Course Solutions And Notes - FinalReview 12
| sets.ps Path: SUNY Albany >> CSI >> 311 Fall, 2009 Description: %! %Creator: devps (Pipeline Associates, Inc.) %CreationDate: Tue Mar 7 13:32:09 2006 %Pages: (atend) %DocumentFonts: (atend) /X{exch}def /r{rmoveto}def /m{moveto}def /l{lineto}def /rl{rlineto}def /lc{yc X xc X l st}def /mc{yc X xc X m}def /el{gs /a ... Date Added: 2009-04-27 20:03:28 |
| t3Spring08.doc Path: Kennesaw >> SCIENCE >> 3310 Fall, 2009 Description: CSIS3310 Test # 3. Spring/2008 1) Describe two mechanisms that can significantly improve the performance of your queries (one paragraph). 2) Why do we use a pseudo-file ? 3) In the lab that we connected Visual Basic .NET to MS-Access and then Visua... Date Added: 2009-04-27 20:04:30 |
| chain4.pdf Path: Charleston Law >> MA >> 490 Fall, 2009 Description: ... Date Added: 2009-04-27 20:08:22 |
| readme.txt Path: East Los Angeles College >> ENVI >> 1400 Fall, 2009 Description: FEDERAL CLIMATE COMPLEX GLOBAL SURFACE SUMMARY OF DAY DATA VERSION 7 (OVER 9000 WORLDWIDE STATIONS) 08/24/2006 ** ... Date Added: 2009-04-27 20:09:31 |
| col7.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 110 Fall, 2008 Description: ECE 110 M.-C. Brunet IV Characteristic: What is it? Example 1: I I C ( v - + It is the equation I = f(V) 2 is the relationship between I and V) v I + I= xV+ For one particular connection of the circuit C, we get one point (v, i) on the ... Date Added: 2009-04-27 20:12:11 |
| PS01.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 313 Fall, 2008 Description: University of Illinois Spring 2009 ECE 313: Problem Set 1 Calculus Review Due: Reading: Noncredit Exercises: Wednesday January 28 at 4 p.m. Ross Chapter 1.11.4, Chapter 2.12.5. Chap. 1: Probs. 1-5,7,9. Theoretical exercises 4,8,13. Self-test probs.... Date Added: 2009-04-27 20:12:33 |
| HE1soln.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 313 Fall, 2008 Description: H eeteGhGtxpxuokolvq tpj tpGtfGtxk p h f p ~ l p s i s w l s r h r p i p o{ HsXy@xpxukmlyxxzGGnml H rr zz uu ww kk kk ww pp pp kk rr ss HsXy@xpxukmlyxxzGGnml H r z u w k k w p ... Date Added: 2009-04-27 20:13:14 |
| Lecture 1 Process, Requirements and Use Cases.pdf Path: UCSD >> CSE >> 111 Fall, 2008 Description: Lecture 1: Processes, Requirements, and Use Cases 1 Development Processes Early Days: evolve a system Build and fix Leads to chaos Need for intelligent design Waterfall Model Requirements, Design, Code, Tests, Maintenance 2 Rational Unified... Date Added: 2009-04-27 20:14:25 |
| l_spr_st.txt Path: Michigan State University >> GEO >> 7515 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR THE SENEY AREA DIVISION: EAST UPPER TOWN: 45N COUNTY: SCHOOLCRAFT RANGE: 13W LATITUDE: 46d 17m SECT.: 17 LONGITUDE: 85d 57m ... Date Added: 2009-04-27 20:19:59 |
| tmen_st.txt Path: Michigan State University >> GEO >> 6507 Fall, 2009 Description: 1952-1980 STATISTICAL SUMMARY FOR PETOSKEY DIVISION: NORTHWEST LOWER TOWN: 34N COUNTY: EMMET RANGE: 06W LATITUDE: 45d 22m SECTION: 01... Date Added: 2009-04-27 20:20:18 |
| g8650_st.txt Path: Michigan State University >> GEO >> 5531 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR MIO DIVISION: NORTHEAST LOWER TOWN: 26N COUNTY: OSCODA RANGE: 02E LATITUDE: 44d 40m SECTION: 12 LONG... Date Added: 2009-04-27 20:20:41 |
| tmin_st.txt Path: Michigan State University >> GEO >> 2395 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR THE EAST LANSING AREA # DIVISION: SOUTH CENTRAL LOWER TOWN: 03N COUNTY: INGHAM RANGE: 02W LATITUDE: 42d 40m SECTION:... Date Added: 2009-04-27 20:23:02 |
| gdd55_st.txt Path: Michigan State University >> GEO >> 4104 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR IRONWOOD DIVISION: WEST UPPER TOWN: 47N COUNTY: GOGEBIC RANGE: 47W LATITUDE: 46d 28m SECTION: 16 L... Date Added: 2009-04-27 20:23:27 |
| dpg10_st.txt Path: Michigan State University >> GEO >> 4104 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR IRONWOOD DIVISION: WEST UPPER TOWN: 47N COUNTY: GOGEBIC RANGE: 47W LATITUDE: 46d 28m SECTION: 16 ... Date Added: 2009-04-27 20:23:28 |
| dpg50.txt Path: Michigan State University >> GEO >> 8251 Fall, 2009 Description: TRAVERSE CITY FAA AP DIVISION: 3 STATION #8251 ... Date Added: 2009-04-27 20:24:55 |
| annual.pdf Path: Michigan State University >> GEO >> 3769 Fall, 2009 Description: 28 YEAR SUMMARY OF ANNUAL VALUES FOR HESPERIA (3769) Y E A R TEMPERATURE (F) MEANS EXTREMES MEAN MEAN MONTH HIGH- DATE LOW- DATE MAX MIN MEAN EST EST TOTAL NUMBER OF DEGREE DAYS HEAT COOL PRECIPITATION (IN) LIQ. EQUIV. SNOWFALL AMT. GREATEST AMT. GRE... Date Added: 2009-04-27 20:26:19 |
| dpg10_st.txt Path: Michigan State University >> GEO >> 4244 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR KALAMAZOO DIVISION: SOUTHWEST LOWER TOWN: 02S COUNTY: KALAMAZOO RANGE: 11W LATITUDE: 42d 17m SECTION: 21 ... Date Added: 2009-04-27 20:28:37 |
| gss.txt Path: Michigan State University >> GEO >> 0647 Fall, 2009 Description: Growing Season Summary Station: (200647) BEECHWOOD_7_WNW Years: 1971 To 2000 Missing Data: 33.9% Base Date of Last Spring Occurrence Date of First Fall Occurrence Tem... Date Added: 2009-04-27 20:30:00 |
| g8650.txt Path: Michigan State University >> GEO >> 4090 Fall, 2009 Description: IRON MOUNTAIN DIVISION: 1 STATION #4090 ... Date Added: 2009-04-27 20:31:52 |
| tmp1_nm.txt Path: Michigan State University >> GEO >> 7280 Fall, 2009 Description: TEMPERATURE (F) SUMMARY FOR ST. JOHNS FOR THE 30 YEAR PERIOD 1951-1980 DIVISION: SOUTH CENTRAL LOWER TOWN: 07N COUNTY: CLINTON RANGE: 02W LATITUDE: 43d 01m SECTION: 09 LON... Date Added: 2009-04-27 20:32:36 |
| txg90_st.txt Path: Michigan State University >> GEO >> 7280 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR ST. JOHNS DIVISION: SOUTH CENTRAL LOWER TOWN: 07N COUNTY: CLINTON RANGE: 02W LATITUDE: 43d 01m SECTION: 09 ... Date Added: 2009-04-27 20:32:39 |
| prec_nm.txt Path: Michigan State University >> GEO >> 4954 Fall, 2009 Description: PRECIPITATION SUMMARY FOR LUDINGTON FOR THE 30 YEAR PERIOD 1951-1980 DIVISION: WEST CENTRAL LOWER LAT.: 43d 54m TOWN: 18N SEC.: 31 COUNTY: MASON LONG.: 86d 24m RANGE:... Date Added: 2009-04-27 20:33:39 |
| prec_nm.txt Path: Michigan State University >> GEO >> 5816 Fall, 2009 Description: PRECIPITATION SUMMARY FOR NEWBERRY FOR THE 30 YEAR PERIOD 1951-1980 DIVISION: EAST UPPER LAT.: 46d 20m TOWN: 45N SEC.: 01 COUNTY: LUCE LONG.: 85d 30m RANGE:... Date Added: 2009-04-27 20:35:28 |
| prssn_st.txt Path: Michigan State University >> GEO >> 8167 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR THOMPSONVILLE DIVISION: NORTHWEST LOWER TOWN: 35N COUNTY: BENZIE RANGE: 14W LATITUDE: 44d 31m SECTION: 36... Date Added: 2009-04-27 20:36:03 |
| gss.txt Path: Michigan State University >> GEO >> 5452 Fall, 2009 Description: Growing Season Summary Station: (205452) MILFORD_GM_PROVING_GROUND Years: 1971 To 2000 Missing Data: 6.9% Base Date of Last Spring Occurrence Date of First Fall Occurrence Tem... Date Added: 2009-04-27 20:37:29 |
| dtnl0.txt Path: Michigan State University >> GEO >> 3319 Fall, 2009 Description: GRAND MARAIS 1 SE DIVISION: 2 STATION #3319 ... Date Added: 2009-04-27 20:37:59 |
| tmin_st.txt Path: Michigan State University >> GEO >> 2381 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR EAST JORDAN DIVISION: NORTHWEST LOWER TOWN: 32N COUNTY: CHARLEVOIX RANGE: 07W LATITUDE: 45d 09m SECTION: 2... Date Added: 2009-04-27 20:39:01 |
| mtmin.txt Path: Michigan State University >> GEO >> 5184 Fall, 2009 Description: MARQUETTE WSO AP DIVISION: 1 STATION #5184 ... Date Added: 2009-04-27 20:39:47 |
| gdd40_st.txt Path: Michigan State University >> GEO >> 0032 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR ADRIAN DIVISION: SOUTHEAST LOWER TOWN: 06S COUNTY: LENAWEE RANGE: 03E LATITUDE: 41d 55m SECTION: 36 LO... Date Added: 2009-04-27 20:41:09 |
| 111final_equations.doc Path: Towson >> CHEM >> 111 Fall, 2008 Description: B. MISCELLANEOUS CONSTANTS AND EQUATIONS R = 8.3145 J/(mol K)= 0.08206 L atm/(mol K) = 1.9872 cal/(mol K) Go = Ho TSo G = H TS Log k = Log A Ea 2.303 RT Log (k2/k1) = Ea [(1/T2) (1/T1)] 2.303 R Go = nFEo G = Go + 2.303 RT Log Q sg = kHPg PA = XA... Date Added: 2009-04-27 20:45:06 |
| Exam I.doc Path: Clayton >> CHEM >> 2411 Fall, 2009 Description: Chemistry 2411 Exam 1 February 7, 2006 Name: _ This exam consists of 17 questions on 5 pages. Please write your name at the top of each page. Read all of the questions carefully. If there is anything that is unclear, please ask. Answers should be p... Date Added: 2009-04-27 20:45:13 |
| 3404-T2.pdf Path: Allan Hancock College >> MATH >> 3404 Fall, 2009 Description: MATH3404, Tutorial Problems 2 (week 3) To encourage your participation, the course coordinator introduce a peer assessment in tutorials. Instructions are: 1. Ask you to complete an answer to a problem with * from the tutorial problem sheet before eac... Date Added: 2009-04-27 20:46:11 |
| IC220_S09_Set9_Ch3.pdf Path: Naval Academy >> IC >> 220 Spring, 2009 Description: ADMIN Reading Read 2.4 3.1, 3.2, 3.3 Skim 3.4 Reminder: course paper descriptions due Thurs Feb 26 via plain text email (not MS Word) See details online IC220 Slide Set #9: Computer Arithmetic (Chapter 3) 1 2 Chapter Goals Introduce 2s c... Date Added: 2009-04-27 20:47:19 |
| Duke and Dauphin Essay.doc Path: Penn State >> MQR >> 5017 Fall, 2009 Description: Mallory Ravotti English 15 4-?-07 Duke and Dauphin The duke and the dauphin are two con men who Huck and Jim rescue as they are being run out of a river town. The dauphin, whose real name was Edmund Kean, was the older man who claimed to be the son ... Date Added: 2009-04-27 20:48:57 |
| 2005929_r01o_042297.pdf Path: Stanford >> OVTI >> 1031 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 DOUGLAS J. CLARK, State Bar No. 171499 JARED L. KOPEL, State Bar No. 126817 CAMERON P. HOFFMAN, State Bar No. 229316 WILSON SONSINI GOODRICH & ROSATI Professional Corporation... Date Added: 2009-04-27 20:49:27 |
| 092207 WS4 Notes.doc Path: Oregon State >> CH >> 121 Summer, 2008 Description: Chemistry 121 Worksheet 4 Notes 1. Oregon State University Dr. Richard L Nafshun Which of the following sets of elements will form a molecular compound? Explain. (a) Ni and Cu. No. These are two metals. (b) Li and F. No. One metal and one non-metal... Date Added: 2009-04-27 20:49:50 |
| Sunscreen Pre-lab.pdf Path: Oregon State >> CH >> 221 Fall, 2008 Description: Sunscreen Pre-lab 1. What is the relationship between energy and wavelength? 2. Why does the light around us only cause a few electronic transitions? 3. What is a photon? 4. What is Intensity? How is it measured? 5. State Beer\'s Law and define al... Date Added: 2009-04-27 20:50:04 |
| RE618_04F_FAS.pdf Path: Wichita State >> RE >> 618 Fall, 2008 Description: Real Estate Investment Analysis Fall 2004 Final Exam - Version A Solutions Dr. Stanley D. Longhofer MW 9:30-10:45 1) (30 points) Brady Enterprises (BE) is planning on opening a new 120,000 square foot call center in Wichita. They have found a suitab... Date Added: 2009-04-27 20:54:19 |
| RE618_03F_MT2AS.pdf Path: Wichita State >> RE >> 618 Fall, 2008 Description: Real Estate Investment Analysis Fall 2003 Midterm Exam 2 Version A Solutions Dr. Stanley D. Longhofer Tu-Th 11:00-12:15 1) (20 points) Jen is selling an apartment building Pueblo, Colorado. According to the terms of the sale contract, Jen will rece... Date Added: 2009-04-27 20:54:22 |
| 7426-2008-09-sum-reading-guide.rtf Path: Allan Hancock College >> LAW >> 7426 Fall, 2009 Description: Law 7426 International Copyright Law (2008) Monash Law Prof. P. Bernt Hugenholtz Reading Guide Class # 1 (24 Nov) Introduction; Copyright basics P. Goldstein, International Copyright: 5 Protection Under Copyright and Neighboring Rights [this chapter... Date Added: 2009-04-27 20:54:44 |
| CHAP 12v1.rtf Path: Maryville MO >> CHE >> 534 Fall, 2009 Description: ELECTROCHEMICAL IMPEDANCE SPECTROSCOPY. Introduction. Electrochemical impedance spectroscopy is a recent tool in corrosion laboratories that is slowly making its way into the service environment as units are decreased in size and become portable. Imp... Date Added: 2009-04-27 20:55:47 |
| AA210a_Homework_3_08_09.pdf Path: Stanford >> AA >> 210 Fall, 2009 Description: AA210A HOMEWORK #3 2008-2009 Due October 28 Reading: Chapters 5, 6, 7 and 8 Problems: Chapter 5 - Problems 1, 3, 4, 6 and 12 Chapter 6 - Problem 1 Chapter 7 - Problems 2, 4 Chapter 8 - Problems 2, 3, and 8 1 10/13/08 ... Date Added: 2009-04-27 20:56:15 |
| rec2.pdf Path: Minnesota >> CSCI >> 4011 Fall, 2008 Description: CSci 4011, Spring 2007 Group Work 2 due: February 1, 2007 If there are N people in your group, then the N/2 group members with the longest \"commute\" to this class should work on Problem 1 today, while the rest work on Problem 2. Remember to record al... Date Added: 2009-04-27 20:56:34 |
| 23-06nov16Matlabscript.pdf Path: Cornell >> CS >> 100 Fall, 2008 Description: 16 November Matlab We spend the rest of the semester looking at the programming language Matlab. This language has variables, if-statements, loops, methods (called functions and procedures), like Java. But it has no OO concepts. Instead, its operatio... Date Added: 2009-04-27 20:58:27 |
| an_introduction.pdf Path: MSMC NY >> BIO >> 408 Fall, 2009 Description: ! # % $ $ $ % % $ $ % (% % ! % % \' % $ $ % (% % $ ) % * ! \" % % $ \' 0 \' 2 % % 1 \' Communities ! 0 % 3 0 -44- *$ $ $ \' & \' % 0 \' 5 $ $ % % $ 1$ % 0 % ) $ 0 0 * % % $ $ $ $ %$ ... Date Added: 2009-04-27 21:00:40 |
| C216W09HW7.pdf Path: CSU San Bernardino >> C >> 216 Fall, 2009 Description: CHEMISTRY 216 General Chemistry II: Principles of Chemical Reactions Winter Term, 2009 Homework Assignment #7 (12 points) Due: Monday, March 2, 2009 1. The dissociation of chlorine molecules into chlorine atoms (Cl2(g) 2 Cl(g) has an equilibrium con... Date Added: 2009-04-27 21:03:46 |
| C208F08quiz3v2.pdf Path: CSU San Bernardino >> C >> 208 Fall, 2009 Description: CHEMISTRY 208 Survey of Human Biochemistry Fall Term, 2008 Quiz #3 (Yellow Version) (6 points) Friday, October 17, 2008 CH3 O CH2 C H Name _ In each of the following, indicate the correct answer by circling the appropriate letter. 1. Oxidation of C... Date Added: 2009-04-27 21:04:19 |
| 006 Comparative square and triangle spectra.xls Path: East Los Angeles College >> GM >> 4068 Fall, 2009 Description: Square Triangle Harmonic wave wave number Frequency amplitude amplitude 0 0.00 0.00 1 100 100.00 100.00 3 300 33.33 11.11 5 500 20.00 4.00 7 700 14.29 2.04 9 900 11.11 1.23 11 1100 9.09 0.83 13 1300 7.69 0.59 15 1500 6.67 0.44 17 1700 5.88 0.35 19 19... Date Added: 2009-04-27 21:05:13 |
| d3lb2-3.txt Path: Cincinnati >> CAS >> 253 Fall, 2009 Description: Turbo Assembler Version 3.1 10/16/99 15:14:39 Page 1 D3LB3-3.TXT 1 2 0000 STACKSG SEGMENT PARA STACK 3 4 0000 STACKSG ENDS 5 6 0000 DATASG SEGMENT PARA 7 0000 ... Date Added: 2009-04-27 21:05:36 |
| 4 Semivowels (approximants).pdf Path: East Los Angeles College >> GM >> 4068 Fall, 2009 Description: Figure 1. /r@/ vs /l@/ Figure 2. /ri/ vs /li/ Semivowels (approximants).doc: CTS Page 1 11/04/05 ... Date Added: 2009-04-27 21:05:41 |
| JAN_65.pdf Path: Penn State >> BUB >> 1965 Fall, 2009 Description: ... Date Added: 2009-04-27 21:06:35 |
| hw11_solutions.pdf Path: Rochester >> ME >> 226 Fall, 2009 Description: Introduction to Solid Mechanics Homework #11 Solutions ... Date Added: 2009-04-27 21:06:58 |
| first_order_logic.pdf Path: Sanford-Brown Institute >> CS >> 141 Fall, 2009 Description: CS 141 Introduction to AI Greenwald Lecture 13: First-Order Logic 10:30 AM, Mar 10, 2009 Contents 1 Overview 2 Syntax 3 Semantics 4 Substitution 5 Logical Entailment 5.1 5.2 Logical Inference: Natural Deduction . . . . . . . . . . . . . . . . . . ... Date Added: 2009-04-27 21:07:17 |
| air_plate.pdf Path: Michigan State University >> T >> 962 Fall, 2009 Description: ... Date Added: 2009-04-27 21:08:41 |
| e2e-protocols.pdf Path: UCSC >> CMPE >> 257 Winter, 2008 Description: Wireless and Mobile Networks CMPE 257 Spring 2006 End-to-End Protocols CMPE 257 - Wireless and Mobile Networking 1 Announcements Exam: June 7th in class. Project presentations and demos: June 12th. 4-7pm. CMPE 257 - Wireless and Mobile Netwo... Date Added: 2009-04-27 21:12:06 |
| XMLDTDs.ppt Path: Cal Poly Pomona >> CIS >> 311 Fall, 2009 Description: DTDs - Defining Data Format Guthrie, Winter 2002 Review XML documents .xml all about data customized tags Data Type Definition (DTDs) All data defined in your XML document follows rules that you set up called a Schema. Document is said to be ... Date Added: 2009-04-27 21:13:17 |
| cis283_lect3_F07_4p.pdf Path: CSU LA >> CIS >> 283 Fall, 2009 Description: LECTURE 3: Object Concepts CIS 283 Introduction to Application Programming Fall 2007 Instructor: Dr. Song Xing Outline Introduction to objects and methods Creating objects The String class Packages Formatting output Enumerated types Introduction to ... Date Added: 2009-04-27 21:17:25 |
| cis100_03_PowerPointWF.pdf Path: CSU LA >> CIS >> 100 Fall, 2009 Description: Office 2003 Introductory Concepts and Techniques Microsoft PowerPoint Web Feature Creating a Presentation on the Web Using PowerPoint Objectives Preview and save a presentation as a Web page Create a new folder using file management tools View ... Date Added: 2009-04-27 21:17:35 |
| cis484_S08_lect1_4p.pdf Path: CSU LA >> CIS >> 484 Fall, 2009 Description: LECTURE 1: Introduction to Network Communications CIS 484 Outline Network Communications Elements of a Network Transmission Speed Network Types Basic Configurations of Networks Client/Server vs. P2P The internets IP Address Management Home/Small Of... Date Added: 2009-04-27 21:17:45 |
| cis100_F06_PowerPointWF.pdf Path: CSU LA >> CIS >> 100 Fall, 2009 Description: Office 2003 Introductory Concepts and Techniques Microsoft PowerPoint Web Feature Creating a Presentation on the Web Using PowerPoint Objectives Preview and save a presentation as a Web page Create a new folder using file management tools View ... Date Added: 2009-04-27 21:18:16 |
| cis410_W06_lect1_3p.pdf Path: CSU LA >> CIS >> 410 Fall, 2009 Description: LECTURE 1: Systems Architecture CIS 410 Hardware and Software Architecture Winter 2006 Instructor: Dr. Song Xing Department of Information Systems California State University, Los Angeles Learning Objectives Describe the activities of information s... Date Added: 2009-04-27 21:18:32 |
| hw6.pdf Path: U. Houston >> ECE >> 6341 Fall, 2008 Description: ECE 6341 Spring 2009 Homework 6 1. Use integration by parts to asymptotically evaluate the following integral: I ( ) = e - x cos ( x ) dx . 0 1 2. Use the stationary-phase method to asymptotically evaluate the Bessel function J n ( x ) for larg... Date Added: 2009-04-27 21:19:49 |
| Assignment 3.pdf Path: U. Houston >> CIVE >> 7397 Fall, 2008 Description: CIVE 7332 Groundwater Transport Fall 2007 Assignment 3 Due: Oct 23, 2007 Solve the following problems from your textbook: 6-4, 6-6, 6-7, 6-10, 6-12, 6-22, 6-23, 6-24, 6-25, and 6-26. ... Date Added: 2009-04-27 21:19:54 |
| 44 -51.pdf Path: U. Houston >> ECE >> 7366 Fall, 2008 Description: ... Date Added: 2009-04-27 21:20:16 |
| D&Fch16b.doc Path: Berkeley >> ECON >> 161 Fall, 2008 Description: Dornbusch and Fischer chapter 16 Inflation and Unemployment Dynamics II Inflation, expectations, and the aggregate supply curve (1) (4) (10) This is pretty complicated to work with, so let\'s make a bunch of simplifying assumptions: that the only kin... Date Added: 2009-04-27 21:22:43 |
| ex1s08.pdf Path: Boise State >> ECE >> 470 Fall, 2008 Description: ECE470 EXAM #1 SPRING 2008 Instructions: 1. Closed-book, closed-notes, open-mind exam. 2. Work each problem on the exam booklet in the space provided. 3. Write neatly and clearly for partial credit. Cross out any material you do not want graded. ... Date Added: 2009-04-27 21:23:41 |
| exam3-f03.pdf Path: Boise State >> ECE >> 350 Fall, 2008 Description: EE350 Fall 2003 - Exam 3 3 December 2003 Name: _ EE 350 Signals and Systems Fall 2003 Exam #3 One 8 x 11 sheet of notes, and a calculator are allowed during the exam. Write all answers neatly and show your work to get full credit. Rationalize all ... Date Added: 2009-04-27 21:25:37 |
| ILS8ABQ.pdf Path: MSCD >> AES >> 180 Fall, 2009 Description: ALBUQUERQUE, NEW MEXICO LOC/DME I-SPT APP CRS Rwy Idg AL-12 (FA ) 12793 5317 535 MALSR A 5 1 1.9 Chan T 56 For inoperative MALSR, increase Cat D S-LOC 8 visibil ty to RVR 50 0. 079^ TDZE Apt Elev ILS RWY 8 ALBUQUERQUE INTL SUNPORT MIS ED AP RO... Date Added: 2009-04-27 21:26:12 |
| l35.pdf Path: Duke >> CPS >> 100 Fall, 2009 Description: Graphical User Interfaces: GUIs Components Flat Layouts Hierarchical Layouts Designing a GUI Coding a GUI CompSci 100E 35.1 Components JLabel text/image display JTextField single line for text input/output JTextArea multiple lines fo... Date Added: 2009-04-27 21:27:00 |
| slides14.pdf Path: Duke >> CPS >> 108 Fall, 2009 Description: How Java works The java compiler takes a .java file and generates a .class file The .class file contains Java bytecodes, the assembler language for Java programs Bytecodes are executed in a JVM (java virtual machine), the valid bytecodes are specif... Date Added: 2009-04-27 21:27:11 |
| HW5.pdf Path: Maryland >> PHYS >> 260 Fall, 2008 Description: /4n* lltpamo 2 r,q l f :-;:- po,i\"tn .,_ To\'\\o\'c\' Zi3,K p/= qr{T/ ,rt o\' l7 Ys-tlu\"l /l/t \") .8ll\\ I\'PoYo pn rrdcArr[(.\\$Jhdt Vt-3Vo SsjS. . F6 tl nj .l*\"{,. .lO -3 r P.:ans I 3... Date Added: 2009-04-27 21:29:17 |
| n22.pdf Path: Duke >> CPS >> 237 Spring, 2009 Description: Markov Chains for Sampling Sampling: Given complex state space Want to sample from it Use some Markov Chain Run for a long time end up \"near\" stationary distribution Reduces sampling to local moves (easier) no need for global description of st... Date Added: 2009-04-27 21:30:47 |
| moresync6.pdf Path: Duke >> CPS >> 210 Fall, 2009 Description: SharedLock : Reader/Writer Lock A reader/write lock or SharedLock is a new kind of lock that is similar to our old definition: Synchronization: Going Deeper supports Acquire and Release primitives guarantees mutual exclusion when a writer is pres... Date Added: 2009-04-27 21:30:55 |
| test2spr98.pdf Path: Duke >> CPS >> 140 Fall, 2009 Description: CPS 140 Exam 2 Dr. Rodger Spring 1998 1. 16 pts Answer TRUE or FALSE to the following statements. a The pumping lemma for context-free languages can be used to prove a language is context-free. TRUE or FALSE? b If L is a regular language, then the... Date Added: 2009-04-27 21:31:31 |
| L-15.pdf Path: Duke >> CPS >> 102 Fall, 2009 Description: 15 Inclusion-Exclusion Today, we introduce basic concepts in probability theory and we learn about one of its fundamental principles. Throwing dice. Consider a simple example of a probabilistic experiment: throwing two dice and counting the total num... Date Added: 2009-04-27 21:31:59 |
| quiz2key Path: UF >> CHEM >> chm2046 Spring, 2009 Description: Quiz 2A 1. T 2. T 3. F, A and C are equiefficacious 4. F, A is less potent than B 5. F 6. T 7. F, C and B both have the same normal slope 8. F, A and C both have the same normal slope 9. F, A and B both have the same normal slope 10. T 11. T 12. This... Date Added: 2009-04-27 21:35:24 |
| quiz1akey.pdf Path: UNC >> COMP >> 110 Fall, 2007 Description: Name:ANSWERKEY Quiz1a:Objects,Classes,Variables,andExpressions COMP110004 01/28/2009 String myString; /line 1 int myInt = 100; /line 2 myInt = 200; /line 3 / set int z = 100; /line 4 myString = \"This quiz is easy!\"; /line 5 1.Whichofthefollowingo... Date Added: 2009-04-27 21:35:26 |
| chem2100-exam3-blank.pdf Path: Laurentian >> CHEM >> 200203 Fall, 2009 Description: Dr. Kevin Smith NAME: Question Mark Possible INSTRUCTIONS: 4 1 Chemistry 2100 November Quiz 3 (Version A) Stu. No.: 2 3 4 5 6 7 30 minutes Section A or B (circle one) Total 4 4 5 3 5 5 30 1) Please read the exam over carefully before beginn... Date Added: 2009-04-27 21:35:51 |
| intro.pdf Path: Harvard >> M >> 259 Fall, 2009 Description: Math 259: Introduction to Analytic Number Theory What is analytic number theory? One may reasonably define analytic number theory as the branch of mathematics that uses analytical techniques to address number-theoretical problems. But this \"definitio... Date Added: 2009-04-27 21:39:00 |
| Summary8-9.pdf Path: Bard >> MATH >> 142 Fall, 2009 Description: Applications of Taylor Series Summary of Section 8.9 This section has two relatively small, unrelated topics: 1. Using power series to compute limits, and 2. Using partial sums of Taylor series to approximate functions. Limits Using Power Series Wh... Date Added: 2009-04-27 21:43:07 |
| quiz12.doc Path: Hudson VCC >> EE >> 101 Fall, 2009 Description: a) Why Canny edge extraction method over perform other methods? The Canny edge detection method combines the convolution of the image with the Gaussian function G and finds the maxima in the derivative both together in one operation. Local maxima of ... Date Added: 2009-04-27 21:44:01 |
| 00000097.pdf Path: Carnegie Mellon >> TERA >> 05101437 Fall, 2009 Description: ... Date Added: 2009-04-27 21:47:27 |
| lec14s08.pdf Path: George Mason >> BINF >> 630 Fall, 2008 Description: DNA From genes to proteins PROMOTER ELEMENTS Structural Genomics Iosif Vaisman RNA SPLICE SITES TRANSCRIPTION mRNA START CODON SPLICING STOP CODON Email: ivaisman@gmu.edu TRANSLATION PROTEIN Computational Gene Prediction Where the genes ar... Date Added: 2009-04-27 21:47:49 |
| project8.pdf Path: Montana >> MATH >> 441 Fall, 2008 Description: PROJECT 8 Math 441 Due: Tuesday, December 2 All \"by hand\" calculations require that you SHOW YOUR WORK. All MATLAB code and output must be turned in. 1. Discrete Fourier Transform: Do the following in MATLAB. (a) Calculate a random 5 1 vector x. (b)... Date Added: 2009-04-27 21:48:02 |
| Matched_BVP.pdf Path: Montana >> M >> 591 Fall, 2009 Description: This worksheet demonstrates how Maple can be used to find a uniformly valid asymptotic approximation to linear 2-point boundary value problems with Dirichlet boundary conditions. The problem must have the form d d d 2 y(x ) + a(x, ) y(x ) + b... Date Added: 2009-04-27 21:48:28 |
| short.pdf Path: Maryville MO >> ZHANGC >> 072408 Summer, 2009 Description: CULTURAL VALUES REFLECTED WITH CHINESE CHILDREN\'S STORIES Chenyi Zhang Dr. Johnetta Morrison, Dissertation Supervisor ABSTRACT A total of 145 Chinese children\'s stories published from the 1980s to the present were examined to explore the changes ... Date Added: 2009-04-27 21:50:37 |
| InverseTrigDerivs.ppt Path: Adelphi >> M >> 141 Fall, 2009 Description: Calculus I - Fall 2008 Logarithmic Differentiation and Derivatives of Inverse Trig Functions Voting Warmup The derivative of ln(x2-1) with respect to x is: 1) (2x)ln(x2-1) 2) (2x)/(x2-1) 3) (dx)/ln(x2-1) 4) 1 / (x2-1) Logarithmic Differentiation ... Date Added: 2009-04-27 21:51:34 |
| Project 2009.pdf Path: Clarkson >> AE >> 458 Fall, 2009 Description: CLARKSON UNIVERSITY Department of Mechanical and Aeronautical Engineering AE 458 Design of Aircraft Structures Spring 2009 Project 1. Tapered Bar (1-D Static Problem) Consider a tapered bar of circular cross section. The length of the bar is 1m, and... Date Added: 2009-04-27 21:52:37 |
| Delucia07_isCUEconstant_GCB.pdf Path: Arizona >> ECOL >> 596 Fall, 2008 Description: Global Change Biology (2007) 13, 11571167, doi: 10.1111/j.1365-2486.2007.01365.x Forest carbon use efficiency: is respiration a constant fraction of gross primary production? E VA N H . D E L U C I A *, J O H N E . D R A K E w , R I C H A R D B . T ... Date Added: 2009-04-27 21:54:10 |
| 00000038.pdf Path: Carnegie Mellon >> TERA >> 05101532 Fall, 2009 Description: ... Date Added: 2009-04-27 21:54:28 |
| 00000038.pdf Path: Carnegie Mellon >> DISK >> 05101532 Fall, 2009 Description: ... Date Added: 2009-04-27 21:54:29 |
| 00000030.pdf Path: Carnegie Mellon >> TERA >> 05101611 Fall, 2009 Description: ... Date Added: 2009-04-27 21:54:31 |
| WE694P.pdf Path: Ohio State >> WE >> 694 Fall, 2009 Description: Welding engineering 694P Title: Computational Modeling of Microstructure Evolution During Welding/Joining Baker Systems 0281; Monday, Wednesday 0130P to 0248P Instructor: Prof. S. S. Babu; Office Hours: By appointment; Email: babu.13@osu.edu What is ... Date Added: 2009-04-27 21:56:23 |
| q7.pdf Path: Maryland >> C >> 660 Fall, 2009 Description: AMSC/CMSC 660 Quiz 7 , Fall 2004 Show all work. You may leave arithmetic expressions in any form that a calculator could evaluate. By putting your name on this paper, you agree to abide by the universitys code of academic integrity in completing ... Date Added: 2009-04-27 21:56:43 |
| flyer.pdf Path: San Jose State >> EDIT >> 269 Fall, 2009 Description: EDIT 273 Steven J. McGriff Revised: 9/2/03 RUBRIC Flyer (100 points / 10%) Name: _ Create a single-side, one page promotional piece of work (letter, legal, or tabloid size) that is typically posted on a wall and captures attention from 9-12 fee... Date Added: 2009-04-27 21:57:29 |
| lecture4.pdf Path: UCSD >> PHYSICS >> 203 Winter, 2009 Description: ... Date Added: 2009-04-27 21:58:18 |
| Spring term week 2.pdf Path: East Los Angeles College >> SOCS >> 242 Fall, 2009 Description: www.yusu.org/dougsoc 11 York University students were today said to be \'nonplussed\' at the news that two campus bridges were closed. The University might build them, assuming they have enough money left after building the new private health spa for... Date Added: 2009-04-27 21:59:56 |
| sp03_1.pdf Path: Colorado State >> M >> 161 Fall, 2009 Description: @ D 1 D @ D C B A19 7) 9 @ 1 7 5 ( ) 4 3 )2 \'12 ) 1 \' % # \" $ # ! \"! 8 ) 6 ( 2 7 7 G 2 \" ) 5 0 ... Date Added: 2009-04-27 22:00:47 |
| SIch2.pdf Path: New Mexico >> ASTR >> 423 Fall, 2008 Description: e8# 9 ee5P0g!a a0I#e8 a 6 1 0)( h x s w x q x n x n o s x s w u t s m r x k wk k o k w x q x eXvg Xdd$gE 4gXgFvWEg2dqB2g0g2@X0FXdn q k n q I2 9$n w m s j q ... Date Added: 2009-04-27 22:00:54 |
| ishs-1980spring02.pdf Path: N. Illinois >> ISHS >> 1980 Fall, 2009 Description: The Doyle Mission to Massac, 1794 L E L A N D R. J O H N S O N \"A very considerable party of Hostile Indians being now in the vicinity of the intended post,\" wrote Major Thomas Doyle to his commanding officer, General Anthony Wayne, \"every exertion... Date Added: 2009-04-27 22:04:44 |
| 3502(0809)formula-final.pdf Path: ECCD >> STAT >> 3502 Fall, 2009 Description: 1 Computational (or short-cut formula) for the variance, covariance, and correlation 2 = E(X 2 ) [E(X)]2 , Cov(X, Y ) = E(XY ) E(X)E(Y ), (X, Y ) = Cov(X, Y ) . X Y TABLE OF COMMON DISTRIBUTIONS Binomial(n, p) pmf mean and variance Hypergeometric... Date Added: 2009-04-27 22:04:59 |
| 3006107.pdf Path: Michigan State University >> LIB >> 1930 Fall, 2009 Description: June, 1930 107 Special Instruction for Greenkeepers at Pennsylvania State College By H. W. Thurston, Jr. Pennsylvania State College, State College, Pa. The first short course of instruction for greenkeepers given in Pennsylvania was presented in 1... Date Added: 2009-04-27 22:06:17 |
| T3F08vaKey.pdf Path: Maryville MO >> MATH >> 141 Fall, 2009 Description: ... Date Added: 2009-04-27 22:10:23 |
| KeyE3S07(108).pdf Path: Maryville MO >> MATH >> 108 Fall, 2009 Description: ... Date Added: 2009-04-27 22:10:55 |
| 2.1.25.pdf Path: Maryville MO >> MATH >> 307 Fall, 2009 Description: ... Date Added: 2009-04-27 22:12:12 |
| ARCH 4420.doc Path: Georgia Tech >> GTE >> 383 Fall, 2009 Description: ARCH 4420 Prof. Olubi Babalola Ana Maria Taroco Assignment 1 31 AUG 00 A very interesting input-output device is the aid for physically disabled users. This device gives the opportunity for those who have disabilities to be able to learn and work. In... Date Added: 2009-04-27 22:13:08 |
| practice1.pdf Path: CSU San Marcos >> MATH >> 303 Fall, 2009 Description: Review for Exam 1 Name_ Math 303 Spring 2007 Dr. Ramamurthi MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Solve the problem. 1) An election is held among five candidates (A, B, C, D, and E). ... Date Added: 2009-04-27 22:13:59 |
| 103s06key3.pdf Path: Wisconsin >> PHYS >> 103 Fall, 2008 Description: ID: A Physics 103 Exam 3 Answer Section MULTIPLE CHOICE 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: ANS: A D D C A C C... Date Added: 2009-04-27 22:14:07 |
| hw3sol.pdf Path: CSU San Marcos >> MATH >> 544 Fall, 2009 Description: Math 544, Fall 2003 Solutions to Assignment 3 1. Gk is triangle-free: We argue by induction on k. The base case is G1 = K1 . To construct Gk , we take disjoint copies of the graphs G1 , . . . , Gk1 (which are all triangle-free). Hence a triangle must... Date Added: 2009-04-27 22:14:14 |
| cinfo_Spring09.pdf Path: CSU San Marcos >> MATH >> 051 Fall, 2009 Description: California State University San Marcos Math 051C, Intermediate Algebra, Spring 2009 The following 10 course sheets contain information about the policies in this course. These will always be available on the course web site. General course informatio... Date Added: 2009-04-27 22:14:43 |
| r15.pdf Path: San Diego State >> ASTRO >> 660 Fall, 2009 Description: Selected Powerpoint Slides: Lecture 11 (1007.02.27) Note: This slide contains material from more than one class slide. Malmquist bias: A selection effect that occurs when using a magnitude-limited sample of objects, in which only the intrinsically ... Date Added: 2009-04-27 22:15:14 |
| 2005FallExam3.pdf Path: Puget Sound >> MA >> 122 Fall, 2009 Description: Math 122D THIRD HOUR EXAM NAME General Notes: 1. Show work. 2. Look over the test first, and then begin. 3. No calculators on this exam. Friday, Nov. 11, 2005 100 pts. Page 1 I. Work, fluid pressure, and such 1. (15 pts.) The cross section of a t... Date Added: 2009-04-27 22:16:33 |
| assign5_hardware_project.pdf Path: UMBC >> CMPE >> 310 Spring, 2008 Description: CMPE 310 Hardware Project Assigned: Friday, Nov. 3 Due: Friday, Dec. 1 Project Description: Hardware Project Fall 2006 Design a 8086 microprocessor board using Orcad Capture and Layout. Draw the schematic using Capture, export the necessary les fo... Date Added: 2009-04-27 22:16:51 |
| TableDt.xls Path: Wells >> MATH >> 251 Fall, 2009 Description: IPS5e Table D, back flyleaf Upper tail P Two-sided P Degrees of freedom 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 .25 .50 50% 1.000 0.816 0.765 0.741 0.7... Date Added: 2009-04-27 22:17:01 |
| lect2.pdf Path: UMBC >> CH >> 771 Fall, 2009 Description: Computational Intelligence Chapter 10, Lecture 2, Page 1 Conditional independence Random variable X is independent of random variable Y given random variable Z if, for all xi dom(X), yj dom(Y ), yk dom(Y ) and zm dom(Z), P(X = xi |Y = yj Z = z... Date Added: 2009-04-27 22:17:39 |
| kvl_problems.pdf Path: Oregon State >> ECE >> 112 Winter, 2008 Description: ... Date Added: 2009-04-27 22:17:50 |
| kif.pdf Path: UMBC >> CS >> 771 Fall, 1997 Description: Knowledge Interchange Format A review of Sys 3 Know. Base in Lang3 Know. Base in KIF First-Order Logic Using KIF Knowledge Interchange Format Material adapted from Professor Richard Fikes Stanford University KIF ~ First order logic theory An in... Date Added: 2009-04-27 22:18:28 |
| ConstraintSatisfaction.ppt Path: UMBC >> CS >> 471 Fall, 2004 Description: CMSC 471 Constraint Satisfaction Chapter 5 Adapted from slides by Tim Finin and Marie desJardins. Some material adopted from notes by Charles R. Dyer, University of Wisconsin-Madison 1 Overview Constraint satisfaction offers a powerful problem-sol... Date Added: 2009-04-27 22:18:30 |
| E680_PS3_solutions.pdf Path: UMBC >> ENEE >> 680 Fall, 2008 Description: ENEE 680 Problem Set #3 Solutions Fall 2007 1. We have that B/t = C0 x cos t = E. This equation is not sucient to z uniquely dene E. From the denition of the curl, we have Ey Ex = C0 x cos t. z x y The solution to this equation is E = C0 ax C0... Date Added: 2009-04-27 22:18:33 |
| 2001mtsolutions.pdf Path: UMBC >> CS >> 471 Fall, 2004 Description: Name:_The answers_ SSN:_ 1 2 20 20 3 15 4 15 5 10 6 15 7 30 8 15 9 total 10 150 UMBC CMSC471 Midterm Exam October 10, 2001 Being forced to write comments actually improves code, because it is easier to fix a crock than to explain it. - Guy Steele Pl... Date Added: 2009-04-27 22:18:52 |
| Test1.W06.pdf Path: MO St. Louis >> CS >> 4760 Fall, 2009 Description: CS 4760 Name: Operating Systems Spring 2006 Test 1 Max Pts: 50 Important: This is an open book test. You can use any books, notes, or paper, but not exchange anything with other students. You are not allowed to use any electronic/communication dev... Date Added: 2009-04-27 22:20:15 |
| mc.pdf Path: MO St. Louis >> CS >> 5740 Fall, 2009 Description: Monte Carlo Methods Introduction Solve a problem using statistical sampling First important use in development of atomic bomb during WWII Appliactions of Monte Carlo Methods Evaluating integrals of arbitrary functions of 6+ dimensions Predicting... Date Added: 2009-04-27 22:20:25 |
| constraints.pdf Path: Mississippi State >> ECE >> 4512 Fall, 2009 Description: 2. Design Requirements The goal of this project is to design an electric motor configuration for the ChallengeX GM Equinox. An electric motor or motors will be selected as well as the best configuration to recharge the batteries as well as power th... Date Added: 2009-04-27 22:21:12 |
| David_Ex3_11.pdf Path: GCSU >> CSCI >> 2350 Fall, 2008 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 /* David Smith Object Oriented WelcomeApplett3.java This java applet demonstrates ja... Date Added: 2009-04-27 22:22:09 |
| 04-Lex-In-A-Nutshell.pdf Path: Syracuse >> CIS >> 631 Spring, 2008 Description: CS143 Autumn 2007 Handout 04 January 26, 2007 lex (and flex): In A Nutshell Handout written by Julie Zelenski. is a lexical analyzer generator. You specify the scanner you want in the form of patterns to match and actions to apply for each token. ... Date Added: 2009-04-27 22:25:01 |
| gp6_rpt2.pdf Path: UCSD >> CENG >> 124 Fall, 2009 Description: Coal-to-Methanol Process: Progress Report 2 Norman Betty Katarzyna Matusik Nazia Nagpurwala (Equal report contributors) CENG 124B Dr. Pao C. Chau April 24, 2008 Abstract A Shell coal gasification process and a high-temperature CO shift reactor will... Date Added: 2009-04-27 22:25:08 |
| day1notes.pdf Path: Whitman >> M >> 235 Fall, 2009 Description: Day 1 Notes: Calculus Lab Computer Basics in the Lab: Be sure you can log in/log out of the computers in the lab. Be sure you have changed your password to something you can remember (but also something hard to guess). Maple and Matlab: Find the Ma... Date Added: 2009-04-27 22:26:26 |
| 06-Euclid.pdf Path: Rose-Hulman >> CSSE >> 479 Fall, 2009 Description: DTTF/NB479: Dszquphsbqiz Announcements: Day 6 Homework 1 returned. Homework 2 due according to schedule page Quiz Tuesday on concepts from chapter 2 (tentative) Practical quiz next week on breaking codes from chapter 2 Questions? Today: Wrap up LF... Date Added: 2009-04-27 22:27:04 |
| 09-FermatEuler.ppt Path: Rose-Hulman >> CSSE >> 479 Fall, 2009 Description: DTTF/NB479: Dszquphsbqiz Announcements: Day 9 Homework 3 posted Solutions to HW1 and 2 posted Written quiz tomorrow on chapters 1-2 (next slide) Computer quiz Friday on chapter 2 Questions? Today: Fermat\'s little theorem Euler\'s theorem Bo... Date Added: 2009-04-27 22:27:04 |
| Comprehensive_Examination_answers.pdf Path: UNC >> BIOCH >> 134 Fall, 2009 Description: Comprehensive Examination Department of Biochemistry and Biophysics May 2003 Charles W. Carter, Jr Topic: linked equilibria and free energy transduction References: 1. Jonathon Howard, Mechanics of Motor Proteins and the Cytoskeleton, Sinauer Associ... Date Added: 2009-04-27 22:27:31 |
| ECE351%20HW7P.pdf Path: Rose-Hulman >> ECE >> 351 Fall, 2009 Description: ECE351 HW # 7 Due 5/6/02 VCC VCC VCC VCC VCC RD RB C1 Q2 RC J4 Q3 RS C4 M1 C2 + Vout + C3 RL Vin - I1 REE1 I2 REE2 I3 REE3 -Vee -Vee -Vee -Vee PROBLEM 1: Find the midband gain Vo/Vin. PROBLEM 2: Find the location of all low frequency p... Date Added: 2009-04-27 22:27:35 |
| lab7.pdf Path: Rose-Hulman >> ECE >> 320 Fall, 2009 Description: Lab 7: PI-D and I-PD Control with Dynamic Prefilters Overview In this lab you will be controlling the one degree of freedom systems you previously modeled using PI-D and I-PD controllers with and without dynamic prefilters. You will need your Simulin... Date Added: 2009-04-27 22:30:38 |
| lec0508.pdf Path: DePaul >> IS >> 313 Winter, 2009 Description: GUI IV IS 313 5.8.2003 Outline Event handling example Model-view-controller JTable Homework #3 Event handling example Model-view-controller Controller manipulate-able interface modality View observable interface display Model underlying data str... Date Added: 2009-04-27 22:33:34 |
| MAT1102_calc_l4_wk2_2solutions.pdf Path: Allan Hancock College >> MAT >> 1102 Fall, 2009 Description: MAT1102 Algebra & Calculus I Calculus Review question A) How are a function f and its inverse f-1 related? B) How are domain and range of f and f-1 related? C) Find the inverse function of f(x) = ln(ex-3)+4 D) Find the inverse function of f(x) = ln(e... Date Added: 2009-04-27 22:34:44 |
| 6r.pdf Path: Stevens >> E >> 344 Fall, 2009 Description: ... Date Added: 2009-04-27 22:36:37 |
| ps_6.pdf Path: Stevens >> E >> 344 Fall, 2009 Description: Problem Set 6 Due: Wednesday, 30 June, 2004 at beginning of lecture 1. A vacancy is: a. missing electron from the valence band b. due to group III dopants c. an unoccupied atom position on a crystal lattice d. typically smaller than an interstitial. ... Date Added: 2009-04-27 22:37:07 |
| apc_section_7.pdf Path: Stevens >> E >> 344 Fall, 2009 Description: Assessment Performance Criteria Section 10 Magnetic Materials Students will be able to: 10.1 draw a B-H or M-H diagram and identify the points that correspond to the coercive field, the remnant magnetization, and the saturation magnetization. 10.2 u... Date Added: 2009-04-27 22:37:37 |
| apc_section_10.pdf Path: Stevens >> E >> 344 Fall, 2009 Description: Assessment Performance Criteria Section 10 Magnetic Materials Students will be able to: 10.1 draw a B-H or M-H diagram and identify the points that correspond to the coercive field, the remnant magnetization, and the saturation magnetization. 10.2 u... Date Added: 2009-04-27 22:37:38 |
| Soln2_01.doc Path: Stevens >> E >> 344 Fall, 2009 Description: An interconnect is a small wire between two points on a semiconductor device. For a copper interconnect with a rectangular cross section which is 5 m wide, 1 m thick, and 1 mm long, estimate how many atoms are contained in the interconnect. (5 1 10 -... Date Added: 2009-04-27 22:43:14 |
| SummaryOfClusterEvaluation.ppt Path: WTAMU >> IDM >> 6355 Fall, 2009 Description: Summary of Options for Evaluating Clusters and Clusterings What do we want to accomplish? Rate overall effectiveness of a clustering Did it find real clusters or just chance occurrences in a random data set? Compare clusters within a cluste... Date Added: 2009-04-27 22:46:32 |
| Lecture_2_measure.pdf Path: UNC >> PHYS >> 351 Fall, 2008 Description: Circuit analysis Kirchoffs Laws Voltage Law (conservation of energy) = KVL Current Law (conserve charge & momentum) = KIL Series impedances Parallel impedances Voltage dividers Thvenin equivalent circuit Norton equivalent circuit Phys 351, Fall 2008 ... Date Added: 2009-04-27 22:46:38 |
| Math101ZF07PTest4.pdf Path: Charleston Law >> MATH >> 101 Fall, 2009 Description: Name: Math 101Z - Fall 2007 - Practice Test 4 1. A car braked with a constant deceleration of 16 feet per second per second, producing skid marks measuring 200 feet before coming to a stop. How fast was the car traveling when the brakes were first a... Date Added: 2009-04-27 22:48:12 |
| 08 Autism 3 slides per page.pdf Path: UCSB >> PSY >> 105 Fall, 2008 Description: `Mindblindness\' Click here Overview Autism at the behavioral level What does it look like? Autism at the biological level What causes it? A cognitive analysis How does it work? The `theory of mind\' theory of autism Why is developmental pathology... Date Added: 2009-04-27 22:49:35 |
| Model systems in Toxicology handouts.pdf Path: UNC >> ENVR >> 132 Spring, 2006 Description: Model Systems and Organisms in Toxicology Thomas et al. EHP (2002) Parallelogram Approach to Characterize Toxicity Why Use Models? Very limited number of studies can be done on humans Allows for controlled experiments Environmental variables can b... Date Added: 2009-04-27 22:55:02 |
| section19.pdf Path: Arkansas Tech >> MATH >> 2033 Fall, 2008 Description: 19 Addition and Subtraction of Fractions You walked 1 of a mile to school and then 3 of a mile from school to your 5 5 friend\'s house. How far did you walk altogether? How much farther was the second walk than the first? 1 To solve the first proble... Date Added: 2009-04-27 22:56:44 |
| chaos1995.pdf Path: Michigan Flint >> BUS >> 381 Fall, 2009 Description: The CHAOS Report (1994) \"The Roman bridges of antiquity were very inefficient structures. By modern standards, they used too much stone, and as a result, far too much labor to build. Over the years we have learned to build bridges more efficiently, u... Date Added: 2009-04-27 22:56:49 |
| morder_pnictides.pdf Path: Rutgers >> PHYSICS >> 681 Fall, 2008 Description: Vol 453 | 12 June 2008 | doi:10.1038/nature07057 LETTERS Magnetic order close to superconductivity in the iron-based layered LaO12xFxFeAs systems Clarina de la Cruz1,2, Q. Huang3, J. W. Lynn3, Jiying Li3,4, W. Ratcliff II3, J. L. Zarestky5, H. A. Mo... Date Added: 2009-04-27 22:58:46 |
| sol1.pdf Path: Rutgers >> PHYSICS >> 507 Fall, 2008 Description: Physics 507 Homework Solution #1 Fall, 2008 1. From the force law F (r) = GME mr/r 3 , if there is a potential, then r2 U(r1 ) U(r2 ) = F dr r1 for any path. As every path lying on the surface of a sphere |r| =const. is perpendicular to the ra... Date Added: 2009-04-27 22:59:19 |
| hw4.pdf Path: Rutgers >> PHYSICS >> 601 Fall, 2008 Description: Homework IV 1. Do Taylor Heinonen Problem 8.2, page 313. 3. Suppose one atomic percent of Zn is dissolved randomly without correlation in otherwise pure Cu. Estimate the resistivity in cm at 0 K using ... Date Added: 2009-04-27 23:00:03 |
| Olsen.pdf Path: University of Iowa >> IBS >> 593 Fall, 2009 Description: Copyright 2002 by the Genetics Society of America Contrasting Evolutionary Forces in the Arabidopsis thaliana Floral Developmental Pathway Kenneth M. Olsen, Andrew Womack, Ashley R. Garrett, Jane I. Suddith and Michael D. Purugganan1 Department of ... Date Added: 2009-04-27 23:02:16 |
| ethnc.pdf Path: Delaware >> IR >> 0708 Fall, 2009 Description: UD Facts & Figures 2007-08 ETHNICITY OF STUDENTS BY TIME STATUS Fall 2003 Through Fall 2007 A. FULL-TIME MATRICULATED STUDENTS 2003 2004 N % N % Undergraduate1 Total 15,331 100.0 White 13,126 85.6 African-American 840 5.5 Hispanic 482 3.1 Asian 508 ... Date Added: 2009-04-27 23:02:33 |
| psyc352-week9.1-winter2008-web-4perpage.pdf Path: Université du Québec à Montréal >> PSYC >> 313170 Fall, 2009 Description: Study cues The phonological loop (Baddeley, Thomson & Buchanan, 1975) Articulatory suppression: Goal, Rationale, Procedure/Material, Hypotheses/Predictions, Results, Interpretation/Mechanical explanations for each effect obtained The visuo-spatial sk... Date Added: 2009-04-27 23:03:35 |
| practice5.pdf Path: Arizona >> ECE >> 474 Fall, 2009 Description: PRACTICE PROBLEMS 5 Lecture 8 1. 2. Provide an overview of the Quine-McCluskey algorithm. What are the possible methods to implement each step? Given the constraint matrix where columns correspond to prime implicants and rows correspond to minterms i... Date Added: 2009-04-27 23:03:40 |
| typingProblemsInOOPLs.pdf Path: Southern New Orleans >> CS >> 4210 Fall, 2009 Description: ! # $ # % \' ( + + , ( \" # % # . . + 3$ 0 $ \" \" clone method ! 5 ! \" \" 0 18 & ... Date Added: 2009-04-27 23:04:52 |
| CPSC450-ExerciseLab2.pdf Path: Bridgeport >> CS >> 450 Fall, 2009 Description: CPSC450: EX Lab 2 DATABASE DESIGN UNIVERSITY OF BRIDGEPORT CPSC 450 Database Design Exercise Lab 2 When: Thursday, Mar. 26 and Apr. 2, 9:30 PM ~ 10:45 PM and 1:00 PM ~ 2:15 PM Where: Technology Building #113 (Tech. Lab) Before you come to lab, ... Date Added: 2009-04-27 23:06:11 |
| 305hw9key.pdf Path: Sonoma >> ECON >> 305 Fall, 2008 Description: Problem Set #9-Key Sonoma State University Economics 305-Intermediate Microeconomic Theory Dr. Cuellar Consider the following daily product and cost schedule for a profit maximizing firm operating in a perfectly competitive market. Labor 0 1 2 3 4 ... Date Added: 2009-04-27 23:06:11 |
| exam1ov.pdf Path: Delaware >> ST >> 200 Fall, 2009 Description: STAT 200 EXAM 1 OVERVIEW You may bring a single sheet of paper with as many notes on it as you can fit front and back. It must be your paper and not a photocopy of someone elses notes. The Exam will consist of the following 25 True/False or Multip... Date Added: 2009-04-27 23:07:23 |
| SS211CPS1_05.pdf Path: Caltech >> SS >> 211 Fall, 2009 Description: ADVANCED E CONOMIC T HEORY S O C I A L S C I E N C E 211C P R O B L E M S E T 1 - D U E 4.21.2005 1. Preference for flexibility completing the proof of Theorem 1. Using class notation, a. Show that there exist a real-valued function a:X (a negative... Date Added: 2009-04-27 23:08:25 |
| 1022hwk.pdf Path: UMBC >> MT >> 105 Fall, 2009 Description: Solutions to homework due 24 Sept These problems take up a lot of space when I write them down, but (I promise) their solutions are rather short. 1: A Fair Coin. Suppose we are flipping a coin that is evenly weighted, so that heads and tails occur wi... Date Added: 2009-04-27 23:08:51 |
| 01-raster.pdf Path: Princeton >> CS >> 426 Fall, 2009 Description: Overview Display hardware How are images displayed? Raster Graphics Adam Finkelstein Princeton University COS 426, Spring 2002 Raster graphics systems How are imaging systems organized? Color models How can we describe and represent colors? ... Date Added: 2009-04-27 23:09:40 |
| lec7.ps Path: Princeton >> CS >> 522 Spring, 2009 Description: %!PS-Adobe-3.0 %Title: C:\\texinput\\courses\\complexity\\mynotes\\lec7.dvi %Creator: DVIPSONE 2.2.1 http:/www.YandY.com %For: Jim Roberts (Princeton U #2) 822 2000 Mar 29 14:19:39 %CreationDate: 2001 Mar 08 13:19:18 %BoundingBox: 72 42 504 720 %Pages: 5 ... Date Added: 2009-04-27 23:09:49 |
| implicit.pdf Path: Princeton >> CS >> 598 Fall, 2009 Description: Implicit Surfaces Misha Kazhdan CS598b Definition: Given a function F the implicit surface S generated by this function is the set of zero points of F: S = {p F (p ) = 0} The interior I is the set of points on which F is negative: I = {p F (p ) <... Date Added: 2009-04-27 23:09:54 |
| 08LabExerciseSimulation.pdf Path: Delaware >> STAT >> 616 Fall, 2008 Description: 08 Lab Exercise Simulation The basis of tonight\'s exercise is the simulation example involving an autoregressive covariance pattern. Instead of this pattern you will explore other covariance structures that could apply to longitudinal data. 1. Work ... Date Added: 2009-04-27 23:11:09 |
| 7Midterm1.doc Path: Wayne State University >> BE >> 1010 Fall, 2009 Description: BE1010 Fall 2002 MIDTERM EXAM 1/4 1. what is a cold boot? (349) 2. Explain and give an example of the Excel MID function? (199) 3. The cheapest form of read/write memory in wide use today is what? (34) 4. What is a URL? (285) 5. What is the differenc... Date Added: 2009-04-27 23:15:17 |
| B3.doc Path: ASU >> MAT >> 310 Fall, 2009 Description: 2.3 Formal Proofs 1. State and prove: SAS 2. ASA 3. AAS 4. SSS (NOTE: The congruence results above are independent of the parallel postulate) 2. State and prove the Isosceles Triangle Theorem (ITT) for planes. If we assumed Euclid\'s development of a... Date Added: 2009-04-27 23:17:11 |
| homework2.pdf Path: Rose-Hulman >> ECE >> 320 Fall, 2009 Description: ECE-320 Linear Control Systems Homework 2 Due Date: Thursday, March 27, 2003 Problems: 1 For the following transfer functions: I) determine the characteristic polynomial II) determine the characteristic modes III) determine if the system is stable, u... Date Added: 2009-04-27 23:19:29 |
| 000634.pdf Path: Rose-Hulman >> CM >> 000000 Fall, 2009 Description: MATERIAL SAFETY DATA SHEET Page 1 of 5 MATERIAL SAFETY DATA SHEET 3,4-Dimethoxybenzoic acid, 99+% 16688 * SECTION 1 - CHEMICAL PRODUCT AND COMPANY IDENTIFICATION * MSDS Name: 3,4-Dimethoxybenzoic acid, 99+% Veratric acid Company Identification: ... Date Added: 2009-04-27 23:20:07 |
| Lab2-Linearity.pdf Path: Weber >> CEET >> 3010 Fall, 2008 Description: Laboratory 2 CEET 3010 Fall 2007 Linear Circuits Purpose: To demonstrate proportionality and superposition techniques for linear circuits. Equipment and Components: Prototyping board, Multimeter, Power Supply, Signal Generator, Oscilloscope. Resi... Date Added: 2009-04-27 23:22:17 |
| DEAC121808.pdf Path: University of Hawaii - Hilo >> MIN >> 0809 Fall, 2009 Description: Summary Notes Distance Education Advisory Council December 18, 2008 2:45 PM 3:45 PM Building 6, Conference Room 101 Present: Bill Becker, Ross Egloria, Greg Gruwell, Ralph Kam, Jan Petersen, Patrick Patterson, Cynthia Smith, Cyndi Uyehara Unable to ... Date Added: 2009-04-27 23:23:47 |
| shw2.pdf Path: Utah >> MATH >> 1100 Fall, 2008 Description: ... Date Added: 2009-04-27 23:24:40 |
| prfinal.pdf Path: University of Hawaii - Hilo >> EE >> 213 Fall, 2009 Description: Practice Final 1) The natural response of a circuit is nat(t) = 1+ u(t 2) . If possible, find the impulse response, step response, and transfer function of the circuit. 2) (a) Find the zero state response of the circuit below. (b) Find the zero inp... Date Added: 2009-04-27 23:25:50 |
| notes-ch3.ps Path: Calvin >> M >> 381 Fall, 1998 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: notes.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -O0in,0.5in -p 25 -l 30 -o n... Date Added: 2009-04-27 23:26:22 |
| Topic 2: Algebra.pdf Path: Allan Hancock College >> MATH >> 123 Fall, 2008 Description: Mathematics 123 Topic 2: Algebra This material is covered in Chapters 5 to 7 of the text. Notes on the Text Chapter 5 This is probably the most important chapter in the text since it forms the basis of all symbolic calculations. There are numerous d... Date Added: 2009-04-27 23:27:06 |
| hand6.txt Path: Cincinnati >> YR >> 614 Fall, 2009 Description: LINEAR MODELS HANDOUT #6 DATA S229; INPUT EDUC $ ED $ INDEX; CARDS; HIGHSH1 A 74 HIGHSH1 A 68 HIGHSH1 A 77 HIGHSH2 B 76 HIGHSH2 B 80 COLLEGE C 85 COLLEGE C 93 ; PROC GLM;... Date Added: 2009-04-27 23:30:06 |
| xcquiz.pdf Path: Maryland >> MATH >> 221 Fall, 2008 Description: Extra Credit Quiz Due Thurs. 8/10 dy 1. Find the particular solution of (lny)2 dx = x2 y such that y(2) = 1 2. Find the general solution(s) of y + ytant = tant with < t < 2 3. Verify that y = 3 + t 3 2 satises the dierential equation t(y )2 yy... Date Added: 2009-04-27 23:33:26 |
| agu07.pdf Path: CUNY Baruch >> CE >> 193 Fall, 2009 Description: Recent trends in USA streamflow: Implications for the water cycle Nir Y Krakauer, Inez Fung Department of Earth and Planetary Science, University of California, Berkeley, CA 94720 niryk@berkeley.edu, ifung@berkeley.edu 2 We use a subset of 1000 Unit... Date Added: 2009-04-27 23:33:56 |
| 00000036.pdf Path: Carnegie Mellon >> TERA >> 05100791 Fall, 2009 Description: ... Date Added: 2009-04-27 23:34:52 |
| 00000053.pdf Path: Carnegie Mellon >> TERA >> 05100791 Fall, 2009 Description: ... Date Added: 2009-04-27 23:34:57 |
| 00000178.pdf Path: Carnegie Mellon >> TERA >> 05101621 Fall, 2009 Description: ... Date Added: 2009-04-27 23:36:01 |
| 00000090.pdf Path: Carnegie Mellon >> TERA >> 05101561 Fall, 2009 Description: ... Date Added: 2009-04-27 23:37:37 |
| 00000219.pdf Path: Carnegie Mellon >> TERA >> 05101561 Fall, 2009 Description: ... Date Added: 2009-04-27 23:38:06 |
| 00000068.pdf Path: Carnegie Mellon >> TERA >> 05101623 Fall, 2009 Description: ... Date Added: 2009-04-27 23:39:57 |
| 00000014.pdf Path: Carnegie Mellon >> TERA >> 05102022 Fall, 2009 Description: ... Date Added: 2009-04-27 23:40:07 |
| 00000026.pdf Path: Carnegie Mellon >> TERA >> 05101228 Fall, 2009 Description: ... Date Added: 2009-04-27 23:40:33 |
| 00000083.pdf Path: Carnegie Mellon >> TERA >> 05102020 Fall, 2009 Description: ... Date Added: 2009-04-27 23:41:43 |
| umi-uncg-1167.pdf Path: UNC Greensboro >> ETD >> 1167 Fall, 2009 Description: SECHRIST, STACY M., Ph.D. The Form and Function of Females\' Aggression. (2006) Directed by Dr. Jacquelyn White. 74 pp. Many researchers approach the study of aggression by searching for gender differences. The end result has depicted females as emot... Date Added: 2009-04-27 23:44:23 |
| to_the_ladies.pdf Path: Bridgewater State >> SW >> 304 Fall, 2009 Description: / \'f 0 the Ladies Wife and servant are the same, But only differ in t~e name: For when that fatal knot is tied, Which nothing, nothing can divide: When she the word obey. has said, And man by law supre\'Ye has made, Then all that\'s kind isi3id aside... Date Added: 2009-04-27 23:44:58 |
| Psyc147_S09 Syllabus.pdf Path: UCSB >> PSYC >> 147 Spring, 2009 Description: PSYCHOLOGY 147: INTERGROUP RELATIONS Spring Quarter 2009 Instructor: David L. Hamilton Office: Psychology East 3819 Office hours: Wednesday, 10:00-11:30 a.m. Other times by appointment Office phone: 893-2456 Email: hamilton@psych.ucsb.edu Teaching... Date Added: 2009-04-27 23:45:56 |
| ExEssay09.pdf Path: UF >> AST >> 2039 Spring, 2008 Description: AST2039 Essay Question for Midterm Exam Due at the time of the exam Friday, 06 March Write a short essay on one of the following three topics. Keep your answer to fewer than three pages typewritten and double-spaced, about 750 words. As before, emplo... Date Added: 2009-04-27 23:46:15 |
| E2-2009.pdf Path: UF >> AST >> 2039 Spring, 2008 Description: AST2039 Essay Question for Midterm Exam Due at the time of the exam Friday, 06 March Write a short essay on one of the following three topics. Keep your answer to fewer than three pages typewritten and double-spaced, about 750 words. As before, emplo... Date Added: 2009-04-27 23:46:16 |
| Lecture9-092408.pdf Path: UF >> ECO >> 4504 Spring, 2008 Description: Public Goods (Chapters 7-9) Political Economy Part-1 Political Economy Optimal Provision of Public Goods So far, we have discussed when and how the government should intervene in order to achieve social efficiency. We now turn our attention to the... Date Added: 2009-04-27 23:49:00 |
| Lecture 5 - Coral Reefs_07.pdf Path: UCSB >> EEMB >> 112 Fall, 2008 Description: Announcements Download coral paper (pdf) from EEMB 112 website Coral Reefs Lecture 5 January 19, 2007 Professor Hofmann Sinauer Associates, Inc. 2. Demographic analyses Coral Life Cycle Photo: A. Morse Outline of Lecture 5 Ecosystems in the ba... Date Added: 2009-04-27 23:49:50 |
| Class18.pdf Path: Michigan >> CEE >> 212 Fall, 2008 Description: ... Date Added: 2009-04-27 23:51:53 |
| ANTH 211 2008-2009 CF.doc Path: St. Francis IL >> ANTH >> 211 Fall, 2009 Description: ANTH 211: HEALTH & ILLNESS IN CROSSCULTURAL PERSPECTIVES Professor: Dr. Clare Fawcett Service Learning Placement Options January 2008-April 2009 PLACEMENT: 1. ADULT FRIENDSHIP CORNER Mandate: Need: Schedule: Location: Screening: # OF STUDENTS 2 22 ... Date Added: 2009-04-27 23:52:01 |
| rtlinux_intro.pdf Path: Kentucky >> EE >> 599 Fall, 2008 Description: Real-Time Linux (RTLinux) Intro Linux with RT extensions (RTOS w/ Linux) RTLinux Programs RTLinux programs run as kernel modules No virtual memory protection in kernel space Many library routines not available RT threads cannot call many kerne... Date Added: 2009-04-27 23:53:59 |
| 16Jul07.pdf Path: UF >> MCB >> 3020 Fall, 2008 Description: Main groups of eukaryotic microbes 1 Properties of fungi Comprised of yeasts, molds and mushrooms From microscopic to macroscopic (mushrooms) All non-photosynthetic and non-phagocytotic Cell walls of chitin (NAG polymer) Can grow as filaments ... Date Added: 2009-04-27 23:54:33 |
| h06.pdf Path: Drake >> ECON >> 174 Fall, 2009 Description: Intermediate Macroeconomic Analysis (Econ 174) Drake University, Spring 2002 William M. Boal HOMEWORK ASSIGNMENT 6: INSTRUCTIONS Aggregate Demand in the Open Economy, and Aggregate Supply Due Tuesday, April 23, 2002 Procedure: 1. Work the problems b... Date Added: 2009-04-27 23:54:41 |
| chap28.pdf Path: UF >> CEN >> 5035 Fall, 2008 Description: Chapter 28 Process Improvement Ian Sommerville 2004 Software Engineering. Chapter 28 Slide 1 Objectives q q q To explain the principles of software process improvement To explain how process factors influence quality and productivity To explai... Date Added: 2009-04-27 23:55:28 |
| AG-439-8.pdf Path: N.C. State >> AG >> 439 Fall, 2008 Description: ... Date Added: 2009-04-27 23:56:15 |
| Chapter4.pdf Path: Purdue >> STAT >> 540 Fall, 2008 Description: MATHEMATICS OF FINANCE CHAPTER 4 OPTION PRICING IN CONTINUOUS-TIME JOS E. FIGUEROA-LPEZ INSTRUCTORS CLASS NOTES SPRING 2009 C ONTENTS 1. 1.1. 1.2. 1.3. 2. 3. 3.1. 3.2. 4. 5. 5.1. 5.2. 6. 6.1. 6.2. 6.3. 7. The market model Description of the assets P... Date Added: 2009-04-27 23:59:20 |
| PHYS112-Final.xls Path: Purdue >> STAT >> 225 Fall, 2008 Description: Back N M L N M L Left K J I H G F E D C B A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 K J I H G F E D C B A X X X X 17 18 19 20 Front Tilman Shannon Claire PHYS 112 Students are to sit in the highlighted seats for their lecturer! Right ... Date Added: 2009-04-27 23:59:29 |
| topic5fig1.pdf Path: Purdue >> STAT >> 514 Fall, 2008 Description: ... Date Added: 2009-04-27 23:59:52 |
| topic5fig1.pdf Path: Purdue >> STAT >> 512 Fall, 2008 Description: ... Date Added: 2009-04-27 23:59:53 |
| Campbell.pdf Path: UF >> EIN >> 6918 Fall, 2008 Description: Industrial and Systems Engineering Graduate Seminar New Directions in Routing and Network Design Ann Melissa Campbell Department of Management Sciences University of Iowa Monday, February 9th, 2004 Period 5 (11:45 - 12:35), Weil Hall, Room 279 ABSTRA... Date Added: 2009-04-28 00:00:00 |
| 0810NUR490A.pdf Path: Augsburg >> TRI >> 0809 Fall, 2009 Description: AUGSBURG COLLEGE DEPARTMENT OF NURSING NUR 490- LEADERSHIP/ MANAGEMENT Fall Trimester Sept. Dec. 2008 Faculty: Contact Information: Class Hours: Location: Class Days: Pauline J. Utesch, MA, RN Assistant Professor Email: utesch@augsburg.edu Phone: 5... Date Added: 2009-04-28 00:02:38 |
| u010604a.pdf Path: UF >> U >> 010604 Fall, 2009 Description: CNS /Update Newsletter Feature NETg Help Available for First-Time Users CNS Document ID: u010604a Last Updated: 5/01/01 UF Computing & Networking Services 112 Bryant Space Sciences Bldg, University of Florida P.O. Box 112050 Gainesville Florida 326... Date Added: 2009-04-28 00:03:20 |
| key_exam1_inclass.pdf Path: Villanova >> CHM >> 7292 Fall, 2009 Description: ... Date Added: 2009-04-28 00:03:37 |
| w5_2_tone2.pdf Path: Washington >> LING >> 451 Winter, 2008 Description: Today Revisit UAC Obligatory Contour Principle Mende tone melodies Shona Margyi toneless morphemes Igbo floating tones Autosegmental conventions (Universal) Association Convention (UAC): Link tones and TBUs one-to-one. TBUs or tones may be ... Date Added: 2009-04-28 00:05:05 |
| Problem Set 23.4,6.pdf Path: NMSU >> PHYS >> 216 Fall, 2009 Description: PROBLEM SET 23.4-6 Problem 23.18 A fish in a flat-sided aquarium sees a can of fish food on the counter. To the fish\'s eye, the can looks to be 30 cm outside the aquarium. What is the actual distance between the can and the aquarium? (You can ignore ... Date Added: 2009-04-28 00:06:46 |
| Walker3_ISM_Ch31.pdf Path: NMSU >> CHAPTER >> 216 Fall, 2009 Description: Chapter 31: Atomic Physics Answers to Even-Numbered Conceptual Questions 2. There are many such reasons, but perhaps the most important is that orbiting electrons in Rutherfords model would radiate energy in the form of electromagnetic waves, with th... Date Added: 2009-04-28 00:07:40 |
| diagnostic.pdf Path: Christian Brothers >> M >> 115 Fall, 2009 Description: ... Date Added: 2009-04-28 00:13:50 |
| wcci_02.pdf Path: Hampshire >> CS >> 115 Fall, 2009 Description: gwyB BeBBhrd d rvrp(6ggtw v wvrg\"d ghipg pgrdwf5lpd g(gwbSgv(b wg rg phd $Bg( r Bp$8 phB dby Bgwupd pwb(vgw8 hBg(b pi (bg(vg pBbhu wd8 D( \"wb b v vBgb B(BeBg wgdw h v b v p g h h(wgwdvypdfrv$wv g(vBbg rgpgtpBBwy89B rp6g pd g b e d ... Date Added: 2009-04-28 00:20:20 |
| 101_hw3.ps Path: UCSD >> CSE >> 101 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: 101_hw3.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o 101_hw3.ps 101_hw3.dvi ... Date Added: 2009-04-28 00:21:43 |
| cal.pdf Path: UCSD >> CSE >> 101 Winter, 1998 Description: CSE 101 Calibration Homework (Homework 0) Fall 2006 Background, (Order and Recurrence Relations, simple algorithms) Due Friday, September 29 100 points total, DOES NOT COUNT TOWARDS GRADE Analyzing algorithms, 10 pts. Assume proc(I) is an algorithm t... Date Added: 2009-04-28 00:24:58 |
| ans3.pdf Path: UCSD >> CSE >> 202 Winter, 1998 Description: CS 202 Homework 3 Dynamic Programming and Network Flow Answer Key General directions: Algorithms may be described at high level without actual code. You may use any lower bound, algorithm or data structure from the text or in class, and their correct... Date Added: 2009-04-28 00:26:19 |
| lec22.pdf Path: SUNY Buffalo >> PHY >> 101 Fall, 2009 Description: Car moving forward on TV, but the tires seem to rotate backward. Example: A 50 kg diver stands at the end of a 4.6 m diving board. Neglecting the weight of the board, what is the force on the pivot 1.2 meters from the end? 1) Draw free body diagram... Date Added: 2009-04-28 00:28:36 |
| Nationalismoutline.pdf Path: CSU Bakersfield >> ENGL >> 580 Fall, 2009 Description: 1 Jonathan M. DeWitt Dr. Monica Ayuso English 580 5 February 2009 Nationalisms Significance in Representation of the Other Anderson, Benedict. Introduction. Imagined Communities. New York: Verso, 1991. Anderson proposes that the nation is an imagine... Date Added: 2009-04-28 00:34:08 |
| index.pdf Path: Temple >> MATH >> 0701 Fall, 2009 Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Fall 2008 Course Syllabus Course: Mathematics 0701.014. Course Title: Elementary Algebra. Time: MWF 4:40 PM -5:50 PM. Place: BARTON HALL 103(BB 103). Instructor: Varghese... Date Added: 2009-04-28 00:34:43 |
| Elguebaly1.pdf Path: UCSD >> ARIES >> 0012 Fall, 2008 Description: Chamber Nuclear Performance Chamber Nuclear Performance L. El-Guebaly Fusion Technology Institute University of Wisconsin - Madison With input from R. Raffray (UCSD) ARIES Project Meeting 5-7 December 2000 UCSD Fusion Technology Institute University... Date Added: 2009-04-28 00:36:26 |
| Goodin.pdf Path: UCSD >> ARIES >> 0012 Fall, 2008 Description: Update on IFE Target Fabrication N. Alexander, P. Gobby, D. Goodin, J. Hoffer, J. Latkowski, A. Nobile, D. Petti, R. Petzoldt, A. Schwendt, W. Steckle, D. Sze, M. Tillack Presented by Dan Goodin December 6, 2000 University of California, San Diego ... Date Added: 2009-04-28 00:36:27 |
| 6up-lecture01.pdf Path: Duke >> CPS >> 104 Fall, 2009 Description: General Information Instructor: Alvin R. Lebeck Office: D308 LSRC email: alvy@cs.duke.edu Office Hours: Tues 4:00-5:00, Wed 3:30-4:30, or by appointment Computer Science 104: Computer Organization, Design & Programming Alvin R. Lebeck Teaching Assi... Date Added: 2009-04-28 00:37:59 |
| 4Deutschliver.pdf Path: Colorado >> MCDB >> 4600 Fall, 2009 Description: Development 128, 871-881 (2001) Printed in Great Britain The Company of Biologists Limited 2001 DEV3286 871 A bipotential precursor population for pancreas and liver within the embryonic endoderm Gail Deutsch1,*, Joonil Jung1,2, Minghua Zheng1, Jo... Date Added: 2009-04-28 00:39:51 |
| OCD_LCA_F06a_T05_v1.4.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Operational Concept Description (OCD) Team #5 SimVBSE Game Evolution Analysis Arpitha Shetty Anuj Walia Bhavin Doshi Neha Sethi Sapan Parekh Sneha Matani Ryan McAlinden Project Manager System Analyst System Analyst Logistics Business Analyst Busin... Date Added: 2009-04-28 00:43:55 |
| CMN_11_17_F08a_T04.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: UNO WEB TOOL CLIENT MEETING NOTES 11/17/2008 CLIENT SIDE Laura Hurjo DEVELOPER SIDE Fu, JingQiao Nishant Ankit TIME 9:00-9:30pm LOCATION BKS 400 2) AGENDA:The basic requirement for this meeting was to finalize all the requirements the client prop... Date Added: 2009-04-28 00:46:27 |
| midterm1solns.pdf Path: USC >> MATH >> 118 Fall, 2008 Description: MIDTERM 1 SOLUTIONS MATH 118, SEPTEMBER 23, 2004 Therefore, by the point-slope form, the equation of the line joining (1, 2) and (3, 1) is 3 (x 1); 2 (note that when x = 1 this yields y = 2), which simplies to y2= 3 7 y = x+ . 2 2 Alternatively, yo... Date Added: 2009-04-28 00:47:21 |
| Memory.pdf Path: Princeton >> COS >> 217 Fall, 2009 Description: Memory Allocation Good programmers make efficient use of memory Understanding memory allocation is important o Create data structures of arbitrary size o Avoid memory leaks o Run-time performance Memory Allocation CS 217 1 2 Memory What is mem... Date Added: 2009-04-28 00:48:30 |
| Announcements_9_24.ppt Path: USC >> CS >> 577 Fall, 2009 Description: Announcements LCO Core Assignment posted Due 10/1 WinWin Team Assignment will be posted soon Due 9/29 (Should be a simple assignment if you are done with your negotiations) Everyone submit ER form by tonight Mentor FAQ Who are the mentors? ... Date Added: 2009-04-28 00:48:44 |
| hw14.pdf Path: Clemson >> CES >> 206 Fall, 2009 Description: ... Date Added: 2009-04-28 00:49:31 |
| 59.pdf Path: Princeton >> MAE >> 412 Fall, 2008 Description: CMOS Static RAM 16K (2K x 8-Bit) IDT6116SA IDT6116LA x Features High-speed access and chip select times Military: 20/25/35/45/55/70/90/120/150ns (max.) Industrial: 20/25/35/45ns (max.) Commercial: 15/20/25/35/45ns (max.) Low-power consumption B... Date Added: 2009-04-28 00:49:36 |
| 19620608_0000481538.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: I ._ I,. - . DRAFT .: MJ3.I ICIRAI i i * I J M FOR: Mr. Allen W. Dulles ,rj REFERENCE: -. . . M r l DuUeg\' Memo of 8 June 1962 I I welcome your memo of 8 June regarding the piece you contemplate on doing or the Encyclopedia Britannfca. . *... Date Added: 2009-04-28 00:50:30 |
| as02.pdf Path: USC >> PHYS >> 516 Spring, 2008 Description: PHYS516 ASSIGNMENT 2MC SIMULATION OF THE ISING MODEL Due: Friday, February 13, 2009, at the class 1. Write a program that performs Monte Carlo (MC) simulations of the L L twodimensional Ising model following the discussion in the lecture note. 2. ... Date Added: 2009-04-28 00:51:45 |
| chapter5_study_questions.pdf Path: N. Illinois >> BIOS >> 447 Spring, 2008 Description: 1 COMPARATIVE VERTEBRATE ANATOMY REVIEW FOR CHAPTER 5 1. Be able to explain the concept of a life cycle, and discuss the different appearances of a sample of organisms as they progress through their lives. You should be able to cite examples of an... Date Added: 2009-04-28 00:52:49 |
| Patton_Manuscript.pdf Path: North Texas >> KINE >> 2030 Fall, 2008 Description: How Audiovisual Systems Affect Member Retention Robert W. Patton Kimberly A. Williams Fitness Management, January 2005, p 39-40. ... Date Added: 2009-04-28 00:54:56 |
| 0211-small.pdf Path: Trinity U >> CS >> 3294 Fall, 2009 Description: CSCI 3294 February 11, 2008 Administrivia Reminder: Homework 2 due Wednesday. Homework 1 graded; sample solution on Web soon. Slide 1 More Useful Commands, Continued xargs build and execute command lines from standard input. Examples: Fi... Date Added: 2009-04-28 00:56:03 |
| Ecce11Packet-Final.pdf Path: UGA >> LATN >> 4770 Fall, 2008 Description: Ecce 11 Content Outline 1. Translation Translate genitive case with \"of\" 2. Vocabulary Draw pictures of selected words Complete sentences with correct word choices Recall meanings quickly for translation 3. Grammar Nouns Genitive & Dative Cases R... Date Added: 2009-04-28 00:56:08 |
| lec13_post.pdf Path: Wisconsin Milwaukee >> C >> 106 Fall, 2009 Description: Announcements Web assignment is due one week from today. Most of today will be the in-class debate. To receive extra credit you need to turn in hard copy of your research, and you\'ll get it back approved for use as part of the open notes exam. Sum... Date Added: 2009-04-28 00:56:48 |
| misc0142.pdf Path: Midwestern State University >> MISC >> 0142 Fall, 2009 Description: MISC0142 Woodland Fish and Wildlife Cavity Nesting Ducks he Northwest has several ducks that utilize cavitities or holes in trees for nesting. These include the wood duck (Aix sponsa), hooded merganser (Lophodytes cucullatus), common merganser (Mer... Date Added: 2009-04-28 00:58:45 |
| homework2.pdf Path: Allan Hancock College >> COMP >> 2070 Fall, 2009 Description: COMP3520 Operating System Internals Homework 2 1. What is the purpose of system call? What is the purpose of system programs? 2. What are the major activities of an operating system in regard to file management? 3. What are the advantages and disad... Date Added: 2009-04-28 00:59:37 |
| project6.pdf Path: Texas Tech >> M >> 5365 Fall, 2009 Description: EXERCISES IN TABLES AND DEFINED COMMANDS YOUR NAME HERE A. Some types of matrices In Table A.1, we list some common types of matrices. Note that the table is a oating gure. It may not show up in the same place in your document! Note that in this doc... Date Added: 2009-04-28 01:00:21 |
| ch13x2.pdf Path: UMass (Amherst) >> ECE >> 397 Fall, 2009 Description: Chapter 13: Mass-Storage Systems Disk Structure Disk Scheduling Disk Management Swap-Space Management RAID Structure Disk Attachment Stable-Storage Implementation Tertiary Storage Devices Operating System Issues Performance Issues Disk Structure Dis... Date Added: 2009-04-28 01:03:19 |
| laplace.pdf Path: Texas >> GEO >> 391 Fall, 2008 Description: ... Date Added: 2009-04-28 01:03:24 |
| Ex3S05Blue.pdf Path: UMass (Amherst) >> CHEM >> 112 Fall, 2008 Description: Chemistry 112 YOU MUST: Exam 3 (100 points) BLUE Spring 2005 - Section 1 (Botch) 4/14/05 SHOW YOUR WORK CLEARLY Use the ICE METHOD Use UNITS USEFUL INFORMATION Please keep your eyes on your own paper and your answers covered. Turn in the entir... Date Added: 2009-04-28 01:03:42 |
| pw.pdf Path: UMass (Amherst) >> PHIL >> 383 Fall, 2008 Description: Philosophy 383 Philosophical Approaches to Religion Spring 2007 Possible Worlds p =df necessarily p (p is necessary) p =df possibly p (p is possible) x is a possible world =df x is a maximally consistent set of propositions A proposition p is true ac... Date Added: 2009-04-28 01:04:03 |
| 10.pdf Path: Tulsa >> LIB >> 1923 Fall, 2009 Description: ... Date Added: 2009-04-28 01:04:12 |
| a425_final_data09.pdf Path: Rochester >> A >> 425 Fall, 2009 Description: UNIVERSITY OF ROCHESTER William E. Simon Graduate School of Business Administration APS 425 Advanced Managerial Data Analysis Winter 2009 Professor G. William Schwert CS3-110L, 585-275-2470 Fax: 585-461-5475 email: schwert@schwert.simon.rochester.edu... Date Added: 2009-04-28 01:04:41 |
| 5figure6.pdf Path: Oregon State >> SR >> 1061 Fall, 2009 Description: 50 45 40 0.6 0.50 0.43 0.38 0.39 0.33 0.4 35 30 0.37 0.35 B (lb/A) 0.2 0 B ppm 25 0.28 20 0.27 0.21 15 1998-1999 ppm 10 5 0.12 0.11 0.07 0.05 0.00 0 Sowing Winter Rosette Spring Rosette Bolting 1997-1998 1998-1999 (lbs/A) 0 Early Bloom ... Date Added: 2009-04-28 01:06:33 |
| short.pdf Path: Maryville MO >> CASELMANE >> 120707 Fall, 2009 Description: ELASTIC PROPERTY PREDICTION OF SHORT FIBER COMPOSITES USING A UNIFORM MESH FINITE ELEMENT METHOD Elijah Caselman Dr. Douglas E. Smith, Thesis Supervisor ABSTRACT This thesis presents a uniform mesh finite element method to determine the elastic mate... Date Added: 2009-04-28 01:06:40 |
| short.pdf Path: Maryville MO >> CALLOWAYC >> 010507 Fall, 2009 Description: PASSIVE TRANSFER OF MYCOPLASMA BOVIS-SPECIFIC ANTIBODIES IN CALVES BORN TO VACCINATED DAMS Christopher Douglas Calloway Dr. Loren G. Schultz, Thesis Supervisor ABSTRACT Mycoplasma bovis is a bacterial pathogen that has been shown to cause respiratory... Date Added: 2009-04-28 01:07:02 |
| ad9s12dp256pins1.pdf Path: TAMU Kingsville >> EEEN >> 4252 Fall, 2008 Description: 3.00 H2 - Secondary I/O or Memory Expansion Optional RS485 Interface DC In (6 to 12V) low-dropout 5V regulator (rear-mounted) 0.125 typ. mounting holes 0.125 dia. 4 places 0.15 typ. Reset button 2.30 2.00 BDM In CAN transceivers Optional precis... Date Added: 2009-04-28 01:09:39 |
| hw6.pdf Path: Stanford >> MSANDE >> 251 Fall, 2009 Description: MS 8 with positive probabilities :\" :8... Date Added: 2009-04-28 01:11:40 |
| 344_lab2_s09.pdf Path: New Mexico >> ECE >> 344 Fall, 2009 Description: EECE 344L Microprocessors Spring 2009 Laboratory 2 More Basic Assembly Language Programming Due Date: Points: Feb 24, 2009 20 Points Work individually. Objective: Purposes of this laboratory include further practice with the assembler/linker/load... Date Added: 2009-04-28 01:13:36 |
| section1.5.pdf Path: UNC Charlotte >> MATH >> 0900 Fall, 2008 Description: ... Date Added: 2009-04-28 01:17:52 |
| homework2.pdf Path: Suffolk >> EC >> 750 Fall, 2009 Description: Homework 2 (due 9/22) Part 1: Problems B2, B4, B10 from appendix B (pp. 745-6). Part 2: The data in file hmw2data.txt are, from left to right, the daily percentage returns from Jan 4, 2005 to Oct 31, 2005 on the Dow Jones Industrial Average (DJIA) an... Date Added: 2009-04-28 01:18:40 |
| c255a3.pdf Path: McGill >> MATH >> 255 Fall, 2009 Description: Department of Mathematics and Statistics McGill University MATH255, Winter 2009 Assignment 3 n=1 n=1 Due Friday, February 20, 2009 1. Show that m=1 1 (m + n)2 = and that m=1 1 (m + n)3 < . 1 1 1 1 1 1 1 1 1 1 1 2. Show that the rearranged... Date Added: 2009-04-28 01:19:17 |
| lis650n08a-00.ppt Path: Long Island U. >> LIS >> 650 Fall, 2009 Description: LIS650 lecture 0 Introductory lecture Thomas Krichel 2008-10-18 today Today\'s contents Administrative introduction to the course Substantive introduction to the course Talk about you! Introduction to the web Introduction to XML Introduction... Date Added: 2009-04-28 01:19:42 |
| Test2BSolns.pdf Path: Southern Oregon >> MATH >> 2433 Fall, 2009 Description: ... Date Added: 2009-04-28 01:20:03 |
| hwk2.pdf Path: Texas A&M >> M >> 401 Fall, 2009 Description: Math. 401, Sec. 501 Homework 2, due February 4 Spring, 2009 In Exercises 14 nd the leading behavior of all roots. For real roots, continue the calculation up through the rst positive power of . 1. [Logan, p. 59, 2.1(a)] the notes, pp. 1417.) x4 + x... Date Added: 2009-04-28 01:21:18 |
| HE2StudySheet.pdf Path: Bemidji State >> CHEM >> 1212 Fall, 2009 Description: CHEM 1212: Principles of Chemistry II Hour Exam II Study Guide Chapter 14: Chemical Equilibrium-General Concepts o Dynamic equilibrium and equilibrium Laws Be able to write mass action expressions for any reaction. Know difference between reaction q... Date Added: 2009-04-28 01:21:46 |
| hw6.pdf Path: Texas A&M >> M >> 409 Fall, 2009 Description: MATH 409 Homework 6 1. For each of the following sequences of functions {fn (x)}, determine whether they converge pointwise on [0, 1], and if so, nd the limit function f (x). Do they converge 1 1 uniformly? For those that do not, determine whether l... Date Added: 2009-04-28 01:22:19 |
| home7.pdf Path: Texas A&M >> MATH >> 609 Fall, 2008 Description: Homework 7. (Due Dec 6.) Math. 609 1. Question 2 of the 2005 Spring qualier, see, http : /www.math.tamu.edu/research/numerical analysis/qualif iers/qualif y.html. Problem 8, parts a+c (P. 555). Problem 9,10,13. (P. 555). 1 ... Date Added: 2009-04-28 01:22:45 |
| 0428.pdf Path: Princeton >> COS >> 511 Spring, 2009 Description: COS 511: Theoretical Machine Learning Lecturer: Rob Schapire Scribe: Nadia Heninger Lecture #22 April 28, 2008 1 Portfolio Selection Last time we discussed our model of the stock market. N stocks start on day 1 with $1 pt (i) = price relative = pr... Date Added: 2009-04-28 01:23:00 |
| prob2sol.pdf Path: Texas A&M >> MATH >> 645 Fall, 2008 Description: Sept 12 Homework 1. Explain why the answer to Schumer problem 1.14 is Fn+1 . Let an represent the number of ways dominos can cover a 2 by n grid. Then either the 2 squares in the top (n-th) row are covered by a single horizonal domino, in which case ... Date Added: 2009-04-28 01:23:29 |
| Chapter_3--Biological_Foundations_of_Development.ppt Path: MSMC NY >> SCOO >> 8662 Fall, 2009 Description: Genetics Genome The complete set of genes \"Book of instructions\" for making a body Chromosomes Tightly coiled ribbons of DNA and proteins Humans have 46 23 are from the mother 23 are from the father Copyright Houghton Mifflin Harcourt Publ... Date Added: 2009-04-28 17:11:36 |
| Spring2003_ENTC425_grades.pdf Path: Texas A&M >> ENTC >> 425 Fall, 2009 Description: Mod Reports Last 5-dig 10331 11033 15285 15658 15911 19082 19162 24247 24440 24696 28370 30132 30786 32773 33143 37864 45328 52044 52859 56709 57281 57454 57597 59024 59751 70109 72246 75188 75789 75841 75868 76229 76924 90790 91976 92394 92767 97307... Date Added: 2009-04-28 17:11:45 |
| PEZ_and_Web_Design.pdf Path: MICA >> IM >> 200 Fall, 2009 Description: !\" # $% The Pez dispenser is a simple concept. One click and there you have it-candy. Over the years folks have tried making it more complicated, adding bells and whistles (literally), making it bigger, added multiple heads, moving parts, even made... Date Added: 2009-04-28 17:11:58 |
| maze.pdf Path: Sanford-Brown Institute >> CS >> 031 Fall, 2009 Description: Maze Help Session Overview Structs in assembly Memory Management Breadth-first search Implementation Specifics What We Give You, What You Give Us Q&A Structs In Assembly Take a block of memory and use words/bytes in that block for differen... Date Added: 2009-04-28 17:12:55 |
| AppB.pdf Path: Texas A&M >> MATH >> 142 Fall, 2008 Description: Problem8 / page654 The World Almanac for 1995 gives the information on AIDS (rounded to the nearest thousand) shown in the table below year new cases 1985 1986 1987 1988 1989 1990 1991 1992 8 21 31 34 42 44 46 (a) Let x represent the number of year... Date Added: 2009-04-28 17:13:02 |
| asgt10.pdf Path: Cal Poly Pomona >> CS >> 081 Fall, 2009 Description: Computer Science 81 Assignment 10 due Wednesday, November 26, 2008 This assignment is about Turing machines, computability, reductions, and Rices theorem. Remember that the languages J = {m#x | M accepts x} and H = {m#x | M halts on x} are recursiv... Date Added: 2009-04-28 17:14:24 |
| exp3.pdf Path: Michigan State University >> PHY >> 191 Fall, 2008 Description: PHY191 Experiment 3: Simple Measurements and Error Estimation 7/30/2008 Page 1 Experiment 3 Simple Measurements and Error Estimation Reading and problems: Homework 3: turn in as part of your preparation for this experiment. This is a difficult ho... Date Added: 2009-04-28 17:16:54 |
| Ex_1-3_&_Final_excuses.pdf Path: Michigan State University >> PHY >> 232 Fall, 2008 Description: Exams 1 - 3 and Final Exam with excused-exam corrections PID# Exam#1 Ex#2 Ex#3 final Ex excused # correct # correct Exam score out of 12 out of 24 (see bottom of printout) A22162361 9 6 9 21 A23538238 10 7 8 17 A23760953 9 8 10 22 A24010302 11 7 12 1... Date Added: 2009-04-28 17:16:59 |
| TommeleinLi Path: Curtin >> CBS >> 456765 Spring, 2009 Description: Just-in-Time Concrete Delivery: Mapping Alternatives for Vertical Supply Chain Integration JUST-IN-TIME CONCRETE DELIVERY: MAPPING ALTERNATIVES FOR VERTICAL SUPPLY CHAIN INTEGRATION Iris D. Tommelein1 and Annie En Yi Li2 ABSTRACT This paper explains... Date Added: 2009-04-29 07:19:57 |
| HB100-11_leadership_and_mgt Path: Michigan State University >> HB >> 265 Spring, 2009 Description: HB 100 Session 11 Chapter 14 Leadership and Management Leadership Traits Courage Decisiveness Dependability Endurance Enthusiasm Initiative Integrity Judgment Justice Knowledge Loyalty Tact Unselfishness Identifiable Practices Common t... Date Added: 2009-04-29 10:57:45 |
| Chapter 4 Path: George Mason >> ECON >> 103 Spring, 2009 Description: CHAPTER 4 Elasticity After studying this chapter you will be able to Define, calculate, and explain the factors that influence the price elasticity of demand Define, calculate, and explain the factors that influence the cross elasticity of demand ... Date Added: 2009-04-29 10:59:13 |
| evolution2 Path: George Mason >> BIOL 303 >> 303 Spring, 2009 Description: Other mechanisms of evolution. Sexual selection (recognized by Darwin) [Several figures, not in book, but see 23.15, p. 482]. - what about obviously silly characteristics like colors in birds, silly behaviors (e.g. humans), etc.? - Characteristics se... Date Added: 2009-04-29 14:52:08 |
| Prob02032 Path: Cornell >> MAE >> 2120 Spring, 2009 Description: COSMOS: Complete Online Solutions Manual Organization System Chapter 2, Problem 32. Determine the resultant of the three forces of Prob. 2.22. Problem 2.22: Determine the x and y components of each of the forces shown. Vector Mechanics for Enginee... Date Added: 2009-04-30 12:17:23 |
| Chapter 3 Path: BCHS >> FINC >> 106 Spring, 2009 Description: Financial Analysis Chapter 3 Integrated Case DLeon Part I of this case, presented in Section 3, discussed the situation that DLeon Inc., a regional snack foods producer, was in after a 1994 expansion program. Like Borden, Inc., DLeon had increased... Date Added: 2009-05-01 15:58:13 |
| Lecture_8___membrane_processing Path: Cornell >> FDSC >> 4250 Spring, 2009 Description: Membrane Separation in the Dairy Industry Carmen I. Moraru Cornell University Principle of the separation process The solution to be concentrated or fractionated Feed Concentrate Also called retentate Permeate The liquid passing through the mem... Date Added: 2009-05-02 18:30:06 |
| oldhw25 Path: Texas >> PHY 303K >> 303K Spring, 2009 Description: oldhomework 25 Turner (58185) This print-out should have 12 questions. Multiple-choice questions may continue on the next column or page nd all choices before answering. 001 10.0 points A uniform rod of mass 3.5 kg is 15 m long. The rod is pivoted... Date Added: 2009-05-02 19:30:57 |
| Note to class 2_19_09 Path: RPI >> ECSE >> 2410 Spring, 2009 Description: February 10, 2009. Enough students in our class have made me aware that e-mailing A#09 so late (Wed evening) created a significant scheduling problem for them in trying to do the homework in the space of a day and a half already packed with other com... Date Added: 2009-05-03 11:47:48 |
| March 5 Path: Texas >> PSY 301 >> PSY 301 Spring, 2009 Description: March 5 ... Date Added: 2009-05-05 20:34:47 |
| Assessing Overall Audit Risk Path: Aarhus Universitet >> ACCT >> ACCT2 Spring, 2009 Description: Working Paper Reference_ Client Name_ EVALUATION OF OVERALL ACCEPTABLE AUDIT RISK Year-ended_ Prepared by_ Date prepared_ Reviewed by__ Likelihood of Financial Difficulty (check one) _ High probability that the company will successfully continue in b... Date Added: 2009-05-06 18:07:40 |
| AEMC11 Path: Ohio State >> AAE >> 580 Spring, 2009 Description: 11 Systems of Nonlinear Differential Equations Exercises 11.1 1. The corresponding plane autonomous system is x = y, y = -9 sin x. If (x, y) is a critical point, y = 0 and -9 sin x = 0. Therefore x = n and so the critical points are (n, 0) for n =... Date Added: 2009-05-08 12:50:26 |
| hw2p2sol Path: SMU >> MATH >> 5316 Spring, 2009 Description: % % Homework 2 Problem 2 % A=-.99999*tril(ones(60,60),-1)+eye(60); A(:,60)=ones(60,1); [L,U]=lu(A); xtrue=randn(60,1); b=A*xtrue; x=U\\(L\\b); Warning: Matrix is close to singular or badly scaled. Results may be inaccurate. RCOND = 1.735235e-18. norm(L... Date Added: 2009-05-08 22:47:44 |
| Jeong Question 6 Path: Binghamton >> HIST >> 104A Spring, 2009 Description: HIS 204 Three factors that drew the United States into World War I United States joined the World War I on 6th April 1917, this was because of the American view that Isolation was the best way for America to succeed therefore they took the view that ... Date Added: 2009-05-09 13:54:51 |
| history 4 Path: Binghamton >> HIST >> 104A Spring, 2009 Description: HIS 204 David R Buck : Assess three of the objectives of American foreign policy prior to World War I. There are three aspects of the objectives of American foreign policy prior to World War I. The first debate(1780s~1820s) were Jeffersonians vs Hami... Date Added: 2009-05-09 13:54:51 |
| Chapter 29 Path: Fullerton College >> BIOLOGY >> 21909 Spring, 2009 Description: Chapter 29 Protists I. Evolution of the Protists A. Polyphyletic 1. Plantlike (autotrophs) 2. Heterotrophic more animal like 3. 1.5 BYA 4. Artificial Group B. Endosymbiosis possible origin 1. Pelomyxa = ancient eukaryotic cell with symbiotic bacte... Date Added: 2009-05-10 03:39:30 |
| m2_320w05 Path: Ohio State >> ECE >> 323 Winter, 2009 Description: ECE 320 Prof. Clymer Midterm Exam 2 February 25, 2005 50 minutes Printed Name: Write the Honor Code Pledge here: Signed: Please WRITE OUT the Honor Code Pledge: No aid given, received or observed, and sign your name on the exam before your turn it... Date Added: 2009-05-10 12:42:28 |
| Tut 1 - Stress Strain Path: City University of Hong Kong >> MXXM >> 2XX9 Spring, 2009 Description: Tutorial 1: STRESS AND STRAIN 1. The steel tie bar shown is to be designed to carry a tension force of magnitude 120 kN when bolted between double brackets at A and B. The bar will be fabricated from 20 mm thick plate stock. The maximum allowable str... Date Added: 2009-05-10 15:21:59 |
| CFS_Practice_Question Path: Cornell >> AEM >> 2210 Fall, 2008 Description: ... Date Added: 2009-05-12 21:12:04 |
| MidTerm Solutions 2006 Path: McGill >> CHEE >> 380 Fall, 2007 Description: ... Date Added: 2009-05-17 17:49:27 |
| Computer Science 61A - Fall 1997 - Harvey - Midterm 3 Path: Berkeley >> CS >> 61A Spring, 2009 Description: CS 61A, Midterm #3, Fall, 1997 CS 61A, Fall 1997 Midterm 3 Professor Harvey Problem #1 What will the Scheme interpreter print in response to each of the following expressions? Also, draw a \"box and pointer\" diagram for the result of each expression... Date Added: 2009-05-17 18:05:20 |
| BIPN 100 - 2006 Midterm 1 (Fortes) Path: UCSD >> ECON >> ECON 100A Spring, 2009 Description: ... Date Added: 2009-05-18 20:56:53 |
| BICD 130 - 2006 Midterm 1 (Tour) Path: UCSD >> ECON >> ECON 100A Spring, 2009 Description: ... Date Added: 2009-05-18 20:58:53 |
| midterm_sol_05 Path: UCLA >> CIVIL ENGI >> CEE 135A Spring, 2009 Description: ... Date Added: 2009-05-19 19:42:21 |
| BucketBottle.pdf Path: Iowa State >> CD >> 83639 Fall, 2009 Description: BUCKET BOTTLE CALF SHOW Senior Bucket Bottle Calves Champion Reserve Champion 3rd Intermediate Bucket Bottle Calves Champion Reserve Champion Junior Bucket Bottle Calves Champion Reserve Champion Blue Ribbons Kelley Williams Tyler Erenberger Sara Jo... Date Added: 2009-05-21 14:52:50 |
| global.doc Path: Iowa State >> PUBLIC >> 0921 Fall, 2009 Description: Farm News, IA 09-14-07 Farm Transition Network goes global By Darcy Dougherty Maulsby, Farm News staff writer As it supports programs to foster the next generation of farmers and ranchers, the National Farm Transition Network at Iowa State University... Date Added: 2009-05-21 14:55:07 |
| global.doc Path: Iowa State >> MR >> 0921 Fall, 2009 Description: Farm News, IA 09-14-07 Farm Transition Network goes global By Darcy Dougherty Maulsby, Farm News staff writer As it supports programs to foster the next generation of farmers and ranchers, the National Farm Transition Network at Iowa State University... Date Added: 2009-05-21 14:55:07 |
| SongerMemorialScholarship1.pdf Path: Iowa State >> NR >> 84941 Fall, 2009 Description: ISU Extension, Madison County 4-H Application for Bonnie & Leroy Songer Memorial Scholarship Application deadline: September 26 by 5 p.m. to the Madison Co. Extension office. No late entries will be accepted. In accordance with the wishes of the F... Date Added: 2009-05-21 14:55:58 |
| F07.106.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F07.106 repeat_region TEL07R-YP (Y\' element) Chr07 1084353.1090946 tatatatgtcactgtattgcatgctggatggtgttagacaaggccgtagg gacatatagcatctaggaagtaaccttgtacgaaaataggcaatatttcc tgtttaggcgattgtgacgcagattttagtccaacgatctagcgtcaagg aatttttttatagtgggacattgcacca... Date Added: 2009-05-21 14:56:03 |
| 2006531_r01x_0404908.pdf Path: Stanford >> UTSI >> 1033 Fall, 2009 Description: Case 5:04-cv-04908-JW Document 137 Filed 05/31/2006 Page 1 of 4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 TERRY T. JOHNSON, State Bar No. 121569 (tjohnson@wsgr.com) BORIS FELDMAN, State Bar No. 128838 (boris.feld... Date Added: 2009-05-21 14:57:28 |
| 20051019_r03o_043009.pdf Path: Stanford >> CRM >> 1031 Fall, 2009 Description: 1 2 3 4 5 6 7 FOR THE NORTHERN DISTRICT OF CALIFORNIA 8 9 10 11 This Document Relates To Case No. 04-3134 IN RE SALESFORCE.COM, INC. SECURITIES LITIGATION Master File No. C 04-03009 JSW ORDER CLOSING CONSOLIDATED CASE FOR STATISTICAL PURPOSES ONLY / ... Date Added: 2009-05-21 14:57:44 |
| Datasheet_TexasInstruments_74HC00.pdf Path: Montana >> EE >> 261 Fall, 2008 Description: SN54HC00, SN74HC00 QUADRUPLE 2-INPUT POSITIVE-NAND GATES SCLS181E DECEMBER 1982 REVISED AUGUST 2003 D D D Wide Operating Voltage Range of 2 V to 6 V Outputs Can Drive Up To 10 LSTTL Loads Low Power Consumption, 20-A Max ICC D D D Typical tpd = ... Date Added: 2009-05-21 15:00:59 |
| notes_lecture_24.pdf Path: Wyoming >> ATSC >> 5320 Fall, 2009 Description: What is pH? By definition, pH = - log10 (c H + ) But our modeling is based on a molality scale, so how to make the conversion? A relationship between molality and molarity is developed in the homework We can employ that, so for H + , the conversion g... Date Added: 2009-05-21 15:01:31 |
| reading4.pdf Path: Montana >> AGEC >> 445 Spring, 2008 Description: ... Date Added: 2009-05-21 15:01:36 |
| Midterm3Review.pdf Path: Wisconsin >> CS >> 302 Fall, 2008 Description: Exam Review When: Monday, May 9, 2005 from10:05 am 12:05 pm Where: 1240 CS Building IMPORTANT MUST BRING UW Student-ID I will be proctoring two classes, it is required I take your ID when you pick up the exam, and then give it back to you at the ... Date Added: 2009-05-21 15:01:39 |
| hw5.pdf Path: Wisconsin >> BMI >> 776 Fall, 2009 Description: BMI/CS 776 Spring 2008 Homework #5 Prof. Colin Dewey Due Tuesday, April 15th, 2008 by 11:59pm The goal of this assignment is to become familiar with two pattern matching techniques: sux trees and locality-sensitive hashing. You have three options fo... Date Added: 2009-05-21 15:02:14 |
| paper9.pdf Path: Old Dominion >> CS >> 775 Fall, 2008 Description: Decentralized Access Control in Distributed File Systems STEFAN MILTCHEV and JONATHAN M. SMITH University of Pennsylvania VASSILIS PREVELAKIS Drexel University ANGELOS KEROMYTIS Columbia University and SOTIRIS IOANNIDIS Institute of Computer Scien... Date Added: 2009-05-21 15:03:22 |
| index.pdf Path: East Los Angeles College >> C >> 1007 Fall, 2009 Description: Evolution Spring 2005 Course Organiser : Adam Eyre-Walker JMS Building 5B8 / 5B20 a.c.eyre-walker@sussex.ac.uk Office Hours Tuesday 2-3pm Wednesday 2-3pm Timetable Date Lecture subject Test/handin/tutorial Week 1 Mon Jan 10th No Lecture th Tues Jan... Date Added: 2009-05-21 15:04:07 |
| lect2.pdf Path: Berkeley >> ARE >> 213 Fall, 2003 Description: Imbens, Lecture Notes 2, ARE213 Fall 04 ARE213 Fall 2004 1 Econometrics UC Berkeley Department of Agricultural and Resource Economics Ordinary Least Squares II: Variance Estimation and the Bootstrap (W 4.2.3, 12.8.2) In the rst lecture we consider... Date Added: 2009-05-21 15:08:44 |
| assn6.doc Path: UC Riverside >> CS >> 061 Fall, 2008 Description: CS 061 Computer Org. & Assembly Lang. Assignment 6 - due Sunday 5/8, 11 pm Instructions: Turn in your source code (.asm file) to the folder assn6: Remember to include your personal header (name, id, team partners, etc.) Assignment: Spring - 2005 B... Date Added: 2009-05-21 15:10:54 |
| fork.doc Path: UC Riverside >> CS >> 164 Fall, 2008 Description: Lab 3: Concurrent Server using fork() Outline 1.) Different types of servers 2.) A concurrent server using fork() 1.) Different types of servers Depending on whether we are interested in connectionless communication (UDP) or connection oriented commu... Date Added: 2009-05-21 15:11:03 |
| L01.Introduction.pdf Path: Virginia Tech >> CS >> 2504 Spring, 2006 Description: Course Outline I. II. III. IV. V. VI. VII. VIII. IX. X. Introduction Machine language level organization Assembly language and assemblers Logic design Computer arithmetic Performance Processor design Memory hierarchy Storage and networks Other archit... Date Added: 2009-05-21 15:11:06 |
| as6.txt Path: UC Riverside >> CS >> 100 Fall, 2008 Description: *argument.h* - the command line parser does not work well. cs -h -v -i -o -w -d -b will actually do every single option but does not run the cs program - in arguments.h, the variable wire_on is made global when it could instead just be made a privat... Date Added: 2009-05-21 15:11:21 |
| A05007.pdf Path: Minnesota >> A >> 05007 Fall, 2009 Description: ... Date Added: 2009-05-21 15:13:43 |
| final.pdf Path: Western Washington >> CS >> 410 Fall, 2009 Description: 1. _ languages are sometimes described as computing via side effects. (a) imperative (b) Object-oriented (c) dataflow (d) functional (e) logic or constraint-based 2. - languages employ a computational model based on the recursive definition of functi... Date Added: 2009-05-21 15:18:46 |
| hw2.pdf Path: Saint Louis >> HW >> 193 Fall, 2009 Description: Assignment 2 Due September 15, 2008 Name: The following problems address physical units, scientific notation and some simle, but essential concepts. 1. Given a resistor with a value of 38000000 Ohms, write this value in the following formats: Scien... Date Added: 2009-05-21 15:19:44 |
| Money.pdf Path: N. Michigan >> CS >> 255 Fall, 2008 Description: ! \" # $ % , - -\" % ! ! \" \"- - . / , - -/ % $- ! / ! . \", - \"% \"- ! \"! . 0 ! ! $/ $/ , - $/ % - $\" - , \" -1 ! % 2 !... Date Added: 2009-05-21 15:20:05 |
| lecture07-01.ps Path: Wisc La Crosse >> M >> 182 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: lecture07-01.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o lecture07-01.ps lecture07-01.dvi %DVIPSParameters... Date Added: 2009-05-21 15:20:45 |
| Project1 - NCTM Standards.pdf Path: Wisc La Crosse >> MTH >> 125 Fall, 2009 Description: Mth125 Project Dr. Hasenbank, Spring 2008 NCTM Expectations (10 pts) Due: Mon. May 5 In 2000, the National Council of Teachers of Mathematics (NCTM) published a set of curriculum standards (called the Principles and Standards for School Mathematics... Date Added: 2009-05-21 15:21:20 |
| 4343 Week_02 Total for website.ppt Path: UT Arlington >> MANAGEMENT >> 4343 Fall, 2009 Description: C h a p t e r 2 McGrawHill/Irwin Strategic Training 2008 The McGrawHill Companies, All Rights Reserved Introduction: Business Strategy A plan that integrates the company\'s goals, policies, and actions The strategy influences how the company uses: ... Date Added: 2009-05-21 15:23:23 |
| fvprob.xls Path: Ohio State >> MODULE >> 212 Fall, 2009 Description: Accounting 212 Version 1 Q 300 F V C f v c Version 1 Solution Q 300 F V C f v c Version 2 Q 50 F V C f v c Version 2 Solution Q 50 F V C f v c 04/26/2009 Fixed and Variable Cost Problem 400 $35,000 Q*v $5 F/Q 400 $1,500 $35,000 $36,500 $3.75 $87... Date Added: 2009-05-21 15:28:02 |
| mt1b.pdf Path: University of Illinois, Urbana Champaign >> CS >> 257 Spring, 2008 Description: ib 9 IR IGRh R QWXgXXPp @ I6 fRp `GR agXgQ6gXPp U I6 fRp `GR agXgap6gXgp b Fg b r b 9 fdb d Xb dXb Qp AE 7A QIF2F EA4 UA HIF52 D R B gHpEXR D w5 E G E 4 2 `6 E2 4 f R I 2 yR e 6 E E 2 ` ` e 6... Date Added: 2009-05-21 15:31:19 |
| smunday_00cn-hp.pdf Path: East Los Angeles College >> MH >> 902 Fall, 2009 Description: Health Profile for Birmingham 2006 Introduction Local authority health profiles are designed to show the health of people in each local authority area, and include comparisons with other similar populations. They are produced by Public Health Observa... Date Added: 2009-05-21 15:32:08 |
| How to Buy and Process Stockers.pdf Path: Texas A&M >> IRR >> 1985 Fall, 2009 Description: ... Date Added: 2009-05-21 15:33:22 |
| 95_data.txt Path: University of Illinois, Urbana Champaign >> AE >> 526 Fall, 2008 Description: Time (sec) Temp (C) Heat Flow (mW) Heat of Reaction (J/g)0.0000 96.416 25.701 0.000019.998 95.916 25.440 1.410039.998 95.412 24.581 2.460059.998 95.132 23.931 3.050079.998 95.038 23.648 3.340099.996 95.034 23.608 3.5300120.00 95.054 23.679 3.7300140.... Date Added: 2009-05-21 15:34:32 |
| Crimp.pdf Path: Rochester >> AAH >> 128 Fall, 2009 Description: ... Date Added: 2009-05-21 15:37:47 |
| feifmedi.pdf Path: Rochester >> AAH >> 260 Fall, 2009 Description: ... Date Added: 2009-05-21 15:37:59 |
| pal22v10.pdf Path: Maine >> ELE >> 172 Fall, 2009 Description: FINAL COML: -7/10/15 PAL22V10 Family, AmPAL22V10/A 24-Pin TTL Versatile PAL Device DISTINCTIVE CHARACTERISTICS s As fast as 7.5-ns propagation delay and 91 MHz fMAX (external) s 10 Macrocells programmable as registered or combinatorial, and active ... Date Added: 2009-05-21 15:38:09 |
| pal22v10.pdf Path: Maine >> ELE >> 373 Fall, 2009 Description: FINAL COML: -7/10/15 PAL22V10 Family, AmPAL22V10/A 24-Pin TTL Versatile PAL Device DISTINCTIVE CHARACTERISTICS s As fast as 7.5-ns propagation delay and 91 MHz fMAX (external) s 10 Macrocells programmable as registered or combinatorial, and active ... Date Added: 2009-05-21 15:38:16 |
| nray2.pdf Path: University of Illinois, Urbana Champaign >> CS >> 498 Fall, 2008 Description: Nigel Ray Thunderwire: A Field Study of an Audio-Only Media Space Hindus, Ackerman, Mainwaring, and Starr Thunderwire is a voice communication system. It is designed to send high bandwidth audio to multiple users in real time. The program has no visu... Date Added: 2009-05-21 15:38:24 |
| PHAR 725 (website list).doc Path: Oregon State >> P >> 22004 Fall, 2009 Description: http:/www.nlm.nih.gov/medlineplus http:/users.rcn.com/jkimball.ma.ultranet/BiologyPages/A/Antibiotics.html (good brief summary of antibiotics in general) http:/www.intmed.mcw.edu/drug/antibiotics.html (website that lists hospital acquisition cost for... Date Added: 2009-05-21 15:39:26 |
| 754_2003_quiz1.pdf Path: Oregon State >> P >> 22004 Fall, 2009 Description: \" / ~\" U ~ Phar754 Quiz # I, 7 April 2003 PageI , \'\" I- \' I. 11Under which circumstances may intravenous recombinant tissue plasminogen activator (rtPA) be administered for the treatment of ischemic stroke? (2 pts) ~ , ~;:\';-\"b-;-;~ -:R-; t-f)fOSe... Date Added: 2009-05-21 15:40:04 |
| Pr3F06.doc Path: Syracuse >> CSE >> 681 Fall, 2008 Description: CSE681 Software Modeling and Analysis Fall 2006 Project #3 Remote Execution System due 18 Oct 2006 Version 2 Purpose: This project requires you to develop an architecture for a remote execution system. The requirements for that program ... Date Added: 2009-05-21 15:40:47 |
| Interactivity1.doc Path: Syracuse >> CSE >> 681 Fall, 2008 Description: ... Date Added: 2009-05-21 15:41:30 |
| CreateStorage.doc Path: Syracuse >> CSE >> 775 Spring, 2008 Description: Creating Structured Storage ... Date Added: 2009-05-21 15:41:54 |
| Step 1.doc Path: Oregon State >> BA >> 350 Fall, 2008 Description: To get your College of Business Username: 1. Take the first 3 letters of your last name. 2. Add the first letter of your first name. 3. Add the first letter of your middle name (if you dont have a middle name dont add anything) 4. Add the day of the ... Date Added: 2009-05-21 15:45:28 |
| Chap010.ppt Path: Oregon State >> BA >> 351 Winter, 2008 Description: Chapter 10 Human Resource Management Learning Objectives Afterreadingthischapter,youshouldbeableto: Explaintheroleofhumanresourcemanagementinachievinga sustainablecompetitiveadvantage. Identifythekeyfactorsintheenvironmentaffectingthe ma... Date Added: 2009-05-21 15:46:35 |
| Ch.14 Advertising and Public Relations.ppt Path: Oregon State >> BA >> 497 Fall, 2008 Description: Total EU Ad Expenditures 1996 Radio, 5.00% Magazines, 18.80% Cinema, 0.70% Newspapers, 39.30% TV, 31.20% ... Date Added: 2009-05-21 15:46:40 |
| BUILT TO LAST.doc Path: Oregon State >> BA >> 350 Fall, 2008 Description: The metaphor of the North Star symbolizes \"intrinsic motivation\" at the organizational level Built to Last Building Your Company\'s Vision What You Don\'t Know About Decision Making \"Cultural\" How to Invest in Social Capital \"Political\" The Balanc... Date Added: 2009-05-21 15:46:47 |
| 5-Quotes on Interaction.doc Path: Oregon State >> BA >> 350 Fall, 2008 Description: Unlike nonrenewable resources - including fossil fuels and iron ore -renewable resources are linked in highly complex, interdependent systems with many nonlinear and feedback relations. The overextraction of one resource can lead to multiple, unantic... Date Added: 2009-05-21 15:47:35 |
| test2.pdf Path: Salisbury >> MATH >> 210 Fall, 2008 Description: ... Date Added: 2009-05-21 15:49:25 |
| ex1343.pdf Path: Salisbury >> MATH >> 210 Fall, 2008 Description: ... Date Added: 2009-05-21 15:49:25 |
| Test3Sp06Solutions.pdf Path: Salisbury >> MATH >> 230 Spring, 2008 Description: ... Date Added: 2009-05-21 15:49:32 |
| ENCh08.ppt Path: Georgia Tech >> CS >> 4400 Fall, 2008 Description: Copyright 2004 Pearson Education, Inc. Chapter 8 SQL-99: Schema Definition, Basic Constraints, and Queries Copyright 2004 Pearson Education, Inc. Used to CREATE, DROP, and ALTER the descriptions of the tables (relations) of a database Data Defi... Date Added: 2009-05-21 15:49:49 |
| 0.pdf Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Computational Geometry Final. Due: 4/30/2004 1. Given a 3-dimensional convex polytope (represented as a doubly-connected edge list data structure) describe an ecient datastructure that allows to decide whether a query point is inside or outside that ... Date Added: 2009-05-21 15:51:47 |
| PopQuiz1.ppt Path: Georgia Tech >> CS >> 2200 Fall, 2008 Description: CS 2200 Pop Quiz 1 Pop Quiz 1 We have a one-processor system where users submit the following jobs A at time 0, needs 10s to complete B at time 1, needs 5s to complete C at time 7, needs 20s to complete D at time 12, needs 9s to complete Th... Date Added: 2009-05-21 15:51:47 |
| Safeway.ppt Path: Oregon State >> BA >> 495 Fall, 2008 Description: Michelle Beck Lindsey Thompson Danielle Witt Store History 1915 M.B. Skaggs purchased first grocery store from father Business strategy- give customers value and to expand by keeping a narrow profit margin 1928- 428 stores in 10 states (with t... Date Added: 2009-05-21 15:57:18 |
| sis063bj.pdf Path: Colorado State >> SIS >> 063 Fall, 2009 Description: sis063bj SP02 05/21/02 10:21 Page 1 Office of Budgets and Institutional Analysis Section Size by College and Course Level Spring 2002 Agricultural Sciences Lower Lab 1 - 10 11 - 25 26 - 50 51 - 75 101 - 150 Lecture 1 - 10 11 - 25 26 - 50 51 - ... Date Added: 2009-05-21 15:59:44 |
| sis063cj.pdf Path: Colorado State >> SIS >> 063 Fall, 2009 Description: sis063cj FA97 09/24/97 09:49 Page 1 Office of Budgets and Institutional Analysis Section Size by Course Level for the University Fall 1997 University Lower Lab 1 10 11 25 26 50 51 75 76 100 101 150 151 200 Lecture 1 10 11 25 26 50 51... Date Added: 2009-05-21 16:00:05 |
| sis063cj.pdf Path: Colorado State >> SIS >> 063 Fall, 2009 Description: sis063cj SP95 06/07/01 10:37 Page 1 Office of Budgets and Institutional Analysis Section Size by Course Level for the University Spring 1995 University Lower Lab 1 - 10 11 - 25 26 - 50 51 - 75 76 - 100 101 - 150 Lecture 1 - 10 11 - 25 26 - 50 ... Date Added: 2009-05-21 16:00:11 |
| Lecture_03a-PreassessmentResultsAB.ppt Path: Georgia Tech >> CS >> 2200 Fall, 2008 Description: CS2200 Presentation 2a Pre-assessment Results Results Number of students who took the assessment 250 200 150 100 50 0 Fa 02 Sp 03 Fa 03 Sp 04 Su 04 Fa 04 A Fa 04 B Fa 01 Sp 02 Su 02 Su 03 Su 01 Question: What do you want to do? 100 150 200 250... Date Added: 2009-05-21 16:02:50 |
| 2300HW04-1_Fall2002.doc Path: U. Houston >> ECE >> 2300 Fall, 2008 Description: ECE 2300 CIRCUIT ANALYSIS HOMEWORK #4 Part 1 Fall 2002 Due Dates: MW Sections: October 7, 2002 TuTh Sections: October 3, 2002 Complete problems from Electric Circuits, 6th Edition, by Nilsson and Riedel: 4.3, 4.11, 4.26 Additional Problems: D9. Use... Date Added: 2009-05-21 16:05:18 |
| 2300HW10_Spring2004.doc Path: U. Houston >> ECE >> 2300 Fall, 2008 Description: ECE 2300 CIRCUIT ANALYSIS HOMEWORK #10 Spring 2004 Due Dates: MW Section May 3, 2004 TuTh Section May 3, 2004 (Turn in under Dr. Dave\'s office door, W326-D3, by midnight) Complete problems from Electric Circuits, 6th Edition, by Nilsson and Riede... Date Added: 2009-05-21 16:05:32 |
| notes18 1100.ppt Path: U. Houston >> ECE >> 1100 Fall, 2008 Description: ECE 1100: Introduction to Electrical and Computer Engineering Spring 2008 David R. Jackson Professor, ECE Dept. Notes 18 Kirchhoff Voltage Law (KVL) KVL v 4 + + v1 + v 2 + v 3 N voltage drops are defined around a closed loop (N = 4 here) The volta... Date Added: 2009-05-21 16:05:45 |
| 3455HW04_Assign_Fall2004.doc Path: U. Houston >> ECE >> 3455 Fall, 2008 Description: ECE 3455 ELECTRONICS HOMEWORK #4 Due Date: September 29, 2004 For the circuits below, plot the straight-line approximation to the Bode Plots (magnitude and phase). Note that the transfer functions for these circuits were determined in HW #3. ... Date Added: 2009-05-21 16:06:19 |
| CS2_36_InterclassCommunication_Demo.ppt Path: Georgia Tech >> CS >> 1322 Fall, 2008 Description: CS2 Module 36 Category: Elements of Java Topic: Interclass Communication Demo Objectives Interclass Communication CS 2 Introduction to Object Oriented Programming Module 36 Elements of Java Interclass Communication The Screen TheS oup WindowL... Date Added: 2009-05-21 16:06:57 |
| Women 1.ppt Path: University of Illinois, Urbana Champaign >> EPS >> 201 Fall, 2008 Description: What does literacy mean to those who are illiterate today? Chameli Waiba Nepal -Read Handout http:/www.npr.org/templates/story/story.php?storyId=100677646 \"I realized the power concealed in the alphabet on the very first day I joined the adult lite... Date Added: 2009-05-21 16:09:05 |
| rigaut.pdf Path: Toledo >> CHM >> 1054 Fall, 2009 Description: 1999 Nature America Inc. http:/biotech.nature.com RESOURCES IN THE LABORATORY A generic protein purification method for protein complex characterization and proteome exploration Guillaume Rigaut, Anna Shevchenko, Berthold Rutz, Matthias Wilm, Mat... Date Added: 2009-05-21 16:10:00 |
| AMA2008.doc Path: North Texas >> BUSI >> 6280 Fall, 2008 Description: ... Date Added: 2009-05-21 16:10:09 |
| bagozzi_Yi)1989.pdf Path: North Texas >> BUSI >> 6280 Fall, 2008 Description: On The Use Of Structural Equation Models Experimental Desig Bagozzi, Richard P.; Yi, Youjae JMR, Journal of Marketing Research; Aug 1989; 26, 3; ABI/INFORM Global pg. 271 Reproduced with permission of the copyright owner. Further reproduction prohib... Date Added: 2009-05-21 16:10:14 |
| HWK4Linkage.pdf Path: Washington >> PHG >> 518 Spring, 2008 Description: Homework 4: Linkage L I N E A R R E G R E S S I O N Effective D.F. -109 A N A L Y S I S Full Sibs Pi Mean -0.476784 Half Sibs Pi Mean -Regress Y on P T-values P-values -1.8747 0.031758 Intercept -1.8550 Slope -1.47 Trait Locus - -FACTOR3 HSLVNTR ... Date Added: 2009-05-21 16:12:47 |
| CS110_FALL_2005_syllabus.doc Path: Coker >> CS >> 110 Fall, 2009 Description: Coker College Syllabus CS110 - Computer Science I FALL of 2005 Instructor Dr. Ze Zhang Assistant Professor of Computer Science Department of Science and Mathematics Office: 112 Science Building Phone: 383-8122 Email: zzhang@coker.edu Web: http:/cour... Date Added: 2009-05-21 16:13:15 |
| solution.pdf Path: Washington >> MATH >> 20090224 Fall, 2009 Description: Challenge of the Week February 24March 2, 2009 Problem This nifty problem was suggested by Tom Boothby. It arose while nding ecient algorithms to do arithmetic in nite elds for SAGE. A bit of background is necessary. Dene the four inputs 0 A= 0 0 ... Date Added: 2009-05-21 16:15:09 |
| Team_6_Nurses.pdf Path: Washington >> LIS >> 510 Fall, 2008 Description: The Information Behavior of Nurses LIS 510: Assignment #2 By Team 6 Sheri Boggs Lynly Ewel Lisa Pirlot Lorraine Thomas Our review of current literature surrounding information behavior in nursing was dominated by the widely acknowledged need for mor... Date Added: 2009-05-21 16:15:27 |
| Bond Pricing with Excel.xls Path: Oregon State >> BA >> 442 Fall, 2008 Description: Semi-Annual Bond Price at July 1, 2006 $110.10 $109.87 $109.68 $109.24 Coupon Rate is 8% Price at October 1, 2007 Maturity Date is Price at January 1 18 remaining coupons 18 remaining coupons, but have way through the coupon period 17 remaining c... Date Added: 2009-05-21 16:15:58 |
| nintendo wii[1].ppt Path: Oregon State >> BA >> 495 Fall, 2008 Description: \"Nintendo Wii: Funny Name, fun system\" by Chris Morris Stephanie Sandoval Thad Sandow Lisa Schaeffer The System 3 On sale: November 19 3 Price: $250 3 Game price: $50 3 Memory Card 3 Comes with Wiisport 3 Features: Wiimote comes with one cont... Date Added: 2009-05-21 16:16:44 |
| Levels of Listening 2.doc Path: Oregon State >> BA >> 450 Fall, 2008 Description: Seek First To Understand Four reasons to listen Four \"levels\" of understanding? F1 = you learn significant/important/critical information where others are \"coming from\" - their \"frames\" and their \"priorities\" + \"aikido\" strategies work F2 = you alter... Date Added: 2009-05-21 16:17:18 |
| MIS 204-Chapter 4 HW.doc Path: Penn State >> EHS >> 5010 Fall, 2009 Description: Emily Smetanick 15 February 2008 MIS 204 Chapter 4 Homework 1) The CPU follows the basic instructions that cause the computer to function. The CPU consists of 2 units, the Control Unit and the Arithmetic Logic Unit. The Control Unit manages and organ... Date Added: 2009-05-21 16:19:34 |
| metric_system_primer.pdf Path: Washington >> ESS >> 203 Winter, 2008 Description: Metric System Primer Unit Length Time Mass Temperature Abbreviation m c d k M Temperature 100 C 20 C 0 C -40 C Metric Unit meter (m) second (s) kilogram (kg) Kelvin (K) Definition millicentidecikiloMegaConversions 2.5 cm ~ 1 in 1 m ~ 1 yard 1 km = 10... Date Added: 2009-05-21 16:21:01 |
| prob5_4.pdf Path: Washington >> MATH >> 120 Fall, 2008 Description: 3 dGViS8s8G8cd qT# 4C C x P W 9HQP H CA 7 x H d 4 4 W BSSwm#u GCXBG8q~EDmAq5qhlBG}XVUS8fD5RDeRSDwDeGq5Hf8q}v PC T 4 7Q v C WT Y THA 7 @E W W QC x 7 CTHQ TACQCT TACPQ C WT x f g g f g a C r @ V H 7 H AA @Q P Q 7 @ E x ... Date Added: 2009-05-21 16:21:13 |
| Quiz_5_solution.doc Path: UF >> EIN >> 6357 Spring, 2008 Description: Quiz 5 20 minutes, Open Book, Open Course Slides. Last Name:_ First Name_ There are 7 questions, and each question is worth 14 points (2 points are free, summing up to 100). 1. Suppose that a fair coin is tossed twice. The minimum and the maximum of ... Date Added: 2009-05-21 16:21:44 |
| Construction Portfolio Part 1.pdf Path: Washington >> M >> 445 Fall, 2009 Description: Math 445 Construction Portfolio Part 1 Page 1 Math 445 Construction Portfolio Part 1 Instructions: Do each construction with compass and unmarked straightedge. Label key points so that others can read and understand the steps in your work. This par... Date Added: 2009-05-21 16:23:16 |
| m308aquiz1.pdf Path: Washington >> M >> 308 Fall, 2009 Description: Math 308A Winter 2002 Math 308A Quiz #1 Quiz 1 Page 1 Problem 1: The matrix A = 0 0 0 0 1 0 0 0 2 0 0 2 4 1 . Vector w = 0 0 1 0 0 2 1 -2 . 2 4 Solve the equation Ax = w. Make clear which are the free variables. Write the general solu... Date Added: 2009-05-21 16:23:18 |
| EmailScheduling.ppt Path: Naval Academy >> SI >> 200 Spring, 2009 Description: SI200 Information Systems for the Junior Officer E-mail and Scheduling Objectives Understand the fundamentals of Email in the military Understand Scheduling/Task Management Know some basics of Outlook E-mail benefits Convenience Speed R... Date Added: 2009-05-21 16:23:26 |
| CSE535_02_17.pdf Path: ASU >> CSE >> 535 Fall, 2008 Description: ... Date Added: 2009-05-21 16:23:50 |
| Vivek.ppt Path: ASU >> CSE >> 534 Fall, 2008 Description: Resolving Conflicting Mitigative Actions for a Criticality in the Ayushman System Vivek Rana Advanced Computer Networks Questions to keep in mind. What is a Criticality? What is a Mitigative action and how is it followed? What is the Conflict... Date Added: 2009-05-21 16:26:01 |
| HW6Sols.pdf Path: University of Alaska Fairbanks >> MATH >> 641 Fall, 2009 Description: Math F641: Homework 6 Solutions October 17, 2007 1. Carothers 10.7 (Solution by Nichole Schimanski) Let ( f n ) and (g n ) be real-valued functions on the set X, and suppose that ( f n ) and (g n ) converge uniformly on X. Show that ( f n + g n ) c... Date Added: 2009-05-21 16:27:40 |
| EE215Su08_Homework5_Solution.pdf Path: Washington >> EE >> 215 Fall, 2009 Description: EE 215 Fundamentals of Electrical Engineering Homework #5 EE 215 FUNDAMENTALS OF ELECTRICAL ENGINEERING UNIVERSITY OF WASHINGTON DEPT. OF ELECTRICAL ENGINEERING SUMMER 2008 1. Problem 5.7 (10 points) ... Date Added: 2009-05-21 16:29:27 |
| 04.pdf Path: University of Hawaii - Hilo >> BOTANY >> 153 Fall, 2009 Description: RESULTS AND DISCUSSION Checklist The 266 moss specimens in the HAVO Herbarium were examined to verify identification. Of these, 39 had not been identified beforehand and 17 had been misidentified resulting in a list of 68 species in the park. Nine sp... Date Added: 2009-05-21 16:30:08 |
| gpslabweek3.docx Path: UNC >> GEOG >> 370 Fall, 2008 Description: Emily Madara 3 April 2008 moemily@email.unc.edu 711960088 GPS Lab- Week 3 1. Your friend just moved to a new neighborhood that is 2 miles from campus according her map. What would you estimate for the biking distance? How reliable is your estimation?... Date Added: 2009-05-21 16:32:21 |
| p10245.pdf Path: LSU >> V >> 102 Fall, 2009 Description: Problem J The Closest Pair Problem Input: standard input Output: standard output Time Limit: 8 seconds Memory Limit: 32 MB Given a set of points in a two dimensional space, you will have to find the distance between the closest two points. Input Th... Date Added: 2009-05-21 16:34:55 |
| mt.sln.pdf Path: Washington >> STAT >> 341 Winter, 2008 Description: STAT 341 Midterm solution W02 1. P(X=i,Y=j)=P(X=i)P(Y=j) by independence, so need only determine marginal distributions. P(Y=1)=0.03+0.04+0.03=0.1 Hence P(X=1)=0.03/0.1 = 0.3, and P(Y=2)=0.15/0.3=0.5. This P(Y=3) =1-0.1-0.45=0.4, and P(X=2)=0.04/0... Date Added: 2009-05-21 16:35:31 |
| dt.clstr.100101_SC3_V34.sw.1.pdf Path: Minnesota >> DT >> 100101 Fall, 2009 Description: Nearest Boom to +DC B-Field = 2 6 6 FILE = dt.clstr.100101_SC3_V34.sw.1.ps 7 4 9 @ # TIME START 09:47:17.050153 END 09:47:17.051625 8 5 5 4 4 4 TOTAL ANGLE 30.982794 30.922540 Spin Angle 149.03494 149.09558 Cant Angle -1.1045930 -1.1150253 EFFE... Date Added: 2009-05-21 16:37:10 |
| ts.bx.042802.0354b.dat.pdf Path: Minnesota >> TS >> 100101 Fall, 2009 Description: ... Date Added: 2009-05-21 16:38:15 |
| lab_4_part_1.doc Path: SUNY Purchase >> CS >> 265 Fall, 2009 Description: Lab 4 Part 1 Name: Part 1: To be completed in the lab on Friday 07/23/04 or next Friday 07/30/04 (i) (ii) Review Preparation for Lab 4. Prepare, run and test Java code, which accomplishes the following tasks: Takes an input integer n as a command li... Date Added: 2009-05-21 16:38:23 |
| Lab06.pdf Path: Penn State >> STAT >> 462 Fall, 2008 Description: Computer Lab Session #6 Load the file MASSCOLL.MTW from the Minitab example data sets, Student 12 subdirectory. 1. Consider the simple linear regressions of y=%WhoGrad on x=CSAT. Using Stat > Regression > Regression > Storage, save the regular residu... Date Added: 2009-05-21 16:41:45 |
| STAT514HWK6.pdf Path: Penn State >> STAT >> 514 Spring, 2008 Description: ... Date Added: 2009-05-21 16:41:50 |
| Feb4.doc Path: Penn State >> STAT >> 462 Fall, 2008 Description: Stat 462 Output for Feb. 4 Lecture Example Dataset is the hospital infection risk dataset in the appendix of our text. Following are simple regression results for three different predictor variables: Beds= number of beds in hospital, Census = average... Date Added: 2009-05-21 16:46:43 |
| hw4.pdf Path: Arizona >> MATH >> 129 Spring, 2006 Description: Name Written Homework 3 Math 129 Section 13 Spring 2009 Evaluate the following integrals if possible. Otherwise, show whether they converge or diverge. 1. 2 1 dz 4 + z2 1 2. 1 x4 + 1 dx x /2 3. /3 sin d cos 4. 1 2 + cos d 2 5. ... Date Added: 2009-05-21 16:47:35 |
| keeler-2.pdf Path: Los Angeles Southwest College >> CHEM >> 729 Fall, 2009 Description: 2 NMR and energy levels The picture that we use to understand most kinds of spectroscopy is that molecules have a set of energy levels and that the lines we see in spectra are due to transitions between these energy levels. Such a transition can be... Date Added: 2009-05-21 16:49:51 |
| chapter7.pdf Path: Los Angeles Southwest College >> CHEM >> 729 Fall, 2009 Description: NMR Chapter 7: 1D Techniques Interaction between spins can be used for spectral assignments and to obtain structural information. The most common techniques exploit scalar (J) coupling. Scalar coupling can be used to identify spin pairs that interact... Date Added: 2009-05-21 16:49:53 |
| q17a.ps Path: Los Angeles Southwest College >> CSCE >> 330 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.78 Copyright 1998 Radical Eye Software (www.radicaleye.com) %Title: q17a.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSCommandLine: dvips q17a.dvi -o q17a.ps %DVIPSParameters: dpi=60... Date Added: 2009-05-21 17:59:08 |
| q6a.ps Path: Los Angeles Southwest College >> CSCE >> 330 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: q6a.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMBX12 CMCSC10 CMR12 CMR10 CMBX10 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (... Date Added: 2009-05-21 19:12:32 |
| q14a.ps Path: Los Angeles Southwest College >> CSCE >> 330 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: q14a.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMBX12 CMCSC10 CMR12 CMR10 CMBX10 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: ... Date Added: 2009-05-21 19:12:34 |
| TEAM PROJECT BASIC TASKS S09.doc Path: UNC Wilmington >> BLA >> 361 Fall, 2009 Description: TEAM PROJECT BASIC TASK BUSINESS LAW Spring 2009 THE BASIC PARAMETERS The simulation takes place during the summer of the year 2014. Your presentation will occur FIVE years in the future, so you must do a bit of business forecasting! Organize your c... Date Added: 2009-05-21 19:14:44 |
| lec13_FSM.ppt Path: Auburn >> E >> 2200 Fall, 2009 Description: ELEC 2200-002 Digital Logic Circuits Fall 2008 Finite State Machines (FSM) (Chapter 7-10) Vishwani D. Agrawal James J. Danaher Professor Department of Electrical and Computer Engineering Auburn University, Auburn, AL 36849 http:/www.eng.auburn.edu/~v... Date Added: 2009-05-21 19:19:41 |
| ELEC3050 HCS12 Lab2.pdf Path: Auburn >> ELEC >> 3050 Fall, 2008 Description: ELEC 3040/3050 Lab Manual Lab 2 Revised 1/14/09 LAB 2: DEVELOPING C PROGRAMS IN CODEWARRIOR FOR THE HCS12 MICROCONTROLLER The objective of this laboratory session is to become familiar with the process for creating, executing and debugging applicat... Date Added: 2009-05-21 19:21:38 |
| ELEC3050 HCS12 Lab11.pdf Path: Auburn >> ELEC >> 3050 Fall, 2008 Description: ELEC 3040/3050 Lab Manual Lab 11 Revised 01/23/09 LAB #11: SPEED CONTROL OF A D.C. MOTOR MOTOR CHARACTERIZATION INTRODUCTION The primary goal of this semester-long project is to develop a speed controller for a D.C. motor. Whenever the motor is to ... Date Added: 2009-05-21 19:21:42 |
| Homework 8.pdf Path: Auburn >> ELEC >> 2220 Fall, 2008 Description: ELEC 2220 Computer Systems Homework #8 Due: Friday, 9-12-08 Given the CPU12 program below, sketch a diagram of the data memory, beginning at address $0800. As in Homework #6, label each byte of memory with its address, indicate which byte of memory c... Date Added: 2009-05-21 19:22:13 |
| Distillation_Calibration_Sheets_publish.xls Path: Auburn >> MANS >> 486 Fall, 2009 Description: ul MeOH 1 1000 997 994 991 988 985 982 979 976 973 970 920 870 820 770 720 670 620 570 520 470 420 370 320 270 220 170 120 70 20 0 2 3 5 6 8 9 uls EtOH volume ratio, ME/ET fraction, MeOH mol 0.000 3.000 6.000 9.000 1.00 100.0% Methanol in Ethanol C... Date Added: 2009-05-21 19:22:58 |
| lect10.ppt Path: UMBC >> CMSC >> 104 Fall, 2006 Description: Algorithms IV Top-Down Design Top-Down Design Also known as Top-Down Stepwise Refinement. Big problem becomes a set of smaller problems Smaller problems become even smaller problems Finally a simple problem that is easy to solve. Example - Co... Date Added: 2009-05-21 19:25:08 |
| hwsol07.pdf Path: Texas A&M >> MATH >> 622 Fall, 2008 Description: ... Date Added: 2009-05-21 19:25:30 |
| lec5.ps Path: Penn State >> A >> 534 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.86 p1.5d Copyright 1996-2001 ASCII Corp.(www-ptex@ascii.co.jp) %based on dvipsk 5.86 Copyright 1999 Radical Eye Software (www.radicaleye.com) %Title: lec5.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %D... Date Added: 2009-05-21 19:27:10 |
| EckertCh.7Forensicpath.pdf Path: N. Illinois >> BIOS >> 493 Fall, 2008 Description: ^c Sciences Forensic Pathology RONALD K. WRIGHT WILLIAM G. ECKERT 7 iblished by vloenssens, ed by The I. Johnson, ig Co., St. Forensic pathology is probably the oldest branch of the forensic sciences, and, indeed, until the first quarter of the t... Date Added: 2009-05-21 19:28:07 |
| bus_bs_mrkt_as_acct_000.pdf Path: JWU Denver >> FL >> 0506 Fall, 2009 Description: Student Academic Planner North Miami To use the planner: ACCOUNTING Associate Degree in Accounting for students entering in catalog year 2005/2006 Instructions Suggested course sequencing follows. Remember: All classes do not run every term. 1. Re... Date Added: 2009-05-21 19:29:35 |
| first_order_logic.pdf Path: Sanford-Brown Institute >> CSCI >> 1410 Fall, 2009 Description: CS 141 Introduction to AI Greenwald Lecture 13: First-Order Logic 10:30 AM, Mar 10, 2009 Contents 1 Overview 2 Syntax 3 Semantics 4 Substitution 5 Logical Entailment 5.1 5.2 Logical Inference: Natural Deduction . . . . . . . . . . . . . . . . . . ... Date Added: 2009-05-21 19:30:32 |
| 090211_exercises_ID.pdf Path: UVA >> CS >> 202 Fall, 2008 Description: Exercises for Discrete Math CS 202 version 2009-02-11-12:24 Exercises for Integers and Division ID1. Determine whether each of the following statements is TRUE or FALSE and explain your answer. a. ab | c b | c b. ab | bc a | c c. (a | b) (b | a) ... Date Added: 2009-05-21 19:30:58 |
| wk12_Design of experiment I ECE311.pdf Path: Idaho >> ECE >> 311 Fall, 2008 Description: ECE311 Design of Experiment I: Page 1 of 2 ECE311 - Fundamentals of Electronics Lab Department of Electrical Engineering and Computer Engineering University of Idaho Problem 1 1. 2. 3. 4. Draw electronics symbol for the diode 1N2004. Identify the a... Date Added: 2009-05-21 19:31:26 |
| long.pdf Path: Sanford-Brown Institute >> CSCI >> 2440 Fall, 2009 Description: CSCI 2440 Long X. Nguyen An Truthful Approximation Combinatorial Auction 1 Introduction This document summarizes ideas of an truthful approximately combinatorial auction from the paper [1]. In combinatorial auctions, bidders can express their pref... Date Added: 2009-05-21 19:33:39 |
| Discretion.pdf Path: Wisconsin >> PS >> 217 Fall, 2009 Description: Discretion October 14, 2003 Political Science Legal Studies 217 Discretion Discretion and Law Discretion is inevitable Discretion all pervasive Legal discretion defined: The space between and within legal rules where legal actors can and do exerci... Date Added: 2009-05-21 19:38:07 |
| Math210_Assignment_04_Solutions.doc Path: Coker >> MATH >> 210 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|21 Sep 2005 15:40:43 -0000 vti_extenderversion:SR|5.0.2.2623 vti_thicketsupportingfile:BW|true ... Date Added: 2009-05-21 19:39:08 |
| Chapter8HardCopy.ppt Path: Hartford >> CS >> 220 Fall, 2009 Description: Data Structures with C+ Using STL Chapter Eight Queues and Priority Queues 04/26/09 Chapter 8 1 What is a Queue? q q q A queue is a sequential storage structure which permits access only to the two ends of the sequence. New elements are added... Date Added: 2009-05-21 19:40:07 |
| rutherfordg022.pdf Path: Texas >> RUTHERFORD >> 022 Fall, 2009 Description: Copyright by Gregory Franklin Rutherford 2002 The Dissertation Committee for Gregory Franklin Rutherford Certifies that this is the approved version of the following dissertation: Academics and Economics: The Yin and Yang of For-Profit Higher Educa... Date Added: 2009-05-21 19:43:16 |
| 00000034.pdf Path: Carnegie Mellon >> TERA >> 05102393 Fall, 2009 Description: ... Date Added: 2009-05-21 19:43:57 |
| 00000034.pdf Path: Carnegie Mellon >> DISK >> 05102393 Fall, 2009 Description: ... Date Added: 2009-05-21 19:43:57 |
| midterm.pdf Path: CSU San Bernardino >> CSCI >> 313 Fall, 2009 Description: MIDTERM PRACTICE K.E. SCHUBERT (1) Convert the following (a) -39 to 8 bit 2\'s complement (b) 234 to 8 bit unsigned (c) 3.03125 to IEEE single precision (2) Multiply (without converting back) your result from (1c) and 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 ... Date Added: 2009-05-21 19:45:18 |
| P200_exam2soln1_F08.pdf Path: Wittenberg >> P >> 200 Fall, 2009 Description: ... Date Added: 2009-05-21 19:54:25 |
| P200lab_05_f08.pdf Path: Wittenberg >> P >> 200 Fall, 2009 Description: Physics 200B Lab 5: Force and Motion \". . . equal forces shall effect an equal change in equal bodies . . .\" - Newton Objectives - To develop a method for measuring forces reliably. - To explore how the motion of an object is related to the forces ap... Date Added: 2009-05-21 19:54:40 |
| SLi_Outline.pdf Path: Santa Clara >> ENGR >> 019 Fall, 2009 Description: Research Paper Outline of ENGR 301: Page 1 of 1 Research Paper Outline of ENGR 301: I. Cellular phone has changed the way of how people communicate. a. Less private personal time b. Expectation of reaching a person c. Convenience, emergency More So... Date Added: 2009-05-21 19:55:00 |
| TwafaUseCase.pdf Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: ATM Report on Configuration DefaultConfig PACKAGES Default USE CASE DIAGRAMS: ATM System ATM System Capture User Picture Deposit Money Camera Withdraw Money Email Transactio n Customer Check Balance Dispense Cash Email Controller Cash Dispense... Date Added: 2009-05-21 19:55:04 |
| Class18b.pdf Path: Santa Clara >> ENGR >> 019 Fall, 2009 Description: Food and Hunger Tom Juric Ashley Fabeck Cynthia Longs Food and Hunger Background Information Hunger Facts Professional Issues Legal/Policy Issues Ethical Issues Stakeholders Actions/Consequences Final Decision Background Causes of hunger: ... Date Added: 2009-05-21 19:56:08 |
| tarek_eldin_hw3.pdf Path: Santa Clara >> ENGR >> 300 Fall, 2009 Description: 84 Tarek Eldin Transportation 1. Economics a. Is it desirable or undesirable on any of these scales: global, country, region, company, immediate neighbors, people in general? Its tough to see the impact that these technologies would have in the futu... Date Added: 2009-05-21 19:56:44 |
| NZooleh_Proposal.pdf Path: Santa Clara >> ENGR >> 019 Fall, 2009 Description: Research topic: Internet Security and why it\'s necessary We can explain its necessity by discussing what would happen ( or what happens) when there\'s not enough of it provided( or the levels of security are not utilized to the full extents.) Having d... Date Added: 2009-05-21 19:57:44 |
| vmatocinos_UseCase.pdf Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: PersonalProject_Us eCases Report on Configuration DefaultConfig PACKAGES Default GLOBALS: ACTORS: Programmer Relations: itsSet overheat protection system Association with Set overheat protection system, Multiplicity of 1, Bi-directional itsProgram a... Date Added: 2009-05-21 19:58:44 |
| hw1.pdf Path: Kentucky >> MA >> 515 Fall, 2008 Description: MA515 Homework #1 Due Monday, August 30 1. A matching in a graph is a subset of edges of the graph such that no two selected edges share a common endpoint. If we associate the edges e E(G) of the graph with variables xe , consider the characteristic... Date Added: 2009-05-21 19:59:19 |
| lecture 8.pdf Path: Arizona >> AREC >> 514 Fall, 2008 Description: Aggregation Need to aggregate impacts across individuals Welfare Function: Aggregation of individual welfare functions. Individual welfare function for i Ui = Ui(Xi1, Xi2, Xij) Max L=Ui(Xi1, Xi2, Xij) _i(p1*Xi1+p2*Xi2 +pj*Xij - Yi) FOC: Uj/ Xij... Date Added: 2009-05-21 20:01:55 |
| cs2335_overview.ppt Path: Georgia Tech >> CS >> 2335 Fall, 2008 Description: C ourseOve w and the rvie Big Picture CS 2335 S m r 2006 um e Bob Wate rs Age nda inistrativeInfo Adm Big Picture I ntro to Quality Adm inistrativeData lass b C We Page wsgroup Mandatory Re ading Daily Ne ad/write ) git.cc.class.cs2335 (re a... Date Added: 2009-05-21 20:02:10 |
| STP226S09_Ch10handout.pdf Path: ASU >> STP >> 226 Fall, 2008 Description: Chapter 10 Inferences for Two Population Means STP 226: Elements of Statistics Jenifer Boshes Arizona State University 10.1: The Sampling Distribution of the Difference Between Two Means Independent Samples Independent samples: The sample samples: ... Date Added: 2009-05-21 20:02:22 |
| curlanddivergence.pdf Path: George Mason >> MATH >> 215 Fall, 2008 Description: 3.8 Finding Antiderivatives; Divergence and Curl of a Vector Field 77 3.8 Finding Antiderivatives; Divergence and Curl of a Vector Field Overview: The antiderivative in one variable calculus is an important concept. For partial derivatives, a simil... Date Added: 2009-05-21 20:04:56 |
| interaction.pdf Path: Wellesley >> CS >> 307 Fall, 2008 Description: 1 User Interaction So far, we\'ve mostly been creating images and animations, rather than interacting with the user. Our interaction has mostly been limited to keyboard callbacks using TW, and even that has been mostly toggling global settings such as... Date Added: 2009-05-21 20:05:05 |
| M187S07test2.pdf Path: Boise State >> MATH >> 187 Fall, 2008 Description: Math 187 Test II Dr. Holmes This test begins at 8:40 am and ends at 9:35. You are allowed to use a plain scientic calculator with no graphing or symbolic computation capability. Cell phones must be turned o and out of sight. 1 1. Give a demonstrati... Date Added: 2009-05-21 20:05:19 |
| EconomicTurbulence.pdf Path: Montclair >> PSC >> 643 Fall, 2009 Description: Economic Turbulence Ahead: How Much, How Long, and What Markets Are Telling Us Presentation to the Lions Club of Montclair, New Jersey, March 19, 2008 Phillip LeBel, Ph.D. Professor of Economics School of Business Montclair State University Lebelp@m... Date Added: 2009-05-21 20:05:21 |
| test2.ps Path: Boise State >> MATH >> 170 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: test2.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips test2 -otest2.ps %DVIPSPara... Date Added: 2009-05-21 20:05:25 |
| 3-4.doc Path: Valdosta >> MATH >> 3161 Fall, 2008 Description: Chapter 3: Estimation and Computation 3.4 Algorithms for Multiplication and Division 3.4.1. Developing Algorithms for Multiplication 3.4.1.1. Using the Area Model for Multiplication 3.4.1.1.1. Base-Ten Blocks see ex. 3.22 p. 163 3.4.1.2. Your turn p... Date Added: 2009-05-21 20:09:17 |
| homework1.pdf Path: Wright State >> EE >> 701 Fall, 2008 Description: EE-701 Solution of Homework-1 Spring-2008 ... Date Added: 2009-05-21 20:10:00 |
| collaboration.pdf Path: University of Montana >> CS >> 335 Fall, 2009 Description: Computer Science 335 Programming Languages. Policy on joint work and outside help: The ability to work together is a valuable tool for learning. I encourage you to discuss your homework problems with your fellow students, and to seek outside help wh... Date Added: 2009-05-21 20:10:56 |
| FinalProjectInstructions.ppt Path: UCSB >> CS >> 240 Fall, 2009 Description: CS 240A Final Project What is it? Significant parallel implementation / experiment by team of students Performance / tuning will be part of grade Can parallelize existing serial code (from research, public domain, etc.) Can leverage your other ... Date Added: 2009-05-21 20:15:13 |
| Armenian Church of Rochester.pdf Path: Nazareth >> DOCS >> 20052006 Fall, 2009 Description: ArmenianChurchofRochester (AtSt.ThomasEpiscopalChurchinRochester) ResearchedbyAndrewSerce(StudentofNazarethCollegeofRochester) InformationprovidedbyMaxBoudakian AddressandContacts: 226JoanneDrive,Rochester,NewYork14616 Fr.KeghamZakarian(Pastor) 1.... Date Added: 2009-05-21 20:15:31 |
| chapter8.txt Path: UMDNJ >> BINF >> 5312 Fall, 2009 Description: Chapter 8: Class Inheritance and Interfaces 1. Analyze the following code: class Circle { private double radius; public Circle(double radius) { radius = radius; } } a. The program has a compilation error because it does not ha... Date Added: 2009-05-21 20:16:55 |
| PatientPop.ppt Path: UMDNJ >> BINF >> 5075 Fall, 2009 Description: PATIENT RECRUITMENT and EXCLUSION CRITERIA BINF5075 Choosing Study Subjects and Recruitment Population A complete set of people with a specified set of characteristics Choosing Study Subjects and Recruitment (cont) Target population The set of a... Date Added: 2009-05-21 20:17:19 |
| Lecture_14_5230_2006S.ppt Path: UMDNJ >> BINF >> 5513 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|26 Apr 2006 19:56:09 -0000 vti_extenderversion:SR|4.0.2.7802 vti_cacheddtm:TX|26 Apr 2006 19:56:09 -0000 vti_filesize:IR|1601536 vti_cachedlinkinfo:VX|H|#ref1 vti_cachedsvcrellinks:VX|FHUS| shrpnwk/COUR... Date Added: 2009-05-21 20:18:13 |
| midterm_eval.pdf Path: UCSB >> CS >> 501 Fall, 2009 Description: Midterm TA Evaluation all evaluations are strictly confidential Note: evaluate one TA with this form to evaluate another TA, use another form TA Name _ Course # _ Section Day __ Time _ Question 1 Do you attend discussion sections? _ YES ... Date Added: 2009-05-21 20:19:32 |
| hw5.pdf Path: UCSB >> ECE >> 215 Fall, 2009 Description: ECE215A/Materials206A Winter 2008 Prof. Brown/ECE Dept/UCSB Homework 5 1. Show that the mean kinetic energy of a three-dimensional Fermi gas of N free electrons at 0 K is 3 U 0 = 5 NU F 2. Classical limit of Fermi gas. (a) For the Fermi gas of ele... Date Added: 2009-05-21 20:20:16 |
| last_half_syllabus.pdf Path: Wisconsin >> ENGR >> 408 Fall, 2009 Description: Topics to be covered and learning goals: NEEP 408: March May Week March 17-19 Topics MC code development Description + Goals -Understand MC structure through code development - Develop practical experience in calculating radiation interactions with ... Date Added: 2009-05-21 20:21:03 |
| Lecture13-LogicalEffort.pdf Path: Berkeley >> EE >> 141 Fall, 2008 Description: EE141 EE141EE141-Spring 2008 Digital Integrated Circuits Lecture 13 Logical Effort EE141 EECS141 Lecture #13 1 Announcements Project starts end next week New assignment p g posted on Monday y Midterm results on We EE141 EECS141 Lecture #13 2... Date Added: 2009-05-21 20:21:40 |
| profile.pdf Path: Sanford-Brown Institute >> CS >> 295 Fall, 2009 Description: Profile-Driven Cache Management Mitch Cherniack Brandeis University Waltham, MA 02454 mfc@cs.brandeis.edu Eduardo F. Galvez Brandeis University Waltham, MA 02454 eddie@cs.brandeis.edu Michael J. Franklin University of California Berkeley, CA 94720 fr... Date Added: 2009-05-21 20:21:43 |
| interaction_no.pdf Path: Penn State >> STAT >> 401 Fall, 2008 Description: ... Date Added: 2009-05-21 20:22:11 |
| 20090316 EE235 Raman.ppt Path: Berkeley >> EE >> 235 Fall, 2009 Description: Raman Spectroscopy of Nanostructures EE 235 16 March 2009 EE235 16 March 2009 1 Raman studies of nanostructures Multiple meanings! Study of the nanostructures themselves Study of a chemical analyte on top of nanostructures EE235 16 March 200... Date Added: 2009-05-21 20:24:22 |
| 17-Kinematics.pdf Path: Berkeley >> CS >> 184 Fall, 2008 Description: CS-184: Computer Graphics Lecture #17: Forward and Inverse Kinematics Prof. James O\'Brien University of California, Berkeley V2006-F-17-1.0 Today Forward kinematics Inverse kinematics Pin joints Ball joints Prismatic joints 2 Forward Kinematics A... Date Added: 2009-05-21 20:25:26 |
| solution9.pdf Path: Berkeley >> MATH >> 113 Fall, 2000 Description: Dr. Martin Olbermann Due: Thursday, Nov. 1, in class Math 113, Section 4 Fall 2007 Homework 9 Proofs and explanations should always be written, as often as possible, using complete English sentences. You should always explain and justify each of t... Date Added: 2009-05-21 20:29:23 |
| lecture011806.txt Path: Michigan >> ECE >> 270 Fall, 2009 Description: If (temp >= 0) { temp = sqrt(temp);/notice this is NOT algebra cout < \"root1 = \" < (-b+temp)/(2*a); cout < \"root2 = \" < (-b-temp)/(2*a); } /end of code block else cout < \"Roots are complex!\ \";... Date Added: 2009-05-21 20:31:34 |
| lecture 101205.txt Path: Michigan >> ECE >> 270 Fall, 2009 Description: /* Don\'t worry about pointers for today\'s quiz! Dynamic memory: Memory can be requested from the operating system and assigned to pointers. In this manner, it is possible to create \"arrays\" of any size. int *pointer = new int[100];/dynamical... Date Added: 2009-05-21 20:31:39 |
| midterm.pdf Path: Delaware >> CIS >> 372 Fall, 2009 Description: CISC 372: INTRODUCTION TO PARALLEL PROGRAMMING Fall 2006 Midterm Exam Study Guide Midterm Time and Date: classtime on Thursday, October 19, 2006 1 References - Lectures notes from start of course through October 17. - Textbook: all readings posted... Date Added: 2009-05-21 20:35:05 |
| project_instruction.pdf Path: Delaware >> CIS >> 841 Fall, 2009 Description: CISC 841 Bioinformatics Spring, 2006 Final Project Goals The final project is an essential part of this course (40% of the grade). It is intended to let you get a feel about doing research in bioinformatics. While you are allowed to choose a topic b... Date Added: 2009-05-21 20:35:10 |
| 00000091.pdf Path: Carnegie Mellon >> TERA >> 05101320 Fall, 2009 Description: ... Date Added: 2009-05-21 20:35:23 |
| 00000091.pdf Path: Carnegie Mellon >> DISK >> 05101320 Fall, 2009 Description: ... Date Added: 2009-05-21 20:35:23 |
| pump.pdf Path: Mich Tech >> CM >> 3215 Fall, 2008 Description: What is Pumping Head? Associate Professor of Chemical Engineering Michigan Technological University September 8, 1999 Faith A. Morrison There is often considerable confusion among students when it comes to the de nition and use of pumping head. Thi... Date Added: 2009-05-21 20:50:53 |
| tcp-game.pdf Path: Duke >> CPS >> 214 Fall, 2009 Description: Review What are the limits to throughput for TCP? The Congestion Game Jeff Chase Duke University Limits to Throughput Host limitations/overhead Flow limits: how fast can app can produce or consume data? Wire speed Congestion limits available b... Date Added: 2009-05-21 20:56:29 |
| ContrastCodingInANOVAUnequalCells.doc Path: North Texas >> T >> 6240 Fall, 2009 Description: AppliedMultivariateStatistics BUSI6240 ANOVA ContrastCodinginANOVAWithUnequalCellSizes -COMMENT \"Unequal Cell Sizes\". COMMENT \"Creating the Data Set\". DATA LIST FREE / Case Group Y. BEGIN DATA. 1 2 61 2 4 78 3 1 47 4 2 65 5 2 45 6 4 106 7 1 120 8 2... Date Added: 2009-05-21 21:03:49 |
| Unif_contin_notes.pdf Path: Portland >> MTH >> 320 Fall, 2009 Description: Math 320-1 Notes on Uniform Continuity Spring 2006 These notes supplement the discussion in our text on uniform continuity. It shows you one of the important applications of uniform continuity which, informally stated, asserts: Every function that\'... Date Added: 2009-05-21 21:22:41 |
| EWB%20Challenge%20Design%20Brief%20_08(1).pdf?PHPSESSID=073773dd5a246b4f5b7dc53be35ce7b3 Path: Allan Hancock College >> ENGG >> 1803 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>12744b9e1b30e40e2cac7efd0a49aead656baa0b.pdf %3FPHPSESSID</Key><RequestId>60998FE010214B1B</RequestId><HostId>YMswPTujGrlAnB5... Date Added: 2009-05-21 21:29:44 |
| COIT11222__Week_08__Lecture.ppt Path: Allan Hancock College >> COIT >> 11222 Fall, 2009 Description: COIT 11222 Visual Programming Lecture: Week 8 References: Java Programming - Complete Concepts and Techniques, 3rd Edition, Shelly Cashman et al. COIT 11222 - Visual Programming Author(s): Mike OMalley Slide: 1 Topics For This Week Avoiding ... Date Added: 2009-05-21 21:30:03 |
| sogawlagb2006538.txt Path: Allan Hancock College >> SOGAWLAGB >> 2006538 Fall, 2009 Description: Passed by both Houses New South Wales Sale of Goods and Warehousemen\'s Liens Amendment (Bulk Goods) Bill 2006 Contents ... Date Added: 2009-05-21 21:31:52 |
| tmb2000277.txt Path: Allan Hancock College >> TMB >> 2000277 Fall, 2009 Description: PARLIAMENT OF VICTORIA Trade Measurement (Amendment) Act 2000 Act No. TABLE OF PROVISIONS Clause Pa... Date Added: 2009-05-21 21:32:15 |
| mcgb2008262.txt Path: Allan Hancock College >> MCGB >> 2008262 Fall, 2009 Description: PARLIAMENT OF VICTORIA Melbourne Cricket Ground Bill 2008 TABLE OF PROVISIONS Clause Page 1 Purpose ... Date Added: 2009-05-21 21:33:29 |
| wmar20062006n87417.txt Path: Allan Hancock College >> WMAR >> 20062006 Fall, 2009 Description: The legislation that is being viewed is valid for Sessional. Water Management Amendment Regulations 2006 (S.R. 2006, No. 87) - CONTENTS Water Management Amendment Regulations 2006 ... Date Added: 2009-05-21 21:33:43 |
| test.doc Path: Contra Costa College >> LYRA >> 4388 Fall, 2009 Description: Another test ... Date Added: 2009-05-21 21:34:12 |
| veatfab2001464.txt Path: Allan Hancock College >> VEATFAB >> 2001464 Fall, 2009 Description: _ VOCATIONAL EDUCATION AND TRAINING FUNDING AMENDMENT BILL 2001 1998-1999-2000-2001 THE PARLIAMENT OF THE COMMONWEALTH OF AUSTRALIA HOUSE OF REPRESENTATIVES VOCATI... Date Added: 2009-05-21 21:34:53 |
| ccaofsb2008401.txt Path: Allan Hancock College >> CCAOFSB >> 2008401 Fall, 2009 Description: Serial 137 Criminal Code Amendment (Drink or Food Spiking) Bill 2008 Dr Burns A Bill for an Act to amend the Criminal Code Act [Page Break] CRIMINAL CODE AMENDMENT (DRINK OR FOOD SPIKING) ACT 2008 ... Date Added: 2009-05-21 21:35:13 |
| Ch11.ppt Path: UNC >> ECON >> 400 Fall, 2008 Description: Linear Regression Relationship Between Variables - Often we are interested in how one variable is correlated with another - Does amount of schooling correlated with higher wages? - What variables are correlated with a person\'s choice of health insur... Date Added: 2009-05-21 21:36:29 |
| cs530-Thursday.ppt Path: East Los Angeles College >> CS >> 530 Fall, 2009 Description: Thursday - Practical Tables CS530 Database Architecture Models and Design Prof. Ian HORROCKS Dr. Robert Stevens In this Section - Topics Covered SQL Query and View Integrity Triggers - Examples Classes CS530 - Ian Horrocks and Robert Stevens... Date Added: 2009-05-21 21:37:41 |
| CS2606HW2.doc Path: Virginia Tech >> CS >> 2606 Fall, 2006 Description: CS 2606 Data Structures and OOP II Homework #2 Spring 2008 Due: 10 March, 11:59pm You will submit this homework through the curator system in any format that can be opened using Microsoft Word or Notepad (plain ASCII text is fine). If you submit mo... Date Added: 2009-05-21 21:38:11 |
| MatlabTutorial.pdf Path: Oregon State >> ECE >> 560 Fall, 2008 Description: ... Date Added: 2009-05-21 21:40:31 |
| 13Mar2009.ppt Path: Allegheny >> CHEM >> 232 Fall, 2009 Description: A fe w pi ct u re s . . ... Date Added: 2009-05-21 21:42:00 |
| notes.doc Path: CSU LA >> CS >> 120 Fall, 2009 Description: George Navarro The internet was originally developed by physicist as a method to distribute research papers faster than publishing in traditional science journals. Eventually the project was picked by the government and then the computer science comm... Date Added: 2009-05-21 21:42:14 |
| Lecture_10_Leadership_amended.pdf Path: Brookdale >> PUAD >> 2803 Fall, 2009 Description: Lecture 10: Leadership Management in the Public Sector PUAD 2803 Winter 2009 Carmen Kontur-Gronquist Mayor of Arlington Oregon Eliot Spitzer Governor of New York James McGreevey Governor of New Jersey Christine Keeler John Profumo, Secretary... Date Added: 2009-05-21 21:45:15 |
| 3705quiz1.pdf Path: Youngstown >> MATH >> 3705 Spring, 2008 Description: MATH 3705 Code 2110 Name: Differential Equations: Quiz 1 Summer 2003 Score: /100 1. Determine the order of the differential equation and state whether the equation is linear or non-linear: (a) t2 d2 y dy + t + 2y = sin t dt2 dt (b) dy + ty 2 = 0... Date Added: 2009-05-21 21:46:55 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 05102263 Fall, 2009 Description: ... Date Added: 2009-05-21 21:47:19 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 05102263 Fall, 2009 Description: ... Date Added: 2009-05-21 21:47:19 |
| Site-Map 4(530).doc Path: Mt. Mercy >> IBS >> 530 Fall, 2009 Description: Page: Shopping Cart S assy Creations (Logo) H ome About Sassy FAQs Policies Cont act Shopping Jewelr y Galler y Shop by Pr ice I mage Sizing Shipping Ret ur n Policy Blog Jewelr y Par t ies Remove Image Remov Cont inue Checkout ... Date Added: 2009-05-21 21:52:44 |
| finm331W09Homework7.pdf Path: Ill. Chicago >> FINM >> 331 Fall, 2009 Description: FINM331/STAT339 Financial Data Analysis Hanson Winter 2009 Lecture 7 Homework: NonParametric Regression for Options and Time Series (Homework Due by Lecture 8 in Chalk FINM331 Digital Dropbox or otherwise acceptable to TA/CA/Graders) You must ... Date Added: 2009-05-21 21:53:16 |
| ece520-s15.pdf Path: Idaho >> ECE >> 520 Spring, 2008 Description: ... Date Added: 2009-05-21 21:54:06 |
| ece523-s06.pdf Path: Idaho >> ECE >> 523 Fall, 2008 Description: ... Date Added: 2009-05-21 21:54:16 |
| HW01.pdf Path: Idaho >> ECE >> 504 Spring, 2008 Description: ECE 504 Special Topics Power System Stability II HW #1 I. Define the Situation The parameters for the following circuit are: C1 := 3 C2 := 2 r1 := 11.2 r2 := 17.8 ORIGIN := 1 rm := 7.0 r1 r2 i1 + v1 C1 rm + vm - i2 C2 + v2 - v01 := 10 v0... Date Added: 2009-05-21 21:54:39 |
| 115_problem_set_answers_sp07.pdf Path: Berkeley >> E >> 115 Fall, 2008 Description: Department of Economics University of California Berkeley CA 94720 Problem Set Guide Prepared by Jonathan Rose 1 Identifications 1.1 Portfolio Investment Flows Economics 115 The 20th Century World Economy Spring 2007 These flows refer to the owners... Date Added: 2009-05-21 21:55:46 |
| Lecture_24.pdf Path: N.C. State >> CH >> 331 Spring, 2008 Description: Kinetics The Arrhenius rate constant Transition state rate constant Catalysis The Arrhenius equation The empirical observation is that: ln k = ln A for many reactions. This means that a plot of ln(k) vs. 1/T gives a straight line. A is the pre-ex... Date Added: 2009-05-21 21:56:19 |
| lecture20.pdf Path: Minnesota >> ECE >> 575 Fall, 2009 Description: Lecture 20 AerE/EE/Math/ME 575 Introduction to Robust Control Fall 2001 M. Khammash 1 SISO Robust Stability and Performance We have developed an uncertainty model of the form: Additive Uncertainty: where Gp G wa Multiplicative Uncertainty: Gp G... Date Added: 2009-05-21 21:57:26 |
| lect23.pdf Path: Minnesota >> ECE >> 577 Fall, 2009 Description: ... Date Added: 2009-05-21 21:57:33 |
| lecture9.pdf Path: Minnesota >> ECE >> 577 Fall, 2009 Description: ... Date Added: 2009-05-21 21:57:36 |
| 01ch14-8am.pdf Path: UMass (Amherst) >> CHEM >> 262 Fall, 2008 Description: Announcements You should get copies of two pages of handouts. Course WWW page will be www.chem.umass.edu/~lahti/Education/Undergraduate/Chem 262 OWL sections will be rostered tomorrow for this course. Report exam conflicts to me by end of next week ... Date Added: 2009-05-21 21:59:12 |
| Lecture5.pdf Path: Berkeley >> EE >> 290 Spring, 2004 Description: EE290q - Spring 2006 EE290q Spring 2006 Organization and Management of Organization and Management of Ad-hoc Sensor and Actuator Networks Ad-hoc Sensor and Actuator Networks We 4-6pm, 203 McLaughlin Lecture 5: The Hardware Abstraction Trivia Presen... Date Added: 2009-05-21 22:00:45 |
| HighSpeedLANs.ppt Path: New Hampshire >> ECE >> 734 Fall, 2008 Description: ECE 734/834 Data and Network Communications Chapter 16 Medium Access Control for High Speed LANs Ethernet (CSMA/CD) MostwidelyusedLANstandard Developedby XeroxoriginalEthernet IEEE802.3 CarrierSenseMultipleAccesswithCollision Detection(CSMA/CD) ... Date Added: 2009-05-21 22:02:21 |
| Week09_PR_S06b_T06.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: Team Number: 6 Week: 03/27-04/03 Program Size (SLOC) Base Added Deleted Modified Reused # of COTS Total New SLOC Effort (Hours) Project Mgmt. Requirements COTS Assessment Design Life Cycle Planning Environment Preparation Configuration Mgmt. Feasibil... Date Added: 2009-05-21 22:02:45 |
| FRD_RLCA_Elog_S06b_T06_AS.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: February 27, 2006 CSCI 577b Team 6 USC Football Recruitment Database Revati Kadu Akshay Aras Natasha Karnik Amruta Chitnis Abhishek Venkatesh Explanation Log: FRD Aditya Shukla 1. Area of Concern 1 Section is not in conjugation with SSAD as there ... Date Added: 2009-05-21 22:04:07 |
| E320Ex1SolDvorak-F08.pdf Path: Arizona >> ECE >> 320 Fall, 2008 Description: ECE 320A Name: Exam 1 Student ID: October 2, 2008 ~I-K-J- 1. This problem involves a single-phase circuit that consists of a source with an unknown voltage V, and a load that consists of a capacitor (C, ) in parallel with a series combination of ... Date Added: 2009-05-21 22:04:49 |
| Apr_76.x.txt Path: New Hampshire >> SR >> 1976 Fall, 2009 Description: The University of Chicago IMP 8 Cosmic Ray Nuclear Composition (CRNC) High Mass Data Averaging Period = 3600.00 seconds Fill Data = -1... Date Added: 2009-05-21 22:04:51 |
| Lecture5.3.pdf Path: Uni. Worcester >> ECE >> 230 Fall, 2009 Description: Multiple Access protocols single shared broadcast channel multiple access control protocols determine how nodes share channel, i.e., when to send, how to recover from collision Three broad classes: Channel Partitioning divide channel into sma... Date Added: 2009-05-21 22:06:08 |
| 3360318s.xls Path: U. Houston >> TECH >> 132 Fall, 2009 Description: x 19.1 38.2 57.3 76.2 95.0 114.0 131.0 150.0 170.0 y 0.1 0.17 0.26 0.35 0.43 0.500 0.580 0.65 0.72 Solution to problem 3.18 on page 114 LINEST - Click on cell D7 to see what was entered. Press: Ctrl/Shift/Enter (hold all down at the same time) slop... Date Added: 2009-05-21 22:07:06 |
| Viegas-etal.pdf Path: Toledo >> CS >> 2528 Fall, 2009 Description: From Submit to Submitted via Submission: On Lexical R u l e s in Large-Scale L e x i c o n A c q u i s i t i o n . Evelyne Viegas, Boyan Onyshkevych , Victor Raskin ~, Sergei Nirenburg Computing Research Laboratory, New Mexico State University, Las C... Date Added: 2009-05-21 22:09:49 |
| Megalithic.ppt Path: SUNY Buffalo >> MACROWORLD >> 303 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|GEOWEB\\Travis Nelson vti_modifiedby:SR|GEOWEB\\Travis Nelson vti_timelastmodified:TR|25 Aug 2003 19:25:18 -0000 vti_timecreated:TR|23 Jan 2003 16:27:55 -0000 vti_title:SR|PowerPoint Presentation vti_extenderversio... Date Added: 2009-05-21 22:10:47 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
