Course Solutions And Notes - magahet 1c
| lab5.pdf Path: Colorado >> EEB >> 2040 Fall, 2009 Description: Estimating Species Richness and Diversity and Assessing Stream Quality: A Survey of the Macro-invertebrates in Boulder Creek Part II LABORATORY # 5 OVERVIEW This lab is the data analysis component of the stream diversity project. During this lab, we... Date Added: 2009-04-21 17:15:53 |
| FormulaSheetExam2.pdf Path: Colorado >> PHYS >> 3220 Fall, 2008 Description: Formula Sheet for Exam 2 Steve and Oliver\'s Crib sheet: The classical wave equation: The time-dependent Schrdinger Equation, (TDSE): i (x,t) 2 2 (x,t) =- + V (x)(x,t) t 2m x 2 ^ The time-independent Schrdinger Equation (TISE): Hu(x) = E u(x) , or... Date Added: 2009-04-21 17:17:22 |
| Problem_Set_1.pdf Path: Colorado >> PHYS >> 7240 Fall, 2009 Description: Problem Set 1 Phys 7240 Due: Sep 12 1D Ising Model The partition function of the ID Ising model is given by N N +1 Z= k =1 fL (1 ) exp K i=1 i i+1 + m i=1 i fR (N +1 ). (0.1) J h Here K = T , and m = T , where h is the \"magnetic field\". 1 The... Date Added: 2009-04-21 17:17:29 |
| Presentation.ppt Path: Calvin >> SENIORDESI >> 08 Fall, 2009 Description: Team8:BatteriesNotIncluded DaveDickinsheets MattScholten DavidQu KnoaKnapper PresentationOutline ProjectReintroduction DesignProcess MajorObstacles MajorAccomplishments NextSteps ProjectReIntroduction BatteryfreeTirePressureMonitori... Date Added: 2009-04-21 17:18:18 |
| m256-10-2.pdf Path: Calvin >> M >> 256 Fall, 2007 Description: Mathematics 256 October 2 & 3, 2008 The Extended Euclidean Algorithm (Rosen 3.7) Theorem (Rosen page 232). If a, b Z+ , then there exist s, t Z such that gcd(a, b) = sa + tb. Furthermore, gcd(a, b) is the smallest positive integer that can be writt... Date Added: 2009-04-21 17:20:09 |
| Lecture4.ppt Path: Colorado >> ASEN >> 5090 Fall, 2008 Description: Signal Structure AS 5090 LEC EN TURE NOTES LARS ON, AXELRAD Position Solution The position solution involves an equation with four unknowns: Receiver position (x, y, z) (in what reference frame) Receiver clock correction (correction to what?) ... Date Added: 2009-04-21 17:20:39 |
| test01-info.pdf Path: Calvin >> M >> 361 Fall, 2009 Description: Math 361 Test 1 Study Sheet Topics Covered Test 1 covers Chapter 0 and the rst three sections of Chapter 1. Here are some specic topics you should be sure to review. 1. Proof Techniques (a) Templates for standard proof forms proving if . .... Date Added: 2009-04-21 17:20:42 |
| ~$tion1D.doc Path: Colorado >> PHYS >> 1110 Fall, 2008 Description: #Michael Dubson#M#i#c#h#a#e#l# #D#u#b#s#o#n#<# #P#h#y#s#i#c#s# #U#.# #C#o#l#o#r#a#d#o# #B#o#u#l#d#e#r#\\7$# ... Date Added: 2009-04-21 17:21:27 |
| info.pdf Path: Calvin >> M >> 162 Spring, 2007 Description: Math 162 Course Information Prerequisite An ACT composite score of at least 29 (or 1290 on the SAT), and a score of 5 on the relevant AP exam. Required Text University Calculus, by J. Hass, M. Weir, and G. Thomas, Jr. Course Content Selected sections... Date Added: 2009-04-21 17:22:04 |
| gentrification.pdf Path: Calvin >> JKS >> 4 Fall, 2008 Description: \"Urban Altruism\" | Calvin College | Spring 2006 www.calvin.edu/~jks4/city Gentrification and Displacement Janelle Vandergrift Gentrification is a word that has become commonplace over the last several years. And yet, it is not necessarily understoo... Date Added: 2009-04-21 17:22:28 |
| week2pset.pdf Path: Colorado >> CHEM >> 4761 Fall, 2008 Description: ... Date Added: 2009-04-21 17:24:39 |
| 25maptravel.doc Path: Bard >> CATALOGUE >> 06 Fall, 2009 Description: Bard Campus Map Academic Resources Center (Stone Row) C3 Administrative Offices (Ludlow) C3 Admission (Hopson Cottage)B3 Albee Hall (Bard Music Festival) C3 Alumni Houses (residence halls) Bluecher, Bourne, Honey, Leonard, Obreshkove, Rovere, Rueger,... Date Added: 2009-04-21 17:24:42 |
| Recitation_5.pdf Path: Colorado >> PHYS >> 2010 Fall, 2008 Description: Recitation 5: Energy and Momentum file:/Users/kinney/class/phys2010/web/Lab-Rec/rec/recitation_5.html Recitation 5: Energy and Momentum Your job is to challenge your TA and to think creatively about energy and momentum. Pre-Recitation Work: 0. rea... Date Added: 2009-04-21 17:25:08 |
| yoga_sequence.pdf Path: Colby >> MU >> 254 Fall, 2009 Description: MU 254 Yoga Sequence The Sanskrit word siddha means accomplished or adept, one who has attained the highest order. The name implies the attainment of a perfectly stilled mind and the experience of peace that results from meditation. The accomplished... Date Added: 2009-04-21 17:26:49 |
| Respiration.ppt Path: Colby >> BI >> 235 Fall, 2009 Description: RESPIRATION QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture. Whydoallorganismsneedfood? Suppliessourcesofenergyrequiredtocarryout manylifefunctions,e.g.: cellularandorganismalactivities maintenanceandrepairofexist... Date Added: 2009-04-21 17:27:32 |
| ArchLinkDecember2008.pdf Path: Findlay >> E >> 5546825 Fall, 2009 Description: ArchLink - Your E-Link to The University of Findlay 1000 North Main St., Findlay, OH 45840 Phone: 1-800-472-9502 Fax: 419-434-4822 December 2008 Welcome to ArchLink! Holiday greetings from your alma mater! Another year of accomplishments comes to a ... Date Added: 2009-04-21 17:28:44 |
| URHandbook05.pdf Path: Findlay >> EC >> 76 Fall, 2009 Description: A Guide to Public Information Services Introduction This guide has been prepared by the Office of Public Information to assist The University of Findlays faculty and staff. First and foremost, our goal is to provide you with the services you need to ... Date Added: 2009-04-21 17:28:46 |
| LessonInElectricCircuits.pdf Path: Rose-Hulman >> ME >> 430 Fall, 2009 Description: Fourth Edition, last update July 30, 2004 2 Lessons In Electric Circuits, Volume IV Digital By Tony R. Kuphaldt Fourth Edition, last update July 30, 2004 i c 2000-2004, Tony R. Kuphaldt This book is published under the terms and conditions of the... Date Added: 2009-04-21 17:30:16 |
| Download%20Picosoft.pdf Path: Rose-Hulman >> ME >> 430 Fall, 2009 Description: For this homework assignment you are going to download the software for running the Programmable Logic Controllers (PLCs). You must download PicoSoft 6.1 off their website. Go to: http:/www.ab.com/programmablecontrol/plc/pico/picosoft.html If someday... Date Added: 2009-04-21 17:30:18 |
| Ps9.pdf Path: Rose-Hulman >> EC >> 300 Fall, 2009 Description: ROSE-HULMAN INSTITUTE OF TECHNOLOGY Department of Electrical and Computer Engineering EC 300 Signals and Systems Fall 2000 B.A. Black Problem Set 9 1. Find the Fourier transform Y(f) of the signal y(t) shown below. Use the integration property. Do ... Date Added: 2009-04-21 17:30:27 |
| HW3prob3waves1.pdf Path: Rose-Hulman >> ECE >> 333 Fall, 2009 Description: Moving through the correct sequence. Note that Lock is activated when reset goes high. Cursor = 782ns Baseline = 0 Cursor-Baseline = 782ns Page 1 of 1 Printed at 23:38:08 on Wed, Oct 08, 2003 Printed by SimVision from Cadence Design Systems, Inc. ... Date Added: 2009-04-21 17:30:45 |
| ECE250%20LAB7.pdf Path: Rose-Hulman >> ECE >> 250 Fall, 2009 Description: VII. Bipolar Junction Transistor Biasing ECE250 Lab VII Bipolar Junction Transistor Biasing In this lab we will look at two different ways of biasing a bipolar junction transistor (BJT). The first method is a very poor method and the bias is heavily... Date Added: 2009-04-21 17:32:39 |
| welcome310template.txt Path: Wellesley >> LATIN >> 310 Fall, 2009 Description: Subject: Latin 310-from %Name Welcome Form Results for Latin 200 from %name Student Name: %name Local Address: %address Email User Name: %username Background in ancient Rome %background Background in Latin %latinbackground Where my Latin is... Date Added: 2009-04-21 17:34:49 |
| MoreNotation.pdf Path: Rose-Hulman >> CSSE >> 373 Fall, 2009 Description: Proving Program Properties Curt Clifton Rose-Hulman Institute of Technology Hmm, elephants Assignment Rule Whatever is true about \"E\" before is true about \"V\" after /* P(E) */ V = E; /* P(V) */ What must be true about \"E\" before if we want some... Date Added: 2009-04-21 17:34:55 |
| Logic%20Gates%20Lecture%20Handout.pdf Path: Rose-Hulman >> ME >> 430 Fall, 2009 Description: 11/24/2007 : ME430 Le02 Logic Gates Logic Gates Panel 1 Panel 2 Panel 3 Panel 4 Page 1 of 4 11/24/2007 : ME430 Le02 Logic Gates Logic Gates Panel 5 Panel 6 Panel 7 Panel 8 Page 2 of 4 11/24/2007 : ME430 Le02 Logic Gates Logic Gates Pa... Date Added: 2009-04-21 17:35:20 |
| CamWorks%20Mold%20plate%20preparation.doc Path: Rose-Hulman >> ME >> 520 Fall, 2009 Description: ME520 Computer-Aided Design and Manufacturing Spring Quarter 2005-06 Version 1.0 CamWorks Mold Plate Preparation Before you start milling you mold plates for you projects there are a few basic holes etc. that youll need to prepare. If you choose to... Date Added: 2009-04-21 17:37:29 |
| GEOP4210_Lab2_MagneticInterpretation.pdf Path: Montana Tech >> GEOP >> 421 Fall, 2009 Description: GEOP 4210 Geophysics Field Camp Instructor: Prof. Xiaobing Zhou GEOP 4210 Lab # 2: Magnetic Interpretation Using GRAVMAG 1. Introduction GRAVMAG is a 2D computer program that calculates gravity and magnetic field due to solids (or voids of negative... Date Added: 2009-04-21 17:38:51 |
| Syllabus_2004_Abbreviated.pdf Path: Northern State >> K >> 12 Fall, 2008 Description: AP English Language and Composition Sec. 1 11:00 11:50 a.m. Sec. 2 12:00 12:50 a.m. Mrs. Deanna Mauck, Instructor Office: NSU, MJ 134 Phone: (605) 626-3391 Mail: NSU 1200 So. Jay St. NSU Box 693 Aberdeen, SD 57401 E-mail: mauckd@northern.edu Rati... Date Added: 2009-04-21 17:41:41 |
| sg2.doc Path: W. Kentucky >> MAT >> 109 Fall, 2009 Description: MAT 109.031 Study Guide for Midterm 2 over sections 1.5-1.8 Midterm date: Friday, July 23 Students may use a calculator and a 3x5 card of notes/formulas. Material covered: From 1.5: Be able to solve linear equations of one variable (not linear equati... Date Added: 2009-04-21 17:42:43 |
| 03AGFBIContact1.pdf Path: GWU >> NSAEBB >> 84 Fall, 2009 Description: ... Date Added: 2009-04-21 17:44:08 |
| calvin_map.pdf Path: Calvin >> WORKSHOP >> 07 Fall, 2009 Description: L A K E D R I V E Ravenswood Physical Plant P Parking Athletic Fields P Kalsbeek Huizenga WA L K I N G TRAIL E NTRANC E Boer Bennink Noordewier VanderWerp Physical Education Building Rooks VanDellen Knollcrest Dining Hall P P Conference Par... Date Added: 2009-04-21 17:45:57 |
| holdren.pdf Path: Michigan >> NRE >> 301 Fall, 2009 Description: ... Date Added: 2009-04-21 17:49:03 |
| pc_rules.pdf Path: Rowan >> SAC >> 05 Fall, 2009 Description: Region 2 Student Activities Conference - 2005 Student Paper Competition Guidelines A. Purpose The IEEE Student Prize Paper Contest offers the undergraduate IEEE Student member opportunities to exercise and improve both written and verbal communicati... Date Added: 2009-04-21 17:49:56 |
| PASbrochure_08.pdf Path: KYSU >> A >> 78 Fall, 2009 Description: LET\'S PAS IT ON! My gift is enclosed for $_ Please make check payable to: KSU Foundation. Memo line: PAS Fund Charge my gift of $ _ to: (Check one) K Master Card K Visa K American Express _ Card Number _ _ Expiration Date Authorization Code Yes, I wi... Date Added: 2009-04-21 17:50:49 |
| ascii.txt Path: RIC >> CS >> 201 Fall, 2009 Description: American Standard Code for Information Interchange (ASCII) Ordinal Char Ordinal Char Ordinal Char 32 64 @ 96 ` 33 ! 65 A 97 ... Date Added: 2009-04-21 17:52:46 |
| ScholarshipApp.pdf Path: Winston Salem State >> AFEE >> 43 Fall, 2009 Description: ... Date Added: 2009-04-21 17:53:05 |
| agenda_1.29.08.pdf Path: St. Mary MD >> AGENDA >> 07 Fall, 2009 Description: SGA Agenda 1.29.08 I. II. III. IV. V. VI. VII. VIII. Call to Order Roll Call Approval of Agenda Approval of Minutes Student Speakout Guest Speakers Mark Heidrich & Maggie OBrien New Business a. Bill 03-08S Officer Reports a. President b. Vice Presid... Date Added: 2009-04-21 17:53:24 |
| Lecture5_100.pdf Path: MN State >> PDEV >> 100 Fall, 2009 Description: Lecture5_100.gwb - 1/13 - Tue Jan 15 2008 11:12:47 Lecture5_100.gwb - 2/13 - Tue Jan 15 2008 11:13:55 Lecture5_100.gwb - 3/13 - Thu Jan 29 2009 11:38:37 Lecture5_100.gwb - 4/13 - Thu Jan 29 2009 11:44:14 Lecture5_100.gwb - 5/13 - Thu Jan 29 2009 ... Date Added: 2009-04-21 17:54:08 |
| dhillon_psych.pdf Path: St. Francis IL >> ACCAWEB >> 06 Fall, 2009 Description: CONTEMPORARY COLLEGE STUDENT\'S ATTITUDES REGARDING SEXISM IN TWO DIFFERENT ENVIRONMENTS Katja Kremer, Psychology, Junior, Aurora University Maninder Dhillon, Psychology, Senior, Aurora University Maria Rodriguez, Psychology, Senior, Aurora University... Date Added: 2009-04-21 17:54:52 |
| modica_psyc.pdf Path: St. Francis IL >> ACCAWEB >> 05 Fall, 2009 Description: Author: Modica The Psychology of Stress Addiction Abstract The question of stress upon college students today and just how students cope with it has been of interest for some time now (Sax, 2003; Sax, 1997; Somerfield Sciacca & Hyner,... Date Added: 2009-04-21 17:54:57 |
| m201_reflect_prompts.doc Path: Indiana Northwest >> M >> 201 Fall, 2009 Description: Big Idea _ Process Skills _ #_ Date Taught _ Grade _ Name _ Self-Assessment of Science Teaching Lesson # _ Directions: IMMEDIATELY following your M201 teaching experience, briefly answer each question. This form is for data collection purposes on... Date Added: 2009-04-21 17:55:53 |
| foodandfundbrochure.pdf Path: SUNY Albany >> IST >> 4385 Fall, 2009 Description: The Work of the Coalition The Food Warehouse provides staple food items to our pantries. Contained within the warehouse, the Infant Needs Project provides infant formula and diapers, and the Holiday Meals Project provides for special meals. Food Pa... Date Added: 2009-04-21 17:56:16 |
| W&PSYL2003.pdf Path: SUNY Albany >> HH >> 476533 Fall, 2009 Description: Tolstoy\'s War and Peace RUSS 194, Fall 2003 MWF 2:20-3:20, HUM 212 www.macalester.edu/russian/courses/RUSS194.html Hilde Hoogenboom 651-696-6528, HUM 205 Off. hrs 11-12 MWF & by appt. hoogenboom-at-macalester.edu Writing Assistant: Susannah Johnson ... Date Added: 2009-04-21 17:56:41 |
| SUMMER_06_FTE_4WK.pdf Path: Eastern Oregon >> U >> 064 Fall, 2009 Description: 24-JUL-2006 11:54:49 Summer 2006 Fourth Week Eastern Oregon University FTE by Discipline and Location On Campus Extended Totals Total Page 1 RPTREPORT_PRINT2 DDE College of Arts & Science Arts and Letters Art English/Writing Humanities Liberal ... Date Added: 2009-04-21 17:59:00 |
| master_mba.pdf Path: LSU Shreveport >> CATALOG >> 0708 Fall, 2009 Description: MASTER OF BUSINESS ADMINISTRATION Admission Procedures To be considered for regular admission to the Master of Business Administration (MBA) degree program, the applicant must a. submit a graduate application for admission to the Office of Admissions... Date Added: 2009-04-21 17:59:14 |
| t3-2008fall-math221.pdf Path: LSU Shreveport >> MATH >> 221 Fall, 2009 Description: Calc I MATH 221-001 T3 Fall 2008 Name: Instructions: Do all problems correctly. You may NOT use calculators or any electronic devices or notes of any kind. Loads of points are possible on the test, but the highest grade that I will award is 115 poi... Date Added: 2009-04-21 17:59:23 |
| 621FINs06.pdf Path: SUNY Albany >> AECO >> 621 Fall, 2009 Description: State University of New York at Albany Department of Economics ECO621 Econometrics II May 16, 2006 T. Kinal Final Examination (24) 1. Comment on each of the following (one or two sentences are su cient): a. An investigator, testing linear restrictio... Date Added: 2009-04-21 18:00:11 |
| 001-UrbTransBRTPaper_2003.pdf Path: Columbia >> SW >> 354 Fall, 2009 Description: S. Sabina Wolfson Urban Transportation Planning Term paper Bus Rapid Transit on the East Side of Manhattan The East Side of Manhattan needs more (and better) public transportation1 . Eventually a Second Avenue Subway (SAS) could fulfill this need. ... Date Added: 2009-04-21 18:00:12 |
| Chang_LaTeX_sheet.pdf Path: Columbia >> BHB >> 2102 Fall, 2009 Description: A LTEX 2 Cheat Sheet Lists \\begin{enumerate} Numbered list. \\begin{itemize} Bulleted list. \\begin{description}Description list. \\item text Add an item. \\item[x ] text Use x instead of normal bullet or number. Required for descriptions. Justificatio... Date Added: 2009-04-21 18:01:07 |
| GEOLOGY.pdf Path: Wisc Eau Claire >> FY >> 2008 Fall, 2009 Description: geOLOgY First Year advising 2008-2009 geOLOgY Geology can be either a comprehensive or a standard major. The core of the geology program consists of several sequenced courses. This sequence reuires a minimum of two years to complete. Chemistry is a p... Date Added: 2009-04-21 18:02:30 |
| GroupProjectsSP.pdf Path: N.E. Illinois >> SOC >> 1 Fall, 2009 Description: GROUP PROJECTS FOR SOCIAL PROBLEMS DEBBIE CUNNINGHAM This entire exercise serves many different functions: to help alleviate the impact of social problems in this community; to bring students together who would not normally socialize; to offer ... Date Added: 2009-04-21 18:07:53 |
| ch12_p34.pdf Path: Johns Hopkins >> C >> 171 Fall, 2008 Description: 34. (a) Eq. 12-9 leads to TLsin mpgx mbg L 2 = 0 . This can be written in the form of a straight line (in the graph) with T = (slope) L + y-intercept , where slope = mpg/sin and y-intercept = mbg/2sin. The graph suggests that the slope (in SI uni... Date Added: 2009-04-21 18:08:13 |
| homework05.pdf Path: Harvard >> EDU >> 124 Fall, 2009 Description: }@Q{yvPHFEC9}WfA9} W~ 3641uuF0)Y(m m R~ v B ~ I G8 D } B 3 @ 87 5 3 2 ) $ \" qU f msW \' m {wfmo6 m $ \" mj qu%m$mT # ! { { c f FmqwmYEm{... Date Added: 2009-04-21 18:09:24 |
| lectureRAID.pdf Path: Wisconsin >> CS >> 537 Spring, 2001 Description: UNIVERSITY of WISCONSIN-MADISON Computer Sciences Department CS 537 Introduction to Operating Systems Andrea C. Arpaci-Dusseau Remzi H. Arpaci-Dusseau Motivation: Why use multiple disks? Capacity More disks allows us to store more data Storage Sys... Date Added: 2009-04-21 18:10:01 |
| unitssymbols.pdf Path: Wisconsin >> ME >> 370 Fall, 2009 Description: ME 370 - Energy Systems Laboratory - Appendix List of Symbols A amperes A area c velocity of sound C capacity rate C discharge coefficient Cc center coefficient CD drag coefficient Cp pressure coefficient cp specific heat Cr rolling resistance coeff... Date Added: 2009-04-21 18:12:57 |
| PR5_Chewing_Sounds.pdf Path: Wisconsin >> BME >> 200 Fall, 2009 Description: Progress Report 5 10/6/06 10/12/06 Project Title: 43. Chewing Sounds Team Members: Jimmy Fong - Co-Leader 312-799-0278 fong@wisc.edu Matthew Valaskey - Co-Leader 920-470-6437 mvalaskey@wisc.edu Bryan Mounce - BWIG 715-308-4509 mounce@wisc.edu Aditi... Date Added: 2009-04-21 18:13:24 |
| L8_building_blocks_aa.pdf Path: Wisconsin >> BIOCHEM >> 801 Fall, 2008 Description: From analysis of amino acid spin systems to assignments Information derivable from NMR spectra Atom nomenclature Amino acid spin systems and experiments used to analyze them Assignment strategies Suggested readings Markley J et al (1998) Recommendat... Date Added: 2009-04-21 18:14:46 |
| limno_assignment08.pdf Path: Wisconsin >> ZOO >> 315 Fall, 2008 Description: Zoology 315: Limnology Assignment Scientific Controversy N vs. P limitation and controlling lake eutrophication Nov. 13, 2008 Due date: Dec. 2, 2008 (in class) Target length: 3 pages, double spaced Point value: 10% of final grade The goal of this as... Date Added: 2009-04-21 18:15:16 |
| solutionhw7.pdf Path: Wisconsin >> ENGR >> 531 Fall, 2009 Description: PROBLEM SET #7 pcf := lbf ft 3 psf := lbf ft 2 kip := 1000lbf 3 ksf := 1000psf R := 50.93ft 2 ksi = 1 10 psi R = 25.465 ft L := 54.07 ft 2 B := 42.33ft H := 40ft b := 70pcf m := 125pcf w := 62.4 pcf ki := 0.4 := 38deg kip tult := 16 f :... Date Added: 2009-04-21 18:15:19 |
| cbe430-homework07solutions.pdf Path: Wisconsin >> CHE >> 430 Fall, 2009 Description: ... Date Added: 2009-04-21 18:16:32 |
| moreprojectcomments.pdf Path: Wisconsin >> CHE >> 450 Fall, 2009 Description: Some more comments on the design report 1. Writing: This is a \"draft\" report, in the sense that you will have a chance to revise it. However, it should look and read like a final report! 2. Phase equilibrium: Please be sure to check that the modeling... Date Added: 2009-04-21 18:16:36 |
| FourierNotes.pdf Path: Wisconsin >> CHEM >> 008 Fall, 2009 Description: Exploring Fourier Transform Techniques with Mathcad Mark Iannone Department of Chemistry Millersville University, Millersville, PA 17551 Fourier transform instruments are common in the modern laboratory. While an understanding of the Fourier transfor... Date Added: 2009-04-21 18:18:32 |
| Home1Winter2009.pdf Path: Drexel >> CS >> 461 Winter, 2009 Description: Homework Assignment 1 Database Systems CS 461 Total Points: 100 Due Thursday January 22nd Post your solutions to WebCT no later than 11:55 PM Use the following relations to answer the questions. All questions may not have a valid answer. If they do... Date Added: 2009-04-21 18:19:33 |
| lab5.pdf Path: Wisconsin >> ENGR >> 605 Fall, 2009 Description: Lab 5 Exercise 4 Pin Class work 1. Startanewpart,Click:FileSetWorkingDirectoryOKCreateanewObjectPARTName ANCHOROKEditsetupunitsUnitsmanagerInchIbmSecondOKCloseMaterial DefineChooseSteelMMBtocloseSAVE.Clickondefaultcoordinatesystemnameonthe modelPRT_... Date Added: 2009-04-21 18:19:34 |
| ece531h5.pdf Path: Wisconsin >> ECE >> 531 Fall, 2009 Description: ECE 432 Programming Project 5 Due by start of class, Thursday, April 10 Pitch measurement of speech One of the principal properties of the acoustic speech waveform is the periodicity of vowels and our sounds originating with a a periodic voice source... Date Added: 2009-04-21 18:20:23 |
| Phy208Exam3Blank.pdf Path: Wisconsin >> EXAMSFALL >> 208 Fall, 2009 Description: Name: _ Student ID: _ Section #: _ Physics 208 Exam 3 Nov. 29, 2007 Print your name and section clearly above. If you do not know your section number, write your TAs name. Your final answer must be placed in the box provided. You must show all you... Date Added: 2009-04-21 18:21:03 |
| CAfinal_project.pdf Path: Wisconsin >> AOS >> 575 Fall, 2009 Description: Climatological Analysis (AOS 575) Final Project The final project for this course will involve analysis of a particular phenomenon or physical process that is of interest to each student. Students will be required to identify a particular phenomenon ... Date Added: 2009-04-21 18:21:21 |
| Extraction.pdf Path: Wisconsin >> CHEM >> 342 Fall, 2008 Description: Solubility Solubility is the property of a substance, which describes the ability of the substance to form mixtures with other substances, usually liquids, which are chemically and physically homogeneous. In most cases, the solubility of a substance ... Date Added: 2009-04-21 18:21:40 |
| exam2-fall95.pdf Path: Wisconsin >> CS >> 540 Fall, 2002 Description: CS 540-1: Introduction to Articial Intelligence Exam 2: 7:15-9:15pm, November 20, 1995 CLOSED BOOK (one page of notes allowed) Write your answers on these pages and show your work. If you feel that a question is not fully specied, state any assumpti... Date Added: 2009-04-21 18:22:28 |
| FinalExamFormulaSheet.pdf Path: Wisconsin >> PHYS >> 201 Fall, 2008 Description: Measurements and Units SI Prefixes: Mega M Kilo K centi c milli m micro nano n pico p ~\" 107s/yr 106 103 10-2 10-3 10-6 10-9 10-12 Using Newton\'s Laws dynamic friction f = N direction opp. to v static friction f = N direction as needed Circular ... Date Added: 2009-04-21 18:25:18 |
| SwahiliMorphAnsKey.pdf Path: Wisconsin >> LING >> 101 Fall, 2009 Description: LINGUISTICS 101 PRACTICE MORPHOLOGY PROBLEM: ANSWER KEY [Source: The Language Files, Eight Edition, Department of Linguistics, Ohio State University] Swahili Morphology The following data come from Swahili, a language spoken in East Africa. Strat... Date Added: 2009-04-21 18:26:46 |
| weight_project.pdf Path: Wisconsin >> AOS >> 640 Fall, 2009 Description: Microwave Weighting Functions and Radiances AOS 640 Prof. Petty due at end of semester 1. Objectives Implement a radiative transfer code for computing emission weighting functions and top-of-the-atmosphere microwave brightness temperatures for an ar... Date Added: 2009-04-21 18:28:32 |
| ex2.pdf Path: Wisconsin >> CHEM >> 103 Fall, 2008 Description: ... Date Added: 2009-04-21 18:30:40 |
| qu-07aa.pdf Path: Wisconsin >> CHEM >> 343 Fall, 2008 Description: ... Date Added: 2009-04-21 18:32:55 |
| C59_H1.pdf Path: Wisconsin >> C >> 59 Spring, 2009 Description: Unknown C59 in CDCl3 Chem636 Spring 2003 Acquired at 300MHz cgfry O O 10Hz/cm 2.42 2.38 2.34 2.30 PPM 20Hz/cm 3.3 3.2 3.1 3.0 2.9 PPM 2.5 2.4 2.3 2.2 2.1 2.0 1.9 1.8 1.7 PPM 20 Hz/cm 8.0 7.8 7.6 7.4 7.2 PPM 2.84 2.98 3.02 2.00 1.04 1.00... Date Added: 2009-04-21 18:33:18 |
| C59_H1.pdf Path: Wisconsin >> C >> 636 Fall, 2009 Description: Unknown C59 in CDCl3 Chem636 Spring 2003 Acquired at 300MHz cgfry O O 10Hz/cm 2.42 2.38 2.34 2.30 PPM 20Hz/cm 3.3 3.2 3.1 3.0 2.9 PPM 2.5 2.4 2.3 2.2 2.1 2.0 1.9 1.8 1.7 PPM 20 Hz/cm 8.0 7.8 7.6 7.4 7.2 PPM 2.84 2.98 3.02 2.00 1.04 1.00... Date Added: 2009-04-21 18:33:19 |
| 379_SP_06_HW_4.pdf Path: Wisconsin >> CAE >> 379 Fall, 2008 Description: ECE 379 Spring 2006 Professor Lipasti TA: Payam Karbassi Homework Assignment #4 Due: Wednesday, April 12th at the beginning of class Instructions for problems 1-4: Please complete problems 1-4 by working together in a study group of 2-3 students. At... Date Added: 2009-04-21 18:34:50 |
| FactDesign.pdf Path: Wisconsin >> IE >> 642 Fall, 2008 Description: Optimize Pallet allocation and Buffer spaces using Factorial Designs Simulation Project Presented by: Chia-Chi Fan Wen-Shun Wang Problems of the Current System u Variation in Output is due to F Line changeover for different color & style products ... Date Added: 2009-04-21 18:38:29 |
| Horse.pdf Path: Oregon State >> FW >> 470 Fall, 2008 Description: Changes to flora and fauna in the Interior Columbia Basin where does the horse fit in? by Andrea S. Laliberte June 4, 2001 In partial fulfillment of the requirements for FW 570 Ecology and History: Landscapes of the Columbia Basin Introduction T... Date Added: 2009-04-21 18:42:36 |
| 446HW1.pdf Path: Idaho >> PSYC >> 446 Fall, 2008 Description: Psychology 446 Engineering Psychology Assignment 1 10 points NAME:_ STUDENT #:_ 0.04 Inspector Clouseau P N, N P S_plus_N , S_plus_N 0.02 0 20 40 X 60 80 100 0.04 Inspector Morse P N, N P S_plus_N , S_plus_N 0.02 0 20 40 X 60 8... Date Added: 2009-04-21 18:47:20 |
| 2008917_r02m_05232.pdf Path: Stanford >> ABFI >> 1034 Fall, 2009 Description: Case 2:05-cv-00232 -TON Document 75 Filed 09/17/2008 Page 1 of 23 UNITED STATES DISTRICT COURT FOR THE EASTERN DISTRICT OF PENNSYLVANIA IN RE AMERICAN BUSINESS FINANCIAL SERVICES INC. NOTEHOLDERS LITIGATION ) ) Master File No. 05-232 MEMORANDU... Date Added: 2009-04-21 18:49:19 |
| scuw97003full.pdf Path: Maryville MO >> SCUW >> 97003 Fall, 2009 Description: ... Date Added: 2009-04-21 18:49:56 |
| tamuw95002_part4.pdf Path: Maryville MO >> TAMUW >> 95002 Fall, 2009 Description: ... Date Added: 2009-04-21 18:50:25 |
| Math301HW1.pdf Path: Charleston Law >> MATH >> 301 Fall, 2009 Description: Math 301 - Spring 2008 Homework 1: due 22 April (1) Make sure you can open, read and print this document. (2) Buy book if you havent already done so. (3) Read Chapter 1 in text. (4) Find out about at least one of the following: (a) John Nash (b) Evar... Date Added: 2009-04-21 18:51:01 |
| Omnivision_SCCB.pdf Path: Stanford >> EE >> 109 Fall, 2009 Description: APPLICATION NOTE Serial Camera Control Bus Functional Specification Last Modified: 8 March 2002 Document Version: 2.0 THIS DOCUMENT IS PROVIDED \"AS IS\" WITH NO WARRANTIES WHATSOEVER, INCLUDING ANY WARRANTY OF MERCHANTABILITY, NON-INFRINGEMENT, FIT... Date Added: 2009-04-21 18:52:51 |
| 2006331_r01o_05204.pdf Path: Stanford >> IIG >> 1033 Fall, 2009 Description: IN THE UNITED STATES DISTRICT COURT DISTRICT OF UTAH, CENTRAL DIVISION P JLE D 20 6 b MBAR 3I A 10 : 0 b IN RE IMERGENT SECURITIES LITIGATIO N Master File No . : 2 :05-cv-0204 This Document relates to: All Action s HILLEL HYMAN, individually and o... Date Added: 2009-04-21 18:53:27 |
| lecture05.pdf Path: Stanford >> CS >> 0809 Fall, 2009 Description: CS140 - Fall 2008 - Handout #5 Past & Present CS 140: Operating Systems Lecture 5: Deadlocks Mendel Rosenblum Have looked at two constraints: mutual exclusion constraint between two events is a requirement that they not overlap in time enforced ... Date Added: 2009-04-21 18:55:54 |
| P3-16.pdf Path: SDSMT >> ME >> 216 Fall, 2009 Description: \"f ~O\'\\.\\t.\'(\'(\\, ~ - \\<0 S\\-o\'\",\", \",-\\\"\'\\ ~Ct.~o-~w.<Z.J.5v~\\\' ~ -\\CoG \"T\\. \\-\\.~\"\'- \'<\".:\\\".jV\\\" ,\\-\\\'l \'1.(,\'(\\,t-O\"~\'rtv\\d \"\ ~-\\\" ,\'\" J. \'1:1\'l-\\.~\",:,~ X -: - ~.>OOO ANh\'t-/rn.,.) .\'d\" - \'\\} bOO -(.(. \",-I\",) .\",J, ~)<.d \" ~ \\ ) ;). ~ 0... Date Added: 2009-04-21 18:57:14 |
| FinalSolutions2006.pdf Path: Stanford >> BIOSCI >> 113 Fall, 2009 Description: Bio 113/244 Winter 2005 2006 Final exam (with solutions) 1. A naturalist finds one red and four brown beetles in a random sample of one hundred beetles, the rest of which are black. She has read that carapace color is controlled in this species at a... Date Added: 2009-04-21 18:59:37 |
| tm1.pdf Path: Yale >> CS >> 460 Fall, 2009 Description: Turing Machines A function f : Z Z is \"effectively computable\" if there is an \"algorithm\" takes as input any integer x and halts in a finite number of steps, returning f (x). It is easy to see that the \"cardinality\" of the set of all functions is th... Date Added: 2009-04-21 19:00:43 |
| MIP0313part0.pdf Path: Yale >> NOV >> 0313 Fall, 2009 Description: ALICE EMCal Cosmic Calibration - MIP plots Column 4 Column 5 Column 6 Column 7 No cuts on tower 30 25 20 15 10 5 0 0 10 20 30 40 50 60 AmpMax hMIPTower1 Entries Mean RMS 1327 8.838 3.329 No cuts on tower 22 20 18 16 14 12 10 8 6 4 2 0 0 10 hMIPTo... Date Added: 2009-04-21 19:03:16 |
| hw5_soln.pdf Path: Carnegie Mellon >> HW >> 10701 Fall, 2009 Description: 10701: Homework 5 solutions December 5, 2008 1 Principle Component Analysis [Hanghang, 20 points] Given N data points xn , (n = 1, ., N ), in PCA, we look for M orthonormal vectors (u1 , ., uM ) which maximize the variance of the projected data i... Date Added: 2009-04-21 19:05:16 |
| ho4.pdf Path: Carnegie Mellon >> STAT >> 218 Fall, 2009 Description: X aY}ux5uPf aP(ux5 up!EEay!5HUw up!EEay i D z A B I II c B g e e u dpI dlo HF o EB FkHF fI B d jpwH eF B vCA d kAEG oe I d A c w A o e uI D BA hIF x u F (m pI e u o A 9d F e D ... Date Added: 2009-04-21 19:05:19 |
| 31295015659039.pdf Path: Texas Tech >> ETD >> 07312008 Fall, 2009 Description: TOWARDS A HOLY COMMERCIAL THEATRE: BETTY BUCKLEYHISTORY, PERFORMANCE, AND THEORY by DARISE HELEN ERROR, B.A.T., M.A. A DISSERTATION IN FINE ARTS Submitted to the Graduate Faculty of Texas Tech University in Partial FulfiUment of the Requirements for ... Date Added: 2009-04-21 19:07:27 |
| 31295017085274.pdf Path: Texas Tech >> ETD >> 07312008 Fall, 2009 Description: NOVEL APPARATUS FOR EVALUATION OF HEAD AND NECK INJURY by GEORG CHRISTIAN KAMM, B.S.M.E. A THESIS IN MECHANICAL ENGINEERING Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of MASTER... Date Added: 2009-04-21 19:08:18 |
| 2005112_r02t_0404681.pdf Path: Stanford >> TRPH >> 1032 Fall, 2009 Description: 1 2 3 4 5 67 8 9 10 11 12 HOWARD 13 RICE NEMEROVSK I GILBERT R. SEROTA (No . 75305) SARAH A. GOOD (No . 148742) CLARA J . SHIN (No . 214809 ) HOWARD RICE NEMEROVSKI CANADY FALK & RABKI N A Professional Corporation Three Embarcadero Center, 7th Floor... Date Added: 2009-04-21 19:09:00 |
| matII5.pdf Path: UPenn >> CIS >> 610 Fall, 2009 Description: Math 603, Spring 2003, HW 5, due 3/31/2003 Part A AI) Write A for an integral domain, K = Frac A, and set A = IntK (A). The domain A is called the normalization of A. Now set F = (A A) = { A | A A}. Of course, F is an ideal of A, called the condu... Date Added: 2009-04-21 19:09:54 |
| newhw4.pdf Path: SUNY Albany >> CSI >> 400 Fall, 2009 Description: Univ. at Albany, SUNY Homework 4 CSI 400 Operating Systems Fall 2004 Professor Chaiken Due 10/1 and 10/6 Problem 1this is due NEXT CLASS, 10/4 Suppose the concurrent execution of two threads with a shared integer variable COUNT is modelled so tha... Date Added: 2009-04-21 19:10:56 |
| Week05bLecture.pdf Path: Arizona >> GEO >> 540 Fall, 2009 Description: Topography and flexure of the Indian plate Lecture 5 continued: 24 September 2008 1 Sun, 21 Sep, 2008 Topography !\"! $\"! #\"! $\"! %\"! ! \'\"! (\"! (\"! ()\"! $\"! #\"! #\"! !\"! !\"! *\"! *\"! $\" !\" )\" \" !)\" !\" !$\" )\"! )\"! (\"! !\"! Sun, 21 Sep, 2008 ... Date Added: 2009-04-21 19:12:30 |
| PredatoryFishRemoval.pdf Path: Arizona >> ECOL >> 482 Fall, 2008 Description: ... Date Added: 2009-04-21 19:13:14 |
| az1138_6.pdf Path: Arizona >> AZ >> 1138 Fall, 2009 Description: Evaluation of Thinning Agents for Kinnow Mandarins1 Michael A. Maurer and Kathryn C. Taylor Abstract An experiment was designed to determine the effectiveness of foliar prebloom boron (B) sprays for thinning Kinnow mandarins (Citrus reticulata). Tre... Date Added: 2009-04-21 19:13:49 |
| az1254_12.pdf Path: Arizona >> AZ >> 1254 Fall, 2009 Description: Grain Sorghum Variety Trial in Greenlee County, 2000 L.J. Clark and E.W. Carpenter Abstract Four mid- to full-seasoned grain sorghum hybrids were compared in a replicated trial planted on the Jones farm in the Duncan-Virden valley. Dekalb 66 was the... Date Added: 2009-04-21 19:13:51 |
| Prosodic_Modeling_for_Improved_Speech_Recogntion_and_Understanding_Wang_phd_thesis.pdf Path: Benjamin Franklin Institute of Technology >> ECE >> 5526 Fall, 2009 Description: Prosodic Modeling for Improved Speech Recognition and Understanding by Chao Wang M.S., Massachusetts Institute of Technology (1997) B.S., Tsinghua University, Beijing, China (1994) Submitted to the Department of Electrical Engineering and Computer ... Date Added: 2009-04-21 19:16:55 |
| copyright.pdf Path: Benjamin Franklin Institute of Technology >> ECE >> 5526 Fall, 2009 Description: COPYRIGHT INFORMATION AND DISCLAIMER The RES 6.0 software contained on this disc accompanies the publication Speech Recognition - Theory and C+ Implementation copyright 1999 John Wiley & Sons, Ltd., Baffins Lane, Chichester, West Sussex, UK PO19 1UD... Date Added: 2009-04-21 19:16:56 |
| prehna.pdf Path: Evansville >> PS >> 480 Fall, 2009 Description: Yersinia Virulence Depends on Mimicry of Host Rho-Family Nucleotide Dissociation Inhibitors Gerd Prehna,1 Maya I. Ivanov,2 James B. Bliska,2 and C. Erec Stebbins1,* Laboratory of Structural Microbiology, Rockefeller University, New York, NY 10021, US... Date Added: 2009-04-21 19:17:24 |
| chapter6.pdf Path: Alabama Huntsville >> EE >> 448 Fall, 2009 Description: EE448/528 Version 1.0 John Stensby Chapter 6 r r AX = b: The Minimum Norm Solution and the Least-Square-Error Problem Like the previous chapter, this chapter deals with the linear algebraic equation problem AX = b. However, in this chapter, we imp... Date Added: 2009-04-21 19:17:36 |
| 05s_cpe526_syllabus.pdf Path: Alabama Huntsville >> CPE >> 526 Fall, 2009 Description: The University of Alabama in Huntsville Electrical and Computer Engineering Course Syllabus CPE 426/526 01 Spring 2005 Textbook: VHDL Design Representation and Synthesis, James R. Armstrong and F. Gail Gray, Prentice Hall, 2000, Second Edition. http:... Date Added: 2009-04-21 19:17:43 |
| lecture13.pdf Path: Alabama Huntsville >> CS >> 513 Fall, 2009 Description: CS513 Intro to Computer Architecture Lecture #13 Assembly Language Spring 2004 Compiled Code Consider the following simple program that calculated the Fibbonocci number series (1, 2, 3, 5, 8, 13, ) int main(int argc, char *argv[]) { int a, b; in... Date Added: 2009-04-21 19:18:06 |
| WindEnergyInfo.pdf Path: Colorado >> PHYS >> 3070 Fall, 2008 Description: Wind Energy Information General Wind Information American Wind Energy Association (AWEA) Web Site: www.awea.org This is the web site of the U.S. Wind Trade Group. This comprehensive web site covers many different aspects of wind energy technology an... Date Added: 2009-04-21 19:20:30 |
| exam1.pdf Path: Colorado >> AMATH >> 2350 Fall, 2008 Description: APPM 2350 Summer 2005 Exam 1 June 17, 2005 1 INSTRUCTIONS: Computers, calculators, books, notes, ying monkeys, etc. are not permitted. Some (possibly) useful formulae are attached. Write your name, your instructors name, and the color of your exa... Date Added: 2009-04-21 19:22:08 |
| exam1.pdf Path: Colorado >> ALL >> 2350 Fall, 2008 Description: APPM 2350 Summer 2005 Exam 1 June 17, 2005 1 INSTRUCTIONS: Computers, calculators, books, notes, ying monkeys, etc. are not permitted. Some (possibly) useful formulae are attached. Write your name, your instructors name, and the color of your exa... Date Added: 2009-04-21 19:22:08 |
| CHEN3200SYLLABUS.pdf Path: Colorado >> CHEN >> 3200 Fall, 2008 Description: Spring, 2007 Syllabus CHEN 3200: ChE Fluid Mechanics Instructors Robert Sani, Professor Department of Chemical and Biological Engineering Office Number: ECCH 103A E-mail address: robert.sani@colorado.edu Phone: 303-492-5517 Ms. Julie Benton, Advanced... Date Added: 2009-04-21 19:23:04 |
| lab3.pdf Path: Colorado >> EEB >> 2040 Fall, 2009 Description: STATISTICAL ANALYSIS Factors Affecting the Growth Rate of Ponderosa Pines II LABORATORY # 3 OVERVIEW: Introductions to statistics Applying statistics to answer ecological questions Using Microsoft Excel to graph data & conduct statistical tests... Date Added: 2009-04-21 19:24:24 |
| ProgProj6.pdf Path: Colorado >> MATH >> 1310 Fall, 2008 Description: MATH 1310 Programming Project #6 (TI-83 Plus) You have the whole class period to work on the project with your group. You are required to use your own calculator and turn in your own paper. Be sure to answer all of the questions asked. Guessing the ... Date Added: 2009-04-21 19:24:48 |
| Ch28_circuits_lect.pdf Path: Colorado >> PHYS >> 1120 Fall, 2008 Description: 28-1 (SJP, Phys 1120) Electrical Circuits: Most electrical phenomena (everything from light bulbs to toaster ovens to computer screens to lightning bolts.) involve the flow of current. Flow happens when you have a source of potential difference, and... Date Added: 2009-04-21 19:25:00 |
| ch3.pdf Path: Colorado >> ECEN >> 5817 Fall, 2008 Description: C HAPTER 3 STATE PLANE ANALYSIS, AVERAGING, AND OTHER ANALYTICAL TOOLS he sinusoidal approximations used in the previous chapter break down when the effects of harmonics are significant. This is a particular problem in the case of discontinuous con... Date Added: 2009-04-21 19:25:25 |
| Boushey_Opting_Out.pdf Path: Wisc La Crosse >> ECO >> 336 Fall, 2009 Description: This article was downloaded by:[IAFFE] On: 8 January 2008 Access Details: [subscription number 777677978] Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer St... Date Added: 2009-04-21 19:25:30 |
| syllabus.pdf Path: Colorado >> PHIL >> 1200 Fall, 2008 Description: Philosophy 1200: Philosophy and Society Spring 2007, Section 010 Syllabus Instructor Chris Heathwood Office: Hellems 192 Office Hours: Wed., 2:00-4:00 WF 9:00-9:50 HALE 270 Office Phone: (303-73) 5-0450 Email: heathwood@colorado.edu Teaching Assis... Date Added: 2009-04-21 19:25:40 |
| teraflopattackilluminata.pdf Path: VCU >> CMSC >> 502 Fall, 2008 Description: Copyright 2005 Illuminata, Inc. TM Blue Genes Teraflop Attack Quick Note When the latest edition of the TOP500 supercomputer list was published this past June,1 it showed a remarkable proliferation of IBM Blue Gene systems. Not only did a Blue Gen... Date Added: 2009-04-21 19:26:28 |
| help_ladder.pdf Path: Colorado >> CHEN >> 1211 Fall, 2008 Description: Help Ladder This is a large class and there are many people organized to help you. For maximum efficiency, follow the help ladder. This procedure will allow us to help you as effectively as possible. 1) Help Room. ECCH 103D (Library) is the CHEN 1211... Date Added: 2009-04-21 19:27:19 |
| Py_Whypython.pdf Path: Colorado >> MCDB >> 6440 Fall, 2008 Description: WHY PYTHON? I. Excellent Learning Language 1. Simple Syntax (easy to read and write) C+ #include <iostream.h> int main() { cout < Hello World!\ ; } Python print Hello World!\ ; (No variable delarations, no worries about pointers, excellent imbedded d... Date Added: 2009-04-21 19:31:20 |
| LidovEulogyLetter.pdf Path: Colorado >> ASEN >> 5519 Fall, 2008 Description: ACTA 117810 Moscow Profsoyuznaya 84/32 Space Research Institute (IKI) Dr. A. Sukhanov Dear Dr. Sukhanov, Consulting Group 1994 January 11 I was very sad to hear of the death of Professor Michael Lidov. He was one of my most valued teachers, even t... Date Added: 2009-04-21 19:32:56 |
| ps11.pdf Path: Wesleyan >> ECON >> 301 Fall, 2006 Description: ECON 301, Prof. Hogendorn, Spring 2002 Problem Set 11 1. Suppose that Microsoft is considering various functional forms for the model of network eects for the Xbox. They expect there is a potential market of 10,000,000 users, and these users can be ... Date Added: 2009-04-21 19:37:50 |
| hw2.pdf Path: Wesleyan >> ECON >> 362 Fall, 2009 Description: ECON362: Spring 2004 Homework #2 The due date for this assignment is Feb. 9. I will not accept any late work. You must type your answers. 1. Read Temin (1993) (a) Explain how the adherence to gold standard transmitted the Great Depression across dier... Date Added: 2009-04-21 19:39:30 |
| FormalMethods.pdf Path: MSOE >> CS >> 489 Fall, 2009 Description: Formalmethodsintroduction Sunday,November02,2008 9:26PM Formal methods What are they? Uses Tools Application to software development FormalMethods Page 1 Whatareformalmethods? Sunday,November02,2008 9:49PM Do you have any idea? FormalMethods... Date Added: 2009-04-21 19:43:52 |
| cs489-19.pdf Path: MSOE >> CS >> 489 Fall, 2009 Description: CS489-F98-19 11/1/98 Understanding the Client The hard part! Non-technical user But should know more about needs Communication difficulty Gause, Donald C. and Weinberg, Gerald M. Exploring Requirements: Quality Before Design. Dorset House Publ... Date Added: 2009-04-21 19:44:05 |
| p1a.pdf Path: MSOE >> CS >> 489 Fall, 2009 Description: Code Counter Analysis Team Delta Team Members: Team Leader: Greg Meiste Development Manager: Troy Hamilton Process/Planning Manager: Jesse Moll Quality/Test Manager: Kyle Sweet Submitted on: September 27, 2004 Submitted to: Dr. Welch -1- Table of C... Date Added: 2009-04-21 19:44:09 |
| se280-02.pdf Path: MSOE >> SE >> 280 Fall, 2009 Description: SE280 Lecture 02 W0304 12/1/2003 1 SE-280 Process Elements Baseline process Document what you now do Effort (time) Quality (defects) Establish current performance Reference for measuring improvement New process elements Acknowledgment Lecture mat... Date Added: 2009-04-21 19:44:15 |
| 04slide.pdf Path: Emory >> CS >> 170000 Fall, 2009 Description: while Loop Flow Chart while (loop-continuation-condition) { int count = 0; while (count < 100) { System.out.println(\"Welcome to Java!\"); count+; } count = 0; Chapter 4 Loops } / loop-body; Statement(s); Loop Continuation Condition? true Statement(... Date Added: 2009-04-21 19:45:00 |
| b23.pdf Path: Loyola Chicago >> BURKE >> 504 Spring, 2009 Description: ... Date Added: 2009-04-21 19:45:48 |
| Lecture17.pdf Path: Wayne State University >> PHY >> 2140 Fall, 2008 Description: General Physics (PHY 2140) Lecture 17 Electricity and Magnetism Induced voltages and induction Lenzs law Generators and motors http:/www.physics.wayne.edu/~apetrov/PHY2140/ Chapter 20 10/10/2003 1 Lightning Review Last lecture: 1. Induced voltages ... Date Added: 2009-04-21 19:50:34 |
| Project-2.pdf Path: MNSU >> CSC >> 445 Fall, 2009 Description: Project Two: Windows-Based Snort IDS Purpose 1) 2) 3) Install and configure Windows-based Snort IDS Add a custom rule to detect any packet with content secret in its payload Conduct testing to show true positive detection based on the custom rule ... Date Added: 2009-04-21 19:51:28 |
| LawAssessing.pdf Path: GWU >> ED >> 220 Fall, 2009 Description: 82 c. ~\"SSMENTSTRATEGIES FOR THE ON-LINE CLASS As on-line degree programs are made available in Monaghan, P. \"Union leaders Raise Concerns About Technology for Teaching.\" Chronicle of Higher Education, March IS, 1996, p. A26. [http:/www.chronicle.c... Date Added: 2009-04-21 19:52:34 |
| notes-09-03.pdf Path: Rutgers >> CS >> 519 Spring, 2002 Description: CS 519: Operating Systems Theory Lecture: September 03, 2003 Instructor: Thu D. Nguyen, tdnguyen@cs.rutgers.edu Scribe: Chen Fu, chenfu@cs.rutgers.edu August 19, 2005 Abstract: The September 03 class is the rst class in the fall. Syllabus can be foun... Date Added: 2009-04-21 19:53:10 |
| Project_Evaluation.pdf Path: St. Ambrose >> CSCI >> 480 Fall, 2009 Description: C# Project Evaluation Sheet Programmer Name:_ Project Number: _ Disk Folder Name: _ Date Due: _ Solution (.sln) file: _ Date Turned In: _ Points (100 Possible) Above to be completed by student Project Performance: Project works according to specif... Date Added: 2009-04-21 19:54:23 |
| mackie.pdf Path: Rutgers >> PHIL >> 103 Fall, 2009 Description: Free Will and the Problem of Evil1 by John L. Mackie 2 Perhapsthemostimportantproposedsolutionoftheproblemofevilisthatevil isnottobeascribedtoGodatall,buttotheindependentactionsofhumanbeings, supposedtohavebeenendowedbyGodwithfreedomofthewill.Thiss... Date Added: 2009-04-21 19:56:00 |
| 09-10-lakshminarayanan.pdf Path: Rutgers >> CS >> 519 Spring, 2002 Description: CS 519: Operating Systems Theory Lecture: September 10, 2003 Instructor: Thu D. Nguyen, tdnguyen@cs.rutgers.edu Scribe: Vijay Lakshminarayanan, mail_vj@yahoo.com Papers Discussed: UNIX Time-Sharing System remarkable thing was hardware size and cost... Date Added: 2009-04-21 19:56:24 |
| Bio301_Session_26_Review_Questions.pdf Path: Rutgers >> BIO >> 301 Fall, 2009 Description: 120:302 Foundations of Biology/Session 26 Review Questions Professor Cervantes/Fall 2008 Eukaryotic Signal Transduction 1. Which is the correct order of the flow of information during cell signaling? A) receptor-ligand binding signal transduction ... Date Added: 2009-04-21 19:57:38 |
| lec4f00bridges.pdf Path: SUNY Buffalo >> EE >> 312 Fall, 2009 Description: BRIDGES IMPEDANCE MEASUREMENT Experiment # 4 EE 312 Basic Electronics Instrumentation Laboratory Fall 2000 September 20, 2000 OBJECTIVES: The first objective of this experiment is to learn how to use bridges used to measure values for Resistance R... Date Added: 2009-04-21 19:59:54 |
| main.pdf Path: Millersville >> MATH >> 365 Fall, 2009 Description: Euler Equations MATH 365 Ordinary Differential Equations J. Robert Buchanan Department of Mathematics Summer 2008 J. Robert Buchanan Euler Equations Euler Equations An Euler equation is a simple form of second order linear ODE with a regular si... Date Added: 2009-04-21 20:01:16 |
| ch01.pdf Path: UPR Mayagüez >> ICOM >> 4015 Fall, 2009 Description: Chapter One: Introduction Big Java by Cay Horstmann Copyright 2008 by John Wiley & Sons. All rights reserved. Chapter Goals To understand the activity of programming To learn about the architecture of computers To learn about machine code and hi... Date Added: 2009-04-21 20:03:53 |
| exam_iii_s00.pdf Path: UPR Mayagüez >> ICOM >> 5007 Fall, 2009 Description: Name (On rst page only)_ ICOM 5007 EXAM III - Spring 2000 May 2, 2000 Open books and notes. Only the course text and notes in your own handwriting may be used. 1. The following relate to client-server implementation using Berkeley sockets. Please an... Date Added: 2009-04-21 20:04:05 |
| SupplementIII.pdf Path: UPR Mayagüez >> FISI >> 3172 Fall, 2009 Description: Electric Current and Direct Current Circuits Why bother with Electric Potential V, Capacitance, and Electric Fields? The electric potential difference between point a) and point b) in a circuit is the force driving current from a) to b) Capacitanc... Date Added: 2009-04-21 20:04:13 |
| mt.pdf Path: NMSU >> CS >> 473 Fall, 2009 Description: CS 473 Midterm Exam October 13, 2004 The following exam is open book and open notes. You may feel free to use whatever additional reference material you wish, but no electronic aids are allowed. Please note the following instructions. There will be ... Date Added: 2009-04-21 20:05:56 |
| InfoFinding.pdf Path: Michigan >> SI >> 110 Fall, 2008 Description: Finding Information All about how we now search for and (hopefully) find information and determine (or not!) its veracity. Theories of classification and the revolt against old hierarchical systems. In passing, issues of how information finding syste... Date Added: 2009-04-21 20:08:57 |
| Don_Norman_on_Interfaces.pdf Path: Michigan >> SI >> 110 Fall, 2008 Description: Emotion and Design ( jnd.org ) Books home > essays > emotion DESIGN: ATTRACTIVE THINGS WORK BETTER (modified, July, 2002) A version of this essay was published in Interactions,... Date Added: 2009-04-21 20:09:00 |
| 24369101.pdf Path: Michigan >> EECS >> 482 Fall, 2008 Description: Addendum Intel Architecture Software Developers Manual Volume 1: Basic Architecture Order Number 243691-001 NOTE: The Intel Architecture Software Developers Manual consists of the following volumes: Basic Architecture, Order Number 243190; Instructi... Date Added: 2009-04-21 20:09:33 |
| Schedules_timeline1_(701).pdf Path: Michigan >> NRE >> 701 Fall, 2008 Description: ... Date Added: 2009-04-21 20:09:44 |
| timeline1.pdf Path: Michigan >> NRE >> 2003 Fall, 2009 Description: ... Date Added: 2009-04-21 20:09:45 |
| timeline1.pdf Path: Michigan >> NRE >> 701 Fall, 2008 Description: ... Date Added: 2009-04-21 20:09:45 |
| sat.pdf Path: RIT >> GPROJ >> 531 Winter, 2009 Description: Parallel Computing I Winter Quarter 2006 Graduate Programming Project 1 Parallel SAT Solver Alan Kaminsky ark@cs.rit.edu January 22, 2007 1 Introduction Graduate Programming Project 1 is to write a parallel program for a SMP computer that solves ... Date Added: 2009-04-21 20:09:49 |
| FCA_User_Guide_2006Dec.pdf Path: Michigan >> FY >> 2006 Fall, 2009 Description: Facility Condition Assessment (FCA) Program User Guide 12/13/2006 INTRODUCTION: This guide is intended for those that do not use the Facility Condition Assessment (FCA) software often enough to remember how to get into the database or how to get to ... Date Added: 2009-04-21 20:09:51 |
| FCA_User_Guide_2006Dec.pdf Path: Michigan >> FY >> 200601 Fall, 2009 Description: Facility Condition Assessment (FCA) Program User Guide 12/13/2006 INTRODUCTION: This guide is intended for those that do not use the Facility Condition Assessment (FCA) software often enough to remember how to get into the database or how to get to ... Date Added: 2009-04-21 20:09:52 |
| proposal.pdf Path: RIT >> TEAMU >> 482 Fall, 2009 Description: Team Members: Achilleas Tziazas - apt0084@rit.edu Ed Wolf -efw6415@rit.edu Team Name: The Phone Phreakers Team Website: http:/www.cs.rit.edu/~efw6415/ Topic Description: Our team project will focus our presentation on the Blowfish Cipher. This Ciphe... Date Added: 2009-04-21 20:10:44 |
| Proposal.pdf Path: RIT >> HJP >> 0608 Fall, 2009 Description: Proposal Student: Hardik J. Parikh Chair: Prof. Alan. Kaminsky Topic: Solving MRI Spin Relaxometry Problem (using PJ) Abstract: Magnetic resonance imaging (MRI) is an imaging technique used primarily in medical profession to produce high quality imag... Date Added: 2009-04-21 20:10:45 |
| 1104849.pdf Path: RIT >> P >> 08005 Fall, 2009 Description: Service Manual 3G Storm Series Wheelchairs Arrow RWD Torque SP RWD Ranger X RWD DEALER: KEEP THIS MANUAL. THE PROCEDURES IN THIS MANUAL MUST BE PERFORMED BY A QUALIFIED TECHNICIAN. Part No. 1104849 1 3G Storm Series Wheelchairs WARNING WARNING ... Date Added: 2009-04-21 20:11:48 |
| mt620f07sol.pdf Path: Michigan >> STAT >> 620 Fall, 2009 Description: Statistics 620 Fall, 2007 1. Suppose that the number of hours between successive arrivals of the train at a station is uniformly distributed on (0, 1). Passengers arrive according to a Poisson process with a rate . Suppose a train has just left the s... Date Added: 2009-04-21 20:12:03 |
| Exam2_115.pdf Path: Michigan >> MATH >> 115 Fall, 2008 Description: M ATH 115 S ECOND M IDTERM March 25, 2008 N AME : I NSTRUCTOR : S ECTION N UMBER : 1. Do not open this exam until you are told to begin. 2. This exam has ? pages including this cover. There are ? questions. 3. Do not separate the pages of the exam.... Date Added: 2009-04-21 20:12:38 |
| 511notes07-12.pdf Path: Michigan >> IOE >> 511 Fall, 2008 Description: IOE 511/Math 562, Section 1, Fall 2007 69 12 Successive quadratic programming (SQP) In this section we will describe some basic ideas of the Sequential Quadratic Programming (SQP) method for solving nonlinearly constrained optimization problems.1... Date Added: 2009-04-21 20:13:31 |
| ppintro.pdf Path: Sanford-Brown Institute >> CS >> 092 Fall, 2009 Description: Blessed Sacrament Elementary Mathematics Project for Ms. Robillards First Grade Class Blessed Sacrament Elementary Ms. Robillards Class First Grade Mathematics Concepts Coins and Money, Time Recognition Skills emphasized: recognition (of coins ... Date Added: 2009-04-21 20:13:51 |
| msh.pdf Path: Sanford-Brown Institute >> CS >> 190 Fall, 2009 Description: E-Study Specifications Document author: Mark Humphrey <msh> date: February 7, 2003 1. Introduction 1.1 Problem Statement While the world gets more electronic-based with every day, students still typically lug around massive textbooks when they could... Date Added: 2009-04-21 20:14:15 |
| Locks.pdf Path: Michigan >> EECS >> 584 Fall, 2008 Description: Quick Review 2-Phase Locking Lock Manager Implementation Deadlock Definition, Detection, Prevention 10/1/08 1 Two-Phase Locking (2PL) If T wants to read (modify) an object, first obtains a shared (exclusive) lock If T releases any lock, it ... Date Added: 2009-04-21 20:15:36 |
| en175_proj.pdf Path: Sanford-Brown Institute >> EN >> 175 Fall, 2009 Description: EN175: ADVANCED MECHANICS OF SOLIDS Finite Element Project (due 12/10/02) The project is to be an in-depth study of a boundary value problem in mechanics of deformable materials by means of the numerical finite element method. The problem selected fo... Date Added: 2009-04-21 20:15:45 |
| tversky&kahneman1983.pdf Path: Sanford-Brown Institute >> CG >> 195 Fall, 2009 Description: ... Date Added: 2009-04-21 20:15:51 |
| ppintro.pdf Path: Sanford-Brown Institute >> CSCI >> 0920 Fall, 2009 Description: Blessed Sacrament Elementary Mathematics Project for Ms. Robillards First Grade Class Blessed Sacrament Elementary Ms. Robillards Class First Grade Mathematics Concepts Coins and Money, Time Recognition Skills emphasized: recognition (of coins ... Date Added: 2009-04-21 20:17:03 |
| ppintro.pdf Path: Sanford-Brown Institute >> CSCI >> 2002 Fall, 2009 Description: Blessed Sacrament Elementary Mathematics Project for Ms. Robillards First Grade Class Blessed Sacrament Elementary Ms. Robillards Class First Grade Mathematics Concepts Coins and Money, Time Recognition Skills emphasized: recognition (of coins ... Date Added: 2009-04-21 20:17:04 |
| lecture24.pdf Path: Sanford-Brown Institute >> CS >> 195 Fall, 2009 Description: CS195-5 : Introduction to Machine Learning Lecture 24 Greg Shakhnarovich November 8, 2006 Announcements Projects: three types Focused literature survey A non-trivial application of ML Theoretical and/or empirical analysis of an advanced ML model... Date Added: 2009-04-21 20:18:12 |
| photometricUnits_PMThandbook.pdf Path: Michigan >> NERS >> 580 Fall, 2008 Description: 4 CHAPTERl INTRODUCTION 1. 2 Photometric units Before starting to describe photomultiplier tubes and their characteristics,this section briefly discusses photometric units commonly usedto measurethe quantity of light. This section also explains ... Date Added: 2009-04-21 20:21:11 |
| lecture8.pdf Path: Johns Hopkins >> APL >> 605411 Fall, 2008 Description: 1 2 3 The instruction following the branch could be stalled for three clock cycles until the outcome of the test is known. If the branch is not taken then the instruction in the fetch stage can be allowed to proceed. However, if the branch is take... Date Added: 2009-04-21 20:24:09 |
| 20081014.pdf Path: Harvard >> CSCIE >> 153 Fall, 2009 Description: XSLT and XPath Table of Contents | All Slides | Link List | CSCI E-153 Home Page 1 of 39 XSLT and XPath Page 2 of 39 Announcements Assignment 2 Use either XHTML Strict or Transitional. You will get \"XHTML 1.0 Strict\" if you use <map:serialize typ... Date Added: 2009-04-21 20:24:24 |
| excel_basics.pdf Path: Wisconsin >> PHYSICS >> 247 Fall, 2008 Description: Physics 247 Excel Basics Basic Excel Needs Include 1) Having a place to work with it that you can print results. 2) Realizing that it doesn\'t have to be Excel. You can use other spreadsheet programs or write computer language programs that accompli... Date Added: 2009-04-21 20:26:07 |
| cee629-lab3-master.pdf Path: Wisconsin >> ENGR >> 629 Fall, 2009 Description: CEE 629 Fall 2005 Environmental Microbial Biotechnology Lab 3 Quantitative Real Time PCR QUANTITATIVE REAL TIME PCR Tuesday, 11 October Room 3231 Engineering Hall (Environmental Engineering Teaching Lab) Background Standard PCR of the type that y... Date Added: 2009-04-21 20:27:09 |
| 2001_Dervan_BioorgMedChem.pdf Path: Wisconsin >> BIOCHEM >> 704 Fall, 2008 Description: Bioorganic & Medicinal Chemistry 9 (2001) 22152235 Molecular Recognition of DNA by Small Molecules Peter B. Dervan* Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125, USA Accepted 17 July 2001 Ch... Date Added: 2009-04-21 20:27:44 |
| dist-comp-intro.pdf Path: Rutgers >> ECE >> 451 Fall, 2008 Description: Distributed Computing: Introduction Manish Parashar parashar@ece.rutgers.edu Department of Electrical & Computer Engineering Rutgers University Definition of a Distributed System (1) A distributed system is: A collection of independent computers tha... Date Added: 2009-04-21 20:33:15 |
| GigaSpaces_and_Amazon_EC2.pdf Path: Rutgers >> ECE >> 572 Fall, 2008 Description: Section One | Amazon EC2 and Challenges for Stateful Applications High-Performance, Scalable Applications on the Amazon Elastic Compute Cloud Dynamically Scaling Stateful, Transactional and Data-Intensive Applications on the Amazon EC2 Web Service ... Date Added: 2009-04-21 20:33:21 |
| alf.handouts.pdf Path: Rutgers >> CS >> 352 Spring, 2006 Description: Computer Networks CS352 Presentation #17 By: Rafal Kaczmarek, Nikita Lytkin Application Level Framing(ALF) Architectural Considerations for a New Generation of Protocols Abstract The c urrent generation o f protocol architecture, such a s TCP/IP or ... Date Added: 2009-04-21 20:33:31 |
| 20010111o1cNU.pdf Path: Stanford >> NEON >> 1016 Fall, 2009 Description: UNITED STATES DISTRICT COURT DISTRICT OF COLORADO Civil Action No._ _ GILBERT J. VECONI, JR., on behalf of himself and all others similarly situated, Plaintiff, v. NEW ERA OF NETWORKS, INC., GEORGE F. ADAM, JR., PATRICK FORTUNE AND STEPHEN E. WEBB, D... Date Added: 2009-04-21 20:37:16 |
| 20051028_r13m_032522.pdf Path: Stanford >> CNO >> 1028 Fall, 2009 Description: E XHIBIT L ~j aef F \'~tt-.4.ss=?i. .` p_,F: ~\',-,!,.,7c`^.- . . \',_ .-}\"~ . i.7Cit$ :.7i.i$ `+.e tiAa^\'`^, h . - News and Earning s November 2, 1999 First Quarter Earnings CornerStone Propane Partners, L.P . Reports 70% Increase in Earnings ... Date Added: 2009-04-21 20:37:43 |
| 20001121_f01c_0012408.pdf Path: Stanford >> AI >> 1039 Fall, 2009 Description: Case 1 : 00-cv-1 -NG Document 1 Filed 11/2 IS 00 Page 1 of 37 UNITED STATES DISTRICT COURT DISTRICT OF MASSACHUSETTS T. ROWE PRICE TAX-FREE HIGH YIELD FUND, INC., and SMITH BARNEY MUNICIPAL on behalf of themselves and all others similarly sit... Date Added: 2009-04-21 20:37:51 |
| 20.1.pdf Path: Stanford >> CS >> 374 Fall, 2009 Description: CS 374: Algorithms in Biology (Fall 2006) Vijay Krishnan Lecture 20: Machine Learning for Protein Classification Paper reference Rui Kuang, Eugene Ie, Ke Wang, Kai Wang, Mahira Siddiqi, Yoav Freund and Christina Leslie. Profile-based string kernels... Date Added: 2009-04-21 20:38:06 |
| rails-SoftwarePub.pdf Path: Michigan >> CSCS >> 530 Fall, 2009 Description: Software Engineering Considerations for Individual-based Models Glen E. P. Ropella The Swarm Development Group 624 Agua Fria Santa Fe NM 87501 E-mail: gepr@acm.org Steven F. Railsback Lang, Railsback & Associates 250 California Avenue Arcata CA 95521... Date Added: 2009-04-21 20:38:07 |
| 2001913_r01x_010033.pdf Path: Stanford >> MAWIOB >> 1016 Fall, 2009 Description: ORIGINAL 1 2 3 .4 5 6 7 8 MILBERG WEISS BERSHAD HYNES & LERACH LLP REED R. KATHREIN (139304) CHRISTOPHER P. SEEFER (201197) SHAWN A. WILLIAMS (213113) 100 Pine Street, Suite 2600 San Francisco, CA 94111 Telephone: 4151288-4545 4151288-4534 (fax) -an... Date Added: 2009-04-21 20:38:27 |
| 200631_r03o_043009.pdf Path: Stanford >> CRM >> 1031 Fall, 2009 Description: Case 3:04-cv-03009-JSW Document 102 Filed 03/01/2006 Page 1 of 2 1 2 3 4 5 6 7 FOR THE NORTHERN DISTRICT OF CALIFORNIA 8 9 10 In re: SALESFORCE.COM SECURITIES LITIGATION No. C 04-03009 JSW IN THE UNITED STATES DISTRICT COURT United States Distri... Date Added: 2009-04-21 20:41:36 |
| 15HTTP2.pdf Path: Stanford >> CS >> 193 Fall, 2009 Description: CS193i Summer 2004 Handout #15 Kelly A. Shaw HTTP Part 2 HTML on the Client Most often the HTTP response to a client request is Hypertext Markup Language (HTML) The HTML includes URL links that, when clicked, lead to further HTTP transactions. The ... Date Added: 2009-04-21 20:41:41 |
| preece-2002-interviews.pdf Path: Oregon State >> CS >> 589 Fall, 2008 Description: ... Date Added: 2009-04-21 20:43:47 |
| Chapter5answer.pdf Path: SUNY Buffalo >> EE >> 310 Fall, 2009 Description: Chapter 5 5.3 iC = I S eVBE / VT Devece : 1 0.2 10 3 = I S1e 0.72 / 0.025 I S 1 = 6.214 10 17 A Device : 2 12 10 3 = I S 2 e 0.72 / 0.025 I S 2 = 3.728 10 15 A Is A A2 I S 2 iC 2 12 = = = = 60 A1 I S1 iC1 0.2 5.7 (a) I C = I B 10 3 = 50 10 ... Date Added: 2009-04-21 20:45:59 |
| StableAssemblages.pdf Path: SUNY Buffalo >> GLY >> 206 Fall, 2009 Description: Equilibrium Assemblages Stable Mineral Assemblages Reference: Winter Chapter 24 At equilibrium, the mineralogy (and the composition of each mineral) is determined by T, P, and X Mineral paragenesis refers to such an equilibrium mineral assemblage ... Date Added: 2009-04-21 20:46:55 |
| su30_objectives.pdf Path: SUNY Buffalo >> CE >> 429 Fall, 2009 Description: Unit Number: 30 Unit Topic(s): Rate Expressions from PFR Data; Differential Method Objectives: After completing this unit, the student should be able to 1. Describe the differential operation of a PFR 2. Explain why differential data analysis can be ... Date Added: 2009-04-21 20:47:12 |
| Lab2.pdf Path: SUNY Buffalo >> CSE >> 113 Fall, 2009 Description: CSE 113 Lab 2 Your First Java Application Due Week of 9/16 Objectives In this lab you will learn about entering, compiling, debugging, and testing Java programs. You will apply the knowledge you acquire in this lab to all subsequent labs. You will le... Date Added: 2009-04-21 20:47:17 |
| Lecture26.pdf Path: MSOE >> EE >> 3101 Fall, 2009 Description: ... Date Added: 2009-04-21 20:48:29 |
| quizoutput.pdf Path: Rutgers >> STAT >> 563 Fall, 2009 Description: 4. (a) SAS code: data expen; input expenditure earnings size; cards; 2.6 3 1 3.2 4 1 4.4 5 2 4.8 6 2 4.2 4.5 3 4.8 6 3 4.8 5 4 5.6 7 4 ; proc reg data=expen; model expenditure=earnings/clb; plot (R.)*P.; run; SAS output: R code: > earnings<-c(3,4,5... Date Added: 2009-04-21 20:50:39 |
| Lecture3.pdf Path: Stevens >> MA >> 331 Fall, 2009 Description: Lecture 3 Sampling distributions. Counts, Proportions, and sample mean. Statistical Inference: Uses data and summary statistics (mean, variances, proportions, slopes) to draw conclusions about a population or process. Statistic: Any random variabl... Date Added: 2009-04-21 20:50:41 |
| reput.pdf Path: Sanford-Brown Institute >> EC >> 218 Fall, 2009 Description: Incomplete Information and Reputation Consider Seltens Chain Store game: A E E CS 1, 1 F -1, 0 N 0, 4 The unique SGPE is (E,A). The same would happen with any nite number of entrants. COUNTERINTUITIVE Incomplete Information and Reputation Kreps... Date Added: 2009-04-21 20:51:42 |
| 31last.pdf Path: Sanford-Brown Institute >> CS >> 169 Fall, 2009 Description: What Next? CS 167 XXXI1 Copyright 2006 Thomas W. Doeppner. All rights reserved. XXX!1 Youll Soon Finish 167/169 You might celebrate take another course - 160 - 166 - 168 - 176 - 275 do some systems research become a 167/169 TA CS 167 XXX... Date Added: 2009-04-21 20:52:03 |
| MotherEarth.pdf Path: Sanford-Brown Institute >> DECEMBER >> 1910 Fall, 2009 Description: *v MOTHER EARTH Vol. VI. APRIL, 1911 No. 2 CONTENTS Page The Cry of Toil Rudyard Kipling Everlasting Murder M. B.: Observations and Comments 33 34 37 Brooding Patience The Slave\'s Government Blood Money Gifts The Spirit of the Martyr The Lie of U... Date Added: 2009-04-21 20:52:24 |
| 31295019150076.pdf Path: Texas Tech >> ETD >> 06272008 Fall, 2009 Description: FATHERS* EMOTION FRAMING AND CHILDREN\'S EMOTIONAL COMPETENCE by AMANDA E. BRUEDIGAM, B.A. A THESIS IN HUMAN DEVELOPMENT AND FAMILY STUDIES Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the D... Date Added: 2009-04-21 20:53:17 |
| agro-patents.pdf Path: Michigan >> SI >> 110 Fall, 2008 Description: May 15, 2001 The Green Revolution Yields to the Bottom Line By ANDREW POLLACK r. William Folk, a professor at the University of Missouri, wants to genetically engineer soybeans to improve their nutritional value. But he faces more than scientic hur... Date Added: 2009-04-21 20:55:42 |
| hw1_soln.pdf Path: Virginia Tech >> HW >> 2074 Fall, 2009 Description: AOE/ESM 2074 Introduction to Computational Methods due 30 August 2001 3. At the Matlab prompt we type diary hw 1.3. This saves the Command window dialogue to the file hw 1.3. u = 1; v = 3; a = (4*u)/(3*v) a = 0.4444 b = (2*v^-2)/(u+v)^2) b = 0.0139 c... Date Added: 2009-04-21 20:58:25 |
| nyt_5-17-02.pdf Path: Texas >> BIO >> 311 Fall, 2009 Description: Meteor May Have Started Dinosaur Era Page 1 of 3 May 17, 2002 Meteor May Have Started Dinosaur Era By KENNETH CHANG The age of dinosaurs, which ended with the cataclysmic bang of a meteor impact 65 million years ago, may also have begun with one.... Date Added: 2009-04-21 20:59:22 |
| ma130Sum08e03.doc Path: Juniata >> MA >> 130 Fall, 2009 Description: MATHEMATICS 130 EXAM 03 May 30, 2008 Name: _ This exam has 6 pages, including this cover page. Please make sure you have all 6 pages. Note that the last page is blank, and may be used for scratch paper. You have 60 minutes to complete this exam. Ca... Date Added: 2009-04-21 21:03:13 |
| Rubric12.txt Path: BYU >> CS >> 330 Fall, 2009 Description: % Grading rubric: % 1. 1 pt. per cell-contents (10 pts. total). % 4 pts. for explaining C2 := C1 % 2. 6 pts. for putting the cells in correctly. % 8 pts. for an explanation on writing test programs using the cells. % 3. 4 pts. for writing an e... Date Added: 2009-04-21 21:03:40 |
| J0EAID_ISOE.TXT Path: UCLA >> CACHE >> 0001 Fall, 2009 Description: Sheet1 * SEQUENCE OF EVENTS: YEAR-DAY OF YEAR -> 1995-337 GENERATED ON DAY OF YEAR = * PROJECT * COMMAND TABLE = PHASE #1 * GALILEO * FINAL APPROVED SOE FOR J0EAID (MERGED WITH JOI) 1995-337/12:21:51 TO 1995-341/13:32:07 * ID:J0EAID & RJ426S:VER-FAS... Date Added: 2009-04-21 21:04:44 |
| hilaga.pdf Path: Stanford >> CS >> 468 Fall, 2009 Description: Topology Matching for Fully Automatic Similarity Estimation of 3D Shapes Masaki Hilaga Yoshihisa Shinagawa Taku Kohmura Tosiyasu L. Kunii The University of Tokyo The Institute of Physical and Chemical Research Hosei University Kanazawa In... Date Added: 2009-04-21 21:06:40 |
| lecture16.PPT Path: Cornell >> CS >> 100 Fall, 2008 Description: CS100ALecture16 PreviousLecture Programmingconcepts s s s s Binarysearch Applicationoftherulesofthumb Asymptoticcomplexity ConditionalExpressions JavaConstructs s s ThisLecture Programmingconcepts s Twodimensionalarrays Constructorsfortwodim... Date Added: 2009-04-21 21:06:46 |
| l17.pdf Path: Rutgers >> CS >> 520 Fall, 2009 Description: CS 520: Introduction to CS 520: Introduction to Artificial Intelligence Artificial Intelligence Prof. Louis Steinberg Lecture 17: Bayes Nets CS520: Steinberg Lecture 17 1 Acting under uncertainty Acting under uncertainty Probability: methods... Date Added: 2009-04-21 21:10:15 |
| SDArticle4.pdf Path: IUPUI >> N >> 361 Fall, 2009 Description: Creating the Project Plan This article describes how to create a complete project plan using your insight into project cost and schedule. This includes a work breakdown structure, a deliverable plan and estimating for maintenance. Author: William Roe... Date Added: 2009-04-21 21:11:26 |
| homework10solutions.pdf Path: Wisconsin >> ENGR >> 649 Fall, 2009 Description: Homework #10 Advanced Concrete Materials CEE 649 Lecture 2 1) Chapter 5, Problem 17, page 177. With respect to the corrosion of steel in concrete, explain the significance of the following terms: carbonation of concrete, passivity of steel, Cl-/OH-... Date Added: 2009-04-21 21:12:02 |
| lect_36_section_3.pdf Path: Wisconsin >> ME >> 361 Fall, 2008 Description: ... Date Added: 2009-04-21 21:12:09 |
| control_handouts.pdf Path: Wisconsin >> ME >> 739 Fall, 2009 Description: Jointed system components One link Arm Assume mass is ALL at the distal link Block Diagram of One-Link System Block Diagram of Multi-Link Robot System Dynamics Physical Physical vectors 1 Dynamics of 2-link slender rod Dynamics of 2-link ... Date Added: 2009-04-21 21:12:56 |
| homework208sol.pdf Path: Wisconsin >> ENGR >> 615 Fall, 2009 Description: Name _ Homework 2 BME 615 Due: Sept. 23, 2008 There are 10 kinds of people, those who know binary and those who do not. 1. Consider a deformation that is given by x1 = 3 1 3 4 X 1 + X 2 , x2 = X 2 and x3 = X 3 . 2 2 2 9 Here, Xi (i=1~3) represent ... Date Added: 2009-04-21 21:13:30 |
| ee421_10.pdf Path: Kentucky >> EE >> 421 Fall, 2009 Description: 10.1 Equally Likely Outcomes Approach Probability is the result of mapping an event into a number that in some sense indicates how likely or often the event will occur. One way to do that is to use the notion of equally likely outcomes. Define the sa... Date Added: 2009-04-21 21:15:15 |
| SampleFinals.pdf Path: Georgia Tech >> MATH >> 4305 Fall, 2008 Description: Math 4305 Summer 2003 Andrew/Yu Here are two sample final exams. Final Exam Fall 2000 1. (25) Find all values of the parameter a for which the following system of equations has a solution. x + 3y + 3z = 1 x + y + 6z = a x + y 9z = a 2. (25) A ma... Date Added: 2009-04-21 21:16:18 |
| qu-03aq.pdf Path: Wisconsin >> CHEM >> 345 Fall, 2008 Description: Name Chem 345 Quiz 3A September 26, 2008 6 1. Give the major product(s) of the following reactions. Br a) NaOMe O b) O Br c) Br H N O SO3H e) F HNO3 H2SO4 Cl2 FeCl3 Cl AlCl3 d) H2SO4 H 2O f) H2SO4 3 2. Write the complete mechanism for the... Date Added: 2009-04-21 21:17:29 |
| Answers_Ex2_S07.pdf Path: Kentucky >> MA >> 123 Fall, 2008 Description: MA 123 Elementary Calculus SECOND MIDTERM SPRING 2007 03/07/2007 Name: Sec.: Do not remove this answer page you will return the whole exam. You will be allowed two hours to complete this test. No books or notes may be used. You may use a graphi... Date Added: 2009-04-21 21:17:48 |
| HW15.pdf Path: Kentucky >> EE >> 613 Fall, 2008 Description: EE613 0. 1. Keep working on your project! Consider the following continuous Kalman Filter problem: HW #15 & x = w(t) z(t) = x(t) + v(t) with w(t) and v(t) being zero-mean continuous normal processes with spectral densities of Rc=Qc=2. a) b) c) Solv... Date Added: 2009-04-21 21:17:54 |
| x_sovietconduct.pdf Path: Wisconsin >> HIST >> 102 Fall, 2009 Description: 1 \"The Sources of Soviet Conduct\" (1947)1 Mr. X [George Kennan] The political personality of Soviet power as we know it today is the product of ideology and circumstances: ideology inherited by the present Soviet leaders from the movement in which t... Date Added: 2009-04-21 21:18:53 |
| secStorage.pdf Path: Mich Tech >> CS >> 5411 Fall, 2009 Description: Secondary Storage Secondary Storage Disk Performance Disk Scheduling RAID 1 Disk Performance Wait for device available Wait for channel available Seek to desired track (seek time) Wait for desired sector to rotate under head (rotational delay) Tra... Date Added: 2009-04-21 21:25:27 |
| useCase.pdf Path: Mich Tech >> CS >> 3141 Fall, 2008 Description: Host Game Auction Start Game Join Game Unowned Property Buy End Turn Roll Dice Player\'s Turn Buy Houses Sell Houses UnMortgage Property Propose Trade Mortgage Property Insucient Cash Declare Bankruptcy Diagram: Monopoly Use Case Page 1 ... Date Added: 2009-04-21 21:25:48 |
| sp05ex1sln.pdf Path: Georgia Tech >> ECE >> 4000 Fall, 2008 Description: ECE 4000 - Project Engineering and Professional Practice February 16, 2005 Problem 1. (26 points) EXAM #1 Solution Page 1 of 4 For each motor, the present value of the operating cost = Purchase Price (not considered here) + Present value of (Mainte... Date Added: 2009-04-21 21:27:40 |
| shear_moment_examples.pdf Path: Wisconsin >> ENGR >> 340 Fall, 2009 Description: CEE 340 Beam with hinge shear and moment example CEE 340 Shear and Moment Frame Example 2 2 ... Date Added: 2009-04-21 21:27:50 |
| chen_keke_200608_phd.pdf Path: Georgia Tech >> ETD >> 06132006 Fall, 2009 Description: Geometric Methods for Mining Large and Possibly Private Datasets A Thesis Presented to The Academic Faculty by Keke Chen In Partial Fulllment of the Requirements for the Degree Doctor of Philosophy College of Computing Georgia Institute of Techno... Date Added: 2009-04-21 21:28:17 |
| Chapter-7.pdf Path: Wisconsin >> ECE >> 352 Fall, 2008 Description: University of Wisconsin - Madison ECE/Comp Sci 352 Digital Systems Fundamentals Kewal K. Saluja and Yu Hen Hu Spring 2002 Logic and Computer Design Fundamentals Chapter 7 Register Transfers & Datapaths Originals by: Charles R. Kime Modified for co... Date Added: 2009-04-21 21:28:30 |
| Exam1Solutions.pdf Path: Georgia Tech >> CS >> 2000 Fall, 2009 Description: EXAM 1 Solutions CS 4210 Advanced Operating Systems Fall 1999 Georgia Tech/Computer Science Hutto This exam is closed-book. There are 12 questions worth 80 points. You have 1 hour and 20 minutes. The number of points is a rough estimate of the amou... Date Added: 2009-04-21 21:28:48 |
| Exam1Solutions.pdf Path: Georgia Tech >> CS >> 4210 Fall, 2008 Description: EXAM 1 Solutions CS 4210 Advanced Operating Systems Fall 1999 Georgia Tech/Computer Science Hutto This exam is closed-book. There are 12 questions worth 80 points. You have 1 hour and 20 minutes. The number of points is a rough estimate of the amou... Date Added: 2009-04-21 21:28:48 |
| harrisengineeringethicsconceptsandcases.pdf Path: Wisconsin >> ENGR >> 155 Fall, 2009 Description: ... Date Added: 2009-04-21 21:29:36 |
| syllabus2008.pdf Path: UF >> PHY >> 3101 Fall, 2008 Description: 1 Syllabus for PHY 3101 Modern Physics Spring 2008 Instructor: Steven Detweiler Announcements: You are responsible for announcements made at the beginning of class. In particular, changes in the schedule or homework assignments along with descriptio... Date Added: 2009-04-21 21:31:39 |
| ku_hyunchul_200312_phd.pdf Path: Georgia Tech >> ETD >> 04052004 Fall, 2009 Description: ... Date Added: 2009-04-21 21:33:01 |
| kaluskar_vivek_p_200312_ms.pdf Path: Georgia Tech >> ETD >> 04082004 Fall, 2009 Description: ... Date Added: 2009-04-21 21:33:26 |
| modelcalib.pdf Path: UF >> ABE >> 6254 Fall, 2008 Description: Model Calibration and Testing Calibration Process of adjusting model parameters to achieve accurate simulation What information will be important when the model is applied? Calibration Select set of criteria for determining model accuracy provid... Date Added: 2009-04-21 21:33:58 |
| asgn2.pdf Path: UF >> STA >> 7249 Fall, 2008 Description: STA 7249: Generalized Linear Models Spring 2004: Assignment 2 More problems will be added to this assignment. These are given now so that you can get started on them. 1. (Exercise 5.10, McCulloch and Searle, 2001) Suppose that y1 , . . . , yn are in... Date Added: 2009-04-21 21:34:04 |
| RAQuiz.pdf Path: Michigan State University >> AST >> 101 Fall, 2008 Description: Quiz #3: Right Ascension and Declination Name: _ Examine the rectangular star map. It represents the entire celestial sphere as a rectangle. Distortions occur when a 3D sphere is drawn as a flat rectangle. The distortions are severe near the top an... Date Added: 2009-04-21 21:38:16 |
| PHY184-Lecture20n.pdf Path: Michigan State University >> PHY >> 184 Fall, 2008 Description: Permanent Magnets Examples of permanent magnets include refrigerator magnets and magnetic door latches Physics for Scientists & Engineers 2 Spring Semester 2005 Lecture 20 They are all made of compounds of iron, nickel, or cobalt If you touch an... Date Added: 2009-04-21 21:38:21 |
| w98final.pdf Path: Michigan >> MATH >> 115 Fall, 2008 Description: Math 115 Calculus Final April 24 1998 Department of Mathematics University of Michigan Name: Signature: Instructor: Section: General instructions: This test consists of 11 questions on 12 pages including this cover sheet and a blank nal page, totall... Date Added: 2009-04-21 21:40:24 |
| 305cp03.pdf Path: Michigan >> PHYS >> 305 Fall, 2009 Description: 305/Chap 03 Krane: Question #3-7 Key equations for the photoelectric effect: h . K max h . cutoff a) If the frequency of the incoming were to be doubled there would be more energy per photon and hence the ejected electrons would have more ki... Date Added: 2009-04-21 21:41:35 |
| heat.pdf Path: Michigan State University >> PHY >> 251 Summer, 2008 Description: Undergraduate Physics Labs, Dept. of Physics & Astronomy, Michigan State Univ. EXPERIMENT: HEAT EQUIVALENT OF MECHANICAL ENERGY PRIMARY OBJECTIVE: To observe the conversion of mechanical energy into heat, and to verify quantitatively that: Friction ... Date Added: 2009-04-21 21:41:41 |
| Exam2sol2007F.pdf Path: Michigan >> ME >> 335 Fall, 2008 Description: ME 335 (HEAT TRANSFER), FALL 2007, EXAM II, SOLUTION Department of Mechanical Engineering, University of Michigan PROBLEM 1 (35%) GIVEN: A disk of diameter D is electrically (Joule) heated at a rate of Se,J and its radiation is guided with a well in... Date Added: 2009-04-21 21:41:57 |
| photometricUnits_PMThandbook.pdf Path: Michigan >> NERS >> 481 Fall, 2008 Description: 4 CHAPTERl INTRODUCTION 1. 2 Photometric units Before starting to describe photomultiplier tubes and their characteristics,this section briefly discusses photometric units commonly usedto measurethe quantity of light. This section also explains ... Date Added: 2009-04-21 21:41:59 |
| hw1-sol.pdf Path: Texas A&M >> CS >> 420 Fall, 2009 Description: CPSC 420-500 Homework #1 Solution Yoonsuck Choe October 10, 2007 1 Uninformed Search B A (a) Tree 1 C E (c) Tree 3 D (b) Tree 2 Figure 1: Search Trees. Consider the three search trees in Figure 1. Suppose the branching factor is b and the tre... Date Added: 2009-04-21 21:42:34 |
| extra_credit_m102_e3.pdf Path: Texas A&M >> MATH >> 102 Fall, 2008 Description: Name Math 102 Extra-credit assignment Sec Spring 2008 Show all your work. Due Friday, April 25. 1. (2 points) Find the constant of proportionality k from the conditions: r if varies directly as s and inversely as t, and s = 3, t = 12, then ... Date Added: 2009-04-21 21:42:54 |
| w98test2.pdf Path: Michigan >> MATH >> 115 Fall, 2008 Description: Math 115 Calculus Exam II March 25 1998 Department of Mathematics University of Michigan Name: Signature: Instructor: Section: General instructions: This test consists of 11 questions on 12 pages including this cover sheet and a blank nal page, tota... Date Added: 2009-04-21 21:43:03 |
| Exam2PracticeMore.pdf Path: Texas A&M >> AGECON >> 605 Fall, 2009 Description: Spring 2008 Lard AGEC 605 Additional Practice Problems for Exam 2 Additional Practice Problems I. Property Tax Problem Complete the tax savings on a 200-acre dryland crop farm that qualifies for Agricultural Use Valuation. Assume this is the 2004 ... Date Added: 2009-04-21 21:43:10 |
| c5.pdf Path: Princeton >> WWS >> 509 Fall, 2009 Description: WWS 509 Stata Logs G. Rodrguez Log-linear Models for Contingency Tables in Stata In this section we illustrate the use of Stata\'s poisson command to fit log-linear models to contingency tables. 5.1 Models for Two-dimensional Tables We start with a... Date Added: 2009-04-21 21:44:19 |
| CaseClass15.pdf Path: Princeton >> IIE >> 337 Fall, 2009 Description: November 7, 2006 Democrats Seize Control of House; Senate Hangs on Virginia and Montana By ADAM NAGOURNEY Democrats seized control of the House of Representatives and defeated at least four Republican senators yesterday, riding a wave of voter disco... Date Added: 2009-04-21 21:44:26 |
| montonwfo.pdf Path: Princeton >> PHI >> 538 Fall, 2009 Description: WAVE FUNCTION ONTOLOGY by Bradley Monton Department of Philosophy, University of Kentucky, Lexington KY 40506 USA bmonton@uky.edu phone: 1-859-225-8430 fax: 1-859-257-3286 April 19, 2001 1 WAVE FUNCTION ONTOLOGY Abstract I argue that the wave fu... Date Added: 2009-04-21 21:45:24 |
| 19440406_0000035413.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: . . . Telegram No Dated: A p r i l 6 , 1944. SECSTATE WASIIIBGTOB . .: * IYATPCII . . Jackpot 1 4 0 and Carib. . I pollowing- summarizes statement from Rreakers : S i t u a t i o n i n Germany r a p i d l y approaching climax w i t h end o f ... Date Added: 2009-04-21 21:46:58 |
| tangible_wk15tu_summary.pdf Path: Berkeley >> I >> 290 Fall, 2009 Description: Tuesday Week 15: Summary Theory and Practice of Tangible User Interfaces week 15 Summary TUI and Interaction Design Research 1 Tuesday Week 15: Summary Theory and Practice of Tangible User Interfaces Lecture Outline TUI and Design Research S... Date Added: 2009-04-21 21:48:12 |
| slide21.pdf Path: Berkeley >> CS >> 164 Fall, 2008 Description: Lecture #21: More on Types Administrivia. Exam at 6PM tonight in 105 North Gate. Format: 2 hours, open book/notes. No computers, calculators, cell phones, or other communication devices. Last modified: Wed Mar 16 01:53:43 2005 CS164: Lecture #21 1... Date Added: 2009-04-21 21:49:09 |
| JP-07-Midterm-Guidelines.pdf Path: Berkeley >> PS >> 143 Fall, 2009 Description: MIDTERM GUIDELINES The midterm will be in class Thursday, October 11. It will cover the readings through October 4. Please bring a blue book. Two of the following questions will appear on the midterm, and you will be asked to answer one (1) out of tw... Date Added: 2009-04-21 21:51:37 |
| 2008HW1_Solution.pdf Path: Berkeley >> EE >> 232 Fall, 2009 Description: EE 232 Lightwave Devices h_bar := 1.05459 10 m_e := 0.067 m0 1. (a) Lx := 10nm E_total ( m , n , kz) := 34 HW#1 Solutions q := 1.6 10 eV := q V 19 Prof. Ming C. Wu 31 J s C m0 := 9.11 10 meV := 10 3 kg eV Ly := 5nm h_bar m 2 + 2 ... Date Added: 2009-04-21 21:52:00 |
| stollnitz98.pdf Path: Berkeley >> CS >> 294 Fall, 1924 Description: Reproducing Color Images Using Custom Inks Eric J. Stollnitz Victor Ostromoukhov David H. Salesin University of Washington Abstract We investigate the general problem of reproducing color images on an offset press using custom inks in any combination... Date Added: 2009-04-21 21:55:20 |
| lec1208b.pdf Path: University of Illinois, Urbana Champaign >> CS >> 225 Spring, 2008 Description: ... Date Added: 2009-04-21 21:56:59 |
| solution7a.pdf Path: University of Illinois, Urbana Champaign >> PHYS >> 598 Fall, 2008 Description: Topics in Quantum Optics and Quantum Information University of Illinois at Urbana-Champaign by Man Hong, Yung last updated 12 March 2007 The operation of the beam splitter is as follows: Problem Set #7a Question 1 + + a1+ ( a1\' + ia2\' ) / 2 + +... Date Added: 2009-04-21 21:57:18 |
| Lect01.pdf Path: University of Illinois, Urbana Champaign >> PHYS >> 212 Fall, 2008 Description: Welcome to Physics 212 http:/online.physics.uiuc.edu/courses/phys212 This lecture is VERY full. Please sit next to someone nice. (There wont be empty seats). 01 Physics 212 Lecture 1, Slide 1 Physics 212 Lecture 1 Today\'s Concepts: a) Coulombs La... Date Added: 2009-04-21 21:57:22 |
| BP401-notes-2008-10-01&03.pdf Path: University of Illinois, Urbana Champaign >> LIFE >> 401 Fall, 2009 Description: Lecture # 13-14 October 1st and 3rd (Wednesday; Friday) ENZYMES KINETICS: For the two-state transitions23 we discussed previously we were only concerned with the partition between the two macro-states when the system is at equilibrium. This partiti... Date Added: 2009-04-21 21:58:51 |
| 486Disc4Sol.pdf Path: University of Illinois, Urbana Champaign >> PHYS >> 486 Fall, 2008 Description: 486 Discussion Problems Week 4 1. Discussion problem 1 (a) To normalize, we note Spring 09 | = 1 2 A2 e2|x| dx = 1 2 0 2 2x (1) (2) (3) (4) A e dx = 1 1 2 A =1 2 A= 2 (b) x = xdx = xe2|x| dx (5) This is odd about x = 0 so x... Date Added: 2009-04-21 21:59:49 |
| slideshow0831.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 220 Fall, 2008 Description: Compositions of functions and transformations of graphs Solutions to the worksheet from August 30 If f (x) = x and g(x) = 2x + 3, then (f + g)(x) = x + (2x + 3) (f g)(x) = x (2x + 3) (f g)(x) = x(2x + 3) f x (x) = g 2x + 3 If f (x)... Date Added: 2009-04-21 21:59:58 |
| dld-dis-document.pdf Path: Wichita State >> CS >> 898 Fall, 2009 Description: Implementation of a Distributed Document-Based System David Leigh Dellinger Computer Science Department Wichita State University Wichita, KS Abstract The World Wide Web and commercial software products such as Lotus Notes have demonstrated the value ... Date Added: 2009-04-21 22:01:15 |
| exam1p_solution.pdf Path: Wichita State >> MATH >> 555 Fall, 2008 Description: MATH555 Spring 2009 Dierential Equations Practice Exam I 1. Find the value of y0 for which the solution of the initial value problem y y = 1 + 2 cos t, remains nite as t . Solution: y y = 1 + 2 cos t. p(t) = 1 (t) = e y(t) = p(t)dt y(0) = y0 = ... Date Added: 2009-04-21 22:01:36 |
| solution.pdf Path: Washington >> MATH >> 20080212 Fall, 2009 Description: Challenge Of the Week February 12February 18, 2008 Problem Given a (2m + 1) (2n + 1) checkerboard in which the four corners are black squares, show that if one removes any one red square and any two black squares, the remaining board is coverable w... Date Added: 2009-04-21 22:03:00 |
| hw2.pdf Path: Washington >> EE >> 528 Fall, 2009 Description: Homework #2 EE 528 due 10/8/08 1. (a) What is the total and marginal (change for last atom added) entropy of mixing for 20,000 atoms of element A substitutionally into 980,000 atoms of B (1,000,000 total sites)? (b) If the equilibrium concentration ... Date Added: 2009-04-21 22:04:38 |
| rat4-22.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 0557 Fall, 2009 Description: RATIONAL ISOMORPHISMS BETWEEN K-THEORIES AND COHOMOLOGY THEORIES Eric M. Friedlander and Mark E. Walker Abstract. The well known isomorphism relating the rational algebraic K-theory groups and the rational motivic cohomology groups of a smooth varie... Date Added: 2009-04-21 22:08:09 |
| hw02.pdf Path: University of Illinois, Urbana Champaign >> CS >> 554 Spring, 2008 Description: CSE 512/CS 554 Homework Assignment 2 Due February 26, 2008 1. Construction of the Empire State Building required about two person-millennia of eort, yet the project was completed in only about one year. How was this possible? What must the average wo... Date Added: 2009-04-21 22:09:14 |
| suggested_problems_Nov_5.pdf Path: University of Illinois, Urbana Champaign >> CHEM >> 104 Fall, 2008 Description: Chemistry 104 A/C Suggested Problems #11 November 5, 2007 These questions have been developed to give you practice with the concepts of organic chemistry that we are dealing with in class. I have tried to write these questions to give you practice... Date Added: 2009-04-21 22:09:32 |
| dnaforensics.pdf Path: Washington >> GS >> 37206 Fall, 2009 Description: ... Date Added: 2009-04-21 22:09:48 |
| PS5_test.pdf Path: Washington >> EC >> 200 Fall, 2009 Description: UNIVERSITY OF WASHINGTON Department of Economics Economics 200G Problem Set 5 1. Figure 1 plots the output (per week) of Firm A for various amounts of labor and a given amount of capital that is fixed in the short run. Firm A pays each worker the mar... Date Added: 2009-04-21 22:10:52 |
| hw4.pdf Path: Washington >> MATH >> 555 Fall, 2008 Description: lp p ! X h xwu h g c uq h d i XX@gXX pr w vp ! iFiX tt oiXiiXi h i@tx8XeXu w v r xh u r r h dB h iu h grspiwzX gc oBr3XX1 h h B p}h i h e b h u u w h l qXw}XswsgXX ... Date Added: 2009-04-21 22:11:43 |
| Quick_gCOSY_ui500nb_3Mar08.pdf Path: University of Illinois, Urbana Champaign >> UI >> 500 Fall, 2009 Description: SettinguptheGCOSYExperimentonUI500NB Thefollowingsetupassumesyouhavetunedtheprobeanddeterminedthe90pulsewidth (pw90).Ifyouhavenot,dothemnowbeforecontinuing. Makesureyouoptimizethe1H1Dspectrumparametersbyusingswbyusingthetwocursors andthemoveswcomma... Date Added: 2009-04-21 22:14:41 |
| 9a.pdf Path: University of Illinois, Urbana Champaign >> CS >> 533 Spring, 2008 Description: Enhancing Software Reliability with Speculative Threads Jeffrey Oplinger and Monica S. Lam Computer Systems Laboratory Stanford University jeffop, lam @stanford.edu This paper advocates the use of a monitor-and-recover programming paradigm to enh... Date Added: 2009-04-21 22:14:47 |
| Unit2_1.pdf Path: Washington >> CHIN >> 461 Fall, 2008 Description: ... Date Added: 2009-04-21 22:15:08 |
| 02jensendissertation.pdf Path: Fayetteville State University >> ETD >> 07092004 Fall, 2009 Description: CHAPTER 1 Ongoing calls for educational reform focus on the premise that schools are not satisfactorily educating all children, and teacher preparation programs have received criticism for inadequately preparing teachers to help all children achieve... Date Added: 2009-04-21 22:15:43 |
| NewYorker_Numbers_Guy.pdf Path: Washington >> PSY >> 333 Fall, 2009 Description: ... Date Added: 2009-04-21 22:17:31 |
| lab4.pdf Path: Washington >> MENGR >> 374 Spring, 2009 Description: ME 374 Laboratory Experiment #4 Response of a 2nd Order System to Periodic Inputs The purpose of this lab is to measure the response of the following electrical circuit and qualitatively predict the response. Laboratory Procedure 1) Set up the functi... Date Added: 2009-04-21 22:17:45 |
| solhw6_03.pdf Path: Washington >> PHYS >> 324 Fall, 2008 Description: 1 Physics 324 Solution to Problem Set # 6 P1 (x) = 1. The Parity operator in one dimension, P1 , reverses the sign of the position coordinate, x: (x). Note that P2 (x) = P1 P1 (x) = ( x) = (x) 1 (a) Find the eigenvalues of the Parity operator, P... Date Added: 2009-04-21 22:17:52 |
| DSChapter9.pdf Path: UCSC >> CMPS >> 013 Fall, 2009 Description: How to Compare Different Problems and Solutions Two different problems Which is harder/more complex? Algorithm Efficiency and Sorting Two different solutions to the same problem Which is better? Questions: How can we compare different problems an... Date Added: 2009-04-21 22:18:22 |
| jeremiahk.pdf Path: Fayetteville State University >> ETD >> 08232005 Fall, 2009 Description: THE FLORIDA STATE UNIVERSITY COLLEGE OF EDUCATION JUNIOR SECONDARY SCHOOL STUDENTS RECOGNITION OF KAGISANO/SOCIAL HARMONY, THE NATIONAL PHILOSOPHY OF BOTSWANA By KOKETSO JEREMIAH A Dissertation submitted to the Department of Middle and Secondary Ed... Date Added: 2009-04-21 22:18:59 |
| intro_ams27.pdf Path: UCSC >> AMS >> 027 Fall, 2009 Description: AMS 27: Mathematical Methods for Engineers. Instructor: Bruno Mendes mendes@ams.ucsc.edu, Oce 141 Baskin Engineering TA-AMS27: Christopher Simon csimon@soe.ucsc.edu, Oce 160 TA-AMS27L: Sumanth Kolar kis@soe.ucsc.edu June 6, 2007 Required Text Edward... Date Added: 2009-04-21 22:19:05 |
| BT6IncrementalROR.pdf Path: SMU - Cox School of Business >> ENGR >> 2360 Fall, 2009 Description: ... Date Added: 2009-04-21 22:25:43 |
| Lect.3a--Oppnets-Spec_ad_hoc_for_emerg_resp.pdf Path: Western Michigan >> CS >> 6030 Fall, 2008 Description: CS 6910 Pervasive Computing Section 0.B: Opportunistic Networks: Specialized Ad Hoc Networks for Emergency Response Applications Dr. Leszek Lilien WiSe Lab (Wireless Sensornet Laboratory) http:/www.cs.wmich.edu/wsn Department of Computer Science We... Date Added: 2009-04-21 22:27:56 |
| oldexam1.pdf Path: Western Michigan >> STAT >> 662 Fall, 2009 Description: Stat 662 Exam 1 October 25, 2006 Name: 1. Check the bullet for the correct answer. If you change your mind, encircle the new answer. (All questions (a)-(f) refer to least squares simple linear regression.) (a) If I multiply each X-observation by 5... Date Added: 2009-04-21 22:28:20 |
| 271s1.pdf Path: ASU >> MATH >> 271 Fall, 2009 Description: Solutions to MAT 271 Test #1 (1) (15 points) Evaluate the integral t2 sin(2t) dt. Solution: Use integration by parts twice: cos(2t) 2 2t cos(2t) dt 2 t cos(2t) dt sin(2t) dt 2 u=t u =1 v = cos(2t) u = t2 u = 2t v = sin(2t) t2 sin(2t) dt = ... Date Added: 2009-04-21 22:29:49 |
| SESE_TSO_Intro.pdf Path: ASU >> ARROWSMITH >> 410 Fall, 2009 Description: Computing Resources Arizona State University School of Earth and Space Exploration Marvin Simkin Manager of Information Technology Computing Resources What is available? How can I make the most of these resources? How can I avoid losing my work? H... Date Added: 2009-04-21 22:30:04 |
| double-stars.pdf Path: CSU LA >> A >> 360 Fall, 2009 Description: $ ` S D A Sc H` E R9Q37h)QPa0b f \"3`38 b38 E H E k A \"c ` S D A Sc Hf bD `f \"3`38 b38 S3 E H E k E H q Hf H A D 0ga9@9@RYPhs)2gY3)QPeh)we09@9ah9aYAgRQPsaY`h7Y\"a@Q`%af E H E k 38 A3P D8 b S c Hf Hfcf` c 3 H 53 A D \" cP `38 q 338 Ef 3`3 Ef... Date Added: 2009-04-21 22:31:01 |
| test3.pdf Path: CSU Northridge >> M >> 24771 Fall, 2009 Description: TEST#3\" \" Q, decimals, rates M ATH 2 1 0 F8 \" ANSWERS TO THE EASIEST TEST EVER (5 ) 1. Order the follow ing rational numbers ( least to greatest ) : 2 ) 3 < . 67 .6 67 0.6 = .6767676 @ @ @ 67 .6& = .6777777... Date Added: 2009-04-21 22:31:36 |
| X80_ProductSheet.pdf Path: Cal Poly >> CPE >> 482 Fall, 2009 Description: X80 An Industrial Grade Robot for Research and Development Applications educational research residential consumer Product Information March 2005 This ready to use mobile robot platform is designed for researchers developing advanced robot applica... Date Added: 2009-04-21 22:32:32 |
| BrunnerYou_project.pdf Path: Midwestern State University >> FILESMATH >> 574 Fall, 2009 Description: Temporal and Structural Analysis of Biological Networks Michael Brunner (m.brunna@gmx.net) Chang hun You (changhun@wsu.edu) Abstract Our project introduces a graph-based relational learning approach using graph-rewriting rules for temporal and struct... Date Added: 2009-04-21 22:32:50 |
| CPE580_Lecture_02.pdf Path: Cal Poly >> CPE >> 580 Fall, 2009 Description: CPE 580 Fall 2008 Lecture 2 Bayes Filter This lab will not be graded, but completion of Step 4 should be demonstrated to the instructor. 1 - Statistical Tools Mean -Average value -Is the expected value of some random variable - = E*X+ - = x p(x) d... Date Added: 2009-04-21 22:33:03 |
| ps3.pdf Path: Washington University in St. Louis >> CSE >> 577 Fall, 2009 Description: CSE 577 Design and Analysis of Switching Systems Problem Set 3 Jonathan Turner 1. Consider the design of a 32 port switch, based on a sub-divided bus with knockout concentrators at the output. Assume that the links operate at 1 Gb/s and that the ... Date Added: 2009-04-21 22:33:22 |
| hw9sol.pdf Path: Washington University in St. Louis >> CS >> 514 Fall, 2009 Description: CS514 Fundamentals of Computer Science, Fall 2000 Solutions Homework Assignment 9 Problem 1 (40 points total) Consider the following adjacency list representation of a directed graph: A: B: C: D: E: F: B C A A C C D F E F B E F D (a) (10 points) D... Date Added: 2009-04-21 22:33:25 |
| CSE131Quiz4.pdf Path: Washington University in St. Louis >> CS >> 131 Fall, 2009 Description: Name_ CSE131 Quiz 4 Objects and References September 28, 2007 Consider the following Java code: public class Account { private int balance; public Account(int openingBalance) { balance = openingBalance; } public int getBalance() { return balance; } p... Date Added: 2009-04-21 22:33:26 |
| C++_Programming_Intro.pdf Path: Washington University in St. Louis >> CSE >> 332 Fall, 2009 Description: CS 342: Intro to C+ Programming A Simple C+ Program #include <iostream> using namespace std; int main() { cout < hello, world! < endl; return 0; } Copyright 2004 Dept. of Computer Science and Engineering, Washington University CS 342: Intro to C+... Date Added: 2009-04-21 22:33:31 |
| hwk2.pdf Path: Washington University in St. Louis >> CSE >> 547 Fall, 2008 Description: CSE 547 Formal Languages and Automata Spring 2009 Homework 2: More on Finite Automata and Regularity Assigned: February 9, 2009 Due Date: February 25, 2009 I expect you to prove the correctness of your constructions. Remember, your colleagues must... Date Added: 2009-04-21 22:33:33 |
| lec10.pdf Path: Penn State >> STAT >> 511 Fall, 2008 Description: Stat 511, Lecture 10 1 \' $ Simple Linear Regression, Part I Simple linear regression is a model with one predictor. Many textbooks devote a great deal of space to this modelnot because it is often used in practice (it isnt), but because a thoroug... Date Added: 2009-04-21 22:35:24 |
| IST_302.pdf Path: Penn State >> RAM >> 347 Fall, 2009 Description: Penn State University McKeesport, PA IST 302 I.T. Project Management Project Team Shawn Phythyon Zach Godula Doug Shipe Rich Mock Dave Stovich IST 302 Penn State University McKeesport, PA Short Film Competition Project (Course Project Type 2; Run... Date Added: 2009-04-21 22:35:50 |
| p211c12.pdf Path: Penn State >> P >> 210 Fall, 2009 Description: Gravitation Newtons Law of Universal Gravitation: Every particle attracts every other particle Force is proportional to each mass Force is inversely proportional to the square of the separation m Gm1m2 Fg ;on1due to 2 = r12 F 2 r r12 m 2 1 r Gm1m2... Date Added: 2009-04-21 22:36:04 |
| SmithResume.pdf Path: Penn State >> ZRS >> 5000 Fall, 2009 Description: Zachary R. Smith Permanent Address: 433 Erb Road Perkiomenville, PA 18074 (610) 999-5605 smith.zacharyr@gmail.com Current Address: 674F E. Prospect Ave. State College, PA 16801 EDUCATION: Pennsylvania State University, University Park, PA Bachelor... Date Added: 2009-04-21 22:36:08 |
| exam2prep.pdf Path: Penn State >> STAT >> 511 Fall, 2008 Description: Stat 511 - Fall 2007 Some Practice Problems for Exam 2 1. You need to predict a response variable Y from an ordinal predictor X taking values 1, 2, . . . , k (assume k 2). Student A treats X as a numeric variable and ts Model A: Y = 0 + 1 X + error.... Date Added: 2009-04-21 22:36:18 |
| IMD4-MIPS-MOPS-and-Other-FLOPS.pdf Path: NMSU >> COD >> 473 Fall, 2009 Description: IMD 4.8-8 In More Depth In More Depth: MIPS, MOPS, and Other FLOPS One particularly misleading definition of MIPS that has been occasionally popular is peak MIPS. Peak MIPS is obtained by choosing an instruction mix that minimizes the CPI, even if ... Date Added: 2009-04-21 22:44:43 |
| latexsheet.pdf Path: Michigan >> STAT >> 810 Fall, 2009 Description: A LTEX 2 Cheat Sheet Lists \\begin{enumerate} Numbered list. \\begin{itemize} Bulleted list. \\begin{description}Description list. \\item text Add an item. \\item[x ] text Use x instead of normal bullet or number. Required for descriptions. Justificatio... Date Added: 2009-04-21 22:44:46 |
| Radio_1_Amplifiers.pdf Path: N. Arizona >> EE >> 490 Fall, 2008 Description: Amplifiers muse Amplifiers Overview PerformanceParameters:LowNoise&HighPower DesignandTechnologyIssues DesignApproach LowNoiseAmplifiers Conclusions ImpactonSystemDesign Overview Band select Filter Image Reject Filter Channel select Filter IF... Date Added: 2009-04-21 22:47:12 |
| Student_UAS_Instructions.pdf Path: UH Clear Lake >> EDUC >> 6032 Fall, 2008 Description: Unit Assessment System (UAS) Instructions for Students Where to find UAS You can access UAS from the School of Education website, using the URLs below. School of Education http:/soe.uhcl.edu/uas How to login 1. From the School of Education web si... Date Added: 2009-04-21 22:48:02 |
| shell.txt Path: Stanford >> CME >> 212 Fall, 2009 Description: wc * wc * | awk \'{ print $2 }\' ls grep HTML * grep ^\\< * grep ^\\< * | more grep \\>$ * | more more /usr/dict/words wc /usr/dict/words grep ^my /usr/dict/words grep my$ /usr/dict/words grep ^my.$ /usr/dict/words wc * vi awkf wc * | awk -f awkf wc * cat... Date Added: 2009-04-22 03:18:56 |
| title7.txt Path: RIT >> BJB >> 3973 Fall, 2009 Description: thumbTitle=the World is on loan. ... Date Added: 2009-04-22 03:20:41 |
| resume.pdf Path: Penn State >> GRF >> 5028 Fall, 2009 Description: Gregory Fuller grf5028@psu.edu EDUCATION Penn State University Smeal College of Business o University Park, Pa Owen J. Roberts High School Class of 2008 o Pottstown, Pa EMPLOYMENT Sheetz Morgantown, Pa June 2007 present Sales Associate Put... Date Added: 2009-04-22 03:24:42 |
| MergedStyBd.pdf Path: NYU >> AMS >> 827 Fall, 2009 Description: Anisah Syed Producer Salaam Project Scene 1 Oct. 9, 2008 Date 1 Page CADA Center For Advanced Digital Applications Scn: 1 Shot: 1 Description: Two school-aged children, approximately ten years old each, play in front of lone small house standi... Date Added: 2009-04-22 03:27:19 |
| estuary.doc Path: S.F. State >> GEOL >> 103 Fall, 2009 Description: GEOL/METR 103 Exercise 8 ESTUARIES AND SAN FRANCISCO BAY Objective: The objective of this lab is to begin to look at the characteristics of coasts and of San Francisco Bay, in preparation for our upcoming field trip to the China Camp wetlands and our... Date Added: 2009-04-22 03:41:12 |
| Ch5_calc.doc Path: S.F. State >> CHEM >> 353 Fall, 2009 Description: 35 Chapter 5: Basic Calculus Derivatives Derivatives can be evaluated in Mathematica using many different commands. The D command requires three arguments inside the square brackets: the function, the variable and the number of derivatives. The last... Date Added: 2009-04-22 03:41:55 |
| SPSSdata.pdf Path: Penn State >> IS >> 124 Fall, 2009 Description: SPSS Data Standardization Missing Values 9,99,9999999, etc will be labeled \"missing\" and defined as missing variables. \"detailed responses\" in numerical variables will be labeled as such and defined as missing. When applicable \"0\" will be labeled ... Date Added: 2009-04-22 03:50:17 |
| Lab8.doc Path: Syracuse >> ECS >> 102 Fall, 2008 Description: ECS 102 Lab 8 Spring 2009 Name _ Sec 1(3:45) 2(12:45) Anywhere that I ask you to observe what happens, write down your observations in the space provided. I. Here is a program that will introduce you to the if and the if . else statements. Run it wit... Date Added: 2009-04-22 03:51:51 |
| FinalProjSu07v2.doc Path: Syracuse >> CSE >> 691 Spring, 2008 Description: CSE691ComparativeWebPlatforms Summer2007 due26July,2007 ProjectDescriptionWikiSystem Version2.0 Purpose: ThisprojectrequiresyoutodevelopaWikilikewebsitethatcanbeusedby,possibly,many people,tocollaborateontextandnotes,usingawebinterface.Youandyour... Date Added: 2009-04-22 03:54:56 |
| ArgUnitOverview2008.doc Path: Syracuse >> WRT >> 670 Fall, 2009 Description: For new TAs. Introduction to the Argument Unit in WRT 105 Critical Encounters (4th ed) and Writing Analytically (5th ed) and The brief Thomson Handbook (1st ed) Fall 2008 The relationship between analysis and argument is recursive. However much we t... Date Added: 2009-04-22 04:00:34 |
| Lect2Notes.pdf Path: Syracuse >> PHY >> 307 Fall, 2008 Description: NOTES AND QUOTES PHY307 Sept. 3, 2002 - LECTURE #2 (3rd meeting) OUTLINE: 1. Computers what are they? a. Analog vs. Digital b. Babbage & Lovelace c. Universal Computers d. Universe as a computer 2. Pieces of Python a. Types of objects b. Expressions... Date Added: 2009-04-22 04:01:05 |
| FormMain.txt Path: Syracuse >> IST >> 256 Fall, 2008 Description: Public Class Form1 Private Sub Button1_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles Button1.Click Me.Hide() FormDescription.Show() End Sub \' Get the number of color that the user ordered and ... Date Added: 2009-04-22 04:02:48 |
| hw6-3.pdf Path: Syracuse >> MFE >> 654 Fall, 2008 Description: ... Date Added: 2009-04-22 04:05:42 |
| 30crane06.pdf Path: Utah State >> PUBH >> 3310 Fall, 2008 Description: Objectives Crane and Hoist Safety PUBH 3310 November 13, 2006 Know hazards associated with cranes Become familiar with common types of industrial and construction cranes Understand rigging basics, including the importance of \"sling angle\" Be fa... Date Added: 2009-04-22 04:06:06 |
| 8-Confidentiality-6.pdf Path: Utah State >> PSY >> 6460 Fall, 2008 Description: What is the difference between privacy, privilege and confidentiality? What is the difference between privacy, privilege and confidentiality? Why the need for confidentiality? What is the SCOPE of confidentiality? Issue 1: Maintain confidentiality Is... Date Added: 2009-04-22 04:07:59 |
| Assignment7.pdf Path: Utah State >> CS >> 5400 Fall, 2008 Description: Assignment #7 Computer Graphics Due: Monday, October 13, 2008 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. What are the typical terms for rotation of an airplane and what axis do they rotate about? What happens to the color specif... Date Added: 2009-04-22 04:08:06 |
| voecks.pdf Path: Syracuse >> YEARBOOK >> 1988 Fall, 2009 Description: Fire Management of the Piassava Fiber Palm (Attalea funifera) in Eastern Brazil Robert A. Voecks Department of Geography California State University, Fullerton Fullerton, CA 92634 Sergio G. da Vinha Herbarium, Cacao Research Center Itabuna-Bahia, Bra... Date Added: 2009-04-22 04:08:08 |
| ECE7750-Project2.doc Path: Utah State >> ECE >> 7750 Spring, 2008 Description: ECE 7750 DISTRIBUTED CONTROL SYSTEMS SPRING 2005 PROJECT-2 Design and Implementation of a wireless sensor network application for noise detection and recording Objective: To design and Implementation of a wireless sensor network application for noise... Date Added: 2009-04-22 04:09:21 |
| ECE7360_project2.doc Path: Utah State >> ECE >> 7360 Fall, 2008 Description: ECE/MAE7360. Robust and Optimal Control. Electrical and Computer Engineering, Utah State University Project #2: Space-shuttle robustness analysis (stability and performance) Submit your report via e-mail only. 1. Project Objectives: Become expert in ... Date Added: 2009-04-22 04:09:34 |
| WorkplanSBroadbent.doc Path: Utah State >> INST >> 5270 Spring, 2008 Description: Sam Broadbent INST 5270 Work Plan INTRODUCTION: I was just hired at the Firehouse as a salad maker, host, and a bus boy. The hardest part of being hired there was learning where everything is at in the restaurant. The intent of my project is to simp... Date Added: 2009-04-22 04:09:55 |
| jdb_1554answers.pdf Path: UNC Charlotte >> COE >> 1202 Fall, 2009 Description: ENGR 1202 Introduction to Civil Engineering Spring 2008 Test 2 Format and Instructions Test 2 April 25, 2008 5 problems on 4 pages, 100 points total, open book and notes, show all calculations for partial credit, start at 9:30 AM, end at 10:20... Date Added: 2009-04-22 04:10:43 |
| index_notes.txt Path: Grand Valley State >> CIS >> 361 Fall, 2009 Description: - | type commands at prompt | - $ | ls | - |pwd| : | print working directory | - e.g. | /home/mcguire | - \" | / | \" separates directory-names -- \"| @account@|\" means | home-directory | of |@account@| - e.g. | mcguire... Date Added: 2009-04-22 04:12:16 |
| l17-18.ppt Path: Grand Valley State >> CIS >> 160 Fall, 2009 Description: CMPSC 160 Translation of Programming Languages Fall 2002 Lecture-Modules 17 and 18 slides derived from Tevfik Bultan, Keith Cooper, and Linda Torczon Department of Computer Science University of California, Santa Barbara 1 Structure of a Compiler S... Date Added: 2009-04-22 04:12:17 |
| finalproject.pdf Path: UNC Charlotte >> ECON >> 6219 Fall, 2008 Description: Final Project ECON 6219: Financial Econometrics Stanislav Radchenko Fall 2003 1. Download the data for U.S. Term Structure for the period 1947 - 1991 collected by J. Hustin McCulloch and Heon-Chul Kwon. The data can be downloaded from either of the f... Date Added: 2009-04-22 04:13:10 |
| SatelliteManagement.ppt Path: Oklahoma State >> SOIL >> 4213 Fall, 2008 Description: Using Landsat TM Imagery to Predict Wheat Yield and to Define Management Zones Landsat TM Imagery How can we use Landsat TM imagery to predict wheat yield? How accurately can imagery collected in near flowering (April 1 to May 15) predict wheat yi... Date Added: 2009-04-22 04:14:17 |
| cpu3_test.txt Path: Oklahoma State >> ECEN >> 4243 Fall, 2008 Description: `timescale 1ns/10ps module cpu3_testbench(); reg [31:0] ibustm[0:30], ibus; wire [31:0] abus; wire [31:0] bbus; wire [31:0] dbus; reg clk; reg [31:0] dontcare, abusin[0:30], bbusin[0:30], dbusout[0:30]; integer error, k, ntests; parameter ADDI = ... Date Added: 2009-04-22 04:17:26 |
| Chap2-HW.pdf Path: Oklahoma State >> ENSC >> 3233 Fall, 2008 Description: ENSC 3233 Fluid Mechanics Homework Chapter 2 Due: 1/28/2009 1. The weight of a hot air balloon envelope (empty), basket and passenger is 400 lb. If the air temperature is 80oF and the burner can heat the gas inside the envelope to 200oF, what envelop... Date Added: 2009-04-22 04:18:57 |
| games.ppt Path: Oklahoma State >> CS >> 4793 Fall, 2008 Description: Notes adapted from lecture notes for CMSC 421 by B.J. Dorr game playing Outline What are games? Optimal decisions in games Which strategy leads to success? - pruning Games of imperfect information Games that include an element of chance 2 ... Date Added: 2009-04-22 04:19:01 |
| Homework-2.doc Path: Oklahoma State >> CS >> 3570 Fall, 2008 Description: 6.3 What is the meaning of the term busy waiting? What other kinds of waiting are there in an operating system? Can busy waiting be avoided altogether? Explain your answer. 6.5 Explain why implementing synchronization primitives by disabling ... Date Added: 2009-04-22 04:19:02 |
| prob407.pdf Path: Minnesota >> SOIL >> 4601 Fall, 2009 Description: chemical Antimony* Site Concen (mg/kg ) dry Site HQ SRV weight (1) Cancer risk 12 25 0.417 Barium 1200 1000 0.833 Beryllium 55 50 0.182 9.09E-09 Cadmium 25 25 0.200 5.00E-09 Copper 11 10 0.909 Lead* 300 500 1.667 Nickel 560 125 0.045 Thallium 3 3 0... Date Added: 2009-04-22 04:19:11 |
| 8_pseudomonas.pdf Path: Minnesota >> CVM >> 6202 Fall, 2008 Description: CVM6202: Microbiology K.V. Nagaraja PSEUDOMONAS CVM6202: Microbiology K.V. Nagaraja Learning Objectives To learn important characteristics of the agent To know species of importance To understand the pathogenesis and disease caused by the ag... Date Added: 2009-04-22 04:20:23 |
| chap8.pdf Path: University of West Georgia >> FINC >> 4521 Fall, 2008 Description: Types of Exposure Transaction exposure sensitivity of realized domestic currency values of the firms contractual cash flows denominated in foreign currencies to p g g unexpected changes in exchange rates INTERNATIONAL FINANCE Chapter 8 Economic exp... Date Added: 2009-04-22 04:20:56 |
| 5165syllabus-latex.pdf Path: Minnesota >> MATH >> 5165 Fall, 2008 Description: MATH 5165 CLASS SCHEDULE AND HOMEWORK LIST The Rules: Exercises should be neatly written or typed (math symbols may be done by hand). Pencil is not acceptable. Exercises should be double or triple spaced (so I have space to write nasty comments bet... Date Added: 2009-04-22 04:21:19 |
| syllabus-comp3825-lanwang.pdf Path: U. Memphis >> COMP >> 3825 Fall, 2008 Description: COMP 3825: Networking and Information Assurance - Fall 2007 Prof. Lan Wang 12:40-2:05PM Mon & Wed, FIT324 Contact Information: Office: 318 Dunn Hall Department Office: 209 Dunn Hall Phone: 678-2727 Department Phone: 678-5465 E-mail: lanwang@memphis.... Date Added: 2009-04-22 04:23:07 |
| 02_19_07.pdf Path: Minnesota >> PSY >> 3201 Fall, 2008 Description: How Smart is a Rabbit? Are humans really such inadequate social thinkers? Monday, February 19, 2007 I. A \"Mixed Review\" of our Social Cognitive Skills A. We do have shortcomings. 1. Schemas can bias our interpretations, memories, and fact-finding. ... Date Added: 2009-04-22 04:23:15 |
| Hurricane_Isabel.ppt Path: U. Memphis >> GEOG >> 1010 Fall, 2008 Description: Hurricane Isabel Wind swath Cape Hatteras Wilmington, NC Radar: Wilmington, NC 9:00 am Sept 18, 2003 Radar: Cape Hatteras, NC 9:00 am Sept 18, 2003 Sea surface Temperatures Hurricane Isabel Sept. 8th, 2003 Hurricane Isabel Sept. 17th, 2003 H... Date Added: 2009-04-22 04:23:30 |
| Schema.doc Path: U. Memphis >> PSYC >> 3303 Fall, 2008 Description: 7# #,K#<$#`#6#a#6#a#6a#6a#6a# #6o#8_#8_#8_#8_# #8i#88#88#88 #x#7#D#9# #9%#9;#*#9e#6a# # Schema TheoryA schema is a cluster of knowledge that describes the typical properties of the concept it represents. The basic insight is that concepts are define... Date Added: 2009-04-22 04:24:26 |
| 04_IV_abstract.doc Path: Caltech >> ETD >> 05302008 Fall, 2009 Description: iv ABSTRACT Feature selection from measured data aims to extract informative features to reveal the statistic or stochastic mechanism underlying the complicated or high dimensional original data. In this thesis, the feature selection problem is probe... Date Added: 2009-04-22 04:25:46 |
| GRS_liming.ppt Path: Caltech >> GE >> 151 Spring, 2008 Description: OBSERVATION OF GRS FROM CASSINI MULTI-FILTER IMAGES Liming Li OUTLINEOFPRESENTATION Introduction Data FeaturesofGRS a)structureb)withwind c)motiond)size Conclusions (I)INTRODUCTIONTOGRS a:size(20000km,10000km) b:position(latitude:22) c:co... Date Added: 2009-04-22 04:26:41 |
| hw1.pdf Path: Caltech >> EE >> 148 Fall, 2009 Description: ms u | z v s o x v o o} | m l v x s lo o x } v| vx v| 7~ysv nB\'bvds\'yDo\' D|p{m\'~sypm5VDYnfyoUs\'FD{mnD\'YD~ysd7ydn l jv u u| s v x v z u v| v | s v j Do d{|BsDwoD|nywvD\'yu~ys\'wodnyvdnU\'y\'{ki 5\'y~UlDo dB {jDfTDo\'Uysd|{7\'Do\'d\'yvx d... Date Added: 2009-04-22 04:27:08 |
| lecture11.ppt Path: Caltech >> CS >> 141 Fall, 2009 Description: Recap Concurrent Garbage Collection Relations and SQL CS 141b - Distributed Computation Laboratory http:/www.cs.caltech.edu/~cs141/ 2PL, Intro to Transactions 17 February 2004 1 Today Introduction to Transactions CS 141b - Distributed Compu... Date Added: 2009-04-22 04:27:27 |
| Lecture6.ppt Path: Caltech >> ME >> 105 Fall, 2008 Description: Creativity can it be engineered? Sustainability what is it? Lecture 6 October 16, 2008 Today M arketing HW Presentations Creativity in the Product Development Process Sustainability Lecture Oct 19, 2006 Creativity- Can it be Engineered? Creati... Date Added: 2009-04-22 04:27:42 |
| TimeAndRegulation.ppt Path: Caltech >> APH >> 161 Fall, 2009 Description: The Central Dogma of Molecular Biology: How Genes Lead to Proteins Crick and others mused over the `two great polymer languages\'. Central dogma explains the chain of events relating them. The ribosome is the universal translating machine that speaks ... Date Added: 2009-04-22 04:28:30 |
| yfp_sequences.txt Path: Caltech >> APH >> 162 Fall, 2009 Description: (all sequences are in the 5\'-3\' direction) YFP:atgagcaaaggtgaagaactgttcaccggcgttgtgccaattctggttgagctggatggtgacgtgaatggccacaaattttccgtgtctggtgaaggcgagggtgatgctacttatggcaaactgactctgaaactgatctgtaccaccggcaaactgcctgttccgtggccaactctggtcactactctgggttacggcc... Date Added: 2009-04-22 04:28:43 |
| yfp_sequences.txt Path: Caltech >> APH >> 2009 Fall, 2009 Description: (all sequences are in the 5\'-3\' direction) YFP:atgagcaaaggtgaagaactgttcaccggcgttgtgccaattctggttgagctggatggtgacgtgaatggccacaaattttccgtgtctggtgaaggcgagggtgatgctacttatggcaaactgactctgaaactgatctgtaccaccggcaaactgcctgttccgtggccaactctggtcactactctgggttacggcc... Date Added: 2009-04-22 04:28:43 |
| cognition6.pdf Path: Minnesota >> PSY >> 3301 Fall, 2008 Description: Current View (Nisbett & Norenzayan, 2002) Norenzayan, Culture and Cognition 1.Some cognitive processes are highly 1.Some susceptible to change, even for adults 2.Cultures differ markedly in the type of 2.Cultures inferential procedures they typical... Date Added: 2009-04-22 04:28:46 |
| baylon-handout2-07.pdf Path: Minnesota >> DENT >> 5501 Summer, 2008 Description: Dental Development and Occlusion Dr. Rick Baylon Tooth Development and Eruption Disturbances Tooth number: hypodontia/hyperdontia Tooth shape/size Hypoplasia Eruption delay/acceleration Ectopic eruption Diastema Ankylosis Crossbites Dr. Rick Baylon... Date Added: 2009-04-22 04:29:20 |
| List_e_1965.pdf Path: Caltech >> ETD >> 09302002 Fall, 2009 Description: ... Date Added: 2009-04-22 04:29:34 |
| HW8_MS115a.pdf Path: Caltech >> MS >> 115 Fall, 2009 Description: MS 115a, Problem Set #8 assigned 11/20/08; revised 11/23/08 due 11/26/08 1. Consider the electrical properties of an ideal metal: (a) Write down the functional dependence of electron density of states, N(E), on energy. Plot this function. (b) Write d... Date Added: 2009-04-22 04:30:35 |
| pchp_brainstorming.doc Path: Minnesota >> D >> 5230 Fall, 2009 Description: Craig Stroupe | COMP 5230 Brainstorming: The Personal Course Home Page Concept 1. Make a List Open up a Word document, Save it as \"pchp brainstorm\" in your \"nonwww\" folder in a new folder called \"pchp\" (nonwww/pchp). (If you don\'t have a USB dr... Date Added: 2009-04-22 04:30:39 |
| ta01_007.txt Path: Minnesota >> CH >> 5021 Fall, 2009 Description: # File ta01_007.txt from publisher\'s web site # Data from Table 1.7, p. 35 of IPS4 # Col. 1: year (1944-2000) # Col. 2: number of major hurricanes by year year count 1944 3 1945 2 1946 1 1947 2 1948 4 1949 3 1950 7... Date Added: 2009-04-22 04:31:52 |
| P8_G11_K.doc Path: Minnesota >> CSCI >> 8701 Fall, 2008 Description: Title of Paper: XML Structure Best Practices for Efficient Native XML Querying Authors: Mitchell Felton, David Nguyen Reviewer Team (Name, Student Ids): G10, Kuo-Wei Hsu, 3483317 Date Review Completed: 11/13/2006 SUMMARY: As the number of mobile devi... Date Added: 2009-04-22 04:32:57 |
| Chetan_Nayak_solid_state.pdf Path: Caltech >> PHY >> 135 Fall, 2009 Description: Solid State Physics Chetan Nayak Physics 140a Franz 1354; M, W 11:00-12:15 Oce Hour: TBA; Knudsen 6-130J Section: MS 7608; F 11:00-11:50 TA: Sumanta Tewari University of California, Los Angeles September 2000 Contents 1 What is Condensed Matter P... Date Added: 2009-04-22 04:34:06 |
| dissertation2.pdf Path: Caltech >> ETD >> 06022003 Fall, 2009 Description: Cooperation and Social Choice: How foresight can induce fairness Thesis by Elizabeth Maggie Penn In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy I N ST IT U T E O F T EC IF O R NIA HNOLOG 1891 C AL Califo... Date Added: 2009-04-22 04:34:23 |
| Chapter4.pdf Path: Caltech >> ETD >> 01122006 Fall, 2009 Description: 4-1 Chapter 4. Heat-induced Chemical Changes in Tholins: the Case Against Pyrolysis 4.1. Introduction Pyrolysis is a common technique for the analysis of organic polymers, since it enables the volatilization of high molecular weight species, allowin... Date Added: 2009-04-22 04:35:38 |
| E6270_syl.doc Path: Auburn >> E >> 6270 Fall, 2009 Description: Spring 2009 ELEC 5270-001/6270-001 Low-Power Design of Electronic Circuits MWF 3PM, Broun 125 2006 Catalog Data circuits and low-power memory and Textbook: References: Education, Coordinator: Course Objectives: ELEC 5270/6270. LOW-POWER DESIGN OF EL... Date Added: 2009-04-22 04:36:41 |
| lecture20.pdf Path: Auburn >> CS >> 122 Fall, 2009 Description: Elementary Sorting Algorithms CS122 Algorithms and Data Structures Selection Sort, Insertion Sort, and Bubble Sort all have a worst-case time of O(n2), making them impractical for large arrays. But they are easy to program, easy to debug. Insertion S... Date Added: 2009-04-22 04:36:52 |
| TREC-9-README.txt Path: Auburn >> COMP >> 7970 Fall, 2008 Description: This README file describes all the data files associated with the OHSUMED document collection as it was used for the TREC-9 Filtering Track. Please see \"The TREC-9 Filtering Track Final Report\" by Stephen Robertson and David A. Hull in the TREC-9 pr... Date Added: 2009-04-22 04:37:12 |
| Edme71-1.ppt Path: Auburn >> MANS >> 486 Fall, 2009 Description: Two-Level Full Factorials DOE Process and design construction Step-by-step analysis (popcorn) Popcorn analysis via computer Multiple response optimization Advantage over one-factor-at-a-time (OFAT) 1. Mark Anderson and Pat Whitcomb (2000), DOE... Date Added: 2009-04-22 04:37:44 |
| 01bthecelltext.ppt Path: Auburn >> HIST >> 0509 Fall, 2009 Description: THE CELL 1 http:/multimedia.mcb.harvard.edu/innerlife.html 2 Cell - from the Latin word cella meaning small room Robert Hooke (about 1670) - first to use term in a biological sense. Used it to describe the small, organized compartments he observe... Date Added: 2009-04-22 04:38:27 |
| Ex6F06an.pdf Path: Iowa State >> ECON >> 353 Fall, 2008 Description: Answer Outline ECONOMICS 353 L. Tesfatsion/Fall 06 EXERCISE 6: Six Questions (8 Points Total) DUE: Tues, October 10, 2006, 2:10pm *IMPORTANT REMINDER: LATE ASSIGNMENTS WILL NOT BE ACCEPTED NO EXCEPTIONS* EXERCISE INSTRUCTIONS: (1) Please fill in yo... Date Added: 2009-04-22 04:41:09 |
| lec2_3.pdf Path: Iowa State >> ECON >> 353 Fall, 2008 Description: Material for Lecture 2 3 will use the following transparencies, plus Figure 1 and Tables 1 5 of Chapter 2 of the textbook. Overview of the Financial System 1. The Functions of the Financial System 2. Financial Markets 3. Financial I... Date Added: 2009-04-22 04:41:42 |
| aer-461-7a.ppt Path: Iowa State >> ENG >> 461 Fall, 2009 Description: Transcendental Constraint Systems A transcendental constraint system is one in which an explicit solution for the objective function cannot be obtained. Constraint systems of this type require iterative procedures for solution access. Example #1: Ex... Date Added: 2009-04-22 04:42:26 |
| hw1lab.doc Path: Iowa State >> EE >> 324 Fall, 2009 Description: Plotting discrete-time signals and their envelopes In ee324, we look at discrete signals and plot them using the stem command. However, it is often useful to also plot the envelope of the signal as well to see if the samples represent the signal accu... Date Added: 2009-04-22 04:43:39 |
| syllabus.pdf Path: Iowa State >> TC >> 315 Fall, 2009 Description: TC 315 Technical Design Processes Catalog description: (2-2) Credits 3. F. Prereq: 225, 231, 278, portfolio review. Permission of instructor. Garment development and analysis; fit, performance, quality, cost. Explore alternative materials, constructi... Date Added: 2009-04-22 04:44:32 |
| Lecture14.ppt Path: Auburn >> STAT >> 3600 Fall, 2008 Description: Lecture 14 Chapter 7 Statistical Intervals Based on a Single Sample What is a confidence interval (CI)? The point estimate provides only a single value estimate for a population parameter. It does not provide any information on how \"good\" the estim... Date Added: 2009-04-22 04:46:15 |
| lecture-12-astro-150-s08.pdf Path: Iowa State >> ASTRO >> 150 Fall, 2008 Description: Lecture 12 page 1 Astro 150: Post MS Evolution of Stars: Review: H-R diagram Main Sequence Red Giants White Dwarfs - Luminosity vs. Temperature - stars fusing hydrogen helium - cool, but huge stars - hot but small stars Reading: Chapter 18 V... Date Added: 2009-04-22 04:46:28 |
| test2f99.doc Path: Auburn >> AGEC >> 0500 Fall, 2009 Description: 1 AGEC 500 Agribusiness Management Test 2 -November 12, 1999 1. (4) Name Use the attached extension Irish potato enterprise budget to answer the following questions. (11 total) A. What is the breakeven price? (4) B. What is the breakeven yield? ... Date Added: 2009-04-22 04:47:31 |
| Cooling_Fin_Assignment4.doc Path: Auburn >> MANS >> 382 Fall, 2009 Description: Cooling Fin Assignment Procedure 1. Read references carefully before starting. 2. Before beginning the heat transfer experiment, take some data of the rods at constant temperature. To do this you need only turn on the attached PC and run the \"Get dat... Date Added: 2009-04-22 04:47:40 |
| lecture14.ppt Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: MPC555.h Header File union{ UINT16R; struct{ UINT16PIRQ:8; UINT16PS:1; UINT16:4; UINT16PIE:1; UINT16PITF:1; UINT16PTE:1; }B; }PISCR; union{ UINT32R; struct{ UINT32PITC:16; UINT32:16; }B; }PITC; USIU.PISCR.B.PTE Week 14 ISU, CprE 211, F02 1 Input Ca... Date Added: 2009-04-22 04:48:30 |
| eval_form_lab_2.pdf Path: Iowa State >> CPRE >> 488 Fall, 2009 Description: CprE 488X Lab Evaluation Form Lab 2 Lab Partners _ _ Section/Lab Time _ Completed _ _ _ _ Description Prelab None Lab Notebook (10 pts) Questions in Lab (2 pts each) 1. (Pg. 2) Why might writing to the serial port in the interrupt handler be a ... Date Added: 2009-04-22 04:48:43 |
| photoinhib.pdf Path: Iowa State >> AGRON >> 317 Fall, 2008 Description: Agronomy 317 Principles of Weed Science Photosynthesis Inhibitors I. Photosynthesis A. Conversion of solar energy to chemical energy B. Two major steps 1. Light reactions a. Photosynthetic pigments trap solar energy i. Several pigments involved, chl... Date Added: 2009-04-22 04:50:17 |
| sunwoo.pdf Path: Auburn >> E >> 7250 Fall, 2009 Description: An Effective Design-for-Iddq-Testing Approach for Embedded Cores Based System-on-Chip John Sunwoo (Author), Jonathan Harris (Reviewer) Dept. of Electrical and Computer Engineering Auburn University Auburn, AL 36849-5201 phone: (334)844-1843 john@john... Date Added: 2009-04-22 04:50:41 |
| lect05.ppt Path: Iowa State >> CPRE >> 210 Fall, 2009 Description: ADD/SUB revisited Understand the examples again Overflow When two positive numbers added together or a negative number subtracted from a positive number yields negative Underflow When two negative numbers added together or a positive number subt... Date Added: 2009-04-22 04:51:44 |
| E3s08Key.pdf Path: Iowa State >> ECON >> 330 Fall, 2008 Description: ... Date Added: 2009-04-22 04:53:14 |
| LAB9F2008.doc Path: Iowa State >> ECON >> 330 Fall, 2008 Description: Econ 330 Lab 9 Fall 2008 Name_ Lease and Land Purchase Analysis The purposes of this week\'s lab exercise are to (1) compare the cost of cash and crop share leasing, (2) estimate the maximum cash rent that you can afford to pay, (3) estimate the eco... Date Added: 2009-04-22 04:53:19 |
| Exam3_Fall2005_Key.pdf Path: Iowa State >> ECON >> 330 Fall, 2008 Description: Economics 330 Fall 2005 Exam 3 KEY LAND, LABOR, CAPITAL AND MACHINERY A. 1. Circle the best answer. You may indicate your second choice with a square. (4 points each) When the Farm Service Agency (FSA) provides a \"marketing loan\" to a grain farmer:... Date Added: 2009-04-22 04:53:20 |
| teams.txt Path: Iowa State >> ECON >> 1982 Fall, 2009 Description: Long name,Short name,Class,District,Conference Ackley-Geneva,Ackley-Geneva,1A,1,1 Afton East Union,Afton East Union,1A,1,1 Alden,Alden,1A,1,1 Algona,Algona,1A,1,1 Alta,Alta,1A,1,1 Ames,Ames,1A,1,1 Ankeny,Ankeny,1A,1,1 Arnold West Burlington,Arnold We... Date Added: 2009-04-22 04:54:34 |
| Portes.pdf Path: Iowa State >> SOC >> 640 Fall, 2008 Description: ... Date Added: 2009-04-22 04:55:39 |
| syllabus.pdf Path: Iowa State >> TC >> 165 Fall, 2009 Description: TREND AND CONSUMER ANALYSIS Spring 2009 Lecture Tu/Th 11:10-12:20 1352 Gilman Dr. Mary Lynn Damhorst Office: 1068 LeBaron Phone: 294-9919 e-mail: mldmhrst@iastate.edu Office Hour: 2-3 Mondays or by appointment Melissa Jakubauskas Office: 28 MacKay Ph... Date Added: 2009-04-22 04:55:54 |
| Vacancysummerintern.doc Path: Iowa State >> NR >> 93237 Fall, 2009 Description: VACANCY ANNOUNCEMENT POSITION : RESPONSIBILITIES: Summer 4H /Youth Intern 1. Teach Clover Kids curriculum to youth K3 in Cerro Gordo County communities. Responsibilities will also include working at the Cerro Gordo County Fair, assis... Date Added: 2009-04-22 04:56:30 |
| hw12sol.pdf Path: Iowa State >> STAT >> 542 Fall, 2008 Description: Homework 12 Solutions, Statistics 542, Fall 2006, Michael Larsen 1. 5.49 (a) See example 2.1.4 on page 51. (b) X = g(U ) = - log 1-U . Then u = g -1 (x) = U 1 . 1+e-x dg -1 (x)/dx = e-x (1 + e-x )-2 . So fX (x) = 1 |e-x (1 + e-x )-2 |, x (-, ), ... Date Added: 2009-04-22 04:57:02 |
| Ch1_Limits_ans.pdf Path: Iowa State >> M >> 165 Fall, 2009 Description: MIKE ANCTIL MATH 165: LIMITS PRACTICE 1. lim x2 x2 - 4 x-2 Direct substitution gives 0 , which is an indeterminate. 0 But the numerator can be factored: lim x2 ( x - 2 )( x + 2 ) x-2 Simplifying the limit gives a form that is solvable by dire... Date Added: 2009-04-22 04:58:14 |
| Day10-ERP-ProjectMngtConcepts.pdf Path: Bowling Green >> MBA >> 8125 Fall, 2009 Description: ERP Project management overview Ronald E. Giachetti, Ph.D. Associate Professor Industrial and Systems Engineering Duane P. Truex, Ph.D. Associate Professor Robinson College of Business Department of Computer Information Systems ERP Methodology & P... Date Added: 2009-04-22 04:59:05 |
| FinalExamPrep.pdf Path: Bowling Green >> CIS >> 3300 Fall, 2009 Description: )LQDO ([DP 5HYLHZ 5HYLHZ DVH \'RFXPHQWDWLRQ ODVV \'LDJUDP &KHFN WKH 6SHFLILFDWLRQ :LOOLDP 1 5RELQVRQ 4XHVWLRQV $QVZHUHG LQ 7KLV /HFWXUH :LOOLDP 1 5RELQVRQ :KDW DUH WKH FXUULFXODU JR... Date Added: 2009-04-22 04:59:23 |
| HW2.sol.2008Fall.pdf Path: Bowling Green >> CS >> 3320 Fall, 2009 Description: Homework 2 - Solution Due : Midnight on Sep.20 Email to Song Guo jigsaw1079@gmail.com Question 1 (15) Describe the meaning for each regular expression below. For each expression, give 3 different examples that match the pattern. a. /^[A-Z].$/ ANSWER:... Date Added: 2009-04-22 04:59:43 |
| ChC1.q-sol.txt Path: Bowling Green >> CS >> 3320 Fall, 2009 Description: C recipe Variable - Types - primitive type char, short, int, long, float, double, long double - truncation <= > >= ... Date Added: 2009-04-22 04:59:46 |
| ps6.pdf Path: Iowa State >> ECON >> 571 Fall, 2008 Description: Economics 571 Problem Set #6 (1) Wooldridge, Exercise 3.9. (2) Wooldridge, Exercise C3.4. (3) Wooldridge, Exercise 4.5. (4) Wooldridge, C4.5, parts (i) and (ii). (Note that \"lsalary\" in the data set is the log of salary). ... Date Added: 2009-04-22 05:00:25 |
| Anita.Whiting.Dissertation.pdf Path: Bowling Green >> ETD >> 05062005 Fall, 2009 Description: PERMISSION TO BORROW In presenting this dissertation as a partial fulfillment of the requirements for an advanced degree from Georgia State University, I agree that the Library of the University shall make it available for inspection and circulation ... Date Added: 2009-04-22 05:00:38 |
| ticks.doc Path: Iowa State >> MR >> 0622 Fall, 2009 Description: Shreveport Times, LA 06-15-07 Ticks don\'t find people; people find the ticks By Mary Challender Is your scalp crawling? If not, you probably haven\'t spent much time outdoors recently. In some areas of the country spring rains and warmer weather have ... Date Added: 2009-04-22 05:00:51 |
| ticks.doc Path: Iowa State >> PUBLIC >> 0622 Fall, 2009 Description: Shreveport Times, LA 06-15-07 Ticks don\'t find people; people find the ticks By Mary Challender Is your scalp crawling? If not, you probably haven\'t spent much time outdoors recently. In some areas of the country spring rains and warmer weather have ... Date Added: 2009-04-22 05:00:51 |
| DoesEntrepreneurshipPay-AnEmpiricalAnalysisoftheReturnsofSelf-Employment.pdf Path: Iowa State >> ECON >> 520 Fall, 2008 Description: ... Date Added: 2009-04-22 05:03:40 |
| mgt493-w07_chapter14.ppt Path: Wright State >> MGT >> 493 Fall, 2008 Description: 14 Employment Law III: Labor-Management Relations McGrawHill/Irwin 2007 by the McGrawHill Companies, Inc. All rights reserved. Chapter 14 Employment Law III: Labor-Management Relations Key Points Understand the history out of which labor unions g... Date Added: 2009-04-22 05:03:56 |
| SFIStockOverview.LT.pdf Path: Iowa State >> ECON >> 308 Spring, 2008 Description: Agent-Based Computational Economics Overview of the Santa Fe Artificial Stock Market Model Leigh Tesfatsion Professor of Economics and Mathematics Department of Economics Iowa State University Ames, IA 50011-1070 1 Basic References (See Syllabus fo... Date Added: 2009-04-22 05:04:32 |
| 2006DevModel.ppt Path: Iowa State >> EE >> 501 Fall, 2009 Description: CMOS Device Model Objective Hand calculations for analog design Efficiently and accurately simulation CMOS transistor models Large signal model Small signal model Simulation model Noise model Large Signal Model Nonlinear equations for solv... Date Added: 2009-04-22 05:06:13 |
| 2006DevModel.ppt - Part 2 Path: Iowa State >> EE >> 501 Fall, 2009 Description: n be viewer as a measure of normalized power. power Signal to noise ratio Ps S rms SNR = 10 log10 ( ) = 20 log10 ( )... Date Added: 2009-04-22 05:06:13 |
| E207L9S08Key.pdf Path: Iowa State >> ECON >> 207 Spring, 2008 Description: ECONOMICS 207 SPRING 2008 LABORATORY EXERCISE 9 KEY Problem 1. Consider the following matrices. 64 24 5 1 4 3 B = -24 -9 -2 A = -2 -9 -8 11 4 1 -3 -8 0 1 -2 2 7 -8 -10 G = 3 -3 -4 F = -3 7 -2 0 1 1 3 -7 3 1 6 9 b = -17 c = -16 a = 2 ... Date Added: 2009-04-22 05:06:46 |
| hw6.pdf Path: Iowa State >> CMU >> 301 Fall, 2009 Description: qn}kyu1 zr c% |qiqB}%si%q 1 !u!qukrqziTqw~1iuukrqzp1qrqqqhqi\'wcqrq%d~q}ky}|{qz|pzu1sf |!v { tr ny o tr y ~r ~ z ~ z nr z ~ { ~ ~r z y n y n z tr ~ t y n n qnqhqq}qrqqr!~%qiky4ukrpzqkocTukrpzqkoqkyvuqwrqurpBqqhp... Date Added: 2009-04-22 05:07:13 |
| presentation-detail.pdf Path: Iowa State >> TRLOG >> 360 Fall, 2009 Description: LSCM 360 Business Logistics Management Group Presentations on Current logistics Issues Objective: Learn current topics and issues of logistics and/or transportation. Since logistics and transportation environment is constantly changing, we need to le... Date Added: 2009-04-22 05:07:56 |
| sec3_3.txt Path: WVU >> CS >> 440 Fall, 2008 Description: We describe functions to manage users here. \\subsubsection{Add a User} \\begin{itemize} \\item Description: Create a new user/operator. \\item Inputs: user name, ID, job, user name, password \\item Source of Inputs: supervisor \\item Outputs: confirmation... Date Added: 2009-04-22 05:09:51 |
| Team7Des.doc Path: WVU >> CS >> 430 Fall, 2008 Description: West Virginia University SOFTWARE DESIGN SPECIFICATION CS 430 Gage Pollard, Matt Crum, Zack Hutzell, Matt Williams 3/11/2008 Contact email: gpollard@mix.wvu.edu Table of Contents Table of Contents..2 1.0 Introduction.4 1.1 Goals and objectives..4 ... Date Added: 2009-04-22 05:10:49 |
| p_quiz01_soln.pdf Path: WVU >> CS >> 591 Fall, 2008 Description: Answer Key for Practice Quiz - 1 CS 591U/791V - Pattern Recogniton Instructor: Dr. Arun Ross Posted on: September 28, 2005 1. List the 3 general forms of learning that can be used by a pattern recognition system. Answer (see section 1.5 in DHS): (a)... Date Added: 2009-04-22 05:11:04 |
| commoner-connections.ppt Path: WVU >> WMAN >> 150 Fall, 2008 Description: Ba rry C o m m o ne r\'s Fo urLa ws o fEc o lo g y ,a s writte ninTheClosingCirclein1971. 1. Everything is Connected to Everything Else. T h e re is o ne e c o s p h e re fo ra llliving o rg a nis m s a nd wh a ta ffe c ts o n e ,a ffe c ts a ll. C... Date Added: 2009-04-22 05:11:19 |
| RESM440_Fall2008Exercise1Introduction.pdf Path: WVU >> RESM >> 440 Fall, 2008 Description: Exercise 1. Introduction to ArcGIS Assigned August 21/22, 2008 Part A due at end of lab today Part B due at beginning of lab next week This exercise will serve as a brief introduction to GIS technology and the ArcGIS software. This exercise will also... Date Added: 2009-04-22 05:11:35 |
| 3-forestry-lab.ppt Path: WVU >> RESM >> 493 Fall, 2009 Description: ArcGIS Tools for Forestry Applications Thurs Fri Nov 20,21 Fragmented Much edge Core interior forest Applied GIS for Env Mgmt Basic GIS landscape tools Focal and Block Statistics Functions: Unique calculation for each cell based on values of sur... Date Added: 2009-04-22 05:11:38 |
| syllabus.pdf Path: Iowa State >> ECON >> 603 Spring, 2008 Description: ECONOMICS 603 Part II: Game Theory Spring 2008 Instructor: Jinhua Zhao jzhao@iastate.edu 377 Heady, 294-5857 Lectures: TTh: 9:3011:20am, 272 Heady Office hours: M,F: 2-3pm, or by appt TA: Luisa Menapace luisa@iastate.edu 280D Heady, 294-2177 Discussi... Date Added: 2009-04-22 05:12:21 |
| lazy-eager.txt Path: Iowa State >> COMS >> 541 Fall, 2009 Description: Com S 641 meeting -*- Outline -*- * lazy and eager evaluation of abstracts (2.4-2.6) subject: choices for semantics of abstractions and which is (generally) better - LAZY vs. EAGER EVALUATION OF ABSTRACTS (2.4-2.6) fun F = @loc... Date Added: 2009-04-22 05:12:45 |
| lecture-02.pdf Path: Iowa State >> CS >> 342 Fall, 2009 Description: Compilation vs. Implementation Implementation strategies Overview of Compilation Principles of Programming Languages Ting Zhang Iowa State University Computer Science Department Lecture 2 August 28, 2008 Compiler and Interpreter based on the wor... Date Added: 2009-04-22 05:19:46 |
| A_Decision_Chart_for_Stat_tests.pdf Path: WVU >> PS >> 300 Fall, 2009 Description: A Decision Chart for Statistical Inference about the Mean Tests About the Mean of one Sample Statistic z-test When to Use Use when comparing a sample mean to a population mean (or standard) and you have the population standard deviation (). Use when... Date Added: 2009-04-22 05:20:15 |
| Spam_E-mail_Problem.pdf Path: WVU >> CS >> 117 Fall, 2009 Description: Microsoft Excel I Background Information A significant and growing problem for most Internet users is spam e-mail, formally unknown as unsolicited commercial e-mail (UCE). As of 2007, spam is estimated to comprise about 85% of total e-mail and can in... Date Added: 2009-04-22 05:20:34 |
| PowerPoint_Chapter_1.ppt Path: WVU >> CS >> 101 Fall, 2008 Description: Exploring Microsoft Office PowerPoint 2007 Chapter 1: Presentations Made Easy Robert Grauer, Keith Mulbery, Cindi Krebs Copyright 2008 Pearson Prentice Hall. AllNext Committed reserved. to Shaping the rights Generation of IT Experts. 1 Objectives ... Date Added: 2009-04-22 05:20:49 |
| S01.pdf Path: WVU >> PHYS >> 102 Fall, 2008 Description: PHYS 102 Introductory Physics II HOMEWORK #1 Solution The Bohr model of the hydrogen atom assumes that the negatively charged electron revolves about the positively charged nucleus in a circular orbit of radius r. Ignore the gravitational interacti... Date Added: 2009-04-22 05:21:30 |
| AE351-syllabus-F08.pdf Path: Iowa State >> AE >> 351 Fall, 2009 Description: Syllabus Aero Eng 351 ASTRODYNAMICS Fall 08 I. Mathematics/Dynamics Refresher A. Vectors and products B. Newton\'s laws, particle dynamics Two-Body Problem A. Potentials and integrals 1. Constants of the motion 2. Orbit equation B. Conic-section ... Date Added: 2009-04-22 05:22:03 |
| hw2.pdf Path: WVU >> CS >> 591 Fall, 2008 Description: Homework 2 CS 591Q/791V - Pattern Recognition Instructor: Dr. Arun Ross Due Date: March 6, 2008 Note: You are permitted to discuss the following questions with others in the class. However, you must write up your own solutions to these questions. An... Date Added: 2009-04-22 05:22:22 |
| hw5.pdf Path: WVU >> CS >> 591 Fall, 2008 Description: Homework 5 CS 591Q/791V - Pattern Recognition Instructor: Dr. Arun Ross Due Date: May 2, Friday (5:00pm) Note: You are permitted to discuss the following questions with others in the class. However, you must write up your own solutions to these ques... Date Added: 2009-04-22 05:22:22 |
| 23-Reproduction.ppt Path: Iowa State >> ANS >> 235 Fall, 2009 Description: Reproduction in Dairy Cows The Reproductive Cycle 1st breeding anytime after VWP Voluntary waiting period Later breedings Conception Calving Cycle from one calving until the next calving Gestation The Reproductive Cycle Voluntary Waiting Peri... Date Added: 2009-04-22 05:24:14 |
| 02-basics-1.ppt Path: UVA >> CS >> 101 Fall, 2008 Description: Javabasics Inclassquiz What aretherule for an ide s ntifie in Java? r In what m thod doe a programbe What is there e s gin? turn typeof that m thod? What e param te doe it re e r(s) s quire ? What is thee xpone ntiation ope rator in Java? How do w... Date Added: 2009-04-22 05:25:20 |
| D-Cycle.pdf Path: UVA >> TCC >> 315 Fall, 2009 Description: ... Date Added: 2009-04-22 05:25:47 |
| adding_vels.pdf Path: UVA >> PHYS >> 252 Spring, 2008 Description: Adding Velocities: A Walk on the Train Michael Fowler, UVa Physics, 12/1/07 The Formula If I walk from the back to the front of a train at 3 m.p.h., and the train is traveling at 60 m.p.h., then common sense tells me that my speed relative to the gro... Date Added: 2009-04-22 05:26:35 |
| review2.pdf Path: UVA >> CS >> 457 Fall, 2008 Description: 5 1HWZRUN#/D\\HU $GGUHVVLQJ )RUZDUGLQJ 5RXWLQJ 0XOWLFDVW 2WKHU#7RSLFV#+$532\'+3 7UDQVSRUW#/D\\HU $GGUHVVLQJ= ODVVHV 6XEQH... Date Added: 2009-04-22 05:26:38 |
| TransitionsAndEquivalencesH3.pdf Path: Iowa State >> CS >> 641 Fall, 2009 Description: 3/3/2004 Transitions and Equivalences Overview LTS of concurrent processes Reactions vs. transitions Strong bisimulation up-to Algebraic properties References Robin Milner, \"Communication and Concurrency\" Robin Milner, \"Communicating and Mobil Syst... Date Added: 2009-04-22 05:26:55 |
| consensus.pdf Path: Iowa State >> CPRE >> 545 Fall, 2009 Description: ... Date Added: 2009-04-22 05:28:19 |
| week12.pdf Path: UVA >> CS >> 120 Fall, 2009 Description: DEPARTMENT OF COMPUTER SCIENCE UVA User-defined Types - enum Enumeration type: values are defined by a list of constants of type int. #include <iostream.h> enum logical {false, true}; / enumerated / type int main() { int a; logical test; / define va... Date Added: 2009-04-22 05:28:29 |
| chapter3.ppt Path: Maryville MO >> CS >> 4450 Fall, 2009 Description: CS4450/7450:PrinciplesofProgrammingLanguages PROGRAMMING IN HASKELL Chapter3TypesandClasses 1 Announcements Today introductiontoHaskelltypes andmoreHaskellfunctionalprogramming. Homework1isavailable namely:doExercises35inHutton,Chapter1 besu... Date Added: 2009-04-22 05:29:19 |
| M605notes-6-25-08.pdf Path: Iowa State >> M >> 605 Fall, 2009 Description: DESIGN THEORY AND ASSOCIATION SCHEMES Sung-Yell Song June 25, 2008 2 This note covers the first half of the course material for Math 605. It is based on teaching a semester course at Iowa State University for the first or second year graduate studen... Date Added: 2009-04-22 05:29:50 |
| adsl.txt Path: Clemson >> CS >> 851 Fall, 2009 Description: ISDN - Integrated services digital network (a.k.a It Still Does Nothing) Essential concepts. a collection of well defined STDM Channels: B - 64kps PCM for voice or data D - 16kbps for signaling Services Basic rate 2B+1D Primary rate 23B + 1D (... Date Added: 2009-04-22 05:33:59 |
| 1320FS05ex1.pdf Path: Maryville MO >> MATH >> 1320 Fall, 2009 Description: Math 1320 First Exam Fall Semester 2005 Do all the problems. Calculators are neither needed nor allowed. You must show all work to get credit. Name Student Number Instructor Class Hour: Part A. Short Answers. 3 points each. Put your answer in the sp... Date Added: 2009-04-22 05:35:54 |
| ShortHedgeExamplewithFutures.ppt Path: Maryville MO >> NCR >> 134 Fall, 2009 Description: Short Hedge Example with Futures Information developed by: Joe Parcell University of Missouri - Columbia Short Hedge Example with Futures This presentation details the placing of an output (short) hedge in the futures market for use in reducing the... Date Added: 2009-04-22 05:36:47 |
| chap9.ppt Path: Clemson >> CHAP >> 481 Fall, 2009 Description: Chapter 9 The Game Shell Brian Malloy What\'s new? Logo Screen for 7 sec q Title Screen for 10 sec q Menu Screen q New BMP files q new functions q new enums in Defines.h q NO new classes q 2 Logo Screen 3 Title Screen 4 Menu Screen 5 The game ... Date Added: 2009-04-22 05:36:50 |
| asm-cpp.txt Path: SHSU >> CS >> 272 Fall, 2008 Description: Here\'s another example (this is simple, but it is complete, so you can immediately check it out.) Here is the .cpp file: - #include <iostream.h> extern \"C\" { short Test_Asm( short, short); } int main() { short sum; sum = Test_Asm(1, 2); c... Date Added: 2009-04-22 05:37:59 |
| CollaborativeCommerce-PS.pdf Path: San Jose State >> CMPE >> 232 Fall, 2009 Description: A Collaborative Commerce Application DesignFest Problem Aness Dhala, Sanhitha Seerapu, Vandana Sunkara, Mohamed Fayad, PhD adhala@unlnotes.unl.edu, and {sseerapu, vandana, fayad}@cse.unl.edu Abstract: Our problem is to design a collaborative commerce... Date Added: 2009-04-22 05:38:25 |
| MDLDOT.txt Path: San Jose State >> CS >> 157 Fall, 2009 Description: B100 VAN/WAGON 86 B100 VAN/WAGON 86 B200 VAN/WAGON 86 B200 VAN/WAGON 86 B300 VAN/WAGON 86 B300 VAN/WAGON 86 D100 (2WD) PICKUP 86 D100 (2WD) PICKUP 86 D200 (2WD) PICKUP ... Date Added: 2009-04-22 05:39:36 |
| Lichen.txt Path: San Jose State >> MATH >> 161 Fall, 2009 Description: NO_3 Lichen .05 .48 .1 .55 .11 .48 .12 .5 .31 .58 .37 .52 .42 1.02 .58 .86 .68 .86 .68 1 .73 .88 .85 1.04 .92 1.7 ... Date Added: 2009-04-22 05:40:39 |
| exams141.doc Path: San Jose State >> BUS >> 141 Fall, 2009 Description: MIDTERM I 1. There are several other names for materials management. Which of the following is NOT one of them? a. purchasing management b. supply management c. logistics management d. procurement management e. acquisition management Which of the fol... Date Added: 2009-04-22 05:40:42 |
| input.txt Path: University of Hawaii - Hilo >> EE >> 467 Fall, 2009 Description: fred 70 barney 60 wilma 90 betty 95 ren 50 stimpy 90 beavis 20 butthead 30 ... Date Added: 2009-04-22 05:41:33 |
| exam2.tex.txt Path: University of Hawaii - Hilo >> EE >> 341 Fall, 2009 Description: \\documentstyle[12pt]{article} \\pagestyle{empty} \\textwidth6in \\advance\\topmargin-0.5in \\advance \\oddsidemargin-0.5in \\parskip6pt \\textheight8.2in \\parindent0pt \ ewcommand{\\wo}{\\omega_0} \ ewcommand{\\wl}{\\omega_1} \ ewcommand{\\exc}{\\bf E} \ ewcomman... Date Added: 2009-04-22 05:41:48 |
| PDIUSBD12.pdf Path: University of Hawaii - Hilo >> EE >> 296 Fall, 2009 Description: PDIUSBD12 USB interface device with parallel bus Rev. 08 - 20 December 2001 Product data 1. Description The PDIUSBD12 is a cost and feature optimized USB device. It is normally used in microcontroller based systems and communicates with the system m... Date Added: 2009-04-22 05:43:13 |
| L07F05.pdf Path: University of Hawaii - Hilo >> BIOLOGY >> 101 Fall, 2009 Description: Introduction George Wong, mycologist Office Hour: TBA Office: St. John 612B Telephone: X63940 Email: biol101@hawaii.edu biol101@hawaii. Mushroom Lecture 7 Ecology How organisms interact with each other and their physical environment. Includes relat... Date Added: 2009-04-22 05:45:40 |
| lab1.doc Path: University of Hawaii - Hilo >> LING >> 631 Fall, 2009 Description: Linguistics431/631:Connectionistlanguagemodeling BenBergen Lab1:Gettingstarted August29,2006 ThegoalofthislabistogetyougoingwiththebasicsoftheJavaNNSprogram. Labassignmentsaskyoutocreateandtestconnectionistnetworks.Theinstructionswillgive youagoodide... Date Added: 2009-04-22 05:46:33 |
| e9-9.txt Path: University of Hawaii - Hilo >> SOC >> 100 Spring, 2008 Description: Free trade is leading us to a more globalized economy. Is this good or bad? There is both good and bad that comes with globalization. The increased competition brings prices down but these low prices put out of business many small plantations or b... Date Added: 2009-04-22 05:47:17 |
| 002evmum.pdf Path: University of Hawaii - Hilo >> M >> 56000 Fall, 2009 Description: Order this document by DSP56002EVMUM/D Rev. 1.0, 3/1999 DSP56002 Evaluation Module Quick Start Guide Motorola, Incorporated Semiconductor Products Sector 6501 William Cannon Drive West Austin TX 78735-8598 Copyright Motorola, Inc., 1999. All righ... Date Added: 2009-04-22 05:47:38 |
| ch8s.ppt Path: San Jose State >> BUS >> 120 Fall, 2009 Description: INFORMATION SYSTEMS CONTROLS FOR SYSTEMS RELIABILITY PART II: CONFIDENTIALITY, PRIVACY, PROCESSING INTEGRITY, AND AVAILABILITY Chapter 8 CONFIDENTIALITY Review SYSTEMS RELIABILITY SECURITY PRIVACY PROCESSING INTEGRITY AVAILABILITY Confidenti... Date Added: 2009-04-22 05:47:43 |
| exam152m3-04fall.pdf Path: University of Hawaii - Hilo >> PHYS >> 152 Fall, 2009 Description: Physics 152 November 19, 2004 Roster No.: Score: Midterm Exam #3, Part A Exam time limit: 50 minutes. You may use a calculator and both sides of TWO sheets of notes, handwritten only. Closed book; no collaboration. For multiple choice questions, ci... Date Added: 2009-04-22 05:49:40 |
| SYLLABUSsp09.pdf Path: San Jose State >> AVIA >> 179 Fall, 2008 Description: SYLLABUS SAN JOSE STATE UNIVERSITY DEPARTMENT OF AVIATION AND TECHNOLOGY AVIA 179 Advanced Airport Planning and Management I. Course Information San Jose State University Aviation 179; (Wednesday 6:00 pm-8:45 pm; ) Spring 2009, AB107 Eric Peters... Date Added: 2009-04-22 05:50:14 |
| ex1_2002.doc Path: Ole Miss >> MIS >> 409 Spring, 2008 Description: Name _ MIS 409 - Applications of Database Management 1) Explain FIVE of the following SEVEN terms (in detail): 1. 2. 3. 4. ACID B+ trees Estimate the cost in query optimization Lost update problem Class Number __ Exam #1, April 1, 2002 (20 points) ... Date Added: 2009-04-22 05:51:41 |
| kowalchuk.ppt Path: E. Kentucky >> AE >> 510 Fall, 2009 Description: Electron Beam Curing of Composite Structures for Space Applications Prepared by: Scott A. Kowalchuk University of Kansas Aerospace Engineering Abstract This presentation will give you knowledge and insight into electron beam curing and it\'s applicat... Date Added: 2009-04-22 05:52:30 |
| cs590_2.pdf Path: SIU Edwardsville >> CS >> 490 Fall, 2008 Description: Communication in Distributed Systems Dr. Stephen Blythe SIUE Layered Protocols (1) 2-1 Layers, interfaces, and protocols in the OSI model. Layered Protocols (2) 2-2 A typical message as it appears on the network. Data Link Layer 2-3 Discussi... Date Added: 2009-04-22 05:52:55 |
| 18_InternetProtocols.ppt Path: SIU Edwardsville >> CS >> 447 Fall, 2008 Description: CHAPTER 18 INTERNET PROTOCOLS CS 447 CHAPTER 18: INTERNET PROTOCOLS PAGE 1 INTERNETWORKING Networks can be connected via a variety of devices, operating at various protocol layers. A repeater works at the Physical Layer to regenerate weak signa... Date Added: 2009-04-22 05:53:04 |
| grading.pdf Path: E. Kentucky >> EECS >> 168 Fall, 2009 Description: Programming Project Grading Sheet Student Name: Correctness Criteria: Project: Date: Reads normal input data Handles incorrect input data Calculates correct results Outputs results properly Prints appropriate error messages Design Criteria:... Date Added: 2009-04-22 05:53:28 |
| 168-1.ppt Path: E. Kentucky >> EECS >> 168 Fall, 2009 Description: Welcome to EECS 168 Programming I Dr. John Gauch Dr. Frank Brown Goals To learn about computer based problem solving To learn how to program in C+ To have fun 2 Approach Learn by doing! weekly labs to explore ideas and learn skills bi-weekly... Date Added: 2009-04-22 05:53:29 |
| note1.pdf Path: Ill. Chicago >> BIOE >> 494 Fall, 2008 Description: ... Date Added: 2009-04-22 05:54:31 |
| law1thermodynamics_internal_energy.pdf Path: Ill. Chicago >> CHEM >> 342 Fall, 2008 Description: ... Date Added: 2009-04-22 05:57:19 |
| residue.pdf Path: Ill. Chicago >> HON >> 201 Fall, 2008 Description: Residues at Isolated Singularities If z0 is a complex number we shall use the notation Cr (z0 ) for the closed circular path Cr (z0 ) = {z |z z0 | = r } traversed in the counterclockwise direction. Residue Theorem One Singularity Version. Let f (z)... Date Added: 2009-04-22 05:58:56 |
| FrequentlyAskedQuestions.doc Path: Ill. Chicago >> C >> 10 Fall, 2009 Description: Frequently Asked Questions Q: Who can file a complaint against a student? A: Any member of the UIC community, including faculty, staff, fellow students, and local residents. Q. Is the student disciplinary process similar to the state or federal judic... Date Added: 2009-04-22 06:00:17 |
| FrequentlyAskedQuestions.doc Path: Ill. Chicago >> C >> 966 Fall, 2009 Description: Frequently Asked Questions Q: Who can file a complaint against a student? A: Any member of the UIC community, including faculty, staff, fellow students, and local residents. Q. Is the student disciplinary process similar to the state or federal judic... Date Added: 2009-04-22 06:00:17 |
| xml.b2-php.txt Path: Pittsburgh >> CS >> 1520 Fall, 2007 Description: <?php include \'example.php\'; $content = file_get_contents(\"http:/cs1520.cs.pitt.edu/~labrinid/cd_catalog.xml\"); if (! $content) { die(\"ERROR: Could not download XML file\"); } $xml = new SimpleXMLElement($content); foreach ($xml->CD as $cd) { ec... Date Added: 2009-04-22 06:02:11 |
| PalmOSOverview.ppt Path: Pittsburgh >> CS >> 449 Spring, 2008 Description: Developing/Programming PalmOS Applications CS449 Introduction to Systems Software Palm Application Development hello .prc Palm Resource file (GUI... Date Added: 2009-04-22 06:02:41 |
| ComputationalBiology.ppt Path: Pittsburgh >> CS >> 3150 Fall, 2008 Description: Applications of Game Theory in the Computational Biology Domain Richard Pelikan April 13, 2008 CS 3110 Overview The evolution of populations Understanding mechanisms for disease and regulatory processes Models of cancer development Competition f... Date Added: 2009-04-22 06:03:02 |
| cocacola.ppt Path: CSU Sacramento >> MGMT >> 135 Fall, 2009 Description: HERE WE GO. In the Beginning. It all started in Milwaukee, Wisconsin in 1903 when William, Walter, and Arthur Davidson, along with William S. Harley, created the first Harley-Davidson in their family shed. In 1907, the Harley-Davidson Motor Company... Date Added: 2009-04-22 06:06:07 |
| FIN10_Fa08_E03_SampleMC_KEY.doc Path: CSU Sacramento >> FIN >> 101 Fall, 2009 Description: FIN 101 Fall 2008 Exam #3 Sample Multiple Choice Questions - KEY 1. The difference between an investment\'s market value and its cost is called the: a. present value. B. net present value. c. capital value. d. cash flow. e. net income. 2. Discounted ... Date Added: 2009-04-22 06:06:22 |
| wk13_VPN.ppt Path: CSU Sacramento >> CSC >> 196 Fall, 2009 Description: Guide to Network Defense and Countermeasures Chapter 7 1 Chapter 7 - Setting up a Virtual Private Network Explain the what, why, and how of virtual private networks (VPNs) Understand the tunneling protocols that enable secure VPN connections De... Date Added: 2009-04-22 06:06:57 |
| h2.1s05.doc Path: CSU Sacramento >> CSC >> 250 Fall, 2009 Description: CSc 250 Hwk#2.1, Feb 3, 05 RED sections are aspects of the assignment typically causing difficulty/confusion BLUE: HandIn rev. POSTED: 2/4 Goals Download, configure, and use a typical security tool. This will illustrate the common wisdom: When yo... Date Added: 2009-04-22 06:07:02 |
| l13.pdf Path: Pittsburgh >> CHE >> 2101 Fall, 2008 Description: Lecture #13 Lecture 13 1 Objectives 1. Be able to compute the following: (a) Populations of ground and excited states (b) Thermodynamic quantities such as entropy 1. Example: Electronic partition function and excited states. Nitric oxide has a low-... Date Added: 2009-04-22 06:07:49 |
| 04CFunctions.ppt Path: Pittsburgh >> CS >> 449 Spring, 2008 Description: Functions in C Outline 1 Introduction 2 Program Modules in C 3 Math Library Functions 4 Functions 5 Function Definitions 6 Function Prototypes 7 Header Files 8 Calling Functions: Call by Value and Call by Reference 9 Random Number Generation 10 Exam... Date Added: 2009-04-22 06:10:33 |
| lab2TelFTP.doc Path: Pittsburgh >> CS >> 110 Fall, 2009 Description: Lab2 (Telnet /SSHClient) Part 1 Connecting to Remote Computers using SSH Client and Telnet Purpose The purpose of this lab is to work with Telnet, a tool used to connect to a remote computer system. The FSecure SSH Client or telnet programs are ... Date Added: 2009-04-22 06:10:43 |
| Exam3StudyFile.doc Path: CSU Sacramento >> INDIV >> 120 Fall, 2009 Description: Chapter 19: How to work with inheritance MULTIPLE CHOICE 1. When used correctly, inheritance can a. b. c. d. make an application run faster make it easier to write the code for the application simplify the overall design of an application eliminate t... Date Added: 2009-04-22 06:11:16 |
| class_03.ppt Path: UGA >> CS >> 1302 Fall, 2007 Description: Unix Environment Basics CSCI-1302 Pooya Shareghi Getting Account on Atlas All the projects to be done on Atlas You will all receive accounts on Atlas Go to room 307 Boyd on Friday afternoon/tomorrow to collect your account information You will g... Date Added: 2009-04-22 06:14:34 |
| notes10b.pdf Path: UGA >> PHYS >> 1211 Fall, 2008 Description: The Spring Consider a spring, which we apply a force FA to either stretch it or compress it FA x unstretched -FA -x x=0 FA = kx k is the spring constant, units of N/m, different for different materials, number of coils From Newton\'s 3rd Law, the sp... Date Added: 2009-04-22 06:16:08 |
| Chpt8_jo_2_28_08.doc Path: UGA >> EMAT >> 3500 Fall, 2008 Description: Olive & Oppong: Transforming Mathematics with GSP 4, page 97 Chapter 8: Trigonometry of the unit circle with GSP Most high-school curricula introduce the trigonometric ratios using ratios in a right triangle. The three main ratios are usually define... Date Added: 2009-04-22 06:17:38 |
| EMAT3500Eval.doc Path: UGA >> EMAT >> 3500 Fall, 2008 Description: EMAT3500 Course Evaluation Exploring Concepts in Secondary School Mathematics John Olive Fall Semester 2006 To evaluate this course, we must reflect upon and consider both intentions and actual events-each objective, activity and experience. What ... Date Added: 2009-04-22 06:17:39 |
| 2006f411s.pdf Path: Georgia Tech >> PHYSICS >> 2212 Fall, 2009 Description: Choose a seat labeled Physics 2212 K Fall 2006 Instructions: A Test Form 411 Quiz 4 Name 1. Print your name, test form number (above), and nine-digit student number in the section of the answer card labeled \"STUDENT IDENTIFICATION.\" 2. Bubble your ... Date Added: 2009-04-22 06:18:36 |
| lecture19airquality.pdf Path: UGA >> HORT >> 3140 Fall, 2008 Description: Lecture # 6 Interior Air Quality Florida Cities Urban Density/60 Cities City Density people / sq. mile Rank 19 24 48 59 Ft. Lauderdale 4,747 St. Petersburg 4,059 Orlando 2,148 Jacksonville 837 Range 23,369 714 Florida Cities and Rank: 75 Large... Date Added: 2009-04-22 06:19:06 |
| GEOG303_AB_3.2.ppt Path: Montana >> GEOG >> 303 Fall, 2008 Description: Earth\'s Energy Balance (GEOG 303, 16 September, 2008) 1. Energy Balance and Temperature a. Atmospheric influences on insolation: absorption, reflection, and scattering a. Fate of incoming solar radiation b. Surface-atmosphere energy transfer c. Gree... Date Added: 2009-04-22 06:21:14 |
| Assignment_1_GEOG430.doc Path: Montana >> GEOG >> 430 Fall, 2009 Description: Mountain Geography GEOG 430 Philip Higuera Fall 2008 Assignment 1 due the second day of class. Please answer the following questions on a piece of paper and return them to the instructor at the next class period. You do not need to write down the ... Date Added: 2009-04-22 06:21:15 |
| ee261_lecture_30.pdf Path: Montana >> EE >> 261 Fall, 2008 Description: EE 261 Introduction to Logic Circuits Lecture #30 Agenda 1. Mealy Moore Machines ... Date Added: 2009-04-22 06:21:41 |
| EE409_28_Magnetics.pdf Path: Montana >> EE >> 409 Fall, 2008 Description: 11/18/2008 EE409 Material Science Todd J. Kaiser Lecture 28 Chapter 8 Magnetic Properties Magnetization of Matter pp: 685704 1 Magnetization of Matter un m Current loops create a magnetic moment defined by: A I ^ m = IAn It creates a mag... Date Added: 2009-04-22 06:24:33 |
| lee_jonghoon_200708_phd.pdf Path: Georgia Tech >> ETD >> 07032007 Fall, 2009 Description: HIGHLY INTEGRATED THREE DIMENSIONAL MILLIMETER-WAVE PASSIVE FRONT-END ARCHITECTURES USING SYSTEM-ONPACKAGE (SOP) TECHNOLOGIES FOR BROADBAND TELECOMMUNICATIONS AND MULTIMEDIA/SENSING APPLICATIONS A Dissertation Presented to The Academic Faculty by Jo... Date Added: 2009-04-22 06:24:38 |
| PROJECT2.pdf Path: Montana >> ME >> 430 Fall, 2008 Description: ME 430 Therma System Des al sign Desig Project - 2 gn Water D Desalination P Plant Spring 200 09 One O of the me ethods for wat desalinatio (to produc fresh water) is a distilla ter on ce ation process using multistage flash evapo e orators. A t ty... Date Added: 2009-04-22 06:25:21 |
| 1_445.txt Path: Georgia Tech >> CS >> 2004 Fall, 2009 Description: CS8803D Course Reading Summaries Paper #: 133 Title: Free Transactions with Rio Vista (1) Problems Failure recovery had been a problem for database system for a long time. The atomic operation requires either all or none applies for asso... Date Added: 2009-04-22 06:25:38 |
| 1_445.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: CS8803D Course Reading Summaries Paper #: 133 Title: Free Transactions with Rio Vista (1) Problems Failure recovery had been a problem for database system for a long time. The atomic operation requires either all or none applies for asso... Date Added: 2009-04-22 06:25:38 |
| hw6.pdf Path: N.C. State >> CSC >> 570 Fall, 2008 Description: Homework 6 CSC 570, Fall, 2006 Issued 11/15/04, due 11/27/06 1. (Tanenbaum, 3.8) To provide more reliability than a single parity bit can give, an error-detecting codign scheme uses two parity bits: one parity bit for checking allt he odd-numbered b... Date Added: 2009-04-22 06:28:31 |
| Answer_Key_Test_2.pdf Path: N.C. State >> GN >> 301 Fall, 2008 Description: ANSWER KEY FOR PROBLEM SET #2 1. Genotype: The actual genetic makeup of the cells of an individual with respect to a given trait. Phenotype: The observable properties of an organism with regard to a specific trait. 2a. 9/16 F-P-, 3/16 F-pp, 3/16 ffP-... Date Added: 2009-04-22 06:28:37 |
| ChalkAirMiamiCrashFatigue.pdf Path: N.C. State >> MAE >> 543 Spring, 2008 Description: CNN.com - Investigators find crack in plane\'s wing - Dec 21, 2005 International Edition | Member Center: Sign In | Register SEARCH q Home Page q World q Investigators find crack in plane\'s wing Enter Keywords U.S. q Wednesday, December 21, 200... Date Added: 2009-04-22 06:29:04 |
| handouts3.pdf Path: N.C. State >> MAE >> 415 Fall, 2008 Description: ... Date Added: 2009-04-22 06:29:15 |
| mae416L1.pdf Path: N.C. State >> MAE >> 416 Fall, 2008 Description: MAE: 41t. - 003 .1\'. W. LEA<\'H lis IO<J 7.) INT\'R.oDUC.F. pt:t,.o TE G T 61i!.1J\"\'MAr-J 0 A\\ a) J,!CfeTH1tl.tJP STI\'TEMf,v, F vJo fl. \'\" 3) RE.v A) ~) IW THE. Syt,LA8 IA S ARE:. R~ \'or\'IHAT yo tJ, YdU IJIIU. [) ro DO. UOW W... Date Added: 2009-04-22 06:29:24 |
| 02EnergyBalance.pdf Path: UCSB >> ESM >> 203 Fall, 2008 Description: 10/02/2007 Energy balance principles ESM 203: Earth-Sun* energy balance EarthJeff Dozier Energy\" and \"heat\" are equivalent Energy in energy ... Date Added: 2009-04-22 06:29:45 |
| Hw1.pdf Path: UCSB >> ECE >> 002 Fall, 2009 Description: ECE 2A Spring 2008 Prof. K. Banerjee Department of Electrical & Computer Engineering University of California, Santa Barbara Homework #1 Due Date: April 16, 2008 (by 5:00 pm) 1. An electron placed in the electric field created by an unknown charge ... Date Added: 2009-04-22 06:31:01 |
| Hodges_Lecture_07.pdf Path: UCSB >> EEMB >> 129 Winter, 2008 Description: EEMB 129 - LECTURE 7 - 2004 I. Linkage (Chapter 5) Three-Point Testcrosses X2 analysis Tetrad Analysis Chpt 5 problems: Three-Point Testcrosses: Now will look at triple heterozygote on the X chromosome: v - vermilion eyes, cv - cross-veinless, ct - c... Date Added: 2009-04-22 06:32:07 |
| Lecture7.pdf Path: UCSB >> ECE >> 125 Winter, 2008 Description: ECE 225 High Speed Digital IC Design Lecture 7 Interconnect Technology and Scaling Issues-IV (High-Frequency Effects, Emerging Technologies) Prof. Kaustav Banerjee Electrical and Computer Engineering E-mail: kaustav@ece.ucsb.edu 1 ECE 225, Lecture 7... Date Added: 2009-04-22 06:33:30 |
| s08_hw3_solution.pdf Path: UCSB >> ECE >> 152 Fall, 2009 Description: 3 2 3 Homework #3 Problems: 4. Consider a synchronous circuit with 800 flip-flops and a single clock source. We are interested in designing its clock tree. Assume that a buffer with zero load has a propagation delay of 0.3ns. Also assume that a si... Date Added: 2009-04-22 06:33:52 |
| midterm_soln.pdf Path: N.C. State >> MA >> 780 Fall, 2008 Description: MA 780: Midterm Review Test 1. Given (x0 , y0 ), (x1 , y1 ), , (xn , yn ). Write down the following: (a) the formula of Lagrange polynomial interpolation. (b) the Newton polynomial interpolation using the divided difference. (c) the error estimate.... Date Added: 2009-04-22 06:35:09 |
| lectures.pdf Path: UC Riverside >> STAT >> 160 Fall, 2009 Description: STAT 160A Elements of Probability and Statistical Theory 1 1 Probability and Distribution 2 Introduction A phenomenon is random if individual outcomes of the experiment are uncertain but there is nonetheless a regular distribution of outcomes ... Date Added: 2009-04-22 06:35:14 |
| HW_Q10.pdf Path: UC Riverside >> CHEM >> 110 Fall, 2009 Description: Chemistry 110A Lecturer Francisco Zaera Physical Chemistry Homework #10 (due M 12-04-00) Fall 2000 TA Stefan Wehner ... Date Added: 2009-04-22 06:35:46 |
| lec23.pdf Path: N.C. State >> ENGR >> 521 Fall, 2009 Description: Precise Interrupts [H&P A.4] Precise interrupts are required in order for a program to have sequential semanticsthe same behavior as a program whose instructions are executed in order. In order to achieve sequential semantics in a pipelined processor... Date Added: 2009-04-22 06:36:07 |
| FRD_LCO_F03a_T03.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Feasibility Rationale Description (FRD) Version 0-16 AADL to XML Converter Feasibility Rationale Description(FRD) Team Members for Team #3 Mr. Mayurkumar Patel Mr. Jorge Documet Mr. Prudhvi Reddy Mr. Rahul Tiwari Mr. Deepak Narang Mr. Prasanna Bad... Date Added: 2009-04-22 06:38:48 |
| LCP_LCO_F04a_T04_V01.00.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Life Cycle Plan (LCP) Hunter-Gatherer Anthropological Database Team 4 Sushil Premjani Project Manager David Cabezas System Architect Usha Guduri UML Modeler Kajal Bhargava Life Cycle Plan Nishant Kaushik OCD Abhyuday Chakravarthi - Requiremen... Date Added: 2009-04-22 06:41:52 |
| Week03_MPP_F05a_T16.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Task Name Engineering Phase Inception Phase Team 16 Assembled, Project Assigned Initial Client meeting at USC Research Diff Programs and string comparison algori Shared... Date Added: 2009-04-22 06:42:32 |
| Respond_AARSummary_LCOPackage_F07a_T15.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Respond_AARSummary_LCOPackage_F07a_T15 - Problem List Cover Project Name: Artifact: Module: Proctor and Test Site Tracking system LCO Package Review #: LCO Package Date: 6 11/12/2007 Type of review: Internal Review No. of Priority: Comments: M... Date Added: 2009-04-22 06:43:00 |
| ise330_2007_midtermReview.pdf Path: USC >> ISE >> 330 Fall, 2008 Description: University of Southern California Viterbi School of Engineering Daniel J. Epstein Department of Industrial and Systems Engineering ISE 330: Introduction to Operations Research - Deterministic Models Fall 2007: Midterm Review Linear Programming Linear... Date Added: 2009-04-22 06:44:26 |
| 10_19_99.pdf Path: USC >> CS >> 599 Fall, 2008 Description: USC C S E University of Southern California Center for Software Engineering CS599 Software Process Modeling Week 8 Ray Madachy October 19, 1999 1 cs599 9/7/99 USC C S E University of Southern California Center for Software Engineering Outli... Date Added: 2009-04-22 06:45:43 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


