Course Solutions And Notes - Art 108 study guide Constable & Turner 13
| test2practiceanswers.txt Path: Duke >> X >> 100 Fall, 2009 Description: Answers to test 2 practice problems Thinking about Thinking about sorting 1. Bubble sort is slower because it is swap intensive: O(n^2) swaps vs. O(n) swaps for selection sort. Strings are slower because they use more memory so take longer to s... Date Added: 2009-06-08 15:25:53 |
| spring98roster.txt Path: Duke >> X >> 108 Fall, 2009 Description: burk, john bradley jbb2@acpub.duke.edu congdon, james douglas (jim) jdc11@acpub.duke.edu hancock, alexander edward (alex) aeh5@acpub.duke.edu luoma, stacey lee luoma@cs.duke.edu (audit) ande... Date Added: 2009-06-08 15:26:02 |
| SampFinal.doc Path: Laurentian >> MGT >> 200203 Fall, 2009 Description: Sample Final Exam The breakdown of the final exam will be: Chapter 11. Supply Chain Management 12. Inventory Management 13. Aggregate Planning 14. Material Requirements Planning 15. Short Term Scheduling 16. Project Management 17. Maintenance and Rel... Date Added: 2009-06-08 15:26:02 |
| samegame.ps Path: Duke >> X >> 149 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 72 558 720 %Creator: Mozilla (NetScape) HTML->PS %DocumentData: Clean7Bit %Orientation: Portrait %Pages: 3 %PageOrder: Ascend %Title: Problem 2 %EndComments %BeginProlog [ /.notdef /.notdef /.notdef /.notdef /.notdef /... Date Added: 2009-06-08 15:26:23 |
| EECS_311_HW1.pdf Path: Case Western >> EECS >> 311 Fall, 2009 Description: EECS 311 Electromagnetic Fields II Spring 2003 Homework #1: Due January 24th Basic transmission line problem with resistive loads Ringing is often encountered when the source or load impedance is less than the cable characteristic impedance You are a... Date Added: 2009-06-08 15:32:25 |
| Chapter18-p23-24-.pdf Path: Minnesota >> CS >> 5631 Fall, 2008 Description: Symmetric Approach To Mutual Exclusion Idea: Ask every other process if it is OK to enter the critical section by sending a request message Processes not in critical section send reply message Only enter own critical section if get reply from all ... Date Added: 2009-06-08 15:36:07 |
| vhdl_tutorial.pdf Path: San Jose State >> EE >> 176 Fall, 2008 Description: Agenda q q q q q q q q q q EE Dept., SJSU 9/6/98 VHDL.1 Fundamental of VHDL Design for FPGA Chapter 1: Who is in attendant? What is VHDL? Chapter 2: VHDL Design w/ Max+PlusII Chapter 3: ABCs of VHDL Chapter 4: Introduction to Data Types Chapter 5: P... Date Added: 2009-06-08 15:44:29 |
| Ch7_4.pdf Path: San Jose State >> EE >> 118 Spring, 2008 Description: Synchronous and asynchronous systems 3 SPECIFICATION OF SEQUENTIAL SYSTEMS 1 x(t) x(t) Synchronous z(t) sequential systems z(t) Clock CLK 0 1 2 (a) Figure 7.2: Mealy time (b) and Moore machines time 3 4 5 6 Time State behavior minimiz... Date Added: 2009-06-08 15:44:31 |
| lecture_22_Oct_2002.doc Path: University of Alaska Fairbanks >> LECTURES >> 338 Fall, 2009 Description: 2002 NRM338 Lecture Noes Page#1 Lecture Notes NRM338 Oct 22, 2002 Thursday 1) 2) 3) 4) 5) Questions? Lattice versus Grids Digital Elevation Models Arcview 3D Analyst Extension Go over lab#7 Digital Elevation Models Lattice versus Grid Identical fi... Date Added: 2009-06-08 15:44:56 |
| 74LS85_on-semi.pdf Path: UF >> DOCS >> 3701 Fall, 2009 Description: SN74LS85 4-Bit Magnitude Comparator The SN74LS85 is a 4-Bit Magnitude Camparator which compares two 4-bit words (A, B), each word having four Parallel Inputs (A0A3, B0B3); A3, B3 being the most significant inputs. Operation is not restricted to binar... Date Added: 2009-06-08 15:45:04 |
| Sept 23 Assignment.doc Path: Kent State >> BUSINESS >> 63022 Fall, 2009 Description: BAD 63022 Professional Issues in Accounting September 23rd Assignment Financial Reporting and Disclosures-Past & Present Comparison with Financial Reporting in Other Countries References on 2-Hour Reserve at KSU Main Library Historical Perspectives o... Date Added: 2009-06-08 15:45:35 |
| pictograph.xls Path: U. Houston >> CUIN >> 3111 Fall, 2008 Description: Transportation Number of Students Car Bus Walking 6 5 10 Ways We Get To School 21 18 15 Number of Students 12 9 6 3 0 Car Bus Types of Transportation Walking Number of Students of s ... Date Added: 2009-06-08 15:53:50 |
| CompleteFairBook09.pdf Path: Iowa State >> NR >> 101476 Fall, 2009 Description: 4-H in Fairs Fairs are an opportunity for Iowa\'s most valuable resource PEOPLE to have a unique 4-H learning experience. Fairs provide 4-Hers an opportunity to demonstrate what they have learned. This represents an educational function in which the... Date Added: 2009-06-08 15:53:59 |
| 122 vocab list 1:16:08.pdf Path: Hudson VCC >> JAPN >> 122 Fall, 2009 Description: 1 08/1/16 (n) putting on weight over the New Year\'s holidays; ED (n) food served during the New Year\'s Holidays; ED ; (n-adv,n) year; age; SP ; (n) (1) mouse; rat; (2) dark gray; slate color; SP (n) ... Date Added: 2009-06-08 15:54:26 |
| 122 vocabulary 3:7.pdf Path: Hudson VCC >> JAPN >> 122 Fall, 2009 Description: !\"# $%# %<=>? @ # AB B CDE E F F F GH @ @=G: I>J @ AG=KLGJLEMN F O E F F F N K9HGAB :P# AB B CDE E H I :9H@ GHI : E H I :9H@ E K9= @=PE9>K=UGAB :P# Q> RP9@AGHI : # # A B B C DE E=> RP9@AGH I : E # S9= @=P# T... Date Added: 2009-06-08 15:54:28 |
| rect.pdf Path: Michigan State University >> ECE >> 435 Fall, 2009 Description: ... Date Added: 2009-06-08 15:54:43 |
| ReflectiveEssay1 wd.doc Path: Penn State >> SAV >> 5034 Fall, 2009 Description: Sarah Verbos Reflective Essay 1 As I have observed for 30 hours at the middle school I was able to go with the teachers into a classroom to watch and listen as they plan lessons for the upcoming week. I have never really thought how much work and ef... Date Added: 2009-06-08 15:56:04 |
| B0924hall_3_dem.txt Path: Washington University in St. Louis >> MER >> 0924 Fall, 2009 Description: The file B924hall_3_dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0227485 2) Add -5.80086 The x & y scales are 0.030 mm / pixel. Maximum value for DEM, corresp... Date Added: 2009-06-08 16:01:38 |
| B0145cobblehill_1_dem.txt Path: Washington University in St. Louis >> MER >> 0145 Fall, 2009 Description: The file B145cobblehill1dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0228127 2) Add -5.81723 The x & y scales are 0.030 mm / pixel. Maximum value for DEM, cor... Date Added: 2009-06-08 16:02:02 |
| IntroduceYourselftoaWorm.doc Path: Iowa State >> NR >> 100902 Fall, 2009 Description: Introduce Yourself to a Worm Science Process Skills observing communicating categorizing ordering applying Materials Per Participant: clear plastic tumbler pencil a worm writing paper For Entire Group: hand lenses (optional) honey Do... Date Added: 2009-06-08 16:04:20 |
| project2_lable.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: Art 240 M-W 1pm Russ Prior Project #2 Kurt Dudley Psychoillogical Disorder San Diego State University ... Date Added: 2009-06-08 16:06:18 |
| healthcenter00.doc Path: SUBR >> FILE >> 2417 Fall, 2009 Description: FOR IMMEDIATE RELEASE December 7, 2000 Contact: Amanda P. Larkins (225) 771-4545 MEDIA ADVISORY Southern University plans ribbon-cutting ceremony for new student health center BATON ROUGE-Southern University will host a ribbon-cutting ceremony for... Date Added: 2009-06-08 16:20:46 |
| Chapter 02.ppt Path: BYU >> ECE >> 124 Fall, 2008 Description: Chapter 2 Bits, Data Types, and Operations CS/ECEn 124 Chapter 2 1 What are Decimal Numbers? xDecimal means that we have ten digits to use in our representation (the symbols 0 through 9) xWhat is 3,546? It is three thousands + five hundreds + fo... Date Added: 2009-06-08 16:38:03 |
| Assignment6.pdf Path: Eastern Oregon >> CS >> 121 Fall, 2009 Description: CS 121 Assignment Six: Figures from the History of Computing From the list of names below, choose one to research and write about. Your research should include at least two independent sources. One of these may be Wikipedia or a similar web-based kno... Date Added: 2009-06-08 16:39:43 |
| Helloe.txt Path: WVU >> CS >> 110 Fall, 2008 Description: - Begin Helloe.java - 1: /* 2: * @(#)Helloe.java 3: * @CS 110 Sample Program 4: * @8-20-08 5: * @Prints out a hello message 6: * @Demonstrates compiler errors 7: */ 8: 9: 10: public class Helloe 11: { 12: public static void main (String[] ... Date Added: 2009-06-08 16:41:12 |
| s330t2sol.pdf Path: W. Alabama >> STAT >> 330 Fall, 2009 Description: ... Date Added: 2009-06-08 16:41:22 |
| Chapter 8 Version 1.pdf Path: UVA >> ECON >> 302 Fall, 2008 Description: Outline of Chapter 8 Consumption and Savings decisions by Consumers Preferences for consumption today versus tomorrow The Permanent Income Hypothesis Intertemporal Substitution Borrowers vs Lenders Ricardian Equivalence 1 Income (Y) split be... Date Added: 2009-06-08 16:41:31 |
| proj.pdf Path: Kentucky >> CS >> 471 Fall, 2009 Description: CS 471 Spring 2008 Programming Project 1 A Basic Web Server (Sockets, the HTTP Protocol, and Cookies) Due: Monday, February 11, 2008 1 Overview The goal of this project is to write a simple web server that can respond to client requests by serving... Date Added: 2009-06-08 16:44:15 |
| PROC_5850.pdf Path: Webster FL >> UTAH >> 0910 Summer, 2009 Description: The School of Business 801... Date Added: 2009-06-08 16:45:53 |
| MoreSampleExamAnswers.pdf Path: North-West Uni. >> OPNS >> 430 Fall, 2009 Description: OPNS-430 sample mid-term: SOLUTIONS [1] Consider the life cycle of a product from introduction to maturity to decline. What kind of process (job shop, batch process, or line flow) would be appropriate at each stage and why? At the introduction pha... Date Added: 2009-06-08 16:50:34 |
| swb_timeinfo_1s.txt Path: Berkeley >> ASTRO >> 00306754 Fall, 2009 Description: #file=swb15-350lc.txt dt=1.0 tstart=-7.355 tstop=50.365 #t90 dt90 t50 dt50 rt90 drt90 rt50 drt50 rt45 drt45 tav dtav tmax dtmax trise dtrise tfall dtfall cts cts_err pk_rate dpk_rate band 46.000 3.432 25.000 2.263 34.000 2... Date Added: 2009-06-08 16:50:39 |
| progress_week7.doc Path: WVU >> EE >> 481 Fall, 2008 Description: WEST VIRGINIA UNIVERSITY COLLEGE OF ENGINEERING AND MINERAL RESOURCES Lane Department of Computer Science and Electrical Engineering DESIGN PROJECT TEAM WEEKLY REPORT TEAM NO/TITLE: Group 15 Electronic Go Member Clint Conner Jason Goble Brian Rockwo... Date Added: 2009-06-08 16:54:03 |
| Ochsner_Principles_Social Cognitive Neuroscience.pdf Path: Columbia >> KO >> 2132 Fall, 2009 Description: CHAPTtr,R ? SocialCognitiveNeuroscience HistoricalDevelopment, Principles, Core and FuturePromise KrvrN N. OcHsNen Thc supermarket checkout line provides interesting lesr.,ns about the human psyche. Beside the social norms \'-:-rr clictate that we ... Date Added: 2009-06-08 16:54:53 |
| 001121_1.pdf Path: Pittsburgh >> AEI >> 4019 Fall, 2009 Description: ... Date Added: 2009-06-08 17:01:21 |
| EB403_NOTES_ON_CASE_STUDIES.pdf Path: East Los Angeles College >> EB >> 403 Fall, 2009 Description: School of Entrepreneurship and Business University of Essex EB 403 Introduction to Accounting and Finance Spring Term 2008 Individual report (25% of the total mark) Notes to the case studies CASE STUDY 1: INDIRECT COSTS Requirement 1, Requirement 2... Date Added: 2009-06-08 17:05:50 |
| ICDay.pdf Path: Pittsburgh >> AEI >> 641 Fall, 2009 Description: Paper presented to the Ionian Conference, Corfu, 19-22 May, 2000 Dealing with Alien Suffrage: Examples from the EU and Germany Stephen Day, Centre for the Study of Law in Europe, Department of Law, University of Leeds, Leeds, LS2 9JT. E-mail: s.r.d... Date Added: 2009-06-08 17:06:29 |
| anshari_etal_p3_2001.pdf Path: UF >> CLAS >> 6930 Fall, 2009 Description: Palaeogeography, Palaeoclimatology, Palaeoecology 171 (2001) 213228 www.elsevier.com/locate/palaeo A Late Pleistocene and Holocene pollen and charcoal record from peat swamp forest, Lake Sentarum Wildlife Reserve, West Kalimantan, Indonesia Gusti A... Date Added: 2009-06-08 17:06:37 |
| slac-pub-2736.pdf Path: Stanford >> PUBS >> 2500 Fall, 2009 Description: SLAC-PUB-2736 May 1981 (E/I) TEST OF A SINGLE VOLUME CERENKOV COUNTER/DRIFT CHAMBERDETECTOR* Daniel L. Scharre Stanford Linear Accelerator Stanford University, Stanford, Center CA 94305 ABSTRACT A prototype Cerenkov counter detector radiator has p... Date Added: 2009-06-08 17:09:44 |
| Assignment_13.rtf Path: California State University, Monterey Bay >> ENGL >> 101 Fall, 2009 Description: Assignment # 13 4/2/07 Read: \"Visits\" in Brothers and Keepers As you read the first chapter of John Edgar Wideman\'s book, Brothers and Keepers, you will notice that John talks about running in terms of both his brother and himself. Why? Robby is the... Date Added: 2009-06-08 17:10:30 |
| review2.pdf Path: Pittsburgh >> MATH >> 1470 Fall, 2008 Description: Sample Problems for Second Midterm, Math 1470 November 12, 2008 1. Find the Fourier sine series of f (x) = 1 on [0, ]. 2. Find the Fourier cosine series of f (x) = sin x on [0, ]. 3. Consider the eigenvalue problem X + X = 0, x (0, ) , X (0) = 0, X ... Date Added: 2009-06-08 17:10:53 |
| hw5_1.doc Path: N.C. State >> ST >> 745 Spring, 2008 Description: > library(survival) Loading required package: splines > b = seq(-8,3,0.01) > pl = 7*b - log(exp(3*b)+exp(4*b)+exp(5*b)+exp(6*b)-log(exp(3*b)+exp(5*b) +exp(6*b) > plot(b,pl) > order(pl) [1] 1101 1100 1099 1098 1097 1096 1095 1094 1093 1092 1091 1090 1... Date Added: 2009-06-08 17:16:46 |
| Test 2 - TH.pdf Path: N. Illinois >> Z >> 146867 Fall, 2009 Description: Math 220, Take Home Test 2 31 May 2007 Name: You may receive partial credit on a single problem even if your final answer is incorrect, depending upon the amount and quality of work shown. Thus, show all work clearly and in order, carefully marking... Date Added: 2009-06-08 17:17:30 |
| files.doc Path: FIU >> CS >> 2210 Fall, 2009 Description: Computer Programming I COP 2210 Instructor: Greg Shaw Working with Data Files in Java I. Concepts and Terms A file is an organized collection of information stored on a disk. Files may contain anything - documents, spreadsheets, graphics, program... Date Added: 2009-06-08 17:17:32 |
| keys.txt Path: UF >> CIS >> 4301 Fall, 2008 Description: Host Key - - aol.com 42 bellsouth.net 23 earthlink.com 88 msn.com 12 sprint.com 76 ... Date Added: 2009-06-08 17:17:44 |
| sol4_5.doc Path: UF >> PHYS >> 2049 Fall, 2009 Description: Paul Avery PHY 2049, Period 5 Oct. 8, 2002 Solution to Quiz 4 A proton moves horizontally through an apparatus containing a vertical electric field of strength 40 kV/m and a horizontal magnetic field (perpendicular to the direction of the proton) of... Date Added: 2009-06-08 17:18:20 |
| Gens Book Chapter.docx Path: Uni. Westminster >> JIH >> 0329 Fall, 2009 Description: Westminster College COMM 310 Professional Writing 1 dent: ce where you can use your status as a student to your advantage! Tickets for students are $612, or price on a single tic er Student, Liz Robinson, thinks that the Grand is highquality com... Date Added: 2009-06-08 17:20:10 |
| Poster PresenTation Nov 17_05.ppt Path: Penn State >> DMS >> 201 Fall, 2009 Description: Workforce Education Performance Systems, The Pennsylvania State University Physical Environment Geography 143 miles long, 51 miles w... Date Added: 2009-06-08 17:34:00 |
| lecture4.pdf Path: UC Davis >> GEL >> 150 Fall, 2009 Description: Lecture 4 Geoid and Satellite Altimetry Geoid GEL/ESP 150B Force of Gravity between two point masses with masses, M and m, a distance r apart: Fg = GM m/r2 . Where, G = 6.67 10-11 m3 /(kg*s2 ). Also know, F = ma, set Fg = F and solve for the acc... Date Added: 2009-06-08 17:38:55 |
| Copyrights.ppt Path: University of South Dakota >> EDAD >> 885 Fall, 2008 Description: opyrights Copyright Secured Automatically upon Creation The way in which copyright protection is secured is frequently misunderstood. No publication or registration or other action in the Copyright Office is required to secure copyright. There... Date Added: 2009-06-08 17:41:46 |
| SERVICE LEARNING2.doc Path: Idaho >> PEP >> 440 Spring, 2008 Description: SERVICE LEARNING AFTER REVIEWING THE INFORMATION ON SERVICE LEARNING BELOW, DESIGN A SERVICE LEARNING PROJECT FOR YOUR UNIT PLAN. (Due Apr. 8, 2003) Design a service learning project that answers the following questions: 1. 2. 3. 4. Why would your st... Date Added: 2009-06-08 17:43:20 |
| Energy_S05.pdf Path: ASU >> GLG >> 101 Spring, 2008 Description: Energy Where Does it come from? How do we use it? Coal Coal Coal Formed mostly from plant material Largest energy source for electricity in the U.S., China Non-renewable resource Coal Heavy pollution Acid rain (S) Pyrite in coal Acid rain ... Date Added: 2009-06-08 17:45:48 |
| UnixIntro.pdf Path: Toledo >> EECS >> 2550 Fall, 2008 Description: O p e r a t i n g S y s t e m s Unix Introduction Unix is CASE sensitive. LS <> ls! Common Commands: ls lists a directory (if no directory is given it lists the current directory Common Flags -l Lists in long format. includes size, permissions, dat... Date Added: 2009-06-08 17:46:26 |
| FrankSActivity8.0.rtf Path: Maryville MO >> SFC >> 9475 Fall, 2009 Description: Stefan Frank\'s Activity 8.0: 1. Listing and summarizing information sources: One of the innovations I would like to take a closer look at is the use of the remote desktop in our school. I will use our technology person as an information source and po... Date Added: 2009-06-08 17:46:52 |
| Otitispa.pdf Path: UCLA >> N >> 239 Fall, 2009 Description: CAREFUL ANTIBIOTIC USE Otitis media with effusion does not require antibiotic treatment OTITIS MEDIA Differentiating Acute Otitis Media (AOM) from Otitis Media with Effusion (OME): A tool for promoting appropriate antibiotic use. 1 Always use pneuma... Date Added: 2009-06-08 17:48:00 |
| L5 Role of Congress.ppt Path: Arkansas >> AS >> 400 Fall, 2009 Description: Role of Congress Overview Constitutional Powers, Roles/Duties of the U.S. Congress War Powers Resolution Act Congressional oversight 2 Constitutional Powers Powers to assess and collect taxes-called the chief power to regulate commer... Date Added: 2009-06-08 17:48:01 |
| 1055798256692HFMiniSetR030157_final.pdf Path: UCLA >> N >> 239 Fall, 2009 Description: Clinical Performance Measures Physician Consortium for Performance Improvement Heart Failure Tools Developed by Physicians for Physicians Provided by: American College of Cardiology American Heart Association Physician Consortium for Performance I... Date Added: 2009-06-08 17:48:09 |
| Medieval.ppt Path: Rochester >> RES >> 104 Fall, 2009 Description: Medieval Judaism and Jewish Mysticism What do we mean by \"medieval\"? Commentary, Philosophy, and Mysticism Maimonides (1135-1204) Mishnah Torah Guide for the Perplexed Challenge and Criticism Mysticism What is Mysticism? Kabbalah & Zohar Challenge of... Date Added: 2009-06-08 17:49:26 |
| BOD Procedures.pdf Path: Citadel >> CIVL >> 419 Fall, 2009 Description: BOD Test 1. Preparation of Dilution Water a) Transfer 4 liters of distilled water into a 5 gallon plastic storage container. Make measurements with a one-liter graduated cylinder. Add 4 mL of each of the following to the container: phosphate buffer, ... Date Added: 2009-06-08 17:51:28 |
| HW4-I1-soln.pdf Path: Georgia Tech >> ME >> 3015 Fall, 2008 Description: ... Date Added: 2009-06-08 17:52:16 |
| CHEM 513 Spring 09 Lecture 2.pdf Path: NMT >> CHEM >> 513 Fall, 2008 Description: CHEM 513 Separation Science Lecture for January 22, 2009 Basic Terminology and Plate Theory I. page 1/4 Michael J. Pullin, 2009 Chromatography Terminology, independent of theory A. time = t B. flow rate of mobile phase = F (Q) C. volume of mobile ... Date Added: 2009-06-08 17:52:59 |
| Practice_9.doc Path: Eastern Washington University >> CSCD >> 320 Fall, 2008 Description: CScD-320 Assignment 9 Solution Set Fall 2008 1 B 3 E 2 2 A 1 C 1 1 F 2 1 2 2 D 3 G 1 1 B 3 E 2 2 A 1 C 1 1 F 2 1 2 2 D 3 G Kruskal\'s Algorithm 1 1 B 3 E 2 2 A 1 C 1 1 F 2 1 2 2 D 3 G 1 AC AE AG CF EF FG AB AD Prim\'s algorithm Recurs... Date Added: 2009-06-08 17:55:01 |
| n001.pdf Path: Rutgers >> FO >> 1953 Fall, 2009 Description: i i {yz h XY` A j4 ! jk ij i{ ik ijj v ba 9@A z f l c r)C)h ) I1 I) 1 Wm q1W CWW 1w 1h I) 6 ) s1 o q m 16 6m 1W s )h )P W e DWa 0 ... Date Added: 2009-06-08 17:56:35 |
| lecture6.ps Path: Arizona >> AST >> 400 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: lecture6.dvi %Pages: 9 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMMI12 CMMI8 CMEX10 CMR8 CMSY10 CMMI6 %+ CMSY8 CMR6 %EndComments %DVI... Date Added: 2009-06-08 17:57:08 |
| faf0809052.pdf Path: LA Tech >> DOCS >> 0809 Fall, 2009 Description: MEMORANDUM TO: FROM: DATE: SUBJECT: ABSENCE FROM CAMPUS DURING NORMAL OFFICE HOURS FROM: Date Time TO: Date Time REASON: ANNUAL LEAVE SICK LEAVE OFFICIAL BUSINESS COMP TIME OTHER (explain) COMMENTS: May be reached at: Address: Telephone: ... Date Added: 2009-06-08 18:01:31 |
| faf0809069a.pdf Path: LA Tech >> DOCS >> 0809 Fall, 2009 Description: NAME:_ CWID:_ DEPT. CODE:_ DATES: Begins: 07/01/08 Ends: 07/20/08 TIMESHEETS DUE: MONDAY, 07/21/08 NOON SUNDAY FROM TO TOTAL FROM LOUISIANA TECH UNIVERSITY Individual Student Time Report SUMMER QUARTER 2008 Hourly Pay Rate _ TUESDAY FROM TO TOTAL ... Date Added: 2009-06-08 18:01:57 |
| MEMPHIS.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: 93 1 5 2 3 67 4 8 12 0 4 3 789 5 46 wolf make a statement slab serifs \"They have a job of work out affectation but with to do, and they do it withconsiderable effect\" The large and bold style of the slab serif fonts were originally created d... Date Added: 2009-06-08 18:14:52 |
| mt1bier Path: UCSD >> BIOLOGY >> 652245 Spring, 2009 Description: EXAM 1 Developmental Neurobiology, BIPN144 100 Points Total TA Alex Dileep Teddy Beth Mimi 20 pts: Question Graded 1 2 3 4 5 April 23, 2009 1. With the aid of a diagram, indicate how initial dorsal-ventral polarity is created in fruit fly and frog ... Date Added: 2009-06-08 18:14:53 |
| problemset8-overhead.pdf Path: Toledo >> PHY >> 238 Fall, 2009 Description: PHY 238Y PROBLEM SET #D2 HAND IN WEEK OF MARCH 25, 2002 FROM INTERFERENCE Q 20, 22, 24 FROM DIFFRACTION Q 2, 5, 6 ... Date Added: 2009-06-08 18:17:32 |
| 238-pss2.doc Path: Toledo >> PHY >> 238 Fall, 2009 Description: ... Date Added: 2009-06-08 18:17:35 |
| slac-pub-0748.pdf Path: Stanford >> PUBS >> 0500 Fall, 2009 Description: SLAC-PUB-748 May 1970 VW METHODS FOR THE BETHE-SALPETER EQUATION II: BRACKETS AND THE N/D.METHOD* David Kershaw University of California, Berkeley, California 94720 Charles Zemach Stanford Linear Accelerator Center Stanford University, Stanford, Ca... Date Added: 2009-06-08 18:20:37 |
| ua40429_01.pdf Path: Texas San Antonio >> UA >> 40429 Fall, 2009 Description: U R B A N IZED A R EA O U TLIN E M A P (C EN SU S 2000) H ouston, TX Conroe, TX 19747 Shadow Lake Shadow Lake Montgomery CCD 92625 SYMBOL DESCRIPTION International AIR (Federal) Trust Land / Home Land OTSA / TDSA / ANVSA LEGEND SYMBOL NAME STYLE... Date Added: 2009-06-08 18:23:24 |
| answers_ch2-4.pdf Path: UCSB >> ECON >> 171 Spring, 2008 Description: 2 1. The Extensive Form 2. (a) (b) Incomplete information. The worker does not know who has hired him/her. Instructors\' Manual for Strategy: An Introduction to Game Theory 73 Copyright 2002, 2008 by Joel Watson For instructors only; do not dist... Date Added: 2009-06-08 18:30:58 |
| hw3.pdf Path: SUNY Stony Brook >> AMS >> 345 Fall, 2008 Description: AMS 345/CSE 355 (Spring, 2009) Joe Mitchell COMPUTATIONAL GEOMETRY Homework Set # 3 Due at the beginning of class on Monday, March 2, 2009. Recommended Reading: O\'Rourke, Chapter 2 (sections 2.12.4). Reminder: In all of the exercises, be sure to g... Date Added: 2009-06-08 18:30:59 |
| 20 Middle Ages Architecture.ppt Path: BYU >> MFG >> 201 Fall, 2008 Description: Middle Ages Architecture High Creativity Early Medieval Architecture Byzantine Continuation of Roman architecture Domes and windows Russian and Eastern Orthodox Onion domes Light into the church Openness led to feeling of exaltation H... Date Added: 2009-06-08 18:31:26 |
| Roy-BananaTime-HumOrg.pdf Path: CSU Channel Islands >> ICS >> 235 Fall, 2009 Description: ... Date Added: 2009-06-08 18:31:51 |
| downtown.pdf Path: Wilfrid Laurier >> ENGO >> 551 Fall, 2009 Description: EL LASALLE CR B O Glenmore Park 21 ST SW 20 ST SW 19 ST SW VELODROME W RI VE R Edworthy Park 20 A VE N 19 A VE N W West Nose Creek HW AN A AD 35 ST TRAIL 54 A VE SW RD CROWCHILD 54 A VE SW LODGE CR SINAI A VE SW NW GLENMORE ATHLETIC... Date Added: 2009-06-08 18:33:31 |
| p5.pdf Path: Virginia Tech >> ESM >> 2204 Fall, 2008 Description: ... Date Added: 2009-06-08 18:33:35 |
| study guidequestions maria stewart.doc Path: ASU >> TRE >> 394 Fall, 2009 Description: AFH/ENG/HUM/WST 394 L. Myles Spring `03 Discussion Guide Questions to Maria W. Stewart. Critiquing \"Religion and the Pure Principles of Morality\" 1. 2. 3. 4. 5. 6. 7. 8. 9. What Prompt Stewart to a public voice? Summarize Stewart\'s argument in this... Date Added: 2009-06-08 18:34:39 |
| design_outline_color.pdf Path: Utah State >> ECE >> 5460 Spring, 2008 Description: Verilog Based Design An outline of a Verilog based synthesized ASIC design ECE 5460-70 Alan W Shaw 2004 Front End Design Starts from an idea P Concept What P Algorithm How P Preliminary Functional Partition ECE 5460-70 Alan W Shaw 2004 Prelim... Date Added: 2009-06-08 18:35:02 |
| m496nt.doc Path: East Los Angeles College >> M >> 496 Fall, 2009 Description: M496 An orphan\'s song. Sung by Zhang Wei-qing. Notes. This song is recorded in Document F (no. 24, page 26). Line 7. Following this line the Miao text has an extra line identical with line 11. It is entirely appropriate preceding line 12, but quite ... Date Added: 2009-06-08 18:37:03 |
| Estimation - Inference.pdf Path: CSU Northridge >> BJC >> 20362 Fall, 2009 Description: ... Date Added: 2009-06-08 18:47:03 |
| variance.pdf Path: CSU Northridge >> BJC >> 20362 Fall, 2009 Description: ... Date Added: 2009-06-08 18:47:03 |
| 44285--ch02notes.pdf Path: Kent State >> PERSONAL >> 44285 Fall, 2009 Description: Slide 1 Chapter 2 Chapter 2 The External Environment PowerPoint slides by: Colorado State University Copyright 2004 South -Western All rights reserved. R. Dennis Middlemist Slide 2 The Strategic Management Process Copyright 2004 South -Wester... Date Added: 2009-06-08 18:54:17 |
| JamieBergt.ppt Path: North Texas >> CECS >> 4100 Fall, 2008 Description: GETTING STUDENTS READY FOR THE NEXT GENERATION! Jamie Bergt CECS 4100.001 Fed Ex Technology Camp Preparing Students for the Next Generation! The Need for Technology Training Shortage of qualified applicants in I T industry. Rapid advance of tech... Date Added: 2009-06-08 18:54:48 |
| tfig14-a.pdf Path: Utah State >> HPC >> 190 Fall, 2009 Description: Baseline 0.4 0.2 0 y -0.2 -0.4 0 0.5 x 1 1.5 y ... Date Added: 2009-06-08 18:58:38 |
| Chapter 9.ppt Path: CSU Dominguez Hills >> CSC >> 411 Spring, 2008 Description: Chapter 9 Reasoning in Uncertain Situations Contents Uncertain situations Nonmonotonic logic and reasoning Certainty Factor algebra Fuzzy logic and reasoning DempsterShafer theory of evidence Bayesian belief network Markov models CSC411 Artificial ... Date Added: 2009-06-08 19:00:00 |
| MAT251_FINALEXAM_REVIEW.doc Path: ASU >> MAT >> 251 Fall, 2009 Description: MAT251 FINAL EXAM REVIEW A. TANGENT LINES: Find the equation of the tangent line for the following: 1. f ( x) = ( x + 3) 2 e 3 x at (0, 9) 2. g ( x) = x 3 at (2, 8) 3. h( x) = x ln( x ) at (1, 0) B. IMPLICIT DIFFERENTIATION - Find x 2 1. e y + dy im... Date Added: 2009-06-08 19:04:54 |
| Econ.pdf Path: ASU >> PUBLIC >> 101 Fall, 2009 Description: EXPERIMENT 5: CONSERVATION OF ENERGY Introduction: In this lab, you will test conservation of mechanical energy by analyzing the motion diagram of a swinging pendulum. IMPORTANT: Special concerns for swinging pendulum and ink-jet timer 1. The aluminu... Date Added: 2009-06-08 19:09:39 |
| DereferenceVsConversion.pdf Path: UMBC >> CS >> 202 Fall, 1997 Description: Pointer Dereferencing vs. Conversion Operators Pointer Dereferencing The pointer dereferencing operator does exactly what it is expected to do overloads the dereferencing of that particular class. template <class T> class Pointer { public: Pointer(T... Date Added: 2009-06-08 19:15:22 |
| lecture-static-color-04.pdf Path: San Diego State >> MATH >> 693 Fall, 2009 Description: b... Date Added: 2009-06-08 19:16:55 |
| lecture-static-color.pdf Path: San Diego State >> MATH >> 693 Fall, 2009 Description: blomgren@terminus.SDSU.EDU http:/terminus.SDSU.EDU $Id: lecture.tex,v 1.7 2008/04/10 03:02:06 blomgren Exp $ Elliptic Equations: Finite Difference Schemes p. 1/22 ... Date Added: 2009-06-08 19:16:57 |
| Accommodation.doc Path: Oregon >> NOBELSYMPO >> 131 Fall, 2009 Description: 1 ACCOMODATION BOOKING FORM Nobel Symposium 131 13-17 June 2005 Bckaskog Castle, Sweden Delegate details Title: First Name: Surname: Address (street and city): Zip Code: Email: Arrival date and time at Bckaskog Castle: Departure date and time: Co... Date Added: 2009-06-08 19:17:25 |
| SummEval1.pdf Path: Wisc Stevens Point >> KMCHU >> 768 Fall, 2009 Description: ... Date Added: 2009-06-08 19:21:06 |
| bag_outFINAL.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: ... Date Added: 2009-06-08 19:21:22 |
| problems_3.pdf Path: East Los Angeles College >> MA >> 222 Fall, 2009 Description: METRIC SPACES MA222 - 2008/2009 Problems 3 1. Decide whether the following statements hold for every subset S of o oo o every topological space T : (a) S = S o . (b) S = S . (c) S = S S. (d) S o = S \\ S. (e) S = S \\ S o . (f) S = S \\ S o . 2. In R2 ... Date Added: 2009-06-08 19:21:26 |
| comp26.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: 3 4 2 1. 2. 3. 4. 2 1 4 2 1 1 3 _ 1 3 3 4 2 3 4 2 1 4 2 1 3 4 241_Graphic Design I : Spring 2009 : Tim Garcia ... Date Added: 2009-06-08 19:21:32 |
| Lab 01.pdf Path: Western Washington >> GEOL >> 306 Spring, 2008 Description: Geo 306 lab 01 p. 1 of 7 Physical properties of minerals and determinative techniques Goals for this lab: 1. Learn the most important observations/tests for mineral identification: cleavage, habit, form, streak, luster, hardness, and density. 2. Le... Date Added: 2009-06-08 19:21:55 |
| main-xml.pdf Path: SUNY Buffalo >> CSE >> 636 Fall, 2009 Description: Data Integration: XML Jan Chomicki University at Buffalo February 5, 2008 Jan Chomicki (UB) Data Integration: XML February 5, 2008 1/6 XML documents (simplified) XML tree [KSS03] finite, ordered, unranked tree element, attribute and text nodes ... Date Added: 2009-06-08 19:23:02 |
| manufacturing_opmgmt_c.pdf Path: Ferris State >> PROGRAMSHE >> 0809 Fall, 2009 Description: Manufacturing Operations Management l Certificate Why Choose the Manufacturing Operations Management Certificate? The certificate in Manufacturing Operations Management is designed to give the student a basic understanding of the principles involved ... Date Added: 2009-06-08 19:30:57 |
| chapter07.ppt Path: MNSU >> IT >> 110 Fall, 2008 Description: Chapter 7: Computer Networks, the Internet, and the World Wide Web Invitation to Computer Science, C+ Version, Fourth Edition Objectives In this chapter, you will learn about Basic networking concepts Communication protocols Network services and... Date Added: 2009-06-08 19:31:26 |
| Chapter 6.pdf Path: MNSU >> ISYS >> 101 Fall, 2008 Description: Chapter 6 Multiple Choice Identify the choice that best completes the statement or answers the question. _ 1. The first stage in the problem-solving process is the _ stage. a. intelligence c. monitoring b. design d. choice 2. In the _ stage of the pr... Date Added: 2009-06-08 19:31:34 |
| Excuse.doc Path: U. Houston >> CUIN >> 3111 Fall, 2008 Description: Dear name_of_teacher, I am writing to ask you to excuse my son, person_in_room_male_, from math class. Trying to do his homework has given him a pain in the part_of_the_body_. This has caused him to be unable to use a / an noun. He is just like his a... Date Added: 2009-06-08 19:32:46 |
| hw15.doc Path: Rose-Hulman >> CSSE >> 373 Fall, 2009 Description: CSSE 373 Formal Methods in Specification and Design - Fall 2003 HW15 Due: 11/13 Purpose: Demonstrate awareness of costs and benefits of formal methods. Using references suggested by the textbook or the readings (or any other source), find a software ... Date Added: 2009-06-08 19:33:36 |
| 003112_1.pdf Path: Pittsburgh >> AEI >> 4691 Fall, 2009 Description: ... Date Added: 2009-06-08 19:36:18 |
| ep10-proef.pdf Path: Pittsburgh >> AEI >> 8979 Fall, 2009 Description: academia-egmont.papers.10.book Page i Wednesday, November 23, 2005 11:34 AM UN REFORM AND NATO TRANSFORMATION: THE MISSING LINK DICK A. LEURDIJK academia-egmont.papers.10.book Page ii Wednesday, November 23, 2005 11:34 AM academia-egmont.papers.10... Date Added: 2009-06-08 19:36:26 |
| rwecch2.pdf Path: Appalachian State >> READ >> 3030 Fall, 2009 Description: In addition ble and make up cery list. They from magnetic EmergentLiter694S&a... Date Added: 2009-06-08 19:36:53 |
| Fatty acid biosynthesis scheme.doc Path: Indiana State >> CARBON >> 432 Fall, 2009 Description: Fatty acid biosynthesis CO2 C2 CO2 C3 C5 C4 FAS C4 C4 C4 C2 acetyl CoA/ACP C3 malonyl CoA/ACP FAS fatty acid synthase multienzyme complex ... Date Added: 2009-06-08 19:38:18 |
| tcpa.pdf Path: Duke >> CPS >> 182 Fall, 2009 Description: Cryptography and Competition Policy Issues with `Trusted Computing\' Ross Anderson Cambridge University Abstract. The most significant strategic development in information technology over the past year has been `trusted computing\'. This is popularly... Date Added: 2009-06-08 19:38:42 |
| live hog demand.pdf Path: Maryville MO >> NCR >> 134 Fall, 2009 Description: An Empirical Investigation of Live Hog Demand by: Joe Parcell, James Mintert, and Ron Plain* *Parcell and Plain are Assistant Professor and Professor, respectively, University of Missouri Columbia. Mintert is a Professor at Kansas State University... Date Added: 2009-06-08 19:39:27 |
| 000193_1.pdf Path: Pittsburgh >> AEI >> 3833 Fall, 2009 Description: ... Date Added: 2009-06-08 19:50:11 |
| lecture006correlation_old2.ppt Path: Cleveland State >> UST >> 601 Fall, 2009 Description: Applied Quantitative Reasoning UST/PAD/PDD601 Lecture 6. Correlation Analysis Sugie Lee, Ph.D. Assistant Professor Urban Planning, Design and Development Program Levin College of Urban Affairs Cleveland State University Part IV. ASSOCIATION Part... Date Added: 2009-06-08 19:50:57 |
| E 375L Project 1 My Responses.doc Path: Texas >> E >> 375 Fall, 2008 Description: E 375L Project 1 Responses 1. Response to Brittany Lacys Post I really enjoyed reading your post! It was very easy to get into the time period because of your writing style and description of the events. I also found it interesting to read about the ... Date Added: 2009-06-08 19:51:59 |
| Stand Outside Yourself an.doc Path: Texas >> E >> 375 Fall, 2008 Description: Yashoda Sampath Stand Outside Yourself and Write What You See \"It\'s as if you lived in a little town, and you go up to a mountaintop and, looking down, you see how you move about in the course of an ordinary day\"(Dass 73), said Ram Dass about how be... Date Added: 2009-06-08 19:52:13 |
| Lab3.pdf Path: Randolph College >> P >> 351 Fall, 2009 Description: Physics351Lab3,ThermodynamicEfficiency Usingthethermodynamicswehavelearned,designandrunanexperimentthatwillallowyouto measuretheefficiencyofsomeprocess/equipment(e.g.airconditioner,heater,engine,treadmill,etc. anydevicethatinvolvesheat/energyflowandw... Date Added: 2009-06-08 19:52:38 |
| VMEGLUE.pdf Path: University of Hawaii - Hilo >> VMEGL >> 026 Fall, 2009 Description: OFD L57 P[31:0] L50 -MD[31:0] P[31:0] I[31:0] SSYNC D Q -SSYNC OPAD LOC=P3 RAM data MDI[31:0] RDBLBUF RDMA MBANK U1 U7 RDBLBUF RDMA MBANK MDI[31:0] ADDR[15:0] INTEG OE LBUS[31:0] NENLO NENHI DO[31:0] C IPAD32PU PAD IN RAM Bank LOC=P27 -... Date Added: 2009-06-08 20:02:40 |
| Test4.pdf Path: Auburn >> JCD >> 0013 Fall, 2009 Description: Test 4 Name: Pythagorean: sin2 (x) + cos2 (x) = 1 Angle sum: sin(u v) = sin(u) cos(v) cos(u) sin(v) cos(u v) = cos(u) cos(v) sin(u) sin(v) Double angle: sin(2x) = 2 sin(x) cos(x) cos(2x) = cos2 (x) - sin2 (x) Half angle: cos( 1 x) = 1+cos(x) 2 2 ... Date Added: 2009-06-08 20:08:11 |
| Lecture 20 done Path: UC Riverside >> BCH >> 120 Spring, 2009 Description: Lecture 20: Eukaryotic Gene Regulation 2 1. What is an enhancer? What is its function? What are the special properties of enhancers? Activators whos binding site is in DNA about 80-160 base pairs upstream from the start site; distance from start site... Date Added: 2009-06-08 20:10:59 |
| homework3.ps Path: Dallas >> EE >> 3341 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.66a Copyright 1986-97 Radical Eye Software (www.radicaleye.com) %Title: homework3.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips homework3 %DVIPSParameters: dpi=600, ... Date Added: 2009-06-08 20:13:47 |
| midterm_presentation3.ppt Path: Georgia Tech >> CS >> 3911 Fall, 2008 Description: TeamSemperFi CS3911Summer2003 Project CollegeofComputingOnlineTAApplication Members ChrisChoTechnicalLead KirandeepAtwalAnalyst/Designer JayYeoTechnicalWriter PavelFavorovProjectManager FacultyAdvisor AllisonTew TheProblem ProcessUndergraduate&... Date Added: 2009-06-08 20:16:07 |
| traveling_in_space.pdf Path: Angelo State >> CS >> 2323 Fall, 2009 Description: Traveling in Space Distances to galactic objects are often measured in light years, the distance traveled by light in one year. The distance from the Sun to the nearest star, Proxima Centauri, is approximately 4.22 light years. How many times would s... Date Added: 2009-06-08 20:16:51 |
| heattranscalc_rev1.xls Path: RIT >> P >> 09021 Fall, 2009 Description: Tubing ID OD Wall Thickness 0.5 in 0.69 in 0.09 in 0.01 m 0.02 m 0m Heater Watts 25 75 100 75 80 125 Btu/s Size (in) 0.02 5x1 0.07 15x1 0.09 10x2 0.07 5x3 0.08 4x4 0.12 5x5 Price ($) 52 60 60 61 62 70 q\"(Btu/s in^2) q\" (W/m^2) Length (in) English 0 ... Date Added: 2009-06-08 20:18:50 |
| mytm01b.txt Path: Calvin >> M >> 381 Fall, 1998 Description: ATM Version of Hopcroft 0} with 2-way infinite tape 0 1 / input alphabet, note such comments are permitted at the end of the line 0 1 X Y B / tape alphabet 1 / number of tapes 1 / number of tracks on tape 0 2 / tape 0... Date Added: 2009-06-08 20:19:49 |
| resilience reading #2.pdf Path: ASU >> PGS >> 191 Fall, 2008 Description: ... Date Added: 2009-06-08 20:20:14 |
| Biomimetism and bioinspiration as tools for the design.pdf Path: Utah >> BIOEN >> 3201 Fall, 2008 Description: REVIEW ARTICLE Biomimetism and bioinspiration as tools for the design of innovative materials and systems Materials found in nature combine many inspiring properties such as sophistication, miniaturization, hierarchical organizations, hybridation, r... Date Added: 2009-06-08 20:22:05 |
| Rate_Law_of_a_Chemical_Reaction.pdf Path: Wofford >> CHEM >> 124 Fall, 2009 Description: Determining the Rate Law of a Chemical Reaction In lab this week we will determine the rate law for the following chemical reaction. I2 + H3C O C CH3 H + O H3C C CH2I + IH acetone iodo-acetone The H+ above the reaction arrow indicates tha... Date Added: 2009-06-08 20:28:10 |
| Outhouse.doc Path: Oregon State >> BA >> 465 Fall, 2008 Description: ... Date Added: 2009-06-08 20:30:20 |
| 20090318-echo-based_ranging.pdf Path: Carnegie Mellon >> CS >> 16722 Fall, 2009 Description: echo-based range sensing mws@cmu.edu 16722 20080228 L06Ua echo-based range sensing 1 example: low-cost radar automotive DC in / digital radar signal out applications include pedestrians / bicycles in urban environment obstacles / vehicles in ... Date Added: 2009-06-08 20:33:26 |
| sensorsCaptureAttention.pdf Path: Carnegie Mellon >> CS >> 16722 Fall, 2009 Description: THE JOURNAL OF APPLIED SENSING TECHNOLOGY FEBRUARY U R N AVOL. F ANO. L I E D S E N S I N G T E C H N O L O G Y T H E J O 2001 L O 18 P P 2 www.sensorsmag.com Imaging Sensors That Capture Your Attention by Helen Titus, Eastman Kodak Co. Image Se... Date Added: 2009-06-08 20:33:32 |
| Ned_collaborative_robotics.pdf Path: Carnegie Mellon >> CS >> 16722 Fall, 2009 Description: Sensing and Sensors CMU SCS RI 16-722 S09 Sensors & Systems for Human Safety Assurance in Collaborative Exploration Ned Fox nfox@andrew.cmu.edu Outline What is collaborative exploration? Humans sensing robots Robots sensing humans Overseers ... Date Added: 2009-06-08 20:33:37 |
| test2.pdf Path: Wash. College >> ECON >> 111 Fall, 2009 Description: test #2 econ 111 spring 2009 prof. andy helms name : For questions #1-3 : Suppose that the savings function is S = $50 + .5 Y and intended investment is $100. 1. What is the consumption function? 2. What is the aggregate expenditure function? 3.... Date Added: 2009-06-08 20:39:09 |
| Compensating Wage Differentials.ppt Path: UCSD >> EC >> 139 Fall, 2009 Description: Compensating Wage Differentials Not All Jobs Are Created Equal Risk of death or injury on the job. Location. Flexibility of hours. Health benefits. Pension plans. Repetitiveness of tasks. Weeks of vacation. Compensating Wage Differentials W... Date Added: 2009-06-08 20:42:02 |
| FSMFs.pdf Path: Nevada >> CS >> 773 Fall, 2009 Description: Fuzzy Set Membership Functions We will be concerned here with continuous fuzzy set membership functions, although discrete ones are used for cerain situations. Definition: We take a fuzzy set membership function (FSMF) to be a unimodal (one hump shap... Date Added: 2009-06-08 20:42:24 |
| lect8textslides.pdf Path: Laurentian >> ASTR >> 2070 Fall, 2009 Description: Mars Terrestrial 2004PearsonEducationInc.,publishingasAddisonWesley Neptune Jovian ... Date Added: 2009-06-08 20:45:28 |
| ch8.doc Path: Ill. Chicago >> BSTT >> 401 Fall, 2008 Description: Ch 8 Multiple Regression Analysis: General consideration example . t x t WGT 64 71 53 67 55 58 77 57 56 51 76 68 HGT 57 59 49 62 51 50 55 48 42 42 61 57 (Tab le 8- 1) AGE 8 10 6 11 8 7 10 9 10 6 12 9 AGE2 64 100 36 121 64 49 100 81 100 36 144 81 As ... Date Added: 2009-06-08 20:46:14 |
| saladinch13.ppt Path: Pima CC >> BIO >> 201 Fall, 2009 Description: Human Anatomy & Physiology Spinal Cord, Spinal Nerves and Somatic Reflexes Chapter 13 By Abdul Fellah, Ph.D. 13-1 Spinal Cord, Spinal Nerves and Somatic Reflexes Spinal cord Spinal nerves Somatic reflexes 13-2 Overview of Spinal Cord Informati... Date Added: 2009-06-08 20:49:47 |
| CompTchn.pdf Path: University of Louisiana at Lafayette >> CIC >> 6380 Fall, 2009 Description: Computational Technologies Vol 6, No 4, 2001 IMPLICIT VECTORIAL OPERATOR SPLITTING FOR INCOMPRESSIBLE NAVIER STOKES EQUATIONS IN PRIMITIVE VARIABLES (Paper dedicated to the memory of Professor N. N. Yanenko) C. I. Christov University of Louisiana... Date Added: 2009-06-08 20:52:18 |
| arrays2.txt Path: Michigan >> E >> 101 Fall, 2009 Description: = getting the maximum value from a list function result = findMaxValue(list) % function result = findMaxValue(list) result = list(1); for i=2:length(list) if list(i) > result result = list(i); end end = getting the index of the maximum... Date Added: 2009-06-08 20:52:38 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 4880 Fall, 2009 Description: 1962-63 38199:41415:4670:848 85 31625:61866:837:414 ; 46930:49698:253:808 41143:47686:228:788 a 23021:51552:1700:828 17893:37589:710:611 38402:39364:1395:867 23147:49757:710:591 acti 27843:44472:2741:848 activities 22538:42697:5913:631 11523:37609:59... Date Added: 2009-06-08 20:54:57 |
| 08727.pdf Path: Harvard >> IAUC >> 08700 Fall, 2009 Description: Circular No. 8727 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION Mailstop 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.EDU or FAX 617-495-7231 (subscriptions) CBAT@CFA.HARVARD.... Date Added: 2009-06-08 20:55:03 |
| digestive_system.pdf Path: Toledo >> BIO >> 210 Fall, 2009 Description: BIO210 The Digestive System Overview of the Digestive Tract. Basic design of digestive tract Peristaltic action with antagonistic muscles Coelom and Mesenteries Oral cavity, hard and soft palate, tongue, dentition Dentition (section through tooth sho... Date Added: 2009-06-08 20:55:11 |
| YFL037W.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YFL >> 037 Fall, 2009 Description: YFL037W.t2k EBGHTL 3 2 1 CCEEEEEE TEXC T X X 1 10 20 30 40 E 3 2 1 H T T E E X C E T E E G T C C E C C G E H X X X X X X ET TTTTEEEEE C CTCCC C X HGEEGHETTCTEEEEEEE C T T T C H C CCH E C H T T G C C C C C H T T T H C C C H H C T X X X... Date Added: 2009-06-08 20:56:59 |
| OCT.pdf Path: University of Iowa >> BME >> 060 Fall, 2009 Description: Ris-R-1278(EN) Optical Coherence Tomography: System Design and Noise Analysis Michael H. Frosz Michael Juhl Morten H. Lang Ris National Laboratory, Roskilde, Denmark July 2001 Ris-R-1278(EN) Optical Coherence Tomography: System Design and Noise A... Date Added: 2009-06-08 20:57:28 |
| Rad_for_GP_for_web.pdf Path: University of Iowa >> BME >> 060 Fall, 2009 Description: RADIATION AND YOUR PATIENT: A GUIDE FOR MEDICAL PRACTITIONERS A web module produced by Committee 3 of the International Commission on Radiological Protection (ICRP) What is the purpose of this document ? In the past 100 years, diagnostic radiology, n... Date Added: 2009-06-08 20:57:29 |
| 104practicetest3.pdf Path: CSU Northridge >> BLW >> 09471 Fall, 2009 Description: Math 104 Practice Test #3 Fall 2007 For more practice, do this in addition to the hw assigned out of the textbook: Chapter 6 Test in your textbook on pages 312-313. Do #s 1-20, 26-29. Chapter 7 Test in your textbook on pages 364-366. Do #s 1-40. The ... Date Added: 2009-06-08 20:59:49 |
| 265ALecture1_29_07.pdf Path: UCSD >> ECE >> 265 Fall, 2009 Description: ... Date Added: 2009-06-08 21:03:23 |
| finalsc1.ps Path: Utah >> M >> 1210 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.60.1 Copyright 1986, 1996 Radical Eye Software %Title: finalsc1.dvi %CreationDate: Thu Aug 3 15:52:50 2006 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips finalsc1.dvi %DVI... Date Added: 2009-06-08 21:04:17 |
| 111nunit4.pdf Path: Simmons >> CHEM >> 111 Fall, 2009 Description: Simmons College Chemistry 111N- Fall 2007 Tentative Syllabus and Lecture Outline UNIT IV: Acid/Base and Nuclear Chemistry Chem 111N study groups: Date Lecture # Topic Reading Stoker 10.1-10.6 HW Problems from Stoker Textbook 10.1, 10.7, 10.9, 10.15, ... Date Added: 2009-06-08 21:04:20 |
| Total Marks Distribution After Quiz 6.doc Path: Oklahoma State >> ECEN >> 3913 Fall, 2008 Description: Total Marks Distibution after Quiz 6 Class Average - 65 4 Total Points After Quiz 6 3 No of Students 2 1 0 19 33 43 45 50 53 54 56 58 61 64 66 68 69 75 76 78 85 90 91 100 Points Obtained ... Date Added: 2009-06-08 21:04:22 |
| index.txt Path: Berkeley >> TMP >> 00180977 Fall, 2009 Description: 0.22500002 2.0250001 3588.5313 -0.25605473 2.0250001 2.4749999 1990.0411 0.0000000 2.4749999 5.1750002 4330.8153 -1.8942826 5.1750002 11.025000 2414.1741 ... Date Added: 2009-06-08 21:04:37 |
| YPL049C.t04.alpha-logo.pdf Path: UCSC >> YPL >> 049 Fall, 2009 Description: YPL049C.t04 alpha 3 2 1 C E E EABE E A E E E B B A XX X XXX A E H B X H XXX E H H T H E A S E B S H X X X X X X X X X X H E H H E XXXXXXXXXXXXX H C A E C B B G A S D T F H S E I T B E EAAA E A EE B E E H B B H A H X SS T HBT BD... Date Added: 2009-06-08 21:05:48 |
| YPL097W.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YPL >> 097 Fall, 2009 Description: YPL097W.t2k EBGHTL 3 2 1 C X C T C GGGXXXXHHEEXXTCXXXXHTTTTGGXHTTTHCXCTXXXXCC G T H B C B T T T C T H T C H G T T E G G T C H C T H T H H H C H T H C X X X X X X X X X X X X X X T C H H H H X X X X X 1 10 20 30 40 H 3 2 1 X X X X T T T E ... Date Added: 2009-06-08 21:06:36 |
| math340notes_week3.pdf Path: California State University, Monterey Bay >> MATH >> 340 Fall, 2009 Description: MATH 340 - DIFFERENTIAL EQUATIONS CLASS NOTES - WEEK 3 MICHAEL B. SCOTT 3. Separable Equations A first order differential equation is said to be separable if we can put all the x\'s on one side of the equation and all the y\'s on the other. Example 3.... Date Added: 2009-06-08 21:07:16 |
| YGL175C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YGL >> 175 Fall, 2009 Description: YGL175C.t2k DSSP-EHL2 2 1 CCCC X X E C C C C E E E C X X X X X H X X 1 10 20 30 40 H E 2 1 E CC H H T E H H H H H H X X X X X X X X X X E X X X X X X X X X X X X X X 51 60 70 80 90 T 2 1 C C H T H H X X E E C C C E X X X X X... Date Added: 2009-06-08 21:08:01 |
| Respond_AARSummary_SID_LCODraft_F07a_T05.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: 13f07c9c45b107b7b2ce0f7bde47a16b15caaeb9.xls - Areas of Concern Log Project Name: Artifact: Module: MBASE Phase/level: Activity: Exit Criteria: Reviewer: Review Leader email: Review Leader phone: Author: Crystal Stairs Dashboard Protype : SID_LCO_... Date Added: 2009-06-08 21:09:52 |
| Playing_for_the_King.doc Path: N.E. Illinois >> ENG >> 386 Fall, 2009 Description: Hobbs Playing for the King (rewrite) by Thomas Hobbs Fall 2004 Page 1 of 6 Andre places the ticket in his pants pocket, being careful not to crease it. Slouching women with ankle hose and comfortable shoes clutch large purses. The woman with hair s... Date Added: 2009-06-08 21:11:06 |
| ELED_430_Reading_4.doc Path: N.E. Illinois >> ELED >> 430 Fall, 2009 Description: Thomas Hobbs ELED 430 Dr. Katy Smith Spring 2004 Reading Assignment 2/10/04 At first I thought Airasian was taking an objective view of the subject, which was irritating me. As I read further I realized that he is in fact in favor of standardized hig... Date Added: 2009-06-08 21:11:09 |
| YDR103W.dssp-ehl2-logo.pdf Path: UCSC >> YDR >> 103 Fall, 2009 Description: YDR103W dssp-ehl2 2 1 CCCCCCC X X C C C C C C E E E E E E E E C E E H E E E E E H E E H X X X X X X X X X X X X X X X X X X X X X X X X X X 1 10 20 30 40 2 1 H C H C C X X X X X X 51 60 70 80 90 H 2 1 CCCCCCCCCCCXXXCCCCXXCCCCCCC H H X X... Date Added: 2009-06-08 21:21:40 |
| YDR188W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YDR >> 188 Fall, 2009 Description: YDR188W.t2k DSSP-EHL2 2 1 CC X 1 10 20 30 40 E 2 1 E X T E H T E T CCE C E 51 60 70 80 90 S 2 1 E S H S H H T S T H HHHHHHHHHH CCCHHHHHHHHHHHHHHHHHHHHH C C C C C C C C C X X X X X X X X X X X C E E E E E E H H H H C H C C... Date Added: 2009-06-08 21:21:49 |
| YDR183C-A.t2k.alpha-logo.pdf Path: UCSC >> YDR >> 183 Fall, 2009 Description: YDR183C-A.t2k ALPHA 2 1 S E X X H XX A B E C H X X H D EBABAEH E EHBBE HBBBAAEAA S C AABABB A G H B B E B H H H H H H XXXXXX XXHXXHXHHXXXXXXXXXXXXAXHX X X X X X X T EEEE 10 S C D X H H H E H I I E I E E H H E H X X X X H H H X X X... Date Added: 2009-06-08 21:22:23 |
| YDR153C.t2k.alpha-logo.pdf Path: UCSC >> YDR >> 153 Fall, 2009 Description: YDR153C.t2k ALPHA 3 2 1 C B H D B S XXXII H B H X X X X X X 1 10 20 30 40 B 3 2 1 H S B H S E H S B H HHHHHHHHHH X X X X G HHHII I I S I I I G I IIIHHF I I G ISIIIIIXXXXXXXXXXXHIXXIIIIIIXXXXXXX XXHI X X X HHHHH H H 51 60 70 80 ... Date Added: 2009-06-08 21:22:39 |
| SP09_essay_2.pdf Path: North Texas >> MUSIC >> 4680 Fall, 2009 Description: Dear 5680 students: Composer Roger Reynolds has long been known for works involving electroacoustic music and live performance. In the early 1980\'s he developed a set of four works, Transfigured Wind I - IV, for flute solo, flute with orchestra and t... Date Added: 2009-06-08 21:23:11 |
| BEHV_5900_APP.pdf Path: North Texas >> WEB >> 1379 Fall, 2009 Description: ... Date Added: 2009-06-08 21:24:16 |
| 48007MacularDegenerationOubre1.pdf Path: LSU >> BIOL >> 4800 Fall, 2008 Description: MACULAR DEGENERATION Antioxidant Therapy A ti id t Th By Michael Oubre INTRODUCTION Macular Degeneration, frequently called AMD (age-related macular g ) g degeneration), is the leading cause of vision loss and blindness in Americans aged 65 and ol... Date Added: 2009-06-08 21:25:49 |
| YNL207W.t2k.w0.5-logo.pdf Path: UCSC >> YNL >> 207 Fall, 2009 Description: YNL207W.t2k w0.5 5 4 3 2 1 L V L E L I N VL L A XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX K E F L V I V E L S M K DI Y E L R W I V T L L Y R E A T M M R K G L S K D R V I A F S L P I L L E S I S L V E A X XXXXXXXXXXXX S R A... Date Added: 2009-06-08 21:28:30 |
| cp1030_recent_Answers.doc Path: Allan Hancock College >> CP >> 1030 Fall, 2009 Description: PART A (Questions 1-100) [90 MARKS] MULTIPLE CHOICE (70 MARKS: 1 MARK EACH) (QUESTIONS 1-70) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. C B C A D C C D D B B D A A C C 17. A 18. A 19. B 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. D C A D... Date Added: 2009-06-08 21:29:54 |
| SpectralPrep.rtf Path: Nevada >> MECH >> 322 Fall, 2009 Description: SpectralPrep.vi Connector Pane Front Panel Block Diagram Express VI Configuration Information Spectral Measurements Spectral Measurements Performs spectral measurements, such as peak spectrum and auto-power spectrum, on a signal. -This Express VI ... Date Added: 2009-06-08 21:39:22 |
| Syllabus_105B_S091.pdf Path: UCSB >> PHYS >> 105 Spring, 2009 Description: Physics 105B: Classical Mechanics UC Santa Barbara Department of Physics Spring 2009 Lectures: Discussion: Final: June 8 MWF W M 10:00-10:50 am 6:00-6:50 pm 8:00-11:00 am Phelps 1260 Phelps 1508 Phelps 1260 Syllabus (this document), lecture notes, h... Date Added: 2009-06-08 21:52:01 |
| executive meetings.doc Path: Clayton >> CSU >> 12148 Fall, 2009 Description: Richard Grays AOACSE Executive Meetings Page AOACSE Graphic AOACSE Header Menu Text ... Date Added: 2009-06-08 22:00:12 |
| 02.doc Path: Arizona >> CS >> 227 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|20 Dec 2007 23:23:11 -0000 vti_title:SR|Objects and Control Structures vti_author:SR|mercer vti_modifiedby:SR|mercer vti_timecreated:TR|03 Sep 2008 16:53:47 -0000 vti_backlinkinfo:VX| vti_extenderversio... Date Added: 2009-06-08 22:00:40 |
| exam1.pdf Path: Wisconsin >> M >> 222 Fall, 2008 Description: Math 222 Spring 2006 C. Gmez o February 15, 2006 Exam 1 Name: Please circle your TA\'s name: Problem 1 2 3 4 5 6 7 8 Total Score Garrett Alston Sharon Garthwaite James Hegeman Alec (Evan) Johnson Keya Zhu Absolutely no calculators, notes, or b... Date Added: 2009-06-08 22:02:52 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 3011 Fall, 2009 Description: \" 13266,13842,472,1118 \" 12227,51269,472,1078 \" 12267,49157,497,1238 \" 12987,22217,447,1078 \" 12547,40782,497,1078 \"wa 11868,53282,944,6393 * 12227,55320,521,1038 190 11308,5964,1018,3356 ; 31009,51592,919,439 a 39281,45454,671,959 a 13666,55246,1018... Date Added: 2009-06-08 22:05:19 |
| LING.pdf Path: Maryland >> RR >> 0901 Fall, 2009 Description: ... Date Added: 2009-06-08 22:11:34 |
| mpolex.pdf Path: Princeton >> ECO >> 072399 Fall, 2009 Description: Econ. 511b Spring 1997 C. Sims Monetary Policy 1. Suppose that, in the model we have been studying in class, instead of following a monetary policy of M M , the government follows a policy of M = Met , for some fixed money growth rate . How does ... Date Added: 2009-06-08 22:16:35 |
| ep_nfl_dat.txt Path: Berkeley >> ASTRO >> 00153866 Fall, 2009 Description: # Ep dEp lprob lNiso dlNiso 367.029 0.299 -3.66e-05 2.159 0.392 367.349 0.343 -2.10e-04 2.159 0.362 367.716 0.392 3.34e-04 2.159 0.360 368.136 0.449 3.02e-05 2.159 0.360 368.617 0.514 -2.19e-04 2.159 0.360 369.168 0.589 -4.41e-04 2.159 0.360 369.798 ... Date Added: 2009-06-08 22:19:45 |
| PHY346Midterm2000.pdf Path: Toledo >> PHY >> 346 Fall, 2009 Description: ... Date Added: 2009-06-08 22:20:13 |
| populationgrowthpaper.doc Path: Uni. Westminster >> JLK >> 0627 Fall, 2009 Description: JodiKent CompositionandResearch 04/22/03 PopulationGrowthinUtah The population growth in Utah has increased drastically and is continuing to do so overtime. Ultimately, there is a result of two observable facts that are the main cause of this probl... Date Added: 2009-06-08 22:24:25 |
| Psy460_GrpTask08_Immediacy.pdf Path: CSU Northridge >> HCPSY >> 002 Fall, 2009 Description: IMMEDIACY Immediacy is somewhat related to self-disclosure. When using immediacy, the counselor briefly and appropriately discloses his/her immediate reactions about the client to the client. The distinction between self-disclosure and immediacy is t... Date Added: 2009-06-08 22:24:39 |
| Electrochemistry.pdf Path: Coastal Carolina University >> CHEM >> 321 Fall, 2008 Description: Electrochemistry Activity Name _ Co-Worker _ Additional Group Members _ Learning Objectives: 1. To learn how to construct electrochemical cells for various uses. 2. To carry out calculations involving electrochemical reactions and processes. Topics: ... Date Added: 2009-06-08 22:48:00 |
| Midterm Outlines Path: UCSB >> HIST >> 4C Fall, 2007 Description: Section Three: Essay Question #1: What were the ideas of the enlightenment? How did they have influence on events in France and st. domingue from 1789-1799? I. Secularism A. Nov. 1, 1755Lisbon Earthquake occurred [over 50% died]. Survivors scattered ... Date Added: 2009-06-08 23:33:48 |
| ks07 Path: UC Davis >> MIC >> 170 Spring, 2009 Description: Gene Expression & DNA Microarrays Background and basis for approach Array Technologies First published example (from yeast) Bioinformatics and Array Data Analysis Applications of Expression Profiling Human cells Other uses of microarrays Concept: us... Date Added: 2009-06-11 03:16:15 |
| ps4.pdf Path: Mt. Holyoke >> MA >> 319 Fall, 2009 Description: Math 319 Reading: NZM 2.1, 2.2. Problem Set #4 Due 12 March 2000 Exercises: Write your solutions in complete sentences. 1. (2.1, problem 34) Show that an integer m > 1 is a prime if and only if m divides (m - 1)! + 1. 2. (1.2, problem 32) Let n 2... Date Added: 2009-06-11 14:13:26 |
| Ou-Zhu-Zang.pdf Path: N.C. State >> CSC >> 791 Fall, 2009 Description: IEEE JOURNAL ON SELECTED AREAS IN COMMUNICATIONS, VOL. 21, NO. 9, NOVEMBER 2003 1367 Traffic Grooming for Survivable WDM NetworksShared Protection Canhui (Sam) Ou, Student Member, IEEE, Keyao Zhu, Student Member, IEEE, Hui Zang, Member, IEEE, Laxma... Date Added: 2009-06-11 14:14:26 |
| bulletin013006.pdf Path: CSU Sacramento >> BULLETIN >> 013006 Fall, 2009 Description: NEWS | CALENDAR | ACADEMICS | HR | SUBMIT NEWS | BULLETIN HOME | Print version January 30, 2006 vol. 12, no. 19 THIS WEEK STUDENT LIFE-Students crowd Greek organization and campus club booths set up in the Library Quad Thursday. The University spru... Date Added: 2009-06-11 14:23:34 |
| 2N3904.pdf Path: LSU >> EE >> 2230 Fall, 2008 Description: 2N3903, 2N3904 2N3903 is a Preferred Device General Purpose Transistors NPN Silicon Features http:/onsemi.com COLLECTOR 3 PbFree Packages are Available* MAXIMUM RATINGS Rating Collector Emitter Voltage Collector Base Voltage Emitter Base Voltage ... Date Added: 2009-06-11 14:23:53 |
| bag_outFINAL.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: ... Date Added: 2009-06-11 14:55:58 |
| CalcHist5.pdf Path: Boise State >> MATH >> 160 Fall, 2008 Description: The History of Infinity1 What is it? Where did it come from? How do we use it? Who are the inventors? 1 The Beginning As there is no record of earlier civilizations regarding, conceptualizing, or discussing infinity, we will begin the story of inf... Date Added: 2009-06-11 14:56:16 |
| The History of Infinity.pdf Path: Boise State >> MATH >> 160 Fall, 2008 Description: The History of Infinity1 What is it? Where did it come from? How do we use it? Who are the inventors? 1 The Beginning As there is no record of earlier civilizations regarding, conceptualizing, or discussing infinity, we will begin the story of inf... Date Added: 2009-06-11 14:56:28 |
| ocs_requirements.doc Path: University of Hawaii - Hilo >> DOCS >> 014 Fall, 2009 Description: Joint Astronomy Centre James Clerk Maxwell Telescope Nick Rees, Mary Fuka, Bill Dent, Dennis Kelly, Gary Hovey, John Lightfoot April, 2000 OCS System Note 14.0 The Future of the JCMT Observatory Control System Project 1 SUMMARY..2 2 INTRODUCTION..3 ... Date Added: 2009-06-11 15:43:53 |
| asplos02.pdf Path: Arizona >> CS >> 652 Spring, 2009 Description: ECOSystem: Managing Energy as a First Class Operating System Resource Heng Zeng, Carla S. Ellis, Alvin R. Lebeck, Amin Vahdat Department of Computer Science Duke University zengh,carla,alvy,vahdat @cs.duke.edu Abstract Energy consumption has recent... Date Added: 2009-06-11 15:44:52 |
| 060306respect.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Feeling No Pain - New York Times March 6, 2006 Op-Ed Columnist Feeling No Pain By PAUL KRUGMAN President Bush\'s main purpose in visiting India seems to have been to promote nuclear proliferation. But he also had some kind words for outsourci... Date Added: 2009-06-11 15:46:07 |
| YGR210C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YGR >> 210 Fall, 2009 Description: YGR210C.t2k CB_BURIAL_14_7 3 2 1 X X X X AABCEEG BB FF 1 AD CCCBDDEE D D D D E E X X X X X X X FGFG F F F G G D F CDE E C D D D B E E F G D D F D EECBDCC F D E EEXXXEEFEEGXCDCADCEADCAEFEEEEXECDDCDDCCA E D D A D E X XXXXXD X X X X XXDXXDXXX XXXX... Date Added: 2009-06-11 16:07:07 |
| lect13.ps Path: Duke >> CPS >> 130 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: lect13.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips lect13 %DVIPSParameters: dpi=... Date Added: 2009-06-11 16:39:36 |
| PPA349S07povertyLO.pdf Path: CSU Northridge >> PPA >> 349 Fall, 2009 Description: ! \" $ ! % # \' ) ! * . / 0 * (+ ! ( , ... Date Added: 2009-06-11 16:55:04 |
| NRiC2.txt Path: Maryland >> ASTR >> 688 Fall, 2008 Description: [Following excerpt from e-mail sent to class 9/26/07] The NRiC2 code on the department machines is here: /local/src/lib/NumRecC/ The subdirectories of interest are \"other2/\" and \"recipes/\". The latter is where most of the code source is. For... Date Added: 2009-06-11 17:15:39 |
| YFR048W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YFR >> 048 Fall, 2009 Description: YFR048W.t2k DSSP-EHL2 2 1 CC 1 C C E X X X X 10 20 30 40 H 2 1 T G H E H G T H C C C C C C C E E E H X X X X X X X 51 60 70 80 90 T 2 1 T T T S T T C H H H H C C C H H C C H C H H H H H H C C C H C H C C H X X X X X X X X ... Date Added: 2009-06-11 17:33:58 |
| DNS-RESOLVER-MIB.txt Path: UMKC >> CS >> 590 Fall, 2009 Description: Network Working Group R. Austein Request for Comments: 1612 Epilogue Technology Corporation Category: Standards Track J. Saperia ... Date Added: 2009-06-11 17:47:53 |
| quantization.pdf Path: George Mason >> M >> 447 Fall, 2009 Description: ... Date Added: 2009-06-11 17:56:53 |
| incentive.pdf Path: Duke >> X >> 296 Fall, 2009 Description: Incentive Compatible Ranking Systems Faculty of Industrial Engineering and Management Technion Israel Institute of Technology Haifa 32000, Israel Alon Altman Faculty of Industrial Engineering and Management Technion Israel Institute of Technology... Date Added: 2009-06-11 18:08:03 |
| mid2006S.pdf Path: Toledo >> CSC >> 148 Fall, 2009 Description: CSC148H Summer 2006 L0101 Midterm Duration: 50 minutes Last Name: _ First Name: _ Student Number: _ __ Do not turn this page until you have received the signal to start. __ #1: _ / 10 Midterm aids allowed: NONE Please write legibly. If you run ou... Date Added: 2009-06-11 18:11:55 |
| YDR224C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YDR >> 224 Fall, 2009 Description: YDR224C.t2k EBGHSTL 3 2 1 CC X 1 10 20 30 40 H 3 2 1 H H T H SHSGSTC HXXGGSXHHXTX S H X X X X C S G X C T TT X TT C C 51 60 70 80 90 T 3 2 1 H T H HHH 101 X X XXHXCXX X X H CH S T H 110 120 H 130 AV RLI LPGELAKH AVSEGT... Date Added: 2009-06-11 18:25:29 |
| L24-JavaScript_Security.pdf Path: Stanford >> CS >> 193 Fall, 2009 Description: JavaScript cs193i - Internet Technologies Lecture 24 Stanford University Ron B. Yeh ronyeh@cs.stanford.edu May 24, 2004 Two Methods Build HTML dynamically as the Web Page loads Monitor user events, and take action 3 Generate Dynamic HTML . <BODY>... Date Added: 2009-06-11 18:26:53 |
| 1941.txt Path: UCCS >> CS >> 591 Fall, 2009 Description: Rule: - Sid: 1941 - Summary: This event is generated by an attempt to exploit a buffer overflow in TFTP file handling routines. - Impact: Implementation Dependent. Several implementations of TFTP are vulnerable to a buffer overflow when processin... Date Added: 2009-06-11 18:34:29 |
| Oct 22 Course Email.txt Path: University of Illinois, Urbana Champaign >> CS >> 598 Fall, 2008 Description: Hello everyone. Sorry for late notice, my email was down over the weekend. Today is the session on Medical Devices. Partially I will cover measurement issues with treatments that are devices rather than drugs or screenings. Partially I will cover... Date Added: 2009-06-11 18:37:43 |
| MichaelCramponF.pdf Path: USC >> CS >> 653 Fall, 2008 Description: To start working on the academic data project I began with a subset of data containing information on just over fifty-five thousand students. Each student\'s information is originally broken into 104 fields containing identification information for id... Date Added: 2009-06-11 18:40:24 |
| 13-Notes.ppt Path: Ill. Chicago >> ACTG >> 593 Fall, 2008 Description: 13IntercorporateInvestments 1 Investmentsinsecurities InvestmentinCommonShares,Notes,etc. Individualinvestor:Totalincomeearnedontheinvestments = Dividendsandinterestreceived + Capitalgain(realizedorunrealized) Forcorporations:Whatshouldbereportedin... Date Added: 2009-06-11 18:58:03 |
| Moving.pdf Path: Minnesota >> RASM >> 0254 Fall, 2009 Description: The Intention of Moving Forward Crowded streets dust my eyes. Laundry is hung out the window to dry. A woman in an apron shakes a rug. A stray dog roams the sidewalk wagging its tail passing two old men playing chess. A vendor sells raw fish on the c... Date Added: 2009-06-11 19:00:32 |
| Software-Development-Plan-Template-u.doc Path: San Jose State >> CMPE >> 195 Fall, 2009 Description: <Company Name> <Project Name> Project or Software Development Plan Version <1.0> [Note: The following template is provided for use with the Rational Unified Process. Text enclosed in square brackets and displayed in blue italics (style=InfoBlue) is i... Date Added: 2009-06-11 19:00:34 |
| Video_Guidelines.pdf Path: Rutgers >> METHODS >> 501 Fall, 2009 Description: ... Date Added: 2009-06-11 19:00:42 |
| cs418-1.pdf Path: Montana >> CS >> 418 Fall, 2008 Description: CS418-Operating Systems Lecture 1 Textbook: Operating Systems by William Stallings 1 0. About CS418 Course home page: http:/www.cs.montana.edu/bhz or http:/www.cs.montana.edu/bhz/classes/spring-2003/cs418 Basic operating systems (67%) and advanc... Date Added: 2009-06-11 19:04:07 |
| NSEE_prg_complt_ppt.pdf Path: Hamline >> FAS >> 270 Fall, 2009 Description: Hamline University Graduate School of Education Master of Arts in Education: Natural Science and Environmental Education In Order to Graduate (outline) Submit Intent to Graduate form. Complete all the program requirements. Transfer the necessary cre... Date Added: 2009-06-11 19:04:19 |
| Proj3_Final_HMM_S07.pdf Path: North Texas >> EENG >> 2910 Fall, 2008 Description: AM Radio Transmitter T itt University of North Texas Department of Electrical Engineering EENG 2910 May 10, 2007 John Howington- abe.howington@gmail.com Ahmid mosih- mosih200@yahoo.com Tyler Moradi- thm0018@unt.edu In The Beginning Beginning Ampli... Date Added: 2009-06-11 19:08:09 |
| L11.pdf Path: East Los Angeles College >> M >> 172 Fall, 2009 Description: ... Date Added: 2009-06-11 19:09:12 |
| Discussion 1.ppt Path: Arizona >> CLASS >> 480580 Fall, 2009 Description: Presented by Laila Haidar Working Knowledge How Organizations Manage What They Know Chapter 1- Chapter 4 Discussion Occurring Themes Knowledge is People The Authors Describe Knowledge Management Using Real Scenarios and Practices Tuesday 09-06... Date Added: 2009-06-11 19:18:55 |
| CCFicaSCs3allv25.ps Path: UNC >> STAT >> 321 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: MATLAB, The Mathworks, Inc. %Title: \\Talks\\ComplexPopn\\CorpColl\\CCFicaSCs3allv25.ps %CreationDate: 03/05/ 1 23:02:44 %DocumentNeededFonts: Helvetica %DocumentProcessColors: Cyan Magenta Yellow Black %Extensions: CMYK %Pages: ... Date Added: 2009-06-11 19:19:36 |
| Deriv Forces_pdf.pdf Path: East Los Angeles College >> MANS >> 1095 Fall, 2009 Description: in Nihil Sine Ratione: Mensch, Natur und Technik im Wirken von G. W. Leibniz ed. H. Poser (2001), 720-27. Paul Lodge (New Orleans) Primitive and Derivative Forces in Leibnizian Bodies Page 720 I It is well known that Leibniz believes that the motion... Date Added: 2009-06-11 19:19:43 |
| MiniFreezer.doc Path: UCSD >> MAE >> 156 Fall, 2008 Description: Researched by: I-Ting Chen Mini Freezer Report The component I choose to research is the small refrigerator, which is the main part of our testing device. The purpose for obtaining a small refrigerator is to stimulate the snow-cold environment up the... Date Added: 2009-06-11 19:19:43 |
| exp1_(rates)_template.xls Path: Washington >> CHEM >> 162 Fall, 2008 Description: 13e4e3cdbb001b0977409d3f3b2e7319d9d8ebe1.xls H2O2 ml bleach ml H2O ml relative concentration of bleach 1 Time to generate 50 mL of gas (seconds) rate ml/s Page 1 13e4e3cdbb001b0977409d3f3b2e7319d9d8ebe1.xls Concentration of crystal violet sto... Date Added: 2009-06-11 19:20:04 |
| lecture15.ps Path: San Diego State >> PHYS >> 410 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: lecture15.dvi %Pages: 7 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMSY10 CMR12 MSAM10 CMMI12 MSBM10 CMR8 CMMI8 %+ CM... Date Added: 2009-06-11 19:21:23 |
| lecture19.ps Path: San Diego State >> PHYS >> 410 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: lecture19.dvi %Pages: 8 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMSY10 CMR12 CMMI12 CMTI12 CMR8 CMMI8 CMSY8 %+ CME... Date Added: 2009-06-11 19:21:24 |
| lecture04.ps Path: San Diego State >> PHYS >> 608 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96.1 Copyright 2007 Radical Eye Software %Title: lecture04.dvi %CreationDate: Thu Sep 11 16:56:20 2008 %Pages: 13 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMSY10 C... Date Added: 2009-06-11 19:21:45 |
| Physics 227_08 HW IV.pdf Path: Washington >> PHYS >> 2278 Fall, 2009 Description: Physics 227 - Autumn 2008 HW IV Due Monday 10/27/08 (Special date) Note that the first Mid Term exam is Friday 10/24/08. Example problems: Not to be turned in solutions can be found at the back of the book. See also Appendix B to the relevant lectur... Date Added: 2009-06-11 19:23:38 |
| public.pdf Path: Maryville MO >> EDESB >> 042507 Winter, 2009 Description: Public Abstract First Name:Benjamin Middle Name:Taylor Last Name:Edes Adviser\'s First Name:Brian Adviser\'s Last Name:Mann Co-Adviser\'s First Name: Co-Adviser\'s Last Name: Graduation Term:WS 2007 Department:Mechanical & Aerospace Engineering Degree:MS... Date Added: 2009-06-11 19:23:57 |
| Sun_Jan_20.txt Path: Auburn >> RH >> 370 Fall, 2009 Description: rajagma smb17153 131.204.14.152 Sun Jan 20 22:53 - 22:57 (00:03) rajagma smb14249 131.204.14.152 Sun Jan 20 22:49 - 22:51 (00:01) mph0001 smb6462 131.204.14.145 Sun Jan 20 21:51 - 22:01 (00:10) swh0001 smb5984 131.2... Date Added: 2009-06-11 19:25:54 |
| BL262ex08-3.pdf Path: Regis >> BL >> 262 Fall, 2009 Description: Name BIOLOGY 262, FALL 2008 IN-CLASS EXAM EXAMINATION #3 (PART 1) Date MULTIPLE CHOICE.For the following multiple choice questions circle the letter in front of the response that best answers the question or completes the sentence. (20%, 2% each) ... Date Added: 2009-06-11 19:26:19 |
| submit.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: executable = pass6_31517.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31517... Date Added: 2009-06-11 19:26:22 |
| submit.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: executable = pass6_31940.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31940... Date Added: 2009-06-11 19:26:44 |
| output.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-GYVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2748 02/10/2008 10:54 PM <DIR> . 02/10/2008 10:54 ... Date Added: 2009-06-11 19:27:30 |
| output.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5ZVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3900 02/10/2008 10:24 PM <DIR> . 02/10/2008 10:24 ... Date Added: 2009-06-11 19:28:28 |
| log.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: 000 (56570.000.000) 02/10 19:20:29 Job submitted from host: <128.95.94.28:1098> . 001 (56570.000.000) 02/10 22:12:39 Job executing on host: <172.25.101.161:1061> . 006 (56570.000.000) 02/10 22:32:47 Image size of job updated: 393988 . 005 (56570.000.... Date Added: 2009-06-11 19:28:58 |
| f07.pdf Path: Oregon State >> ECE >> 478 Fall, 2008 Description: Bit: 0 16 Security Parameters Index (SPI) Sequence Number 24 31 Confidentiality Coverage Authentication Coverage Payload Data (variable) Padding (0 - 255 bytes) Pad Length Authentication Data (variable) Next Header Figure 16.7 IPSec ESP Form... Date Added: 2009-06-11 19:31:18 |
| zhao3_gantt.pdf Path: Oregon State >> ECE >> 441 Fall, 2008 Description: 2008-09Template - 43% Complete ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Spring Reinspection Expo Materials Complete Expo Day 0 days Travis/Vincent 0 days Travis/Vincent 0 days Travis/Vincen... Date Added: 2009-06-11 19:31:44 |
| Chapter 27 (Change Management) slides.ppt Path: Emporia >> CS >> 552 Spring, 2008 Description: Chapter 27: Change Management (CM) Software Configuration Management (SCM) Why SCM ID change Control change Ensure proper change implementation Report change Software Configuration Items (SCI) Computer programs (both source and executable) Do... Date Added: 2009-06-11 19:32:05 |
| Mech320-Assign5-Solutions.pdf Path: Virgin Islands >> MECH >> 320 Fall, 2009 Description: ... Date Added: 2009-06-11 19:33:18 |
| hw1psol.pdf Path: Washington University in St. Louis >> CSE >> 577 Fall, 2009 Description: CS 577 Design and Analysis of Switching Systems Homework 1 Solutions Jonathan Turner 9/10/02 You are encouraged to work all the problems, but you need only turn in the ones that have points assigned to them. 1. Consider the basic cell switch descr... Date Added: 2009-06-11 19:34:32 |
| PS09.pdf Path: MIT >> UMB >> 113 Fall, 2009 Description: Physics 113 Problem Set 9 You couldn\'t possibly forget the . . . Spring 2007 Due March 1 in Discussion Section First Quiz, on Chapters 1-7, on March 8 in the usual lecture room at the usual lecture time. Reading for Thursday March 1: Text Sections ... Date Added: 2009-06-11 19:36:39 |
| Book29_04.txt Path: N.C. State >> ST >> 610 Fall, 2008 Description: /* This code is shown in Chapter 29 on page 501. */ /* The SAS data set GRADES was created earlier */ /* in Chapter 29 on page 481. */ goptions reset=global gu... Date Added: 2009-06-11 19:36:57 |
| DA14A_Lecture.ppt Path: Ohio State >> H >> 192 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|FEHWEBSERVER\\beams vti_modifiedby:SR|FEHWEBSERVER\\beams vti_timelastmodified:TR|03 Jan 2007 02:43:10 -0000 vti_timecreated:TR|03 Jan 2007 02:38:31 -0000 vti_title:SR|Characters and Strings vti_extenderversion:SR|... Date Added: 2009-06-11 19:38:24 |
| KLP apsa 2008 nominations opinion.pdf Path: Columbia >> JRL >> 2124 Fall, 2009 Description: Public Opinion and Senate Confirmation of Supreme Court Nominees Jonathan P. Kastellec JPK2004@columbia.edu Department of Political Science Columbia University Jeffrey R. Lax JRL2124@columbia.edu Justin Phillips JHP2121@columbia.edu March 26, 2009 A... Date Added: 2009-06-11 19:38:36 |
| R-CA.pdf Path: Montana >> OPA >> 200870 Fall, 2009 Description: Office of the Registrar MSU-Bozeman Bozeman, MT REPORT C - PART A STUDENT CREDIT HOURS BY SUBJECT FIELD For Event: LOWER DIVISION UPPER DIVISION D Total Res Non WUE X D Total Res Non End of Third Week Fall Semester October 3, 2008 200870CENSUS GRAD... Date Added: 2009-06-11 19:40:00 |
| 125 F2006 Lecture 13 Outline- Militarism and Unions.doc Path: Wisconsin >> SOC >> 125 Fall, 2008 Description: 125:F2006:13:120406 Militarism and Unions Americans usually understand the military as necessary to our national defense and used to promote democracy. Is that right? Who controls the military, and to whom are officers sworn? What are the costs of th... Date Added: 2009-06-11 19:41:01 |
| eval_b.xls Path: ASU >> ECE >> 536 Fall, 2009 Description: =Much More Important 9 =More Important 3 The =Same 1 =Less Important 0.333 =MuchLess Important 0.111 Criteria INTEREST META THINK/PROCESS WORK WITH OTHERS PROBLEM SOLVING ORGANIZE/PRESENT DEVELOP MODELS SCHEDULE/ALLOCATE INTEREST THINK/PROCESS... Date Added: 2009-06-11 19:41:31 |
| 24165-8.txt Path: UNC >> DOCS >> 24165 Fall, 2009 Description: The Project Gutenberg EBook of The Development of Embroidery in America, by Candace Wheeler This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the te... Date Added: 2009-06-11 19:43:23 |
| Ap27.ps Path: Washington >> AP >> 124 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: Ap27.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips Ap27.dvi -o Ap27.ps %DVIPSParame... Date Added: 2009-06-11 19:43:51 |
| L14_Fa02_Lewis(6:2fp).pdf Path: Wayne State University >> CHM >> 1220 Fall, 2009 Description: I LiH NaH KH RbH CsH II BeH 2 MgH2 CaH 2 SrH 2 BaH 2 III IV CH4 SiH 4 SnH 4 PbH 4 V NH 3 PH 3 AsH3 SbH3 BiH3 VI H2O H2S H 2 Se H 2 Te VII HF HCl HBr HI (AlH 3) X InH3 TlH B2 H 6 Further proof that our picture of electron configuration is cor... Date Added: 2009-06-11 19:43:57 |
| lecture8.pdf Path: Pittsburgh >> ME >> 2080 Fall, 2008 Description: Lecture 8 Si Anisotropic Etching (2) Anisotropic etching: (110) Si x x x A mask will not be undercut if its outline follows the intersections of (111) planes with the (110) surface The (111) planes are perpendicular to the (110) wafer surface so ... Date Added: 2009-06-11 19:44:55 |
| Introduction to Sociology 2.pdf Path: East Los Angeles College >> SFOS >> 0015 Fall, 2009 Description: Religion and Secularisation What is religion? Functional definition belief system that offers solutions to \"ultimate problems\" belief system that promotes social solidarity/ stabilises society Rules out the phenomena of secularisation by defini... Date Added: 2009-06-11 19:45:05 |
| mm545052113.051900.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.641 107.744 -71.891 41.662 -72.453 43.409 6.462 -72.172 42.536 67.669 5B3 CNH ... Date Added: 2009-06-11 19:46:18 |
| mm545072020.071906.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 196.621 106.114 -73.643 46.935 -71.715 45.771 19.757 -72.679 46.353 2... Date Added: 2009-06-11 19:47:39 |
| mm545080420.080306.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 197.091 106.368 -73.801 45.922 -71.558 46.784 18.342 -72.679 46.353 2... Date Added: 2009-06-11 19:47:40 |
| mm545072713.072506.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.529 107.683 -67.933 48.253 -68.482 50.011 7.403 -68.207 49.132 3... Date Added: 2009-06-11 19:47:55 |
| mm515080413.080300.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.39 107.069 -75.037 48.943 -74.018 50.601 13.667 -74.528 49.772 4... Date Added: 2009-06-11 19:49:03 |
| mm515070913.070800.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] dchibougamau[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.891 107.879 -68.883 44.311 -68.597 46.097 3.556 -68.74 45.20... Date Added: 2009-06-11 19:50:04 |
| Feb 14.doc Path: Kentucky >> ME >> 321 Fall, 2008 Description: Created with Microsoft Office OneNote 2007 One place for all your notes and information ... Date Added: 2009-06-11 19:52:32 |
| testprobs.pdf Path: Princeton >> SOC >> 301 Fall, 2008 Description: SOC 301 Practice Questions for Final exam Below are 10 practice problems geared to test your ability to (1) determine and (2) apply appropriate statistical tests, given a particular research question. I suggest you try answering these questions two w... Date Added: 2009-06-11 19:53:13 |
| L16A.pdf Path: St. Joseph IN >> ESS >> 125 Fall, 2009 Description: Chapter 7: Earth and the Terrestrial Worlds Lecture 16, part A Survey of Ch.7: Earth and the Terrestrial Worlds Why have the Terrestrial planets turned out so differently, when they were formed at the same time from the same materials? We\'ll see ... Date Added: 2009-06-11 19:53:18 |
| Session 7Observer.doc Path: Cal Poly Pomona >> EVALUATION >> 550 Fall, 2009 Description: 1 Observers Form: Name _ Project at [observers location- street intersection]:_Ob #_ Day: S M T W T F S (circle 1) Date: _/_/ Start Time:_ End time:_ __ (USE separate form for each 15 minutes of observation) 1. Indicate on grid where you are and circ... Date Added: 2009-06-11 19:53:42 |
| code.ps Path: Duke >> CPS >> 100 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: demo.cpp, libsort.cpp %For: Owen L. Astrachan %Creator: a2ps version 4.13 %CreationDate: Fri Mar 26 09:41:21 2004 %BoundingBox: 24 24 588 768 %DocumentData: Clean7Bit %Orientation: Landscape %Pages: 3 %PageOrder: Ascend %Docume... Date Added: 2009-06-11 19:53:57 |
| fractions info.pdf Path: Pima CC >> MAT >> 092 Fall, 2008 Description: sampleproblems Solveeachproblemandblockyouranswer. Findtheprimefactorizationofthenumber.Ifthenumberisprime,statethis. 1) 828 2) 936 3) 413 Simplify. 4) 255 45 147 21 350 420 5) 6) Performtheindicatedoperationand,ifpossible,simplify. 6 10 7) + 48 5... Date Added: 2009-06-11 19:54:35 |
| m2686hprojectcoor.pdf Path: Youngstown >> M >> 2686 Fall, 2009 Description: Math. 2686h I. Answer the following: Another Project Spring, 2004 Consider the following objects: A box whose side s are 1 x 2 x 3, a cylinder whose radius is 1 and height is 2, a sphere whose radius is 1. I.) Using Maple, graph all 3 objects in th... Date Added: 2009-06-11 19:54:46 |
| OnLineDiscussions.pdf Path: W. Alabama >> CS >> 200 Fall, 2009 Description: Discussion Marks CS200 ID Number 00008352 00024474 00050351 00088911 00141435 00990204 20063873 20064172 20064809 20065008 20065579 20065586 20066263 20067494 20067731 20072343 20073322 20078650 20083255 20090927 20093160 20093557 20093593 20098501 2... Date Added: 2009-06-11 19:57:24 |
| batschmann.pdf Path: Minnesota >> AH >> 3401 Fall, 2009 Description: ... Date Added: 2009-06-11 19:58:24 |
| Quiz3Ans.doc Path: CSU Fullerton >> DES >> 715 Fall, 2009 Description: DES715 Database Design Winter 2009 Quiz 3 Page 1 of 1 Order nurseName 1 contains fills 1.n 1 Pharmacist name 1.n Prescription 1.n has 1.n has Prescriptio nDetail 1.n dosage qty repeat Drug name is on 1 1 Patient name unit roomNum ... Date Added: 2009-06-11 19:59:02 |
| HW1sol08.pdf Path: Utah >> ECE >> 2280 Spring, 2008 Description: ECE2280 Homework #1: Homework #1 Spring 2008 1. Given Vg=lOmV, fmd Yo. Find the Thevenin equivalent between terminals a-b. (Note: VI\"* Vg) Ion + 5n . - - - - ; - -.- - - ( J a 3n I-ob 2. Sketch the following waveforms. Identify the de compo... Date Added: 2009-06-11 20:00:01 |
| shellProject.pptx Path: Rose-Hulman >> SEC >> 200920 Fall, 2009 Description: Shell Project Click to edit Masterasubtitle style xssh Implementation of simple shell, (Section 1 version) What is a shell? A process that does command line interpretation Reads a command from standard input (stdin) Executes command corresponding t... Date Added: 2009-06-11 20:00:19 |
| Lesson 18 -- Concurrency.pptx Path: Rose-Hulman >> SEC >> 200920 Fall, 2009 Description: Concurrency Click to edit Master subtitle style Enforcing Mutual Exclusion, Semaphores Four different approaches Hardware support Disable interrupts Special instructions Software-defined approaches Support from the OS/compiler 22 OS support: Sema... Date Added: 2009-06-11 20:00:19 |
| Oct 10.ppt Path: Skidmore >> MA >> 113 Fall, 2009 Description: Areas and Volumes Using the Integral (10/10/08) If we can see how to express the area or volume of 2- or 3-dimensional figures by adding up little cross-sectional areas or volumes, then we can use the integral to get the answer. This general techn... Date Added: 2009-06-11 20:02:24 |
| Coastal Geology, em1110-2-1810.pdf Path: UF >> EOC >> 6430 Fall, 2008 Description: CECW-EG Engineer Manual 1110-2-1810 Department of the Army EM 1110-2-1810 31 January 1995 U.S. Army Corps of Engineers Washington, DC 20314-1000 Engineering and Design COASTAL GEOLOGY Distribution Restriction Statement Approved for public releas... Date Added: 2009-06-11 20:03:31 |
| check_O3_spikes_29_06_2002.ps Path: East Los Angeles College >> IP >> 261 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 360 558 720 %Title: Graphics produced by IDL %For: ajtic@meltem.aero.jussieu.fr, % /a/net/nfs/home/ajtic/Crystal_face/work %Creator: IDL Version 5.4 (OSF alpha) %CreationDate: Fri Feb 4 17:52:52 2005 %DocumentData: Cle... Date Added: 2009-06-11 20:07:37 |
| Adept-Reference.pdf Path: Iowa State >> DEC >> 0911 Fall, 2009 Description: REFERENCES CITED [1] M. Bezdek, D. Helvick, R. Mercado, D. Rover, A. Tyagi, and Z. Zhang. Developing and teaching an integrated series of courses in embedded systems. In Proceedings of the ASEE/IEEE Frontiers in Education Conference (FIE), 2006. [2] ... Date Added: 2009-06-11 20:08:50 |
| Presentation1.ppt Path: Iowa State >> MAY >> 0911 Fall, 2009 Description: Humanoid Robot Head Dan Potratz Cody Genkinger Tim Meer Jason Pollard Andrew Taylor Requirements The head has three degrees of freedom, and can turn from side to side smoothly in under a second. Facial features will be controlled by servomo... Date Added: 2009-06-11 20:09:05 |
| review 01-04-08.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 567 Fall, 2008 Description: ... Date Added: 2009-06-11 20:10:36 |
| Sea level rise.pdf Path: UF >> GEO >> 2200 Fall, 2008 Description: Eos, Vol. 88, No. 9, 27 February 2007 VOLUME 88 PAGES 105116 NUMBER 9 27 FEBRUARY 2007 EOS, TRANSACTIONS, AMERICAN GEOPHYSICAL UNION Risk of Rising Sea Level to Population and Land Area PAGES 105, 107 Low- elevation land areas and their populatio... Date Added: 2009-06-11 20:11:45 |
| Fl07 PH141 HW11 Ch10 My Assigned Solutions.pdf Path: Clarkson >> PH >> 141 Fall, 2009 Description: Chris Sulyma Fl07 PH141 HW 11: Ch 10 Questions Ch:10 # 2, 3, 6, 9, 10, 11, 12, 13 Problems Ch:10 # 1, 4, 6, 15, 18, 25, 39 Question 2: The net force is the same for both cases An ideal spring will give the same force if it is compressed or stretch... Date Added: 2009-06-11 20:13:24 |
| 4350.pubgoodgame.pdf Path: UGA >> TERRY >> 4010 Fall, 2009 Description: Econ 4350 Game # 4: Public Goods Game You can hold two valued cards for a private payoff or give them up to a general fund, which will be divided equally after I match them. Prof. Atkinson Spring 2003 Sudent Name Personal Gain Trial 1 2 3 4 Valued ... Date Added: 2009-06-11 20:14:06 |
| 4350.compgame.pdf Path: UGA >> TERRY >> 5100 Fall, 2009 Description: Econ 4350/6350 Game # 1: Competitive Supply and Demand Prof. Atkinson Sudent Name COMPETITIVE MKT: Buyers Trial 1 2 3 4 5 6 No. Firms Your max WTP Negotiated Price Consumer Surplus COMPETITIVE MKT: Sellers Trial 1 2 3 4 5 6 No. Firms Your MC Negoti... Date Added: 2009-06-11 20:14:07 |
| 4350.compgame.pdf Path: UGA >> TERRY >> 4350 Fall, 2009 Description: Econ 4350/6350 Game # 1: Competitive Supply and Demand Prof. Atkinson Sudent Name COMPETITIVE MKT: Buyers Trial 1 2 3 4 5 6 No. Firms Your max WTP Negotiated Price Consumer Surplus COMPETITIVE MKT: Sellers Trial 1 2 3 4 5 6 No. Firms Your MC Negoti... Date Added: 2009-06-11 20:14:09 |
| Rout Optimization presentation.ppt Path: Midwestern State University >> CPTS >> 559 Fall, 2009 Description: Rout Optimization in Mobile IP By Ching-Guo Wu Feb. 24, 2004 Base Mobile IP protocol Allow mobile nodes to move about while continuing to be identified by its home IP address. Datagram routed through home agent (HA). Path is significant longer. D... Date Added: 2009-06-11 20:14:46 |
| salonadis.pdf Path: Midwestern State University >> CPTS >> 559 Fall, 2009 Description: Distributed Topology Construction of Bluetooth Personal Area Networks Theodoros Salonidis 1, Pravin Bhagwat2, Leandros Tassiulas1, and Richard LaMaire3 thsalon@glue.umd.edu, pravinb@research.att.com, leandros@glue.umd.edu, lamaire@us.ibm.com 1 Elect... Date Added: 2009-06-11 20:14:48 |
| frameMultipleInherW11.pdf Path: Allan Hancock College >> COIT >> 13121 Fall, 2009 Description: physical object isa vehicle isa car use : transport int isa holden kingswood amo ruths kingswood propulsion method : internal combusion engine currently registered cars mean age : 6.4 apo electrical system apo battery amo apo make : holden mode... Date Added: 2009-06-11 20:15:04 |
| consel98architecturing.pdf Path: UAB >> CS >> 693 Fall, 2009 Description: h p f d f p t p s p h u6rfv s gp! qihp D eisf Godgf uisr e d qti g8d wb gqs isGqdt qhs gx s6gpcrf G p ipgr 6dAibqt g qpGd Dp \"fGs odgrf ux iseQ6xpqpqhhf}p is u\'s eCr gH6rfipe$gbgipgDsis pgseGxt evpd 6tpipr }pGuGipt ex Cut gpDsviss vb&... Date Added: 2009-06-11 20:16:07 |
| submit.txt Path: Washington >> V >> 12465 Fall, 2009 Description: executable = allgamma_12465.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-11 20:18:41 |
| error.txt Path: Washington >> V >> 12440 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Jan 31 17:55:22 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Jan 31 19:12:14 2008 ( 4612 s elapsed) ... Date Added: 2009-06-11 20:20:52 |
| submit.txt Path: Washington >> V >> 12233 Fall, 2009 Description: executable = allgamma_12233.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-11 20:21:31 |
| error.txt Path: Washington >> V >> 12347 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Jan 31 15:54:54 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Jan 31 17:04:27 2008 ( 4173 s elapsed) ... Date Added: 2009-06-11 20:22:23 |
| log.txt Path: Washington >> V >> 12068 Fall, 2009 Description: 000 (45568.000.000) 01/31 07:09:52 Job submitted from host: <128.95.94.28:1098> . 001 (45568.000.000) 01/31 07:12:58 Job executing on host: <172.25.101.183:1063> . 010 (45568.000.000) 01/31 07:21:52 Job was suspended. Number of processes actually su... Date Added: 2009-06-11 20:22:52 |
| Final7300 2005.doc Path: U. Memphis >> PUBLIC >> 7300 Fall, 2009 Description: Econ 7300 125 pts. 1. (20 pts, 5 pts each) Consider a market for used cars, with two brands of cars, Hudsons and DeSotos. There are two types of individuals: 1000 identical types S individuals who have reservation prices $5000 for a DeSoto and $8,000... Date Added: 2009-06-11 20:24:16 |
| Geog473Spring2008_Section01_Homework2_PartIII.doc Path: Maryland >> GEOG >> 473 Fall, 2008 Description: UMD Geog473 GIS and Spatial Analysis Homework 2 Part III Due: March 12, 2008 Section 0101, 0102 Instructor: Naijun Zhou TA: Jennifer Pomeroy Notes: Labs 2.1, 2.2 and 2.3 must be completed and saved in your class folder when the homework is turned i... Date Added: 2009-06-11 20:24:53 |
| e4124final09g.pdf Path: UNC Charlotte >> EEGR >> 4124 Fall, 2009 Description: ECGR4124 Digital Signal Processing Final Spring 2009 Name: _ LAST 4 NUMBERS of Student Number: _ Do NOT begin until told to do so Make sure that you have all pages before starting Open book, 2 sheet front/back notes, NO CALCULATOR, NO CELL PHONES... Date Added: 2009-06-11 20:25:24 |
| beerconsumer.ppt Path: SMU - Cox School of Business >> MKTG >> 6211 Fall, 2008 Description: The Beer Consumer Dallas/Ft Worth Anheuser-Busch, Inc. Retail Business Solutions May 2006 Beer is The Largest Alcohol Category in Supermarkets Share of Spending in Dallas/Ft Worth - FOOD Beer 58.6% Wine 41.4% Beer Is The Largest Alcohol Beverag... Date Added: 2009-06-11 20:25:32 |
| phys2212_exam3_sp09 solutions.pdf Path: St. Augustine NC >> PHYS >> 2212 Spring, 2009 Description: PHYS2212 SP 2009 1. An electron moves parallel to current 1.00m away from a long straight current carrying -19 wire (200.0A). The magnitude of the force on the charge at this time is 10 N. How fast is the charge moving? Dr. Colbert Exam 3 Magnetis... Date Added: 2009-06-11 20:26:07 |
| 2200_Spring_ 2009_ Syllabus.pdf Path: Weber >> TBE >> 2200 Fall, 2008 Description: TBE 2200 Microcomputer Operating Systems Spring 2009 Tuesday/Thursday, 10:00am Instructor: Ken Cuddeback Email: kcuddeback@weber.edu Web: http:/faculty.weber.edu/kcuddeback Text: Guide to Operating Systems, Enhanced Edition, Thomson: Course Technolo... Date Added: 2009-06-11 20:26:29 |
| Midterm.pdf Path: UMass Lowell >> FACULTY >> 491 Fall, 2009 Description: Math 491, Take-home Midterm (due October 28, 9:30 a.m.) Do all of the following problems: 1. (a) (20 points) For n 1, let an be the number of ways to put pennies on the cells of a 2-by-n rectangle (at most one penny per cell) so that no two pennies ... Date Added: 2009-06-11 20:27:22 |
| CIS100 Career Project-spring2006 GS.pdf Path: Spelman >> CIS >> 100 Fall, 2009 Description: CIS100: Career Project Web Page Evaluation Name: Date: On Content including reflections, your assessment will be based on the completeness of the work and the clarity of the writing. If you are missing components or it is not done thoroughly, then i... Date Added: 2009-06-11 20:27:45 |
| Bill Evans bio.doc Path: Belmont >> ETP >> 6500 Fall, 2009 Description: Bill Evans, Jr. \"The Pink Cup Guy\" Evans Glass Company A native Nashvillian, Bill is a graduate of Tennessee Technological University with a B.S. in Accounting. He formally entered the family business on D Day 1977 (6-6-77 for you history impaired p... Date Added: 2009-06-11 20:28:29 |
| Writing assignment 1 - US CA deficit.doc Path: Kentucky >> ECO >> 472 Fall, 2008 Description: ECO 472 Spring 2009 _ Writing Assignment 1 Name: Due Mon, Feb 23, in class. Read the following 2 articles and at least one more of your own choice. 1. Catherine Mann, \"Is the U.S. Current Account Deficit Sustainable?\" Finance and Developmen... Date Added: 2009-06-11 20:28:42 |
| Presentation_Schedule.pdf Path: Sveriges lantbruksuniversitet >> ENSC >> 803 Fall, 2009 Description: ENSC 803 Presentation Schedule Tuesday, July 07 Ahari Kaleibar, Aminreza Ashrafinia, Saeed Break Dai, Xiaochen Dalvandi, Arefe Tuesday, July 14 Tuesday, July 21 Haj Hashemi, Mohamadsadegh Sankaranarayanan, Ananth Narayan Hosseini, Ali Sun, Xiaochuan... Date Added: 2009-06-11 20:29:57 |
| Repro-Endo_09_16.ppt Path: Eckerd >> BI >> 101 Fall, 2009 Description: 21. Reproductive system Functions Produce and deliver gametes Provide nourishment for embryo(s) Provide environment for embryo(s) Produce hormones female yes male yes yes yes yes NO NO yes Differentiation of ducts in male and female mammals. L... Date Added: 2009-06-11 20:32:25 |
| index.txt Path: Berkeley >> ASTRO >> 00271019 Fall, 2009 Description: 1.9999999 3.7500000 0.87525019 5.0916936 1701.1331 3.7500000 6.0000000 6.7236400 0.77409119 393.90709 6.0000000 9.5000000 8.7242464 -0.32976546 5813.5983 ... Date Added: 2009-06-11 20:33:07 |
| ned.txt Path: Berkeley >> ASTRO >> 00271019 Fall, 2009 Description: <html><head> <title>Your NED Search Results</title> </head> <body background=\"/pics/NEDbgHelp.gif\" bgcolor=\"#FFFFFF\"> <center><font size=6 color=\"#CC3333\"><b>N</b></font><font size=4 color=\"#000000\"><b>ASA/IPAC</b></font><font size=6 color=\"#CC... Date Added: 2009-06-11 20:33:07 |
| MDTPPresentation2.ppt Path: Berkeley >> IS >> 213 Spring, 1999 Description: Medical Dictation & Transcription Project (MDTP) IS 213 May 9, 2002 Linda Duffy Sonia KlempererJohnson Carie Cazier System Overview Doctors dictate Transcriptionists type up the dictation Doctors sign the dictation Information is availabl... Date Added: 2009-06-11 20:33:52 |
| flood.rtf Path: Whitman >> HIST >> 327 Fall, 2009 Description: Flood Narratives why theFlood ? how did it flood? when did it flood? who survived? Atrahasis Gilgamesh (tablet XI) Genesis Apollodorus shared motifs 1. overpopulation 2. [end to eternallylong lifespans] result written author ... Date Added: 2009-06-11 20:34:39 |
| 1FJ4_avgMI_P.txt Path: UWO >> PFAM >> 00109 Fall, 2009 Description: 173 241 0.57786 0.41713 0.69086 0.30413 A E 0.115323820952381 0.30413 -1.69989243140265e-16 0.0264325632276436 4.36294505225182 0.105730252910574 241 173 0.41713 0.57786 0.69086 0.30413 E A 0.115323820952381 0.30413 -1.69989243140265e-16 0.0264325632... Date Added: 2009-06-11 20:35:59 |
| 487D.count.txt Path: UWO >> PFAM >> 00347 Fall, 2009 Description: pos A C D E F G H I K L M N P Q R S T V W Y entropy 83 0 0 1 1 22 0 2 12 4 1 0 4 0 5 0 2 4 19 0 1 0.678751145200954 84 0 0 0 0 0 48 0 0 0 0 0 0 29 0 1 0 0 0 0 0 0.241172405988454 85 1 0 2 4 0 0 0 19 1 4 6 0 0 1 0 1 1 38 0 0 0.523922531923493 86 0 ... Date Added: 2009-06-11 20:36:18 |
| 1K6D.count.txt Path: UWO >> COG >> 1788 Fall, 2009 Description: pos A C D E F G H I K L M N P Q R S T V W Y entropy 1 gapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgap 0 2 3 0 4 2 1 1 0 0 3 1 2 7 1 0 0 2 1 1 0 0 0.779666303896488 3 1 1 2 1 0 0 0 0 14 0 0 1 0 3 1 4 1 0 0 0 0.581027334359663 4 0 0 0 1 ... Date Added: 2009-06-11 20:39:01 |
| L3-SENG-321-K09-bw.pdf Path: Virgin Islands >> SENG >> 321 Fall, 2009 Description: 5/15/2009 Welcome to SENG 321 Requirements Engineering and Formal Specification Professor Hausi A. Mller, Ph.D., P.Eng. , , g Department of Computer Science Faculty of Engineering University of Victoria http:/www.engr.uvic.ca/~seng321/ Today ... Date Added: 2009-06-11 20:39:54 |
| recursion Path: ASU >> CS >> 205214 Spring, 2009 Description: Recursion We suppose that you have seen iterative methods in the prerequisite courses. Methods using a loop such as for loops, while loops, or do-while loops are considered to be iterative. Often we can compute the same result using recursion (withou... Date Added: 2009-06-11 20:41:56 |
| Lecture 05.ppt Path: Michigan State University >> ME >> 371 Fall, 2008 Description: ME 221 Statics Lecture #5 Sections 2.6 2.7 ME 221 Lecture 5 1 Announcements Quiz #1 - 15 minutes before the end of the lecture HW #2 due Wednesday 9/10 2.22, 2.23, 2.25, 2.27, 2.29, 2.32, 2.37, 2.45, 2.47 & 2.50 Exam # 1 will be on Wednesday ... Date Added: 2009-06-11 20:42:04 |
| 341-Spr00-p4_questions.txt Path: UMBC >> PROJ >> 341 Fall, 2009 Description: CMSC-341 Spring 2000 Project 4 * * * * YOUR NAME HERE: * * * * Please answer t... Date Added: 2009-06-11 20:47:29 |
| M&MCh04(04).pdf Path: Washington University in St. Louis >> MATH >> 109 Fall, 2008 Description: ... Date Added: 2009-06-11 20:48:18 |
| 0519-cware-ruthconviction.pdf Path: Virginia Tech >> USA >> 1923 Fall, 2009 Description: Chris Ware: The Conviction of Ruthenberg at St. Joseph [May 19, 1923] 1 The Conviction of Ruthenberg at St. Joseph. by C.S. Ware Published in The Worker [New York], v. 6, whole no. 275 (May 19, 1923), pp. 1-2. At 10 minutes of 8 on Wednesday eveni... Date Added: 2009-06-11 20:49:35 |
| Beth5.pdf Path: Oregon >> CPSY >> 642 Fall, 2008 Description: ... Date Added: 2009-06-11 20:50:16 |
| agenda_finance_111808.pdf Path: MSCD >> OSM >> 20082009 Fall, 2009 Description: FINANCE COMMITTEE TRUSTEES OF THE METROPOLITAN STATE COLLEGE OF DENVER Tuesday, November 18, 2008 8:00 a.m. 10:30 a.m. Administration Building, Room 575 Auraria Campus I. II. CALL TO ORDER APPROVAL OF MINUTES October 10, 2008 Finance Committee Min... Date Added: 2009-06-11 20:51:40 |
| UF6812_board_construction_V4_R15.pdf Path: UF >> HC >> 4744 Fall, 2009 Description: University of Florida Department of Electrical and Computer Engineering EEL 4744 Revision 15 Drs. Eric M. Schwartz & Karl Gugel 28-May-07 Page 1/9 OBJECTIVES Building a UF 68HC12 Board (Version 4) from a Development Board Kit In this document you... Date Added: 2009-06-11 20:52:15 |
| EM406Lab 3_2006.pdf Path: Rose-Hulman >> EM >> 406 Fall, 2009 Description: EM 406 Vibrations LAB 3: Experimental Determination of Frequency Response In this lab we will be experimentally determining the frequency response of a mass-springdamper system and then constructing a frequency response plot to visually convey this i... Date Added: 2009-06-11 20:53:21 |
| hw4.pdf Path: RIT >> CS >> 800 Fall, 2008 Description: Algorithms, Spring 2008-09, Homework 4 due Wednesday 1/8/09, 11:59pm For some of the problems you will need to use dynamic programming. In you pdf submission, describe the \"heart of the algorithm\" and estimate the running time of your implementation.... Date Added: 2009-06-11 20:54:14 |
| Distribution of the elements.doc Path: Minnesota >> GEOL >> 2311 Fall, 2009 Description: ABUNDANCE OF THE MORE COMMON ELEMENTS IN THE EARTH\'S CRUST (From Mason, 1958 and Dennen, 1959) ELEMENT Oxygen Silicon Aluminum Iron Calcium Sodium Potassium Magnesium Titanium Hydrogen Phosphorus Manganese Sulfur Carbon Chlorine Rubidium Fluorine St... Date Added: 2009-06-11 20:55:00 |
| exam1_a.s01.pdf Path: N. Illinois >> BIOS >> 106 Fall, 2008 Description: BIOS 106 (Section 2) Environmental Biology Exam 1 - Form A - 2/09/01 Spring 2001 von Ende MARK THE FORM (A or B) OF YOUR TEST ON THE ANSWER SHEET. SELECT THE BEST ANSWER FOR EACH QUESTION. Questions 1 thru 21 are Multiple Choice. Questions 22 thru... Date Added: 2009-06-11 20:55:30 |
| midterm_f2002.pdf Path: Stanford >> ECON >> 157 Fall, 2009 Description: Economics 157 Midterm Exam Fall 2002 Professor Susan Athey Instructions This is a closed book exam. You may use a calculator for calculations, but you may not use a personal digital assistant to access any functions except for calculation. You shoul... Date Added: 2009-06-11 20:56:33 |
| LN_chemical_rxns.pdf Path: Ill. Chicago >> CHEM >> 112 Fall, 2008 Description: AQUEOUS RXNS & SOL\'N STOICHIOMETRY Solutions in which water is the dissolving medium (solvent) are called aqueous solutions. Properties of Aqueous Solutions Electrolytic Properties Ionic Compounds in Water Molecular Substances in Water Strong and... Date Added: 2009-06-11 20:56:59 |
| lab05.pdf Path: Valparaiso >> ECE >> 315 Fall, 2009 Description: ECE 315 Electrical and Computer Junior Lab Laboratory #5: HTML Forms and Image Maps SECTION I. Introduction In this lab, we will examine two features very powerful in communicating information via the WWW: image maps, which allow you to route a user ... Date Added: 2009-06-11 20:58:01 |
| Arya2002.pdf Path: Ohio State >> AMISH >> 520 Fall, 2009 Description: The European Accounting Review 2002, 11:4, 681-697 Depreciation in a model of probabilistic investment Anil Arya, John Fellingham and Doug Schroeder Ohio State University Jonathan Glover Carnegie-Mellon University Manuseript first reeeived: January ... Date Added: 2009-06-11 20:58:54 |
| Lecture 13 insulin glucose drawing F2007.ppt Path: UMass (Amherst) >> KIN >> 110 Fall, 2008 Description: Uptake of CHO by muscle glucose FFA insulin islet cells (in the pancreas) produce insulin MUSCLE Lecture 13 Kinesiology 110 Braun 1 ... Date Added: 2009-06-11 21:00:38 |
| Homework 2.doc Path: UCCS >> ECE >> 4480 Fall, 2009 Description: Homework 2 due: Feb 26 ECE4480 students do problems 1, 2,3,4. ECE5480 students do all problems. 1. Write a Verilog model to implement Booth\'s algorithm and a test program to test the Booth\'s algorithm. Turn in your Verilog code, the test ... Date Added: 2009-06-11 21:00:42 |
| BazalRestaurant.doc Path: Creighton >> FIN >> 402 Fall, 2009 Description: The Intricacies of The Restaurant Industry Bridget Bazal December 11, 2002 Dr. Gasper FIN 402 Table of Contents An Overview Professional Organizations and Publications Industry Trends: Part I Industry Trends: Part II What It Takes Bringing In More ... Date Added: 2009-06-11 21:00:44 |
| ps10.ps Path: NMT >> PH >> 340 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: ps10.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips ps10 %DVIPSParameters: dpi=300, ... Date Added: 2009-06-11 21:02:30 |
| finalproj98.ps Path: Oakland University >> CHEG >> 258 Fall, 2009 Description: %!PSAdobe2.0 %Title: cheg258 final project \'98 %Creator: PrintMonitor %CreationDate: Wednesday, April 29, 1998 %Pages: (atend) %BoundingBox: ? ? ? ? %PageBoundingBox: 30 31 582 761 %For: Leighton %DocumentProcSets: \"(AppleDict md)\" 71 0 % Copyright ... Date Added: 2009-06-11 21:02:58 |
| Chap15.ppt Path: Kentucky >> FIN >> 300 Fall, 2008 Description: Raising Capital Chapter 15 FIN 300 Fall 2005 McGrawHill Key Concepts and Skills Understand the venture capital market and its role in financing new businesses Understand how securities are sold to the public and the role of investment bankers Un... Date Added: 2009-06-11 21:04:48 |
| EqSheet.pdf Path: RIT >> SPSP >> 313 Fall, 2009 Description: Lindberg e = 1.609 x 10-19 C SPSP 313 Exam 3 k= Remove from exam and discard at end ! 0 = 8.85 \" 10 #12 C2 N $ m2 T $m A 1 N # m2 = 8.99 \" 10 9 4! ! o C2 me = 9.11 x 10-31 kg mp = 1.67 x 10-27 kg g = 9.8 N/kg 0 = 4! \" 10 #7 ! kq q ^ F = 12 2 ... Date Added: 2009-06-11 21:08:21 |
| Reaction 1.doc Path: Uni. Westminster >> JET >> 0616 Fall, 2009 Description: James Thompson Experiencing the Arts 3/25/07 The House of Bernarda Alba Going to see a play on a Friday night probably isn\'t a major priority for most college students. But I did it. I arrived about five minutes late to the play, which in a way playe... Date Added: 2009-06-11 21:09:55 |
| 25FCS157AL3.ppt Path: San Jose State >> CS >> 157 Fall, 2009 Description: The E-R Model Prof. Sin-Min Lee Department of Computer Science 11 12 13 14 E-R Model The E-R model is not intended to be associated with any particular database model. E-R diagrams are intended to allow humans the ability to capture more of ... Date Added: 2009-06-11 21:09:59 |
| S_hoo-stw_1446.pdf Path: Hamline >> SAVE >> 110207 Fall, 2009 Description: HOO, KENT Stephen and Richard Charlis M.S. IV London: \"B\" series1 St. Werburgh S hoo-stw 1446 The effigies of Stephen and Richard Charlis, both in civilian dress, 1446. Foot inscription in Latin. Shield lost. On the floor of the nave. The identica... Date Added: 2009-06-11 21:11:07 |
| S3apps.ps Path: Princeton >> CS >> 126 Fall, 2008 Description: %!PS-Adobe-3.0 %IncludeResource: font fat /rightmargin 576 def /leftmargin 72 def /indentamount 27 def /lecture 0 def /unit () def /line {/lineno lineno 1 add def lineno 1 sub lines exch sub lineskip mul leftmargin exch moveto show } def /indentedlin... Date Added: 2009-06-11 21:12:03 |
| problem-set-08.pdf Path: UPenn >> STAT >> 431 Fall, 2008 Description: Statistics 431: Statistical Inference Fall 2006 Problem Set 8 Devore Chapter 13: #40, 44, 46, 48, 72, 74, 76, 80. Due 20 Nov 2006 1 ... Date Added: 2009-06-11 21:12:51 |
| P2_ColorRules7-8.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: Rules for coloring your comps: No Black allowed! You could have a really dark color but not pure black. You can only have one background color for the entire composition Use only one color for each rotation (total of 4) All the shapes within each rot... Date Added: 2009-06-11 21:14:59 |
| pins.ps Path: Acton School of Business >> ABCPU >> 422 Fall, 2009 Description: %!PSAdobe2.0 %Title: Pins (DR) %Creator: PrintMonitor %CreationDate: Thursday, December 19, 1996 %Pages: (atend) %BoundingBox: ? ? ? ? %PageBoundingBox: 29 30 582 761 %For: Scot %DocumentProcSets: \"(AppleDict md)\" 71 0 % Copyright Apple Computer, In... Date Added: 2009-06-11 21:16:44 |
| XOR_sim.ps Path: Acton School of Business >> ECE >> 422 Fall, 1997 Description: %! /MSAVE { /mStat save def } def /MRESTORE { mStat restore } def /SET { exch def } def /SF { /wi SET theFont [wi 0 0 FSIZE 0 0] makefont setfont } def /L { newpath moveto lineto stroke } def /VL { 2 index exch L } def /HL { 1 index L } def /BOX { /@... Date Added: 2009-06-11 21:16:46 |
| PreludeT1_userguide.pdf Path: University of Hawaii - Hilo >> C >> 231 Fall, 2009 Description: Prelude T1 DSU/CSU User\'s Guide DL080 098-01900-01 Rev E December 1997 Copyright Copyright 1997, Digital Link Corporation World copyright reserved. No part of this publication may be stored in a retrieval system, transmitted, or reproduced in any ... Date Added: 2009-06-11 21:18:03 |
| chapter08.ppt Path: University of Hawaii - Hilo >> C >> 231 Fall, 2009 Description: A+ Guide to Managing and Maintaining Your PC Fifth Edition Chapter 8 Understanding and Installing Hard Drives You Will Learn. About hard drive technologies How a computer communicates with hard drive firmware How a hard drive is logically orga... Date Added: 2009-06-11 21:18:04 |
| hw3.pdf Path: Stanford >> MA >> 9003 Fall, 2009 Description: THINKING THE CALCULUS WAY HOMEWORK 3 For FRIDAY, July 2: Read \"A Preview of Calculus\", pages 2-9, in Stewart\'s Calculus. Section 2.1: 2, 7(a)(c). Section 2.2: 2, 4, 8, 14, 24, 25, 32(a), 38. Section 2.3: 1, 2, 3, 4, 9, 10, 11, 12, 17, 22, 25. ... Date Added: 2009-06-11 21:18:56 |
| temp.txt Path: Brandeis >> HW >> 622 Fall, 2009 Description: import java.io.BufferedReader; import java.io.InputStreamReader; /* Problem 3: Checking for Simple Arithmetic Syntax Now modify the program you just wrote so that it checks to see whether the input is a simple arithmetic expression consist... Date Added: 2009-06-11 21:19:34 |
| 13-oct8.ps Path: ASU >> CSE >> 571 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: 13-oct8.dvi %CreationDate: Mon Dec 01 10:22:49 2003 %Pages: 7 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMCSC10 CMR17 CMTI1... Date Added: 2009-06-11 21:19:56 |
| Quiz 2.doc Path: VCU >> CMSC >> 245 Fall, 2008 Description: Quiz 2.2 keys 3 double, float , long double 4 constant declaration 5 0123, 123 false, octal number, decimal number, hex number 0x22= 2*16 +2=34 pg37 6 0xFA 10 true , 0,1, 2 .A, B C D E F 7 skip 8 `\' 9 \'1/n\' false 10 `\ \' a char 11 `\ \' `\\\' escape seq... Date Added: 2009-06-11 21:20:38 |
| Assignment16_solution.doc Path: Texas A&M >> CVEN >> 302 Fall, 2008 Description: Homework Assignment 16 Solution Set Problem 1 Problem 11.1 X 0.800 0.900 1.000 1.100 1.200 Y 0.992 0.999 1.000 1.001 1.008 Forward Difference yi+1 - yi x 0.1 0.001 0.2 0.008 Backward Difference x 0.1 0.2 Richardson Extrapolation Central Difference x... Date Added: 2009-06-11 21:20:42 |
| PPCh01.pdf Path: University of Hawaii - Hilo >> ECON >> 340 Summer, 2008 Description: Why Study Financial Markets? 1. Channels funds from savers to investors, thereby promoting economic efficiency 2. Affects personal wealth and behavior of business firms Chapter One Why Study Financial Markets and Institutions? Slide 12 Types of Fi... Date Added: 2009-06-11 21:20:49 |
| extra.txt Path: Michigan >> CSC >> 392 Fall, 2009 Description: For more information, look at these files and these directories: Some host and DNS information: - /etc/hosts Maps IP address to domain name. This is where you\'d add new machine name aliases that are published \"to the external world\". (Note: I... Date Added: 2009-06-11 21:21:44 |
| 02_Assignment_1_Intro_Spring05.pdf Path: Laurentian >> PHIL >> 200501 Fall, 2009 Description: University of Lethbridge - Department of Philosophy Philosophy 1000B: Introduction to Philosophy Spring 2005 Assignment 1 This assignment is based on two readings from Kessler\'s Voices of Wisdom (5th edition): \"Crito,\" by Plato (pp. 166172), and \"Le... Date Added: 2009-06-11 21:22:12 |
| IST220_Fall07_WAN_Technologies_Routing.ppt Path: Penn State >> IST >> 220 Fall, 2008 Description: IST220 Networking and Telecommunications Chapter 13: WAN Technologies and Routing LOGO Fall 2007 Angsana A. Techatassanasoontorn Company Example of WAN Technology ARPANET Precursor of the Internet One of the first packet switched networks X.... Date Added: 2009-06-11 21:22:22 |
| David Wiseman - Thesis Proposal - Spring 2009.pdf Path: Boston Architectural >> TS >> 7505 Fall, 2009 Description: BOSTON ARCHITECTURAL COLLEGE THESIS PROPOSAL THE STUDY OF SPATIAL, AXIAL, AND STRUCTURAL CONNECTIONS IN AN INTERMODAL TRANSPORTATION STATION IN UNION SQUARE - SOMERVILLE, MASSACHUSETTS DATE OF PROPOSAL: THESIS SEMINAR CLASS : THESIS I: THESIS DOCUM... Date Added: 2009-06-11 21:22:23 |
| SID_LCO_F06a_T16_V1.0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Supporting Information Document (SID) USC CONIPMO TEAM No. 16 Kumar Yalla Project Manager & Software Architect Gaurav Batra OCD Jenish Jariwala Prototyper Shivam Gupta Requirement Analyst Rashmi Shukla FRD Vinita Goyal Life Cycle Planner Davi... Date Added: 2009-06-11 21:22:46 |
| IP_RLCA_S07b_T16_V2.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Team 16 Iteration Plan Version 2.0 Iteration Plan (IP) USC CONIPMO Team 16 Kumar Yalla Hung-Fu Chang Mayank Advani Alexander (Prince) Mathew Vinita Goyal David Davidson Project Manager/SSAD/FRD SSRD/Prototype Coder SIP/OCD LCP IV & V IP_RLCA_S0... Date Added: 2009-06-11 21:23:00 |
| gcnR_flux_ul.txt Path: Berkeley >> ASTRO >> 00163170 Fall, 2009 Description: 50.112 2.938669e-04 5.413229e-05 none yes 50.112 8.874639e-04 1.634769e-04 none yes 56.16 7.381604e-04 1.359742e-04 R yes 132.192 5.106822e-04 9.407114e-05 ... Date Added: 2009-06-11 21:24:15 |
| solution #9.doc Path: Washington >> CHE >> 260 Fall, 2009 Description: Chem E 260 HW #9 C&B: 9.91, 9.94, 9.102E , 9.103 and 10.15E, 10.17, 10.23 ,10.34 9-91 A simple Brayton cycle with air as the working fluid has a pressure ratio of 8. The air temperature at the turbine exit, the net work output, and the thermal effic... Date Added: 2009-06-11 21:24:28 |
| 7-19sol.ps Path: Kentucky >> MA >> 114 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: 7-19sol.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips 7-19sol %DVIPSParameters: dpi=300, comments removed %DVIP... Date Added: 2009-06-11 21:25:16 |
| exp12-16.xls Path: Purdue >> STAT >> 511 Fall, 2008 Description: x 0.07 0.09 0.12 0.05 0.16 0.19 0.06 0.1 0.11 0.06 0.15 0.07 0.11 0.14 0.07 0.11 y 4.60 11.60 9.50 6.30 13.80 15.40 2.50 11.80 8.00 7.00 20.60 16.60 9.20 17.90 2.80 13.00 ... Date Added: 2009-06-11 21:26:10 |
| exp13-01.xls Path: Purdue >> STAT >> 511 Fall, 2008 Description: xi 100 125 125 150 150 200 200 250 250 300 300 350 400 400 yi 150 140 180 210 190 320 280 400 430 440 390 600 610 670 ... Date Added: 2009-06-11 21:26:17 |
| SE-280-06-1-multiple regression.pptx Path: MSOE >> SE >> 280 Fall, 2009 Description: Multiple Regression Calculations Click to edit Master subtitle style We have already discussed the concept of using multiple regression when we have more than one independent variable. y proj = 0 + 1 xest1 + 2 xest2 + + m xestm n = # of previo... Date Added: 2009-06-11 21:27:33 |
| water.xls Path: UNC >> DAY >> 461 Spring, 2009 Description: cost cost Jan. 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 30.04 27.48 29.08 25.70 25.70 43.06 14.57 Feb. 34.06 27.48 17.80 21.90 18.10 26.78 43.06 41.50 51.19 51.19 47.96 56.59 46.31 52.88 65.62 58.61 Mar. 42.10 2... Date Added: 2009-06-11 21:28:02 |
| 2004-I-1A.pdf Path: East Los Angeles College >> PV >> 226 Fall, 2009 Description: ... Date Added: 2009-06-11 21:28:14 |
| hw1sol.doc Path: Idaho >> HW >> 251 Fall, 2009 Description: A Solution Key for Homework 1 John Verzani: simpleR Using R for Introductory Statistics Problems 2.1 to 2.6 (p.78) 2.1 > miles = c(65311, 65624, 65908, 66219, 66499, 66821, 67145, 67447) > diff(miles) [1] 313 284 311 280 322 324 302 x=c(313, 284,... Date Added: 2009-06-11 21:29:40 |
| hw4_sol.pdf Path: JMU >> MATH >> 248 Spring, 2008 Description: Math 248 Computers and Numerical AlgorithmsPruett EXTRA HW ASSIGNMENT 4 (Not to be collected) Solutions to Selected Problems 1. Interpolation Error (Notes: Chapter 7) Suppose you want to interpolate sin(x) to 4-decimal-place accuracy on [0, /2] using... Date Added: 2009-06-11 21:29:56 |
| lab4_skewt_solution.pdf Path: Colorado State >> AT >> 351 Fall, 2008 Description: ... Date Added: 2009-06-11 21:30:00 |
| BestApproximation501Homework-1.pdf Path: Cal Poly >> MATH >> 501 Fall, 2008 Description: Exercises for Best Approximation The Best Approximation has the interpretation of the Projection of a vector(function) onto a set of vectors(functions). When we learned the dot product in Calculus 3 (Math 143) we learned that the dot product had two ... Date Added: 2009-06-11 21:30:39 |
| cs2200pres07_Pipelining.ppt Path: Georgia Tech >> CS >> 2200 Fall, 2008 Description: CS 2200 Presentation 7 Pipelining Concluded Pipeline M X 1 P C ADD ADD BEQ I nstr M em DPRF SE A M X ALU D Data M em M X IF ID EX MEM WB Scenario We have the following code segment: lw R6, X(R0) beq R1, R2, SKIP add R1, R2, R3 SKIP: ... Date Added: 2009-06-11 21:31:37 |
| ho13.ps Path: Yale >> CS >> 223 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: ho13.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Helvetica Times-Roman Times-Bold Times-Italic Courier %DocumentPaperSizes: Letter %End... Date Added: 2009-06-11 21:33:16 |
| Exam III_\'05.pdf Path: North Texas >> CH >> 4610 Fall, 2009 Description: Exam III, Chemistry 4610/5560, Fall 2005 Department of Chemistry, University of North Texas, Dr. Mohammad Omary Student name: p. 1 of 3 1. Fill the following table, which analyzes d-d (ligand-field) transitions in five complexes; refer to the appro... Date Added: 2009-06-11 21:34:43 |
| Lec18StringStreams.ppt Path: Michigan >> EECS >> 498 Fall, 2008 Description: M The University Of Michigan EECS498-006 Lecture 18 Andrew M. Morgan Savitch N/A String Streams M Recall Stream Definition EECS 498 A general definition of a stream A sequence of bytes, interpreted in groups of appropriate size, that can be ... Date Added: 2009-06-11 21:35:06 |
| 04102604.pdf Path: Wisconsin >> SH >> 041026 Fall, 2009 Description: ... Date Added: 2009-06-11 21:35:19 |
| selfs.ps Path: Texas >> CS >> 380 Fall, 2008 Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - Self %Creator: Pscript.dll Version 5.0 %CreationDate: 12/6/2001 9:37:2 %For: Lorenzo Alvisi %BoundingBox: (atend) %Pages: (atend) %Orientation: Portrait %PageOrder: Special %DocumentNeededResources: (aten... Date Added: 2009-06-11 21:35:36 |
| RJP-123.pdf Path: TCNJ >> PHY >> 466 Spring, 2008 Description: ... Date Added: 2009-06-11 21:36:13 |
| hw2s00.ps Path: Wisconsin >> ECE >> 352 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.72 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: hw2s00.dvi %CreationDate: Sat Feb 12 09:48:57 2000 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: /afs/engr.w... Date Added: 2009-06-11 21:36:30 |
| Loweenstein NYT on Soc Sec.doc Path: Maryland >> PUAF >> 734 Fall, 2008 Description: January 16, 2005 A Question of Numbers By ROGER LOWENSTEIN HE CONSERVATIVE NEW DEAL In 1938, the Social Security Act was only three years old, but its future was already very much in doubt. Conservatives claimed it would bankrupt the nation, and in... Date Added: 2009-06-11 21:37:02 |
| Resume-Tim Giles.doc Path: Penn State >> TDG >> 5014 Fall, 2009 Description: Timothy D. Giles Chemical Engineer Permanent Address 1214 Waterford Road West Chester, PA 19380 16802 610-692-1935 Local Address 504 Stuart Hall University Park, PA 610-416-9883 tdg5014@psu.edu Objective To secure a serious job and eventual career u... Date Added: 2009-06-11 21:37:23 |
| weibull.xls Path: Oregon >> PUB >> 355 Fall, 2009 Description: / 1.8 1 4.45 8.00 8.71 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 3 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 4 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 5 5.1 0.00 0.28 0.47 0.61 0.71 0.78 0... Date Added: 2009-06-11 21:38:14 |
| Ceva.pdf Path: Paul Quinn >> MATH >> 518 Fall, 2009 Description: Practice problems on transformations. Problem 1 State and prove Ceva\'s Theorem. Problem 2 Suppose that a triangle ABC has three concurrent Cevians AD, BE, and CF and that X, Y , and Z are points on the sides BC, CA, and AB such that D, E, F , X, Y ,... Date Added: 2009-06-11 21:38:18 |
| IIE336-21.ppt Path: Princeton >> IIE >> 337 Fall, 2009 Description: Introduction to American Politics Lecture #21 Courts Should Not Make Policy Judges are not elected Policy amateurs in most areas Must focus on cases, not policy Court is reactive The cases are not representative Court has limited reme... Date Added: 2009-06-11 21:38:21 |
| PSY436childhoodDo.ppt Path: CSU San Marcos >> PSY >> 436 Fall, 2009 Description: Disorders in Childhood and Adolescence PSY 436 Instructor: Emily E. Bullock, Ph.D. Disorders in Childhood and Adolescence The Statistics Risk Factors Genetic Susceptibility Environmental Stressors Family Factors Males at greater risk in chi... Date Added: 2009-06-11 21:39:30 |
| 103S04 final.pdf Path: UPenn >> M >> 103 Fall, 2009 Description: Math 103 - Final Exam. NAME: Remember to write all your final answers on the answer sheet. 1. Which of the followingis true for ALL real numbers a, b, and e? (A) If a :Sb, then ae :S be. (B) If a < b < 0, then 1/a < I/b < O. (C) 1- al = a. (D) la... Date Added: 2009-06-11 21:39:48 |
| ch02_ppt_3up.pdf Path: UMBC >> C >> 156 Fall, 2009 Description: 1 Technology in Action Chapter 2 Looking at Computers: Understanding the Parts 2 Chapter Topics Functions of a computer Data versus information Bits and bytes Input devices Output devices System unit Ergonomics 3 Computers Are Data Process... Date Added: 2009-06-11 21:41:26 |
| Thon 2008.rtf Path: Penn State >> RMG >> 235 Fall, 2009 Description: Thon 2008: The Success of the Teamwork By Riccardo M. Ghia COMM 260 W Feb.27, 2008 Professor John A. Dillon Grade: A STATE COLLEGE, Pa. The floodlights of the Bryce Jordan Center shone last Friday on a sea of cheering people eager to wipe off the ... Date Added: 2009-06-11 21:42:37 |
| n270.ps Path: Arizona >> Q >> 0424 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:09:38 2001 %DocumentData: Clean... Date Added: 2009-06-11 21:42:46 |
| 13-VirtualMemory.4p.ps Path: UCSC >> CMPE >> 110 Winter, 2008 Description: %!PS-Adobe-2.0 %DocumentFonts: Helvetica Helvetica-Bold Courier Courier-Bold %Title: stdin %Creator: psnup, Copyright (C) 1994 M. Herbert <rxkmh@minyos.xx.rmit.oz.au> %Revision: $Header: psnup.pro,v 2.2 94/06/14 14:39:29 rxkmh Locked 0%CreationDate: ... Date Added: 2009-06-11 21:43:28 |
| Reli207.o26THE SHARI`AH.ppt Path: UVA >> RELI >> 207 Fall, 2008 Description: THE SHARI`AH THE TRIUMPH OF THE PIETYMINDED MUSLIMS PERSONAL AND SOCIAL LIFE CODE The Jewish Example: equality of all Jews through explicit religious legislation Rejection of monastic model in which godly life was seen in world-denying philosophy ... Date Added: 2009-06-11 21:43:35 |
| Test1pS.pdf Path: Utah >> MATH >> 0501 Fall, 2009 Description: Math 3210: Preparation for Test # 1 Solutions to the SAMPLE PROBLEMS Note: I have actually decided to write the complete solution of each problem. (1) Use the Principle of Mathematical Induction to prove that, for all n N, 1 + 3 + 5 + + (2n - 1) ... Date Added: 2009-06-11 21:44:57 |
| worksheet.txt Path: Washington >> SIMUW >> 550 Fall, 2009 Description: Day 1 WS 2 - Stock Market and Sage system:sage <font color=\"purple\"><h1>Introduction to Sage</h1></font> <ol> <li> Sage is free open source mathematical software (show web page). <li> There are about 100 developers (show developer map). <li> You ca... Date Added: 2009-06-11 21:45:46 |
| 11_491_F04.ppt Path: Lafayette >> ECE >> 491 Fall, 2009 Description: ECE 491 - Senior Design I Lecture 11 - Verilog (again), Timing, Synchrnization Fall 2004 Prof. John Nestor ECE Department Lafayette College Easton, Pennsylvania 18042 nestorj@lafayette.edu Where we are Last Time: More about Serial Communication C... Date Added: 2009-06-11 21:46:15 |
| Varias definiciones.doc Path: Pontifical Catholic >> EDUCACION >> 430 Fall, 2009 Description: DEFIN IC IO NES CIENCIA (O EPISTME) C ONOCIM IE N TO PERFECTO , REFERIDO AL M UNDO DE LAS I DEAS , CONSECUENC IA DEL EJERCICIO DE LA RAZN . Platn distingue dos gneros fundamentales de conocimiento: la ciencia (epistme) y la Opinin. A su vez, el... Date Added: 2009-06-11 21:46:24 |
| prontuario737.pdf Path: Pontifical Catholic >> CURSO >> 737 Fall, 2009 Description: PONTIFICIA UNIVERSIDAD CATLICA DE PUERTO RICO COLEGIO DE EDUCACIN ESCUELA GRADUADA MISIN Integrar una comunidad viva, acadmica y de servicio, consagrada a la bsqueda de la verdad y al estmulo de la ms plena realizacin del ser humano en todas sus dim... Date Added: 2009-06-11 21:46:24 |
| Day 9b.ppt Path: Colorado College >> EC >> 303 Fall, 2009 Description: Econometric Problems Econometric problems, detection & fixes? Hands on problems 1 Regression Diagnostics The required conditions for the model assessment to apply must be checked. Is the error variance constant? Are the errors independent? Is... Date Added: 2009-06-11 21:47:06 |
| Lesson14.doc Path: St. Bonaventure >> CS >> 256 Fall, 2009 Description: CS 256 Fall, 2008 Lesson 14 Virtual Camera and Viewing-Projection Transformations The Virtual Camera and the Coordinate System for 3D Viewing The Eye Point that is, the location of the camera and the origin of the coordinate system The Point... Date Added: 2009-06-11 21:48:16 |
| lec076.pdf Path: Arkansas Little Rock >> CS >> 115 Fall, 2009 Description: Revised 27/07/03 2 About This Lecture Self-Reference - Recursion Cmput 115 - Lecture 7 Department of Computing Science University of Alberta Duane Szafron 1999 Some code in this lecture is based on code from the book: Java Structures by Duane A. Ba... Date Added: 2009-06-11 21:48:23 |
| lec18.pdf Path: Arkansas Little Rock >> CS >> 115 Fall, 2009 Description: Revised 21-Mar-05 2 About This Lecture Trees CMPUT 115 - Lecture 18 Department of Computing Science University of Alberta Duane Szafron 2003 Some code in this lecture is based on code from the book: Java Structures by Duane A. Bailey or the compani... Date Added: 2009-06-11 21:48:25 |
| GPS-GSM_mobile_navigator.pptx Path: UNC Charlotte >> ECGR >> 6185 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|16 Mar 2009 02:15:30 -0000 vti_extenderversion:SR|12.0.0.4518 vti_cacheddtm:TX|16 Mar 2009 02:15:30 -0000 vti_filesize:IR|464213 vti_backlinkinfo:VX| ... Date Added: 2009-06-11 21:48:57 |
| log.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: 000 (59458.000.000) 02/13 11:17:38 Job submitted from host: <128.95.94.28:1092> . 009 (59458.000.000) 02/13 11:32:23 Job was aborted by the user. via condor_rm (by user burnett) . 000 (59658.000.000) 02/13 11:50:27 Job submitted from host: <128.95.9... Date Added: 2009-06-11 21:49:04 |
| error.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 13 18:00:33 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 13 19:16:46 2008 ( 4573 s elapsed) ... Date Added: 2009-06-11 21:49:32 |
| output.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-C1WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2264 02/13/2008 01:21 PM <DIR> . 02/13/2008 01:21 ... Date Added: 2009-06-11 21:49:48 |
| log.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: 000 (59320.000.000) 02/13 11:17:10 Job submitted from host: <128.95.94.28:1092> . 001 (59320.000.000) 02/13 11:18:57 Job executing on host: <172.25.101.182:1055> . 004 (59320.000.000) 02/13 11:32:29 Job was evicted. (0) Job was not checkpointed. U... Date Added: 2009-06-11 21:50:11 |
| submit.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: executable = pass6_60085.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs60000-60199/60085... Date Added: 2009-06-11 21:51:13 |
| writ1.pdf Path: Wesleyan >> DKRIZANC >> 212 Fall, 2009 Description: er sae e b Vqr ieq !s!BqctXw9cpXiXV!th!pg f9y#wXiXlycd!fbcchhfe#pXgg9c9h`ty!yh9yXc9ca V b v d V e sb q e g V Y e b p e Ye p b ie b p e vb a v b q ei qr e e d V v b i ae pa b eiae xea V v Y e s b Y b y!9cr!trycW`vXp#ycItht9!rt!tcX... Date Added: 2009-06-11 21:52:43 |
| Lecture9_added_interaction.pdf Path: Alabama >> EC >> 671 Fall, 2008 Description: ... Date Added: 2009-06-11 21:52:55 |
| cs422-FinalReview.ppt Path: MSOE >> CS >> 4220 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|02 Jul 2007 15:52:15 -0000 vti_extenderversion:SR|6.0.2.8161 vti_title:SR|CS422 Lecture vti_assignedto:SR| vti_approvallevel:SR| vti_modifiedby:SR|MSOE\\hornick vti_nexttolasttimemodified:TR|28 Feb 2007 ... Date Added: 2009-06-11 21:54:12 |
| CK_ADC_plot.pdf Path: Penn State >> CREAM >> 20081219 Fall, 2009 Description: CVD Tube 0 CVD Tube 1 CVD Tube 2 CVD Tube 3 10 3 10 3 10 10 3 3 10 2 10 2 10 2 10 2 10 10 10 10 1 1 1 1 500 1000 1500 2000 2500 3000 3500 4000 500 1000 1500 2000 2500 3000 3500 4000 500 1000 1500 2000 2500 3000 3500 4000 500 ... Date Added: 2009-06-11 21:54:52 |
| eng241-lab3-F00.ps Path: W. Alabama >> ENG >> 241 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.58 Copyright 1986, 1994 Radical Eye Software %Title: eng241-lab3-F00.dvi %CreationDate: Thu Jan 18 20:03:35 2001 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: /software/dvips-5... Date Added: 2009-06-11 21:55:34 |
| f90pro.pdf Path: East Los Angeles College >> PX >> 250 Fall, 2009 Description: PX250 Fortran Programming for Scientists 2002 1 PX250 Fortran Programming for Scientists 2002 With this document are 3 projects of which you must do 1. Read them all and do not assume that the one with the shortest text is the easiest! You should s... Date Added: 2009-06-11 21:56:52 |
| a.judis.howdemswon.nr.112006.doc Path: Los Angeles Southwest College >> POLI >> 740 Fall, 2009 Description: HOW THE DEMS WON. Blue\'s Clues by John B. Judis Post date: 11.09.06 Issue date: 11.20.06 t\'s about time. After a series of frustrating election nights for Democrats, dating back to the Florida boondoggle in 2000, this year\'s election is a clear triu... Date Added: 2009-06-11 21:57:40 |
| a.steger.seattle.future.pdf Path: Los Angeles Southwest College >> POLI >> 101 Fall, 2009 Description: ... Date Added: 2009-06-11 21:57:47 |
| MS-party.pdf Path: Harvard >> CSCIE >> 153 Fall, 2009 Description: United States 109th Congress, Page 1 of 1 United States 109th Congress Mississippi Democrat Official Name Taylor, Gene Thompson, Bennie G. State Mississippi Mississippi Republican Official Name Pickering, Charles W. `Chip\' Wicker, Roger F. State Mis... Date Added: 2009-06-11 21:59:17 |
| 09a_item_10_1of1.pdf Path: UNF >> EPC >> 031208 Fall, 2009 Description: Dr. Jeffrey Cornett Chair and Professor Department of Foundations and Secondary Education It is the recommendation of the Chair and Faculty of the Department of Foundations and Secondary Education, the Dean of the College of Education and Human Servi... Date Added: 2009-06-11 21:59:31 |
| Test2_p2.pdf Path: Cal Poly >> AERO >> 301 Spring, 2008 Description: ... Date Added: 2009-06-11 22:00:39 |
| Session35_4.doc Path: UNC >> EC >> 434 Fall, 2009 Description: Class Exercise: Is the government too big, too little or just right? Write too big too little or just right and what areas you think are necessary. Discussion: Too big cannot be efficient, no incentive to perform efficiently. 23% of current GDP is g... Date Added: 2009-06-11 22:01:40 |
| Mechanical Structures.pdf Path: UCLA >> EE >> 250 Fall, 2008 Description: EE M250B/MAE M282/BME M250B Structures, Beams Chapter 9 of Senturia Roark\'s Formulas for Stress and Strain, 6th ed. Warren C. Young, McGraw Hill M. C. Wu 1 EE M250B/MAE M282/BME M250B MEMS Structures Beams Cantilevers Membranes Plates Surf... Date Added: 2009-06-11 22:03:01 |
| lecture 28-29 reconstructing phylogenies.pdf Path: Utah State >> BIOL >> 5250 Fall, 2008 Description: SYSTEMATICS Systematics seeks to: (1) catalogue and name the diversity of life, (2) to discover the phylogenetic relationships among species, and (3) to classify species into more inclusive groups. Systematics establishes the genealogical relationshi... Date Added: 2009-06-11 22:03:23 |
| Lab5.Hydraulic_Conductivity.pdf Path: FIU >> JSTIE >> 001 Fall, 2009 Description: EVR 4211L WATER RESOURCES LAB Laboratory 5 Title: Hydraulic Conductivity Objectives: Students will familiarize themselves with the fundamental components of groundwater movement. Students will investigate the concept of hydraulic conductivity in dep... Date Added: 2009-06-11 22:04:43 |
| CrashingConstructionofaHouse.xls Path: UMass (Amherst) >> CC >> 252 Fall, 2009 Description: Crashing Construction of a House Maximum Crash Cost Time per Week Crash Reduction Saved $5,000.00 5 $400.00 $3,500.00 3 $500.00 $7,000.00 1 $3,000.00 $0 $71,000.00 3 $7,000.00 $1,100.00 3 $200.00 $1,100.00 3 $200.00 $22,000.00 1 $7,000.00 Activity D... Date Added: 2009-06-11 22:08:16 |
| compare_q_systems.xls Path: Drexel >> ISP >> 991 Fall, 2009 Description: System Time t-Test: Two-Sample Assuming Equal Variances Variable 1 1.32 0.12 51 0.1 0 100 7.08 0 1.66 0 1.98 Variable 2 0.88 0.08 51 Mean Variance Observations Pooled Variance Hypothesized Mean Difference df t Stat P(T<=t) one-tail t Critical one-ta... Date Added: 2009-06-11 22:08:38 |
| Navidad_2008_Jose_Jimenez.pdf Path: Cal Poly Pomona >> RAGL >> 4747 Fall, 2009 Description: Yo soy Jos Jimnez. y les deseo una Feliz Navidad 2008 y un prspero Ao Nuevo 2009 para usted y su familia. Para m tal vez pueda que mi cantante favorito sea Ricardo Arjona y mis personajes favoritos sean El Chavo del Ocho y el Chapuln Colorado, mas s... Date Added: 2009-06-11 22:10:26 |
| P5-4.pdf Path: University of Dayton >> MCT >> 313 Fall, 2009 Description: ... Date Added: 2009-06-11 22:10:50 |
| P9-13.xls Path: University of Dayton >> MCT >> 313 Fall, 2009 Description: Problem 9-13 Time (sec) 0 0.01 0.02 0.03 0.04 0.05 0.06 0.07 0.08 0.09 0.1 0.11 0.12 0.13 0.14 0.15 0.16 0.17 0.18 0.19 0.2 0.2 0.5 0.5 0.51 0.52 0.53 0.54 0.55 0.56 0.57 0.58 0.59 0.6 0.61 0.62 0.63 0.64 0.65 0.66 0.67 0.68 0.69 0.7 0.71 0.72 0.73 ... Date Added: 2009-06-11 22:11:04 |
| Fasteners.pdf Path: University of Dayton >> MCT >> 111 Fall, 2009 Description: Threaded Fasteners The most common method of mechanical assembly is by using bolts, screws and nuts. These are called threaded fasteners. Thread Terms Root Crest Pitch Major Dia. 2 1 0 Body Threads per inch Minor Dia. Creating a Tapped Hole F... Date Added: 2009-06-11 22:11:08 |
| 2004-12-01.ps Path: Texas >> CS >> 303 Fall, 2008 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Creator: OpenOffice.org 1.1.1 %For: sarvela %CreationDate: Wed Dec 1 14:44:14 2004 %Title: 2004-12-01.sxi %LanguageLevel: 2 %DocumentData: Clean7Bit %Pages: (atend) %PageOrder: Ascend %EndComments %BeginProlog %%... Date Added: 2009-06-11 22:11:29 |
| Sutter98.pdf Path: Neumont >> IFT >> 6551 Fall, 2009 Description: S o~ Qs y hooQ oS ~t so Q o~ iqS e t ~ Qo~syyouXisrSQ h h u I F bi `dy 0 i% oskQ~ h~}z |{ xwhhf gPTPq p Rn ySiFovutsSrVFoQtXemc l jhhf g kiFgedF r `x vXUy# r hS `dyIIv0QtR FqSiPhf !... Date Added: 2009-06-11 22:12:48 |
| lect14.pdf Path: Rochester >> PHY >> 418 Fall, 2009 Description: ... Date Added: 2009-06-11 22:14:39 |
| MIND GAME.doc Path: Illinois State >> COM >> 329 Fall, 2008 Description: MINDGAME 2% or 98% Thisisstrange.canyoufigureitout? Areyouthe2%or98%ofthepopulation? Followtheinstructions!NOPEEKINGAHEAD! *Dothefollowingexercise,guaranteedtoraisean eyebrow. *There\'snotrickorsurprise. * Just follow these instructions, and answer th... Date Added: 2009-06-11 22:15:13 |
| study_guide2_sp09.doc Path: Illinois State >> COM >> 329 Fall, 2008 Description: COM 229 (Lippert) Spring 2009 Study Guide for Exam #2 Chapters 6-9 This is meant only as a guide for your study in preparation for the exam. You are responsible for the class material, power points, lecture notes, chapter readings, and class activiti... Date Added: 2009-06-11 22:15:16 |
| borgland.ppt Path: Stanford >> SLAC >> 05052006 Fall, 2009 Description: ISOC/SVAC Instrument Analysis Meeting, May 5, 2006 The LAT Is On The Move Anders W. Borgland Science Verification, Analysis and Calibrations / ISOC Anders W. Borgland 1 ISOC/SVAC Instrument Analysis Meeting, May 5, 2006 Done With Muon Taking!... Date Added: 2009-06-11 22:16:10 |
| AndreaDec092005.ppt Path: Stanford >> SLAC >> 12092005 Fall, 2009 Description: GLAST LAT Project IA Meeting Dec 9,2005 Overview Goal Study GEM variables in SVAC ntuple So far in Italy we have not used the GASU Came to SLAC to learn about the GEM variables and how the trigger works Prepare for final LAT data analysis ... Date Added: 2009-06-11 22:16:27 |
| announcements.pdf Path: Stanford >> SLAC >> 09232005 Fall, 2009 Description: SVAC Announcements Instrument Analysis Meeting, September 23, 2005 Anders W. Borgland Science Verification, Analysis and Calibrations Anders W. Borgland 1 SVAC Data Taking Plans Instrument Analysis Meeting, September 23, 2005 As you ... Date Added: 2009-06-11 22:16:35 |
| HW15_Solution.pdf Path: Wisconsin >> CEE >> 310 Fall, 2008 Description: CEE 310 Fluid Mechanics Spring 2009 Homework Assignment #15 Name: _ Due: Not Required to hand in Credit Distribution: Name % of Credit Group Homework Problems: 9.4 9.12 9.21 9.41 9.54 9.68 9.73 9.96 9.99 Problems for Extra Practice (Individuall... Date Added: 2009-06-11 22:18:40 |
| diff.ps Path: University of Hawaii - Hilo >> CS >> 005 Fall, 2009 Description: ... Date Added: 2009-06-11 22:19:51 |
| mtin006.txt Path: University of Hawaii - Hilo >> MT >> 006 Fall, 2009 Description: Format of VAX/Micro transfers on fast bus Page 1 MTIN/6.1 SCIENCE AND ENGINEERING RESEARCH COUNCIL MTIN/6.1 CAVENDISH LABORATORY MULLARD RADIO ASTRONOMY OBSERVATORY MT Project ... Date Added: 2009-06-11 22:19:59 |
| Exam1Answer.pdf Path: Southern Oregon >> MATH >> 2423 Fall, 2009 Description: Exam 1 Math 2423 9-20-06 Name Instructions Give thorough explanations of your work to guarantee getting full credit. calculators is not permitted. Please write on the back of the pages if you need more space. Use of 1. (15 points) Write out the s... Date Added: 2009-06-11 22:23:25 |
| Lesson 18 -- Concurrency.pptx Path: Rose-Hulman >> SEC >> 332 Fall, 2009 Description: Concurrency Click to edit Master subtitle style Enforcing Mutual Exclusion, Semaphores Four different approaches Hardware support Disable interrupts Special instructions Software-defined approaches Support from the OS/compiler 22 OS support: Sema... Date Added: 2009-06-11 22:23:54 |
| shellProject.pptx Path: Rose-Hulman >> SEC >> 332 Fall, 2009 Description: Shell Project Click to edit Masterasubtitle style xssh Implementation of simple shell, (Section 1 version) What is a shell? A process that does command line interpretation Reads a command from standard input (stdin) Executes command corresponding t... Date Added: 2009-06-11 22:23:55 |
| Rachael Unit Plan Matrix.doc Path: Washington >> EDTEP >> 586 Fall, 2008 Description: Rachael Tarshes Understanding Roller Coasters A Unit Plan for Forces and Motion 8th Grade Science 2 Subject area description Eighth grade students at College Place Middle School will be learning about forces and motion for about three weeks for a to... Date Added: 2009-06-11 22:26:08 |
| PI-Characteristic Equation.doc Path: UT Chattanooga >> ENGR >> 328 Fall, 2009 Description: -K t0 s2 + K - t0 s + K I I 2 2 OLTF = KC t 0 s 3 + t0 + s 2 + s I I I 2 2 ... Date Added: 2009-06-11 22:27:07 |
| WORD%20-%20CHAPTER%202(1).xls Path: CSU Northridge >> COMP >> 100 Fall, 2009 Description: Comprehensive Word Chapter 2 Project-Based LastName FirstName Exam (Scenario 1) Ah Choy Noble 87 aljuraiban jasser 95.7 ANUJUO DEREK Arias Ariadna 82.6 Baker John 60.9 Baker Matthew Barkley Kory 91.3 Brink Hannah Butcher Kevin 100 Cervantes Marisol 9... Date Added: 2009-06-11 22:27:12 |
| Exam-1-Sp-05.doc Path: UT Chattanooga >> ENGR >> 328 Fall, 2009 Description: Assessment Instrument 1 ENGR 328 Spring, 2005 This Assessment Instrument is made for you to show your instructor how competent you are in this subject. If you want to show this in another way, you may do that. Show all your work. Open book & notes... Date Added: 2009-06-11 22:27:34 |
| Work-23a.doc Path: UT Chattanooga >> ENGR >> 328 Fall, 2009 Description: 6/4/2009 Work-23 1. Team Name What is the final value of c(t ) for this closed loop feedback system? R( s) = GC ( s ) = K c 1 + 1s I Ke t0 s G ( s) = (s + 1) A s ( ) , Work-23 1. Team Name What is the final value of c(t ) for this clo... Date Added: 2009-06-11 22:28:56 |
| lecture08erk.ppt Path: Arizona >> NATS >> 101 Fall, 2006 Description: NATS 101-06 Lecture 8 Condensation, Fog and Clouds Cloud Condensation Nuclei Small, airborne particles are necessary on which water vapor can condense to produce cloud droplets Without such particles, RH>100% would be needed to produce clouds Such ... Date Added: 2009-06-11 22:32:22 |
| slac-pub-5615.pdf Path: Stanford >> PUBS >> 5500 Fall, 2009 Description: SLAC-PUB-5615 April 1991 WE/A) DIFFERENTIAL MULTIPHOTON LUMINOSITY UNDER BEAMSTRAHLUNG* Pisin Chen Center Ca 94309 Stanford Linear Accelerator Stanford University, Stanford, ABSTRACT For the next generation loss due to beamstrahlung be substanti... Date Added: 2009-06-11 22:35:24 |
| doc00000.doc Path: Los Angeles Southwest College >> MISC >> 0606 Fall, 2009 Description: GUIDE FOR IOOS DATA PROVIDERS, VERSION 1.0 June 2, 2006 Ocean.US IOOS DMAC Steering Team 1 GUIDE FOR IOOS DATA PROVIDERS, VERSION 1.0 June 2, 2006 CONTENTS: Introduction Draft IOOS Data Policy Guidelines Appendix I. Full Descriptions of New Guidel... Date Added: 2009-06-11 22:37:23 |
| nres thematic r.pdf Path: Wisc Stevens Point >> MWAID >> 847 Fall, 2009 Description: Authors: Mackenzie Waidelich and Stephanie Anderson NR 370 Section # 3 Spring 2006 1.) Rationale Night life is an important concept to introduce to children. The framework of environmental education is a basic understanding of the processes of the o... Date Added: 2009-06-11 22:39:01 |
| HW06.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 461 Fall, 2008 Description: University of Illinois 1.(a) Problem Set #6: Solutions Page 1 of 4 ECE 361 Fall 1998 (b) h(t) = s0(Tt) s 1(Tt) = 2s0(Tt) = 2sin(2(Tt)/T)pT(Tt) = 2sin(2t/T)pT(t) = 2s0(t). Also, h(t) = 2s0(Tt+) = 2sin(2(Tt+)pT(Tt+) = 2sin(2(t)pT(Tt+) t ^ (t) = 0 ... Date Added: 2009-06-11 22:39:10 |
| lecture_notes_for_lecture3.pdf Path: SUNY Buffalo >> BCH >> 512 Fall, 2009 Description: The Fly in History 1859-Darwin 1866-Mendel c. 1890-Driesch, Roux (experimental embryology) 1900- \"rediscovery\" of Mendel (birth of genetics) Why Flies? short generation time (~ 12 days) many visible phenotypes only 4 chromosomes (3 autosomes, X&... Date Added: 2009-06-11 22:40:25 |
| PS9-2007.pdf Path: University of Illinois, Urbana Champaign >> PHYS >> 598 Fall, 2008 Description: Physics 498-QOI: Topics in Quantum Optics and Quantum Information Problem set #9 [12] {Distributed 4/12; due 4/19} This is most likely the final (and also the shortest) problem set, to get you in the spirit of quantum circuits. 1. [3] N&C 4.13 2. [5]... Date Added: 2009-06-11 22:41:46 |
| Geospatial workshop_India08_Regression.ppt Path: SUNY Albany >> GJ >> 496782 Fall, 2009 Description: Geospatial Analysis in Public Health Spatial Regression M.J. College, Jalgaon India September 22-26, 2008 Glen D. Johnson, PhD, MS, MA New York State Department of Health and The University at Albany, State University of New York School of Public Hea... Date Added: 2009-06-11 22:42:33 |
| Exercice 03(2008) ana sys.pdf Path: NSULA >> FOR >> 19089 Fall, 2009 Description: Exercice trois Utiliser l\'analyse systmique pour cerner une problmatique environnementale partir du schma illustrant un projet de production porcine, tablissez une rflexion systmique afin de faciliter une dmarche d\'valuation environnementale. 1. 2.... Date Added: 2009-06-11 22:42:59 |
| FSC Norme boréale Canada.pdf Path: NSULA >> FOR >> 17242 Fall, 2009 Description: Forest Stewardship Council - Canada. Norme borale nationale FOREST STEWARDSHIP COUNCIL Groupe de travail du Canada NORME BORALE NATIONALE Approuve par le FSC 6 aot 2004 Ce projet a t rendu possible grce au gnreux appui des Pew Charitable Trusts,... Date Added: 2009-06-11 22:43:12 |
| random.txt Path: Kent State >> CS >> 10061 Fall, 2008 Description: CACGTGCGCCCACCTAAAACATCCGGGGTCGTCGTAAGGTCCTGCGTTAGCGTTACCACGTTATGTACACTTAAGATGGCCAGGTGACCGTCATCGGGGAAGGAAGGCATCAAACAGGGATTAGCGCAGAGCTTAAACACTGGATCCAGCCCGAGTGATGATCTGATGATTTACGACAAATCCGTATATATAATAATGCTAAACCGGAAATCGCAGGACAAAAGGGTTGCCTGGCCTTCTCATTGCGACG... Date Added: 2009-06-11 22:44:05 |
| EME 236Lecture31_MohrsCircleDay2.doc Path: Loras >> CM >> 418218 Fall, 2009 Description: EME 236 Properties and Mechanics of Materials Lecture 31: Mohr\'s Circle for 3-D Stress Element Today: - Homework questions: - Quiz - Stress Transformation using Mohr\'s Circle - Read Chap 9, Section 5 - Homework Assigned: Chap 9: 93, 96, 101, 113 Spr... Date Added: 2009-06-11 22:44:12 |
| EME 236Lecture29_StrainGages.doc Path: Loras >> CM >> 418218 Fall, 2009 Description: EME 236 Properties and Mechanics of Materials Spring 2008 Lecture 29: Strain Gauges and Material Property Relationships Today: - Homework questions: - Return Exams - Strain Gages - Generalized Hooke\'s Law - Homework Assigned: Chap 10: 25, 26, 34, 42 ... Date Added: 2009-06-11 22:44:15 |
| eight.xls Path: Penn State >> CRC >> 5082 Fall, 2009 Description: Assumptions Units Sold in Prior Year Unit Cost Annual Sales Growth Annual Price Decrease Margin 11,459,713.00 13.40 4.50% 4.25% 39.25% Salioto Auto Parts Eight-Year Financial Projection r1 r3 Ye a Ye a Ye a Ye a Sales Cost of Goods Gross Margin 252,... Date Added: 2009-06-11 22:44:32 |
| engr2030exercise16.pdf Path: Armstrong >> ENGR >> 2030 Spring, 2008 Description: ENGR 2030 Class Exercise, representing numbers, signed arithmetic 1. Spring 2008 Given: 2/20/2008 Code the numbers below or indicate if the number cannot be represented in 8-bit unsigned, 8-bit sign magnitude, and 8-bit two\'s complement. + 7310 -... Date Added: 2009-06-11 22:45:16 |
| Crises.doc Path: Middlebury >> ECON >> 0340 Fall, 2008 Description: International Economics: A Policy Approach EC 340 Fall 2004 Kirsten Wandschneider 443-3491 kwandsch@middlebury.edu THE CRASH PBS Frontline, originally aired in the summer of 1999. Questions for discussion: 1) Economists distinguish between differen... Date Added: 2009-06-11 22:45:44 |
| econ2400M_midterm_marks_2009.pdf Path: Maple Springs >> ECON >> 2400 Fall, 2009 Description: ECON2400MW - Midterm Marks - 2009 Student No. 80249 94720 804 2461 57408 40017 26196 52794 75290 46968 94762 11103 31499 87747 92697 20745 64628 43471 88021 20699 87748 89595 10425 44390 97141 3592 26189 55261 86191 94955 8763 59832 61341 42974 11068... Date Added: 2009-06-11 22:46:33 |
| SantasforSingleSoldiers.ppt Path: Benjamin Franklin Institute of Technology >> ECE >> 3553 Fall, 2009 Description: Audrey Moyers Multifarious Systems ECE 3553 Final Project Fall 2006 Main Page Soldier Submit Sponsor Log-In Sponsor Register Browse Single Soldiers Secure area Questions? ... Date Added: 2009-06-11 22:47:41 |
| 1.3.Ex4-00.pdf Path: W. Kentucky >> MAT >> 360 Fall, 2009 Description: ... Date Added: 2009-06-11 22:47:49 |
| annasH.ppt Path: Appalachian State >> FACULTY >> 3030 Fall, 2009 Description: The letter Hh By: Anna Martin and Anna Villegas Hh H is for hair. Hh H is for harp. Hh H is for house. Hh H is for hat. Hh H is for horse. Hh H is for hammock. Hh H is for horns. Hh H is for hearts. Hh QuickTime and a YUV420 codec ... Date Added: 2009-06-11 22:48:31 |
| Class 10 hindered rotational modes.doc Path: UCF >> OSE >> 5312 Fall, 2008 Description: Fundamentals of Optical Science OSE 5312, Fall 2003 Tuesday, October 7, 2003 Interaction of radiation with dipole active rotational modes in condensed matter Rotational modes of molecules do not lend themselves to classical treatment, particularly in... Date Added: 2009-06-11 22:49:41 |
| Homework 10.pdf Path: UCF >> OSE >> 5312 Fall, 2008 Description: OSE 5312 FUNDAMENTALS OF OPTICAL SCIENCE Spring 2006 Homework set 10: Due Wednesday, April 19 1. Derive the expression given in the notes for the steady state solution to the rate equations for N, for a quasi 3-level system, (i.e. a 2-level system wi... Date Added: 2009-06-11 22:50:04 |
| Ch05.ppt Path: Creighton >> MIS >> 470 Fall, 2009 Description: chapter 5 Network Operating Systems 5-3 CHAPTER OVERVIEW Network operating systems provide services such as file storage and network printing that support many of the business activities we conduct on a daily basis, including real-time interacti... Date Added: 2009-06-11 22:51:05 |
| Chapter 12_13_Structural Geology.ppt Path: Idaho >> GEOL >> 101 Fall, 2008 Description: Welcome back! Geology 101 Lectures on Chapter 12/13 Structural Geology and Plate Tectonics Dr Ken Sprenke ksprenke@uidaho.edu Tall Mountains Everest- has highest point above sea level Chimborazo (Andes)-has farthest point from center of Earth. Mauna... Date Added: 2009-06-11 22:51:49 |
| Lecture24_2009.ppt Path: Washington >> BIOC >> 441 Winter, 2008 Description: 1 Biochemistry 441 Lecture 24 Ted Young March 9, 2009 Eukaryotic RNA polymerases Structure Function Complexity of polII transcription 2 \"The highest faculty of the mind-that of tracing the analogy of unconnected observations; of evolving from the m... Date Added: 2009-06-11 22:52:06 |
| scienceteacherlesson.doc Path: NMSU >> EDLT >> 36802 Fall, 2009 Description: Unit Author First and Last Name Author\'s Email Address Course Name(s) Course Number(s) Course Section(s) Instructor(s) Name(s) Unit Overview Unit Plan Title Curriculum-Framing Questions Charlene Gabaldn chrz4@aol.com Integrating Technology With T... Date Added: 2009-06-11 22:52:27 |
| precedence.pdf Path: W. Carolina >> CS >> 361 Spring, 2008 Description: Token . > + + sizeof ~ ! + > < > <= >= != = | ? : += = *= = /= %= <= >= &= ^= |= , Operator direct selection indirect selection increment, decrement inc, dec size bitwise not logical ... Date Added: 2009-06-11 22:55:26 |
| ecolab.xls Path: Middlebury >> BI >> 190 Fall, 2009 Description: Total Abundance of Understory 90 80 70 Number of Organisms 60 50 40 30 20 10 0 10 Meter 30 Meter 50 Meter 70 Meter Study Plot 10 Meter sugar maple red maple witch hazel black birch beech TOTAL 30 Meter sugar maple red maple witch hazel... Date Added: 2009-06-11 22:55:37 |
| Cellular Networks.ppt Path: UC Davis >> ECS >> 289 Fall, 2008 Description: Cellular Networks ECS 289I Lecture 2 SS7 Network SS7 Protocol Stack Call Setup ISUP Message TCAP Query 1. 2. 3. 4. 5. 6. A subscriber served by switch A to reserve a rental car dials the advertised 800 numb... Date Added: 2009-06-11 22:57:06 |
| broadcast and multicast.pdf Path: UC Davis >> ECS >> 152 Fall, 2009 Description: ECS 152B Computer Network Lecture 17 http:/wwwcsif.cs.ucdavis.edu/~ghosal/Teaching/ECS152B/ecs152b These slides are based on slides by Xin Liu (UC Davis) Dipak Ghosal 3/3/2005 ECS 152B Computer Networks 1 Source Duplication vs In-Network Duplica... Date Added: 2009-06-11 22:57:19 |
| homework5.doc Path: Texas A&M University, Corpus Christi >> MATH >> 1324 Fall, 2008 Description: Business Mathematics I Homework 5 By Team # Submitted on Date We, the undersigned, affirm that all of us participated fully and equally in the completion of this assignment and that the work contained herein is original. Furthermore, we understand t... Date Added: 2009-06-11 22:59:09 |
| c3018.pdf Path: Clemson >> PARL >> 903 Fall, 2009 Description: . GUEST EDITORS\' INTRODUCTION Problem-Solving Environments for Computational Science ELIAS HOUSTIS, Purdue University EFSTRATIOS GALLOPOULOS, University of Patras RANDALL BRAMLEY, Indiana University JOHN RICE, Purdue University his issue\'s them... Date Added: 2009-06-11 23:00:00 |
| solutions.pdf Path: St. Vincent >> PH >> 112 Fall, 2004 Description: 1. (25 pts) a) (5 pts) How can a magnetic field be produced without any moving charges? By a changing electric field. This is part of Ampere\'s Law. b) (5 pts) Under normal circumstances, is there any flow of charge directly from one plate to the oth... Date Added: 2009-06-11 23:00:08 |
| matroids.ps Path: CSU Long Beach >> CECS >> 528 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: matroids.dvi %CreationDate: Wed Jan 22 12:13:50 2003 %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (www.ra... Date Added: 2009-06-11 23:01:33 |
| reduce.ps Path: CSU Long Beach >> CECS >> 528 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: reduce.dvi %CreationDate: Sat Jan 25 12:12:07 2003 %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (www.radi... Date Added: 2009-06-11 23:01:37 |
| killerProlog.txt Path: CSU Long Beach >> CECS >> 228 Fall, 2008 Description: %defining negation nott(P) :- P,!,fail ; true. %defining what it means to be the member of a list inList(X,[X|Tail]). inList(X,[Head|Tail]) :- inList(X,Tail). %facts person(aaron,male,doctor,[betty,clara]). person(betty,female,doctor,[aaron,c... Date Added: 2009-06-11 23:01:41 |
| reduce.ps Path: CSU Long Beach >> REDUCEFALL >> 528 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: reduce.dvi %CreationDate: Sat Jan 25 12:12:07 2003 %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (www.radi... Date Added: 2009-06-11 23:01:51 |
| midterm 1 155 s2009 key.pdf Path: San Jose State >> CHEM >> 155 Spring, 2008 Description: ... Date Added: 2009-06-11 23:02:16 |
| notrig_AccMass.ps Path: UConn >> DANK >> 020531 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: notrig_AccMass.psc1 %Creator: ROOT Version 3.03/05 %CreationDate: Thu May 30 15:21:44 2002 %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} def /sw {stringwidth} def /r {rotate} def /rl {... Date Added: 2009-06-11 23:03:26 |
| IT430 - Lesson 19 - Public Key Crypto.ppt Path: Naval Academy >> IT >> 430 Fall, 2009 Description: IT430 Information Assurance Lesson 19 Public Key Cryptography Symmetric Symmetric Key Crypto Same key at both ends Used to Encrypt and Decrypt Asymmetric Asymmetric Key Crypto Different keys to Encrypt and Decrypt Requires... Date Added: 2009-06-11 23:03:32 |
| Anatomy & Physiologych1.ppt Path: University of Hawaii - Hilo >> BIO >> 141 Fall, 2009 Description: Anatomy Physiology Objective: define terms and describe speci... Date Added: 2009-06-11 23:04:13 |
| CH09.ppt Path: UConn >> PHYS >> 1501 Fall, 2009 Description: Essential University Physics Richard Wolfson 9 Systems of Particles PowerPoint Lecture prepared by Richard Wolfson Copyright 2007 Pearson Education, Inc., publishing as Pearson Addison-Wesley Slide 9-1 In this lecture you\'ll learn How to find ... Date Added: 2009-06-11 23:06:03 |
| into to robotic systems.pdf Path: RPI >> ECSE >> 4490 Fall, 2009 Description: ... Date Added: 2009-06-11 23:06:43 |
| greek notes.doc Path: Mt. Holyoke >> PHIL >> 201 Fall, 2009 Description: Why study Greek philosophy? The place of the Greeks in contemporary Western thought o Understanding philosophy o Understanding Western intellectual and cultural history The value of the ideas and texts themselves Problems of studying Greek philosop... Date Added: 2009-06-11 23:07:09 |
| I1.pdf Path: Princeton >> COS >> 126 Fall, 2008 Description: Lecture I1: Introduction COS 126 Princeton University Fall 2002 Kevin Wayne Overview What is COS 126? s Broad, but technical, intro to fundamental ideas of CS. no prerequisites experienced programmers, see COS 217 or COS 226 Basic CS principles.... Date Added: 2009-06-11 23:10:39 |
| ex3-35.txt Path: Minnesota >> CH >> 3022 Fall, 2009 Description: Nitrogen 2.0968 2.4685 1.7486 2.9367 1.685 2.7507 2.822 2.5198 2.7741 1.9762 2.7043 2.4259 2.1739 2.7983 2.8241 2.3821 2.6814 2.3936 1.9928 2.0961 2.6691 2.6456 2.0596 2.5464 2.2194 2.9216 3.052... Date Added: 2009-06-11 23:11:21 |
| ex7-27.txt Path: Minnesota >> CH >> 3022 Fall, 2009 Description: Brand_I Brand_II 38.9 44.6 39.7 46.9 42.3 48.7 39.5 41.5 39.6 37.5 35.6 33.1 36 43.4 39.2 36.5 37.6 32.5 39.5 42 ... Date Added: 2009-06-11 23:11:30 |
| Lee.pdf Path: Colorado >> MCDB >> 4426 Fall, 2008 Description: letters to nature Our results support a simple satisfactory explanation for the presence of the non-heterocystous cyanobacteria Trichodesmium spp. in the (sub) tropical oceans and their absence in temperate and cold seas as well as in freshwater and ... Date Added: 2009-06-11 23:12:10 |
| 99-0697df.pdf Path: Wisconsin >> LAW >> 027 Fall, 2009 Description: 1 l/20/98 2:49:48 PM LRB-0697 1999 DRAFTING REQUEST Bill Received: 10/30/98 Wanted: As time permits For: Marlin Schneider (608) 266-0215 This file may be shown to any legislator: NO May Contact: Subject: Insurance - miscellaneous Received By: kahle... Date Added: 2009-06-11 23:15:22 |
| 99-3051_1.pdf Path: Wisconsin >> LAW >> 384 Fall, 2009 Description: 1999 2000 LEGISLATURE LRB3051/1 MJL:jlg:kjf 1999 ASSEMBLY BILL 384 June 10, 1999 Introduced by Representatives NASS, MUSSER, BRANDEMUEHL, FREESE, TURNER, OWENS, KESTELL, HAHN, PORTER, PLOUFF, SYKORA, HASENOHRL, PETTIS, ALBERS, KEDZIE, HUNDERTMAR... Date Added: 2009-06-11 23:15:59 |
| 99-1152df.pdf Path: Wisconsin >> LAW >> 193 Fall, 2009 Description: ... Date Added: 2009-06-11 23:16:18 |
| 99a0712_1ccc-1.pdf Path: Wisconsin >> LAW >> 308 Fall, 2009 Description: 19992000 LEGISLATURE CORRECTIONS IN: ASSEMBLY AMENDMENT 1, TO 1999 ASSEMBLY BILL 308 Prepared by the Legislative Reference Bureau (February 9, 2000) 1. Page 2, line 14: delete \"The treatment of\". LRBa0712/1ccc1 JLG:ch Minor clerical corrections ... Date Added: 2009-06-11 23:19:13 |
| slides.pdf Path: Maryland >> AMSC >> 662 Fall, 2008 Description: Differentiated Efficiency Benchmarking of Loop Optimization Techniques in Linear Algebra Subroutines Chris Guenther AMSC 662 F03 SVD ESPRIT Direction of arrival finding algorithm Info from paired detectors Uses SVD matrix decomposition twice Wor... Date Added: 2009-06-11 23:20:04 |
| 99-2327_1dn.pdf Path: Wisconsin >> LAW >> 406 Fall, 2009 Description: DRAFTER\'S NOTE FROM THE LRB2327/1dn ISR:cmh:jf LEGISLATIVE REFERENCE BUREAU March 31, 1999 Representative Townsend: This bill allows lottery prize winners to elect whether to receive payment of a lottery prize in the form of a single cash payment ... Date Added: 2009-06-11 23:20:49 |
| 99-0350_1.pdf Path: Wisconsin >> LAW >> 201 Fall, 2009 Description: 1999 2000 LEGISLATURE LRB0350/1 RPN:kmg:jf 1999 ASSEMBLY BILL 201 March 15, 1999 Introduced by Representatives WALKER, KRUSICK, GUNDRUM, LADWIG, F. LASEE, PORTER, HAHN, JENSEN, BRANDEMUEHL, ZIEGELBAUER, OLSEN, M. LEHMAN, MUSSER, SKINDRUD, PLALE,... Date Added: 2009-06-11 23:21:35 |
| 99-0918_1.pdf Path: Wisconsin >> LAW >> 132 Fall, 2009 Description: 1999 2000 LEGISLATURE LRB0918/1 JEO:kmg:hmh 1999 ASSEMBLY BILL 132 February 16, 1999 Introduced by Representatives F. LASEE, KELSO, ZIEGELBAUER, PLALE, SYKORA, BOCK, RYBA, STONE, LA FAVE, GOETSCH, SPILLNER, SKINDRUD, MUSSER, KAUFERT, POWERS, ALB... Date Added: 2009-06-11 23:21:41 |
| PairRequirements.txt Path: Wisc Platteville >> CS >> 143 Fall, 2009 Description: Pairs requirments for Programs, CS 143 Spring 2008 You have the option to work with one other person for program 4. The following requirements indicate what you must adhere to if you choose this option. If you do NOT choose this option, then yo... Date Added: 2009-06-11 23:21:41 |
| prospect.ppt Path: UGA >> EOCS >> 8000 Fall, 2008 Description: Prospective Student Orientation Program of Workforce Education The University of Georgia Areas of Emphasis Career & Technical Education K-12 Post-secondary Technical college emphasis Teacher education Human Resource Development 06/04/09 Pro... Date Added: 2009-06-11 23:23:06 |
| simplicial-duality.pdf Path: UC Riverside >> MATH >> 246 Fall, 2009 Description: ... Date Added: 2009-06-11 23:23:57 |
| 5450RRGaspectualclass.doc Path: Colorado >> LAM >> 5450 Fall, 2009 Description: Aspectual Class and Lexical Decomposition: VVLP Chapter 3 Notes Linguistics 5450 Spring 2005 The Main Point In order to understand the semantic content of predicates and the relationships that hold between predicates and their arguments, we will set ... Date Added: 2009-06-11 23:24:05 |
| handout01.pdf Path: Arizona >> MATH >> 110 Fall, 2008 Description: ... Date Added: 2009-06-11 23:25:05 |
| c2_summary.txt Path: Alabama Huntsville >> CS >> 102 Fall, 2008 Description: COMMENTS - Comments are delimited by /* some comment */ Comments can be on one line, or on multiple lines but must be delimited. Comments cannot be nested (inside each other) Comments should not appear in a string literal or inside a C statement (s... Date Added: 2009-06-11 23:25:23 |
| Discussion Question Week 5.doc Path: Uni. Westminster >> GTG >> 0324 Fall, 2009 Description: Gary Glodowski THTR 124 Dr. Vought Discussion Question: Week 5 Question 1: Was using an entertaining scene for educational purposes unmoral? This is a difficult question to answer because one has to take into account the culture of medieval Europe b... Date Added: 2009-06-11 23:27:21 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
