: <172.25.101.73:1057> . 005 (51128.000.000) 02/06 08:43:14 Job terminated. (1) Normal termination (return valu... Date Added: 2009-05-21 23:35:06 |
| submit.txt Path: Washington >> JOBS >> 70994 Fall, 2009 Description: executable = pass6_70994.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs70500-70999/70994... Date Added: 2009-05-21 23:38:49 |
| output.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-595QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3708 02/11/2008 04:08 PM <DIR> . 02/11/2008 04:08 ... Date Added: 2009-05-21 23:39:49 |
| submit.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: executable = pass6_31138.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31000-31499/31138... Date Added: 2009-05-21 23:40:40 |
| error.txt Path: Washington >> JOBS >> 11490 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:26:07 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:37:15 2008 ( 668 s elapsed) ... Date Added: 2009-05-21 23:43:42 |
| submit.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: executable = pass6_10016.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10000-10499/10016... Date Added: 2009-05-21 23:44:34 |
| error.txt Path: Washington >> JOBS >> 10421 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 03:11:35 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 03:22:35 2008 ( 660 s elapsed) ... Date Added: 2009-05-21 23:44:58 |
| submit.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: executable = pass6_31927.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31927... Date Added: 2009-05-21 23:47:47 |
| log.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: 000 (59728.000.000) 02/13 19:07:31 Job submitted from host: <128.95.94.28:1092> . 001 (59728.000.000) 02/13 20:28:31 Job executing on host: <172.25.101.185:1056> . 006 (59728.000.000) 02/13 20:48:39 Image size of job updated: 386336 . 010 (59728.000.... Date Added: 2009-05-21 23:48:35 |
| log.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: 000 (58607.000.000) 02/11 21:24:51 Job submitted from host: <128.95.94.28:1092> . 001 (58607.000.000) 02/12 01:41:11 Job executing on host: <172.25.101.196:1055> . 006 (58607.000.000) 02/12 02:01:19 Image size of job updated: 394868 . 005 (58607.000.... Date Added: 2009-05-21 23:49:20 |
| log.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: 000 (58977.000.000) 02/11 21:27:04 Job submitted from host: <128.95.94.28:1092> . 001 (58977.000.000) 02/12 04:49:15 Job executing on host: <172.25.101.90:1058> . 006 (58977.000.000) 02/12 05:09:23 Image size of job updated: 394912 . 005 (58977.000.0... Date Added: 2009-05-21 23:49:24 |
| log.txt Path: Washington >> JOBS >> 41082 Fall, 2009 Description: 000 (58647.000.000) 02/11 21:25:07 Job submitted from host: <128.95.94.28:1092> . 001 (58647.000.000) 02/12 02:02:25 Job executing on host: <172.25.101.188:1057> . 006 (58647.000.000) 02/12 02:22:33 Image size of job updated: 462920 . 006 (58647.000.... Date Added: 2009-05-21 23:50:41 |
| output.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-835QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1100 02/12/2008 03:18 AM <DIR> . 02/12/2008 03:18 ... Date Added: 2009-05-21 23:51:13 |
| submit.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: executable = pass6_41180.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs41000-41499/41180... Date Added: 2009-05-21 23:51:22 |
| error.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 12 03:10:40 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 12 04:24:58 2008 ( 4458 s elapsed) ... Date Added: 2009-05-21 23:53:03 |
| submit.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: executable = pass6_41155.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs41000-41499/41155... Date Added: 2009-05-21 23:54:10 |
| log.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: 000 (58942.000.000) 02/11 21:26:54 Job submitted from host: <128.95.94.28:1092> . 001 (58942.000.000) 02/12 04:39:33 Job executing on host: <172.25.101.179:1055> . 006 (58942.000.000) 02/12 04:59:42 Image size of job updated: 415920 . 005 (58942.000.... Date Added: 2009-05-21 23:54:39 |
| log.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: 000 (58819.000.000) 02/11 21:26:09 Job submitted from host: <128.95.94.28:1092> . 001 (58819.000.000) 02/12 03:26:17 Job executing on host: <172.25.101.82:1059> . 006 (58819.000.000) 02/12 03:46:25 Image size of job updated: 402720 . 006 (58819.000.0... Date Added: 2009-05-21 23:54:50 |
| lec10.ps Path: UCSD >> CSE >> 150 Spring, 2007 Description: %! %BoundingBox: (atend) %Pages: (atend) %DocumentFonts: (atend) %EndComments % % FrameMaker PostScript Prolog 3.0, for use with FrameMaker 3.0 % Copyright (c) 1986,87,89,90,91 by Frame Technology Corporation. % All rights reserved. % % Known Problem... Date Added: 2009-05-21 23:57:33 |
| Quiz_1B.doc Path: MN State >> MA >> 304 Fall, 2009 Description: MA 304 Quiz 1B Name _ Seat # _ Evaluate each expression. Be sure you follow the Order of Operations. 1. 9 + 4(5) - (8 - 1) 2. - 42 + (4 - 7) 2 3. 7 + 3(22 + 5) + 6 -32 + 5 Solve. Show your steps and circle your final answer. 4. -3x + 9 = (-51) 5. ... Date Added: 2009-05-21 23:59:13 |
| GM.nt.txt Path: San Diego State >> VP >> 041502 Fall, 2009 Description: > orf1 [4-117] ATGTTGTCAGCCCTTCGTTTGTCTCTGGGACAAATTCTAGCACGGCGGGCCGCCACTGGGAACGGGGCGCGGGATGTGGGGCCAAAAATCACATATTTGTGCGAGCCCGCGGG > orf2 [115-829] ATGACCGAAACCACCGCGCGGCTGGTGACTAAGGCGGAGCTACTGCGCCGAGTCGAGAGGAGCCGCACCAGACTGTACGAGGATGCGAGCGCCAAGGGCGTGCT... Date Added: 2009-05-21 23:59:31 |
| lab_9_comparator_multivibrators_ph412_w08.pdf Path: Oregon State >> PH >> 412 Fall, 2008 Description: PH 412/512 Electronics Laboratory 9: Comparator-Based Multivibrators Concept Operational amplifiers can be used as comparators, that is, the output will be either +Vcc or -Vcc when V+ > V- or vice versa. It is possible to devise a comparator with b... Date Added: 2009-05-21 23:59:49 |
| ps5.pdf Path: SMU - Cox School of Business >> ECO >> 7377 Fall, 2009 Description: ECO 7377 Prof. Millimet PS #5 1. With additive separability, the potential outcomes can be written as y0 = g0 (X) + \"0 y1 = g1 (X) + \"1 = g1 (X) + [(\"1 \"0 ) + \"0 ] = g1 (X) + [ + \"0 ] where E[\"0 ] = E[\"1 ] = 0. Suppose treatment assignment is determi... Date Added: 2009-05-22 00:00:00 |
| ECGR4101-2007-08-hw07.doc Path: UNC Charlotte >> ECGR >> 4101 Spring, 2008 Description: UNCC, Department of Electrical and Computer Engineering ECGR4101/5101, Fall 2007, Homework #7, Due: 10/29/07, at the beginning of class (20 points) 0. (1 point) How long did this homework take you? 1. (3 points) Read the Stuart Ball article Introduct... Date Added: 2009-05-22 00:00:54 |
| s09hwk8-anskey.pdf Path: SMU - Cox School of Business >> FACULTY >> 3315 Fall, 2009 Description: Math 3315/CSE 3365 Spring Semester 2009 Homework 8 Answer Key You were to answer Problems 4.4.4, 4.4.5 and 4.4.7 from the lecture notes. Problem 4.4.4 (2 marks): The least squares Normal equations for a straight line fit p1 (x) = a0 + a1 x to the d... Date Added: 2009-05-22 00:01:05 |
| lecture6.pdf Path: Mich Tech >> FW >> 4540 Fall, 2008 Description: Remote Sensing of the Environment FW4540 Advanced Terrestrial Remote Sensing FW5540 Aerial Photography Geometry Reflectance and Color Relationships 1 Low Oblique Aerial Photograph High Oblique Aerial Photograph 2 Panchromatic Black & White Infr... Date Added: 2009-05-22 00:01:56 |
| 211q04r.pdf Path: N. Illinois >> MATH >> 211 Fall, 2008 Description: MATH 211 Spring 2009 Recitation Quiz 4 26 February 2009 Name: Section (circle one): D1 D2 D3 You may receive partial credit on a single problem even if your final answer is incorrect, depending upon the amount and quality of work shown. Thus, show ... Date Added: 2009-05-22 00:07:30 |
| 211q03-5r.pdf Path: N. Illinois >> MATH >> 211 Fall, 2008 Description: MATH 211 Spring 2009 Recitation Quiz 3: The one that actually counts 19 February 2009 Name: Section (circle one): D1 D2 D3 You may receive partial credit on a single problem even if your nal answer is incorrect, depending upon the amount and qualit... Date Added: 2009-05-22 00:07:31 |
| worksheet3-16-09.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 231 Fall, 2008 Description: WORKSHEET FOR 3/16/2009 Reading assignment for Wednesday. 11.4 Homework due Wednesday. 11.3: 22, 24, 26, 28, 30 Notes: The ratio test is a useful modification of the comparison test. Theorem. (Ratio test for positive series) Suppose that ak > 0 for ... Date Added: 2009-05-22 00:09:26 |
| tatefil-revised4.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 0719 Fall, 2009 Description: The slice ltration and mixed Tate motives Annette Huber and Bruno Kahn Abstract Using the slice ltration, dened by eectivity conditions on Voevodskys triangulated motives, we dene spectral sequences converging to their motivic cohomology and tale e m... Date Added: 2009-05-22 00:14:11 |
| picard.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 0738 Fall, 2009 Description: CHOW-KUNNETH DECOMPOSITION FOR UNIVERSAL FAMILIES OVER PICARD MODULAR SURFACES A. MILLER, S. MULLER-STACH, S. WORTMANN, Y.-H.YANG, K. ZUO Dedicated to Jaap Murre Abstract. We discuss conditions for the existence of an absolute ChowKnneth decomposit... Date Added: 2009-05-22 00:15:05 |
| Mult_Table.MATH402.pdf Path: N. Illinois >> MATH >> 402 Fall, 2008 Description: Multiplication Facts X 0 0 0X0 1 0X1 2 0X2 3 0X3 4 0X4 5 0X5 6 0X6 7 0X7 8 0X8 9 0X9 10 0 X 10 1 1X0 1X1 1X2 1X3 1X4 1X5 1X6 1X7 1X8 1X9 1 X 10 2 2X0 2X1 2X2 2X3 2X4 2X5 2X6 2X7 2X8 2X9 2 X 10 3 3X0 3X1 3X2 3X3 3X4 3X5 3X6 3X7 3X8 3X9 3 X 10 4 4X0 4X... Date Added: 2009-05-22 00:16:08 |
| 4-20.pdf Path: Auburn >> HW >> 2610 Fall, 2009 Description: PROBLEM 5.4 Situation: An 8 cm. pipe carries air, V = 20 m/s, T = 20o C, p = 200 kPa-abs. Find: Mass ow rate: m ANALYSIS Ideal gas law = p/RT = 200, 000/(287 293) = 2.378 kg/m3 Flow rate equation m = V A = 2.378 20 ( 0.082 /4) m = 0.239 kg/s ... Date Added: 2009-05-22 00:17:12 |
| 4-81.pdf Path: Auburn >> HW >> 2610 Fall, 2009 Description: PROBLEM 5.55 Situation: O2 and CH4 enter a mixer, each with a velocity of 5 m/s. Mixer conditions: 200 kPa-abs., 100 o C. Outlet density: = 2.2 kg/m3 . Flow areas: 1 cm2 for the CH4 , 3 cm2 for the O2 , and 3 cm2 for the exit mixture. Find: Exit vel... Date Added: 2009-05-22 00:17:15 |
| Sean.pdf Path: Hampshire >> DOCS >> 201 Fall, 2009 Description: Sean, 1;2 - 1;9 apple ball bottle apple juice flower all gone clock clock bagel girl Adult [.pl] [bal] [b.tl] [.pl.dus] [flaw.r] [al.gn] [klak] [klak] [be.gl] [grl] Sean [a.pu] [ba] [ba.du] [a.pu.bu] [wa.wu] [a.ga] [ka] [ka.ki] [ba.be] [gou] ... Date Added: 2009-05-22 00:18:03 |
| BDO-FairValue-9-07-4.pdf Path: Ill. Chicago >> ACTG >> 593 Fall, 2008 Description: September 2007 Fair Value Measurements, Statement 157 Table of Contents Introduction .2 Summary of Statement 157 .3 Definition of Fair Value under Statement 157.3 Principal Market.3 Market Participants .4 Highest and Best Use (Assets) and Nonperform... Date Added: 2009-05-22 00:18:40 |
| Exam2_2006.pdf Path: St. Lawrence >> MYSLU >> 222 Fall, 2009 Description: ... Date Added: 2009-05-22 00:18:58 |
| 12-23-1982.pdf Path: LSU >> PDFS >> 1982 Fall, 2009 Description: Orleans Parish St. Chorlcs Perish Jefferson Parish SEA GRANT PROGRAM 1825 Bonnie AM Drive Marrero, LA 70072 341-7271. 341-7212 LAGNIAPPE COMMERCIAL FISHERMAN\'S RECORD BOOKS I\'W just received a supply of the Conmercial Fisherman\'s Record The books h... Date Added: 2009-05-22 00:20:14 |
| EE188HWF008S.pdf Path: Rose-Hulman >> EE >> 188 Fall, 2009 Description: EE 188 Plotting Example Define a function for finding the magnitude of a complex number. M( x) Re ( x ) 2 Im( x ) 2 Define the complex function to be plotted. R L C 50 . 1 . mH 1 . F R R 2 .L.R.C F( ) j . .L Plot the function. i 1000 i 0... Date Added: 2009-05-22 00:23:56 |
| 425h4S08.pdf Path: Ill. Chicago >> MATH >> 425 Fall, 2008 Description: MATH 425 Written Homework 4 Radford DUE 03/03/08 1. Exercise 6.2.4 2. Exercise 6.2.11 3. Exercise 6.2.12 4. Exercise 6.3.3 5. Exercise 6.3.7 1 ... Date Added: 2009-05-22 00:25:38 |
| ps12.pdf Path: Ill. Chicago >> MATH >> 414 Fall, 2008 Description: Math 414 Analysis II Problem Set 12 Due Friday April 30 1) Consider the initial value problem g (x) = g(x) where g(0) = 1. Let g0 (x) = 1 be our initial approximation to a solution and follow the proof the existence of solutions for ordinary dierenti... Date Added: 2009-05-22 00:25:46 |
| c223_slide.ppt Path: UCSD >> VLSICAD >> 223 Fall, 2009 Description: Fast Yield-Driven Fracture for Variable Shaped-Beam Mask Writing Andrew B. Kahng , Xu Xu , and Alex Z. Zelikovsky Fracture in Mask Data Process Circuit Design Tape Out Layout Extraction RET Fracture Job Decomposition Tonality PEC Fracture Job Finish... Date Added: 2009-05-22 00:25:52 |
| c212_slide.ppt Path: UCSD >> VLSICAD >> 212 Fall, 2009 Description: Lithography Simulation-Based Full-Chip Design Analyses Presenter: Puneet Sharma (sharma@ucsd.edu) P. Gupta, A. B. Kahng, S. Nakagawa, S. Shah, P. Sharma Blaze DFM Inc., Sunnyvale, CA ECE Department, U.C. San Diego EECS Department, U. of Michigan ... Date Added: 2009-05-22 00:25:57 |
| ps8.pdf Path: Ill. Chicago >> MATH >> 435 Fall, 2008 Description: Math 435 Number Theory I Problem Set 8 Due: Friday October 28: 1) We call n a Carmichael Number if n is not prime but an a (mod n) for all a. Prove that 1105 is a Carmichael Number. 2) We say that a function f is multiplicative if f (nm) = f (n)f (m... Date Added: 2009-05-22 00:26:06 |
| hw-3-19-09.pdf Path: BU >> MATH >> 341 Fall, 2009 Description: MA 341 Exercises on nding e-th roots 1) Solve the following congruences: a) x329 452 (mod 1147) b) c) x113 345 (mod 463) x275 139 (mod 588) 2) What goes wrong if we try to use our method of nding e-th roots to try to solve the congruence x2 23 (... Date Added: 2009-05-22 00:27:11 |
| Logan.pdf Path: UCSD >> ARIES >> 0309 Fall, 2008 Description: Perspectives on Recent Progress and Future Directions in IFE Grant Logan Director Heavy-Ion Fusion Virtual National Laboratory Presented to the ARIES Project Meeting September 4, 2003, Georgia Tech Center ARIES contributions to HIF-IFE Challenges and... Date Added: 2009-05-22 00:29:10 |
| midterm_sol.doc Path: UC Riverside >> CS >> 010 Fall, 2008 Description: Name:_ SSN:_ Login: _ Lab Section: _ CS 10 - Winter 2001 Midterm Tuesday, February 13 Be sure to read each problem carefully and follow the directions. Points may be taken off if you do not follow the directions. For example, if the problem asks yo... Date Added: 2009-05-22 00:29:26 |
| Executalbe_model.pdf Path: Université du Québec à Montréal >> DOCS >> 691 Fall, 2009 Description: An Executable Model for Virtual Campus Environments Gilbert Paquette and Franois Magnan {gilbert.paquette, francois.magnan}@licef.teluq.uqam.ca CICE Research Chair, LICEF Research Center, Tl-universit Abstract. In this chapter, we revisit an innovati... Date Added: 2009-05-22 00:30:37 |
| Lecture15slidesAnno.ppt Path: Colorado >> ECEN >> 5807 Fall, 2008 Description: Feedback theorem Op amp example Buck voltage regulator example Results Example Op amp PD compensator circuit R1 = 1.6 k R2 = 16 R3 = 1.6 k C = 0.1 F Op amp model Ro = 50 Gop(s) = Goo/(1+s/w1) Goo = 105 f1 = 10 Hz Buck voltage regulator example ... Date Added: 2009-05-22 00:30:43 |
| Chapter 20 - The Skin Effect.pdf Path: Colorado >> ECEN >> 3400 Fall, 2008 Description: ... Date Added: 2009-05-22 00:30:53 |
| module one requirements.doc Path: UVA >> TCC >> 315 Fall, 2009 Description: What we are looking for in your patents and presentations Basic Patent Structure: 1. Introduction names of those submitting the patent, location, general purpose 2. Prior art A brief description of the technology (Bell patent, photophone, etc.) upo... Date Added: 2009-05-22 00:32:01 |
| 08-14-1987.pdf Path: LSU >> PDFS >> 1987 Fall, 2009 Description: vol. 11,. 193. 8 August 14, 1987 1825 mnnie Marrero, (504) Ann LA hive 70072 341-7271 SEA GRANT PROCPRAM LAGNIAPPE Nm FISHERIES IAWS \'Ibe fdkwing bills were passed by the 1987 Louisiana Legislature and will 92 into effect Septmber 1, 1987 (u... Date Added: 2009-05-22 00:32:11 |
| sto.doc Path: St. Olaf >> MEDIA >> 0607 Fall, 2009 Description: 2006-07 St. Olaf Women\'s Basketball Roster No. 10 12 14 22 24 30 34 40 42 44 50 52 54 Name Kelsey Oja Shurie Madery Tasha Mrosak Ashley Cooper Holly Grimsrud Danielle Stoermer Christina Sampson Kristina Stoermer Kathryn Thompson Natalie Holm Laura Jo... Date Added: 2009-05-22 00:32:58 |
| Problem Set 1.pdf Path: Texas A&M >> ENTC >> 435 Fall, 2008 Description: ENTC 435 Problem Set 1 The purpose of this problem set is to provide a set of example review questions and problems that the student can use to prepare for Exam 1. All references are to the textbook by W. Stallings, Data and Computer Communications, ... Date Added: 2009-05-22 00:33:08 |
| ENTC 489RF Lab 1.pdf Path: Texas A&M >> ENTC >> 489 Fall, 2008 Description: Lab 1 Real Components: Non-Idealities in Real Lumped Elements Objective: The objective of this lab is to gain an understanding of the difference between ideal resistive, capacitive, and inductive components and their real-world implementations. The s... Date Added: 2009-05-22 00:33:09 |
| ENTC463Key and Coupling.pdf Path: Texas A&M >> ENTC >> 463 Fall, 2008 Description: Chapter 11 Keys and Couplings ENTC 463 Mechanical Design Applications II Keys and Couplings Keys Machine elements placed at the interface between a shaft and the hub of a gear, sprocket, or sheave to transmit torque Couplings Machine elements u... Date Added: 2009-05-22 00:33:37 |
| 380 Total Productive Maintenance.pdf Path: Texas A&M >> ENTC >> 380 Fall, 2008 Description: The Need for TPM Total Productive Maintenance ENTC 380 Think of productive equipment as we think of our cars or telephones They are ready to go when we need them They need not run all the time to be productive For this concept to function proper... Date Added: 2009-05-22 00:33:53 |
| figure2.ps Path: Minnesota >> CSCI >> 4061 Fall, 2008 Description: %!PS-Adobe-3.0 %Creator: Windows PSCRIPT %Title: THR2CHR2.XLC %BoundingBox: 18 9 593 784 %DocumentNeededResources: (atend) %DocumentSuppliedResources: (atend) %Pages: (atend) %BeginResource: procset Win35Dict 3 1 /Win35Dict 290 dict def Win35Dict beg... Date Added: 2009-05-22 00:34:57 |
| BI505.Lecture25.pdf Path: BU >> BI >> 505 Fall, 2009 Description: BI 505 Lecture 25 Evolution of Paired Appendages 2 Finnerty [based on Gilbert, Developmental Biology, 5e, chapter 18 and Gerhardt Evolution, chapter 10] In the previous lecture, I covered: 1). the molecular mechanisms ... Date Added: 2009-05-22 00:35:54 |
| fall07exam1.pdf Path: Princeton >> COS >> 217 Fall, 2009 Description: COS 217 Midterm Fall 2007 Please write your answers clearly in the space provided. For partial credit, show all work. State all assumptions. You have exactly 50 minutes for this exam. This midterm is open book, open notes. Put your name on every pag... Date Added: 2009-05-22 00:36:17 |
| fall07exam1.pdf Path: Princeton >> EXAM >> 217 Fall, 2009 Description: COS 217 Midterm Fall 2007 Please write your answers clearly in the space provided. For partial credit, show all work. State all assumptions. You have exactly 50 minutes for this exam. This midterm is open book, open notes. Put your name on every pag... Date Added: 2009-05-22 00:36:17 |
| 0223.pdf Path: Princeton >> COS >> 511 Spring, 2009 Description: COS 511: Foundations of Machine Learning Rob Schapire Scribe: Brendan Miller Lecture #6 February 23, 2006 1 1.1 Vapnik-Chervonenkis Dimension Occams Razor with the VC Dimension Last time, we proved: with probability 1 , h H, if h is consistent ... Date Added: 2009-05-22 00:36:47 |
| LLT121L18.pdf Path: Missouri State >> LLT >> 121 Fall, 2008 Description: Lecture 18 Good morning and welcome to LLT121 Classical Mythology. In the next two or three class periods, we will be considering the goddess Artemis and her twin brother Apollo, two deities who, to a greater or lesser, extent represent this idea tha... Date Added: 2009-05-22 00:39:30 |
| Chapter 18 – Common Markets.ppt Path: Oregon State >> BA >> 543 Fall, 2008 Description: Chapter 18 Common Markets Where Stocks Trade First Market Trading on an Exchange Physical Floor and Membership Examples: NYSE and AMEX Via Dealer Markets Second Market Trading of non-listed Stocks Third Market Trading of listed stocks ... Date Added: 2009-05-22 00:41:25 |
| BA352 lecture ch7.ppt Path: Oregon State >> BA >> 352 Fall, 2008 Description: Chapter Seven Motivation II: Equity, Expectancy, and Goal Setting 7-1a Chapter Seven Outline Adam\'s Equity Theory of Motivation The IndividualOrganization Exchange Relationship Negative and Positive Inequity Expanding the Equity Concept Practica... Date Added: 2009-05-22 00:41:40 |
| nch15.pdf Path: Sveriges lantbruksuniversitet >> ECON >> 435 Fall, 2009 Description: Estimation of Dynamic Causal Effects (SW Chapter 15) A dynamic causal effect is the effect on Y of a change in X over time. For example: The effect of an increase in cigarette taxes on cigarette consumption this year, next year, in 5 years; The eff... Date Added: 2009-05-22 00:42:44 |
| CBET000796.txt Path: Harvard >> CFA >> 000700 Fall, 2009 Description: Electronic Telegram No. 796 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E... Date Added: 2009-05-22 00:44:47 |
| lab2.pdf Path: SUNY Buffalo >> MATH >> 306 Fall, 2009 Description: 306 Lab 2 Assignment Direction Fields and IVPs (1) (2) (3) Log in to your eng/nsm account. (Try your person number as password if this is the first time.) Start Maple: click once on the Maple icon that is in the \"UB\" menu at the lefthand end of the ... Date Added: 2009-05-22 00:44:49 |
| ex2c.pdf Path: Minnesota >> MATH >> 2263 Fall, 2008 Description: ... Date Added: 2009-05-22 00:45:58 |
| hw01.pdf Path: Texas >> PHY >> 392 Fall, 2008 Description: PHY 392T: The IGERT class Homework # 1. Due 5 p.m. January 31st. Problem 1: We define the adjoint operator the following way: x A! y = Ax y . Prove that if A is a linear operator, then A* is linear. Problem 2: Prove the following property of adjoi... Date Added: 2009-05-22 00:48:36 |
| Thermo.pdf Path: UCLA >> CHE >> 212 Fall, 2009 Description: ... Date Added: 2009-05-22 00:48:48 |
| license.txt Path: Texas >> ISCHOOL >> 36463 Fall, 2009 Description: License granted by Anne Petrimoulx (petrimoulx@gmail.com) on 2008-04-30T03:48:59Z (GMT): NON-EXCLUSIVE PRESERVATION AND DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to the School of In... Date Added: 2009-05-22 00:48:55 |
| license.txt Path: Texas >> ISCHOOL >> 2081 Fall, 2009 Description: License granted by Anne Petrimoulx (petrimoulx@gmail.com) on 2008-04-30T03:48:59Z (GMT): NON-EXCLUSIVE PRESERVATION AND DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to the School of In... Date Added: 2009-05-22 00:48:55 |
| TesarSmolenskyLearnability2000_Extract.pdf Path: UCLA >> PEOPLE >> 201 Fall, 2009 Description: 1 Language Learning 1.1 What This Book Is About This book argues that the linguistic framework of Optimality Theory (OT) (Prince and Smolensky 1993) makes possible a particularly strong union of the interests of language learnability and linguistic... Date Added: 2009-05-22 00:49:09 |
| proj03.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: All that is necessary for evil to succeed, IS THAT GOOD MEN do nothing. Edmund Burke ... Date Added: 2009-05-22 00:50:06 |
| 1-exr.pdf Path: MNSU >> CSC >> 464 Fall, 2009 Description: CHAPTER 1 Introduction Practice Exercises 1.1 1.2 1.3 1.4 What are the three main purposes of an operating system? What are the main differences between operating systems for mainframe computers and personal computers? List the four steps that are ... Date Added: 2009-05-22 00:51:00 |
| 06_objects_for_organizing_data.pdf Path: Auburn >> COMP >> 0200 Fall, 2009 Description: Objects for Organizing Data COMP 0200 Fall 1999 Dr. Hendrix Computer Science and Software Engineering Auburn University Dean Hendrix, 1999 - Computer Science and Software Engineering Course Notes Slide 1 Objects and for Organizing Data Associate... Date Added: 2009-05-22 00:51:28 |
| Dimmick.pdf Path: Auburn >> AG >> 1988 Fall, 2009 Description: Wildlife Benefits from Conservation Tillage Ralph W. Dimmick and William G. Minser1 Abstract Conservation tillage benefits wildlife by retaining vegetative residues on the surface. These residues provide food above the soil surface, cover for nesti... Date Added: 2009-05-22 00:51:30 |
| 0502-walling-towbwilson.pdf Path: Virginia Tech >> USA >> 1917 Fall, 2009 Description: Walling in Greenwich, CT to William B. Wilson in Washington, DC [May 2, 1917] 1 Letter to Secretary of Labor William B. Wilson in Washington, DC, from William English Walling in Greenwich, Connecticut, May 2, 1917 Original in State Department Recor... Date Added: 2009-05-22 00:54:14 |
| hw3.pdf Path: Washington University in St. Louis >> CSE >> 241 Fall, 2008 Description: CSE 241 Algorithms and Data Structures Spring Semester, 2008 Homework 3 February 12, 2008 Due Date: February 19 1. (45 points) Prove a lower bound for the following three problems. (a) (15 points) You are given an array votes of size 4 with each e... Date Added: 2009-05-22 00:55:12 |
| section24.pdf Path: Penn State >> GEOEE >> 408 Spring, 2008 Description: ... Date Added: 2009-05-22 00:55:32 |
| redotest2Fall2002.pdf Path: Whittier >> ORGANIC >> 0203 Fall, 2009 Description: Whittier College Organic Chemistry: CHEM 231A Redo of Test # 2 40 Points Total Due November 8, 2002 1. Consider the following molecules with the following pKa values: (10 points) O H N H OH H O O O O pKa 1a. 1b. 1c. 1d. 1e. 2. 2a. 2b. 16 4.8 20 ... Date Added: 2009-05-22 00:58:38 |
| Microsoft_Word_-_SC_progress_Nov_30_to_Dec_07.pdf Path: Wisconsin >> BME >> 300 Fall, 2008 Description: Title: Device for acute rehabilitation of the paretic hand after stroke Team: Sasha Cai Lesher-Prez (Leader) Carly Brown (Communicator) Lee Linstroth (BSAC) Nathan Kleinhans (BWIG) Date: November 30 December 7, 2007 Project Design Statement: Design ... Date Added: 2009-05-22 00:59:11 |
| ProblemSet3.pdf Path: Berkeley >> ECON >> 241 Fall, 2008 Description: Economics 241B Fall 2008 Problem Set 3 (Due November 6, 2008) Problem 1. Suppose fYt : (AR(1) model 1 t T g is an observed strictly stationary time series generated by the 1 X i=0 i 0 \"t i ; Yt = where j 0 j 2 (0; 1) and \"t It can be shown that i:... Date Added: 2009-05-22 00:59:13 |
| notes06.pdf Path: University of Illinois, Urbana Champaign >> CS >> 373 Fall, 2008 Description: CS 373: Theory of Computation Manoj Prabhakaran Mahesh Viswanathan Fall 2008 1 1 Operations on Languages Operations on Languages Recall: A language is a set of strings We can consider new languages derived from operations on given languages 1 ... Date Added: 2009-05-22 01:00:00 |
| slide18.pdf Path: Virgin Islands >> CSC >> 200901 Fall, 2009 Description: Fundamentals of Multimedia, Chapter 18 Chapter 18 Content-Based Retrieval in Digital Libraries 18.1 How Should We Retrieve Images? 18.2 C-BIRD A Case Study 18.3 Synopsis of Current Image Search Systems 18.4 Relevance Feedback 18.5 Quantifying Resul... Date Added: 2009-05-22 01:00:22 |
| Lesson6- Static Methods.pdf Path: Lincoln U. CA >> CSCI >> 3381 Fall, 2009 Description: Object-Oriented S/W Development with Java CSCI 3381 Lesson 6: Static Methods January 29, 2008 1 Object-Oriented S/W Development with Java CSCI 3381 Outline Static Methods Use Method Doesn\'t Need to Access Object\'s State Method only needs to acces... Date Added: 2009-05-22 01:01:31 |
| OralEvaluation.pdf Path: ECCD >> SYSC >> 4907 Fall, 2009 Description: Department of Systems and Computer Engineering 4TH YEAR Oral Presentation EVALUATION SHEET Date: _ Check one: Group Number STUDENT Supervisor Time : _ FACULTY (Name) Student Name Room: _ _ Quality of Work Total Quality of Presentation 10 10 20 1... Date Added: 2009-05-22 01:02:23 |
| lecture12-handout.pdf Path: Wisconsin >> BMI >> 776 Fall, 2009 Description: BMI/CS 776 Lecture #12: Insertion/deletion models Colin Dewey 2007.03.01 1 Substitution models Substitution models only describe change in state of nucleotide positions the deletion and insertion of nucleotide positions? Z X ACTA GCTT P[X|Z] = PAG... Date Added: 2009-05-22 01:02:58 |
| 2000Quiz1.pdf Path: Berkeley >> IB >> 200 Fall, 2008 Description: Integrative Biology 200A \"PRINCIPLES OF PHYLOGENETICS\" Spring 2000 Quiz 1 You may use any books, notes, or references, but you must work independently of other people. To keep the amount of writing under control, please confine the answers to the sp... Date Added: 2009-05-22 01:03:19 |
| mgt354 quizz1 sp09 ppts.ppt Path: UNC Wilmington >> MGT >> 354 Fall, 2009 Description: Strategies and Processes for Successful New Products Introduction Importance of Technological Innovation Technological innovation now the single most important driver of competitive success in many industries Many firms earn over one-third of sale... Date Added: 2009-05-22 01:06:43 |
| Keegan_5e_03.ppt Path: UNC Wilmington >> INB >> 442 Fall, 2009 Description: Chapter 3 The Global Trade Environment: Regional Market Characteristics and Preferential Trade Agreements Introduction This chapter looks at Global trade organizations Four types of agreements Individual countries and their preferential trade ag... Date Added: 2009-05-22 01:07:00 |
| EBD 482 International Structure 1-2009.ppt Path: UNC Wilmington >> PEOPLE >> 482 Fall, 2009 Description: Structure and Strategies EBD 482, Spring 2009 Galbraith Economic Trends Production Trends Consumption Trends Technology Trends What is going on With U.S. Trade? Physical Barriers Border checks for Technical Barriers Goods (standards)... Date Added: 2009-05-22 01:07:49 |
| 303FreeWillNewYorkTimes.pdf Path: Emory >> DES >> 303 Fall, 2009 Description: Free Will: Now You Have It, Now You Dont - New York Times http:/www.nytimes.com/2007/01/02/science/02free.html?ei=5087&en=f. January 2, 2007 Free Will: Now You Have It, Now You Dont By DENNIS OVERBYE Correction Appended I was a free man until the... Date Added: 2009-05-22 01:10:28 |
| 10-12-03Sowing the Wind- What Went Wrong.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Sowing the Wind- What Went Wrong? October 12, 2003 By MARGARET MACMILLAN When did it all start in the Middle East? The question encompasses Israel, oil, the shaky Persian Gulf states, the United States\' involvement, the much-touted confrontation b... Date Added: 2009-05-22 01:11:48 |
| 2005-04-07Congress Seeks Pardon for Boxing Champion Johnson.txt Path: Western Kentucky University >> TXT >> 202 Fall, 2009 Description: Congress Seeks Pardon for Boxing Champion Johnson Apr 7, 2005 http:/www.boston.com/sports/other_sports/boxing/articles/2005/04/07/congress_seeks_pardon_for_boxing_champion_johnson?mode=PF WASHINGTON (Reuters) - U.S. lawmakers are seeking a presiden... Date Added: 2009-05-22 01:12:12 |
| assignments2009-5.pdf Path: UMass (Amherst) >> BE >> 640 Fall, 2009 Description: Assignment 5. Multiple Linear Regression Applications using Nutrition and Activity Data collected via repeated 24 hour Recalls. Problems (Note: Any SAS output should include program documentation.) This assignment investigates the importance of the ... Date Added: 2009-05-22 01:13:11 |
| Sec9.1web.pdf Path: Ohio State >> STA >> 245 Fall, 2009 Description: Sec. 9.1: Numerical Summaries of Categorical Variables Years of school completed by age, 1994 (millions of people) Age Group Education < High School High School College, 1 3 College, 4+ Total 25 to 34 5.7 14.5 11.9 9.8 35 to 64 14.2 31.5 19.1 22.9 6... Date Added: 2009-05-22 01:15:35 |
| Hwk1sol.pdf Path: Ohio State >> STA >> 427 Fall, 2009 Description: STATISTICS 427 SOLUTIONS FOR HOMEWORK 1 Chapter 1 2a. n=4 Distances: (e.g. 10 yd, 12.1 yd, 30.0 yd, 25.2 yd ) Winter 2005 *22. Skewed to the right. Gap between 600 and 650, but that does not make the observations between 650 and 750 outliers they... Date Added: 2009-05-22 01:16:23 |
| agenda20031120a.pdf Path: Arkansas >> DEPTS >> 20031120 Fall, 2009 Description: ATTACHMENT A ADD, CHANGE OR DELETE PROGRAM OR UNIT Complete this form consistent with the instructions in Academic Policy 1622.20. Use the form to add, change, or delete a program or unit. Proposed additions and changes must be consistent with Academ... Date Added: 2009-05-22 01:17:14 |
| m3.pdf Path: Purdue >> CS >> 555 Fall, 2008 Description: 2 B 9 6 v v 7 p 6 (6 e8!s@v0W@vR!8 B H H v E z smaarW@v85(q nBh 8 W8 6 9 d a E z h w ed \' \' a@a@0kspq nB!X r0) B 6 9 q h E z h H E 6 YHtsq GBDGq z h X V E C B 7 6 4 2 1 %) \' % # Bsa!WU5A9!5 !n3(0(... Date Added: 2009-05-22 01:17:18 |
| Elec311-Fall2006-outline.pdf Path: Contra Costa College >> ELEC >> 311 Fall, 2009 Description: CONCORDIA UNIVERSITY DEPARTMENT OF ELECTRICAL AND COMPUTER ENGINEERING Course Outline ELEC 311 Electronics I (Fall 2006) INSTRUCTORS Professor Chadi Assi (CIISE Department) Section W: Tuesdays/Thursdays, 11:45-13:00, Room H-1070 Office: CB410-13, Tel... Date Added: 2009-05-22 01:17:27 |
| 0119-engdahl-onstokes.pdf Path: Virginia Tech >> USA >> 1918 Fall, 2009 Description: Engdahl: Rose Pastor Stokes Asks to Rejoin SPA [Jan. 1918] 1 Rose Pastor Stokes Asks Privilege to Return to Socialist Party Ranks. by J. Louis Engdahl Published in The Eye Opener (Chicago), v. 9, no. 26 (Jan. 19, 1918), pg. 4. There is considerab... Date Added: 2009-05-22 01:19:09 |
| AssemblyTemplate.pdf Path: Arizona >> ECE >> 372 Fall, 2008 Description: PORTA equ $1000 PACTL equ $1026 org $8000 ;to RUN in UofA EEPROM expanded mode org $8000; to RUN in RAM: org $40, * *allocate space for the variable * main ldaa staa #$04 ;disable $103F watchdog * *put your code here * end org fdb $FFFE main RESET... Date Added: 2009-05-22 01:19:26 |
| F-090-exam.648.008.pdf Path: IUPUI >> DN >> 648 Fall, 2009 Description: STUDENT EXAMINATION NUMBER INDIANA UNIVERSITY SCHOOL OF LAW - INDIANAPOLIS 530 WEST NEW YORK STREET INDIANAPOLIS, INDIANA 46202-3225 FINAL EXAMINATION (NUMBER 008) FOR INCOME TAXATION OF INDIVIDUALS, FIDUCIARIES, BENEFICIARIES, AND BUSINESS ASSOCIATI... Date Added: 2009-05-22 01:21:06 |
| 0907-hillquit-wcunity.pdf Path: Virginia Tech >> USA >> 1921 Fall, 2009 Description: Hillquit: Working Class Political Unity [Sept. 7, 1921] 1 Working Class Political Unity by Morris Hillquit Published in the New York Call, v. 14, no. 250 (Sept. 7, 1921), pg. 7. The immediate importance of the political cooperation resolution has ... Date Added: 2009-05-22 01:22:00 |
| Lecture26_03_14_03.pdf Path: Georgia Tech >> ECE >> 3050 Fall, 2008 Description: ... Date Added: 2009-05-22 01:24:02 |
| solid_motor_ballistic_calc.pdf Path: Georgia Tech >> AE >> 6450 Fall, 2008 Description: Internal Burning Motor Dt Typical Requirements Ab(t) (t), tb Unsteady variables po(t), m(t), . L Design Variables propellant, Dt, Ab(t), L Question given initial grain geometry - how to calculate temporal profiles Solid Motor Design Example ... Date Added: 2009-05-22 01:27:04 |
| REBIRTH OF DESIGN.pdf Path: Alabama >> MKT >> 410 Fall, 2008 Description: ... Date Added: 2009-05-22 01:28:08 |
| mt84_1.pdf Path: Berkeley >> MATH >> 113 Fall, 2000 Description: Math H113 First Midterm Exam Professor K. Ribet Fall, 1984 These questions were given on an 50-minute exam in 1984. The textbook was probably Hersteins Topics in Algebra. 1. Suppose that G is a nite group. a. Dene what is meant by the order of an e... Date Added: 2009-05-22 01:30:36 |
| 12.4.pdf Path: LSU >> PHYS >> 4112 Fall, 2008 Description: ... Date Added: 2009-05-22 01:31:12 |
| estimation.pdf Path: Neumont >> IFT >> 6145 Fall, 2009 Description: Vision par ordinateur: Estimation de param`tres e Sbastien Roy e Jean-Philippe Tardif Dpartement dInformatique et de recherche oprationnelle e e Universit de Montral e e Hiver 2007 Au programme 1 Dcompositions utiles e Optimisation ou estimation ... Date Added: 2009-05-22 01:32:29 |
| optic1.pdf Path: Neumont >> IFT >> 6145 Fall, 2009 Description: IFT 6145 Vision tridimensionelle Estimation du mouvement I Sbastien Roy e Dpartement d\'informatique et de recherche oprationelle e e Universit de Montral e e hiver 2005 En bref. Chapitre 8 du livre Trucco & Verri. Squences d\'images. e Mouvement, f... Date Added: 2009-05-22 01:32:31 |
| 0303-toc.ps Path: UCLA >> MATH >> 0303 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.76 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: bslconts.dvi %CreationDate: Sat Aug 28 08:26:46 1999 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: TimesGamma-Bold TimesGamm... Date Added: 2009-05-22 01:32:35 |
| HW8.ps Path: Virginia Tech >> CS >> 5034 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.58 Copyright 1986, 1994 Radical Eye Software %Title: HW8.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips HW8 -o HW8.ps %DVIPSParameters: dpi=400, comments removed %DVIP... Date Added: 2009-05-22 01:33:44 |
| Devoir3.pdf Path: Neumont >> IFT >> 3512 Fall, 2009 Description: IFT 3512: DEVOIR 2 Patrice Marcotte ` A remettre le mardi 16 mars 2004 1 Soit le programme mathmatique e min x2 + 4x2 2x1 10x2 1 2 x2 x 1 + 1 x1 + x 2 1 x1 + x 2 3 x2 x1 1. (20 points) Dterminer gomtriquement les directions de Zoutendijk,... Date Added: 2009-05-22 01:33:56 |
| Demo9.pdf Path: Neumont >> IFT >> 1571 Fall, 2009 Description: DEMONSTRATION 10 Semaine du 26 mars 2001 1. Rsoudre le probl`me de ot maximal du sommet 1 au sommet 6 dans le graphe ci-dessous, ` laide e e a de lalgorithme dtiquetage e en utilisant des chemins contenant aussi peu darcs que possible ; en utili... Date Added: 2009-05-22 01:34:47 |
| Chapter11.pdf Path: Union College >> PHYSICS >> 110 Fall, 2009 Description: Waves Chapter 11.2 11.5 Transverse vs longitudinal Frequency f, wavelength , period T, wave speed v = f Harmonic waves: y(x) = Asin(kx); with k = 2/ Traveling waves: y(x, t) = Asin(kx +/ t); with = 2f T For waves on a string v = m / L Total ... Date Added: 2009-05-22 01:36:14 |
| 3.3 - Graphics in the Media.doc Path: Pine Manor College >> BI >> 289 Fall, 2009 Description: BI289 - Biostatistics Chapter 3 - Visual Displays of Data 3.3 - Graphics in the Media Learning Goal Understand how to interpret the many types of more complex graphics that are commonly found in news media. 1. A multiple bar graph is a simple extens... Date Added: 2009-05-22 01:36:56 |
| 4.3 - Measures of variation.doc Path: Pine Manor College >> BI >> 289 Fall, 2009 Description: BI289 - Biostatistics Chapter 4 - Describing Data: 4.3 - Measures of variation Learning Goal Understand and interpret these common measures of variation: range, the fivenumber summary, and standard deviation. Definition: The range of a set of data v... Date Added: 2009-05-22 01:36:56 |
| Lab-9-RevA.pdf Path: Mich Tech >> EE >> 2302 Fall, 2009 Description: EE-2302 Passive Filters and Frequency Response Objective The student should become acquainted with simple passive filters for performing highpass, lowpass, and bandpass operations. The experimental tasks also provide an introduction to Complex Freque... Date Added: 2009-05-22 01:40:18 |
| A.syst.model.pdf Path: Mich Tech >> EE >> 2160 Fall, 2009 Description: ... Date Added: 2009-05-22 01:41:20 |
| 1953rcs1-3.pdf Path: Neumont >> EN >> 1952 Fall, 2009 Description: Supreme Court of Canada Campbell v. Minister of National Revenue, [1953] 1 S.C.R. 3 Date: 1952-10-07 Thomas Campbell Appellant; and The Minister Of National Revenue Respondent. 1952: June 5; 1952: October 7. Present: Kerwin, Kellock, Locke, Cartwrigh... Date Added: 2009-05-22 01:42:06 |
| 5200_L15.pdf Path: Mich Tech >> EE >> 5240 Fall, 2009 Description: ... Date Added: 2009-05-22 01:42:54 |
| 5200_L11.pdf Path: Mich Tech >> EE >> 5200 Fall, 2008 Description: ... Date Added: 2009-05-22 01:43:00 |
| 5200_L20.pdf Path: Mich Tech >> EE >> 5200 Fall, 2008 Description: ... Date Added: 2009-05-22 01:43:03 |
| PDR_Revw.pdf Path: Mich Tech >> EE >> 4900 Fall, 2008 Description: EE4901 Preliminary Design Review & Feedback ECE Senior Design Nov 29, 2007 Evaluated by (check one): _ Project Sponsor _ MTU Faculty Evaluation of Team No. _ _ MTU Professional Staff _ Industry/External Evaluate and comment on the draft project ... Date Added: 2009-05-22 01:43:27 |
| summarysp2008.pdf Path: Georgia Tech >> ECE >> 4601 Fall, 2008 Description: ECE4601 SUMMARY REVIEW 1. Channel Capacity a. AWGN Channel Capacity 2. Probability a. Bayes\' theorem b. Moments, covariance, generating functions c. Gaussian, multivariate Gaussian 3. Random Processes a. Definition b. Strict stationary and wide sens... Date Added: 2009-05-22 01:44:37 |
| 1962rcs0-661.doc Path: Neumont >> CSC >> 1962 Fall, 2009 Description: Supreme Court of Canada Koutsogiannopoulos alias Pulos v. Prahales alias Panos, [1962] S.C.R. 661 Date: 1962-06-11 Xenophon Koutsogiannopoulos alias Pulos (Plaintiff) Appellant; and Dame Mary Speros Prahales alias Panos et al. (Defendants) Respondent... Date Added: 2009-05-22 01:44:53 |
| cost Path: A.T. Still University >> DIP >> pp Spring, 2009 Description: ... Date Added: 2009-05-22 23:23:16 |
| m08(1) Path: University of Toronto >> MATH >> MAT157 Spring, 2009 Description: ... Date Added: 2009-05-24 20:48:17 |
| Deflation_Slides Path: UCLA >> ECON >> 161 Winter, 2004 Description: Figure 1. The Post Civil War Deflation, 18691879 Log of Price Level Romer BalkeGordon 0 5 10 15 20 25 30 35 60 50 40 30 20 10 0 10 Log of Real GDP Romer BalkeGordon 1869 1871 1873 1875 1877 1879 1869 1871 1873 1875 1877 1879 220 200 ... Date Added: 2009-05-26 13:58:36 |
| signaling.pdf Path: Delaware >> CHEM >> 527 Fall, 2008 Description: CHEM 527 Epinephrine Signaling and Glycogen Metabolism FG09_43_90201.JPG Adenylyl cyclase GPCR-Adenylyl Cyclase Signaling 1 Adenylyl Cyclase Signaling Adenylyl.mov 2 Hormone binds GPCR dissociating G-GTP inactive adenylyl cyclase I. active... Date Added: 2009-05-26 15:21:12 |
| EC3.pdf Path: SUNY Buffalo >> PSY >> 250 Fall, 2009 Description: PSY250 Extra Credit 3 Sawusch Spring, 2009 Extra Credit Assignment 3 Due Date: Monday, March 30 at class Instructions: Below is a description of a research study. Please read it and answer the following. 1. What is (are) the dependent variable(s)?... Date Added: 2009-05-26 15:23:03 |
| acm113ps6.ps Path: Caltech >> ACM >> 113 Fall, 2008 Description: #;#acm113ps6.ps#kw#% ~_#5}k1tsJR{ Uj#A# @#`#qqxjj~ ~ ^M<|:|sq - =x#7_? nn#w/\'#p~`W[s._)6_ #{? o<)\"~S4#b,\":~w_m#/yyy#Ko } IE |^~}~}{K<s_? & #xx~psx #n#6oo#o... Date Added: 2009-05-26 15:26:11 |
| Kim et al (2008).pdf Path: UGA >> BCMB >> 8120 Fall, 2008 Description: A RT I C L E S Regulation of TORC1 by Rag GTPases in nutrient response Eunjung Kim1,3,4, Pankuri Goraksha-Hicks2,4, Li Li1, Thomas P. Neufeld2,5 and Kun-Liang Guan1,5 TORC1 (target of rapamycin complex 1) has a crucial role in the regulation of cell... Date Added: 2009-05-26 15:32:44 |
| mousestat.pdf Path: Pittsburgh >> CS >> 0447 Fall, 2008 Description: 1/20/2009 Check Yourself: Mouse Status CS 0447, Spring 2009 I/O Devices Input/output devices interact with program Need a way to get a value from device Input values mapped into memory Known addresses hold the values (I/O address) Use loads a... Date Added: 2009-05-26 15:33:46 |
| spec3.pdf Path: Wisconsin Milwaukee >> CHEM >> 601 Fall, 2008 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>InternalError</Code><Message>We encountered an internal error. Please try again.</Message><RequestId>F678B0D3F33EF583</RequestId><HostId>/AUbpzM6czoN2ihcfQnuxqLf8A3ri3/fFOhw6OxX9hLEpvCk/BJS+AmUmCWcd... Date Added: 2009-05-26 15:33:47 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 2894 Fall, 2009 Description: ! 32146,45268,1046,385 \" 5693,22135,423,1155 \" 5650,55937,523,1198 \" 29792,13485,473,1112 \" 5521,41180,473,1155 \" 5778,17873,448,1155 \" 5821,13660,473,1198 \" 11043,36992,473,1198 \"i 5564,30611,922,2867 *\' 5564,45418,473,1326 7 17207,58006,1071,1027 7... Date Added: 2009-05-26 15:34:03 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 2589 Fall, 2009 Description: \" 19810,17144,449,1081 \" 19949,27376,424,941 \" 19984,43723,424,941 \" 19949,33516,449,976 \" 19915,21312,324,906 \'i 2511,40928,873,3557 * 1813,28974,623,592 *\' 19949,45719,474,976 ; 40353,39780,873,348 > 14788,43972,798,837 ^.a 27134,38008,399,3801 a 3... Date Added: 2009-05-26 15:34:05 |
| Lecture13.ppt Path: Washington >> COURSES >> 311 Fall, 2009 Description: Homework #5 8-11 (20 points) 8-25 (20 points) 8-32 (30 points) from \"Spacetime physics\" Physics 311 Special Relativity Lecture 13: Fusion and Fission. Annihilation. Today\'s lecture plan Converting mass to energy: - fusion - fission - annihilati... Date Added: 2009-05-26 15:36:55 |
| Problem_Set_8.pdf Path: Michigan State University >> SS >> 252 Fall, 2009 Description: Problem Set #8: Chapter 24 1. Provide the products and/or the conditions for the following transformations. NH2 O NaCNBH3 Br 1. NaN3 2. H2/Pd 1. NaCN 2. H2/Pd O NH 1. LiAlH4 2. H2O NH2 1. CH3CH2Br (xs) 2. Ag2O, H2O 3. heat O 1. Br NH O 2. NaO... Date Added: 2009-05-26 15:40:44 |
| Quiz_2_yellow.pdf Path: Michigan State University >> SS >> 252 Fall, 2009 Description: Quiz #2 (25 points) CEM252 A. Name the following alcohols (2pts each): OH Cl Name:_ PID:_ Section:_ Br OH B. Complete the following reactions (3 pts each box): 1. NaBH4 (excess) O 2. H3O+ O O 1. LiAlH4 (excess) 2. H3O+ 1. Hg(OAc)2, H2O 2. NaBH... Date Added: 2009-05-26 15:40:57 |
| Lecture_Notes_1_27.pdf Path: Michigan State University >> SS >> 252 Fall, 2009 Description: ... Date Added: 2009-05-26 15:41:07 |
| quiz6.pdf Path: Wisconsin >> MATH >> 221 Fall, 1992 Description: Math 221 - Calculus Quiz 6 Fall 2006 Name: Date: Section: Complete each of the following problems. Show all work. Make sure to clearly label your answer. Any work that is crossed out will not be assessed. Any incorrect work will be assessed. Make s... Date Added: 2009-05-26 15:48:33 |
| quiz3ans.pdf Path: Wisconsin >> MATH >> 221 Fall, 1992 Description: ... Date Added: 2009-05-26 15:49:51 |
| lect0312.pdf Path: Columbia >> WW >> 2040 Fall, 2009 Description: IEOR 4106: Introduction to Operations Research: Stochastic Models Professor Whitt, Spring 2009 Class Discussion, Thursday, March 12 Staffing a Service System We continued the discussion begun on Tuesday. Here we focused more directly on the infinite-... Date Added: 2009-05-26 15:52:51 |
| Homework-4.pdf Path: Duke >> CPS >> 250 Fall, 2009 Description: CPS-250, Spring 2009 Homework-4 Study of the Poisson Equation Model assumptions : the d-dimensional domain is the Kronecker product of d intervals with one for each dimension, d = 1, 2, 3; the Dirichlet boundary condition. Discretization : the ... Date Added: 2009-05-26 15:57:47 |
| p836-halasz.pdf Path: Pace >> CS >> 835 Spring, 2008 Description: REFLECTIONS ON NOTECARDS: SEVEN ISSUES FOR THE NEXT GENERATION OF HYPERMEDIA NoteCards, developed by a team at Xerox PARC, was designed to support the task of transforming a chaotic collection of unrelated thoughts into an integrated, orderly interpr... Date Added: 2009-05-26 15:59:21 |
| erm0531.pdf Path: Columbia >> YC >> 2154 Fall, 2009 Description: 30 LEARNING EDUCAUSE r e v i e w May/June 2005 THE SPACE BETWEEN: CREATING A CONTEXT FOR Illustration by Gary Clement, 2005 By J.C. Herz W ere in a very strange sort of flux right now, with technology and education and information and the way ... Date Added: 2009-05-26 15:59:37 |
| 76_6_2004.pdf Path: Wash. College >> PAST >> 076 Fall, 2009 Description: 75_6_2004 10/15/04 7:40 PM Page 1 (1,1) THE ELM October 15, 2004 Volume 76, Issue 6 Washington College Established 1930 WC Professors Are Underpaid BY CARLIBORCHERDING The salaries of full professors a t Wa s h i n g t o n C o l l e g e c o n s ... Date Added: 2009-05-26 16:00:40 |
| homework3.pdf Path: University of Dayton >> ACADEMIC >> 218 Fall, 2009 Description: MTH 218 HOMEWORK 3 This homework covers the dot product. 1. Let u = 4, -1, 3, 6 and v = 2, 4, -8, -3 . Find u v. 2. Find a unit vector that is orthogonal to both 4, 2, 0 and 1, 1, 1 . There are two possible answers. 3. Find the scalar and vector p... Date Added: 2009-05-26 16:00:56 |
| MM:MTP_Handbook.pdf Path: Johns Hopkins >> DATA >> 3267 Fall, 2009 Description: The Department of Music Theory The Peabody Conservatory Of the Johns Hopkins University Music Theory Pedagogy Handbook Third Edition 23 May 2008 One East Mount Vernon Place Baltimore, MD 21202-2600 410.659.8100 http:/www.peabody.jhu.edu/theory... Date Added: 2009-05-26 16:02:13 |
| HTAMM_08.pdf Path: Johns Hopkins >> DATA >> 2634 Fall, 2009 Description: How to Apply For the MASTERS DEGREE Admissions Office 2008 Please do not hesitate to call if you have questions or need further assistance. The number is 800-368-2521. If you live in Maryland, or outside of the U.S., call 410-659-8110. 1. 2. 3. Fill ... Date Added: 2009-05-26 16:02:21 |
| conf-analysis.doc Path: George Mason >> CHEM >> 350 Fall, 2008 Description: CONFORMATIONAL ANALYSIS \"FREE\" ROTATION occurs around most non-cyclic single sigma bonds. This rotation may produce different spatial relationships between atoms bonded to the rotating carbons. CONFORMATIONS are the infinite number of non-identical m... Date Added: 2009-05-26 16:02:35 |
| 1984rcs2-603.pdf Path: Neumont >> CSC >> 1984 Fall, 2009 Description: R.C.S CALDWELL STUART 603 Margaret and Caldwell Appellant Director Columbia and Human Rights Code of British Appellant Ian Charles Stuart Principal St Thomas Aquinas High School and The Catholic Public Schools of Vancouver Archdiocese ... Date Added: 2009-05-26 16:03:11 |
| project5.pdf Path: SIU Edwardsville >> CS >> 456 Fall, 2008 Description: CS456 Project #5 OPTIONAL DUE: 11:59 PM, Friday, December 12, 2008 - NO LATE SUBMISSIONS 1 Objectives exposes you to working with an NP-complete problem. indicates you understand the basic concept of approximation algorithms. To code an algorit... Date Added: 2009-05-26 16:03:37 |
| mystery_protein.pdf Path: UNC >> STOR >> 072 Fall, 2008 Description: Mystery Protein#0 Promoter sequence: TTGCACA Terminator sequence: ATTCC - ATCTGAACGTGTTTTTACTGCGGCTAGCTAAGG - TAGACTTGCACAAAAATGACGCCGATCGATTCC Mystery Protein#1 Promoter sequence: AGAT Terminator sequence: GGTT - CCGAAACCTTCAATCCTAGAGGACGTATCTTA... Date Added: 2009-05-26 16:07:21 |
| ParentDiscord.pdf Path: UNC >> SPCL >> 016 Spring, 2009 Description: ... Date Added: 2009-05-26 16:07:44 |
| lecture08.pdf Path: Hudson VCC >> CHEM >> 042 Fall, 2009 Description: ... Date Added: 2009-05-26 16:08:03 |
| 2009 Exam 1 Study Guide.pdf Path: Hudson VCC >> CHEM >> 042 Fall, 2009 Description: Chem 042 Spring 2009 Review for Exam 1 Chapter 1 (all), Chapter 2 (2.1 2.12) To do well on the exam, you should be familiar with the following topics and be able to perform the following exercises (topics that usually present problems are in bold): ... Date Added: 2009-05-26 16:08:12 |
| hw1.pdf Path: UCSD >> CENG >> 101 Fall, 2008 Description: CENG101B Heat Transfer Winter Quarter 2008 http:/maecourses.ucsd.edu/ceng101b Homework I Due Wednesday January 16, 2008 by 2 pm. Read Chapter 10. Problems: 1. Construct all the non-dimensional parameters that can be obtained for the four problems i... Date Added: 2009-05-26 16:09:48 |
| StyleNameChart.pdf Path: UNC >> READ >> 3535386 Fall, 2009 Description: Reconciling With the Recent Past, Style Name Chart, NAPC, Baltimore, 2006 Compiled by Jeanne Lambin, National Trust for Historic Preservation, jeanne_lambin@nthp.org Style Name A-Frame Abstract Regional Abstract/Technological Bubble House Contractor ... Date Added: 2009-05-26 16:10:12 |
| EC202 Spring term Answers 1.pdf Path: East Los Angeles College >> EC >> 202 Fall, 2009 Description: University of Essex Department of Economics Spring term 2008-09 EC 202 Spring term Problem Set 1 1. Assume a monopolist operates in a market with demand given by P = 100 - 4Q . Marginal cost is constant at 4. (a) What is the profit maximising qua... Date Added: 2009-05-26 16:10:38 |
| 070708_caries.pdf Path: UNC >> OBIO >> 720 Fall, 2008 Description: Caries Diagnosis and Caries Risk Assessment Dr. Luiz Pimenta Department of Dental Ecology Prevention Luiz A Pimenta DDS,MS, PhD Clinical Professor Dental Ecology - UNC Relationship between Etiological Factors Behavioral and Socio-economic factors ... Date Added: 2009-05-26 16:11:53 |
| VLT3.SummaryTable.Program.doc Path: N.E. Illinois >> CIS >> 3340 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 38 39 40 41 42 43 45 46 47 48 50 51 52 53 IDENTIFICATION DIVISION. PROGRAM-ID. SAMPLE1F. * * THIS PROGRAM: * * 1. READS THE ITEM FILE AND LOADS ITEMS ... Date Added: 2009-05-26 16:12:06 |
| SCALE+grant+final+revised+version.doc Path: UNC >> READ >> 5019538 Fall, 2009 Description: SCALE Grant Proposal Survey Date: Name: March 9, 2009 SMART PATH Service Learning for Social Justice: Developing Critical Literacies for Urban Learners, and Generative Teaching Skill for Urban Schools North Carolina Agricultural & Technical State Uni... Date Added: 2009-05-26 16:13:09 |
| MeadesRanch.pdf Path: Maryville MO >> NRS >> 409 Fall, 2009 Description: Slide 5 of 21 Datums: NAD 27 Slide 6 of 21 A Tourist Destination for Geospatial Geeks and Nerds This Car Visited Meades Ranch ... Date Added: 2009-05-26 16:14:35 |
| lesson10_solutions.pdf Path: Idaho >> MATH >> 144 Fall, 2008 Description: ... Date Added: 2009-05-26 16:15:20 |
| Lecture2.pdf Path: Duke >> PHY >> 042 Fall, 2009 Description: Physics 42 Lecture 2 Outline Some exercises with Coulombs Law Electric charge carriers Properties of conductors and insulators Charging by contact and induction Introduction of the electric field Physics 42 January 13, 2006 Electrostatics (charged o... Date Added: 2009-05-26 16:15:37 |
| dentist-joint2.pdf Path: Brookdale >> CS >> 4150 Fall, 2009 Description: toothache catch cavity cavity L L toothache catch L catch catch .108 .012 .016 .064 .072 .008 .144 .576 L ... Date Added: 2009-05-26 16:15:56 |
| uniform.pdf Path: Duke >> MATH >> 204 Spring, 2008 Description: 1. Uniform convergence. Suppose X is a set and (Y, ) is a metric space. We let B(X, Y ) be the set of bounded functions from X to Y ; that is, f B(X, Y ) if f : X Y and diam rng f < . For each f, g B(X, Y ) we set (f, g) = sup{(f (x), g(x)) : x X... Date Added: 2009-05-26 16:18:46 |
| math158n01.txt Path: Sveriges lantbruksuniversitet >> MATH >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: MATH 158-3 N01 LOCATION: KAM TITLE: CALCULUS-SOC.SCI II SECTION TYPE: SEC SEMESTER: 1996-3 ENROL: 1 ... Date Added: 2009-05-26 16:19:16 |
| kin142d01.txt Path: Sveriges lantbruksuniversitet >> KIN >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: KIN 142-3 D01 LOCATION: SFU TITLE: INTRO KINESIOLOGY SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 17... Date Added: 2009-05-26 16:19:20 |
| geog313d01.txt Path: Sveriges lantbruksuniversitet >> GEOG >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: GEOG 313-4 D01 LOCATION: SFU TITLE: GEOMORPHOLOGY II SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 72... Date Added: 2009-05-26 16:20:39 |
| Syllabus.pdf Path: Southern Oregon >> ECON >> 5032 Fall, 2009 Description: College of Continuing Education The University of Oklahoma Advanced Programs Course Title: Course Number: Managerial Economics I (Micro) ECON 5032-101 Course Description: The course is designed to give students a framework for analyzing contemporary... Date Added: 2009-05-26 16:24:20 |
| 303lec2fall08.ppt Path: CSU Bakersfield >> LECTURES >> 303 Fall, 2009 Description: Lectur e 2 (Cha pter 5) M ethods to Study the Br a i n M ethods of \"Seei ng\" the Li vi ng Br a i n CT M RI PET fM RI Br ai n i magi ng Computed Tomography CT SCAN X-ray of brain beams passed thr ough the head i mages devel oped on sensi ti ... Date Added: 2009-05-26 16:24:34 |
| syllabus.pdf Path: Iowa State >> LSSU >> 151 Fall, 2009 Description: MATH 151: Calculus I Textbook: Essential Calculus, Early Transcendentals, James Stewart Instructor: George Voutsadakis Office: CAS 206J Phone: 635-2667 Email: gvoutsad@lssu.edu URL: http:/www.voutsadakis.com/teach.html Office hours: MTWRF 9:00-9:50 F... Date Added: 2009-05-26 16:26:00 |
| hwk4.pdf Path: Iowa State >> LSSU >> 111 Fall, 2009 Description: HOMEWORK 4 - MATH 111 DUE DATE: Wednesday, October 19 INSTRUCTOR: George Voutsadakis Read each problem very carefully before starting to solve it. Each question is worth 1 point. It is necessary to show your work. Correct answers without explanations... Date Added: 2009-05-26 16:26:30 |
| exam3.pdf Path: Iowa State >> LSSU >> 111 Fall, 2009 Description: EXAM 3 - MATH 111 Wednesday, March 26, 2003 INSTRUCTOR: George Voutsadakis Read each problem very carefully before starting to solve it. Each question is worth 3 points. It is necessary to show your work. Correct answers without explanations are wort... Date Added: 2009-05-26 16:26:40 |
| hwk1.pdf Path: Iowa State >> LSSU >> 140 Fall, 2009 Description: HOMEWORK 1 - MATH 140 DUE DATE: Wednesday, September 8 INSTRUCTOR: George Voutsadakis Read each problem very carefully before starting to solve it. One part of each homework problem will be chosen at random and graded. Each question is worth 1 point.... Date Added: 2009-05-26 16:27:09 |
| bnsf UTA_presentation_04252006.pdf Path: UT Arlington >> MARK >> 4325 Fall, 2008 Description: BNSF BNSF Railway and China 2006425 April 25th, 2006 University of Texas at Arlington 0 Agenda Video: Connecting Your Market to the World The Worlds Leading Railroad BNSF BNSF Railway and China 1 Video: Connecting Your Market to the Worl... Date Added: 2009-05-26 16:27:39 |
| submit.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: executable = pass6_72125.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs72000-72499/72125... Date Added: 2009-05-26 16:28:57 |
| submit.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: executable = pass6_72087.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs72000-72499/72087... Date Added: 2009-05-26 16:30:18 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 18:30:34 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 19:48:42 2008 ( 4688 s elapsed) ... Date Added: 2009-05-26 16:30:20 |
| ECE567_08S_hw5soln.pdf Path: Illinois Tech >> ECE >> 567 Fall, 2009 Description: ECE 567 STATISTICAL SIGNAL PROCESSING Homework Assignment #5 Solutions SPRING 2008 1. We have x(n) N (0, 2 ) and 1 ^ 2 = N 1 ^ E[ 2 ] = N so it\'s unbiased. The variance is ^ ^ var[ 2 ] = E ( 2 - 2 )2 ^ ^ = E ( 2 )2 - 2 2 2 + 4 ^ ^ = E ( 2 )2 ... Date Added: 2009-05-26 16:34:13 |
| MT_summary_v5_May30_2007.doc Path: UC Riverside >> CERT >> 308 Fall, 2009 Description: Summary of WRAP RMC BART Modeling for Montana Draft #5 May 30, 2007 More Information: http:/pah.cert.ucr.edu/aqm/308/bart.shtml Montana BART Webpage: http:/www.deq.state.mt.us/AirQuality/Visibility.asp This document summarizes the preliminary CALMET/... Date Added: 2009-05-26 16:35:53 |
| MT_summary_v5_May30_2007.doc Path: UC Riverside >> PAH >> 308 Fall, 2009 Description: Summary of WRAP RMC BART Modeling for Montana Draft #5 May 30, 2007 More Information: http:/pah.cert.ucr.edu/aqm/308/bart.shtml Montana BART Webpage: http:/www.deq.state.mt.us/AirQuality/Visibility.asp This document summarizes the preliminary CALMET/... Date Added: 2009-05-26 16:35:53 |
| Bugle_EC.pdf Path: UC Riverside >> CERT >> 308 Fall, 2009 Description: WRAP Base02a CMAQv4.4 Bugle Plot EC (+) Goal (-) Goal IMPROVE (+) Criteria STN (-) Criteria 200 150 Fractional Bias (%) 100 50 0 -50 -100 -150 -200 0 1 2 3 4 5 6 7 8 Average Concentration (ug/m3) 200 Fractional Error (%) 150 100 50 0 0 ... Date Added: 2009-05-26 16:35:56 |
| The_Saber_Tooth_Curriculum.pdf Path: TCNJ >> PAN >> 501 Fall, 2009 Description: ... Date Added: 2009-05-26 16:36:48 |
| Food_webs_web.pdf Path: University of Hawaii - Hilo >> OCN >> 621 Fall, 2009 Description: Food Webs K.Selph, OCN 621 Spring 2009 Relatively few species Yet: 1) High diversity in terms of trophic mode, e.g., herbivory, carnivory, mixotrophy, omnivory 2) Trophic level changes with developmental phase (egg to adult) within a species 3) Pre... Date Added: 2009-05-26 16:37:54 |
| lect_39_section_3.pdf Path: Wisconsin >> ME >> 361 Fall, 2008 Description: ... Date Added: 2009-05-26 16:39:33 |
| 20b.pdf Path: CNU >> LEC >> 152 Fall, 2009 Description: CAPACITANCE A capacitor consists of 2 pieces of conductor which are not touching each other. Suppose a charge Q is transferred from one side to the other. This creates an electric field E. What is the potential difference V between the conductors? V... Date Added: 2009-05-26 16:40:34 |
| 1_9-12.pdf Path: CNU >> LEC >> 401501 Fall, 2009 Description: Vectors (a review) Examples of physical quantities that are scalars: kinetic energy T mass m time t speed v angular speed Examples of physical quantities that are vectors: position r velocity v acceleration a angular velocity force F torque (or mom... Date Added: 2009-05-26 16:40:36 |
| Sol-air.xls Path: Minnesota >> ME >> 5103 Fall, 2008 Description: CALCULATION OF SOLAR TIME MONTH DAY Daylight time? yes = 1, no = 0 Standard Longitude Local Longitude ENTER 3 23 0 Modified 4/2/02 n= \"=nD\" calculations by: J.W. Ramsey CALCULATED 82 59 59.00 intermediate calc. for nD 0.99 0.12 0.40 Coefficient... Date Added: 2009-05-26 16:40:37 |
| Toyli_Cryopreservation_Notes.pdf Path: Minnesota >> ME >> 8381 Fall, 2008 Description: ... Date Added: 2009-05-26 16:43:53 |
| mod46.pdf Path: Minnesota >> ME >> 3331 Fall, 2008 Description: A First Course in Thermodynamics 2006 F. A. Kulacki Review Dalton Model Gibbs-Dalton Law Gibbs- Thermodynamic Properties Molal basis Molar basis The Mixing Process The Gibbs Theorem A First Course in Thermodynamics 2006 F. A. Kulacki A ... Date Added: 2009-05-26 16:46:48 |
| Probset4.pdf Path: UNL >> M >> 953 Fall, 2009 Description: Homework 4: Math 953 Spring 2005 Due February 14, 2005 (1) Do problem 1.8 on p. 66 of the text. Also give an example showing that (U, ) need not be right exact [consider using an example from class]. (2) Do problem 1.16 on p. 67 of the text. [For par... Date Added: 2009-05-26 16:47:15 |
| quiz05b.pdf Path: UNL >> MATH >> 104 Fall, 2008 Description: Math 104-004 . 5 Answers to Quiz # 5b 2 05 Oct 07 1. Find the derivative of f (x) = (ex 3x2 )ex Solution. Using the product rule (see page 231 of the text), we have f (x) = d x 2 2 e 3x2 ex + (ex 3x2 ) ex dx 2 2 = ex 6x ex + (ex 3x2 )ex (2x)... Date Added: 2009-05-26 16:47:34 |
| ex4m208F07Key.pdf Path: UNL >> MATH >> 208 Fall, 2008 Description: Exam 4 Key Name: Math 208 Score: Fall 2007 Show your work in the spaces provided below for full credit. Use the reverse side for additional space, but clearly so indicate. You must clearly identify answers and show supporting work to receive any c... Date Added: 2009-05-26 16:48:04 |
| GamblersRuin.xls Path: UNL >> MATH >> 428 Spring, 2008 Description: A B C D E F G H 1 Gambler\'s Ruin 2 Press Shift-F9 to recalculate a new game. 3 Player Bankroll $3 4 House Bankroll $30 5 6 Summary of Game 7 Player Winninngs Player Win Probability 8 House Winnings House Win Probability 9 Number of Flips 90 10 11 Ran... Date Added: 2009-05-26 16:48:10 |
| project.pdf Path: Oakland University >> CSE >> 40746 Fall, 2009 Description: Department of Computer Science and Engineering CSE 40746 Advanced Database Projects Spring 2009 FINAL PROJECT 1. Purpose A group-work project where you will design, build, test, and document a major database driven system with web front-end. Groups ... Date Added: 2009-05-26 16:49:00 |
| sol4.pdf Path: Oakland University >> CSE >> 60111 Fall, 2009 Description: CSE 60111 Complexity and Algorithms Spring Semester, 2009 Assignment 4 1. The idea is to modify the breadth first search and store the number of elements that are smaller than x in a counter. To do so, we keep a queue q of elements in H that we are ... Date Added: 2009-05-26 16:49:00 |
| qual.pdf Path: Laurentian >> CHEM >> 200301 Fall, 2009 Description: Pictures of Sulfide Precipitates as they are Produced in Qualitative Analysis Atomic Line Spectra The colours you see in the flame tests in Experiments #1 and #3 are a composite of the atomic line emissions for the exited-states of those ions in the... Date Added: 2009-05-26 16:49:05 |
| PolymericSystems.pdf Path: Syracuse >> PHY >> 615 Fall, 2008 Description: Polymeric Nano-Systems Used in Drug Delivery Arsen Simonyan SUNY-ESF Types of Nano-Sized Drug Delivery Vehicles Nanosuspensions Nanowires Polymeric Nanoparticles Benefits of Polymer S... Date Added: 2009-05-26 16:53:06 |
| 2008-10-Montes.ppt Path: Rutgers >> MS >> 320 Fall, 2008 Description: Climate change in Bellingshausen Sea: Impact on primary productivity and carbonate system Dr. Martin Montes-Hugo Coastal Ocean Observation Lab Institute of Marine and Coastal Sciences Climate induced along-shelf changes in phytoplankton communities ... Date Added: 2009-05-26 16:53:30 |
| C4.2.pdf Path: Rutgers >> HOME >> 107 Fall, 2009 Description: ... Date Added: 2009-05-26 16:54:55 |
| prf_presentation.pdf Path: Acton School of Business >> ELEC >> 525 Fall, 2008 Description: Partitioning Register Files to Reduce Access Time Kyle Bryson, John Kim, Supratik Majumder, Julie Rosser April 22, 2003 Register Files Register files will grow Search for ILP Register access latencies will increase Wire delay increases with regi... Date Added: 2009-05-26 16:55:06 |
| lect17.pdf Path: Rutgers >> RUT >> 541 Fall, 2009 Description: Chap. 8: Sample Mean iid X1 ; : : : ; Xn , each with PDF fX x The sample mean of X is the rv M n X = X1 + + Xn n Remember Mn X is a rv! Mn X is not the expected value E X 1 Mean and Variance of Mn X Observation: E Mn X =E X =0 Var Mn X =... Date Added: 2009-05-26 16:55:52 |
| boundary layer example.doc Path: Fayetteville State University >> EML >> 3016 Fall, 2009 Description: Flow past a flat plate has a laminar boundary layer. The boundary layer growth can be x described as = 5 , while the momentum thickness can be expressed as U x = 0.664 . where x is the distance measured from the leading edge of the plate, U U is t... Date Added: 2009-05-26 16:56:14 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
