Course Solutions And Notes - week1_1 19
| 009Lectoutline.doc Path: Pima CC >> DTC >> 201 Fall, 2009 Description: 1 LECTURE OUTLINE - UNIT 9 Fundamentals of the Nervous System and Nervous Tissue; Action Potentials [*The following lecture outline follows your textbook very closely; read the outline and the associated sections in Chapter 11 (pp. 388-397) of your t... Date Added: 2009-06-13 05:39:07 |
| RHYS Bibiliography[1].doc Path: Cal Poly Pomona >> URP >> 461 Fall, 2009 Description: BIBLIOGRAPHY http:/retailtrafficmag.com/ar/retail_avoiding_storefront_uniformity. Date accessed: March 1, 2004. http:/www.paseo411.com/directory.htm. Date accessed: February 15, 2004. http:/pps.org/topics/gps/failed_place_feat. Date accessed: March 1... Date Added: 2009-06-13 05:39:49 |
| RLC_GenRLCSoln_CTBan.doc Path: Utah >> ECE >> 2260 Fall, 2008 Description: CONCEPT U A L TOOLS By: Neil E. Cotter Ref: Nilsson & Riedel, Rev 6, Prob 8.7 RLC CIRCUITS GENERAL RLC SOLUTION Example 1 CONCEPT U A L TOOLS By: Neil E. Cotter RLC CIRCUITS GENERAL RLC SOLUTION Example 1 (cont.) CONCEPT U A L TOOLS By: Neil E... Date Added: 2009-06-13 05:40:04 |
| Lect22.ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 212 Fall, 2008 Description: Physics 212 Le cture22 Physics 212 Le cture22, S 1 lide Music Who is the Artist? A) B) C) D) E) Lizz Wright Erykah Badu Sade Cassandra Wilson Diane Reeves Why? Guilty Ple asure s? I know the all say that he voiceis thin, BUT. y r I t doe sound good... Date Added: 2009-06-13 05:40:07 |
| Learning Guide, The Mitten.rtf Path: Uni. Westminster >> KSS >> 0130 Fall, 2009 Description: Gradual Release of Responsibility Model of Instruction The Mitten, By Jan Brett Learning Guide Designed by: Kelly Stevens Grade level: 1st Grade Approximate length of time: 1 1/2 hours Curriculum Areas: Reading, Language Arts, Geography U... Date Added: 2009-06-13 05:40:30 |
| Venn Diagram.docx Path: Uni. Westminster >> KSS >> 0130 Fall, 2009 Description: Venn Diagram Democracy vs. Monarchy ... Date Added: 2009-06-13 05:40:35 |
| interview, shannon, curtis & kelly.docx Path: Uni. Westminster >> KSS >> 0130 Fall, 2009 Description: Kelly Stevens EDUC 315 Teaching and Learning Theory Fall 2007 The three people interviewed for this assignment were my friend and next door neighbor, Shannon, my husband, Curtis and of course, myself. All of our present careers and where we presently... Date Added: 2009-06-13 05:40:37 |
| 5.pdf Path: Wisconsin >> BOOK >> 717 Fall, 2009 Description: Pointwise convergence 85 V. Baire category and consequences Pointwise convergence We explore necessary and sufficient conditions for pointwise convergence of linear maps, particularly in the presence of completeness, i.e., when the domain and/or th... Date Added: 2009-06-13 05:42:16 |
| fact_anova.pdf Path: Maple Springs >> PSYCH >> 6130 Fall, 2009 Description: Factorial Designs Introduction to Two-Way Models Introduction P Dr. Black would like to determine if the sex of a subject, or the size of the community in which the subject is raised (small, medium, large), will impact on the amount of recycling tha... Date Added: 2009-06-13 05:43:38 |
| T0436.t04.w0.5-logo.pdf Path: UCSC >> T >> 0436 Fall, 2009 Description: T0436.t04 w0.5 4 3 2 1 1 10 20 30 40 H 4 3 2 1 T Q T G T H 51 60 70 80 90 T 4 3 2 1 T H T G P S T H 101 110 120 130 140 T 4 3 2 1 S T T Q P Q T S H T 151 160 170 180 190 Q 4 3 2 1 T S H T T P Q S T... Date Added: 2009-06-13 05:43:45 |
| lec07.ps Path: Iowa State >> CS >> 612 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.519 Copyright 1986, 1993 Radical Eye Software %Title: main.dvi %CreationDate: Wed Jan 30 12:04:39 2002 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips main %DVIPSSource: Te... Date Added: 2009-06-13 05:44:04 |
| quiz32solution.pdf Path: Ill. Chicago >> MATH >> 181 Fall, 2008 Description: Math 181 Quiz 3 Solution Consider the region enclosed by the graphs of y = 2x 1, y = 1. Sketch the region. 2. Compute the volume of the solid obtained by rotating the region about the y-axis. Solution: 2 y x, and x = 0. 1 y= x y = 2x 1 x 2 ... Date Added: 2009-06-13 05:45:57 |
| Introduction.ppt Path: Washington >> SOC >> 220 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|31 Mar 2009 22:58:11 -0000 vti_extenderversion:SR|5.0.2.6790 vti_author:SR|SAMCLARK-T42P\\Sam Clark vti_modifiedby:SR|SAMCLARK-VIRTXP\\Samuel Clark vti_timecreated:TR|28 Mar 2006 15:17:52 -0000 vti_title:... Date Added: 2009-06-13 05:47:24 |
| allophones.pdf Path: UNC >> LING >> 101 Fall, 2008 Description: Are two sounds allophones of 1 phoneme or 2 phonemes? Do they occur in any minimal pairs? YES: allophones of 2 different phonemes NO: allophones of 1 phoneme Give an example of a minimal pair to illustrate. In what environments does each allopho... Date Added: 2009-06-13 05:48:48 |
| Leaders in Value Growth.pdf Path: NSULA >> COURS >> 60808 Fall, 2009 Description: printed from www.marakon.com on January 4, 2006 Page 1 sur 7 printed from www.marakon.com on January 4, 2006 Leaders in Value Growth: What It Takes (Part I) By Bruno Mathieu, Esmond Kensington and Andrei Litvinov1 Some companies create a lot more ... Date Added: 2009-06-13 05:50:01 |
| inbus_excel_anecd_03_mgt_lane_netw.docx Path: Oregon >> DSC >> 240 Winter, 2008 Description: 19fd93c6814434ac4ed1ff1770bb04134c0aecfa Excel in Practice: My Role as Operations Research Analyst (Management) Which pieces of a large transportation network have lower margins than the company would like them to? Who are the biggest candidates for... Date Added: 2009-06-13 05:50:02 |
| Lab4.doc Path: SMU - Cox School of Business >> CSE >> 2340 Fall, 2009 Description: CSE 2340 Lab4 Using the following table as a guide, write a program that asks the user to enter an integer test score between 0 and 100. The program should display the appropriate letter grade. Score range 90-100 80-89 70-79 60-69 0-59 Letter grad... Date Added: 2009-06-13 05:50:09 |
| Homework2.pdf Path: UAB >> CS >> 344 Fall, 2009 Description: Fall 2005: CS 344 UNIX Operating Systems Fundamentals Homework 2 100 points. Individual work only. Due September 30, 2005. 1. Using the vi editor type the following text and save it to the file quizscores in the directoryhw2 (under cs344/fall2005).... Date Added: 2009-06-13 05:55:38 |
| 05061716.pdf Path: Wisconsin >> SH >> 050617 Fall, 2009 Description: ... Date Added: 2009-06-13 05:56:11 |
| play.pdf Path: North Texas >> CECS >> 3220001 Spring, 2009 Description: ... Date Added: 2009-06-13 05:56:15 |
| S97exam1.pdf Path: CSU Channel Islands >> OLD >> 151 Fall, 2009 Description: Name _ page 1 Chem 524 - Exam #1 2/11/97 - R. Corn You have fifty minutes to complete the exam, but do look over all the problems before diving in. Please show all of your work; no credit can be given just for the answer. Some information that you... Date Added: 2009-06-13 05:56:36 |
| test2.pdf Path: CSU Channel Islands >> OLD >> 151 Fall, 2009 Description: Name _ page 1 Chem 524 - Exam #1 2/11/97 - R. Corn You have fifty minutes to complete the exam, but do look over all the problems before diving in. Please show all of your work; no credit can be given just for the answer. Some information that you... Date Added: 2009-06-13 05:56:37 |
| chap018.ppt Path: UT Arlington >> MANA >> 5312 Fall, 2008 Description: 18 - 1 Chapter 18 McGrawHill Creating and Managing Change 2003 The McGrawHill Companies, Inc. All rights reserved. Learning Objectives After 18 - 2 studying Chapter 18, you will know: how to manage change effectively sources of resistanc... Date Added: 2009-06-13 05:56:57 |
| t critical values.pdf Path: Hudson VCC >> ST >> 141 Fall, 2009 Description: ... Date Added: 2009-06-13 05:57:32 |
| COIT11224 - Tutorial - Week 3.doc Path: Allan Hancock College >> COIT >> 11224 Fall, 2009 Description: COIT11224 Computer Systems Tutorial Week 3 Chapter 10 Question 1 Simplify, if possible, x 2 + 3 y 2 - 6 y + 7 x 2 Question 2 Explain the distinction, if any, between ( xy 2 )( xy 2 ) and xy 2 xy 2 . Question 3 Explain the distinction, if any, betw... Date Added: 2009-06-13 05:58:32 |
| 21.txt Path: SUNY Stony Brook >> CSE >> 506 Fall, 2008 Description: * netlink sockets See new link online: yes, it\'s a lot of reading linux-2.4.17/include/linux/netlink.h linux-2.4.17/include/linux/netfilter_ipv4/*.h linux-2.4.17/net/ipv4/netfilter/*.c - look at ip_queue.c useful functions such as how netlink_kern... Date Added: 2009-06-13 05:59:13 |
| RUSSN.pdf Path: San Diego State >> ES >> 0607 Fall, 2009 Description: Russian OFFICE: Business Administration 304 TELEPHONE: 619-594-5111 FAX: 619-594-8006 E-MAIL: russian.coord@sdsu.edu http:/www-rohan.sdsu.edu/~russian/ In the Depar tment of European Studies In the College of Arts and Letters Faculty Emeritus: Duka... Date Added: 2009-06-13 06:01:34 |
| lecture09.doc Path: North-West Uni. >> CS >> 110 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|20 Jan 2002 23:18:51 -0000 vti_extenderversion:SR|4.0.2.4426 vti_backlinkinfo:VX|academics/courses/a10/html/notes.html ... Date Added: 2009-06-13 06:03:12 |
| Assignment coversheet.doc Path: Allan Hancock College >> IENV >> 6801 Fall, 2009 Description: THIS FORM IS TO BE ATTACHED TO THE OUTSIDE OF EACH PRAC FOLDER, TUTORIAL OR ASSIGNMENT Student Number: Name (Family Name, Init): Course Code: ATTACHED IS: Tutorial No: Or Assignment No: Due Date: Supervisor/Tutor/ Tute I.D: Marks Received: I certif... Date Added: 2009-06-13 06:03:13 |
| swb_fit.txt Path: Berkeley >> TMP >> 00229185 Fall, 2009 Description: Power-Law Model Fit Norm@15keV 1.2355e-01 (1.1019e-01 1.3782e-01) alpha -1.6966 (-1.7912 -1.6031) Energy Fluence (15-350 keV) 2.2459e-06 (2.1347e-06 2.3618e-06) erg cm^-2 Eiso (1-10^4 keV, host-frame) 1.7302e+52 (1.5429e+52 1.9638e+52) erg Chi/nu= ... Date Added: 2009-06-13 06:03:17 |
| Math 5620 Class Notes-Chapter 3 08.pdf Path: UConn >> MATH >> 5620 Fall, 2008 Description: University of Connecticut Financial Mathematics I Key Concepts and Formulas Chapter 3 Recommended Reading Sections 3.1 3.4 Sections 3.5, 3.7 3.9 Sections 3.10 3.13 The topic of outstanding loan balances (Section 3.6) is deferred until our coverage... Date Added: 2009-06-13 06:03:33 |
| creative.ppt Path: Texas >> ADV >> 391 Fall, 2009 Description: Seminar in Interactive Advertising Department of Advertising College of Communication The University of Texas at Austin Seminar Notes for Topic: Creative Issues in Interactive Advertising Creative Issues in Interactive Advertising I. Interacti... Date Added: 2009-06-13 06:04:20 |
| HW1.pdf Path: SUNY Stony Brook >> AMS >> 315 Summer, 2008 Description: AMS 315 Data Analysis. Homework Set 1. Due to February 5th. (Thursday) Please, do the following problems from the book: 3.58, 4.59, 4.61, 4.65, 4.78, 4.90, 4.91, 4.97. 1 ... Date Added: 2009-06-13 06:06:14 |
| slac-pub-2489.pdf Path: Stanford >> PUBS >> 2250 Fall, 2009 Description: SLAC-PUB-2489 March 1980 (T/E) TARGET MASS CORRECTIONS IN QCD* W. R. Fraser? Stanford Stanford Linear University, and J. F. Gunion Accelerator Stanford, California 9 Center 94305 ABSTRACT We employ the diagrammatic which allows for the fact o... Date Added: 2009-06-13 06:08:00 |
| CRS_RRA_Manual.pdf Path: Washington >> PBAF >> 531 Fall, 2009 Description: Table of Contents Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .i About this Manual . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .... Date Added: 2009-06-13 06:09:36 |
| ch4.ps Path: Sveriges lantbruksuniversitet >> CS >> 384 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: ch4.dvi %Pages: 25 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips ch4.dvi -o %DVIPSParameters: dpi=300, compressed, comments r... Date Added: 2009-06-13 06:13:13 |
| wri.pdf Path: BYU >> LAW >> 1989 Fall, 2009 Description: ... Date Added: 2009-06-13 06:14:51 |
| Structure of Narratives Handout.doc Path: Valdosta >> READ >> 7140 Fall, 2008 Description: Structure of Narratives A. Beginning: 1. Character(s) are introduced. 2. Setting is described: Where & when story takes place. a. Place b. Time of day c. Weather d. Season e. Time period 3. Problem or conflict is established. a. Conflict between ch... Date Added: 2009-06-13 06:15:57 |
| Practice_Chapter_3.doc Path: UNL >> MODULE >> 321 Fall, 2009 Description: Solutions for Practice Problems in Chapter 3 Problem 5 Section 3.1 No. In the experiment in which a coin is tossed repeatedly until a H results, let Y = 1 if the experiment terminates with at most 5 tosses and Y = 0 otherwise. The sample space is inf... Date Added: 2009-06-13 06:16:13 |
| 061128_ZPD256F07.pdf Path: Wisconsin >> SH >> 061128 Fall, 2009 Description: ... Date Added: 2009-06-13 06:18:42 |
| s4x2rightwrong.txt Path: Arizona >> MIS >> 121 Fall, 2009 Description: ID A B C - - - - 0366 1 1 0 0377 1 1 0 0903 1 1 1 0916 1 1 1 1080 1 1 1 1284 1 1 0 1475 1 1 1 1733 1 1 1 2044 1 1 1 2052 1 1 1 2705 1 1 1 2757 1 1 1 2884 1 1 1 3144 1 1 1 3254 1 1 1 3337 1 1 1 3... Date Added: 2009-06-13 06:19:05 |
| barley-lab.pdf Path: N.C. State >> ST >> 512 Fall, 2008 Description: ST512, Lab activity with data from Barley growth expts in notes 1. Create a SAS dataset from the barley growth data discussed in lecture and contained in the file \"barley.dat\" SALTRT c c 6b 6b 12b 12b POT 1 2 1 2 1 2 SUBSAMPLES1-3 11.29 11.08 11.1 7.... Date Added: 2009-06-13 06:20:45 |
| BOM%20-Motor%20Control%20Board.xls Path: RIT >> P >> 07202 Fall, 2009 Description: ... Date Added: 2009-06-13 06:20:55 |
| Schematic2.pdf Path: RIT >> P >> 07202 Fall, 2009 Description: 5 4 3 2 1 P1 H1 1 H2 1 H3 1 CAN Tranciever TP10 1 1 1 1 TEST POINT TP11 +5V 1 C33 TEST POINT D TP12 1 U4 1 2 TXD VSS VDD RXD MCP2551 RS CANH CANL VREF 8 7 R3 6 120 1% 5 R2 47k TEST POINT 1 6 2 7 3 8 4 9 5 DB9-48202-6043 P2 1 6 2 7 3 8 4 9 5 DB... Date Added: 2009-06-13 06:21:01 |
| 043011mid2sample.ps Path: Minnesota >> STAT >> 3011 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: 043011mid2sample.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMBX12 CMBX10 CMMI10 CMR8 CMSY10 CMMI8 %EndComments %DVIPSWebPage: (... Date Added: 2009-06-13 06:22:38 |
| education.txt.txt Path: LA Tech >> QA >> 622 Fall, 2009 Description: Alabama 4.405 17.2 31.144 8 491 538 1029 Alaska 8.963 17.6 47.951 47 445 489 934 Arizona 4.778 19.3 32.175 27 448 496 944 Arkansas 4.459 17.1 28.934 6 482 523 1005 California 4.992 24.0 41.078 45 417 485 902 Color... Date Added: 2009-06-13 06:22:44 |
| u722_37a.pdf Path: CUNY Baruch >> CRJ >> 722 Fall, 2009 Description: The copyright law of the United States (Title 17, United States Code) governs the making of photocopies or other reproduction of copyrighted material. Under certain conditions specified in the law, libraries are authorized to furnish a photocopy or o... Date Added: 2009-06-13 06:23:40 |
| scan1.pdf Path: ECCD >> MATH >> 1007 Fall, 2009 Description: ... Date Added: 2009-06-13 06:24:11 |
| 345_F05_equation_sheet_final.doc Path: Towson >> CHEM >> 345 Fall, 2008 Description: CHEM 345Debye Equation Sheet Ideal and Real Gases Ideal Gas: K-1 mol-1 PV = nRT where R=NAkB R=8.315 J K-1 mol-1 = 0.08206 L atm NA = 6.022 x 1023 kb = 1.381 x 10-23 J K-1 Van der Waals Equation: Barometric Equation: Maxwell Speed Distribution: Spe... Date Added: 2009-06-13 06:24:40 |
| Lecture 5.pdf Path: NJIT >> ECE >> 650 Fall, 2009 Description: Lecture 5: CMOS Amplifiers Inverters October 2, 2007 CMOS Amplifiers Types of Amplifiers Characterization of an Amplifier Components of a CMOS Voltage/Transconductance Amplifier Illustration of Voltage Amplifier Components Amplifier Notation ... Date Added: 2009-06-13 06:26:33 |
| extrinfo.txt Path: Washington University in St. Louis >> MEXMRS >> 0746 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2008-08-05 NOTE ... Date Added: 2009-06-13 06:27:14 |
| extrinfo.txt Path: Washington University in St. Louis >> MEXMRS >> 0771 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2008-08-05 NOTE ... Date Added: 2009-06-13 06:27:22 |
| extrinfo.txt Path: Washington University in St. Louis >> MEXMRS >> 0768 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2008-08-05 NOTE ... Date Added: 2009-06-13 06:27:24 |
| slac-pub-3263.pdf Path: Stanford >> PUBS >> 3250 Fall, 2009 Description: SLAGPUB November 1983 (T/E) APPLIED CHROMODYNAMICS STANLEY LBRODSKY Stanford Linear Accelerator Center Stanford University, Stanford, California 9&lOS A number of novel features of QCD are reviewed, including the consequences of formation zone an... Date Added: 2009-06-13 06:27:45 |
| PP11-FDI.pdf Path: Michigan >> PERSONAL >> 340 Fall, 2009 Description: Econ 340 Lecture 11 Multinationals and International Capital Movements News Feb 9 - Feb 18 1. Trade Provisions in Final Stimulus Bill World Trade\\Interactive: 2/16 * Requires \"buy American\" of iron, steel, and manufactured goods used in funded ... Date Added: 2009-06-13 06:28:26 |
| Tests.pdf Path: Minnesota >> ME >> 3322 Fall, 2009 Description: Name _ (Please print clearly.) ME 3322 Heat Transfer and Fluid Flow Test 2 October 25, 2005 Closed books and closed notes. Please do all of work on these sheets and the reverse sides if necessary. Three problems are required The fourth problem is for... Date Added: 2009-06-13 06:28:51 |
| metacomputing.ps Path: Allan Hancock College >> CS >> 7933 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: metacomputing.dvi %Pages: 24 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: cmr17 cmr12 cmsy10 cmti12 cmmi12 cmbx12 cmtt12 %DocumentPaperSizes: A4 %... Date Added: 2009-06-13 06:29:09 |
| 8112sg1d.pdf Path: Mississippi State >> MKT >> 8112 Fall, 2009 Description: Marketing Management 8112 Key Topic Guidelines for Exam 1 Note: The exam will be a closed book, closed notes, short-answer-and-essay test that includes five short answer questions and one comprehensive essay question. A time limit of one hour and fif... Date Added: 2009-06-13 06:29:12 |
| hw12.05.06.pdf Path: Minnesota >> KHAMV >> 001 Fall, 2009 Description: ... Date Added: 2009-06-13 06:29:52 |
| Quiz II - 1998.doc Path: Wyoming >> GEOL >> 2020 Fall, 2008 Description: _Name (1 pt.) Geol. 2020 Introducton to Petrology Exam II Fall 1999 I. (24 pts.) Basalts During the Phanerozoic two major basalt types have erupted on Earth. These are tholeiites or alkali basalts. Describe how they differ in terms of their: a. miner... Date Added: 2009-06-13 06:29:56 |
| Quiz II - 2004.doc Path: Wyoming >> GEOL >> 2020 Fall, 2008 Description: Name _ Geol 2020 Introduction to Petrology Quiz II Autumn 2004 I (10pts) A-type granites. , 1. In what kind of tectonic environment do A-type granites occur? 2. How are they chemically distinguished from other granite types? II. (10 pts) Layered M... Date Added: 2009-06-13 06:29:57 |
| T0493.t04.str4-logo.pdf Path: UCSC >> T >> 0493 Fall, 2009 Description: T0493.t04 str4 5 4 3 2 1 1 10 20 30 40 V 5 4 3 2 1 S V S V S H G T V U Q V E U S G U E E Q E Q S V S H 51 60 70 80 90 G S 5 4 3 2 1 V G E P B H S H I G T U Q R Q R Q E V S G S G U S 101 110 120 130 140 G R Q R Q R H 5 4... Date Added: 2009-06-13 06:32:28 |
| phys215_lecture1.pdf Path: Virgin Islands >> PHYS >> 215 Fall, 2009 Description: 1 THE EXPERIMENTAL BASIS OF QUANTUM THEORY 1 1 The experimental basis of quantum theory the discovery of new particles (the electron and the photon) that require new physical laws which are not related to \"classical\" physics. A new quantum the... Date Added: 2009-06-13 06:33:36 |
| Ass4.soln.pdf Path: Virgin Islands >> ASTR >> 303 Fall, 2009 Description: From page 4 of the Milky Way Notes, and adding some absorption A: 401. 1 1 N(r) = # !o\"r 2 dr = !o\"r 3 , or log r = log N(r) + c 3 3 0 But with absorption: m $ M = 5 log r $ 5 + A which means: log r = 0.2(m $ M $ A) + 1 Then, if M is const: log N(m... Date Added: 2009-06-13 06:33:46 |
| en_6033.txt Path: Benjamin Franklin Institute of Technology >> ECE >> 5527 Fall, 2009 Description: #Language: eng #File id: 6033 #Starting at 750 Ending at 1350 # 750 760 #BEGIN # 1340 1350 #END 748.92 750.77 A: oh okay 750.68 753.25 B: they ha- they have a mission over here I call it 753.79 755.92 B: and %um {lipsmack} they\'re 756.26 ... Date Added: 2009-06-13 06:34:51 |
| tab58.xls Path: Cornell >> ERS >> 91011 Fall, 2009 Description: Table 58-Dehydrated mashed potatoes: U.S. monthly producer price index, 1968-91 1/ Year Jan Feb Mar Apr May Jun 1982=100 1968 1/ 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 2/ 54.... Date Added: 2009-06-13 06:35:13 |
| Lecture38.4up.pdf Path: Wisconsin >> CS >> 538 Fall, 2008 Description: Python One of the newest and most innovative scripting languages is Python, developed by Guido van Rossum in the mid-90s. Python is named after the BBC \"Monty Python\" television series. Python blends the expressive power and flexibility of earlier sc... Date Added: 2009-06-13 06:35:58 |
| TI application.pdf Path: Oregon State >> BI >> 212 Winter, 2008 Description: Undergraduate Teaching Internship Biology 21X Interested in becoming an Undergraduate Teaching Intern for biology? Receive two hours credit Great addition to your resume Good review for graduate school entrance exams And you gain teaching experie... Date Added: 2009-06-13 06:36:30 |
| spec_wt_bg.txt Path: Berkeley >> ASTRO >> 00277571 Fall, 2009 Description: # tmin tmax 0.16012900 5.48574 [ksec] ;instrument XRT ;exposure 76.430402 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.00000... Date Added: 2009-06-13 06:37:25 |
| Lecture11.ppt Path: UF >> CLAS >> 3032 Fall, 2009 Description: Anatomical terms Planes of section: Frontal/Coronal: Front and back Sagittal: Left and right Median/Midsagittal: Through the center Axial/Horizontal/Transverse: Upper and lower http:/www.spineuniverse.com/displayarticle.php/article1023.htm... Date Added: 2009-06-13 06:40:10 |
| HW16.pdf Path: Auburn >> CHEN >> 7110 Spring, 2008 Description: CHEN 7110/7116 HW #16 Due 04/27/07 Grader: Yuan, W. Solve Example 12.1-2 using method of lines, and plot the dimensionless temperature versus dimensionless time, compare your numerical solution with the analytical solution in the same plot. Chose h =... Date Added: 2009-06-13 06:40:26 |
| lecture4.ps Path: Carnegie Mellon >> EE >> 899 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - lecture4 %Creator: Windows NT 4.0 %CreationDate: 0:8 2/15/1998 %Pages: (atend) %BoundingBox: 13 13 599... Date Added: 2009-06-13 06:42:00 |
| hwset6.pdf Path: Grand Valley State >> ENGINEER >> 214 Fall, 2009 Description: Homework 6 EGR 214 Prof. Bogdan Adamczyk Grand Valley State University Padnos College of Engineering and Computing School of Engineering Fall 2005 H6 -1 Due Date: Mon 11/21/05 The op amp in the circuit shown is ideal. The adjustable resistor R ha... Date Added: 2009-06-13 06:42:02 |
| C&NoOfIntervals.pdf Path: Los Angeles Southwest College >> MUSC >> 525 Fall, 2009 Description: BAIN MUSC 525 Post-Tonal Music Theory Cardinal Number and Number of Intervals Formed The cardinal number (c) of a set refers to the number of distinct elements in the set. The number of intervals formed (n) by a pc set is directly related to the set... Date Added: 2009-06-13 06:43:11 |
| Ch3ExI3.1.pdf Path: Los Angeles Southwest College >> MUSC >> 525 Fall, 2009 Description: BAIN MUSC 525 Post-Tonal MusicTheory Straus, Ch. 3 Exercises Answers I. 3. (p. 95) Which of the following pc sets is transpositionally symmetrical? That is, which of the following pc sets map onto themselves under Tn (other than T0)? If the pc set i... Date Added: 2009-06-13 06:43:18 |
| Syllabus Psy1205r.pdf Path: Pittsburgh >> PSY >> 1205 Fall, 2008 Description: DRAFT DRAFT ABNORMAL PSYCHOLOGY (1205) Spring 2008-2009 Professor: Classroom: Time: Office: Office hours: Email: Dr. Jeffrey Cohn jeffcohn@pitt.edu 332 CL 11:00 12:15 Tues/Thurs 4327 Sennott Square Tuesdays 1:00 2:00 pm and by appointment On subj... Date Added: 2009-06-13 06:43:39 |
| w2of5 - Derrick p36 s3.ppt Path: Purdue >> IE >> 486 Fall, 2008 Description: Fieldevaluationofanadvanced brakewarningsystem DavidShinar HumanFactors1995 Presentedby:DerrickSmets Overview Withrearendcollisionsconstitutingmore thanofallmultiplevehiclecrashes,new researchintopreventativemeasuresis needed Onepossiblesolution... Date Added: 2009-06-13 06:45:27 |
| YuiErn_Nikhil section 4.ppt Path: Purdue >> IE >> 486 Fall, 2008 Description: Analysis of Driving simulator validation for speed research Stuart T. Godley, Thomas J. Triggs, Brian N. Fildes 1.Purpose of Research ideas/question To evaluate countermeasures for mean speed using behavioral validation of an advanced driving simul... Date Added: 2009-06-13 06:45:28 |
| 1201week12b.ppt Path: Minnesota >> D >> 1201 Fall, 2009 Description: How serious are the issues that usually precipitate a divorce? Notice how this question was finessed in the movie. Whitehead: \"Some people say as few as 10-15% of divorces involve marriages that are really irretrievably broken.\" Narrator: \"So eve... Date Added: 2009-06-13 06:45:54 |
| IEM_GW.pdf Path: Wisconsin >> AOS >> 101 Fall, 2009 Description: Economic Note October 2004 Earth warming myth President Putin of Russia announced that finally he would ratify the Kyoto Protocol after claiming the opposite for months. Irrespective of the reason for this change of mind, Russia\'s ratification of th... Date Added: 2009-06-13 06:46:19 |
| DC1Plus.pdf Path: Toledo >> CET >> 1100 Fall, 2008 Description: ... Date Added: 2009-06-13 06:46:26 |
| Lesson Plan 1.pdf Path: Wisc Stevens Point >> ERICH >> 883 Fall, 2009 Description: Lesson Plan 1 - Indoors Life Cycle of a Monarch Butterfly Rationale and Concepts Monarch butterflies are a great way to let students experience the life cycle of a butterfly. This lesson will give students the building blocks needed to understand t... Date Added: 2009-06-13 06:46:37 |
| Asg1.doc Path: Eastern Washington University >> CSCD >> 327 Fall, 2009 Description: Exercise on Mathematical Induction DUE: Monday, 9 April 2001 Complete the inductive proof of the following: Tim Rolfe S(n) = k 3 = k =1 n 1 2 n 4 ( n + 1 ) 2 for all n 1 (1)( 4 ) (1) Basis: S(1) = 13 = 1 1 2 1 2 = 1 ( 1+1 ) = 4 4 (2) Inductio... Date Added: 2009-06-13 06:49:07 |
| Increasing Behavior.ppt Path: San Jose State >> KIN >> 178 Fall, 2008 Description: Reinforcement Always functions to increase behavior. There must be a functional relationship between the behavior and the consequence (reinforcement). A maintenance or increase of the desired behavior must be observed in the future. Positive reinfor... Date Added: 2009-06-13 06:51:18 |
| Chapter6.pptx Path: UNC Charlotte >> MBAD >> 7090 Spring, 2008 Description: Chapter 6: IT Planning and Controlling MBAD 7090 Click to edit Master subtitle style 1 1 IS Security, Audit, and Control (Dr. Zhao) Fall, 2008 Objectives Governance Processes Project Planning and Control in SDLC E-Commerce Security Management 2 ... Date Added: 2009-06-13 06:53:51 |
| Ch27.pdf Path: N.C. A&T >> C >> 600 Fall, 2009 Description: Internet Systems Chapter 27. CGI and Perl CGI (Common Gateway Interface) lets HTTP clients interact with programs across a network through a workstation. CGI is a standard for interfacing applications with a Web server. CGI applications can be writt... Date Added: 2009-06-13 06:54:02 |
| Art History 106 chapter 17.doc Path: N.E. Illinois >> ART >> 106 Fall, 2009 Description: Art History 106 Chapter 17, Romanesque Art Vocabulary Alternative Support System, Compound piers, Narthex, Clerestory Ambulatory, Springing, Groined Vault, Ribbed Vault, Buttress, Tympanum, Trumeau Images Interior of Saint-Etienne, Vignory, France, 1... Date Added: 2009-06-13 06:54:11 |
| t15ApprentissageNonSupervise2_6.ps Path: Neumont >> IFT >> 3390 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: t15ApprentissageNonSupervise2.dvi %Pages: 5 0 %PageOrder: Ascend %BoundingBox: 0 0 612 459 %DocumentFonts: Times-Roman Helvetica CMSY10 Symbol Times-Italic CMR10 %+ T... Date Added: 2009-06-13 06:55:12 |
| YER044C-A.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YER >> 044 Fall, 2009 Description: YER044C-A.t2k CB_BURIAL_14_7 2 1 AAAAA AA AAAA D B X X X X X AAA B BCA BBBBCACBBBBBBBBB C C X X X X X X CCC C CDCDDDDDDDDDDXXXXEEEXEF C C C C C D X X X X X X X X X X D F E F F G E FF GGFFE A ABB AABAA B BB AB B BA BCC BBCBB A C C C CC XCDDCCXX... Date Added: 2009-06-13 07:01:37 |
| Review_Model_Hotel_Revenue.xlsx Path: Uni. Westminster >> AJT >> 1230 Fall, 2009 Description: NumberofDays NumberofRooms OccupancyRates DailyPrice VariableCost FixedCost NumberofRoomDays 365 100 95% $105 $35 $500,000 34,675 75% $135 55% $175 Revenue VariableCost FixedCost NetProfit 27,375 20,075 HighRates MidRates LowRates $3,640,875 $... Date Added: 2009-06-13 07:03:31 |
| YBR198C.t2k.alpha-logo.pdf Path: UCSC >> YBR >> 198 Fall, 2009 Description: YBR198C.t2k ALPHA 3 2 1 H X H H X X H H X X H X X X X X X X X X X X X X H H H H H H H H H H H H H H X X X H H X S E H X XXXXX H H H I E E H H H H H H X X X XXXXXXXXXXX H H H H H H BB B C C E E XXXXXXXX S B E B E E C H... Date Added: 2009-06-13 07:09:07 |
| YBR154C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YBR >> 154 Fall, 2009 Description: YBR154C.t2k EBGHTL 3 2 1 CC H X T TTTHTT H X X X X 1 10 20 30 40 H 3 2 1 T H H T TTCCGGEE T TEG CCT X C E E T E C C T T X X X X X X X X X X X TCCTCC E 51 60 70 80 90 G 3 2 1 H T T E C E T E T T H HH CCC TT E T X X X X X X ... Date Added: 2009-06-13 07:10:27 |
| DENR+CRW+2008+Registration+Form.pdf Path: UNC >> READ >> 4769590 Fall, 2009 Description: COASTAL STORMWATER RULE REVISION WORKSHOPS The new stormwater rules become effective Oct. 1, 2008. Learn how the revisions will impact you and your work in coastal communities. These workshops are free and open to the public. Who should attend? This ... Date Added: 2009-06-13 07:12:43 |
| beveridge_march.pdf Path: Wisconsin >> HIST >> 102 Fall, 2009 Description: 1 \"The March of the Flag\" (1898)1 Albert J. Beveridge It is a noble land that God has given us; a land that can feed and clothe the world; a land whose coastlines would inclose half the countries of Europe; a land set like a sentinel between the two... Date Added: 2009-06-13 07:12:56 |
| 35.pdf Path: Michigan State University >> LIB >> 1988 Fall, 2009 Description: ... Date Added: 2009-06-13 07:14:21 |
| YOR031W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YOR >> 031 Fall, 2009 Description: YOR031W.t2k EBGHSTL 3 2 1 CE X 10 20 30 40 E 3 2 1 S S S S S S S S T T E E T S T S CEEEEEEEC CCE C C ECCCCCCCEC X X X X XXXXXXXXXXT C E C X X X C E E E S C H X 51 E 60 CK CET TCTCEKSK CNCEKC C X 50 1 TTC T S S MT VKI CDCEG... Date Added: 2009-06-13 07:15:13 |
| YML091C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YML >> 091 Fall, 2009 Description: YML091C.t2k DSSP-EHL2 2 1 C C X X 1 10 20 30 40 E 2 1 X X X X T E H E T H E H E H T C CHH C E E E E X X H CCCCC E EEE CCHHH CCCCCXXCCC E X X X E E X X X X H X C X CCCCCCCC X X X X X X X H C H C H C H C E H H H H H H X X X ... Date Added: 2009-06-13 07:15:57 |
| YML085C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YML >> 085 Fall, 2009 Description: YML085C.t2k DSSP-EHL2 2 1 E CCE C 1 E 2 1 X X X X X X X X X X 10 20 30 40 S T H T T H T CCCCCCC E E 51 60 70 80 90 E 2 1 T S E T G E H T S T G T G E T CC C CXCCCXXC X X X X T 2 1 T H S T E S T H HHHHHHHHHH C C ... Date Added: 2009-06-13 07:16:45 |
| slac-pub-10440.pdf Path: Stanford >> PUBS >> 10250 Fall, 2009 Description: SLACPUB10440 May, 2004 hep-ph/0405214 The Contribution from Neutrino Yukawa Couplings to Lepton Electric Dipole Moments Yasaman Farzan1,2,3 and Michael E. Peskin1,3 Stanford Linear Accelerator Center 2575 Sand Hill Road, Menlo Park, California 94025... Date Added: 2009-06-13 07:17:10 |
| 6_lab3_debugging_control.ppt Path: University of Illinois, Urbana Champaign >> BUSINESS >> 458 Fall, 2009 Description: Lab 3: Control Structures and Debugging In this lab, we will: Run loops and condition statement; Learn debugging guidelines; Identify possible errors in loops and learn how to debug them Control Statements Selection structure: Loops: ... Date Added: 2009-06-13 07:18:30 |
| proj04d2.pdf Path: Old Dominion >> PHYS >> 811 Fall, 2008 Description: 10 8 6 4 2 0 69 monomers y -2 -4 -6 -8 -10 -2 0 2 4 6 8 10 12 14 16 18 x ... Date Added: 2009-06-13 07:18:33 |
| 2005929_r01o_0201486.pdf Path: Stanford >> JDSU >> 1023 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 In re: JDS UNIPHASE CORPORATION SECURITIES LITIGATION No. C-02-1486 CW (EDL) ORDER RE: PLAINTIFF HOUSTON MUNICIPAL EMPLOYEES PENSION SYSTEMS MOTION FOR PROTECTIVE ORDER / On September 26, 2005, the Court received Plaintiff Housto... Date Added: 2009-06-13 07:18:41 |
| 64t3n200g02.pdf Path: Stanford >> DATAANALYS >> 040730 Fall, 2009 Description: ... Date Added: 2009-06-13 07:19:43 |
| Decision.pdf Path: Caltech >> EC >> 123 Spring, 2008 Description: CALIFORNIA INSTITUTE OF TECHNOLOGY Division of the Humanities and Social Sciences Aspects of normative decision theory KC Border Spring 1984; Revised Fall 2007 v. 2009.01.16.15.50 Normative decision theory attempts to answer the question, How can I... Date Added: 2009-06-13 07:30:46 |
| anisogeny.pdf Path: Texas >> ACE >> 375 Fall, 2009 Description: An old problem in biology is anisogeny that is, not-equal-size-gametes. Many species, including humans but most obviously including chickens have eggs that are enormously larger than the sperm that fertilize them. The egg contains materials needed ... Date Added: 2009-06-13 07:52:18 |
| Chapter 11 Part 8.pdf Path: Mt. Marty >> PH >> 1726 Fall, 2009 Description: Regression Chapter 11 Part 8 Confidence Bands Comparison of the Slopes of two lines Regression with a zero y-intercept March 3, 2009 Goal: The goal of this lecture is to give the Stata commands that will allow you to create $ confidence intervals a... Date Added: 2009-06-13 07:52:49 |
| ps9.pdf Path: Kentucky >> PA >> 600 Fall, 2009 Description: PHY 600 Problem Set #9 due 1 May 2009 1. Hartle 18-16. 2. Hartle 18-17. 3. Hartle 18-18. 4. This problem explores the flat Robertson-Walker metric of eq. (18.1). (a) Using Hartles Mathematica notebooks, evaluate the Christoffel, Ricci curvature, and... Date Added: 2009-06-13 08:15:02 |
| YGL031C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YGL >> 031 Fall, 2009 Description: YGL031C.t2k EBGHSTL 3 2 1 C X 1 10 20 30 40 E 3 2 1 T S T S E T E H T G T G H H E T T H C H H H H H H H T S S S X X X X X X X X X X X X X XXXXXCX X 51 60 70 80 90 T 3 2 1 H H T H HHHHHHHHHHHHHHHHHHHHHHHH X X T T X X X ... Date Added: 2009-06-13 08:26:19 |
| 690f032.rtf Path: Maryland >> UMIACS >> 690 Fall, 2003 Description: Networks Week 2 LBSC 690 Information Technology Computer Systems Hardware Types of hardware Storage hierarchy Moore\'s law Software Types of software Types of interfaces Types of Software Application programs (e.g., Internet Explorer) What ... Date Added: 2009-06-13 08:32:32 |
| n2_caruso.pdf Path: Pittsburgh >> AEI >> 611 Fall, 2009 Description: Universit degli Studi di Catania Facolt di Giurisprudenza Bruno Caruso Decentralised Social Pacts, Trade unions and collective bargaining (how Labour Law is changing) WP C.S.D.L.E. Massimo DAntona N. 2 / 2002 2002 Bruno Caruso 2002 Faculty of La... Date Added: 2009-06-13 08:33:12 |
| JVMvsCLR.pdf Path: Seattle >> ECIS >> 464 Fall, 2009 Description: JVM versus CLR: A Comparative Study Jeremy Singer University of Cambridge Computer Laboratory William Gates Building, 15 JJ Thomson Avenue Cambridge, CB3 0FD, UK jeremy.singer@cl.cam.ac.uk ABSTRACT We present empirical evidence to demonstrate that ... Date Added: 2009-06-13 08:33:36 |
| Schacterimplicitmem87.pdf Path: North Texas >> RSS >> 5640 Fall, 2009 Description: Journal of Experimental Psychology: Learning, Memory,and Cognition 1987, Vol. 13, No. 3. 501-518 Copyright 1987 by the American PsychologicalAssociation, Inc. 0278-7393/87/$00.75 CRITICAL REVIEW Implicit Memory: History and Current Status Daniel L... Date Added: 2009-06-13 08:34:21 |
| ch4.pdf Path: SMU - Cox School of Business >> SE >> 7312 Fall, 2009 Description: Project management l Organising, planning and scheduling software projects Ian Sommerville 2000 Software Engineering, 6th edition. Chapter 4 Slide 1 Objectives l l l l To introduce software project management and to describe its distinctive ... Date Added: 2009-06-13 08:40:05 |
| Lecture 11.ppt Path: Acton School of Business >> BIOE >> 322 Fall, 2009 Description: Lecture 11 HodgkinHuxleyModel Review of Lecture 10 OrganizationofNervousSystem ConstituentCellsofNervousSystem ElectricalSignalsinNeurons SourceofRestingMembranePotential GatedIonChannels GradedPotential ActionPotential RefractoryPeriod ... Date Added: 2009-06-13 09:01:16 |
| CS_32_pg2 Path: UCLA >> CS >> 32 Winter, 2009 Description: ... Date Added: 2009-06-14 02:34:29 |
| ANTH 1001 3-13 Path: LSU >> ANTH >> 1001 Spring, 2009 Description: (Macaca silenus) http:/www.arkive.org/species/GES/mammals/Macaca_silenus_00.html?movietpe=qMed Subfamily Colobinae: colobine monkeys Diet is folivory: specialized diet of mature leaves Anatomy: Taxanomic infraorder- Catarrhini Catarrhini: Cercopithec... Date Added: 2009-06-14 12:11:13 |
| YGR257C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YGR >> 257 Fall, 2009 Description: YGR257C.t2k EBGHSTL 3 2 1 CC X H S H H H H H H S S T H C H S S T C E T T T S X X X X X X X X X X X X X CCCCC C CCH H 1 10 20 30 40 H 3 2 1 TC C C C C H T C CCC C C TCSSTSCC C C C C C T C C C C C C C C T T C C C C C STTSTS XXXXXXXXXXXXXS... Date Added: 2009-06-14 22:51:35 |
| YGR227W.t2k.w0.5-logo.pdf Path: UCSC >> YGR >> 227 Fall, 2009 Description: YGR227W.t2k w0.5 5 4 3 2 1 M L E I N V D E I H L XXXX 1 F X XXXXXXXXXXXXXXXXXXXX E P Q A R N D Y L E L I V W L I P A F G E D S Q S X T I V V V L L V G Y L M I T A X XX X X X X XXX M I L L F X R T XX P X X L I L X G V S L ... Date Added: 2009-06-14 22:52:01 |
| Chapter26.pdf Path: Bowling Green >> PHYS >> 2212 Fall, 2009 Description: Chapter 26. Electric Charges and Forces The electric force is one of the fundamental forces of nature. Controlled electricity is the cornerstone of our modern, technological society. Chapter Goal: To develop a basic understanding of electric phenomen... Date Added: 2009-06-14 22:52:46 |
| Position_Thompson.doc Path: UNC Greensboro >> POSITIONIN >> 0501 Fall, 2009 Description: Marcia Thompson Positioning and Targeting Case MBA606.01 S01 Professor Roehm Pledged Thompson - 1 _Marcia C. Thompson_ Positioning and Targeting Case National Hardware 18V variable speed cordless drill Introduction National Hardware has developed ... Date Added: 2009-06-14 22:56:05 |
| sm2_10.pdf Path: Michigan >> EECS >> 270 Fall, 2008 Description: Excerpts from this work may be reproduced by instructors for distribution on a not-for-profit basis for testing or instructional purposes only to students enrolled in courses for which the textbook has been adopted. Any other reproduction or translat... Date Added: 2009-06-14 23:26:25 |
| Intro2_old.ppt Path: Oregon State >> CS >> 540 Fall, 2008 Description: Languages Host Languages C, C+ Java, C# PHP, Python Data Sublanguages (DSLs) SQL Data Definition Language (DDL) Used to define the structure of a database Data Manipulation Language (DML) Used to access and manipulate data CODA... Date Added: 2009-06-14 23:33:03 |
| POLSC 370B HIST 352 Plan Fall 2008.pdf Path: Ashland >> CBURKET >> 370 Fall, 2009 Description: POLSC 370B / HIST 352: The American Founding MW 3:00-4:15 PM Fall 2008 Christopher C. Burkett COURSE PURPOSE AND OBJECTIVES: The purpose of this course is to better understand the American political mind as it was during the Founding Era. Through a... Date Added: 2009-06-14 23:33:22 |
| telnet2.txt Path: NMSU >> SH >> 460 Fall, 2009 Description: #!/bin/sh # telnet2.sh | telnet > file1 host=127.0.0.1 port=23 login=steve passwd=hellothere cmd=\"ls /tmp\" timeout=3 file=file1 prompt=\"$\" echo open ${host} ${port} sleep 1 tout=${timeout} while [ \"${tout}\" -ge 0 ] do if tail -1 \"${file}\" 2>/de... Date Added: 2009-06-14 23:33:35 |
| Excel project 1 Surveys.xls Path: N. Georgia >> CS >> 1100 Fall, 2009 Description: Survey Results $160.00 $140.00 $120.00 $100.00 Price $80.00 Column E Column G $60.00 $40.00 $20.00 $male male male male male male male male male female female female female female female female female female female female female female fema... Date Added: 2009-06-14 23:35:39 |
| exam 4 fall 2007 key.doc Path: Michigan >> CHEM >> 402 Fall, 2008 Description: Your Name_Key_ Chem 402 Exam 4 Monday, December 10, 2007 Topic 1. Isolobal analogy 2. Redox chemistry 3. Electron transfer reactions . Total pts possible 25 25 25 pts awarded . 75 Welcome to the fourth Chemistry 402 examination. This 9 page exam... Date Added: 2009-06-14 23:35:53 |
| 3540p3.fall2006.doc Path: UNF >> COP >> 3540 Spring, 2008 Description: COP 3540 Data Structures with OOP Project 3 - Fall 2006 Due: 1 November 2006 Doubly-Linked Lists Using NetBeans 5.0, you are to write a Java program using OOP principles to accommodate the following functionality Assignment #3 Objectives: Provide ... Date Added: 2009-06-14 23:36:38 |
| syllabusF07.pdf Path: Iowa State >> STAT >> 401 Fall, 2008 Description: S TAT 401 F S TATISTICAL M ETHODS FOR R ESEARCH W ORKERS FALL 2007 Instructor: Dr. Petrutza Caragea email address: pcaragea@iastate.edu Office: 314 Snedecor Hall Course Website:www.public.iastate.edu/~pcaragea/stat401 Fax: 294-4040 Phone: 294-558... Date Added: 2009-06-14 23:38:26 |
| mat271test1.pdf Path: ASU >> MAT >> 271 Fall, 2009 Description: 2004 ASU Mathematics MAT 271 Test 1 Ch 7 Surgent Math 271 Test 1 Chapter 7 Surgent Label Directions: Show all steps and clearly circle your final result. Answers without supporting work will lose credit. Please be neat. This test has 4 page... Date Added: 2009-06-14 23:40:11 |
| quiz6.pdf Path: UConn >> MATH >> 107 Fall, 2009 Description: Your Name: Math 107Q: Fall 2006 Instructor: Amy Turlington Quiz 6 Show all of your work to receive full credit. Do not simplify your answers. Solve each of the following equations for x. 1. ex = 30 2. 30.05x = 10 3. ln(2x 7) = 1 3 4. 2 log5 (x2 ... Date Added: 2009-06-14 23:40:39 |
| LING100ALL.TXT Path: Sveriges lantbruksuniversitet >> LING >> 19983 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: LING 100-3 ALL SECTIONS LOCATION: SFU DOW TITLE: CMNS 3 students... Date Added: 2009-06-14 23:40:54 |
| sup9.pdf Path: Washington University in St. Louis >> JEE >> 2330 Fall, 2009 Description: JEE2330 Spring 2009 Lab #9 Values and Notes Experimental Procedure: 9.6.2 Differentiator Omit Report: 9.9.4 (a) 9.9.5 9.9.6 (a) 9.9.7 (a) Derivation Omit Differentiator Omit Theoretical relationship between R, C, and T Omit Theoretical period T... Date Added: 2009-06-14 23:41:03 |
| Badique_bib.doc Path: Washington >> TCSS >> 598 Fall, 2009 Description: TCSS 598 Robert Bunge @article{Badiqu:02, author = { Badiqu, Eric}, title = {New imagining frontiers: 3D and mixed reality }, journal = { First International Symposium on 3D Data Processing Visualization and Transmission (3DPVT\'02 )}, year = {2002}... Date Added: 2009-06-14 23:41:15 |
| programmespecificationf102.pdf Path: East Los Angeles College >> PROGSPECS >> 200506 Fall, 2009 Description: Programme Specification MChem Chemistry (F102) [October 2005] Summary Title of Programme: Awards: MChem BSc Hons DipHE CertHE JACS Code(s): Date of First Intake Frequency of Intake: Duration and Mode of Study: Faculty: Parent Department: Other Con... Date Added: 2009-06-14 23:42:00 |
| Practical_Rock_Engineering_on_site_course.pdf Path: Allan Hancock College >> PAGE >> 2161 Fall, 2009 Description: Australian Centre for Geomechanics CSIRO Curtin University University of WA Joint Venture On-Site Geomechanics Training: Practical Rock Engineering Skills Development Ground Control Systems Training Course Rock Mass Characterisation Training Course ... Date Added: 2009-06-14 23:47:11 |
| assignment3.ps Path: Duke >> X >> 271 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: assignment3.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: cmr17 cmr12 cmbx12 cmr10 cmcsc10 cmmi10 cmti10 cmsy10 %DocumentPaperSizes: ... Date Added: 2009-06-15 00:14:47 |
| simplejogglehelp.txt Path: Duke >> X >> 108 Fall, 2009 Description: This program illustrates a simple GUI that can easily be transformed into an applet. It also shows how to use resources to read from a jar file instead of reading from the environments file system. For applets, the jar file can be loaded over the ... Date Added: 2009-06-15 00:15:07 |
| LinkedListBasics.pdf Path: Virginia Tech >> CS >> 2574 Fall, 2009 Description: Linked List Basics By Nick Parlante Copyright 1998-99, Nick Parlante Abstract This document introduces the basic structures and techniques for building linked lists with a mixture of explanations, drawings, sample code, and exercises. The material ... Date Added: 2009-06-15 00:16:49 |
| RegularExpressions.ppt Path: W. Kentucky >> CIT >> 383 Fall, 2009 Description: CIT 383: Administrative Scripting Regular Expressions CIT 383: Administrative Scripting Slide #1 Topics 1. 2. 3. 4. Creating Regexp objects Regular expression syntax Pattern matching Substitution CIT 383: Administrative Scripting Regular Express... Date Added: 2009-06-15 00:41:44 |
| 1A_lecture1.pdf Path: UCSD >> PH >> 246 Fall, 2009 Description: ... Date Added: 2009-06-15 00:42:18 |
| hmksol4.pdf Path: UCSD >> PH >> 246 Fall, 2009 Description: Physics 8 - Homework set #4 due Friday 4-30-98 Please box your final answers, also write neatly and double check the units of your answer! Special Info: On problem 2, Phoebe pulls with a constant force of 100 N instead of 150 N Discussion Questions 1... Date Added: 2009-06-15 00:42:34 |
| final.pdf Path: ASU >> TEACH >> 442 Fall, 2009 Description: e \'w f x x i g 0 muvt # e } dv 0 i ih v6 h 0 mE% st & ... Date Added: 2009-06-15 00:53:19 |
| errata01.pdf Path: ASU >> TEACH >> 371 Fall, 2009 Description: page 8, line 11: x BF (A B) should be x BF (A B) page 10, line 11: x y = x + (x) should be x y = x + (y) page 11, line 3: x < 0 and y < 0 should be x < 0 and y > 0 1 ... Date Added: 2009-06-15 00:53:39 |
| tut_12.pdf Path: Allan Hancock College >> ICS >> 136 Fall, 2009 Description: MATH136 Semester 1 2007 Week 12 Tutorial Exercises 1. Recall the following steps in using the nite difference method to obtain an approximate solution to a linear differential equation y (x) + p(x)y (x) + q(x)y(x) = r (x), with boundary conditions... Date Added: 2009-06-15 01:03:14 |
| lp.4up.pdf Path: Princeton >> CS >> 226 Fall, 2009 Description: /LQHDU 3URJUDPPLQJ /LQHDU 3URJUDPPLQJ :KDW LV LW\" s 4XLQWHVVHQWLDO WRRO IRU RSWLPDO DOORFDWLRQ RI VFDUFH UHVRXUFHV DPRQJ D QXPEHU RI FRPSHWLQJ DFWLYLWLHV 3RZHUIXO DQG JHQHUDO SUREOHPVROYLQJ PHWKRG VKRUWHVW SDWK PD[ IORZ PLQ FRVW IORZ PXOWLFRPPRGL... Date Added: 2009-06-15 01:09:00 |
| lect01.pdf Path: Duke >> X >> 097 Fall, 2009 Description: Todays topics AI History of Robotics Uses of robots The RCX ROBOLAB Upcoming Basic control Kinematics Robot architectures Mindstorms 1.1 What is AI? How do minds work? Is it possible for machines to act intelligently in the way that ... Date Added: 2009-06-15 01:11:47 |
| 4l13.pdf Path: Duke >> X >> 100 Fall, 2009 Description: r c = (Counter) map.get(s); Tree exercises Searching, Maps,Tries (hashing) Build a tree Searching is a fundamentally important operation People standing up are nodes that are currently in the tree Point at a sitting down person to make ... Date Added: 2009-06-15 01:12:12 |
| MadeUpTask.doc Path: Berkeley >> I >> 247 Fall, 2009 Description: MadeUpTask 11/18/00 Produced by Sacha Pearson, Kim Garrett, and Jennifer English Now that you are familiar with the content of the database, please make up your own task similar to the tasks you saw above. Please state your task below. Then try to ... Date Added: 2009-06-15 01:19:02 |
| selection-individuals.txt Path: Iowa State >> COMS >> 641 Fall, 2009 Description: CS 641 Lecture -*- Outline -*- * selection and individuals (7.5) To allow formulation of arithmetic, we need two more postulates for higher-order logic. Need a time with an infinite number of elements, and the ability to choose one element... Date Added: 2009-06-15 01:19:33 |
| MAE589hmwk1.pdf Path: SUNY Buffalo >> MAE >> 589 Fall, 2009 Description: ... Date Added: 2009-06-15 01:20:31 |
| PJ_2(5_layoutsD.2).pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: Museum of Contemporary Art C h i c a g o Alexander Calder in Focus Exhibition July 28, 2007March 1, 2009 View Calder\'s mobiles, stabiles, drawings and paintings in this small exhibition. These works, dating from 1927 to 1968, demonstrate the artist... Date Added: 2009-06-15 02:10:37 |
| 301t1d_99f.mws.rtf Path: University of Louisville >> MATH >> 301 Fall, 2008 Description: Math 301 Test 1d Fall 1999 To receive full credit you must show sufficient work to indicate that you understand the mathematical issues of each problem, resolve those issues using the concepts and procedures discussed in this course and prerequis... Date Added: 2009-06-15 02:14:26 |
| syllabus 2007 Spring.pdf Path: Washington >> CHEM >> 428 Fall, 2008 Description: Spring 2006 Chem 428 CHEMISTRY 428 BIOINSTRUMENTAL ANALYSIS Spring Quarter 2007 1 Instructor Lecture Text Webpage Norman J. Dovichi Chem Library, Room 131 Office Hours: by appointment dovichi@chem.washington.edu MW/F 11:30 AM - 12:20 PM, Bagley... Date Added: 2009-06-15 02:14:45 |
| LinkedListBasics.pdf Path: Virginia Tech >> CS >> 2704 Summer, 2002 Description: Linked List Basics By Nick Parlante Copyright 1998-99, Nick Parlante Abstract This document introduces the basic structures and techniques for building linked lists with a mixture of explanations, drawings, sample code, and exercises. The material ... Date Added: 2009-06-15 02:23:25 |
| contolshw5 Path: UT Arlington >> MAE >> 4310 Fall, 2007 Description: Problem 1 (a) > num = [1 1.2 3.1]; > den = [1 11 13 30]; > [r,p,k] = residue(num,den) r= 0.9796 0.0102 - 0.0018i 0.0102 + 0.0018i p= -10.0000 -0.5000 + 1.6583i -0.5000 - 1.6583i > sys1 = tf(num,den) Transfer function: s^2 + 1.2 s + 3.1 --s^3 + 11 s^2... Date Added: 2009-06-15 02:26:11 |
| PJ_2(5_layoutsD.2).pdf Path: San Diego State >> ART >> 242 Fall, 2008 Description: Museum of Contemporary Art C h i c a g o Alexander Calder in Focus Exhibition July 28, 2007March 1, 2009 View Calder\'s mobiles, stabiles, drawings and paintings in this small exhibition. These works, dating from 1927 to 1968, demonstrate the artist... Date Added: 2009-06-15 02:51:52 |
| MODULE4.pdf Path: East Los Angeles College >> CL >> 0708 Fall, 2009 Description: MODULE 4 - SHEET 1 public class Bases { public static void main(String[] args) { System.out.printf(\"65 is %d%n\", System.out.printf(\"0x41 is %d%n\", System.out.printf(\"0101 is %d%n\", System.out.printf(\"(int)A is %d%n\", } } 65); 0x41); 0101); (int)A);... Date Added: 2009-06-15 02:55:02 |
| lu1998.pdf Path: Stanford >> CBIO >> 241 Fall, 2009 Description: Cell, Vol. 95, 981991, December 23, 1998, Copyright 1998 by Cell Press lin-35 and lin-53, Two Genes that Antagonize a C. elegans Ras Pathway, Encode Proteins Similar to Rb and Its Binding Protein RbAp48 Xiaowei Lu and H. Robert Horvitz* Howard Hughe... Date Added: 2009-06-15 03:04:45 |
| handouts_Notes_Weeks_1_to_2.pdf Path: Washington >> CHEM >> 484 Fall, 2008 Description: Chem 484 Lecture Notes, Weeks 1-2 1. Lattice: A lattice is a periodic array of \"dots\" (or lattice points). It is a mathematic abstraction used to describe the translational symmetry of a periodic (or extended) structure. The translational symmetry im... Date Added: 2009-06-15 03:27:39 |
| NCSUFrench101Syllabus Path: N.C. State >> FLF >> 101 Spring, 2009 Description: FLF 101 (M-F) Summer I 2009 COURSE INFORMATION Instructor\'s Name: Chuck Johnson, PhD Office: Withers 307 Phone: 360-6725 E-mail: cljohns8@ncsu.edu Webpage: http:/www4.ncsu.edu/~cljohns8/ Office hours: For adverse weather and emergency situation infor... Date Added: 2009-06-16 11:49:22 |
| ws02-09.pdf Path: Rose-Hulman >> MA >> 112 Fall, 2009 Description: MA 112 - Calculus II Worksheet # 9 Professor Broughton Name: Euler\'s method 1. Solve the initial value problem y = -y , y(1) = 1 x Box #: 2. Fill in the table Euler\'s method with a step size of 0.5 and predict the value at x = 3 n xn yn yn 0 1 1 1 2... Date Added: 2009-06-16 13:37:15 |
| COSI118old.pdf Path: LeMoyne-Owen >> COSI >> 118 Fall, 2009 Description: LEMOYNE-OWEN COLLEGE DIVISION OF NATURAL AND MATHEMTICAL SCIENCES Syllabus for COSI 118 INTRODUCTION TO MICROCOMPUTERS Fall Semester, 2005 Text: Class Meeting: Instructor: Capron and Johnson, Computers: Tools for an Information Age, Eighth Edition, P... Date Added: 2009-06-16 13:38:35 |
| ppc405block_ref_guide.pdf Path: Cal Poly >> CPE >> 329 Fall, 2009 Description: PowerPC 405 Processor Block Reference Guide Embedded Development Kit EDK (v3.2.1) April 1, 2003 R PowerPC 405 Processor Block Reference Guide www.xilinx.com 1-800-255-7778 EDK (v3.2.1) April 1, 2003 R \"Xilinx\" and the Xilinx logo shown above a... Date Added: 2009-06-16 13:38:36 |
| output.txt Path: Washington >> V >> 12314 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2884 12/04/2007 12:15 AM <DIR> . 12/04/2007 12:15 ... Date Added: 2009-06-16 13:39:08 |
| 19440804_0000035768.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: Telegram No. Dated: August 4 , 1944. D\'ETAT SECdTATE WASHINGTON \'LATCH. Repeated t o London and A l g i e r s . K i s s f o r first time s i n c e M i n i s t e r h e r e i s now r e c e i v i n g r e p o r t s e x p l a i n i n g p o l i c y of B... Date Added: 2009-06-16 13:39:43 |
| sol.ps Path: CSU Channel Islands >> M >> 210 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: sol.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips sol.dvi -o sol.ps %DVIPSParame... Date Added: 2009-06-16 13:40:10 |
| tj.pt11.2009042712.txt Path: U. Houston >> SERVER >> 2009042712 Fall, 2009 Description: 2 REAL 9 4 27 0 0 REAL 9 4 27 0 0 4BACKWARDOMEGA 9 4 27 12 30.412 -89.081 10.0 9 4 27 12 30.412 -89.081 500.0 9 4 27 12 30.412 -89.081 10... Date Added: 2009-06-16 13:40:35 |
| Social Control Theory and Delinquency.pdf Path: Colorado >> SOCY >> 7004 Fall, 2008 Description: HeinOnline - 23 Criminology 47 1985 HeinOnline - 23 Criminology 48 1985 HeinOnline - 23 Criminology 49 1985 HeinOnline - 23 Criminology 50 1985 HeinOnline - 23 Criminology 51 1985 HeinOnline - 23 Criminology 52 1985 HeinOnline - 23 Criminology ... Date Added: 2009-06-16 13:44:54 |
| homework.pdf Path: E. Kentucky >> MATH >> 647 Fall, 2009 Description: Math 647 Homework Assignment # 1 due Thursday, 8/25/05 Reading 1.1, 1.2, 1.3, 1.4, 1.5 Problems 1.1 3, 4, 12; 1.2 3, 7; 1.3 5 Math 647 Homework Assignment # 2 due Thursday, 9/1/05 Reading 1.6, 2.1 Problems 1.3 1; 1.4 2; 1.6 1, 2, 6 Math 647 Homewor... Date Added: 2009-06-16 13:45:06 |
| Program7_1.pdf Path: UCF >> EGN >> 3210 Fall, 2009 Description: 7.1 Example Plotting a Function The following program plots the function #include #include #define #define double \"stdio.h\" \"math.h\" FALSE 0 TRUE !FALSE max,min,k; f ( x) = sin(3x) . double f(double x) { return sin(3 * x); } int v(double y) { retu... Date Added: 2009-06-16 13:45:08 |
| tj.500m.2009041312.txt Path: U. Houston >> SERVER >> 2009041312 Fall, 2009 Description: 2 REAL 9 4 13 0 0 REAL 9 4 13 0 0 12BACKWARDOMEGA 9 4 13 12 29.696 -95.499 500.0 9 4 13 12 29.670 -95.129 500.0 9 4 13 12 30.039 -94.075 5... Date Added: 2009-06-16 13:45:18 |
| startStopContinue.doc Path: Kennesaw >> SCIENCE >> 3310 Fall, 2009 Description: CSIS3310 - Feedback (use back for any additional comments) What would you like me to start doing that I havent done yet (or do more of) ? What would you like me to stop doing (or do less of) ? What would you like me to continue doing ? Additional ... Date Added: 2009-06-16 13:45:51 |
| K6E0808C1C.pdf Path: Allan Hancock College >> CSEE >> 348206975 Fall, 2009 Description: PRELIMINARY K6E0808C1C-C Document Title 32Kx8 Bit High Speed Static RAM(5V Operating), Evolutionary Pin out. CMOS SRAM Revision History Rev No. Rev. 0.0 Rev. 1.0 History Initial release with Preliminary. Release to final Data Sheet. 1. Delete Preli... Date Added: 2009-06-16 13:48:22 |
| odl.ps Path: U. Houston >> CS >> 6340 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: slides17.dvi %Pages: 19 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: ZapfDingbats %EndComments %DVIPSCommandLine: /usr/local/bin/dvips -f slides17... Date Added: 2009-06-16 13:48:44 |
| The beauty of Alton Baker.doc Path: Oregon >> J >> 408 Fall, 2008 Description: The beauty of Alton Baker Park By Arikka Hall While the city of Eugene, Ore. boasts over 30 parks within city limits, I have been taken with one park in particular; Alton Baker Park. This beautiful park is located along the Willamette River and offer... Date Added: 2009-06-16 13:50:14 |
| SubmitCutoff.txt Path: Scranton >> C >> 344 Spring, 2009 Description: 20090505_235959 ... Date Added: 2009-06-16 13:50:48 |
| 02-alphabets-languages-DFAs.pdf Path: University of Illinois, Urbana Champaign >> CS >> 475 Fall, 2008 Description: ... Date Added: 2009-06-16 13:51:36 |
| HW8.pdf Path: Rose-Hulman >> ECE >> 571 Fall, 2009 Description: ECE571 CONTROL OF POWER SYSTEMS Homework # 8 1. a) Why is it important that the open-loop gain of a turboalternator\'s voltage regulator be high? What considerations should be given to selecting the open-loop gain? The block diagram of a voltage regul... Date Added: 2009-06-16 13:51:39 |
| YIL153W.t2k.alpha-logo.pdf Path: UCSC >> YIL >> 153 Fall, 2009 Description: YIL153W.t2k ALPHA 2 1 B H X X X H H 1 10 20 30 40 H 2 1 E H E B H I S E B E B I H B S T S B HBBB BB H C B S AEEAB BECB S C E SCEEBBDS E C E F E C E I H C A I I B IIIX I G IIIIIIIIIIISIIIXXXGXXCXXXXXXXIXXXII XCXXXXX X XXXXX X X H I B H ... Date Added: 2009-06-16 13:52:45 |
| log.txt Path: Washington >> V >> 22000 Fall, 2009 Description: 000 (34035.000.000) 12/24 09:29:46 Job submitted from host: <128.95.94.28:1084> . 001 (34035.000.000) 12/24 14:32:12 Job executing on host: <172.25.101.165:1059> . 006 (34035.000.000) 12/24 14:52:21 Image size of job updated: 426616 . 005 (34035.000.... Date Added: 2009-06-16 13:55:39 |
| Native Americans & Electoral Process.pdf Path: Evergreen >> MPAFIRSTYE >> 0607 Fall, 2009 Description: The Emerging role of Native Americans in the American Electoral Process Russ Lehman First American Education Project Sponsored by the Evergreen State College Native American Applied Research Institute January, 2003 Executive Summary: The catalyst fo... Date Added: 2009-06-16 13:56:36 |
| Group Project Lesson Plan.doc Path: N. Georgia >> JRMOSS >> 9194 Fall, 2009 Description: Group Members Lauren Clevenger, Heather Brooms, Cara Rodriguez, Jade Moss, Amanda Cate Group Project Lesson Plan Lesson Plan Title: Developed by: Subject Area: Grade Level: Purpose of the Activity: Learning Objectives (include at least one Georgia Q... Date Added: 2009-06-16 13:57:03 |
| Ch2FreqDistrTable(1000obs).xls Path: Texas Tech >> AAEC >> 3401 Fall, 2008 Description: Animal 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 ... Date Added: 2009-06-16 13:57:47 |
| 15 Review Exercises.doc Path: Texas Tech >> AAEC >> 3401 Fall, 2008 Description: Review Exercises The set of exercises in this Appendix cover the methods to 13 and are designed to give the reader experience in concepts and techniques from those chapters to apply in the exercises in this Appendix are different from those book. 1. ... Date Added: 2009-06-16 13:57:50 |
| log.txt Path: Washington >> V >> 22000 Fall, 2009 Description: 000 (34160.000.000) 12/24 09:30:24 Job submitted from host: <128.95.94.28:1084> . 001 (34160.000.000) 12/24 15:45:07 Job executing on host: <172.25.101.173:1057> . 006 (34160.000.000) 12/24 16:05:15 Image size of job updated: 460216 . 005 (34160.000.... Date Added: 2009-06-16 13:57:53 |
| error.txt Path: Washington >> V >> 22000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 24 16:56:40 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 24 18:10:55 2007 ( 4455 s elapsed) ... Date Added: 2009-06-16 13:58:35 |
| YBR201C-A.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YBR >> 201 Fall, 2009 Description: YBR201C-A.t2k DSSP-EHL2 1 C H C X X 1 10 20 30 40 H 1 C X C X H E H E H T H H C C C X X X H C H C H C C C C X X X X X X X X X X H C X X C C 51 H 60 TH YYK DEFCSQRS YTRF 50 EEEEEEE CC CC HHHHHHH ML AMK SFSQVSKS YKASAPSKKL... Date Added: 2009-06-16 13:59:45 |
| 215Reading2007.pdf Path: Los Angeles Southwest College >> MUSC >> 215 Fall, 2009 Description: BAIN MUSC 215 Theory of Tonal Music II KOSTKA/PAYNE READING SCHEDULE TEXTBOOK Stephen Kostka and Dorothy Payne, Tonal Harmony, Fifth Edition (New York: McGraw-Hill, 2004). Week Week 1 Dates August 24 Reading Assignment Self-paced review of the funda... Date Added: 2009-06-16 14:00:03 |
| YMR235C.t2k.w0.5-logo.pdf Path: UCSC >> YMR >> 235 Fall, 2009 Description: YMR235C.t2k w0.5 3 2 1 XXXX L 1 10 20 30 40 H 3 2 1 G T T E T H T T E N C T S G X XXX F V N L I L D T L F I A L L XXXXXXX P XXXXXX A R E L L L V L A X X X X X S S XXXXXXXXXXXXXXXXX N P L LL E R IK VQ E F T A T C M I V D ... Date Added: 2009-06-16 14:00:41 |
| T6 - CRC Cards.doc Path: Rose-Hulman >> TEAM >> 374 Fall, 2009 Description: Name: Brain Responsibilities: -Handles the main functions and delegates duties Collaborators: -Hands -Farming -Mining -Node Finding -Killing Name: Hands Responsibilities: -implements the actions of the brain directly with the game Collaborators: -Bra... Date Added: 2009-06-16 14:00:50 |
| Reader_overview.docx Path: San Diego State >> DESIGN >> 344 Fall, 2009 Description: Christopher Reader Art 344a 1pm Project Overview: For my final project, I want to design a website that informs people about alcohol. I do not plan to take a stand for or against drinking, but simply provide all of the relevant information for the a... Date Added: 2009-06-16 14:02:53 |
| hw8.pdf Path: USF >> HW >> 2053 Fall, 2009 Description: Physics 2053-981 (Rabson) Homework for Week 8 Due date: Wednesday, 26 October fall semester, 2005 1. A wheel-I suppose I really mean tire-can move on a surface at constant speed by slipping or by rolling without slipping. Show that if the wheel doe... Date Added: 2009-06-16 14:03:04 |
| Reader_overview.docx Path: San Diego State >> PROJECT >> 344 Fall, 2009 Description: Christopher Reader Art 344a 1pm Project Overview: For my final project, I want to design a website that informs people about alcohol. I do not plan to take a stand for or against drinking, but simply provide all of the relevant information for the a... Date Added: 2009-06-16 14:03:08 |
| Lesson10_4093.pdf Path: Tulsa >> ME >> 4093 Fall, 2009 Description: ... Date Added: 2009-06-16 14:03:47 |
| sorting.ppt Path: Portland >> CS >> 341 Fall, 2009 Description: Sorting Analysis CS341 Western Washington University Sorts to Consider Selection sort Bubble sort Insertion sort Mergesort Quicksort Radixsort Why do we care about sorting? Sorting Analysis Western Washington University 2 Selection sort O... Date Added: 2009-06-16 14:04:33 |
| error.txt Path: Washington >> V >> 2080 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Jun 02 16:38:17 2007 ( 0 s elapsed) microQuasar created. Total flux = 0.0929 m^-2 s^-1 between 10 MeV and 300000 MeV. microQuasar created. Total flux = 0.0458 m^-2 ... Date Added: 2009-06-16 14:06:33 |
| tj.10m.2006092518.txt Path: U. Houston >> SERVER >> 2006092518 Fall, 2009 Description: 2 REAL 6 9 25 6 0 REAL 6 9 25 6 0 12BACKWARDOMEGA 6 9 25 18 29.696 -95.499 10.0 6 9 25 18 29.670 -95.129 10.0 6 9 25 18 30.039 -94.075 ... Date Added: 2009-06-16 14:06:51 |
| output.txt Path: Washington >> V >> 1044 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G0WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3200 06/02/2007 07:36 AM <DIR> . 06/02/2007 07:36 ... Date Added: 2009-06-16 14:14:26 |
| EvapCondDr-03-25-1920.pdf Path: Cornell >> MANNLIB >> 1920 Fall, 2009 Description: ... Date Added: 2009-06-16 14:38:06 |
| EvapCondDr-09-26-1929.pdf Path: Cornell >> MANNLIB >> 1929 Fall, 2009 Description: ... Date Added: 2009-06-16 14:38:27 |
| quiz11.pdf Path: Oklahoma Baptist >> CHEM >> 105 Fall, 2009 Description: ... Date Added: 2009-06-16 14:47:46 |
| lecture21.pdf Path: Arizona >> LING >> 388 Fall, 2008 Description: LING 388: Language and Computers Sandiway Fong Lecture 21: 11/8 Administrivia Homework 3 graded and returned some email problems. Homework 4 out today usual rules Last Time Reached a course landmark we built a simple working translator out... Date Added: 2009-06-16 14:48:40 |
| 10trie.2up.ps Path: Princeton >> CS >> 226 Fall, 2009 Description: %!PS-Adobe-1.0 %Creator: makepsfont %Title: font definition for fat %Pages: 0 %EndComments /F_fat 10 dict def F_fat begin /FontType 3 def /FontMatrix [0.001 0 0 0.001 0 0] def /FontBBox [60 -410 957 781] def /Encoding 256 array def 0 1 255 {Encoding ... Date Added: 2009-06-16 14:49:05 |
| 20flow.4up.ps Path: Princeton >> CS >> 226 Fall, 2009 Description: %!PS-Adobe-1.0 %Creator: makepsfont %Title: font definition for fat %Pages: 0 %EndComments /F_fat 10 dict def F_fat begin /FontType 3 def /FontMatrix [0.001 0 0 0.001 0 0] def /FontBBox [60 -410 957 781] def /Encoding 256 array def 0 1 255 {Encoding ... Date Added: 2009-06-16 14:49:16 |
| webInterface.pdf Path: Uni. Worcester >> CS >> 3431 Fall, 2008 Description: Web Interface Murali Mani Options PHP with mySQL JSP/Servlets with JDBC on mySQL/Oracle Others Murali Mani 1 PHP with mySQL PHP (Hypertext Pre Processor) Server Side scripting language Provides library functions to connect to databases (mySQL, ... Date Added: 2009-06-16 15:18:31 |
| submit.txt Path: Washington >> V >> 2100 Fall, 2009 Description: executable = sky-v11r5_2151.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\skymodel\\v11r5\\jobs2100-2199/2151... Date Added: 2009-06-16 15:27:24 |
| econ463s07mxkey.pdf Path: Nevada >> ECON >> 463 Fall, 2008 Description: ... Date Added: 2009-06-16 15:58:01 |
| slac-pub-4658.pdf Path: Stanford >> PUBS >> 4500 Fall, 2009 Description: SLAC - PUB June 1988 (4 - 4658 SCENARIOS FOR FUSION ENERGY* W. B . HERRMANNSFELDT Stanford Linear Accelerator Center Stanford University, Stanford, CA 94309 ABSTRACT Are there scenarios for the near future public interest in, and political incre... Date Added: 2009-06-16 16:08:53 |
| source_info.txt Path: Washington >> V >> 2167 Fall, 2009 Description: Source ID Source Name counts 1000 Giommi_BLLacs_000 39 1002 Giommi_BLLacs_002 47 1003 Giommi_BLLacs_003 49 1005 Giommi_BLLacs_005 2 ... Date Added: 2009-06-16 17:00:36 |
| submit.txt Path: Washington >> V >> 2070 Fall, 2009 Description: executable = sky-v11r5_2070.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\skymodel\\v11r5\\jobs2000-2099/2070... Date Added: 2009-06-16 17:02:22 |
| 0878_1.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper #:14 Title: The Connectivity Server: fast access to linkage information on the Web. (1) Problems This paper takes a different approach at retrieved resutls from the content index database of search engines. This view is more in line with a sus... Date Added: 2009-06-16 17:38:28 |
| 0193_1.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper # 4 The New Casper: Query Processing for Location Services without Compromising Privacy (1) Problems - These days, the number of people using the location based services is increased a lot due to easy availability of devices like cellular phon... Date Added: 2009-06-16 17:39:01 |
| 6781_2.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper #: [5.1 P2P] 25 Title: Contructing a Proximity-aware Power Law Overlay Network. The paper discusses an algorithm constructing low diameter power law network considering proximity and capacity information to ensure low maintainance overhead and... Date Added: 2009-06-16 17:39:13 |
| unix.pdf Path: CSU Stanislaus >> CS >> 1500 Fall, 2009 Description: Basic UNIX UNIX Commands Command cat filename more filename mv file1 file2 cd dirname cd . cp file1 file2 ls -a dirname mkdir newdir rm filename rmdir dirname Meaning display filename on terminal same as cat, but display one screen at a time move or ... Date Added: 2009-06-16 17:40:51 |
| Lecture16.pdf Path: UNL >> CSCE >> 230 Fall, 2008 Description: CSCE 230J Computer Organization The Memory Hierarchy Dr. Steve Goddard goddard@cse.unl.edu http:/cse.unl.edu/~goddard/Courses/CSCE230J Giving credit where credit is due Most of slides for this lecture are based on slides created by Drs. Bryant and... Date Added: 2009-06-16 17:40:57 |
| Lec26c.FeedbackI.pdf Path: Berkeley >> EE >> 140 Fall, 2009 Description: EE 140: Analog Integrated Circuits Lecture 26: Feedback I Announcements: Project is due this Friday, 5/1, at 8 p.m. Today: Feedback: Pros & Cons Inspection Analysis of FB Ckts Effect of Feedback on Zi and Zo CTN 4/28/09 Copyright 2009 Regents of... Date Added: 2009-06-16 17:41:10 |
| a4.pdf Path: Sveriges lantbruksuniversitet >> IAT >> 102 Fall, 2009 Description: siat siat siat siat siat Akiko Fukushima 301001933 ... Date Added: 2009-06-16 17:42:21 |
| day 10 - 0209.ppt Path: Oregon State >> BA >> 341 Fall, 2009 Description: Chapter 6 Common Stock Valuation: Putting all the pieces together Objectives We now have an understanding of the how to compute all the inputs for our models except the growth rate in cash flows and earnings. In this lecture, our objectives are ... Date Added: 2009-06-16 17:43:26 |
| 10l.pdf Path: UPenn >> VHM >> 801 Fall, 2009 Description: E thBxC(iFhjRwHCy%oz t t ~ r xv v x d t d q r d 8($uvvr p h dBx8d(t$%y%{tRhBC{`%( u t v x z j x t z v t d dv r t v v r h8HSw~fdiE`q B8HB7w~ dxd rx %($% (d\"(th d t v j t t d t t s h(hi(7\"t w u t r %Hu s xv... Date Added: 2009-06-16 17:44:16 |
| Olefin Polymerization.pdf Path: Laurentian >> CHEM >> 4000 Fall, 2009 Description: Mechanism for Olefin Polymerization Chain Propagation: Cossee-Arlman Mechanism = good basic mechanism. Cossee et al., J. Catal., 1964, 3, 80 & 99. 1,2-insertion alkene coordination R [M] R [M] [M] R CH2 C H2 [M] R Green-Rooney Mechanism involving... Date Added: 2009-06-16 17:44:54 |
| new.ps Path: UAB >> CS >> 624 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: new.dvi %Pages: 18 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o new.ps new.dvi %DVIPSParamete... Date Added: 2009-06-16 17:45:13 |
| 1 - Basic Marketing Concepts.ppt Path: Oregon State >> BA >> 590 Fall, 2008 Description: BA 590 Basic Marketing Concepts Overview BA 590 Marketing Review Modules Marketing Concepts Customer Needs Industry Competition Target Marketing, Segmentation, and Marketing Research New Product Development and Sales 1-5 BA 590 Module 1 B... Date Added: 2009-06-16 17:45:17 |
| Worksheet 14 - Derivative graphs.doc Path: Arizona >> MATH >> 124 Fall, 2008 Description: Worksheet 14 - DERIVATIVE GRAPHS NAME_ Sketch the graph of the derivative of each of the following functions on the same graph. 3 2 1 0 -6 -4 -2 -1 -2 -3 0 2 4 6 -6 -4 -2 3 2 1 0 -1 -2 -3 0 2 4 6 3 2 1 0 -6 -4 -2 -1 -2 -3 0 2 4 6 -6 -4 -2 4 3 2 1... Date Added: 2009-06-16 17:46:55 |
| HW7.pdf Path: UVA >> APMA >> 308 Fall, 2008 Description: ... Date Added: 2009-06-16 17:47:24 |
| p1.pdf Path: Wagner >> MA >> 322 Fall, 2009 Description: Practice 1 1 2 ... Date Added: 2009-06-16 17:48:26 |
| smgo.ps Path: Siena >> ASTRON >> 337 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86e Copyright 2001 Radical Eye Software %Title: smgo.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips smgo -o %DVIPSParameters: dp... Date Added: 2009-06-16 17:48:34 |
| sys595 hw1[1].doc Path: Oakland University >> SYS >> 595 Fall, 2008 Description: SYS 595 Automotive Electronics Homework 1 Due: 9/13/06 1. Briefly describe the design goal for an automotive electronics system. 2. Give a list of electronic systems (controllers) in a typical car. 3. What is a Real Time system? 4. From the list that... Date Added: 2009-06-16 17:49:39 |
| lect12.txt Path: Concordia Chicago >> CMSC >> 10500 Fall, 2009 Description: ; a person is either: ; - a.) represented by constant empty ; - b.) represented by a structure (make-pers name f m king-of king-from king-to) ; where f and m are persons king-of is a symbol or empty and kink-from ; and king-to ar... Date Added: 2009-06-16 17:50:12 |
| hw8.ps Path: UCSD >> ECE >> 161 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.94a Copyright 2003 Radical Eye Software %Title: hw8.dvi %CreationDate: Thu May 26 11:46:06 2005 %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMR10 CMMI10 CMMI7 CMSY10 CMSY7 CMR7 CMB... Date Added: 2009-06-16 17:51:52 |
| Activity Sheet.doc Path: N. Georgia >> CJBRIS >> 7111 Fall, 2009 Description: Name: _ Date: _ Quadratic and Inequality Equations This lesson will provide the student with thorough examples on how to solve quadratic equations and inequalities through factoring, graphing, completing the square, and quadratic formula. SHOW ALL W... Date Added: 2009-06-16 17:56:12 |
| Lect C 07_02 march 27 09.pdf Path: Redlands >> PHYS >> 344 Fall, 2009 Description: Phys 344 Fri. 3/27 Ch 7 Lecture 2 March 27th , 2009 1 . 7.2,3 Fermi Gases (T=0,DoS) B.5 Q. Stat Integ. HW24 7.19, 22, 23, 28, B.15,19,21 HW25 26, 29, 31, 33 HW26 42,44,48, A. 24 HW27 51,52 HW22,23,24 Mon. 4/30 7.3 Fermi Gases (Small T & Sommerfel... Date Added: 2009-06-16 17:57:02 |
| 07-031abc.xls Path: East Los Angeles College >> UKHR >> 0708 Fall, 2009 Description: Table31aTenureprofileofheadsofhouseholdbyageinGreatBritain Percentages Item Owneroccupiers Owned outright Agesat1980 Under25 2529 3044 4564 6574 75orover Allages Under25 2529 3044 4559 6069 7079 80orover Allages Under25 2529 3044 4559 6069 7079 80oro... Date Added: 2009-06-16 17:58:47 |
| 07-047a.xls Path: East Los Angeles College >> UKHR >> 0708 Fall, 2009 Description: Table 47a Average regional house prices Region North Yorkshire & Humberside North West East Midlands West Midlands East Anglia Greater London Rest of South East South West Wales Scotland Northern Ireland United Kingdom 1970 3,942 3,634 4,184 3,966 4... Date Added: 2009-06-16 17:58:49 |
| Attachment 3 - Cross Section.pdf Path: UMKC >> CE >> 404 Fall, 2009 Description: Attachment 3 - Culvert Cross-Section ... Date Added: 2009-06-16 17:59:58 |
| 19590422_0000032680.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: Mr. Dulles: Regyour t r i p t o M a x w e l l , Air Force Base, Gates I3Oya has just told me that Genera3 Todd, Commander, Ar University, is planning t o have i an informal dinner for you on StmBay, 26 A p r i l at 6 s : p.m. General Tate i n cnmnRnd... Date Added: 2009-06-16 18:00:37 |
| demo-partition.ppt Path: Duke >> X >> 001 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|12 Nov 2001 08:49:00 -0000 vti_extenderversion:SR|4.0.2.4426 vti_cacheddtm:TX|12 Nov 2001 08:49:00 -0000 vti_filesize:IR|231424 vti_cachedlinkinfo:VX|H|file:/C:/WINDOWS/Profiles/wayne/My\\ Documents/COS\\... Date Added: 2009-06-16 18:01:48 |
| handout_exam_1_seating.pdf Path: Washington >> CHEM >> 239 Fall, 2008 Description: ... Date Added: 2009-06-16 18:03:59 |
| roots.xls Path: CSU Northridge >> EAW >> 10078 Fall, 2009 Description: Root Words Frequently Used in Geology Root meaning examples in science awithout allos strange archeao primitive argilla clay aesthenos soft aren sand astro star atmos air augen eyes auto self bathys deep bios life boreal northern brachios arm bryos m... Date Added: 2009-06-16 18:04:04 |
| Mendelian Genetics.pdf Path: Nicholls State >> BIOL >> 155 Fall, 2009 Description: Mendelian Genetics Living things tend to reproduce. They make more living things similar to themselves. Genetics is the study of the rules of inheritance. 1 Although the tendency of offspring to resemble their parents has been generally recognized... Date Added: 2009-06-16 18:04:19 |
| Lect16.pdf Path: Fayetteville State University >> PHY >> 2054 Fall, 2009 Description: PHY 2054C College Physics B Fall 2003 Electricity, Magnetism, Light Optics and Modern Physics Dr. Ingo Wiedenhver Dr. A. Volya Today: 1) Models of the Atom 2) Waves of Probability 3) Uncertainty Relation Bohr\'s Model of the Atom Rutherford: The Ato... Date Added: 2009-06-16 18:04:48 |
| 1282 Web Assignment 5.pdf Path: UT Arlington >> BIOLOGY >> 1282 Fall, 2009 Description: Name:_ Biology 1282: Web Assignment 5 Development of Animals and Plants 1. What is the difference between an embryo and a fetus? (3 points) 2. Why do eggs contain yolk? (3 points) 3. Label the following figure: (4 points) ... Date Added: 2009-06-16 18:05:07 |
| L19-Stars.ppt Path: BU >> CC >> 105 Fall, 2009 Description: Stars: Birth to Middle Age CC105 Prof Jackson Today\'s Music Why Does the Sun Shine? (The Sun is a Mass of Incandescent Gas) They Might Be Giants Today\'s Lecture Birth of stars Structure of stars How stars shine The \"Main Sequence\" The Story ... Date Added: 2009-06-16 18:07:38 |
| Ergonomic Specifications (Updated 5-15-08).pdf Path: RIT >> P >> 08001 Fall, 2009 Description: Minimum Adjustable Range of Seat Height, Handlebar Height, and Handlebar Angle Ranges must accommodate patient sizes from the 5th percentile Female to the 95th percentile Male. Calculations are expressed as a ratio of the following body height data o... Date Added: 2009-06-16 18:07:59 |
| p1.pdf Path: Texas State >> CH >> 5318 Fall, 2009 Description: CS5318 Spring 2004 Project 1 C. Hazlewood Language Evaluation The Ada programming language is the result of a careful design process. The language requirements went through a series of reviews and refinements, resulting in a document called the Steel... Date Added: 2009-06-16 18:08:41 |
| IVC.pdf Path: San Diego State >> GB >> 0607 Fall, 2009 Description: Imperial Valley Campus Faculty Emeritus: Ayala, Baldwin, Ballesteros, Elizondo, Fatemi, Harmon, Hill, King, B., Merino, Polich, Spencer, Varela-Ibarra Professors: Champion, Dunn, Medeiros, Neumann, Reyes, Roeder, Ryan, Shumaker Associate Professors:... Date Added: 2009-06-16 18:09:25 |
| SampleFinalSolutions.pdf Path: Colorado State >> M >> 229 Fall, 2009 Description: ... Date Added: 2009-06-16 18:09:47 |
| Nonlinear Spectroscopy.pdf Path: Colorado >> PHYS >> 5606 Fall, 2008 Description: Advanced Optics Laboratory DOPPLER-FREE SATURATED ABSORPTION SPECTROSCOPY: LASER SPECTROSCOPY 1 Introduction In this experiment you will use an external cavity diode laser to carry out laser spectroscopy of rubidium atoms. You will study the Doppler... Date Added: 2009-06-16 18:12:36 |
| InductiveProofsForRecurrences.ps Path: Wilfrid Laurier >> CPSC >> 413 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: InductiveProofsForRecurrences.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -t l... Date Added: 2009-06-16 18:13:06 |
| P142_PS1_Solutions.pdf Path: Rochester >> P >> 142 Fall, 2009 Description: Physics 142 Fall 2007 Solutions to Problem Set 1 Problem 1 (Ohanian 22-2) Problem 2 (Ohanian 22-3) Problem 3 (Ohanian 22-13) Problem 4 (Ohanian 22-14) Problem 5 (Ohanian 22-17) Problem 6 (Ohanian 22-27) Problem 7 (Ohanian 22-53) Problem 8 . ... Date Added: 2009-06-16 18:13:24 |
| ph104exp05_Make_and_ test_a_motor_03.doc Path: Princeton >> PH >> 104 Fall, 2009 Description: 20 PRINCETON UNIVERSITY Physics Department PHYSICS 104 LAB Week #5 EXPERIMENT V MAKE AND TEST A MOTOR. DEMONSTRATIONS OF MAGNETIC FIELD WITH CYCLOTRON MAGNET Introduction. In this lab you will build a little electric motor using a small \"refrigerato... Date Added: 2009-06-16 18:14:20 |
| Jefferson Memorial.ppt Path: BU >> EM >> 610 Fall, 2009 Description: Jefferson Memorial By Luis Marina, and Jayc , ie About the Monument The Jefferson Memorial is located at East Basin Drive Southwest in Washington D.C. It was finished in 1943. It was built because Thomas Jefferson was the third President of the Un... Date Added: 2009-06-16 18:14:35 |
| solution6.pdf Path: WVU >> EE >> 513 Fall, 2008 Description: EE 513: Stochastics System Theory Homework #6: Functions of Pairs of Random Variables Solutions Wednesday, November 29, 2006 1. Do the following problems from chapter 4 of the Leon Garcia text: 48, 54, 76. Problem 48 Let X and Y be independent expone... Date Added: 2009-06-16 18:14:49 |
| YIR006C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YIR >> 006 Fall, 2009 Description: 3 2 1 H X TT TC CTTGGTTCTCCCCTTTCCCTTCTTTCCGGTTTCCTCCCCCCTCCCCCCCT CCC C TTTTC TCCH C CTCTTTTCCCTTTCGGGCC C CTTTTTTC G G G G B C E E E G E E C C E H H H X X X X X X XXXXXXXXXXXXXXHXXXXXXXEX G X TTTT TT TTT X H G X E E E E XXXXXXXEEEX E E E E ... Date Added: 2009-06-16 18:15:09 |
| mullahysindelar.pdf Path: Wisconsin >> PHS >> 548 Fall, 2009 Description: ... Date Added: 2009-06-16 18:15:42 |
| UML_FCPackage_Evalution_IIVV_F08a_T16_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Evaluation Report of UML Team 16 IIVUpload Script_Input Script ... Date Added: 2009-06-16 18:16:26 |
| submit.txt Path: Washington >> V >> 26500 Fall, 2009 Description: executable = allgamma_26951.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs26500-26999/... Date Added: 2009-06-16 18:19:18 |
| submit.txt Path: Washington >> V >> 26500 Fall, 2009 Description: executable = allgamma_26827.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs26500-26999/... Date Added: 2009-06-16 18:21:23 |
| error.txt Path: Washington >> V >> 26500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Dec 26 12:21:10 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Dec 26 13:31:05 2007 ( 4195 s elapsed) ... Date Added: 2009-06-16 18:21:38 |
| error.txt Path: Washington >> V >> 26500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Dec 26 11:41:01 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Dec 26 12:53:40 2007 ( 4359 s elapsed) ... Date Added: 2009-06-16 18:21:53 |
| submit.txt Path: Washington >> V >> 26500 Fall, 2009 Description: executable = allgamma_26680.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs26500-26999/... Date Added: 2009-06-16 18:22:13 |
| prog4BoundaryFill4.txt Path: Oakland University >> CSE >> 466 Fall, 2009 Description: void boundaryFill4 (int x, int y, int fillColor, int borderColor) { int interiorColor; /* Set current color to fillColor, then perform following oprations. */ getPixel (x, y, interiorColor); if (interiorColor != borde... Date Added: 2009-06-16 18:25:04 |
| S3fs in the wide area.ppt Path: Cornell >> CS >> 6464 Fall, 2009 Description: Alvaro Llanos Motivation Reduce delay of the wide-are-network Better end-user experience Improve bandwidth use ? (deciding when to flush the cash) Design Implementation Libasync For handling write/read requests Using sockets to implement Libasync... Date Added: 2009-06-16 18:25:44 |
| asgn4 template.xls Path: DePaul >> IS >> 553 Fall, 2009 Description: IS 553 SPRING 2004 ASSIGNMENT 4 NAME: RISK CATEGORY Culture RISK DESCRIPTION Cross-cultural issues could complicate decision-making and conflict resolution. Example: Non-native English speakers stay silent rather than ask about phrases they don\'t und... Date Added: 2009-06-16 18:26:22 |
| 157_05.pdf Path: Duke >> ECON >> 157 Spring, 2008 Description: Economics 157 Tauchen Problem Set 5 I No Problems to Turn in II Workout Problems Only Spring 1999 II-1 Suppose the equation of the security market line is = 5 + 12 A. What are the mean return m on the market and the risk-free rate? B. Suppose a r... Date Added: 2009-06-16 18:28:50 |
| hw11_sols.ps Path: Texas >> PHY >> 389 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw11.dvi %Pages: 5 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMR17 CMR12 CMBX12 CMTT12 CMMI12 MSBM10 CMSY10 CMMI8 %+ CMSY8 CMR8 CMEX10 CMR6 %Docume... Date Added: 2009-06-16 18:29:54 |
| CmpE297A-OOAD-W01-ws.doc Path: San Jose State >> CMPE >> 297 Spring, 2008 Description: Advanced OOAD-W01- Working Sheet CmpE 297A Dr. M.E. Fayad Announcements: None Hardcopies: 1. My teaching philosophy 2. Syllabus or GreensSheet 3. Lecture #1 - working sheet Lesson Objectives Talk about the Syllabus (Please ask me as many question... Date Added: 2009-06-16 18:30:01 |
| recursion2.pdf Path: Alabama >> CS >> 150 Spring, 2008 Description: CS 150 Recursion (Again) Activity Sheet Summer 2009 I NTRODUCTION In this activity, you are to practice writing recursive functions by converting a program similar to Project 0 to use recursion. R ECURRING OVER LISTS Consider this program: def ma... Date Added: 2009-06-16 18:31:06 |
| intro_chap1.pdf Path: Contra Costa College >> ELEC >> 6621 Fall, 2009 Description: ... Date Added: 2009-06-16 18:31:16 |
| intro_chap1.pdf Path: Contra Costa College >> ELEC >> 6631 Fall, 2009 Description: ... Date Added: 2009-06-16 18:31:20 |
| problem001.pdf Path: NMT >> PH >> 515 Fall, 2009 Description: E ! 3 $ % 2 ! 3 6 1! C @ $ % 2 ( ! ! 6 6 1 @ @ 2$ 2 \" 0 !$ 8 \' % ) % 1 ( ! 3... Date Added: 2009-06-16 18:32:15 |
| T0463.t04.bys-logo.pdf Path: UCSC >> T >> 0463 Fall, 2009 Description: T0463.t04 bys 5 4 3 2 1 M EK V K K I V L I GA S G FV G S AL L N EA L NR G F E V T AV V R HP E K IK I E NE H L KV K K A D VS S L D E V C E V C K GA D A V I S A FN P G W N N P DI Y D E T I K VY L T I I D G VK 1 10 20 30 40 50 60 70 80 90 H 5 4 3 2 1 ... Date Added: 2009-06-16 18:32:24 |
| mat320.xls Path: Paul Quinn >> MAT >> 320 Fall, 2009 Description: ID Name Last 103981457 Andrews 104577394 Chan 101911807 Clark 103897510 Doi 101908520 Edlin 100982190 fersko 102852051 Fiero 100304189 ganz 102077483 Germain 100361397 Gregorwich 104672927 Hernandez 104549124 Inbal 104955732 irimia 102676080 Jacobso... Date Added: 2009-06-16 18:32:34 |
| 662-2.pdf Path: Oregon >> PH >> 662 Fall, 2009 Description: Physics 662, lecture 2 1 ! ! ! $ $ ( $ , \" + - # % \' ) *+ \' * , - $ $ Physics 662, lecture 2 2 * */ % B 2 B 3 B Physics 662, lecture 2 3 B 3 * * & 1 2 . % . , 1 3 1 2 1 3 4 - 53 4 - 5 3 1 67 435 - ... Date Added: 2009-06-16 18:34:17 |
| day21.txt Path: Missouri S&T >> CS >> 234 Fall, 2009 Description: Day 21: - I. Test II II. Next Time: A. Begin Appendix B & Logic Design B. Lab #2 Due C. Lab #3 Assigned ... Date Added: 2009-06-16 18:34:32 |
| DesigningAlgorithmsStudentNotes.pdf Path: Elon >> CSC >> 130 Fall, 2009 Description: New Algorithms Designing Algorithms CLRS 2.3 Make a sorting algorithm that has a slower growth rate than insertion sort How do you make new algorithms? Must know the _ Incremental Approach _ _ is an example of using the incremental approach Par... Date Added: 2009-06-16 18:35:51 |
| jobsatis.txt Path: NYU >> PAGES >> 3307 Fall, 2009 Description: 1 1 20 1 2 24 1 3 80 1 4 82 2 1 22 2 2 38 2 3 104 2 4 125 3 1 13 3 2 28 3 3 81 3 4 113 4 1 7 4 2 18 4 3 54 4 4 92 ... Date Added: 2009-06-16 18:37:59 |
| Fischer-TICS20011.pdf Path: Dickinson State >> PSY >> 486 Fall, 2009 Description: 460 Research Update TRENDS in Cognitive Sciences Vol.5 No.11 November 2001 Cognition in the bisection task Martin H. Fischer Bisecting a visually presented stimulus is a sensitive test for attentional and motor biases in both healthy and brain-dam... Date Added: 2009-06-16 18:38:55 |
| 08_leapfrog.ppt Path: Norwich >> IS >> 455 Fall, 2009 Description: Case 12 Learning from LeapFrog IS455 Strategic Applications of IT Lecture # 8 M. E. Kabay, PhD, CISSP-ISSMP mailto:mkabay@norwich.edu V: 802.479.7937 Assoc Prof Information Assurance Division of Business & Management, Norwich University Copyright ... Date Added: 2009-06-16 18:39:46 |
| QS_4a-11162006.pdf Path: Michigan State University >> PHY >> 215 Fall, 2008 Description: ... Date Added: 2009-06-16 18:40:07 |
| Maple homework solution.pdf Path: Texas A&M >> MATH >> 647 Fall, 2008 Description: Maple problems: 2 1) Here\'s a plot of y = ln x Csin x and y = x K1 on the same set of axes. I\'m defining them to be functions so that I don\'t have to type them in several times. You can also define them to be expressions. A little experimentation sho... Date Added: 2009-06-16 18:41:19 |
| Table5_2.pdf Path: New Mexico >> CHAPTER >> 552 Fall, 2009 Description: TABLE 52 Inherited Syndromes with Defects in DNA Repair NAME PHENOTYPE ENZYME OR PROCESS AFFECTED MSH2, 3, 6, MLH1, PMS2 Xeroderma pigmentosum (XP) groups AG XP variant Ataxiatelangiectasia (AT) BRCA-2 Werner syndrome Bloom syndrome Fanconi anemia g... Date Added: 2009-06-16 18:41:29 |
| Ed 309 Reading Assessment Summary.pdf Path: Wisc Stevens Point >> JWUST >> 436 Fall, 2009 Description: ... Date Added: 2009-06-16 18:43:07 |
| slides01.ppt Path: Harvey Mudd College >> CS >> 121 Fall, 2000 Description: H ar vey M udd Col l ege CS 121 Softwar e Devel opment Spr i ng 2005 Pr ofessor Bob Kel l er kel l er @ cs.hmc.edu 1249 Ol i n 621-8483 01-1 Offi ce H our s (1249 Ol i n): q q q Note: 1249 i s i n the southwest cor ner of Ol i n M W 4-5, TuTh 3-4... Date Added: 2009-06-16 18:44:28 |
| T0306.dssp-ehl2-logo.pdf Path: UCSC >> T >> 0306 Fall, 2009 Description: T0306 dssp-ehl2 2 1 CCEE C E X X X X X X X X X X 10 20 30 40 E 2 1 E X X E E E CCC E 51 60 70 80 E H E 90 CCCCC HH CCC C ECCCCCCCCCCCC C E E E CC CCCC TG EWV LLVSGSSA RQAHKSETSPVDLC V I G IV D E VV S G GQ V IF HK X X X X X EEEEE C... Date Added: 2009-06-16 18:46:47 |
| Chapter 13.ppt Path: Cal Poly >> BUS >> 212 Fall, 2008 Description: External Reporting for Public Companies Chapter 13 2005 Accounting 1/e, Terrell/Terrell 13 1 Learning Objective 1 Determine the role of ethics in business reporting and the implications of the SarbanesOxley Act of 2002. 2005 Accounting 1/e, Terr... Date Added: 2009-06-16 18:47:50 |
| superhet.pdf Path: Bucknell >> ELEC >> 47004 Fall, 2009 Description: ... Date Added: 2009-06-16 18:49:15 |
| minmax.txt Path: University of Illinois, Urbana Champaign >> COM >> 002 Fall, 2009 Description: Time 3600 W = -14.2 37.1 Qr = 11.9 Wz = -86. 67. Time 3660 W = -14.5 37.7 Qr = 11.8 Wz = -87. 62. Time 3720 W = -14.6 37.9 Qr = 11.7 Wz = -87. 60. Time 3780 W = -14.6 37.7 Qr = 11.5 Wz = -86. 63. Time 3840 W = -... Date Added: 2009-06-16 18:49:55 |
| commas.txt Path: University of Illinois, Urbana Champaign >> COM >> 002 Fall, 2009 Description: READ3D CALLED COMMAS model restart file: ini.r00000.g01 read = COMMAS MODEL: v4.0.3 KJI MODEL PARAMETERS: TIME = 0.0 GRID = 1 NX = 60 NY = 60 NZ = 48 NSCALARS = 4 MICROPHYSICS: WARM RAIN EAST-WEST GRID PO... Date Added: 2009-06-16 18:49:56 |
| commas.txt Path: University of Illinois, Urbana Champaign >> COM >> 398 Fall, 2009 Description: READ3D CALLED COMMAS model restart file: ini.r00000.g01 read = COMMAS MODEL: v4.0.3 KJI MODEL PARAMETERS: TIME = 0.0 GRID = 1 NX = 60 NY = 60 NZ = 48 NSCALARS = 4 MICROPHYSICS: WARM RAIN EAST-WEST GRID PO... Date Added: 2009-06-16 18:50:16 |
| minmax.txt Path: University of Illinois, Urbana Champaign >> COM >> 398 Fall, 2009 Description: Time 3600 W = -14.2 37.1 Qr = 11.9 Wz = -86. 67. Time 3660 W = -14.5 37.7 Qr = 11.8 Wz = -87. 62. Time 3720 W = -14.6 37.9 Qr = 11.7 Wz = -87. 60. Time 3780 W = -14.6 37.7 Qr = 11.5 Wz = -86. 63. Time 3840 W = -... Date Added: 2009-06-16 18:50:17 |
| 241_Project2_Phase 2_16.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: 4 x 4 x 4 241_Graphic Design I : Spring 09 : Chanelle Villanueva x 4 x 4 x 4 x 4 x 4 x 4 x 4 x 4 x 4 x 4 ... Date Added: 2009-06-16 18:51:31 |
| Understanding the Telephone System.txt Path: Wisc Whitewater >> ITBE >> 452 Fall, 2008 Description: - UNDERSTANDING THE TELEPHONE SYSTEM FROM \"UNDERSTANDING COMMUNICATIONS SYSTEMS\" CHAPTER 6 BY DON L. CANNON AND ... Date Added: 2009-06-16 18:56:31 |
| sendmail2.txt Path: Wisc Whitewater >> ITBE >> 452 Fall, 2008 Description: # # # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # #... Date Added: 2009-06-16 18:57:24 |
| Vitruvius_BookIV.pdf Path: Texas Tech >> ARCH >> 5362 Fall, 2008 Description: ... Date Added: 2009-06-16 18:57:46 |
| Pointers.ppt Path: Texas >> EE >> 312 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|23 Feb 2005 17:13:35 -0000 vti_extenderversion:SR|5.0.2.6417 vti_author:SR|POOH\\chase vti_modifiedby:SR|POOH\\chase vti_timecreated:TR|23 Feb 2005 17:13:35 -0000 vti_title:SR|PowerPoint Presentation vti_... Date Added: 2009-06-16 18:57:48 |
| link.txt Path: Berkeley >> EE >> 128 Fall, 2008 Description: http:/www.ece.ucsb.edu/~roy/cgi-bin/makepage.pl?nav=course_147b... Date Added: 2009-06-16 18:59:54 |
| Grade Conversion Scale.doc Path: High Point >> JOHN >> 1204 Fall, 2009 Description: Technology Product For Pre-Service Teachers Grading Conversion Scale Points Earned Letter Conversion Grade Conversion <10 F 0-60 10 C70 20 C 73 31 C+ 77 41 B80 51 B 83 62 B+ 87 72 A90 82 A 93 93 A+ 97 ... Date Added: 2009-06-16 19:00:54 |
| Moghadam.pdf Path: Iowa State >> SOC >> 640 Fall, 2008 Description: ... Date Added: 2009-06-16 19:06:43 |
| tttab.ps Path: SUNY Albany >> V >> 177 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.58 Copyright 1986, 1994 Radical Eye Software %Title: tttab.dvi %CreationDate: Sun Feb 1 07:58:12 1998 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -Papple tttab.dvi %DVI... Date Added: 2009-06-16 19:09:56 |
| potassium phosphate.pdf Path: CofC >> RM >> 113 Fall, 2009 Description: Material Safety Data Sheet ACC# 19543 Potassium phosphate, monobasic Section 1 - Chemical Product and Company Identification MSDS Name: Potassium phosphate, monobasic Catalog Numbers: AC205920000, AC205920025, AC205925000, AC271080000, AC271080025,... Date Added: 2009-06-16 19:11:42 |
| hw9.doc Path: UNLV >> CPE >> 100 Fall, 2008 Description: CPE 100-002 Logic Design I Homework 9 Due by 2:30pm Tuesday, Apr. 14 (Show all your work and staple your answer sheets together) 1. Problem 11.2 on pp. 310. 2. Problem 11.5 on pp. 311. 3. Problem 11.6 on pp. 311. 4. Problem 11.8 on pp. 312. 5. Proble... Date Added: 2009-06-16 19:12:25 |
| senotes0129.pdf Path: GWU >> CSCI >> 161 Fall, 2009 Description: Title:Jan292:25PM(1of6) Title:Jan292:28PM(2of6) Title:Jan292:30PM(3of6) Title:Jan292:40PM(4of6) Title:Jan292:44PM(5of6) Title:Jan292:50PM(6of6) ... Date Added: 2009-06-16 19:15:12 |
| alpha 2.ppt Path: Michigan State University >> SCS >> 648 Summer, 2008 Description: Alpha 2 agonists xylazine detomidine medetomidine romifidine How do they work? CNS depression by stimulation of presynaptic alpha 2 adrenoceptors in the CNS and peripherally this decreases norepinephrine release centrally and peripherally ne... Date Added: 2009-06-16 19:15:41 |
| Prelim1Dist.pdf Path: Auburn >> EE >> 2220 Fall, 2009 Description: Prelim 1 Grade Distribution 14 12 10 8 Series1 6 4 2 0 35 40 45 50 55 60 65 70 75 80 85 90 95 ... Date Added: 2009-06-16 19:16:05 |
| L7_Domain_Eng_08.pdf Path: Portland >> OMSE >> 551 Fall, 2009 Description: OMSE 551: Week 7 Domain Engineering Midterm Domain Engineering and PL Architecture Adaptable Components FWS CA 1 Domain Engineering 2 FAST Process Pattern Qualify Domain Engineer Domain Analyze Domain Implement Domain Investment Application Eng... Date Added: 2009-06-16 19:18:40 |
| SMALL PMDC motors.doc Path: Michigan State University >> ECE >> 480 Fall, 2008 Description: APPLICATION NOTE Michigan State University How to Construct a Small Permanent Magnet Direct Current Motor Sarah A. Pardee Michigan State University ECE 480 November 8, 2007 ABSTRACT The permanent magnet direct current (PMDC) motor is considered on... Date Added: 2009-06-16 19:19:50 |
| PostedGrades-Spr08.xls Path: UCF >> COP >> 4331 Fall, 2009 Description: Quiz1 Scores 58 58 55 54 54 54 53 53 52 52 51 51 50 50 50 50 50 47 47 47 47 47 46 46 46 44 44 43 43 43 41 40 40 40 39 39 39 39 38 38 38 38 37 36 36 33 32 29 Quiz1 Letter A A A AAAAAAAAAB+ B+ B+ B+ B+ B B B B B B B B BBBBBC+ C+ C+ C+ C+ C+ C+ C+ C C ... Date Added: 2009-06-16 19:20:49 |
| Tokgoz-Elobeid-Fabiosa-etal_raec_436.pdf Path: Iowa State >> ECON >> 642 Fall, 2008 Description: raec436 RAEC-xml.cls (1994/07/13 v1.2u Standard LaTeX document class) October 11, 2008 16:32 RAEC Journal raec436 MSP No. Dispatch: October 11, 2008 No. of pages: 19 CE: AFL PE: Alison 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 ... Date Added: 2009-06-16 19:20:55 |
| econ70203_6.pdf Path: Minnesota >> EC >> 70205 Fall, 2009 Description: @hU H +ii 2 Odvw fodvv/ zh lqwurgxfhg wkh Oxfdv +4<:;, prgho1 Wkhuh lv d wuhh dqg wkh wuhh |lhogv d udqgrp qxpehu ri iuxlwv dw hdfk shulrg1 Wkhuh lv d uhsuhvhqwdwlyh djhqw1 Lq wkh suhylrxv fodvv/ zh vdlg wkdw wkh htxloleulxp kdv wr eh vxfk wkd... Date Added: 2009-06-16 19:22:38 |
| lecture23.ps Path: Maryland >> ASTR >> 688 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Pages: 5 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -f %DVIPSParameters: dpi=600, comments removed %D... Date Added: 2009-06-16 19:24:22 |
| Homework Assignment.pdf Path: University of Hawaii - Hilo >> BIOLOGY >> 101 Fall, 2009 Description: Homework Assignment Do 2, 15 minute bird species count at two different places on campus This can be the same 2 locations for all students Or each student can have/pick their own two locations Make field notes to describe the data collection ... Date Added: 2009-06-16 19:24:38 |
| SP446S08essaytopics.pdf Path: CSU Northridge >> ARS >> 62917 Fall, 2009 Description: !\" ! ! \" #$ ( \" #) \" + *# - \' \" $ .# \' \" $ /# ) 0 % + 4# #3 ! 7 \' \' ! % ! \"# ! ! ! \'$ ! ! \'+ ! ! \"# \'$ ! % ! \' , ! % ! 3 2# # $% ... Date Added: 2009-06-16 19:27:24 |
| Lesson Outline.pdf Path: CSU Northridge >> AEE >> 52628 Fall, 2009 Description: ... Date Added: 2009-06-16 19:27:31 |
| excel 1.xlsx Path: Uni. Westminster >> AKS >> 0605 Fall, 2009 Description: Kaci\'s Korner Inventory Comparison Sept 3, 2008 records Salt Lake Morro Bay New Orleans Total 43 36 16 25 16 19 75 80 10 44 19 21 16 13 45 78 14 39 26 35 5 16 45 90 165 248 Men Fleece Top Men Lycra Top Men Cotton Top Mens Total Women Fleece Top Wo... Date Added: 2009-06-16 19:28:01 |
| Lesson 2 field trip.pdf Path: Wisc Stevens Point >> NRES >> 370 Fall, 2009 Description: Lesson 2: Macroinvertebrate Sampling On the Wolf River (Caddis fly larvae) Rationale This is the culminating lesson for the biomonitoring unit on the Wolf River and an expansion of the first lesson. I choose this lesson to allow students hands-on ... Date Added: 2009-06-16 19:28:16 |
| oodb08.ppt Path: Alabama >> CS >> 609 Fall, 2008 Description: Object-Oriented Databases 1 Limitations to the relational model? Examples of applications that will not work well with the relational model? 2 Shortcomings of DB models for: CAD/CAM - keep track of 1000\'s of matching parts and subassemblies r... Date Added: 2009-06-16 19:31:06 |
| Woodard_Tony.xls Path: San Diego State >> ARCHIVED >> 240 Fall, 2009 Description: Directions: Use this spreadsheet template for the Spreadsheet and Chart/Graph assignment due in Week Four On the Data worksheet, include the following information in the appropriate columns from the students\' Technology Biography and Self-Assessment... Date Added: 2009-06-16 19:31:33 |
| homework02.pdf Path: UCLA >> CHEM >> 110 Fall, 2009 Description: CHE.M .,g{ 110\'8 -2 f> ;(.tJ8LEM ~\"I.\' J) u.-e I-:J./ - 0 ( 1-.-.-.- ._~ _ ./_.-~h-~-. tL- fY:e t-~ s /k - f-.-Q.LS.Jy;, j.M- ~x I ~ ~l-l.s: C_\'w_LtbCh. \\IV _, ~-th~)_ a.-e~ r e c: ~.Ie f-t-. cd: ~_6.e_.:f\'oV\'-\'2 ~ r f-.-.-J.:~ J. I ~ &... Date Added: 2009-06-16 19:32:26 |
| HW6c.pdf Path: Washington >> AA >> 360 Fall, 2009 Description: AA360 Propulsion Spring 2009 HOMEWORK #6 DUE: Friday, May 22 1. (6 pts.) Problem 3-3 from Mattingly\'s book. 2. (8 pts.) An \"air augmented\" rocket is designed to take advantage of atmospheric oxygen during ascent. Consider the concept shown, where ram... Date Added: 2009-06-16 19:33:08 |
| hw10.pdf Path: USC >> MATH >> 505 Fall, 2009 Description: Homework 10, Math 505a (problems for grading have equal weights) November 10November 17, Due date November 17. Problem 1. (for grading) Suppose the random variable X has generating function G(s). Find in terms of G the generating functions of X + n a... Date Added: 2009-06-16 19:35:51 |
| Marking Criteria Ass RL 1.doc Path: Allan Hancock College >> COMM >> 12116 Fall, 2009 Description: #C#Marking Criteria Ass RL 1.doc# ]#p#Ez Y=V#^,#mLc0#ldY`B#P#Cxw$73karP).p#s# @q2`;#I#PuW#RE\\#Hr|wveK{~i#> X#-gUl_z43sJ/NW# \'W3 %#ioXe#/#g[V1zUgNO=;C1,]z\'}: gzo:U16/aR/->#oz { =XvA[JF<i ... Date Added: 2009-06-16 19:36:48 |
| COIT12169_TAns4.rtf Path: Allan Hancock College >> COIT >> 12169 Fall, 2009 Description: #C#COIT12169_TAns4.rtf#YKs6#G;eH3*#fK6^p#Ip#h#Q #h#W#rI#A=p#UUv|v5}3^#fgqikkB(4#mu#eB#z#]gU6 gJ~ko\"#^Gf#gH#l~dp#_\"C:? A#\'mk~L5;Awf8AgY8~# OG\' UUnqDD D >A A#qeiu0#d #m2^fK EL [N h# ^xl+#-\'4{#,#/of#qfFfa7R#f\\;UU# \'X #A#KS&#i2k?s#e#\\9U# F v# j]+t#0 ... Date Added: 2009-06-16 19:36:54 |
| Contents Page.doc Path: Idaho >> JAMM >> 325 Fall, 2008 Description: Contents Page(s) Must: Work effectively as a \"floor plan\" for the use of the publication Logically group editorial (e.g., departments separate from features) Be a guide to what is most valuable and interesting in the issue Showcase your unique formul... Date Added: 2009-06-16 19:40:16 |
| Lect3_Theory_STUDENTS.pdf Path: Wisconsin >> SOC >> 120 Fall, 2008 Description: Soc 120 Marriage and the Family 1. Theoretical Perspectives FAMILY THEORIES FUNCTIONALISM Family is a structure meeting fundamental needs in society. Family life is organized around a way that is useful (f f l (functional) f society. ti l) for i t ... Date Added: 2009-06-16 19:41:41 |
| CH106 common ion solutions.pdf Path: Winthrop >> CHEM >> 106 Spring, 2008 Description: ... Date Added: 2009-06-16 19:41:55 |
| aquatics.xls Path: Penn State >> ETM >> 5013 Fall, 2009 Description: Aquatics Wear Six-Month Financial Projection be r Se pt em A ug us t Ju ly ct ob er O Total Net Revenues Cost of Goods Sold $23,538,000.00 8,944,440.00 $14,593,560.00 $10,781,000.00 4096780 $6,684,220.00 $18,875,345.00 7172631.1 $11,702,713.90 G... Date Added: 2009-06-16 19:42:48 |
| lecture14.pdf Path: Oakland University >> CSE >> 40833 Fall, 2009 Description: MPI collective communication 10/1/07 Tree-structured communication Suppose we would like to broadcast specific data from one processor to the remaining p - 1 processors. As mentioned before, this can be done using a tree structure. 1 Basic frame... Date Added: 2009-06-16 19:43:52 |
| 19 Coastal Processes 2.ppt Path: Western Washington >> GEOL >> 101 Fall, 2008 Description: This We k & Ne e xt Today oastal Proce s, proble s, solutions sse m C vie e 100 7 pmRe w S ssion ES Friday: rm Midte #2 Today\'s Plan De ltas S a le l change e ve s Tide s C oastal Fe ature s C oastal Proble s m C oastal S olutions De lta... Date Added: 2009-06-16 19:44:29 |
| ece447_lab3_ec.pdf Path: George Mason >> ECE >> 447 Fall, 2008 Description: ECE 447 Lab Assignments #3: Extra Credit (3 Points) Due Dates: 1. Demonstrations of the lab assignment extra credit must be completed by the first 20 minutes of your lab on October 2, 3, 4, 2006. 2. The lab write-up and the source code will be due in... Date Added: 2009-06-16 19:46:47 |
| ch2.ppt Path: Texas A&M >> STAT >> 201 Fall, 2008 Description: Ch 2 and 9.1 Relationships Between 2 Variables More than one variable can be measured on each individual. Examples: Gender and Height Size and Cost Eye color and Major We want to look at the relationship among these variables. Is there an ass... Date Added: 2009-06-16 19:48:52 |
| Reading Questions for Zaidi.doc Path: Laurentian >> ANTH >> 200503 Fall, 2009 Description: Reading Questions for Zaidi. 1. What are the goals of the `new development paradigm\'? 2. How has `the state\' been seen in this new paradigm? 3. What is the role for `civil society\' in this new paradigm? 4. Why and how are NGOs thought to be key for \"... Date Added: 2009-06-16 19:49:36 |
| lecture14.pdf Path: Oakland University >> CSE >> 60833 Fall, 2009 Description: MPI collective communication 10/1/07 Tree-structured communication Suppose we would like to broadcast specific data from one processor to the remaining p - 1 processors. As mentioned before, this can be done using a tree structure. 1 Basic frame... Date Added: 2009-06-16 19:49:50 |
| Syllabus CNIT 499.doc Path: Purdue North Central >> CNIT >> 499 Fall, 2009 Description: Course Syllabus and Outline CNIT 499A Survey of Programming Languages Spring 2009 Prof. M.J. Lantis (219) 785-5477 mlantis@pnc.edu I. COURSE WEB SITE http:/www.pnc.edu/faculty/mlantis/CNIT499SP09 II. COURSE DESCRIPTION Introduction to the history a... Date Added: 2009-06-16 19:55:21 |
| lec_notes_week_7.pdf Path: Ill. Chicago >> CHEM >> 112 Fall, 2008 Description: ... Date Added: 2009-06-16 19:55:30 |
| Creating a Query in Access Using the Wizard.doc Path: Trinity U >> CS >> 1300 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|30 Nov 2005 17:51:25 -0000 vti_extenderversion:SR|6.0.2.6551 vti_author:SR|TRINITY\\jbelisle vti_modifiedby:SR|TRINITY\\jbelisle vti_timecreated:TR|30 Nov 2005 17:51:25 -0000 vti_cacheddtm:TX|30 Nov 2005 ... Date Added: 2009-06-16 19:55:58 |
| Tour.doc Path: Trinity U >> CS >> 1300 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|TRINITY\\jbelisle vti_modifiedby:SR|TRINITY\\jbelisle vti_timelastmodified:TR|12 Aug 2005 20:56:32 -0000 vti_timecreated:TR|12 Aug 2005 20:56:32 -0000 vti_cacheddtm:TX|12 Aug 2005 20:56:32 -0000 vti_filesize:IR|286... Date Added: 2009-06-16 19:56:25 |
| week5-s1.pdf Path: Arizona >> MATH >> 124 Fall, 2008 Description: MATH 124-22 Calculus (Salomone) Quiz 7 Name: Key 1. On the axes at left, sketch the graph y = f (t) of a function which satises the following properties: f(t) f (4) = 3 Note that this means the graph goes through the point (4, 3). f (t) is posi... Date Added: 2009-06-16 20:04:32 |
| a2q4s.pdf Path: Laurentian >> C >> 3710 Fall, 2009 Description: Chemistry 3710 Fall 2001 Assignment 2 Solution to question 4 4. (a) The uncertainties in the heat capacities range over several orders of magnitude, so we\'re going to have to use a weighted fit with weights wi 1 CP i . Fitting the data to the Einste... Date Added: 2009-06-16 20:04:50 |
| Lecture 4.2.pdf Path: UCSC >> ISM >> 293 Spring, 2009 Description: An Introduction to Machine Learning L2: Instance Based Estimation Yahoo! Labs Santa Clara, CA 95051 alex@smola.org UC Santa Cruz, April 2009 : An Introduction to Machine Learning 1 / 49 Overview L1: Machine learning and probability theory Introd... Date Added: 2009-06-16 20:05:25 |
| cd cover.doc Path: St. Catherine >> PROJECT >> 111 Fall, 2009 Description: A simple introduction of Uyen Vu, created by classmate, Renee Petersen (2) click \"start\" and Installation Instructions: Each page has a main header to allow you to see if you are on the right page. Installation Instructions: (1) place cd into... Date Added: 2009-06-16 20:05:33 |
| rfc1062.txt Path: Arkansas Tech >> CS >> 4303 Fall, 2009 Description: Network Working Group S. Romano Request for Comments: 1062 M. Stahl Obsoletes RFCs: 1020, 997, 990, 960, 943, M. Recker 923, 900, 870, 820, 790, 776, 770,... Date Added: 2009-06-16 20:08:06 |
| rfc1067.txt Path: Arkansas Tech >> CS >> 4303 Fall, 2009 Description: Network Working Group J. Case Request for Comments: 1067 University of Tennessee at Knoxville M. Fedor ... Date Added: 2009-06-16 20:08:07 |
| INS Bio Lab 4 miniprep.pdf Path: Evergreen >> ACADEMIC >> 0708 Fall, 2009 Description: SMALL-SCALE PREPARATIONS OF PLASMID DNA Minipreparations of plasmid DNA can be obtained either by the alkaline lysis method presented below or by the boiling method (see page 1.29). Harvesting and Lysis o f Bacteria HARVESTING 1. Transfer a single... Date Added: 2009-06-16 20:09:16 |
| 4550stu17t.pdf Path: St. Augustine NC >> MGMT >> 4550 Fall, 2009 Description: 17 Promotional Strategies PowerPoint Presentation by Charlie Cook 12e Copyright 2003 South -Western College Publishing. All rights reserved. The Communication Process in Promotion Communication Process Components Sourcethe message sender Cha... Date Added: 2009-06-16 20:10:23 |
| Class22_BUS311.ppt Path: University of Hawaii - Hilo >> BUS >> 311 Fall, 2009 Description: Class 22 Outline Ch. 10 Q1-Q3 discussion Group project Part I due tonight! Questions? Assignment #12 due tonight Questions? Pearson Prentice Hall 2009 101 Q1 What is systems development? Q2 Why is systems development difficult and ris... Date Added: 2009-06-16 20:14:18 |
| student.pdf Path: UNC >> BIOS >> 662 Fall, 2008 Description: density 0.0 0.1 0.2 0.3 0.4 0.5 -3 N(0,1) t(df=2) -2 -1 0 1 2 3 z ... Date Added: 2009-06-16 20:15:28 |
| student.pdf Path: UNC >> BIOS >> 162 Fall, 2009 Description: density 0.0 0.1 0.2 0.3 0.4 0.5 -3 N(0,1) t(df=2) -2 -1 0 1 2 3 z ... Date Added: 2009-06-16 20:16:41 |
| waf_2004_123_final.doc Path: SUNY Albany >> ATM >> 401 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>19823df52ca3a24bf2f5bad90d0f79b5e88bf445.doc</Key><RequestId>F 071D271EDC9CF8A</RequestId><HostId>a2V+IbkjAxpTnr7gV7+36Dls4BD... Date Added: 2009-06-16 20:21:05 |
| week3.doc Path: Rosalind Franklin University of Medicine & Science >> COMP >> 107 Fall, 2009 Description: Welcome to Module 3! Module 2 Review: Module 2 was spent learning about learning about the NVU software and how to publish your web pages. Im sure much experimentation occurred with background colors, etc. I would have to admin that I personally am g... Date Added: 2009-06-16 20:21:30 |
| probsolv.pdf Path: Kent State >> MATH >> 14001 Spring, 2008 Description: MATH 14001 INTRODUCTION TO PROBLEM SOLVING SECTIONS 1.1, 1.2 1. Place the numbers 1, 2, 3, 4, 5, 6, 7 into the circles so that any three numbers in a line through the center give the same sum. 2. Mike said that when he opened his book, the sum of... Date Added: 2009-06-16 20:22:35 |
| lessonplanforiep.doc Path: Wisc Stevens Point >> PMEYE >> 130 Fall, 2009 Description: Introduction: This is a lesson was developed as a part of a class that focused on teaching every student in the class, whether they had disabilities or not. Reflection: A teacher needs to know the boundaries a class can accomplish. This lesson is an ... Date Added: 2009-06-16 20:23:10 |
| AK_Chapter_05.pdf Path: Sveriges lantbruksuniversitet >> E >> 105 Fall, 2009 Description: CHAPTER 5 Questions for Review 1. 2. 3. 4. 5. 6. 7. Year 2001 2002 Nominal GDP $200 $600 Real GDP $200 $400 GDP Deflator 100 150 Every transaction has a buyer and a seller. Luxury. Higher market value. $3. It does not affect GDP at all. C + I + G + N... Date Added: 2009-06-16 20:23:31 |
| example1lect3bodeplot.pdf Path: SPSU >> ECET >> 2310 Fall, 2009 Description: ... Date Added: 2009-06-16 20:24:27 |
| Elena_etal_1996.pdf Path: CSU Northridge >> SD >> 51881 Fall, 2009 Description: X-100, 0.5% deoxycholate, 0.10% SDS, 100% glycerol, 1 mM PMSF, 10 ptg/ml of leupeptin, and 10 ,ug/ml of aprotinin. The ZPR1 immunoprecipitates were examined by protein immunoblot analysis with the monoclonal EGFR antibody 20.3.6 (18). 21. Membranes w... Date Added: 2009-06-16 20:26:26 |
| EfficientReplenishmentOutline.pdf Path: Michigan State University >> FIM >> 220 Spring, 2008 Description: FIM 220 Food Products Marketing Efficient Replenishment Objectives: 1. Understand the goals of efficient replenishment 2. Examine how information can be exchanged electronically for inventory 3. Discuss time-based manufacturing and retail strategies... Date Added: 2009-06-16 20:30:41 |
| h_v_2.ps Path: RPI >> ECSE >> 35473 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: Windows PSCRIPT %Title: WordPerfect Document %BoundingBox: 18 9 593 784 %DocumentNeededResources: (atend) %DocumentSuppliedResources: (atend) %Pages: (atend) %BeginResource: procset Win35Dict 3 1 /Win35Dict 290 dict def Win35... Date Added: 2009-06-16 20:32:09 |
| SSAD_LCO_F06a_T21_V1.4.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: System and Software Architecture Description (SSAD) Version 1.4 System and Software Architecture Description (SSAD) AFRICAN MILLENIUM FOUNDATION Team# 21 Sidharth Kumar (Project Manager) Mayank Rathi (System Analyst & Designer) Sarthak Datt (Requir... Date Added: 2009-06-16 20:32:20 |
| ar1datfcp.xls Path: UMKC >> BDS >> 545 Fall, 2008 Description: VERTICAL X X 1000 1 5 5 176.963 177.307 174.414 173.010 178.398 174.578 173.172 172.106 173.703 174.807 177.214 174.723 176.841 178.665 178.910 178.457 175.703 177.961 182.799 180.855 176.512 177.180 178.234 172.377 176.290 179.037 176.677 176.463 17... Date Added: 2009-06-16 20:33:49 |
| handout 26.pdf Path: UMass (Amherst) >> RESE >> 211 Fall, 2009 Description: ... Date Added: 2009-06-16 20:36:44 |
| In Defense of Lecturing.pdf Path: Arizona >> GEOG >> 695 Fall, 2009 Description: In Defense of Lecturing Mary Burgan From Change November/December 2006 http:/www.carnegiefoundation.org/change/sub.asp?key=98&subkey=2105 In the past dozen years or so, pedagogical reformers in higher education have registered their sense of the fac... Date Added: 2009-06-16 20:38:59 |
| lecture13.pdf Path: Virginia Tech >> CS >> 4604 Fall, 2008 Description: Midterm Solutions Midterm Solutions Zaki Malik October 16, 2008 October 16, 2008 SELECT C1.pid FROM Catalog C1, Catalog C2 WHERE C1.pid = C2.pid AND C1.sid <> C2.sid AND C1.cost > C2.cost ; ... Date Added: 2009-06-16 20:39:51 |
| f06families.pdf Path: Laurentian >> BIOL >> 200803 Fall, 2009 Description: Family Salmonidae -15 species, 4 introduced Cisco, Coregonus artedi Shortjaw cisco, Coregonus zenithicus Lake whitefish, Coregonus clupeaformis Pygmy whitefish, Prosopium coulteri Round whitefish, Prosopium cylindraceum Mountain whitefish, Prosopium ... Date Added: 2009-06-16 20:45:41 |
| MAC 1147.doc Path: Miami Dade >> MAC >> 1147 Fall, 2008 Description: Professor: E. Nicoli-Suco Office: 1539 or 2223 Telephone: 305- 237-3505 Email:esuco@mdc.edu MAC 1147 Ref. #: 504578 Pre-Calculus & Trigonomety Prerequisite: Students in this class must have completed MAC 1105 with a C or higher, or have qualified fo... Date Added: 2009-06-16 20:46:39 |
| f97-quiz-2-key.ps Path: CSU Channel Islands >> ICS >> 171 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: f97-quiz-2-key.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o f97-quiz-2-key.ps f97-quiz-2-key.dvi %DVIPSPara... Date Added: 2009-06-16 20:48:47 |
| cge_agenda_10232007.pdf Path: Gallaudet >> AY >> 0708 Fall, 2009 Description: Council on Graduate Education Agenda for 10/23/2007 Meeting 9:30 to 10:45 a.m., Room E150, HMB Members: Dirksen Bauman, ASL and Deaf Studies (Chair); Patrick Brice, Psychology; Francis Duffy, Administration and Supervision; Barbara Gerner de Garcia, ... Date Added: 2009-06-16 20:49:28 |
| CIPS_COE_final_2007.pdf Path: Cuyamaca College >> COMP >> 3663 Fall, 2009 Description: Code of Ethics and Professional Conduct This document describes the Code of Ethics and Professional Conduct to which all CIPS members must commit. Preamble The Information Technology profession has developed over the years to meet the need for IT se... Date Added: 2009-06-16 20:51:58 |
| AnswersSection9_2.pdf Path: Bard >> MATH >> 141 Fall, 2009 Description: Math 141: Business Math I Sections 506 and 523 Answers to Section 9.2 Spring 2008 MW 4:10-5:25, TR 3:55-5:10 Answers to the even-numbered suggested problems from Section 9.2: 10/11 1/11 12. 18. In the long run, 60% of the commuters will use publi... Date Added: 2009-06-16 20:52:05 |
| RSSHW11.doc Path: Idaho >> AGECON >> 333 Fall, 2009 Description: Name:_ RSS RSS Homework 11 -Sales Presentation Outline - 50 points In preparation for the evening of RSS, fill out the four page outline that follows. This assignment does not need to be typed. RSSPresentationOutline Evaluation Possible points =... Date Added: 2009-06-16 20:52:59 |
| spikes.pdf Path: Brookdale >> MATHSTAT >> 5230 Fall, 2009 Description: ... Date Added: 2009-06-16 20:53:06 |
| ex6aut04.xls Path: Fayetteville State University >> BSC >> 5936 Fall, 2009 Description: TL 156 156 163 163 160 156 162 163 164 163 160 160 158 158 158 155 160 156 158 166 165 157 164 166 167 161 166 161 154 160 155 154 156 161 157 159 158 158 160 162 161 160 159 158 159 166 159 160 161 163 156 165 WL 246 245 248 248 250 237 253 254 251... Date Added: 2009-06-16 20:53:57 |
| a4.pdf Path: Arizona >> CS >> 372 Fall, 2009 Description: CSc 372, Fall 2006 Assignment 4 Due: Thursday, October 12 at 23:59:59 Problem 1. (4 points) nzip.rb Write a Ruby iterator nzip(a1, a2, ., aN)that yields a series of arrays. The first array is [a1[0], a2[0],.aN[0], the second array is [a1[1], a2[1],.a... Date Added: 2009-06-16 20:54:49 |
| HW 3.doc Path: UNC Wilmington >> FIN >> 335 Fall, 2009 Description: FINANCE 335 HOMEWORK #3 1. What is the future value of $200,000 invested today if it is invested at 5% compounded annually for six years? 2. How much would you have to invest now at 7% compounded annually to have $40,000 available for the purchase... Date Added: 2009-06-16 20:58:20 |
| csl9501.ps Path: Georgia Tech >> CS >> 7470 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58c Copyright 1986, 1994 Radical Eye Software %Title: paper.dvi %Pages: 44 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Helvetica Times-Roman Times-Italic Times-Bold Courier %EndComments %DVIPSCommand... Date Added: 2009-06-16 21:01:46 |
| PresentationEvaluations.doc Path: Allegheny >> BIO >> 290 Fall, 2009 Description: FS Bio 201 Presentation Evaluation Evaluator: Group Members: Please comment on the following aspects of the FS Bio 201 presentation: 1) explanation of background to experiment 2) clarity of hypothesis / purpose for experiments 3) explanation of proc... Date Added: 2009-06-16 21:01:57 |
| Ford.ppt Path: Wisc La Crosse >> BUS >> 755 Fall, 2009 Description: JasonAustin DenineRood JeanneSands History Ford Motor Company entered the business world on June 16, 1903, when Henry Ford and 11 business associates signed the company\'s articles of incorporation. With $28,000 in cash, the pioneering industrialists... Date Added: 2009-06-16 21:02:11 |
| sp-1-sol.pdf Path: Berkeley >> CS >> 164 Fall, 2008 Description: Midterm I CS164, Spring 2004 February 26, 2003 Please read all instructions (including these) carefully. Write your name, login, SID, and circle the section time. There are 7 pages in this exam and 4 questions, each with multiple parts. Some que... Date Added: 2009-06-16 21:02:43 |
| 08S1ENL280S.pdf Path: Augsburg >> AFA >> 0809 Fall, 2008 Description: COURSE OUTLINE English 280 Genre: History of Mystery Fiction Dr. Kathryn Swanson Memorial 222 (612-330-1010; office hours as posted on office door). I. Course Policies: A. Attendance will not be taken or recorded, but you are held responsible for e... Date Added: 2009-06-16 21:03:09 |
| lecture-26.pdf Path: Sveriges lantbruksuniversitet >> PHYS >> 365 Fall, 2009 Description: Emitter Injection Efficiency : Consider the forward biased p+n emitter junction. Assume neutral region of the emitter is thick: qV / kT - 1) n p ( x p ) = n p e - x / L where n p = n p0 ( e Diffusion current: n EB J En = q Dn D n p which gives I E... Date Added: 2009-06-16 21:03:46 |
| MultipleRepresentations6.pdf Path: Washington University in St. Louis >> CSE >> 131 Fall, 2009 Description: ... Date Added: 2009-06-16 21:04:01 |
| PowerOfPolymorphism2.pdf Path: Washington University in St. Louis >> CSE >> 131 Fall, 2009 Description: ... Date Added: 2009-06-16 21:04:02 |
| sn1999ac_1999_03_05.ps Path: Southern Oregon >> D >> 1990 Fall, 2009 Description: ... Date Added: 2009-06-16 21:06:04 |
| DDP.ppt Path: Neumont >> IFT >> 6100 Fall, 2009 Description: DDP Double Digest Problem prsent par Patrick Charbonneau Cours: IFT 6100 Universit de Montral Au menu Dfinition des enzymes. Dfinition, origine et utilisation des endonuclases. Dfinition et utilisation des cartes de restriction. Thorie des Casse... Date Added: 2009-06-16 21:08:04 |
| Oct15-memmgmt.ppt Path: Iowa State >> ECE >> 308 Fall, 2009 Description: Simple Memory Management One program at a time (not ideal for performance) What does running a program involve? Load program into memory Jump to the first instruction Issues: Need to protect the OS from the user program Relocation: User memor... Date Added: 2009-06-16 21:08:16 |
| A2gradingsheet.doc Path: Rutgers >> ITI >> 103 Fall, 2009 Description: Assignment #2 Grading Sheet: Total possible points before extra points: 30 Use of APA style (5 points) The definition of perfection is correct APA style. _ perfect cover sheet format (1 point) _ perfect reference list format (1 point ) _ perfect cita... Date Added: 2009-06-16 21:09:18 |
| HMC case optimizer - with revisions.xls Path: Tulane >> BREESE >> 714 Fall, 2009 Description: Notes: 1. Do not mess with cells colored in 2. Input values into cells colored in Portfolio Optimization with 12 assets Inputs: Exp. Returns, S.Devs Asset 1 2 3 4 5 6 7 8 9 10 11 12 E(r) 6.5% 6.5% 8.5% 9.5% 5.3% 5.2% 5.3% 5.0% 4.0% 4.0% 3.6% 3.0% Co... Date Added: 2009-06-16 21:14:48 |
| hw01.txt Path: Michigan Flint >> CSC >> 375 Fall, 2009 Description: Problems from Chapter 1, pp. 17 - 19: Do problems 1.2, 1.5, 1.7, 1.9, 1.12, 1.14 Please keep in mind that I do not expect you to write code for any of these. If you are \"defining an ADT\" (as in problem 1.5), you might choose to write this in the ... Date Added: 2009-06-16 21:16:00 |
| UPD for the Web.pdf Path: CSU San Marcos >> CUSTOMERSA >> 0708 Fall, 2009 Description: 2007 Survey San Marcos Police Very Dissatisfied Dissatisfied Neutral Satisfied Very Satisfied Dont Know Total Average Score CSU 2007 Average 1A. Evening guide/escort services 1B. Crime prevention presentations 1C. Procedure for reporting crimes 1D. ... Date Added: 2009-06-16 21:16:08 |
| hw3.pdf Path: Arizona >> MATH >> 537 Fall, 2009 Description: Global Dierential Geometry HW 3 David Glickenstein September 18, 2007 1) 4-2a,4-5 2) 5-1 3) Consider the surface of revolution dened by (s; t) ! s cos t; s sin t; s2 : Compute the components of its Christoel symbols. Show that the meridian curves t =... Date Added: 2009-06-16 21:18:12 |
| review_post.ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 212 Fall, 2008 Description: * * * Easy Medium Difficult Physics 212 Hour Exam3 Re w vie HE3 Re w, S vie lide 1 * HE3 Re w, S vie lide 2 * HE3 Re w, S vie lide 3 * HE3 Re w, S vie lide 4 * HE3 Re w, S vie lide 5 * HE3 Re w, S vie lide 6 * HE3 Re w, S vie lide 7 *... Date Added: 2009-06-16 21:20:34 |
| Discussion Guide.docx Path: Uni. Westminster >> KSS >> 0130 Fall, 2009 Description: Discussion Guide #5 Kelly Stevens EDUC 343 Spring 2008 1. Personal Journal Purpose: To keep a personal journal of daily events in a student\'s life. This is a place where students can write their personal beliefs about what is going on in the world a... Date Added: 2009-06-16 21:21:55 |
| Lecture 14.doc Path: Maryville MO >> ECON >> 3229 Fall, 2009 Description: Chapter 15 iff NBR 1. The Fed uses three policy tools to manipulate the money supply: _, which affect reserves and the monetary base; changes in _, which affect the monetary base; and changes in _, which affect the money multiplier. (1) open market... Date Added: 2009-06-16 21:22:45 |
| chapter6.ppt Path: Old Dominion >> CS >> 455 Fall, 2008 Description: Chapter 6: The Transport Layer CS455/555 The Transport Service Provide efficient, reliable, cost-effective service to upper layers (application layer) Transport entity-the HW/SW that does the work to offer this service Connection-oriented and con... Date Added: 2009-06-16 21:24:40 |
| ch07(solution).doc Path: St. Francis IL >> X >> 341 Fall, 2009 Description: Part 3 Important Financial Concepts CHAPTER 7 Risk and Return SOLUTIONS TO PROBLEMS 7-5 LG: 1 Variance and Standard Deviation for a Series of Historic Returns Year Rate of Arithmetic Return Mean 1995 12.56 6.66 1996 25.58 6.66 1997 14.12 6.66 1998 -... Date Added: 2009-06-16 21:28:41 |
| practice.txt Path: Virginia Tech >> CS >> 5804 Fall, 2008 Description: 0. Know how to formulate given problems as search. Consider the following practice puzzle - the water-jug problem. We are given a 3-liter jug (named A) and a 4-liter jug (named B). Initially A and B are empty. Either jug can be filled wi... Date Added: 2009-06-16 21:28:46 |
| chapter07.ppt Path: S.E. Louisiana >> PHYS >> 191 Fall, 2008 Description: Chapter 7: Linear Momentum Definition of Momentum Impulse Conservation of Momentum Center of Mass Motion of the Center of Mass Collisions (1d, 2d; elastic, inelastic) 1 7.1 Momentum Consider two interacting bodies: F21 F12 Fnet t If we know the ... Date Added: 2009-06-16 21:29:10 |
| quiz43solution.pdf Path: Ill. Chicago >> MATH >> 181 Fall, 2008 Description: Math 181 Quiz 4 Solution Solve the following integral: x sin x dx 2 Solution: Use Integration by Parts to solve the integral. Let u(x) = x u (x) = 1 Then using the integration by parts formula: u(x)v (x) dx = u(x)v(x) - we have: x sin x x x dx = -... Date Added: 2009-06-16 21:29:43 |
| CMPE2322Sp09MatLab.doc Path: Texas Pan American >> CMPE >> 2322 Fall, 2008 Description: sinc(t) = sin(t)/t diric(x,n) =sin(nx/2)/(n*sin(x/2) yn = conv(xn,hn) [hn r] = deconv(yn,xn) \"r is all zero\'s\" stemplot(n,xn) b = fir1(n,w) Returns low pass filter w is normalized cutoff freq (w = 0.7 etc 0 <w <1) if w has two values [w1 w2] then ret... Date Added: 2009-06-16 21:31:06 |
| ClassSchedule.doc Path: Arizona >> MATH >> 302 Fall, 2008 Description: TENTATIVE SCHEDULE Math 302B Fall 2005 We will be examining the topics listed below, but it might not always be in the order presented here or exactly on the week indicated. Any adjustments/changes will be announced in class. Textbooks: Bassarear, T... Date Added: 2009-06-16 21:33:51 |
| hw1-re-critique.pdf Path: Michigan State University >> HW >> 491 Fall, 2009 Description: Requirements Engineering (CSE491-602, Fall 2006) Homework #1 Due September 5, 2006 (beginning of class) After reading the two papers: o B. A. Nuseibeh and S. M. Easterbrook, \"Requirements Engineering: A Roadmap,\" In A. C. W. Finkelstein (ed) The Futu... Date Added: 2009-06-16 21:37:29 |
| dll.ps Path: George Mason >> CS >> 455 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.76a Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: dll.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR7 LCIRCLEW10 CMBX12 CMR10 Helvetica CMSY10 %+ ZapfDingbats CMBX10 ... Date Added: 2009-06-16 21:38:46 |
| ass3-sol.pdf Path: UCSB >> MATH >> 119 Fall, 2009 Description: ... Date Added: 2009-06-16 21:39:05 |
| HW1spring06.doc Path: Iowa State >> MATH >> 165 Fall, 2008 Description: Math 165: Homework #1 Due 1-20-06 Show your work! If no work is shown, no credit will be given. Sec. 2.4: #3, 8, 10, 15 Sec. 2.6: #6, 11, 23 For #6,11: Just find each limit as in class, you do not need to identify each property used step-by-step. For... Date Added: 2009-06-16 21:39:29 |
| hw6sol.pdf Path: Iowa State >> MATH >> 165 Fall, 2008 Description: ... Date Added: 2009-06-16 21:39:44 |
| 450_NatRes_Ch6.ppt Path: LA Tech >> AGBU >> 450 Fall, 2009 Description: Agricultural Business 450 ~ Natural Resource Economics Chapter 6 Valuing the Environment Dr. Susan Watson Goals for Chapter 6 CostBenefit Analysis Estimating Value Techniques of Valuation Contingent Valuation DemandSide Methods SupplySide Me... Date Added: 2009-06-16 21:41:29 |
| Chapter 10.pdf Path: North Texas >> CECS >> 3220001 Spring, 2009 Description: ... Date Added: 2009-06-16 21:46:20 |
| Collection Solutions.doc Path: Frostburg >> COSC >> 641 Fall, 2008 Description: COSC 641 Spring 2006 FSU Collection Data Types Solutions A. Record: 1- Run this code: DECLARE TYPE Add_Type IS RECORD ( No NUMBER, St VARCHAR2(10), City VARCHAR2(8), State CHAR(2), Zip NUMBER(5) ); - A Student may have local address, permanent addre... Date Added: 2009-06-16 21:47:15 |
| Practice Chapter 15 PL SQL part one.doc Path: Frostburg >> COSC >> 641 Fall, 2008 Description: COSC 641 FSU PL/SQL Practice Part one 1 Run the following blocks. Why does this code compile? Sysdate is date type and not number type. Explain DECLARE sysdate NUMBER; BEGIN sysdate := 1; END; But this one does not? DECLARE then NUMBER; BEGIN then ... Date Added: 2009-06-16 21:47:16 |
| 151syllabus.doc Path: CSU Channel Islands >> PS >> 151 Fall, 2009 Description: Chemistry 151 Syllabus Analytical Chemistry Fall 2008 MWF 1000a-1050a Room: DBH 1600 Instructor: Robert M. Corn Email: rcorn@uci.edu Office: 2139 Nat Sci 2 Office hours: Monday 200p-300p; Thursday 1100a-1200p, or by appointment. Web page: http:/unic... Date Added: 2009-06-16 21:48:15 |
| h5.ps Path: University of Iowa >> C >> 177 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: h5.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o h5.ps h5 %DVIPSParameters: dpi=600, compressed, comments re... Date Added: 2009-06-16 21:55:11 |
| emtranscript.doc Path: CSU Northridge >> JMB >> 82846 Fall, 2009 Description: Electro magnetic induction The creation of electric current Transcript: So what I have here is a galvanometer. A galvanometer is a device that will measure and detect electric current. And I got attached to it a loop of wire. I am going to replicate ... Date Added: 2009-06-16 21:55:27 |
| M S E.pdf Path: San Diego State >> GB >> 0405 Fall, 2009 Description: Mathematics and Science Education In the College of Sciences and In the College of Education For further information regarding programs, consult the following: Ph.D. Program . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CRMSE 6475 Al... Date Added: 2009-06-16 21:57:39 |
| P A.pdf Path: San Diego State >> GB >> 0405 Fall, 2009 Description: Public Administration In the School of Public Administration and Urban Studies In the College of Professional Studies and Fine Arts OFFICE: Professional Studies and Fine Arts 100 TELEPHONE: (619) 594-6224 FAX: (619) 594-1165 Faculty Louis M. Rea, Ph... Date Added: 2009-06-16 21:57:40 |
| HHS.pdf Path: San Diego State >> ES >> 0607 Fall, 2009 Description: Health and Human Services OFFICE: Education 154 TELEPHONE: 619-594-6151 FAX: 619-594-7103 http:/chhs.sdsu.edu Courses (HHS) Refer to Courses and Curricula and University Policies sections of this catalog for explanation of the course numbering syste... Date Added: 2009-06-16 21:57:58 |
| DIV02.pdf Path: San Diego State >> ES >> 0304 Fall, 2009 Description: Academic Advising Student Services Financial Aid and Scholarships ... Date Added: 2009-06-16 21:59:07 |
| WMNST.pdf Path: San Diego State >> GB >> 0708 Fall, 2009 Description: Womens Studies In the College of Arts and Letters OFFICE: Arts and Letters 346 TELEPHONE: 619-594-6524 http:/www-rohan.sdsu.edu/dept/wsweb/masters.html whose preparation is deemed insufficient by the Graduate Admissions Committee may be admitted as c... Date Added: 2009-06-16 21:59:21 |
| CS411 Fall 2004 Presentation Guidelines.doc Path: BU >> CS >> 411 Fall, 2009 Description: CS411 Fall 2004 Presentation Guidelines Eachteamwillgiveapresentationabouttheirproject.Yourpresentationshouldbebetween25 30minutes;eachpresentationwillbefollowedbyquestionsanddiscussion. PotentialOutline 1. IntroductionWhatisthepresentationabout?What... Date Added: 2009-06-16 22:01:25 |
| EE319 K Lecture 9.pdf Path: Texas >> EE >> 319 Fall, 2008 Description: EE319 K Lecture 9 Test 1 Debugging Express PCB University of Texas ECE Test 1 Statistics for test Open Test 1 solution doc and go over. Debugging Intrusiveness degree of perturbation caused by the debugging itself how much the de... Date Added: 2009-06-16 22:02:03 |
| DrawingGraphics2D.ppt Path: Arizona >> CS >> 335 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|04 Oct 2006 04:34:10 -0000 vti_title:SR|Chapter 3 vti_author:SR|mercer vti_syncwith_localhost\\p\\:/p\\:TR|06 Oct 2005 20:38:31 -0000 vti_syncwith_localhost\\x\\:/x\\:TR|04 Oct 2006 04:34:10 -0000 vti_syncwit... Date Added: 2009-06-16 22:03:11 |
| YLR329W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YLR >> 329 Fall, 2009 Description: YLR329W.t2k EBGHSTL 3 2 1 C X C C S H H T X H H H T X X X X X X X XXXXXXXXXXXXXXXXXXXXXXX H C C H C H HHHHHHHHHHHH 10 T T T T T H H HHHHHHHH C H H H H X X X X X X X X H H H H H H X X X C H C C H H E H H H C C C X X X X X X X E... Date Added: 2009-06-16 22:08:14 |
| Law-vs-Ethics.ppt Path: Temple >> BA >> 804 Fall, 2009 Description: Law vs.- Ethics International Business Strategy 5136 Ram Mudambi ISEA, Bocconi University Law and ethics Legal dictates `What can be done\' Ethical dictates `What should be done\' Ram Mudambi, Temple University, 2006 2 Law vs. ethics ETHICAL ... Date Added: 2009-06-16 22:08:45 |
| ia-certificate.pdf Path: Georgia Tech >> ECE >> 20040114 Fall, 2009 Description: College of Computing and School of Electrical and Computer Engineering Undergraduate Information Assurance Certificate Version: November 21, 2003 The College of Computing and the School of Electrical and Computer Engineering Undergraduate Information... Date Added: 2009-06-16 22:09:08 |
| andhrapradesh1987.xls Path: Yale >> RP >> 269 Fall, 2009 Description: STATE ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDH... Date Added: 2009-06-16 22:12:20 |
| slac-pub-1766.pdf Path: Stanford >> PUBS >> 1750 Fall, 2009 Description: SLAC-PUB-1766 June 1976 (T/E) PARTICLE RATIOS IN INCLUSIVE ELECTROPRODUCTION FROMHYDROGEN AND DEUTERIUM J.F. Martin)t,C. Bolon, R.C. Lanza, D. Luckey, L.S. Osborne, and. D.G. Roth .Laboratory for Nuclear Science Massachusetts Institute of Tec... Date Added: 2009-06-16 22:15:46 |
| slac-pub-1808.pdf Path: Stanford >> PUBS >> 1750 Fall, 2009 Description: SLAC-PUB-1808 August 1976 w A NOVEL INCONSISTENCY IN TWO DIMENSIONAL GAUGE THEORIES* Y. Frishman* Lauritsen Laboratory California Institute of Technology Pasadena, California 91125 C. T. Sachrajda, t H. Abarbanel, and R. Blankenbecler Stanford Li... Date Added: 2009-06-16 22:15:50 |
| adwarp.ps Path: Air Force Academy >> GES >> 125 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: adwarp.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips adwarp %DVIPSParameters: dpi=600, compressed, comments rem... Date Added: 2009-06-16 22:16:57 |
| lecture11notes.ppt Path: University of Illinois, Urbana Champaign >> PHY >> 122 Fall, 2009 Description: Electromagnetic Induction Induced current/emf(voltage) Current or voltage produced by a changing magnetic field. Motional Emf (voltage) = v B L Is energy Conserved? Magnetic Flux Magnetic flux is the \"amount\" of field lines that pass through ... Date Added: 2009-06-16 22:17:13 |
| act13_F06.pdf Path: Kentucky >> MA >> 109 Fall, 2008 Description: MA109, Activity 13: Other types of equations (Section 1.5, pp. 115-121) Date: Today\'s Goal: So far we have learned how to solve linear and quadratic equations. We now study other types of equations, including those that involve higher powers, fra... Date Added: 2009-06-16 22:22:50 |
| part-2.pdf Path: TCNJ >> POL >> 318 Spring, 2008 Description: INDICATOR Productivity Importance 31 Productivity The amount of Gross State Product produced per worker: Increasing Higher productivity means getting more output from the same amount of work. It can let us enjoy more fruits from the same amount o... Date Added: 2009-06-16 22:25:49 |
| problem 9.doc Path: Laurentian >> ECON >> 3012 Fall, 2009 Description: ECONOMICS J. ALLEN 3012 SPRING 2007 PROBLEM SET 9 I. Given: Yn = 400 Find = 100 f = 2 II. Given: = 1.25 A0 = 800 P0 = 1.0 =5 M0 = 50 Yn = 1000 f =1 = .8 = 250 i = .02 Y - .1 (50/P) A. B. Find AD0 , Y0 and i0 . For each of the thre... Date Added: 2009-06-16 22:25:55 |
| SyllabusFA05.doc Path: N.E. Illinois >> BUS >> 3500 Fall, 2009 Description: Lumpkin College of Business and Applied Sciences School of Business BUS 3500 001 Management Information Systems Fall 2005 Instructor: Dr. Karen Ketler Lumpkin Hall 4012 (217) 581-6906 E-Mail Address: cfkjk@eiu.edu Website: www.ux1.eiu.edu/~cfkjk 1:4... Date Added: 2009-06-16 22:25:59 |
| Notes5.pdf Path: New Mexico >> PHYS >> 523 Fall, 2009 Description: ... Date Added: 2009-06-16 22:30:03 |
| Poster3.pdf Path: Acton School of Business >> BIOE >> 260 Fall, 2009 Description: SpiralAT: First Generation Artificial Trachea Theodore John, Insiya Hussain, Nicole Campuzano, and Yoon Kim Department of Bioengineering, Rice University, Houston, Texas SpiralAT@aim.com Mission Statement We aim to provide the first artificial trach... Date Added: 2009-06-16 22:31:11 |
| Cycling Reflection.doc Path: Penn State >> DHM >> 125 Fall, 2009 Description: KINES 109 Fitness Class Reflection: Cycling 1. Describe the class you attended. I attended a cycling class. It was in a very small squash court where most of the participants were no more than two feet away from each other. 2. How many people were in... Date Added: 2009-06-16 22:32:04 |
| jensen & murphy 1990.pdf Path: UPenn >> ACCT >> 920 Spring, 2009 Description: ... Date Added: 2009-06-16 22:32:47 |
| CS110_9a.ppt Path: N.C. State >> PAGES >> 110 Fall, 2009 Description: CS110: Lecture 24 Some Universal Algorithms Jack Tumblin jet@cs.northwestern.edu I hope you: Have Started on Proj 5, Due Wed Dec. 3 Read about searching and sorting: Chap. 8-6, 8-5 Will be ready for Quiz 4, Wed Nov 26 Search Name2, Name1 Cratc... Date Added: 2009-06-16 22:33:22 |
| besley-burgessQJE.pdf Path: Sveriges lantbruksuniversitet >> E >> 455 Fall, 2009 Description: LAND REFORM, POVERTY REDUCTION, AND GROWTH: EVIDENCE FROM INDIA* TIMOTHY BESLEY AND ROBIN BURGESS In recent times there has been a renewed interest in relationships between redistribution, growth, and welfare. Land reforms in developing countries a... Date Added: 2009-06-16 22:33:43 |
| c07_netw_models.pdf Path: Penn State >> PHYS >> 597 Fall, 2009 Description: Network models Properties common to many large-scale networks, independently of their origin and function: 1. The degree and betweenness distribution are decreasing scale - free functions, usually power-laws. 2. The distances scale logarithmically wi... Date Added: 2009-06-16 22:34:13 |
| project.pdf Path: Utah >> MATH >> 2280 Summer, 2008 Description: Math 2280-2 Computing Project #1 January 24 2008 This project is due on Tuesday February 5 2008. You may work in groups of 13 persons. Only one writeup per group should be submitted. Be sure to put your name(s) on the first page. Some problems may as... Date Added: 2009-06-16 22:36:18 |
| Lecture6radiometric.ppt Path: Mich Tech >> FW >> 5560 Fall, 2008 Description: Digital Image Processing: A Remote Sensing Perspective FW5560 Lecture 6 Radiometric Correction Radiometric correction Improving the accuracy of surface spectral reflectance or emittance. Would like to obtain measurements of absolute reflectance or em... Date Added: 2009-06-16 22:39:54 |
| exam_03_sp02_soln.pdf Path: University of Illinois, Urbana Champaign >> LIFE >> 353 Fall, 2009 Description: 1 Name (Last, First)_KEY_ Graduate _ or Undergraduate _ Biochemistry 353 Third hourly Test April 8, 2002 Part I : Part II : Part III : Part IV : Part V : Total : _ _ _ __ _ _ / 14 / 24 / 20 / 28 / 14 / 100 Part I True / false section: circle appropr... Date Added: 2009-06-16 22:40:33 |
| practiceA4.pdf Path: Allan Hancock College >> MATH >> 1040 Fall, 2009 Description: MATH1040 1. (a) (1) A = {6, 7, 8, 9, 10, 11}. (2) A B = {5, 6, 7, 8, 9, 10, 11, 13, 15}. (3) B C = {6}. (4) A \\ C = {7, 9, 10, 11}. (5) A \\ (B C) = {7, 9, 10, 11}. (6) (A B) C = {6}. Solutions to Practice Questions 4 (b) (1) B C = {-5, -3, -1... Date Added: 2009-06-16 22:45:15 |
| homework2_quizb_sol.pdf Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: 2/11/03 CprE 211 Spring 2003 Homework 2 Quiz Solution Last Name First Name Signature Section Number _ _ _ Score _ _ Given the following memory dump, answer the questions. Note: the byte at address 40002000 has value 0x00; at address 40002001, 0x... Date Added: 2009-06-16 22:45:36 |
| ClickerQuestionBank2.ppt Path: Colorado >> MCDB >> 1150 Fall, 2008 Description: The similarities and differences between bacterial and eukaryotic cells suggest: a. bacteria evolved from eukaryotes b. eukaryotes evolved from bacteria c. eukaryotes and bacteria Which of these characteristics of CELLS apply also to VIRUSES? A. lif... Date Added: 2009-06-16 22:50:53 |
| Miller & Kelley 1994.pdf Path: Illinois State >> SED >> 383 Fall, 2008 Description: JOURNAL OF APPLIED BEHAVIOR ANALYSIS 1994,27,73-84 NUMBER I (SPRING 1994) THE USE OF GOAL SETTING AND CONTINGENCY CONTRACTING FOR IMPROVING CHILDREN\'S HOMEWORK PERFORMANCE DEBORAH L. MILLER AND MARY Lou KELLEY LOUISIANA STATE UNIVERSITY We ex... Date Added: 2009-06-16 22:51:11 |
| topic40.pdf Path: UWO >> AM >> 026 Fall, 2009 Description: Cones. The equation z2 = x2 + y2 represents a right-circular cone with axis along the z-axis. Ellipsoid. The Equation x2 y 2 z 2 + + =1 a 2 b2 c2 represents an ellipsoid with semi-axes a, b and c. If a = b = c, the ellipsoid is a sphere. ... Date Added: 2009-06-16 22:51:58 |
| Lesson 22- IntroToJavaApplets.pdf Path: Lincoln U. CA >> CSCI >> 3381 Fall, 2009 Description: Object-Oriented S/W Development with Java CSCI 3381 Lesson 22: Intro to Applets & Multiple Document Interface (MDI) April 14, 2009 1 Object-Oriented S/W Development with Java CSCI 3381 Java Applets Applet: Java program that runs in an appletviewe... Date Added: 2009-06-16 22:54:26 |
| exam-sp-07_sol.pdf Path: Wisconsin >> ECE >> 753 Fall, 2009 Description: ECE 753 - FAULT-TOLERANT COMPUTING (Spring 2006-2007) Examination CLOSED BOOK Kewal K. Saluja Date: April 18, 2007 Location: Room 3444 Engineering Hall Time: 7:15 PM Duration: 90 Minutes PROBLEM 1 2 3 4 5 6 7 8 TOTAL POINTS SCORE 15 15 10 12 10 1... Date Added: 2009-06-16 22:55:49 |
| xrt.txt Path: Berkeley >> ASTRO >> 00315819 Fall, 2009 Description: 100.003 130.97 1.34552 0.353246 130.97 156.043 1.17027 0.375216 156.043 173.594 1.66058 0.536144 173.594 211.204 1.5446 0.353869 211.204 241.292 2.14153 0.463801 241.292 283.916 1.44193 0.319874 283.916 311.497 1.0567 0.341172 311.497 339.077 1.06389... Date Added: 2009-06-16 22:55:57 |
| swb_timeinfo_1s.txt Path: Berkeley >> ASTRO >> 00315819 Fall, 2009 Description: #file=swb15-350lc.txt dt=1.0 tstart=-0.670 tstop=5.090 #t90 dt90 t50 dt50 rt90 drt90 rt50 drt50 rt45 drt45 tav dtav tmax dtmax trise dtrise tfall dtfall cts cts_err pk_rate dpk_rate band 6.000 0.734 3.000 0.618 5.000 0.... Date Added: 2009-06-16 22:56:00 |
| distrib_nebulae_Hubble.pdf Path: Virgin Islands >> ASTR >> 405 Fall, 2009 Description: 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79.8H 1934ApJ.79... Date Added: 2009-06-16 22:56:31 |
| tab95.xls Path: Cornell >> ERS >> 91011 Fall, 2009 Description: Table 95-World potato production by country, 1961-2002 - continued 1/ Country 1990 1991 1992 1993 1994 1995 1996 Million cwt China Russian Federation India United States of America Ukraine Poland Germany Belarus Netherlands France United Kingdom Turk... Date Added: 2009-06-16 22:58:56 |
| docs3_inst_year_tot.txt Path: CSU Channel Islands >> PRE >> 20080512 Fall, 2009 Description: AI 2000 1660 AI 2001 1622 AI 2002 1827 AI 2003 2396 AI 2004 2563 AI 2005 2523 AI 2006 2362 AI 2007 3005 AI 2008 1731 CA 2000 2423 CA 2001 2760 CA 2002 2877 CA 2003 3168 CA 2004 344... Date Added: 2009-06-16 23:02:40 |
| lec10.ps Path: Rutgers >> CS >> 314 Fall, 2002 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.83 Copyright 1998 Radical Eye Software %Title: lec10.dvi %Pages: 16 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMSY10 CMR17 CMR12 CMSS17 CMTI12 CMTT12 CMMI12 %EndComments %DVIPSWebPage: (ww... Date Added: 2009-06-16 23:02:42 |
| lab 7 SDS.ppt Path: University of Illinois, Urbana Champaign >> BIOE >> 202 Spring, 2008 Description: The usual Pre and post lab exercises are on handouts Online quiz Don\'t return today or tomorrow SDS-PAGE OF myoblasts, myotubes, fibroblasts and adipocyte lysates Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis Is a technique allowing... Date Added: 2009-06-16 23:03:58 |
| Chapter26.ppt Path: Loyola Maryland >> CS >> 482 Fall, 2009 Description: Supplementary Slides for Software Engineering: A Practitioner\'s Approach, 5/e copyright 1996, 2001 R.S. Pressman & Associates, Inc. For University Use Only May be reproduced ONLY for student use at the university level when used in conjunction wit... Date Added: 2009-06-16 23:04:04 |
| DeLong1988.pdf Path: Wisconsin Milwaukee >> ECON >> 353 Fall, 2008 Description: ... Date Added: 2009-06-16 23:04:43 |
| summer353FINAL.pdf Path: Wisconsin Milwaukee >> ECON >> 353 Fall, 2008 Description: University of Wisconsin Milwaukee ECON 353 Summer 2004 Ozlem Eren FINAL TAKE HOME EXAM Answer 3 questions from each part. Type your answers. Each question is worth 10 points. (Total: 120 points) PART I 1. Distinguish between the size and functional d... Date Added: 2009-06-16 23:04:43 |
| Using the Comment & Track Changes Features in Word 2007.doc Path: SEMO >> EN >> 100 Fall, 2009 Description: Using the Comment and Track Changes Features in Microsoft Word 2007 The comment feature is a useful way for teachers and peer editors to exchange discussion about papers electronically. One benefit over simply typing or handwriting comments on a p... Date Added: 2009-06-16 23:07:50 |
| SMOKING ROOM BLONDES.doc Path: SEMO >> EN >> 100 Fall, 2009 Description: SMOKING ROOM BLONDES Erin Gryzmala Upstairs, the thumping bass pulsates from the stereo. The vibrations throb through the walls, all the way down to the basement, and into the couch on which I am sitting. Directly above my head is the dance floor/bar... Date Added: 2009-06-16 23:07:56 |
| final99sol.ps Path: University of Montana >> CS >> 446 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: final99sol.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Times-Italic Helvetica Courier %EndComments %DVIPSWebPage:... Date Added: 2009-06-16 23:09:28 |
| ps5_s09.pdf Path: UCSC >> ECON >> 100 Fall, 2009 Description: Econ 100A: Intermediate Microeconomics Problem Set 5 Due in class Wednesday May 27 1. Answer the following short questions: a. If the firm is producing where the marginal product relative to input price is greater for input 2 than input 1 (i.e. MP2/w... Date Added: 2009-06-16 23:10:43 |
| IE486_exam 1 review revised.ppt Path: Purdue >> IE >> 486 Fall, 2008 Description: IE 486 Work Analysis & Design II Instructor: Vincent Duffy, Ph.D. Associate Professor Exam 1 Review Fri. Feb. 9, 2007 Review for exam 1 Closed book, closed notes exam will cover: 7 lectures and 2 labs Chapters 1, 4-9, 19, 15 (bonus) in Wickens tex... Date Added: 2009-06-16 23:12:18 |
| emphasis.doc Path: Iowa State >> MR >> 0126 Fall, 2009 Description: Des Moines Register, IA 01-24-07 Emphasis on ethanol stands out Energy: Bush plan calls for 20% reduction in gasoline usage within 10 years War in Iraq: President makes case for his strategy, says \'America must not fail By PHILIP BRASHER REGISTER WA... Date Added: 2009-06-16 23:13:18 |
| lecture4-BW-2004.ppt Path: Michigan State University >> LECTURE >> 202 Fall, 2009 Description: Lecture 3: Chemistry of Life Part 3 of 2 Same song Second verse A little bit louder And a whole lot worse Lecture 3: Chemistry of Life Part 3 of 2 Goals: Finish with biochemistry Understand: 1.)What protein is, 2.)What protein does, and 3.) how m... Date Added: 2009-06-16 23:14:32 |
| ex7ans.pdf Path: Duke >> PHY >> 222 Fall, 2009 Description: ... Date Added: 2009-06-16 23:16:59 |
| notes_Lecture_16.pdf Path: Washington >> CHEM >> 152 Fall, 2008 Description: Lecture 16: Bohr Model of the Atom Reading: Zumdahl 12.3, 12.4 Outline Emission spectrum of atomic hydrogen. The Bohr model. Extension to higher atomic number. Newton\'s rings Interference pattern by a circularly symmetric thin film http:/www.... Date Added: 2009-06-16 23:17:01 |
| w2008_solution.pdf Path: ECCD >> EXAMS >> 3909 Fall, 2009 Description: ... Date Added: 2009-06-16 23:17:17 |
| start-time.pdf Path: Washington University in St. Louis >> CSE >> 573 Fall, 2009 Description: 7 E C A r j s t h X Y T T h j Y R V j Y j a a a ~ Hiue`7Y iQ UiQ iUiQ T ii h5sU dy V P V Y }sB{X i0zUydiQ iUiQ T ii54eiieP d #UslUv0`tiQ 0iQ h c | c Q P V h R T h j Y R V j Y x w Q P c R a R y u Q X R Y Y Y X h R 4`rs `... Date Added: 2009-06-16 23:20:41 |
| t_mid.304.03.ans.pdf Path: Michigan State University >> AST >> 304 Fall, 2008 Description: F xut(r qi ! y w v s r p eUehcgQ ` d X edS ca`YW Sf bX US I VTRQPH AE D A@86 GF$C B97543 2 ) Q q \" ( ehS S p 8 6 g j I v Q T S T g Q o n 6 lj 2 Q v } 6 0|8 {mkz6 6 @I y au g hh g 0dpf... Date Added: 2009-06-16 23:21:47 |
| Phys101_Grades 106.pdf Path: Acton School of Business >> PHYS >> 101 Fall, 2008 Description: RICE UNIVERSITY - PHYS101 - FALL 2007 S01096860 QUIZZES(20) Quiz 1 Quiz 2 Quiz 3 Quiz 4 Quiz 5 Quiz 6 Quiz 7 Quiz 8 Quiz 9 Quiz 10 14.00 20.00 18.00 14.00 6.00 16.00 8.00 12.00 16.00 0.00 PLEDGED(30) Pledged 1 Pledged 2 Pledged 3 Pledged 4 Pledged 5 ... Date Added: 2009-06-16 23:24:52 |
| hw5.pdf Path: Concordia Chicago >> MATH >> 242 Fall, 2009 Description: Math 242: Homework 5 John Peca-Medlin May 1, 2006 2. Let , Q and f (x) = i=0 ai xi Q[x] its accompanying (monic) minimal polynomial, with a0 = 0 and an = 1 (so f () = 0). Let k Z be such that kai Z for all i (we can do this if we let k = lcm{q0 ,... Date Added: 2009-06-16 23:27:12 |
| Phone.txt Path: NJIT >> MK >> 296 Fall, 2009 Description: package university; import java.sql.Connection; public class Phone { public int phone_id; public int phone_area; public int phone_middle; public int phone_last; String phone_note; public Phone( int phone_id, int phone_area, int p... Date Added: 2009-06-16 23:28:59 |
| Colloidal and surface phenomenal aspects of Ice cream.doc Path: SUNY Buffalo >> CE >> 457 Fall, 2009 Description: Colloidal and surface phenomenal aspects of Ice cream Yusuo Bob Chang Joseph Kuechle Travis Reese Pierre SaintLouis April 9, 2002 Table of Contents I. Introduction II. History III. Design Considerations IV. Main components and composition V. Basic ... Date Added: 2009-06-16 23:29:47 |
| hmwk6S03.pdf Path: Iowa State >> STAT >> 496 Fall, 2008 Description: STAT 496, Spring 2003 Homework Assignment #6 1. An engineer is interested in the eects of cutting speed (A), tool geometry (B), and cutting angle (C) on the life (in hours) of a machine tool. The levels of each of the 3 factors are given below. The c... Date Added: 2009-06-16 23:30:40 |
| Exercices_2_Chap_3.pdf Path: Université du Québec à Montréal >> EXERCICESS >> 5120 Fall, 2009 Description: Exercices 2 (Chapitre 3) 1 Un grand groupe de femmes sont recrutes le 1er janvier 1970 pour une tude durant laquelle elles subissent un examen mdical chaque 3 ans. L\'tude dure 30 ans et a pour but d\'obtenir des donnes sur X, l\'ge au moment o elles dv... Date Added: 2009-06-16 23:31:13 |
| evaporat_fall01.pdf Path: UConn >> CHEG >> 237 Fall, 2009 Description: 07/30/03, C:\\Documents and Settings\\suzy.ENGR_STUDENT\\My Documents\\courses\\cheg237W\\evaporat fall01.doc Coursework/CHEGlab/DBLEftevap Fenton/Coughlin, Fall 01 CHEMICAL ENGINEERING LABORATORY CHEG 237 Operation of a Double-Effect Evaporator Objectiv... Date Added: 2009-06-16 23:31:21 |
| Lab 3_simulation.pdf Path: Minnesota >> ME >> 3222 Fall, 2008 Description: Lab 3: Simulation of Control Systems Using Matlab/Simulink In ME3140 (System Dynamics and Control), we have learned the basics of designing a control system. Typically, we would simulate the control systems before implementing them in real applicatio... Date Added: 2009-06-16 23:33:04 |
| Chapter1Notes.ppt Path: Fort Lewis >> CS >> 106 Fall, 2009 Description: Chapter 1 An Introduction to Computers and Visual Basic.NET Modified by : Evans Adams (June 2004) Outline and Objectives Introduction to Computers Using Windows Files and Folders An Introduction to Visual Basic.NET Biographical History of Comp... Date Added: 2009-06-16 23:34:01 |
| lec9.pdf Path: University of Illinois, Urbana Champaign >> CS >> 475 Fall, 2008 Description: DFA Minimization 161 Isomorphisms Isomorphism: Two DFAs M1 = (Q1 , , 1 , q1 , F1 ) and M2 = (Q2 , , 2 , q2 , F2 ) are isomorphic is there is a bijection (one-to-one and onto) f : Q1 Q2 such that f (q1 ) = q2 q Q1 . q F1 i f (q) F2 q Q1 .a ... Date Added: 2009-06-16 23:34:53 |
| PHYS3020_final_2003.pdf Path: Allan Hancock College >> PHYS >> 3020 Fall, 2009 Description: (SCIENCE) TIME: TWO AND HALF hours for working. Ten minutes for perusal before examination begins. There are SIX (6) questions Answer TWO (2) questions from Part A and TWO (2) questions from Part B. Eac... Date Added: 2009-06-16 23:40:38 |
| ln12.pdf Path: Georgia Tech >> PHYS >> 8803 Fall, 2008 Description: ... Date Added: 2009-06-16 23:40:56 |
| HV_MODULE_B_sch.pdf Path: Wisconsin >> HVREVIEW >> 091603 Fall, 2009 Description: ... Date Added: 2009-06-16 23:42:01 |
| Synopsis.doc Path: Montana >> GEOL >> 102 Fall, 2009 Description: GEOL 102 Environmental Geology Professor W. W. Locke Traphagen 223/224 PART I What\'s \"Environmental\" What are the Key Environmental Issues? 0. 1. 2. 3. 4. 5. 6. 7. 8. World Nation State County City Why \"Geology\"? Environmental Perspectives Economic ... Date Added: 2009-06-16 23:42:34 |
| 318.assign1.pdf Path: Toledo >> OLD >> 318 Fall, 2009 Description: DEPARTMENT OF COMPUTER SCIENCE UNIVERSITY OF TORONTO CSC 318S THE DESIGN OF INTERACTIVE COMPUTATIONAL MEDIA Winter Term, 1997-8 Assignment 1 BRAINSTORMING IDEAS FOR TERM PROJECT HANDED OUT: Monday, January 5, 1:10 p.m. DUE BACK IN: Sunday, January ... Date Added: 2009-06-16 23:43:36 |
| site5.pdf Path: Georgia Tech >> MARCH >> 396 Fall, 2009 Description: MARTIN WATTENBERG +DESIGN MATTERS +FUNCTION Map of the Market Site XRay History Flow +EXPERIENCE ---Next > < Previous Home Shape of Song Copernica Thinking Machine +CREDITS ... Date Added: 2009-06-16 23:44:00 |
| math281_sylf07.pdf Path: Black Hills >> MATH >> 281 Fall, 2009 Description: MATH 281 Introduction to Statistics Black Hills State University Fall 2007 3 Credit Hours I. Times and Locations: Section 1, MWF 9:00 9:50 am, BJS 168 Section 2, MWF 10:00 10:50 am, BJS 168 Section 3, TTH 9:30 10:45 am, BJA 105 Section 4, TTH 1... Date Added: 2009-06-16 23:44:36 |
| Abstract-Postview-12.pdf Path: Adelphi >> M >> 457 Fall, 2009 Description: Postview Questions Topic # 12 : Introduction to Groups Definitions closure commutative group group table finite group order of a group Explainables group Abelian group Cayley table infinite group structure Why are each of the properties of a gro... Date Added: 2009-06-16 23:45:16 |
| Abstract-Postview-31.pdf Path: Adelphi >> M >> 457 Fall, 2009 Description: Postview Questions Topic # 31 : Zeros of a Polynomial Definitions The Fundamental Theorem of Algebra extension field algebraic extension of a field conjugate zeros primitive polynomials Calculations and Computations quadratic formula algebraic (... Date Added: 2009-06-16 23:45:18 |
| lec3.pdf Path: ASU >> PHY >> 501 Fall, 2008 Description: PHY 501, John Shumway Lec. 3: Calculus of Variations Aug. 30, 2002 Lecture 3: Calculus of Variations 1 The Euler-Lagrange equation For a more in-depth discussion and examples of calculus of variations, see Arfken and Weber (2001). Many functional... Date Added: 2009-06-16 23:47:33 |
| 306 HW 5a 5 yr cash flow.xls Path: WVU >> MINE >> 306 Fall, 2008 Description: BEGIN IN FIRST EXCEL CLASS SAMPLE 5-YEAR CASH FLOW (000) SALES QUANTITY Product 1 0 000 Oz gold 1 7 2 YEARS 3 4 5 6 Rev 10-12-06 No Production in last year EQUATION EXAMPLES Q1 = production in thousands of Oz. HW 5a: add a bi-product Ag that is 19%... Date Added: 2009-06-16 23:49:41 |
| NotesCoursMUS1322-H08.pdf Path: Neumont >> MUS >> 1322 Fall, 2009 Description: MUS 1322 - Technique d\'enregistrement en studio Martin Marier 27 janvier 2009 2 Table des mati`res e 1 Notions pralables e 13 1.1 Quelques notions de physique . . . . . . . . . . . . . . . . . . . . . . . . . . 13 1.1.1 Force . . . . . . . . . . . ... Date Added: 2009-06-16 23:51:07 |
| inl00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20081209 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/08120912_upa.wxp Date: 1200Z 9 DEC 08 Searching for KINL. Searching the city database file for: KINL . Date:1200Z 9 DEC 08 Station: KINL... Date Added: 2009-06-16 23:51:21 |
| 060122_15RANGE.ps Path: Wisconsin >> SH >> 060122 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: MATLAB, The Mathworks, Inc. %Title: 060122_15RANGE.ps %CreationDate: 01/27/2006 17:07:02 %DocumentNeededFonts: Helvetica %DocumentProcessColors: Cyan Magenta Yellow Black %Extensions: CMYK %Pages: (atend) %BoundingBox: (atend... Date Added: 2009-06-16 23:52:17 |
| week 11.pdf Path: Allan Hancock College >> CHEM >> 1611 Fall, 2009 Description: CHEM1611 Problem Sheet 9 (Week 11) Work through the ChemCAL module \"Structural Organic Chemistry\". 1. The compounds shown below are capable of tautomerism. Give the constitutional formula of at least one other tautomer for each compound. Compound NH2... Date Added: 2009-06-16 23:52:48 |
| SP500.xls Path: Purdue >> STAT >> 598 Fall, 2008 Description: S&P 500 Index Date 29-Jan-07 26-Jan-07 25-Jan-07 24-Jan-07 23-Jan-07 22-Jan-07 19-Jan-07 18-Jan-07 17-Jan-07 16-Jan-07 12-Jan-07 11-Jan-07 10-Jan-07 9-Jan-07 8-Jan-07 5-Jan-07 4-Jan-07 3-Jan-07 29-Dec-06 28-Dec-06 27-Dec-06 26-Dec-06 22-Dec-06 21-Dec... Date Added: 2009-06-16 23:53:29 |
| Parser3.txt Path: Wyoming >> COSC >> 3015 Fall, 2008 Description: module Parser3 where import Char import Type_inference hiding (+) import Parser1 hiding (arrow, prod,typ) typ:Parser Type typ = comptype comptype :Parser Type comptype = do a <- tyvar do constr... Date Added: 2009-06-16 23:54:26 |
| WillowBrook.Syndication.xls Path: Colorado >> MBAX >> 6610 Fall, 2009 Description: Real Estate Finance Willow Brook Syndication Professor Thibodeau 1 Project Name: Willow Brook 2 3 ASSUMPTIONS: Year: 0 1 2 3 4 5 4 Property 5 Purchase Price 14,500,000 6 Gross Rental Income NA 2,435,580 7 Growth Rate for Rental Income NA NA 3.00% ... Date Added: 2009-06-16 23:55:14 |
| ch5.ps Path: UF >> ECE >> 6503 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.83 (MiKTeX 1.20c) Copyright 1998 Radical Eye Software %Title: ch5.dvi %CreationDate: Wed Nov 17 16:43:36 1999 %Pages: 22 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Italic Times-Bold... Date Added: 2009-06-16 23:55:23 |
| PeruExp.ppt Path: Solano Community College >> CIS >> 50900 Fall, 2009 Description: Report of Global Humanitarian Peru Expedition Prepared by Miriam Schwartz Overview of Expedition Director: Pablo Fuentes Dates: Dec 25, 2006 to Jan 5, 2007 Village: Paqarimuy, Peru 6 days (5 nights) in village Number of expedition volunteers: ... Date Added: 2009-06-16 23:56:31 |
| Table18.pdf Path: Ohio State >> B >> 780 Fall, 2009 Description: Table 18. Spray Schedules for Pest Control on Blueberry. Time to spray Dormant Before bud break Green tip Bud has 1/4 inch of green Pre-bloom Just before blossoms open Bloom 25% to 75% of blossoms open Petal fall 75% petals have dropped First and se... Date Added: 2009-06-16 23:56:40 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


