Course Solutions And Notes - 12_nfs 22
| Ch7.ppt Path: Case Western >> EPBI >> 431 Fall, 2009 Description: Statistical Inference Population -> Sample -> Conclusions about population Hypothesis Statement about one or more populations (parameters) Is the statement compatible with available data? Research H: supposition motivates the research Statistical... Date Added: 2009-06-04 13:13:26 |
| chap016.ppt Path: Regis >> CS >> 425 Fall, 2009 Description: SYSTEMS ANALYSIS AND DESIGN METHODS 6th Edition Whitten Bentley Dittman C H A P T E R 16 Irwin/McGrawHill INPUT DESIGN AND PROTOTYPING Copyright 2004 The McGrawHill Companies. All Rights reserved SYSTEMS ANALYSIS AND DESIGN METHODS 6th Edition... Date Added: 2009-06-04 13:14:08 |
| Lecture 1 Simulation of a Field Survey.doc Path: UF >> SUR >> 4430 Spring, 2008 Description: Lecture 1 Simulation of a Field Survey, Econometric Model, and Cost Estimates We will simulate a field survey by starting with a scaled sheet of paper or a scaled ACAD drawing of a field situation. Simulation Rules: Enclosed structure no see through... Date Added: 2009-06-04 13:14:55 |
| output.txt Path: Lincoln U. CA >> CSCI >> 3381 Fall, 2009 Description: Rinky-Dink Credit Union Account Balance Report Steve Cormen Member #74126 Savings Account: S-404 Balance: 1,301.56 Loan Account: L-329 Balance: 19,704.76 Payments remaining: 59 David Hiles Member #75345 Loan Account: L-545 Balance: 8,766.38... Date Added: 2009-06-04 13:15:20 |
| lecture10.ppt Path: Cleveland State >> EEC >> 693 Fall, 2009 Description: EEC 693/793 Special Topics in Electrical Engineering Secure and Dependable Computing Lecture 10 Wenbing Zhao Department of Electrical and Computer Engineering Cleveland State University wenbing@ieee.org 2 Midterm #1 Results High: 100; low: 58;... Date Added: 2009-06-04 13:15:38 |
| CHAPTER 11.ppt Path: UNC Wilmington >> ECN >> 324 Fall, 2009 Description: STOCK VALUATION AND RISK CHAPTER 11 STOCK VALUATION MODELS A. The Importance of Efficient Stock Valuation Models 1. Identify over- or under-valued stocks 2. Assist in investment efficiency B. Gordon Growth Model (Dividend Discount) 1. Zero Growth ... Date Added: 2009-06-04 13:15:56 |
| Homework 2 - If Statments with answers.doc Path: UNC Wilmington >> MIS >> 216 Fall, 2009 Description: MIS 216 BUSINESS APPLICATIONS DEVELOPMENT HOMEWORK #2 Increasing your logic skills Due in class on 02/26/2006 Name: _ Detail the answer for each of these IF decision statements. 1. Dim sngRetailPrice as single Dim sngSalesPrice as single sngRetail... Date Added: 2009-06-04 13:16:52 |
| 2005-01-03In War-Torn Africa, Young Girls Are Very, Very Old.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Editorial Observer: In War-Torn Africa, Young Girls Are Very, Very Old January 3, 2005 By HELENE COOPER About three months ago, while visiting my birth country, Liberia, I walked into a local restaurant for a prearranged meeting with the father o... Date Added: 2009-06-04 13:18:14 |
| 2004-07-14Onward G.O.P. Soldiers.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Onward G.O.P. Soldiers July 14, 2004 The Bush-Cheney campaign is buttonholing Christian churches nationwide to serve as virtual party precincts in the Republican drive to turn out voters in November. The campaign has sent congregation volunteers ma... Date Added: 2009-06-04 13:18:20 |
| 2004-10-04Legislators in Iran Dismiss Khatami Ally.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Legislators in Iran Dismiss Khatami Ally October 4, 2004 By NAZILA FATHI TEHRAN, Oct. 3 - In another blow to President Mohammad Khatami\'s reformist government, Iran\'s hard-line Parliament voted Sunday to dismiss the transportation minister, accus... Date Added: 2009-06-04 13:18:58 |
| 2005-01-03In War-Torn Africa, Young Girls Are Very, Very Old.txt Path: Western Kentucky University >> TXT >> 202 Fall, 2009 Description: Editorial Observer: In War-Torn Africa, Young Girls Are Very, Very Old January 3, 2005 By HELENE COOPER About three months ago, while visiting my birth country, Liberia, I walked into a local restaurant for a prearranged meeting with the father o... Date Added: 2009-06-04 13:19:22 |
| Classes5.ppt Path: UMBC >> CSEE >> 202 Spring, 2001 Description: CMSC 202 Classes and Objects Static Methods Topics Static methods Static instance variables Math class Wrapper classes Character class 2 Static Methods So far, class methods required a calling object in order to be invoked. Date birthday = n... Date Added: 2009-06-04 13:20:58 |
| Lecture20-Functions.xlsx Path: CSB-SJU >> CSCI >> 130 Fall, 2009 Description: 1 4 7 1 4 7 9 7 1 2 5 8 2 5 8 10 8 2 3 6 9 3 6 9 11 9 3 Josh Anita Chico Ben 5 7 8 3 Josh Anita Chico Ben Sales Team Name Nick Punto Ron Gardenhire Joe Nathan Johan Santana Michael Cuddyer Joe Mauer Sales 111 120 140 150 160 200 Job Satisfactio... Date Added: 2009-06-04 13:22:05 |
| Ch4.ps Path: Virginia Tech >> CS >> 3304 Fall, 1999 Description: %!PSAdobe3.0 %Title: (Ch4.pdf) %Version: 1 1 %CreationDate: (D:19980107161227) %DocumentData: Clean7Bit %LanguageLevel: 2 %BoundingBox: 0 0 612 792 %Pages: 18 %DocumentProcessColors: (atend) %DocumentSuppliedResources: %+ font Helvetica %+ font Symbo... Date Added: 2009-06-04 13:23:12 |
| economics oral presentation guidelines.doc Path: Davidson >> ECO >> 105 Fall, 2009 Description: PRESENTING YOUR RESEARCH PROJECT IN ECONOMICS Kathleen J. Turner, Ph.D. Professor of Communication Studies As you prepare to present your research project to the class, the five rhetorical canons identified by Cicero can guide its development. I. Inv... Date Added: 2009-06-04 13:23:32 |
| 4.1 - What is Average.doc Path: Pine Manor College >> BI >> 289 Fall, 2009 Description: BI289 - Biostatistics Chapter 4 - Describing Data: What is Average? Learning Goal Understand the difference between a mean, median, and mode and how each is affected by outliers. Also understand how these different types of average can lead to confus... Date Added: 2009-06-04 13:23:55 |
| Bi101 FA08 SCHEDULE.doc Path: Pine Manor College >> BI >> 101 Fall, 2009 Description: 1 Bi101 FA08 PRINCIPLES OF BIOLOGY SCHEDULE We will cover the following chapters in the textbook (Essential Biology: Campbell, Reece and Simon, 3rd edition) Chapter 1 = Introduction Chapter 2 = Essential Chemistry Chapter 3 = The Molecules of life... Date Added: 2009-06-04 13:23:56 |
| Bi102 sp08 syll.doc Path: Pine Manor College >> BI >> 102 Fall, 2009 Description: Bi102 Spring Semester 2008 MWF 9:00-9:50am Dane 211 Dr. Susan Bear Dane 306 (ext7144)bearsusan@pmc.edu Welcome to the course entitled \"Evolution and Biodiversity.\" This course is a continuation of Bi101. We will use the same book (Campbell et al), ... Date Added: 2009-06-04 13:23:57 |
| ch08.ppt Path: ECPI >> IST >> 314 Fall, 2009 Description: Linux+ Guide to Linux Certification, Second Edition Chapter 8 Working with the BASH Shell Objectives Redirect the input and output of a command Identify and manipulate common shell environment variables Create and export new shell variables Edit... Date Added: 2009-06-04 13:26:27 |
| html08.ppt Path: Armstrong >> CSCI >> 1150 Spring, 2008 Description: 1 2 Trading Spaces 3 4 Several properties 5 Dumb Questions there are no Does every <p> element have the same style? Can I set different styles for different paragraphs? How do I know what properties I can set on an element? 6 7 8 What ... Date Added: 2009-06-04 13:27:30 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 2477 Fall, 2009 Description: \" 20853,33186,444,968 \" 28842,41181,419,829 \" 20646,14903,444,1072 \" 20749,37307,444,1072 \" 20715,18999,444,933 \" 20749,25044,444,968 \" 20715,23045,444,968 \" 55817,10634,444,933 *\' 20715,39355,468,1106 74 18674,7352,1036,1936 ; 29464,23144,863,311 a ... Date Added: 2009-06-04 13:27:33 |
| syllabus.ps Path: Wisconsin >> MATH >> 221 Fall, 1992 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: syllabus.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR17 CMR12 CMBX12 CMSY10 CMBX10 CMR10 CMTI10 CMR7 %+ CMTT10 %EndComments %DVIPSWe... Date Added: 2009-06-04 13:27:35 |
| l12.ppt Path: Duke >> CPS >> 001 Fall, 2009 Description: Today\'s topics Java Information Retrieval Upcoming Database Programs Reading Great Ideas, Chapter 4 CPS 001 12.1 Information Retrieval Often want to use program for information storage and retrieval On line phone book is good example Using \"Pa... Date Added: 2009-06-04 13:28:09 |
| Chapter_8_2.ppt Path: St. Francis IL >> STAT >> 201 Fall, 2009 Description: The Elements of a Test of Hypotheses Suppose a new interpretation of the rules by soccer referees is expected to increase the number of yellow cards per game. The average number of yellow cards per game had been 4. A sample of 121 matches using the n... Date Added: 2009-06-04 13:34:09 |
| se6ch10B.ppt Path: UCF >> EEL >> 4884 Fall, 2009 Description: Slide 10B.1 Object-Oriented and Classical Software Engineering Sixth Edition, WCB/McGraw-Hill, 2005 Stephen R. Schach srs@vuse.vanderbilt.edu The McGraw-Hill Companies, 2005 CHAPTER 10 Unit 10B Slide 10B.2 REQUIREMENTS The McGraw-Hill Compan... Date Added: 2009-06-04 13:34:32 |
| ece-301-14.ppt Path: George Mason >> ECE >> 301 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|03 Apr 2000 21:30:19 -0000 vti_extenderversion:SR|4.0.2.2717 vti_filesize:IR|29696 vti_title:SR|Chapter 5: Overview vti_assignedto:SR| vti_approvallevel:SR| vti_backlinkinfo:VX|reading_assignment.htm vt... Date Added: 2009-06-04 13:34:54 |
| EC9330rl(1997 version)revised.doc Path: East Los Angeles College >> EC >> 330 Fall, 2009 Description: EC330 UNIVERSITY OF ESSEX DEPARTMENT OF ECONOMICS Session 2008-2009 Spring Term Alastair McAuley EC330 Economics of Transition Course Outline and Reading List Details of assessment and submission deadlines are contained in the Undergraduate Economic... Date Added: 2009-06-04 13:35:28 |
| Winesburg_Ohio_Final.doc Path: Bowling Green >> RANDO >> 1945 Fall, 2009 Description: Norman 1 Randy Norman ENGL 3830 Dr. Chase Analytical Paper 1 The Grotesque in Winesburg, Ohio The word \"grotesque\" is defined in the Cambridge Advanced Leaner\'s Dictionary as \"strange and unpleasant, especially in a ridiculous or slightly frightenin... Date Added: 2009-06-04 13:36:07 |
| fpa460d01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: FPA 460-3 D01 LOCATION: DOW/VSA TITLE: STUDIO/VISUAL ART V SECTION TYPE: STD SEMESTER: 1996-3 ENROL: 9 ... Date Added: 2009-06-04 13:36:46 |
| 01Browser.ppt Path: UMass Lowell >> CS >> 113 Fall, 2009 Description: The Internet How do we use the Internet ? Communications: emails, IM, blog Search information eBusiness Internet Access browser Windows Internet Explorer 7 Mozilla Firefox Netscape Opera Safari for Mac Browser functions Download, view,... Date Added: 2009-06-04 13:36:55 |
| josephMartin.doc Path: CSU Bakersfield >> ENGL >> 580 Fall, 2009 Description: Martin \"Border Pedagogy and the Politics of Postmodernism\"(1991) Henry A. Giroux Giroux says that he `want[s] to advance the most useful and transformative aspects of border pedagogy by situating it within those broader cultural and political conside... Date Added: 2009-06-04 13:37:49 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 20:14:39 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 21:20:13 2008 ( 3934 s elapsed) ... Date Added: 2009-06-04 13:40:35 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 17:51:17 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 18:59:26 2008 ( 4089 s elapsed) ... Date Added: 2009-06-04 13:40:42 |
| 102.Midterm.1.Practice.Problems.Answers.Spring.2009.ppt Path: Rutgers >> PERRY >> 102 Fall, 2009 Description: I.E Present Value of Three Flows Consider three flows of dollars: (1) $2000 received every year, starting now, lasting for 20 years (2) $3000 received every year, starting now, lasting for 10 years (3) $4000 received every year, starting now, la... Date Added: 2009-06-04 13:41:50 |
| chap19.ppt Path: Maple Springs >> ORGAN >> 2020 Fall, 2009 Description: Amines Wade 6th ed. Chapter 19 Nomenclature Spectroscopy Reactions Synthesis Structure & Properties Amines Structure Solvation X Basicity/Nucleophilicity Chirality/Inversion structure Y Z N N X Y example configuration p sp3 sp2 sp s CH3 ... Date Added: 2009-06-04 13:42:00 |
| syl.doc Path: Rutgers >> RCI >> 588 Fall, 2009 Description: STAT 588: Data Mining. Fall 2005. Rm. Sec 202. Tuesday 6:40-9:30. Web: http:/rci.rutgers.edu/~cabrera/dm Instructor Text Book: Javier Cabrera, email: cabrera@rci.rutgers.edu, Rm 471, Ext-5295 T. Hastie, R. Tibshirani, and J. Friedman (2001) The Ele... Date Added: 2009-06-04 13:42:00 |
| Syllabus1680.010Spring2008.doc Path: North Texas >> EMS >> 0106 Fall, 2009 Description: Math 1680.010 Elementary Probability and Statistics Spring 2008 Instructor: Elizabeth Stelley Class meets: Curry Hall Room 110, MWF from 9:00 to 9:50 Office: General Academic Building Room 401A Office Hours: TBA Email: ems0106@unt.edu Class Website... Date Added: 2009-06-04 13:42:38 |
| dairyconf.doc Path: Iowa State >> MR >> 0504 Fall, 2009 Description: Wisconsin Ag Connection, WI 04-27-07 Four-State Dairy Conference Slated for Mid-June Dairy feeding and management practices that maximize profitability are the focus of a seminar bringing together dairy producers, feed industry personnel, and agribus... Date Added: 2009-06-04 13:42:54 |
| dairyconf.doc Path: Iowa State >> PUBLIC >> 0504 Fall, 2009 Description: Wisconsin Ag Connection, WI 04-27-07 Four-State Dairy Conference Slated for Mid-June Dairy feeding and management practices that maximize profitability are the focus of a seminar bringing together dairy producers, feed industry personnel, and agribus... Date Added: 2009-06-04 13:42:54 |
| quiz5.txt Path: Binghamton >> CS >> 220 Fall, 2009 Description: CS 220: Computer Org. and Assembly Language Fall 2004 - Section 90 Quiz #5 - 2004/11/10 Name: _ = 1: Circle which one (1) of the following is the number of independent 16-bit additions a single \'paddusw\' instruction performs? a) 1 b) 2 c) ... Date Added: 2009-06-04 13:43:14 |
| error.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 13 21:33:39 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 13 22:35:26 2008 ( 3707 s elapsed) ... Date Added: 2009-06-04 13:43:42 |
| output.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS11 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3456 02/13/2008 09:45 PM <DIR> . 02/13/2008 09:45 PM <... Date Added: 2009-06-04 13:44:25 |
| Abstract & Rough Outline.doc Path: Buffalo State >> PHY >> 690 Fall, 2009 Description: David Rheam PHY690 Teaching Students To Have An Intuitive Grasp Of Exponential Functions Abstract: According to Albert A. Bartlett \"The greatest shortcoming of the human race is our inability to understand the exponential function.\" So it should not ... Date Added: 2009-06-04 13:45:41 |
| Jan18.ppt Path: UNC >> COMP >> 120 Fall, 2008 Description: January 18 Hannah is sweet 16! You should have a book by now. A book is on reserve in the library. You should get the email I sent this AM. TA Office hours now in the POOP. Don\'t email answers to ME Assignment 2 C versus ASM Swap(int v[], int... Date Added: 2009-06-04 13:46:08 |
| lect4.ppt Path: UNC >> COMP >> 144 Fall, 2008 Description: The University of North Carolina at Chapel Hill COMP 144 Programming Language Concepts Spring 2002 Lecture 4: Syntax Specification Felix Hernandez-Campos Jan 16 COMP 144 Programming Language Concepts Felix Hernandez-Campos 1 Phases of Compilation ... Date Added: 2009-06-04 13:46:19 |
| H10.doc Path: Washington University in St. Louis >> BIO >> 328 Fall, 2008 Description: 1 Cardiovascular Diseases Hypertension Definition: systolic BP > 140 and/or diastolic BP > 90 Primary: Secondary: Antihypertensive Mechanism Coronary Artery Disease Anatomy of the heart: Normal coronary physiology: Concept of autoregulati... Date Added: 2009-06-04 13:46:36 |
| shanholt.ppt Path: Middlebury >> ECON >> 0428 Fall, 2009 Description: Does Women\'s Employment Reduce the Birth Rate? Vandy Shanholt Topics of Discussion Historical Trends Microeconomic Outlook Macroeconomic Outlook Europe and Unemployment Policy Implications Historical Trends Data from France, West Germany, Italy, S... Date Added: 2009-06-04 13:47:43 |
| 5. TCP-IP.ppt Path: CSU San Marcos >> HTM >> 426 Fall, 2008 Description: TCP/IP Suite Default Gateway Gateway a confusing terminology For our discussion about TCP/IP, gateway and router can be used interchangeably Default gateway: the IP address of the router port where the subnet is connected The router port be... Date Added: 2009-06-04 13:48:11 |
| 279.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sat Oct 18 17:17:47 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-04 13:49:21 |
| TPR_IOC1_S07b_T09_v4.1.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Test Procedures and Results (TPR) Initial Operational Capability - Working Set #1 Version 4.1 Personal Care Technology Help Line Team 9 Team Members: Preeti Agrawal Project Management, LCP Unnati Sethi Architecture Dhara Patel Verification a... Date Added: 2009-06-04 13:49:23 |
| getting-ready.ppt Path: UPenn >> CIT >> 591 Fall, 2009 Description: Getting Ready for Java What is Java? Java is a programming language: a language that you can learn to write, and the computer can be made to understand Java is currently a very popular language Java is a large, powerful language but it is not si... Date Added: 2009-06-04 13:49:29 |
| W08_wk4_visuals.ppt Path: Washington >> ATMOS >> 211 Fall, 2009 Description: This Week: The Greenhouse Effect Reading: Continue Chapter 3 Problem Set 2 Due in Discussion Fri This Week: The Greenhouse Effect (GHE) Atmospheric structure, composition, and absorptivity Which gases contribute to the GHE and why are some bett... Date Added: 2009-06-04 13:51:11 |
| Lecture_Overheads_--_Chp_23_--_Performance_Measures_sv_23.doc Path: Washington >> FACULTY >> 311 Fall, 2009 Description: ACCTG 505 - CHAPTER 23 DECENTRALIZATION II PERFORMANCE MEASURES * I. Multidimensional Performance Evaluation A. Financial Measures Using Internal Accounting Information Measures utilizing divisional operating income: B. External Financial Measures... Date Added: 2009-06-04 13:51:44 |
| CPP_Java.ppt Path: Binghamton >> CS >> 248 Fall, 2009 Description: C+ & Java Dick Steflik CS-248 Similarities Syntax - almost identical Object Model - very similar Stream based I/O Philosophically C/C+ were both developed for building desktop applications (an OS is a desktop application) and as such have the g... Date Added: 2009-06-04 13:51:50 |
| CISC18105SExam1.doc Path: Delaware >> CISC >> 18105 Fall, 2009 Description: CISC 181-016,017,018 Review for Exam #1 Disclaimer - while this list SHOULD cover everything, it MAY not. Don\'t argue after the exam if there happens to be something on the final that wasn\'t mentioned in this list. Topics -1.19-1.25 2.1 - 2.21 3.1-3.... Date Added: 2009-06-04 13:52:10 |
| 1218687126.doc Path: Iowa State >> DATA >> 274 Fall, 2009 Description: Interior Design Student Association (IDSA) Constitution Article I - Name There is a large active student organization called the Interior Design Student Association (IDSA). This association has two liaisons to two major interior design professional s... Date Added: 2009-06-04 13:53:24 |
| ~$part2.doc Path: Iowa State >> PUBLIC >> 230 Fall, 2009 Description: #College of Engineering#C#o#l#l#e#g#e# #o#f# #E#n#g#i#n#e#e#r#i#n#g#I#o#w#a# #S#t#a#t#e# #U#n#i#v#e#r#s#i#t#y#@f# # ... Date Added: 2009-06-04 13:53:29 |
| Implementation.ppt Path: University of Louisville >> CIS >> 482 Fall, 2008 Description: Implementation 1 Implementation Correctness of specifications Steps to follow for secure software Quality of code 2 Correctness of Specifications Requirements Could be informal Functional Most important Exhaustive description of program ... Date Added: 2009-06-04 13:54:00 |
| ITReview_Article.doc Path: American >> MC >> 1617 Fall, 2009 Description: GreenPrint, Business and Environment Working Together By Ann Recht, Claire Recht, and Mike Cannon Many of you have probably experienced the annoyance of that extra useless page of your printing job that only has an ad or a URL. These extra images an... Date Added: 2009-06-04 13:54:54 |
| foodvalue.doc Path: Iowa State >> PUBLIC >> 0316 Fall, 2009 Description: Des Moines Business Record 03-11-07 Top Value Food site\'s future still in question By Sarah Bzdega sarahbzdega@bpcdm.com Debra Carr, president of the Cheatom Park neighborhood group, is leading the effort to reopen a grocery store at the former Top V... Date Added: 2009-06-04 13:55:04 |
| foodvalue.doc Path: Iowa State >> MR >> 0316 Fall, 2009 Description: Des Moines Business Record 03-11-07 Top Value Food site\'s future still in question By Sarah Bzdega sarahbzdega@bpcdm.com Debra Carr, president of the Cheatom Park neighborhood group, is leading the effort to reopen a grocery store at the former Top V... Date Added: 2009-06-04 13:55:04 |
| credit.doc Path: Iowa State >> PUBLIC >> 1102 Fall, 2009 Description: Des Moines Register 10-30-07 University students differ on credit cards ISU and UNI leaders support the marketing of credit cards on campus, but U of I representatives criticize the practice. By CLARK KAUFFMAN REGISTER STAFF WRITER The University of ... Date Added: 2009-06-04 13:55:21 |
| KEYChapter1-2.doc Path: Laurentian >> ECON >> 10102 Fall, 2009 Description: Chapter 1&2 key 1) D 2) D 3) B 4) A 5) A 6) B 7) D 8) A 9) C 10) C 11) B 12) A 13) C 14) B 15) B 16) C 17) A 18) B 19) C 20) C 21) D 22) D 23) C 24) D 25) A 26) B 27) C ... Date Added: 2009-06-04 13:55:43 |
| 6-30-97.doc Path: Michigan State University >> ECE >> 482 Fall, 2009 Description: Design Team #2 Team Meeting 6-30-97 3:30 pm Attendees: Bill, Liu, Nipa, Peter Absent: Mowli, Shawn (excused) Progress Report for Presentation #3 CUPL/CSIM group Completed programming a GAL22V10 chip to output a student ID number and tested. Working... Date Added: 2009-06-04 13:56:17 |
| LAB-ANIM.PPT Path: Michigan State University >> VM >> 303 Fall, 2008 Description: Laboratory Animal Anesthesia anatomy fragile tissues avoid excessive pressure rabbits have tendency to break spine rabbits have small chest volume difficult to find IM sites Restraint soft towel - rats, guinea pigs, rabbits sandwich bag chamber... Date Added: 2009-06-04 13:56:42 |
| ARTMULTI395.doc Path: Wisc Whitewater >> UCC >> 111607 Fall, 2009 Description: University of Wisconsin-Whitewater Curriculum Proposal Form #3 New Course Effective Term: 2087 (Fall 2008) Cross-listing: Subject Area - Course Number: ARTMULTI 395 (See Note #1 below) Course Title: (Limited to 65 characters) 25-Character Abbrevia... Date Added: 2009-06-04 13:57:12 |
| MUSC462.doc Path: Wisc Whitewater >> UCC >> 030306 Fall, 2009 Description: University of Wisconsin-Whitewater Curriculum Proposal Form #3 New Course Effective Term: 2071 (Spring 2007) Cross-listing: Subject Area - Course Number: MUSC 462 (See Note #1 below) Course Title: (Limited to 65 characters) 25-Character Abbreviati... Date Added: 2009-06-04 13:57:20 |
| C300.doc Path: Wisc Whitewater >> C >> 300 Fall, 2009 Description: C300_Deleting_an_Existing_FAQ_Question Show how to delete a question from FAQ. Fig 1 - Deleting an Existing FAQ Question The deleting an existing FAQ Question allows you to delete an FAQ Question. Fig 2 - Click admin. Fig 3 - Click category. Fig ... Date Added: 2009-06-04 13:57:34 |
| license.txt Path: University of Hawaii - Hilo >> MANOA >> 7366 Fall, 2009 Description: License granted by Marcella Bighill (bighill@hawaii.edu) on 2009-01-04T01:43:03Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) ... Date Added: 2009-06-04 13:57:45 |
| Cours09.doc Path: Stetson >> INF >> 145 Fall, 2009 Description: INF145 : Neuvime cours Les Structures de Donnes : Dfinition : o Organisation de l\'information permettant d\'amliorer l\'efficacit d\'un algorithme. Une telle structure peut contenir des informations redondantes Caractristiques les plus courantes : o Vit... Date Added: 2009-06-04 13:58:03 |
| MezaPresentation.ppt Path: CSU Northridge >> COMP >> 595 Fall, 2009 Description: Testing ASP.NET 2.0 and Visual Web Developer by Scott Gu Presented by Jose Meza Introduction Team Structure The Big Test Team Conclusion The Process of Testing Team Structure Product Unit Manger Test Manager Development Manager... Date Added: 2009-06-04 13:58:28 |
| shapes.ppt Path: U. Houston >> CUIN >> 3111 Fall, 2008 Description: Friendly Shapes Designed for Mrs. Ortega\'s First Grade Math Class The purpose of this presentation is to provide an instructional tool. Today we are going to identify . Circles, triangles, rectangles, and squares, in order to describe the ... Date Added: 2009-06-04 13:58:31 |
| lecture708alt.ppt Path: Augustana >> HELIOS >> 105 Fall, 2009 Description: PH 105 Resonance, Interference, Superposition Dr. James van Howe Lecture 7 Right now we have a test scheduled for Monday. Shall we delay it till Wednesday? A. Yes, delay it. B. No, bring it on. Name the Mozart Piece A. B. C. D. Jupiter Impresario ... Date Added: 2009-06-04 13:58:39 |
| BurrelloChapter10-ChapterOutline.doc Path: Johns Hopkins >> DATA >> 706 Fall, 2009 Description: Effective Leadership JHU SPSBE Burrello Chapter 10 Chapter Outline A Reflection on Leadership Local Leadership Counts The educational administrator needs to: Establish a vision based upon widely held values and noble social ideas Stress the nee... Date Added: 2009-06-04 13:59:15 |
| BurrelloChapter10-ChapterOutline.doc Path: Johns Hopkins >> CTE >> 706 Fall, 2009 Description: Effective Leadership JHU SPSBE Burrello Chapter 10 Chapter Outline A Reflection on Leadership Local Leadership Counts The educational administrator needs to: Establish a vision based upon widely held values and noble social ideas Stress the nee... Date Added: 2009-06-04 13:59:15 |
| F15.075.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F15.075 repeat_region TEL15R (XV right telomeric region) Chr15 1083918.1091287 tcaatatgtttatgtattattgttgaagaatggaatatttttatgtttag gtgattttgatggtgattttttggttatattaacataagtgtatataaat taagtggttagtatacggtgtaaaagtggtataacgtatgtattaagagc agttatacaatatttg... Date Added: 2009-06-04 14:00:53 |
| 20-Wii.4p.ps Path: UCSC >> CMPE >> 112 Spring, 2009 Description: %!PS-Adobe-2.0 %DocumentFonts: Helvetica Helvetica-Bold Courier Courier-Bold %Title: stdin %Creator: psnup, Copyright (C) 1994 M. Herbert <rxkmh@minyos.xx.rmit.oz.au> %Revision: $Header: psnup.pro,v 2.2 94/06/14 14:39:29 rxkmh Locked 0%CreationDate: ... Date Added: 2009-06-04 14:01:42 |
| LectureSeven.ppt Path: UMass (Amherst) >> CS >> 491 Fall, 2009 Description: CS 491j : CSOMPG Lecture 7 : AI One CS 491J Computer Science of Multi-Player Games Problem Solving Representation Search Planning CS 491J Computer Science of Multi-Player Games Representation CS 491J Computer Science of Multi-Player Games S... Date Added: 2009-06-04 14:01:49 |
| QUALITY+lecture+3.ppt Path: Portland >> ISQA >> 449 Fall, 2008 Description: ISQA 572/ 449 Models for Quality Control/ Process Control and Improvement Dr. David Raffo Tel: 725-8508, Fax: 725-5850 Email: davidr@sba.pdx.edu Agenda Announcements Questions HW1 Control Charts (Variables) Cont. Quality Costs SPC Vs SQC (Insp... Date Added: 2009-06-04 14:02:18 |
| ak4.doc Path: Montana >> HOMEPAGE >> 301 Fall, 2009 Description: Homework 4 Demand Applications 1. A consumer\'s utility function is given by U(x,y) = 4x1/2 + y1/2 The consumer\'s income is I, the price of good y is Py and the price of good x is Px. a) What is the marginal rate of substitution? MUx = 2x-1/2 MUy = y... Date Added: 2009-06-04 14:02:57 |
| php-1.ppt Path: Montana >> CS >> 550 Fall, 2008 Description: PHP <PHP> <PHP> Hypertext Preprocessor (PHP)+ Hypertext Preprocessor - Vishu Introduction & History PHP: Hypertext Preprocessor, is one of the most popular server-side scripting languages for creating dynamic Web pages. PHP was created in 1994 by... Date Added: 2009-06-04 14:03:06 |
| polsex.txt Path: Texas A&M >> X >> 075 Fall, 2009 Description: HOW TO SPEAK ABOUT WOMEN AND BE POLITICALLY CORRECT She is not a BABE or a CHICK - She is a BREASTED AMERICAN She is not a SCREAMER or MOANER - She is VOCALLY APPRECIATIVE. She is not EASY - She is HORIZONTALLY ACCESSIBLE. ... Date Added: 2009-06-04 14:04:14 |
| lec05-mem.ppt Path: Texas A&M >> LEC >> 614 Fall, 2009 Description: CPSC 614:Graduate Computer Architecture Memory Technology Prof. Lawrence Rauchwerger Based on lectures by Prof. David Culler Prof. David Patterson UC Berkeley Main Memory Background Random Access Memory (vs. Serial Access Memory) Different flavors... Date Added: 2009-06-04 14:04:30 |
| lec05-mem.ppt Path: Texas A&M >> PEOPLE >> 614 Fall, 2009 Description: CPSC 614:Graduate Computer Architecture Memory Technology Prof. Lawrence Rauchwerger Based on lectures by Prof. David Culler Prof. David Patterson UC Berkeley Main Memory Background Random Access Memory (vs. Serial Access Memory) Different flavors... Date Added: 2009-06-04 14:04:30 |
| responsesecurity.doc Path: SUNY Albany >> MF >> 798378 Fall, 2009 Description: Michael Finnerty Reaction Paper 4/30/07 IST499 Elayna Manson, Joel Klimaszewski, and Michael Finnerty presented on Privacy and National Security. Overall it was a decent presentation but lacked any real excitement. I am writing a reaction paper to ... Date Added: 2009-06-04 14:05:27 |
| 2009-February.txt Path: UCSB >> ESM >> 202 Winter, 2008 Description: From esm202@bren.ucsb.edu Thu Feb 5 21:36:51 2009 From: esm202@bren.ucsb.edu (Canadian Pharmacy id4365) Date: Thu, 5 Feb 2009 13:36:51 -0800 (PST) Subject: [Esm202] [SPAM] RE: Message 34717 Message-ID: <20090205213651.0CC14351C0@ashcroft.icess.uc... Date Added: 2009-06-04 14:06:50 |
| GilbertSparseSystems.ppt Path: UCSB >> CS >> 240 Fall, 2009 Description: CS 240A: Solving Ax = b in parallel Dense A: Gaussian elimination with partial pivoting See Jim Demmel\'s slides Same flavor as matrix * matrix, but more complicated Sparse A: Iterative methods Conjugate gradients etc. Sparse matrix times dense ... Date Added: 2009-06-04 14:06:57 |
| output.txt Path: Washington >> V >> 12000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-GYVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_124 01/31/2008 06:54 PM <DIR> . 01/31/2008 06:54 P... Date Added: 2009-06-04 14:11:52 |
| output.txt Path: Washington >> V >> 15456 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-685QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2624 02/04/2008 12:06 PM <DIR> . 02/04/2008 12:06 ... Date Added: 2009-06-04 14:12:05 |
| log.txt Path: Washington >> V >> 10500 Fall, 2009 Description: 000 (44207.000.000) 01/29 22:08:37 Job submitted from host: <128.95.94.28:1098> . 001 (44207.000.000) 01/30 01:38:23 Job executing on host: <172.25.101.187:1064> . 006 (44207.000.000) 01/30 01:58:31 Image size of job updated: 464676 . 005 (44207.000.... Date Added: 2009-06-04 14:12:15 |
| problem26_25.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 26.25: The total power dissipated in the four resistors of Fig. 26.10a is given by the sum of: 2 2 P2 I 2 R2 0.5 A 2 0.5 W, P3 I 2 R3 0.5 A 3 0.75 W, P4 I 2 R4 Ptotal 0.5 A P2 2 4 P4 1 W, P7 P7 4 W. I 2 R7 0.5 A 2 7 1.8 W. P3 ... Date Added: 2009-06-04 14:14:41 |
| submit.txt Path: Washington >> V >> 11867 Fall, 2009 Description: executable = allgamma_11867.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:15:59 |
| submit.txt Path: Washington >> V >> 11803 Fall, 2009 Description: executable = allgamma_11803.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:16:34 |
| output.txt Path: Washington >> V >> 11555 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-9Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2224 01/30/2008 07:54 PM <DIR> . 01/30/2008 07:54 ... Date Added: 2009-06-04 14:16:42 |
| submit.txt Path: Washington >> V >> 11694 Fall, 2009 Description: executable = allgamma_11694.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:17:32 |
| error.txt Path: Washington >> V >> 15374 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 11:20:30 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 12:38:00 2008 ( 4650 s elapsed) ... Date Added: 2009-06-04 14:19:16 |
| error.txt Path: Washington >> JOBS >> 10099 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 02:33:32 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 02:45:47 2008 ( 735 s elapsed) ... Date Added: 2009-06-04 14:21:24 |
| error.txt Path: Washington >> JOBS >> 10022 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 02:27:48 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 02:39:03 2008 ( 675 s elapsed) ... Date Added: 2009-06-04 14:24:26 |
| output.txt Path: Washington >> JOBS >> 10446 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-B15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2764 02/07/2008 03:12 AM <DIR> . 02/07/2008 03:12 ... Date Added: 2009-06-04 14:24:36 |
| error.txt Path: Washington >> JOBS >> 10116 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 02:33:58 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 02:46:09 2008 ( 731 s elapsed) ... Date Added: 2009-06-04 14:25:17 |
| output.txt Path: Washington >> JOBS >> 10137 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-2W4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3060 02/07/2008 02:37 AM <DIR> . 02/07/2008 02:37 ... Date Added: 2009-06-04 14:25:40 |
| cs280-06 Instruction Set.ppt Path: MSOE >> CE >> 2800 Fall, 2009 Description: More on the Atmega32 instruction set Basic Instructions CS-280 Dr. Mark L. Hornick 1 Don\'t confuse instructions with directives Directives are used by the Assembler as it generates machine code from assembly instructions Directives are not conv... Date Added: 2009-06-04 14:27:02 |
| ICOM4015-lec11-f08.ppt Path: UPR Mayagüez >> ICOM >> 4015 Fall, 2009 Description: ICOM 4015: Advanced Programming Lecture 11 Chapter Eleven: Input/Output and Exception Handling ICOM 4015 Fall 2008 Big Java by Cay Horstmann Copyright 2008 by John Wiley & Sons. All rights reserved. Chapter Eleven: Input/Ouput and Exception Handl... Date Added: 2009-06-04 14:27:29 |
| tvac_hot_veto_hi_side_3_B.ps Path: Stanford >> EXP >> 080110 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: test_veto_side_3_B.ps: test_veto_side_3_B %Creator: ROOT Version 5.16/00 %CreationDate: Mon Jan 28 15:46:34 2008 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} d... Date Added: 2009-06-04 14:29:06 |
| vetoScan_ped.txt Path: Stanford >> EXP >> 070413 Fall, 2009 Description: #SYSTEM = acdCalib #instrument= LAT #timestamp = Fri Apr 13 10:23:22 2007 #calibType = ACD_Pedestal #algorithm = MeanValue #DTDVersion = v1r1 #fmtVersion = v1r1 #startTime = 77014355:70170 #stopTime = 77014355:367744 #triggers = 5986/5986/297575 #sou... Date Added: 2009-06-04 14:29:14 |
| BG205-Mod6-Part2-script.txt Path: Colorado State >> MOD >> 205 Fall, 2009 Description: <title=\"BG205_Mod6_Part2\"> <!stamp=\"BG205-Mod6-Part2-imp.jar 691231 17:00:00\"> <s=\"Fundamentals of Business Law\"> <t=> <!slideid=\"422\"> <video=\"> PROFESSOR RAY HOGLER Now the Clean Air Act basically says it tries to limit the emission of pollutant... Date Added: 2009-06-04 14:29:53 |
| 08.txt Path: Erskine >> PH >> 110 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|26 Aug 2000 21:28:41 -0000 vti_extenderversion:SR|4.0.2.2717 ... Date Added: 2009-06-04 14:30:46 |
| ANIMAL PHYLOGENY.ppt Path: Erskine >> BG >> 111 Fall, 2009 Description: OVERVIEW OF ANIMAL PHYLOGENY THE BASIC BODY PLANS ANIMAL CHARACTERISTICS Multicellular, eukaryotes. Heterotrophy by ingestion. No cell walls but intercellular junctions. Differentiated cells organized into tissues, organs, systems. Nervous t... Date Added: 2009-06-04 14:31:04 |
| Lect04.ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 211 Fall, 2008 Description: Physics 211: Lecture 4 Today\'s Agenda q q Recap of centripetal acceleration Newton\'s 3 laws (these describe all of classical mechanics!) How and why do objects move? Dynamics http:/www.devilducky.com/media/36846/ Physics 211: Lecture 4, Pg 1 De... Date Added: 2009-06-04 14:31:40 |
| rlist21.txt Path: Utah >> SPIN >> 134 Fall, 2009 Description: Block: 21 Size: 616 - Printing 282 polynomials . Maximum Degree: 12 -> -q^12+3q^11-3q^10+q^9 Maximum Coefficient: 16 -> 2q^6-8q^5+15q^4-16q^3+9q^2-2q - 0 1 q-1 q^2-2q+1 -q+1 -q^2+2q-1 q^3-3q^2+3q-1 q^3-2q^2+q q^2-q q^4-3q^3+3q^2-q -q^3+2q^2-q -q^2... Date Added: 2009-06-04 14:34:17 |
| kllist7.txt Path: Utah >> SPIN >> 103 Fall, 2009 Description: Block: 7 Size: 24 - Printing 5 polynomials . Maximum Degree: 2 -> q^2 Maximum Coefficient: 1 -> 1 - 0 1 q q^2 q+1 ... Date Added: 2009-06-04 14:34:23 |
| kllist47.txt Path: Utah >> SPIN >> 134 Fall, 2009 Description: Block: 47 Size: 77 - Printing 5 polynomials . Maximum Degree: 3 -> q^3 Maximum Coefficient: 1 -> 1 - 0 1 q q^2 q^3 ... Date Added: 2009-06-04 14:35:07 |
| MATH_2263A_Syllabus.doc Path: Valdosta >> MATH >> 2263 Fall, 2008 Description: Math 2263A Analytic Geometry and Calculus III, Spring 2009 Lectures : Instructor: Office:e-mail:Phone:- MTWR 2:00pm2:50pm , West Hall 00145 Dr. Jemal Mohammed-Awel Ashley Hall 223 jmohammedawel@valdosta.edu 333-5326 My Office Hours: MTWR 11:00am ... Date Added: 2009-06-04 14:35:11 |
| output.txt Path: Washington >> V >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS9 - local directory - Volume in drive C has no label. Volume Serial Number is DAF6-276D Directory of C:\\condor\\execute\\dir_1316 12/03/2007 06:55 AM <DIR> . 12/03/2007 06:55 AM <D... Date Added: 2009-06-04 14:36:17 |
| log.txt Path: Washington >> V >> 11000 Fall, 2009 Description: 000 (25841.000.000) 12/03 06:53:44 Job submitted from host: <128.95.94.28:4757> . 001 (25841.000.000) 12/03 10:29:39 Job executing on host: <172.25.101.165:1060> . 006 (25841.000.000) 12/03 10:49:47 Image size of job updated: 458640 . 006 (25841.000.... Date Added: 2009-06-04 14:37:13 |
| log.txt Path: Washington >> JOBS >> 31006 Fall, 2009 Description: 000 (56004.000.000) 02/10 19:07:49 Job submitted from host: <128.95.94.28:1098> . 001 (56004.000.000) 02/10 19:11:43 Job executing on host: <172.25.101.82:1056> . 006 (56004.000.000) 02/10 19:31:51 Image size of job updated: 398176 . 005 (56004.000.0... Date Added: 2009-06-04 14:37:59 |
| error.txt Path: Washington >> JOBS >> 31386 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 21:26:20 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 22:14:57 2008 ( 2917 s elapsed) ... Date Added: 2009-06-04 14:38:10 |
| output.txt Path: Washington >> JOBS >> 31488 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-F2WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2880 02/10/2008 09:54 PM <DIR> . 02/10/2008 09:54 ... Date Added: 2009-06-04 14:38:57 |
| log.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: 000 (56369.000.000) 02/10 19:09:36 Job submitted from host: <128.95.94.28:1098> . 001 (56369.000.000) 02/10 21:15:45 Job executing on host: <172.25.101.73:1057> . 006 (56369.000.000) 02/10 21:35:53 Image size of job updated: 449600 . 006 (56369.000.0... Date Added: 2009-06-04 14:40:34 |
| error.txt Path: Washington >> JOBS >> 31447 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 21:29:43 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 22:11:25 2008 ( 2502 s elapsed) ... Date Added: 2009-06-04 14:41:17 |
| output.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-F3WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3032 02/10/2008 09:34 PM <DIR> . 02/10/2008 09:34 ... Date Added: 2009-06-04 14:41:35 |
| error.txt Path: Washington >> V >> 11017 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 06:54:42 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 07:57:59 2007 ( 3797 s elapsed) ... Date Added: 2009-06-04 14:43:21 |
| log.txt Path: Washington >> V >> 11389 Fall, 2009 Description: 000 (25934.000.000) 12/03 06:54:21 Job submitted from host: <128.95.94.28:4757> . 001 (25934.000.000) 12/03 11:41:01 Job executing on host: <172.25.101.179:1056> . 006 (25934.000.000) 12/03 12:01:09 Image size of job updated: 412064 . 005 (25934.000.... Date Added: 2009-06-04 14:43:34 |
| submit.txt Path: Washington >> V >> 11096 Fall, 2009 Description: executable = allgamma_11096.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11000-11499/11... Date Added: 2009-06-04 14:44:14 |
| output.txt Path: Washington >> V >> 11283 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS4 - local directory - Volume in drive C has no label. Volume Serial Number is 7833-1AB3 Directory of C:\\condor\\execute\\dir_2720 12/03/2007 10:20 AM <DIR> . 12/03/2007 10:20 AM <D... Date Added: 2009-06-04 14:44:23 |
| Forest Site Preparation.ppt Path: Kentucky >> FOR >> 350 Fall, 2008 Description: Forest Site Preparation Definition: Purposeful treatment of the site to prepare for the regeneration process Applicable to natural and artificial regeneration Site preparation practices include: Removal of unwanted vegetation, slash and stumps, ... Date Added: 2009-06-04 14:46:00 |
| ASMT4LEE [v5.0].doc Path: SUNY Albany >> PAD >> 504 Fall, 2008 Description: PAD 504 - Problem Set #4 Page 1 PAD 504 - Problem Set #4 (1) Construct a spreadsheet representation for the population model described by Stokey and Zeckhauser on pp. 66-67. Use spreadsheet formulas similar to those in the footnote on p. 67 rather ... Date Added: 2009-06-04 14:46:22 |
| bisc312d01.txt Path: Sveriges lantbruksuniversitet >> SCI >> 19972 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: BISC 312-3 D01 LOCATION: SFU TITLE: ENVM\'T TOXICOLOGY I SECTION TYPE: LEC SEMESTER: 1997-2 ENROL: 10... Date Added: 2009-06-04 14:47:16 |
| bisc312d01.txt Path: Sveriges lantbruksuniversitet >> BISC >> 19972 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: BISC 312-3 D01 LOCATION: SFU TITLE: ENVM\'T TOXICOLOGY I SECTION TYPE: LEC SEMESTER: 1997-2 ENROL: 10... Date Added: 2009-06-04 14:47:16 |
| slides1-3.ppt Path: East Los Angeles College >> PX >> 389 Fall, 2009 Description: Relativistic Cosmology 1. Introduction & history of ideas 1500-1700 Stars Solar System, sun as a star: Copernicus (1473-1543) Galileo (1564-1642), Kepler (1571-1630), Newton (1642-1727) . HANDOUT IS NOT A COMPLETE SET OF LECTURE NOTES. YOU WILL CERT... Date Added: 2009-06-04 14:47:58 |
| dix-example.xls Path: Maple Springs >> CSE >> 4441 Fall, 2009 Description: Completion Time (s) by Icon Type Completion Time (s) Participant 1 2 3 4 5 6 7 8 9 10 mean sd Grand mean Percent longer Icon Type Natural Abstract 656 702 259 339 612 658 609 645 1049 1129 1135 1179 542 604 495 551 905 893 715 803 697.70 750.30 265.1... Date Added: 2009-06-04 14:48:01 |
| Debounce Design.ppt Path: Benjamin Franklin Institute of Technology >> ECE >> 5572 Fall, 2009 Description: Debounce Design Example debounce for one key key0 is the input from the push button and is active high signal key0_reg0 : std_logic; signal key0_reg1 : std_logic; process (clk, reset_n, key0) begin if (reset_n = \'0\') then key0_reg0 <= \'0\';... Date Added: 2009-06-04 14:51:11 |
| cs357_6.ps Path: UWO >> CS >> 357 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 125 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where ... Date Added: 2009-06-04 14:51:38 |
| cs641_3.ppt Path: UWO >> CS >> 641 Fall, 2009 Description: The Evolution of Video Games A Brief History from the 1800\'sPresent Ancestors of Video Games s s The beginnings of the video game industry can be traced back to the pinball machine industry. Pinball itself can be traced back to the 1... Date Added: 2009-06-04 14:51:40 |
| cs457_1_4.ps Path: UWO >> CS >> 457 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 3 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where { ... Date Added: 2009-06-04 14:52:12 |
| cs457_14.ps Path: UWO >> CS >> 457 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 34 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where {... Date Added: 2009-06-04 14:52:48 |
| prolog.ps Path: Carnegie Mellon >> CMT >> 751 Fall, 2009 Description: %BeginProlog 50 dict begin % This is a standard prolog for Postscript generated by Tk\'s canvas % widget. % SCCS: @(#) prolog.ps 1.5 96/02/17 17:45:11 % % % % The definitions below just define all of the variables used in any of the procedures here. T... Date Added: 2009-06-04 14:52:58 |
| UAV control pres.ppt Path: Calvin >> ENGR >> 315 Fall, 2009 Description: Flight Control Dynamics & UAVs Outline Their history Basic flight controls Roll Pitch Their benefits Where they are headed Questions Their History: The first UAV was developed in 1917 it was a crude motorized bomb They were develo... Date Added: 2009-06-04 14:53:48 |
| problem32_24.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 32.24: Recall that S E B , so : a) S = i ( ) = k. j j b) S = i = k. j c) S = ( k) ( i ) = . d) S = i ( k) = . j ... Date Added: 2009-06-04 14:56:03 |
| error.txt Path: Washington >> V >> 17000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 06 02:33:09 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 06 03:46:46 2008 ( 4417 s elapsed) ... Date Added: 2009-06-04 14:57:59 |
| log.txt Path: Washington >> V >> 17000 Fall, 2009 Description: 000 (50523.000.000) 02/05 23:53:01 Job submitted from host: <128.95.94.28:1098> . 001 (50523.000.000) 02/05 23:53:56 Job executing on host: <172.25.101.47:1056> . 006 (50523.000.000) 02/06 00:14:04 Image size of job updated: 457228 . 006 (50523.000.0... Date Added: 2009-06-04 14:58:17 |
| submit.txt Path: Washington >> V >> 17000 Fall, 2009 Description: executable = allgamma_17054.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs17000-17499/17... Date Added: 2009-06-04 14:59:20 |
| output.txt Path: Washington >> V >> 17000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2956 02/06/2008 02:25 AM <DIR> . 02/06/2008 02:25 ... Date Added: 2009-06-04 15:00:06 |
| log.txt Path: Washington >> V >> 17000 Fall, 2009 Description: 000 (50921.000.000) 02/05 23:57:42 Job submitted from host: <128.95.94.28:1098> . 001 (50921.000.000) 02/06 03:41:56 Job executing on host: <172.25.101.173:1056> . 006 (50921.000.000) 02/06 04:02:04 Image size of job updated: 417808 . 005 (50921.000.... Date Added: 2009-06-04 15:00:20 |
| solidworks candlestick.doc Path: Penn State >> NJI >> 5003 Fall, 2009 Description: Solidworks: Candlestick Assembly This was created by making two separate parts, the candle and the candlestick holder, and putting them together into one assembly. The candlestick holder required the use of the revolve and sweep tool in solidworks, w... Date Added: 2009-06-04 15:00:35 |
| BMB443W final proj.doc Path: Penn State >> KRK >> 166 Fall, 2009 Description: Katie Kolesar Enzyme #8 Molecular Weight = 27kDa Isoelectric point = 6.5 Stable up to 40oC And pH 5.5-10.0 Starting with 511.0 mg of protein the first step was an Ion Exchange column. The resin used was CM-cellulose, a cation exchange column. The be... Date Added: 2009-06-04 15:00:53 |
| ex1_spr04.doc Path: Washington >> ASTRO >> 101 Fall, 2009 Description: Astronomy 101A Exam 1 Spring Quarter 2004 Name _ Section _ TA _ For some of the multiple choice questions, it may seem that more than one answer SCORE: is correct. This is not the case (although there may be fine distinctions among the choices). Ho... Date Added: 2009-06-04 15:01:04 |
| sample-hw4sol.ps Path: Washington University in St. Louis >> CS >> 441 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: sample-hw4sol.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o sample-hw4sol.ps sample-hw4sol.dvi %DVIPSParamet... Date Added: 2009-06-04 15:01:34 |
| submit.txt Path: Washington >> JOBS >> 30116 Fall, 2009 Description: executable = pass6_30116.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30116... Date Added: 2009-06-04 15:02:33 |
| error.txt Path: Washington >> JOBS >> 30127 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 08:30:50 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 09:11:09 2008 ( 2419 s elapsed) ... Date Added: 2009-06-04 15:04:14 |
| submit.txt Path: Washington >> JOBS >> 30308 Fall, 2009 Description: executable = pass6_30308.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30308... Date Added: 2009-06-04 15:04:37 |
| log.txt Path: Washington >> JOBS >> 30340 Fall, 2009 Description: 000 (55337.000.000) 02/10 07:49:22 Job submitted from host: <128.95.94.28:1098> . 001 (55337.000.000) 02/10 09:26:21 Job executing on host: <172.25.101.84:1056> . 006 (55337.000.000) 02/10 09:46:30 Image size of job updated: 383692 . 005 (55337.000.0... Date Added: 2009-06-04 15:04:43 |
| submit.txt Path: Washington >> JOBS >> 30296 Fall, 2009 Description: executable = pass6_30296.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30296... Date Added: 2009-06-04 15:05:59 |
| log.txt Path: Washington >> JOBS >> 30000 Fall, 2009 Description: 000 (55396.000.000) 02/10 07:49:48 Job submitted from host: <128.95.94.28:1098> . 001 (55396.000.000) 02/10 10:00:55 Job executing on host: <172.25.101.195:3627> . 006 (55396.000.000) 02/10 10:21:03 Image size of job updated: 441660 . 005 (55396.000.... Date Added: 2009-06-04 15:06:01 |
| H-W 13.doc Path: Kent State >> ACCT >> 23020 Fall, 2008 Description: LO 4 EXERCISE 13-3 ACCOUNTS RECEIVABLE AND INVENTORY ANALYSES FOR COCA-COLA AND PEPSI 1. Calculations (all dollar amounts in millions): a. Accounts Receivable Turnover Ratio: Coca-Cola Company $19,805/[($1,798 + $1,666)/2] = $19,805/$1,732 = 11.4 t... Date Added: 2009-06-04 15:06:46 |
| India 1.ppt Path: BYU >> MANEC >> 358 Fall, 2008 Description: The Republic of India Presented by: Team 3 James Draper Brandon Patch Marcus Robinson Shawn Stanford Debesh Shrestha India Background Economic Situation International Aspects Special Problems The Future Demographics Located in South East Asia... Date Added: 2009-06-04 15:07:33 |
| Ge193.ppt Path: Caltech >> GE >> 193 Fall, 2008 Description: An introduction to Inverse Problems Ge193 Research School of Earth Sciences Australian National University Malcolm.Sambridge@anu.edu.au Malcolm Sambridge Visiting Caltech (GPS) until mid December Room 252F malcolms@gps.caltech.edu Course Content... Date Added: 2009-06-04 15:07:41 |
| Chapter11.ppt Path: Texas A&M >> CPSC >> 436 Fall, 2008 Description: Design, prototyping and construction Overview Prototyping and construction Conceptual design Physical design Generating prototypes Tool support Prototyping and construction What is a prototype? Why prototype? Different kinds of protot... Date Added: 2009-06-04 15:09:17 |
| PEDPeakMaximaRun0370.txt Path: Yale >> RUN >> 0370 Fall, 2009 Description: Run number 0370 Signals which were fit High Gain Fit signals tower 3 column 6 row 0 PED max 8.5 mean 11.1128 RMS 4.69657 number of entries 1329 rms/mean 0.422625 Fit signals tower 4 column 3 row 1 PED max 6.5 mean 8.14636 RMS 4.09367 number of entri... Date Added: 2009-06-04 15:10:19 |
| 00E1.ps Path: Los Angeles Southwest College >> M >> 550 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.85 Copyright 1999 Radical Eye Software %Title: 00E1.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips 00E1 -o %DVIPSParameters: dpi... Date Added: 2009-06-04 15:11:04 |
| 93E2.ps Path: Los Angeles Southwest College >> M >> 550 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 Copyright 1986-91 Radical Eye Software %Title: 92E2.dvi %Pages: 4 1 %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: resolution400.ps /SetResolution { /setres where { /setres get exec }{ pop } ifelse } def 400... Date Added: 2009-06-04 15:11:07 |
| BOM Senior Design.xls Path: RIT >> P >> 08004 Fall, 2009 Description: (reference to assy dwg) ITEM NUMBER PART NUMBER 9898K51 S116 8747K139 1685A13 1803A33 1544T3 9924K161 60525K14 01-88730 R314 01-89487 EXPLRWCLOSE 01-90862 8871T34 9640K232 YK0064PLNB64BL5 8874T14 - NBWHEEL40064BL5 - SC10APP062TAZN1 8507K52 VENDOR ... Date Added: 2009-06-04 15:11:17 |
| Herbert_The_Robot.ppt Path: U. Memphis >> COMP >> 7990 Fall, 2009 Description: Herbert The Robot Subsumption Architecture Presented by: Pavan Karnam Course: Control of Autonomous Agents Date: Oct 11, 2005 Introduction When and Where Developed in MIT AI Lab in 1988 By Rodney A. Brooks, Jonathan H. Connell, and Peter Ni... Date Added: 2009-06-04 15:11:53 |
| error.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 19 23:23:21 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 20 00:34:40 2008 ( 4279 s elapsed) ... Date Added: 2009-06-04 15:12:20 |
| submit.txt Path: Washington >> JOBS >> 80399 Fall, 2009 Description: executable = pass6_6_80399.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/803... Date Added: 2009-06-04 15:12:30 |
| submit.txt Path: Washington >> JOBS >> 80100 Fall, 2009 Description: executable = pass6_6_80100.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/801... Date Added: 2009-06-04 15:12:32 |
| submit.txt Path: Washington >> JOBS >> 80369 Fall, 2009 Description: executable = pass6_6_80369.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/803... Date Added: 2009-06-04 15:12:44 |
| output.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-285QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_808 02/20/2008 12:45 AM <DIR> . 02/20/2008 12:45 A... Date Added: 2009-06-04 15:12:51 |
| submit.txt Path: Washington >> JOBS >> 80424 Fall, 2009 Description: executable = pass6_6_80424.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/804... Date Added: 2009-06-04 15:14:07 |
| log.txt Path: Washington >> JOBS >> 80038 Fall, 2009 Description: 000 (62421.000.000) 02/19 20:23:43 Job submitted from host: <128.95.94.28:1092> . 001 (62421.000.000) 02/19 20:26:02 Job executing on host: <172.25.101.168:1062> . 005 (62421.000.000) 02/19 20:28:59 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 15:14:37 |
| log.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: 000 (62473.000.000) 02/19 20:23:51 Job submitted from host: <128.95.94.28:1092> . 001 (62473.000.000) 02/19 20:29:22 Job executing on host: <172.25.101.167:1060> . 005 (62473.000.000) 02/19 20:33:08 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 15:15:03 |
| error.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 19 20:51:49 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 19 22:02:26 2008 ( 4237 s elapsed) ... Date Added: 2009-06-04 15:15:08 |
| output.txt Path: Washington >> JOBS >> 80149 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_660 02/19/2008 10:07 PM <DIR> . 02/19/2008 10:07 P... Date Added: 2009-06-04 15:15:09 |
| log.txt Path: Washington >> JOBS >> 80239 Fall, 2009 Description: 000 (62622.000.000) 02/19 20:24:14 Job submitted from host: <128.95.94.28:1092> . 001 (62622.000.000) 02/19 20:39:33 Job executing on host: <172.25.101.165:1060> . 005 (62622.000.000) 02/19 20:43:31 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 15:15:21 |
| submit.txt Path: Washington >> JOBS >> 80125 Fall, 2009 Description: executable = pass6_6_80125.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/801... Date Added: 2009-06-04 15:17:28 |
| 041006-poster-greg-C.ppt Path: Ithaca College >> IC >> 030038 Fall, 2009 Description: Reduction of Parallax Error in Cesium Magnetometer Surveys using Laser Alignment Authors: G. Shear, M. Rogers, K. Faehndrich Ithaca College, Physics Department 1. A Parallax Error Magnetometer surveys frequently use a continuous surveying mode where... Date Added: 2009-06-04 15:18:54 |
| M1312 ASSN 2full.doc Path: U. Houston >> M >> 1312 Fall, 2009 Description: Math 1312 Assignment 2 Sections 1.5-1.7 Name: Grading ID: 1. Given XZ = 72, XY = 5x + 3 and YZ = 8x 9. Is Y the midpoint of XZ ? Explain your answer. 2. If BD bisects ABC , m ABD = 2(x 3) and DBC = (draw a picture first) 3x , find m ABD . 2 3... Date Added: 2009-06-04 15:19:51 |
| 05_gantt_rsvd.doc Path: Minnesota >> ME >> 4054 Fall, 2009 Description: ... Date Added: 2009-06-04 15:20:11 |
| Alternate Assignments.doc Path: Kent State >> CS >> 10051 Fall, 2008 Description: Alternate Assignments Dean Zeller CS10051 Fall, 2007 Optional - No due date 10 points Addendum to Syllabus: Alternate Assignments At times, optional assignments will be given out to check for interest in a particular topic. Completing an alternate a... Date Added: 2009-06-04 15:20:24 |
| Questions on Wajcman & Smith (Module 2).ppt Path: Allan Hancock College >> CMS >> 3011 Fall, 2009 Description: 1. Wajcman says (p. 6) that \"the compelling nature of much technological change is best explained by seeing technology not as outside society, but as inextricably part of society.\" Give examples of both points of view. McMahon Reading 1. Can you see... Date Added: 2009-06-04 15:21:50 |
| Presentation1.ppt Path: W. Alabama >> CHE >> 661 Fall, 2009 Description: ... Date Added: 2009-06-04 15:22:34 |
| hw4_sol.doc Path: W. Alabama >> CHE >> 037 Fall, 2009 Description: ... Date Added: 2009-06-04 15:22:48 |
| W05 ChE101 Asst 5 Solution.doc Path: W. Alabama >> CHE >> 101 Fall, 2009 Description: ChE 101 Assignment 5 -Solutions (xw)max = (1.99 * 10 - 4)(500 psia ) = 0.25 lb - moledissolvedW lb - molesolution 0.398 psia / molefraction xw = 0.50 (0.25) = 0.2 lb - moleW n 5= 69.0 = n6/(n5 + n6) n6=17.25 lb-mole W/d lb - mole Solvent str... Date Added: 2009-06-04 15:22:57 |
| chap05a.ppt Path: W. Alabama >> CHE >> 725 Fall, 2009 Description: Chapter 5 Weighted Residual Methods (WRMs) Weighted Residual Methods Finite Differences Weighted residuals z x y C.V. Continuous shape function Integral formulation for each element Minimize weighted residual for an arbitrary control vol... Date Added: 2009-06-04 15:23:03 |
| Inherently Safer Design.ppt Path: W. Alabama >> CHE >> 720 Fall, 2009 Description: Overview of Process Safety, Green Engineering, and Inherently Safer Design Harry J. Toups LSU Department of Chemical Engineering with significant material from SACHE 2003 Workshop presentation entitled: Inherently Safer Design, by Dennis Hendershot ... Date Added: 2009-06-04 15:23:04 |
| chap1.doc Path: W. Alabama >> CHE >> 025 Fall, 2009 Description: ... Date Added: 2009-06-04 15:23:21 |
| Inherently Safer Design.ppt Path: W. Alabama >> CHE >> 720 Fall, 2009 Description: Overview of Process Safety, Green Engineering, and Inherently Safer Design Harry J. Toups LSU Department of Chemical Engineering with significant material from SACHE 2003 Workshop presentation entitled: Inherently Safer Design, by Dennis Hendershot ... Date Added: 2009-06-04 15:23:43 |
| Stem Cell.doc Path: W. Alabama >> ENVE >> 482 Fall, 2009 Description: Two projects are available in the laboratory of Prof. Jervis. These projects involve the design and testing of novel stem cell culture bioreactors. One project is focused on the development of a high throughput system for stem cell imaging, while the... Date Added: 2009-06-04 15:23:46 |
| BNP.ps Path: Duke >> STA >> 293 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: BNP.dvi %Pages: 5 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips BNP.dvi %DVIPSParameters: dpi=... Date Added: 2009-06-04 15:25:12 |
| lec13_arithmetic.ppt Path: Auburn >> E >> 6200 Fall, 2009 Description: ELEC 5200-001/6200-001 Computer Architecture and Design Spring 2009 Computer Arithmetic (Chapter 3) Vishwani D. Agrawal James J. Danaher Professor Department of Electrical and Computer Engineering Auburn University, Auburn, AL 36849 http:/www.eng.au... Date Added: 2009-06-04 15:26:51 |
| exam1_questions_corrections.txt Path: UMBC >> EXAM >> 341 Spring, 2009 Description: Corrections to Review Questions for Exam 1 > Question 19: Should read \"Use the given operations for SmQueue and SlStack\", not \"SmQueue and SlList\" > Question 26: Asymptotic time performance should be for the average cases > Question... Date Added: 2009-06-04 15:28:55 |
| error.txt Path: Washington >> V >> 16651 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 11:42:42 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 13:09:53 2008 ( 5231 s elapsed) ... Date Added: 2009-06-04 15:32:02 |
| submit.txt Path: Washington >> V >> 16908 Fall, 2009 Description: executable = allgamma_16908.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:32:20 |
| submit.txt Path: Washington >> V >> 16659 Fall, 2009 Description: executable = allgamma_16659.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:32:21 |
| error.txt Path: Washington >> V >> 16516 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 10:10:44 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 11:26:47 2008 ( 4563 s elapsed) ... Date Added: 2009-06-04 15:32:38 |
| submit.txt Path: Washington >> V >> 16588 Fall, 2009 Description: executable = allgamma_16588.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:32:59 |
| Points Lines Planes.doc Path: TAMU Commerce >> M >> 352 Fall, 2009 Description: Points, Lines, and Planes ... Date Added: 2009-06-04 15:34:05 |
| IntroductionToJavaBeans.ppt Path: Bellevue >> CIS >> 400 Fall, 2009 Description: Introduction to Java Beans Bhim Prasad Upadhyaya International Institute for Software Technology United Nations University P.O. Box 3058 Macau E-mail: bhim@iist.unu.edu Components Components are [5] : 1. self-contained, 2. reusable software units ... Date Added: 2009-06-04 15:35:21 |
| Rahman197.ps Path: Allan Hancock College >> CCP >> 197 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft Word - Aus03Tem.doc %Creator: Windows NT 4.0 %CreationDate: 11:43 7/21/2000 %Pages: (atend) %BoundingBox: 13 13 599 780 %LanguageLevel: 2 %D... Date Added: 2009-06-04 15:35:51 |
| kine4300practice_final_2002.doc Path: Texas Permian Basin >> KINE >> 4300 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|20 Oct 2006 22:20:52 -0000 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|PC12302\\eldridge_j vti_modifiedby:SR|PC12302\\eldridge_j vti_timecreated:TR|20 Oct 2006 22:20:52 -0000 vti_cacheddtm:TX|20 Oct 2... Date Added: 2009-06-04 15:37:06 |
| The Health Fitness Award.doc Path: Texas Permian Basin >> KINE >> 4300 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|20 Oct 2006 22:42:02 -0000 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|PC12302\\eldridge_j vti_modifiedby:SR|PC12302\\eldridge_j vti_timecreated:TR|20 Oct 2006 22:42:02 -0000 vti_cacheddtm:TX|20 Oct 2... Date Added: 2009-06-04 15:37:07 |
| output.txt Path: Washington >> JOBS >> 32422 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS7 - local directory - Volume in drive C has no label. Volume Serial Number is 10A2-98BD Directory of C:\\condor\\execute\\dir_2276 02/11/2008 03:12 AM <DIR> . 02/11/2008 03:12 AM <D... Date Added: 2009-06-04 15:38:16 |
| error.txt Path: Washington >> JOBS >> 32364 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 02:59:05 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 03:42:10 2008 ( 2585 s elapsed) ... Date Added: 2009-06-04 15:39:14 |
| output.txt Path: Washington >> JOBS >> 32476 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-20WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3344 02/11/2008 03:33 AM <DIR> . 02/11/2008 03:33 ... Date Added: 2009-06-04 15:39:20 |
| submit.txt Path: Washington >> JOBS >> 32348 Fall, 2009 Description: executable = pass6_32348.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs32000-32499/32348... Date Added: 2009-06-04 15:40:11 |
| log.txt Path: Washington >> JOBS >> 32031 Fall, 2009 Description: 000 (57029.000.000) 02/10 19:23:18 Job submitted from host: <128.95.94.28:1098> . 001 (57029.000.000) 02/11 01:00:08 Job executing on host: <172.25.101.193:1063> . 006 (57029.000.000) 02/11 01:20:16 Image size of job updated: 404260 . 005 (57029.000.... Date Added: 2009-06-04 15:40:17 |
| submit.txt Path: Washington >> JOBS >> 32000 Fall, 2009 Description: executable = pass6_32455.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs32000-32499/32455... Date Added: 2009-06-04 15:41:23 |
| error.txt Path: Washington >> JOBS >> 32134 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 01:40:21 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 02:22:48 2008 ( 2547 s elapsed) ... Date Added: 2009-06-04 15:41:33 |
| error.txt Path: Washington >> JOBS >> 32496 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 03:42:16 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 04:23:39 2008 ( 2483 s elapsed) ... Date Added: 2009-06-04 15:42:25 |
| log.txt Path: Washington >> JOBS >> 32000 Fall, 2009 Description: 000 (57315.000.000) 02/10 19:24:41 Job submitted from host: <128.95.94.28:1098> . 001 (57315.000.000) 02/11 02:32:41 Job executing on host: <172.25.101.194:1070> . 006 (57315.000.000) 02/11 02:52:50 Image size of job updated: 397084 . 005 (57315.000.... Date Added: 2009-06-04 15:42:46 |
| Math WebQuest-CS.doc Path: NMSU >> ELT >> 36802 Fall, 2009 Description: Single Number Addition and Subtraction Teacher Page A WebQuest for 1st Grade Mathematics Designed by Chantelle Savage chants@nmsu.edu Introduction | Activity | Standards | Process | Resources | Evaluation | Conclusion | Credits Introduction Stude... Date Added: 2009-06-04 15:43:42 |
| LesPlan for writing comic.doc Path: NMSU >> ELT >> 51890 Fall, 2009 Description: Lesson Plan: Creating a Comic Strip Objectives: Design an original cartoon character Understand the creative process and development of a cartoon from brainstorming to final draft Demonstrate competence in the general skills and strategies of th... Date Added: 2009-06-04 15:45:16 |
| All solutions.doc Path: NMSU >> ELT >> 36802 Fall, 2009 Description: PAIRS: 3: 4: 5: 6: 7: 8: 9: 10: 11: 12: 13: 14: 15: 16: 17: 1,2; 1,3; 1,4; 2,3; 1,5; 2,4; 1,6; 2,5; 3,4; 1,7; 2,6; 3,5; 1,8; 2,7; 3,6; 4,5; 1,9; 2,8; 3,7; 4,6; 2,9; 3,8; 4,7; 5,6; 3,9; 4,8; 5,7; 4,9; 5,8; 6,7; 5,9; 6,8; 6,9; 7,8; 7,9; 8,9; TRIPLETS:... Date Added: 2009-06-04 15:46:12 |
| vhwpsld1.txt Path: Austin CC >> C >> 650 Fall, 2009 Description: SET CURRENT SQLID = \'TNT171?\'; 00010005 COMMIT; 00020000 00030000 -DROP VI... Date Added: 2009-06-04 15:50:01 |
| error.txt Path: Washington >> JOBS >> 11593 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:40:57 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:52:46 2008 ( 709 s elapsed) ... Date Added: 2009-06-04 15:51:00 |
| output.txt Path: Washington >> JOBS >> 11712 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-61WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3388 02/07/2008 05:53 AM <DIR> . 02/07/2008 05:53 ... Date Added: 2009-06-04 15:52:13 |
| psend.doc Path: UMass Lowell >> CS >> 516 Fall, 2009 Description: PSEND(2) Xinu Programmer\'s Manual PSEND(2) NAME psend - send a message to a port SYNOPSIS int psend(portid, message) int portid; char *message; DESCRIPTION _#P_#s_#e_#n_#d adds the pointer _#m_#e_#s_#s_#a_#g_#e to the port _#p_#o_#r_#t_#i_#d. If s... Date Added: 2009-06-04 15:52:28 |
| error.txt Path: Washington >> JOBS >> 11500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:38:24 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:50:10 2008 ( 706 s elapsed) ... Date Added: 2009-06-04 15:53:07 |
| output.txt Path: Washington >> JOBS >> 11620 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G0WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3672 02/07/2008 05:41 AM <DIR> . 02/07/2008 05:41 ... Date Added: 2009-06-04 15:53:58 |
| submit.txt Path: Washington >> JOBS >> 11911 Fall, 2009 Description: executable = pass6_11911.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11500-11999/11911... Date Added: 2009-06-04 15:53:59 |
| output.txt Path: Washington >> JOBS >> 11781 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5V4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1132 02/07/2008 06:02 AM <DIR> . 02/07/2008 06:02 ... Date Added: 2009-06-04 15:56:14 |
| output.txt Path: Washington >> JOBS >> 11914 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-315QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3324 02/07/2008 06:17 AM <DIR> . 02/07/2008 06:17 ... Date Added: 2009-06-04 15:57:09 |
| BIT1-2003-Spreadsheet-errors-Lab-97.doc Path: East Los Angeles College >> BIT >> 17583 Fall, 2009 Description: BIT1 Laboratory Exercise 26th March 2004 Revisiting Spreadsheets Spreadsheets are a useful tool for modelling, and testing out ideas. However, are they always the best tool for a modelling or analysis task? Are there any problems with spreadsheets wh... Date Added: 2009-06-04 15:58:05 |
| log.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: 000 (57619.000.000) 02/11 10:24:45 Job submitted from host: <128.95.94.28:1098> . 001 (57619.000.000) 02/11 10:32:33 Job executing on host: <172.25.101.68:1057> . 006 (57619.000.000) 02/11 10:52:41 Image size of job updated: 328200 . 022 (57619.000.0... Date Added: 2009-06-04 15:59:20 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 11:16:31 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 12:32:35 2008 ( 4564 s elapsed) ... Date Added: 2009-06-04 15:59:57 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 19:20:14 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 20:35:27 2008 ( 4513 s elapsed) ... Date Added: 2009-06-04 16:01:22 |
| output.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-61WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_824 02/11/2008 11:14 AM <DIR> . 02/11/2008 11:14 A... Date Added: 2009-06-04 16:02:46 |
| submit.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: executable = pass6_40324.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40324... Date Added: 2009-06-04 16:04:23 |
| submit.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: executable = pass6_40374.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40374... Date Added: 2009-06-04 16:04:29 |
| rfc1321.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group R. Rivest Request for Comments: 1321 MIT Laboratory for Computer Science and RSA Data Security, Inc. ... Date Added: 2009-06-04 16:08:51 |
| rfc1451.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group J. Case Request for Comments: 1451 SNMP Research, Inc. K. McCloghrie ... Date Added: 2009-06-04 16:10:21 |
| Limits.doc Path: Bryn Mawr >> MATH >> 1351 Fall, 2009 Description: Limits ... Date Added: 2009-06-04 16:13:09 |
| log.txt Path: Washington >> V >> 13000 Fall, 2009 Description: 000 (27812.000.000) 12/04 12:04:51 Job submitted from host: <128.95.94.28:4757> . 001 (27812.000.000) 12/04 14:49:08 Job executing on host: <172.25.101.196:1057> . 006 (27812.000.000) 12/04 15:09:16 Image size of job updated: 424656 . 005 (27812.000.... Date Added: 2009-06-04 16:18:50 |
| d0642.pdf Path: Yale >> D >> 1982 Fall, 2009 Description: ... Date Added: 2009-06-04 16:22:37 |
| Urinary system-session2.ppt Path: East Los Angeles College >> GM >> 5094 Fall, 2009 Description: The Renal System (2) Dr Hora Ejtehadi Ext.5489 B704 Learning Objectives Renal System By the end of the session(s), you will be able to: Understand the significance of alterations in glomerular filtration rate. Recall the function... Date Added: 2009-06-04 16:23:22 |
| discussion5.ppt Path: Cornell >> CS >> 430 Fall, 2008 Description: Discussion Class 5 Latent Semantic Indexing 1 Discussion Classes Format: Question Ask a member of the class to answer Provide opportunity for others to comment When answering: Give your name. Make sure that the TA hears it. Stand up Speak clearly s... Date Added: 2009-06-04 16:24:19 |
| Nov30.ps Path: Old Dominion >> CS >> 281 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: root.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o root.ps root.dvi %DVIPSParam... Date Added: 2009-06-04 16:26:27 |
| SSRD_LCO_F06a_T20_v1.7.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: System and Software Requirements Definition (SSRD) ONLINE REQUIREMENT NEGOTIATION SUPPORT SYSTEM TEAM # 20 Hasan Kitapci - Client Sohil Sethi Feasibility Rationale Aditi Bhargava - OCD Deepak Wadhwani - Requirements Himanshu Retarekar LCP Prajwal... Date Added: 2009-06-04 16:26:41 |
| old4.txt Path: Sveriges lantbruksuniversitet >> CS >> 308 Fall, 2009 Description: CMPT 308 Lecture 4 (Variants of TM: k-tape and nondeterministic Turing machines) Read: pp. 173-182 (pp. 159-168 old ed.) Recall that a Turing machine computes by starting in the initial configuration (in state q_start, with the tape head scanning t... Date Added: 2009-06-04 16:26:59 |
| Pr04F06.ps Path: Texas >> PHY >> 387 Spring, 1998 Description: ... Date Added: 2009-06-04 16:27:18 |
| Pr05F01.ps Path: Texas >> PHY >> 387 Spring, 1998 Description: ... Date Added: 2009-06-04 16:27:19 |
| probset_12.ps Path: Oregon >> PH >> 613 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: probset_12.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips probset_12 %DVIPSParameter... Date Added: 2009-06-04 16:28:20 |
| chapter03.ppt Path: VCU >> INFO >> 360 Fall, 2008 Description: Chapter 3 INFORMATION SYSTEMS, ORGANIZATIONS, MANAGEMENT, AND STRATEGY 3.1 2003 by Prentice Hall Essentials of Management Information Systems Chapter 3 Information Systems , Organizations, Management, and Strategy OBJECTIVES What do managers ne... Date Added: 2009-06-04 16:28:35 |
| Epilespy_Take_Home_Exam.doc Path: Allegheny >> INTDS >> 315 Fall, 2009 Description: LS 315 Take Home exam Spring 2005 This is a take-home exam. You may use your text and any of the readings covered thus far in the course. This exam is to be typed, double-spaced and all sources cited in the text and the reference list at the end of t... Date Added: 2009-06-04 16:28:47 |
| output.txt Path: Washington >> V >> 14000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3228 02/02/2008 04:07 PM <DIR> . 02/02/2008 04:07 ... Date Added: 2009-06-04 16:29:06 |
| log.txt Path: Washington >> V >> 14000 Fall, 2009 Description: 000 (47781.000.000) 02/02 08:26:11 Job submitted from host: <128.95.94.28:1098> . 001 (47781.000.000) 02/02 15:42:05 Job executing on host: <172.25.101.195:3627> . 006 (47781.000.000) 02/02 16:02:13 Image size of job updated: 375500 . 005 (47781.000.... Date Added: 2009-06-04 16:31:50 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 15:45:45 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 17:08:55 2008 ( 4990 s elapsed) ... Date Added: 2009-06-04 16:31:55 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14091.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:32:06 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14075.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:32:30 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 15:47:30 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 16:57:45 2008 ( 4215 s elapsed) ... Date Added: 2009-06-04 16:32:50 |
| inputInvalid.txt Path: UMass (Amherst) >> ECE >> 122 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|06 Apr 2008 19:32:08 -0000 vti_extenderversion:SR|5.0.2.2623 vti_backlinkinfo:VX|syllabus.html ... Date Added: 2009-06-04 16:33:35 |
| ref6.txt Path: UMBC >> CS >> 202 Fall, 1997 Description: everest% CC ref6.C everest% everest% a.out Before: x = 3, y = 17, z = 0 After: x = 4, y = 17, z = 21 Before: x = 4, z = 21 After: x = 5, z = 11 everest% ... Date Added: 2009-06-04 16:33:51 |
| balance1.txt Path: UMBC >> CS >> 201 Fall, 2000 Description: lassie% cc201 -o balance1 balance1.c lassie% lassie% balance1 This program helps you balance your checkbook. Enter each check and deposit during the month. To indicate a check, use a minus sign. Signal the end of the month with a 0 value. Enter the... Date Added: 2009-06-04 16:34:11 |
| submit.txt Path: Washington >> V >> 10000 Fall, 2009 Description: executable = allgamma_10302.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs10000-10499/10... Date Added: 2009-06-04 16:35:30 |
| output.txt Path: Washington >> V >> 10134 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS3 - local directory - Volume in drive C has no label. Volume Serial Number is 7A24-68F3 Directory of C:\\condor\\execute\\dir_2132 01/29/2008 04:52 PM <DIR> . 01/29/2008 04:52 PM <D... Date Added: 2009-06-04 16:37:11 |
| output.txt Path: Washington >> V >> 10063 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS5 - local directory - Volume in drive C has no label. Volume Serial Number is FE9C-6B88 Directory of C:\\condor\\execute\\dir_3544 01/29/2008 11:52 AM <DIR> . 01/29/2008 11:52 AM <D... Date Added: 2009-06-04 16:37:49 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05101726 Fall, 2009 Description: 05101726... Date Added: 2009-06-04 16:39:07 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05101726 Fall, 2009 Description: 05101726... Date Added: 2009-06-04 16:39:07 |
| DistributionRenalElimination.ppt Path: W. Alabama >> CHEM >> 434 Fall, 2009 Description: Drug distribution: Compartments Intracellular volume (40% body weight) Interstitial volume (15% body weight) Intravascular volume (5% body weight) Body fat (several % body weight) Factors affecting the equilibrium distribution of drugs across the ... Date Added: 2009-06-04 16:39:57 |
| proj1.ps Path: Stanford >> CS >> 155 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: proj1.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMR17 CMR10 CMBX12 CMTT10 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVI... Date Added: 2009-06-04 16:40:13 |
| Queen Victoria.ppt Path: JMU >> BIO >> 430 Fall, 2008 Description: Queen Victoria: Hemophilia & Porphyria Adam Edwards Bobby Orr Dave Grkovic Danielle Heinbaugh Queen Victoria and the Royal Family The traditional view is that there was a mutation in either Queen Victoria, or in a sperm of her father, Edward Augu... Date Added: 2009-06-04 16:40:48 |
| earlyU.ps Path: Minnesota >> A >> 5022 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: chapter2.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips chapter2.dvi -o chapter2... Date Added: 2009-06-04 16:42:02 |
| Outline2008.doc Path: UWO >> AS >> 2053 Fall, 2009 Description: Instructor Mrs. M. Millard Mr. S. Kopp Mr. Xing Jiang Sec 001 002 570 The University of Western Ontario Department of Statistical and Actuarial Sciences ACTUARIAL SCIENCE 2053 Mathematics for Financial Analysis - 2008-09 Day/Time Location email M 1... Date Added: 2009-06-04 16:42:21 |
| lecture05_supplement.ppt Path: UC Davis >> ERS >> 186 Fall, 2008 Description: Surface Roughness Surface Roughness There is aarelationship between the wavelength of the radar There is relationship between the wavelength of the radar (),the depression angle (),and the local height of objects (h ), the depression angle ), and th... Date Added: 2009-06-04 16:42:27 |
| ch_6_Iran.ppt Path: U. Memphis >> ESCI >> 1301 Fall, 2008 Description: Iran Arg-e Bam castle, built before 500 B.C. Persepolis: 515 BC Palaces, Terrace, Great Hall, Tombs. Persepolis Persepolis Modern Tehran, Iran Modern Tehran, Iran Tehran Tehran Tehran Tehran Tehran Persian religious history Historically... Date Added: 2009-06-04 16:43:38 |
| ch_6_Iran.ppt Path: U. Memphis >> CHAPTER >> 1301 Fall, 2009 Description: Iran Arg-e Bam castle, built before 500 B.C. Persepolis: 515 BC Palaces, Terrace, Great Hall, Tombs. Persepolis Persepolis Modern Tehran, Iran Modern Tehran, Iran Tehran Tehran Tehran Tehran Tehran Persian religious history Historically... Date Added: 2009-06-04 16:43:38 |
| solukeyt2b.doc Path: UNL >> MATH >> 104 Fall, 2008 Description: ... Date Added: 2009-06-04 16:45:45 |
| 4470 Lecture 8 2008.ppt Path: Auburn >> ENG >> 4470 Fall, 2009 Description: Advanced Distillation Column Modelling and Reactive Distillation Presented to the Auburn University Dept. of Chemical Engineering Senior Design Class Jeffrey R. Seay, P.E. Senior Process Engineer Evonik Degussa Corporation 7 February 2008 Sodium M... Date Added: 2009-06-04 16:49:44 |
| Exam2KEY.doc Path: Washington >> PSY >> 101 Fall, 2009 Description: Question # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 Version A C A B C B D C C C B C C B A D D B C A B C C C A D B or D D B A D B C B D A D C A D B Version B C C C B D A D B C B D... Date Added: 2009-06-04 16:49:53 |
| keyT202.pdf Path: UT Arlington >> EE >> 5351 Fall, 2008 Description: ... Date Added: 2009-06-04 16:49:59 |
| l8g.txt Path: Lynchburg College >> CS >> 142 Fall, 2009 Description: Grading for Lab 8 Compiles? Runs? Priority\'s priority data member Priority:enqueue Priority:dequeue demo option Driver Indenting & clarity Friendly 10 free ... Date Added: 2009-06-04 16:50:37 |
| all.ps Path: Cal Poly >> WEEK >> 402 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: groff version 1.18.1 %CreationDate: Mon Oct 6 07:26:59 2003 %DocumentSuppliedResources: procset grops 1.18 1 %Pages: 0 %PageOrder: Ascend %Orientation: Landscape %EndComments %BeginProlog %BeginResource: procset grops 1.18 1 ... Date Added: 2009-06-04 16:50:53 |
| log.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: 000 (53290.000.000) 02/07 04:22:12 Job submitted from host: <128.95.94.28:1098> . 001 (53290.000.000) 02/07 05:00:54 Job executing on host: <172.25.101.195:3627> . 005 (53290.000.000) 02/07 05:13:17 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 16:52:58 |
| error.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:04:31 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:15:48 2008 ( 677 s elapsed) ... Date Added: 2009-06-04 16:56:13 |
| importance.doc Path: Princeton >> COS >> 526 Fall, 2009 Description: Importance Sampling of the Phong Reflectance Model Jason Lawrence We first describe the Phong reflectance model and it\'s associated brdf. We then offer practical advice regarding the implementation of importance sampling in the context of this reflec... Date Added: 2009-06-04 16:56:53 |
| final-info.ps Path: Princeton >> CS >> 423 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: final-info.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -o final-info.ps final-inf... Date Added: 2009-06-04 16:57:13 |
| 01-March_3_Soil_Food_Web_seminar.doc Path: UC Davis >> LOG >> 0803 Fall, 2009 Description: Managing soil food webs for improved nutrient cycling and pest suppression: Lessons from prairies, cover crops and organic systems. March 3rd 4:10 102 Hutchinson Hall Presented by: Tianna DuPont Integrated Pest Management Graduate Group Depa... Date Added: 2009-06-04 16:57:39 |
| Adriaan Lanni.rtf Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: Adriaan Lanni http:/legalhistoryblog.blogspot.com/2 007/10/lakin-reviews-lanni-law-andjustice-in.html http:/www.stoa.org/projects/demos/in tro_legal_system.pdf http:/www.stoa.org/projects/demos/ar ticle_intro_legal_system? page=1&greekEncoding= ... Date Added: 2009-06-04 16:58:06 |
| neaera_quiz.doc Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: :TYPE:MC:1:0:C :TITLE:01 :QUESTION:H Who was Phano? :IMAGE:quiz_images/Image.jpg :ANSWER1:100:H the daughter of Neaera :ANSWER2:0:H the wife of Stephanus :ANSWER3:0:H the daughter of Apollodorus :CAT:quiz9 :TYPE:MC:1:0:C :TITLE:02 :QUESTION:H How wer... Date Added: 2009-06-04 16:58:29 |
| OrphismThurii.rtf Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: OrphismThurii = http:/www.filosofico.net/orfismo.html Le altre laminette, a, b, c, trovate pure a Thurii ma nel timpone piccolo in una sepoltura unica di famiglia o di sodalizio, sono la copia di un medesimo originale, salvo, nella seconda e nella ... Date Added: 2009-06-04 16:58:35 |
| cs496_s03_lecture01_intro.ppt Path: Princeton >> CS >> 496 Fall, 2009 Description: CS 496: Computer Vision Thanks to Chris Bregler CS 496: Computer Vision Instructor: Szymon Rusinkiewicz smr@cs.princeton.edu Course web page http:/www.cs.princeton.edu/courses/cs496/ What is Computer Vision? Input: images or video Output: des... Date Added: 2009-06-04 17:00:32 |
| answers_hw03_rjc_2003.doc Path: Texas A&M >> STAT >> 651 Fall, 2008 Description: Homework #3, STAT 651 2. Distance from the Highway Case Processing Summary Cases Missing N Percent 0 .0% 0 .0% Number of Red Petals Distance from the Highway Near the highway Far from the highway Valid N Percent 100 100.0% 100 100.0% Total N 100... Date Added: 2009-06-04 17:01:58 |
| dss_radec.txt Path: Berkeley >> ASTRO >> 00348428 Fall, 2009 Description: #ra dec rmag drmag 239.728009 35.139682 15.534 0.042 239.734255 35.134979 17.808 0.056 239.434302 35.135309 16.191 0.042 239.490396 35.134076 18.679 0.093 239.906426 35.141644 16.152 0.042 239.525275 35.134791 18.304 0.072 239.868507 35.140009 16.809... Date Added: 2009-06-04 17:02:39 |
| swb_pha.txt Path: Berkeley >> ASTRO >> 00148646 Fall, 2009 Description: ; Instrument bat ; Exposure 45.300000 ; xunit keV ; bintype counts 0.00000 10.0000 -0.075248422 0.079389344 10.0000 12.0000 0.082710132 0.090840556 12.0000 14.0000 0.10799791 0.11545... Date Added: 2009-06-04 17:02:59 |
| dss_radec.txt Path: Berkeley >> ASTRO >> 00313417 Fall, 2009 Description: #ra dec rmag drmag 195.042328 15.686575 16.690 0.006 194.862034 15.678950 16.665 0.006 194.936714 15.673637 16.633 0.006 194.931544 15.670887 18.645 0.031 194.721351 15.672659 19.301 0.056 194.957969 15.673208 17.841 0.015 195.158103 15.671074 17.748... Date Added: 2009-06-04 17:03:23 |
| swb15-350lc.txt Path: Berkeley >> ASTRO >> 00286373 Fall, 2009 Description: # t-869703967.910000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -237.910000 -0.010451 0.005588 0.001212 0.005820 -0.011686 0.005258 -0.004967 0.005149 -236.910000 -0.005830 0.005803 -0.010581 0.00581... Date Added: 2009-06-04 17:03:41 |
| swb_trig.txt Path: Berkeley >> ASTRO >> 00304549 Fall, 2009 Description: # S/N T1 T2 T90 T50 # Estimated T100 Interval: 1.130 53.570 T90= 44.641 17.5 1.330 5.770 3.880 1.960 7.3 6.090 53.570 43.321 30.721 ... Date Added: 2009-06-04 17:04:09 |
| swbz_15-350lc.txt Path: Berkeley >> ASTRO >> 00234516 Fall, 2009 Description: # t-845266760.960000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -172.460000 -0.022322 0.054362 -0.044087 0.047431 -0.126592 0.050619 0.020284 0.036190 -172.310000 -0.046469 0.045978 -0.039943 0.04271... Date Added: 2009-06-04 17:04:27 |
| swb_pha.txt Path: Berkeley >> ASTRO >> 00152325 Fall, 2009 Description: ; Instrument bat ; Exposure 67.830000 ; xunit keV ; bintype counts 0.00000 10.0000 0.0067218567 0.017108112 10.0000 12.0000 0.075486401 0.079140690 12.0000 14.0000 0.18967367 0.19074... Date Added: 2009-06-04 17:06:00 |
| radvt.txt Path: Berkeley >> ASTRO >> 00338338 Fall, 2009 Description: # t1 t2 dt rad_min rad_max cts err scl bg bg_rat wt 0.083966 0.087012 0.003046 0. 16. 1.72 1.44 0.854641 1.000000 0.279570 1 0.088803 0.106354 0.017551 2. 16. 14.88 ... Date Added: 2009-06-04 17:06:34 |
| swb_trig.txt Path: Berkeley >> ASTRO >> 00295301 Fall, 2009 Description: # S/N T1 T2 T90 T50 # Estimated T100 Interval: 24.175 280.485 T90= 160.460 86.0 75.295 145.585 59.640 31.240 24.5 41.215 74.585 29.110 13.490 21.2 145.585 213.035 ... Date Added: 2009-06-04 17:08:05 |
| swb_pha.txt Path: Berkeley >> ASTRO >> 00210254 Fall, 2009 Description: ; Instrument bat ; Exposure 173.000000 ; xunit keV ; bintype counts 0.00000 10.0000 0.025599471 0.033134895 10.0000 12.0000 0.058660537 0.066247256 12.0000 14.0000 0.093095031 0.09880... Date Added: 2009-06-04 17:08:19 |
| swb_zprob.txt Path: Berkeley >> ASTRO >> 00111529 Fall, 2009 Description: #z Prob_Amati Prob_Firmani # Using Model PLEXP 0.100000 6.933537e-04 3.513792e-03 0.104713 8.358917e-04 3.513916e-03 0.109648 1.007845e-03 3.514028e-03 0.114815 1.214992e-03 3.514161e-03 0.120226 1.446441e-03 3.514270e-03 0.125893 1.728598e-03 3.5143... Date Added: 2009-06-04 17:08:34 |
| spec_pc.txt Path: Berkeley >> ASTRO >> 00331475 Fall, 2009 Description: # tmin tmax 102.81096 289.04198 [ksec] ;instrument XRT ;exposure 15670.983 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.00... Date Added: 2009-06-04 17:10:00 |
| spec_pc.txt Path: Berkeley >> ASTRO >> 00333320 Fall, 2009 Description: # tmin tmax 6.70770 34.8971 [ksec] ;instrument XRT ;exposure 9545.7430 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.000000 0... Date Added: 2009-06-04 17:10:21 |
| engl443d01.txt Path: Sveriges lantbruksuniversitet >> ENGL >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 443-4 D01 LOCATION: SFU TITLE: DIRECTED STUDIES C SECTION TYPE: SEC SEMESTER: 1997-1 ENROL: 1 ... Date Added: 2009-06-04 17:12:11 |
| 2200syl.ps Path: Rutgers >> MATH >> 2200 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: 2200syl.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips 2200syl %DVIPSParameters: dpi... Date Added: 2009-06-04 17:13:09 |
| submit.txt Path: Washington >> V >> 13352 Fall, 2009 Description: executable = allgamma_13352.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs13000-13499/13... Date Added: 2009-06-04 17:14:05 |
| log.txt Path: Washington >> V >> 13178 Fall, 2009 Description: 000 (46678.000.000) 02/01 13:46:21 Job submitted from host: <128.95.94.28:1098> . 001 (46678.000.000) 02/01 15:26:58 Job executing on host: <172.25.101.186:1057> . 010 (46678.000.000) 02/01 15:27:12 Job was suspended. Number of processes actually su... Date Added: 2009-06-04 17:15:19 |
| error.txt Path: Washington >> V >> 13042 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Fri Feb 01 14:01:19 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Fri Feb 01 15:17:36 2008 ( 4577 s elapsed) ... Date Added: 2009-06-04 17:15:34 |
| log.txt Path: Washington >> JOBS >> 70644 Fall, 2009 Description: 000 (60526.000.000) 02/16 21:26:54 Job submitted from host: <128.95.94.28:1092> . 001 (60526.000.000) 02/17 02:45:25 Job executing on host: <172.25.101.195:1056> . 006 (60526.000.000) 02/17 03:05:33 Image size of job updated: 433100 . 005 (60526.000.... Date Added: 2009-06-04 17:18:17 |
| log.txt Path: Washington >> JOBS >> 70753 Fall, 2009 Description: 000 (60635.000.000) 02/16 21:28:17 Job submitted from host: <128.95.94.28:1092> . 001 (60635.000.000) 02/17 03:54:56 Job executing on host: <172.25.101.69:1057> . 006 (60635.000.000) 02/17 04:15:04 Image size of job updated: 367532 . 005 (60635.000.0... Date Added: 2009-06-04 17:19:37 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05102491 Fall, 2009 Description: 05102491... Date Added: 2009-06-04 17:23:18 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05102491 Fall, 2009 Description: 05102491... Date Added: 2009-06-04 17:23:18 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05102623 Fall, 2009 Description: 05102623... Date Added: 2009-06-04 17:23:20 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05102623 Fall, 2009 Description: 05102623... Date Added: 2009-06-04 17:23:20 |
| output.txt Path: Washington >> V >> 16000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G0WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_408 02/05/2008 05:46 AM <DIR> . 02/05/2008 05:46 A... Date Added: 2009-06-04 17:27:24 |
| submit.txt Path: Washington >> V >> 16083 Fall, 2009 Description: executable = allgamma_16083.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:27:48 |
| output.txt Path: Washington >> V >> 16000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-895QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3372 02/05/2008 05:39 AM <DIR> . 02/05/2008 05:39 ... Date Added: 2009-06-04 17:28:10 |
| submit.txt Path: Washington >> V >> 16414 Fall, 2009 Description: executable = allgamma_16414.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:28:31 |
| output.txt Path: Washington >> V >> 16000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2308 02/05/2008 07:03 AM <DIR> . 02/05/2008 07:03 ... Date Added: 2009-06-04 17:28:51 |
| error.txt Path: Washington >> V >> 16000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 03:11:49 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 04:18:16 2008 ( 3987 s elapsed) ... Date Added: 2009-06-04 17:29:08 |
| submit.txt Path: Washington >> V >> 16000 Fall, 2009 Description: executable = allgamma_16007.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:29:16 |
| output.txt Path: Washington >> V >> 16000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-21WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2580 02/05/2008 06:51 AM <DIR> . 02/05/2008 06:51 ... Date Added: 2009-06-04 17:29:25 |
| submit.txt Path: Washington >> V >> 16000 Fall, 2009 Description: executable = allgamma_16400.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:29:26 |
| submit.txt Path: Washington >> V >> 16000 Fall, 2009 Description: executable = allgamma_16040.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:29:43 |
| byrating.txt Path: Wisconsin >> HOMEPAGES >> 1944 Fall, 2009 Description: W L T - - - 1 Norman NAS 6 0 0 917 2 Randolph Field 12 0 0 901 3 Ohio St. 9 0 0 875 4 Army 9 0 0 843 5 Oklahoma St. 8 1 0 826 6 Iow... Date Added: 2009-06-04 17:31:08 |
| byrating.txt Path: Wisconsin >> HOMEPAGES >> 1958 Fall, 2009 Description: W L T - - - 1 Louisiana St. 11 0 0 756 2 Iowa 8 1 1 727 3 Wisconsin 7 1 1 712 4 Ohio St. 6 1 2 704 5 Air Force 9 0 2 702 6 Aub... Date Added: 2009-06-04 17:31:09 |
| standing1.txt Path: Wisconsin >> HOMEPAGES >> 1923 Fall, 2009 Description: Division I-A Football Conference Standings as of 01/01/1924 Perfomance Ratings are from David Wilson\'s system Eastern Independent 677 Ave. Rating /-Conference-\\ /-Over-all-\\ Perf W L T Pts Opp W L T... Date Added: 2009-06-04 17:31:17 |
| lec06_oop copy.ppt Path: Wellesley >> CS >> 230 Fall, 2008 Description: ObjectOriented Programming: Classes, Inheritance, and Interfaces Wellesley College CS230 Lecture 06 Thursday, February 15 Handout #14 Reading: Problem Set: Downey: Chapter 13; Carrano: p. 126-134 Assignment #2 due Friday, Feburary 23 06- 1 Objec... Date Added: 2009-06-04 17:31:54 |
| log.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: 000 (61044.000.000) 02/17 07:26:04 Job submitted from host: <128.95.94.28:1092> . 001 (61044.000.000) 02/17 08:42:52 Job executing on host: <128.95.101.202:1057> . 006 (61044.000.000) 02/17 09:03:00 Image size of job updated: 358512 . 005 (61044.000.... Date Added: 2009-06-04 17:34:10 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-21WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2888 02/17/2008 10:13 AM <DIR> . 02/17/2008 10:13 ... Date Added: 2009-06-04 17:34:25 |
| submit.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: executable = pass6_71292.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71000-71499/71292... Date Added: 2009-06-04 17:35:28 |
| log.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: 000 (60892.000.000) 02/17 07:25:17 Job submitted from host: <128.95.94.28:1092> . 001 (60892.000.000) 02/17 07:25:56 Job executing on host: <172.25.101.82:1057> . 006 (60892.000.000) 02/17 07:46:04 Image size of job updated: 484796 . 006 (60892.000.0... Date Added: 2009-06-04 17:37:06 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-315QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1964 02/17/2008 10:09 AM <DIR> . 02/17/2008 10:09 ... Date Added: 2009-06-04 17:37:21 |
| ps11.ps Path: Princeton >> CS >> 341 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: ps11.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMR10 CMMI10 CMSY10 CMTI10 CMMI7 CMR7 CMMI5 CMR5 %EndComments %DVIPSWebPage: (ww... Date Added: 2009-06-04 17:38:16 |
| RESULTATS_A06.xls Path: Université du Québec à Montréal >> A >> 7550 Fall, 2009 Description: NOM DOC x ? x x x x x x x x x x x x x Beauchamp, Amlie Bolduc, Patricia Champoux, Marie Ct, Ariane Courtemanche Bell, Marie-France Hroux, Marie-Christine Ladouceur, Anne-Marie Lajeunesse, Isabelle Lavoie, Valrie Lefort, Lyne Pilon, Catherine Lemieu... Date Added: 2009-06-04 17:38:55 |
| Color Theory - Lindsay Floryan.ppt Path: New Hampshire >> CS >> 502 Fall, 2008 Description: Color Theory Color Theory is a set of principles used to create harmonious color combinations Pro\'s and Con\'s of Color Pro\'s Help organize sections of your pages Highlight Important text Draw users eyes to a specific part of the page Con\'s Confu... Date Added: 2009-06-04 17:39:44 |
| Web Design - Mike Grossman.ppt Path: New Hampshire >> CS >> 502 Fall, 2008 Description: Web Design Philosophy Michael Grossman Keep it Simple Know were on the page a customer might look for certain services Don\'t over due pages Clarity is key 40% of visitors do not return to a site if their first visit results in a negative experi... Date Added: 2009-06-04 17:39:45 |
| BalRxn400.doc Path: Bridgewater College >> CHEM >> 445 Fall, 2008 Description: Question: ... Date Added: 2009-06-04 17:40:04 |
| SASBHW7Sp01.xls Path: Troy >> CHM >> 1143 Fall, 2009 Description: Chart1 Titration of 25 mL 0.050M HCl with 0.050M NaOH 14.00 12.00 10.00 8.00 pH 6.00 4.00 2.00 0.00 0.00 5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00 mL Titrant Page 1 Sheet1 Titration of Strong Acid with Strong B... Date Added: 2009-06-04 17:40:18 |
| ps2.ps Path: Washington >> STAT >> 521 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96 Copyright 2005 Radical Eye Software %Title: ps2.dvi %CreationDate: Wed Jan 23 08:14:34 2008 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMMI12 CMR8 CMSY10 CMMI8 CMSY8 CMMI... Date Added: 2009-06-04 17:40:47 |
| ps3-09.ps Path: Washington >> STAT >> 582 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96 Copyright 2005 Radical Eye Software %Title: ps3-09.dvi %CreationDate: Wed Jan 21 18:28:53 2009 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMMI12 CMR8 CMMI8 CMEX10 CMSY10 ... Date Added: 2009-06-04 17:40:56 |
| Section 2.7.doc Path: Marietta >> MATH >> 125 Fall, 2009 Description: Section 2.7 Tangents and Derivatives Tangent to a circle is clear. What do we mean by tangent to a curve? Limit of secant lines. 1. The tangent line to the curve y = f (x) at the point P(a, f (a) is the line through P with slope f ( x) - f ( a) m = ... Date Added: 2009-06-04 17:41:41 |
| L25-4.ps Path: W. Alabama >> ECE >> 493 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: ImageMagick 6.3.7 %Title: ./150dpi/L25-4.ps %CreationDate: Mon Mar 17 13:41:38 2008 %BoundingBox: 0 0 613 760 %HiResBoundingBox: 0 0 612.909 759.777 %LanguageLevel: 3 %Orientation: Portrait %PageOrder: Ascend %Pages: 1 %EndCo... Date Added: 2009-06-04 17:42:08 |
| bosworth_midtermexplanation.txt Path: Princeton >> COS >> 325 Fall, 2009 Description: Bryan Bosworth COS 325 Midterm Project: Beat Compose The first part of this composition was created using the beatScore.ck score file (\'chuck beats.ck beatScore.ck rec:beatscore14:45 -silent\'). beatScore makes use of the basic functionality of beat... Date Added: 2009-06-04 17:45:22 |
| 21SystemCalls.ppt Path: Princeton >> COS >> 217 Fall, 2009 Description: System Calls and Standard I/O Professor Jennifer Rexford http:/www.cs.princeton.edu/~jrex 1 Goals of Today\'s Class System calls How a user process contacts the Operating System For advanced services that may require special privilege Standard ... Date Added: 2009-06-04 17:45:26 |
| lecture12.doc Path: Rochester >> MAIL >> 106 Fall, 2009 Description: Globalization I. What is it? What\'s going on? What is it? -> shrinking of geographical distance -> increasing rapidity and size of flows of goods, services, people, ideas -> increasing complexification of international affairs -> the phenomenon chang... Date Added: 2009-06-04 17:47:24 |
| Bullet_Statemts_w_Impact.ppt Path: USF >> AS >> 400 Fall, 2009 Description: Welcome to. Bullet Statements with Impact OVERVIEW 1. 1. Importance of Effective Bullets What is a Bullet Statement? Writing Effective Bullets Examples 1. 1. Importance of Effective Bullets Impact on Careers Primary Use Impac... Date Added: 2009-06-04 17:49:12 |
| cover.doc Path: ASU >> WEST >> 547 Fall, 2009 Description: ARIZONA ACADEMIC CONTENT STANDARDS Language Arts Standard 2 WRITING Articulated by Grade Level Approved by Arizona State Board of Education June 28, 2004 ... Date Added: 2009-06-04 17:49:15 |
| 510732.pdf Path: Michigan State University >> LIB >> 1951 Fall, 2009 Description: 32 I SGA JOURNAL \\M> T I K MANAGEMENT: J I L Y , 1951 K TURF EXPERIMENTS IN SOUTH AFRICA We are pleased to present here two pictures of the turf experimental plots at Johannesburg, South Africa, at Frankenuald. This work is under the supervision of... Date Added: 2009-06-04 17:53:57 |
| chap016.ppt Path: Texas El Paso >> CIS >> 3350 Fall, 2008 Description: SYSTEMS ANALYSIS AND DESIGN METHODS 6th Edition Whitten Bentley Dittman C H A P T E R 16 Irwin/McGrawHill INPUT DESIGN AND PROTOTYPING Copyright 2004 The McGrawHill Companies. All Rights reserved SYSTEMS ANALYSIS AND DESIGN METHODS 6th Edition... Date Added: 2009-06-04 17:54:06 |
| VDR_vs_L.ppt Path: Stanford >> NLD >> 20010130 Fall, 2009 Description: Vertex Detecor Radius (VDR) vs L* and luminosity P.Raimondi The main difference for the optimization of the final doublet between old and new FFs is that in the previous version the doublet had to be as short as possible to provide a decent energy b... Date Added: 2009-06-04 17:54:48 |
| lab4.doc Path: Kentucky >> STA >> 672 Fall, 2008 Description: Lab 4 STA672 Summer II 2007 Goals To illustrate the analysis of a full factorial experiment with 3 dichotomous factors. Items in red are items that need to be included in your lab document. Getting Started - login to the computers, start Word, and s... Date Added: 2009-06-04 17:55:49 |
| Jobs.doc Path: Uni. Westminster >> JIC >> 0320 Fall, 2009 Description: Jobs: BS Physics; Photovoltaics Hello, I\'m Jake Campbell and am close to a BS in Physics. I\'m very interested in the research and development of photovoltaics. Perhaps you can advise me on the skills and attributes I would need for a career at ... Date Added: 2009-06-04 17:56:34 |
| p400_11b.ppt Path: N. Illinois >> PHYS >> 500 Fall, 2008 Description: Normal Modes Eigenvalues The general EL equation becomes a matrix equation. q is a vector of generalized coordinates Equivalent to solving for the determinant q j + G -1V ij q j = 0 ( ) (G V )q = q -1 2 det Vij - 2Gij = 0 ( ) The nu... Date Added: 2009-06-04 17:58:18 |
| lab9.doc Path: Colgate >> CS >> 290 Fall, 2009 Description: Computer Science 290 Lab 9, Semigroups and Monoids Part 1: Numeric semigroups. Name_ Consider the set Z12 with the operation * being multiplication mod 12: (Z12, *). For example, 3 * 2 = 6, 3 * 4 = 0, 3 * 5 = 3, 8 * 8 = 4 (a) Prove that (Z12, *) is... Date Added: 2009-06-04 17:59:03 |
| 11.20.doc Path: UMass Lowell >> FACULTY >> 141 Fall, 2009 Description: Section 4.3, continued: Example: f(x) = (x21)2 = x4 2x2 + 1. f (x) = 4x3 4x, which vanishes at +1,0, 1. f (x) = 12x2 4. f (+1) = 8 > 0, f (0) = 4 < 0, f (1) = 8 > 0. So f(x) has local minima at x= 1 and a local maximum at x=0. Example: f(... Date Added: 2009-06-04 17:59:23 |
| Balogh521UVCureAdhesives.doc Path: Arizona >> HW >> 521 Fall, 2009 Description: UV Cure Adhesives OPTI 521 Chuck Balogh UV cured adhesives find wide application in opto-mechanical assemblies. The advantages are freedom to align and check assemblies prior to bonding and a relatively quick cure time after positioning. Minor disa... Date Added: 2009-06-04 18:01:11 |
| fishbioacoustics_chapter_9.pdf Path: Maryville MO >> OCE >> 575 Fall, 2009 Description: 9 Active and Passive Acoustics to Locate and Study Fish David A. Mann, Anthony D. Hawkins, and J. Michael Jech 1. Introduction Two important goals in studying the biology of fishes are to detect and enumerate the fish and to define where the fish a... Date Added: 2009-06-04 18:03:16 |
| amber3.doc Path: Carleton >> CHEM >> 348 Fall, 2009 Description: Chemistry 348 WEEK 9: DYNAMICS OF FOLDED PROTEINS. Spring \'05 Developed by D. Kohen. Inspired by \"Dynamics of folded proteins\". J. Andrew McCammon, Bruce Gelin and Marin Karplus. Nature 1977 267, 585. INTRODUCTION In 1977 Karplus et al... Date Added: 2009-06-04 18:03:46 |
| BB491_quiz1_Beckman.pdf Path: Oregon State >> BB >> 491 Fall, 2008 Description: 1 0 Biochem 4911591 Quiz / 13 January 2006 Your Name /activated\" Coer~zyme What is the name of this cofactor... Date Added: 2009-06-04 18:04:06 |
| howtodoproofs.pdf Path: UPenn >> LING >> 106 Fall, 2006 Description: How To Do Formal Proofs Ling 106, Lucas Champollion September 22, 2005 1 Solution to the handout question Question from the class handout: Show that A B A B. (hint: Use Consistency Principle.) Reminder The consistency principle says: (a) X ... Date Added: 2009-06-04 18:04:26 |
| 00000111.pdf Path: Carnegie Mellon >> DISK >> 05101177 Fall, 2009 Description: ... Date Added: 2009-06-04 18:05:56 |
| 00000194.pdf Path: Carnegie Mellon >> DISK >> 05101177 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:11 |
| 00000016.pdf Path: Carnegie Mellon >> TERA >> 05101977 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:27 |
| 00000016.pdf Path: Carnegie Mellon >> DISK >> 05101977 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:27 |
| 00000050.pdf Path: Carnegie Mellon >> DISK >> 05102233 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:12 |
| 00000082.pdf Path: Carnegie Mellon >> DISK >> 05102233 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:15 |
| 00000008.pdf Path: Carnegie Mellon >> DISK >> 05101222 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:36 |
| 00000031.pdf Path: Carnegie Mellon >> DISK >> 05101980 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:57 |
| 00000044.pdf Path: Carnegie Mellon >> DISK >> 05101980 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:59 |
| 00000025.pdf Path: Carnegie Mellon >> DISK >> 05102231 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:38 |
| 00000024.pdf Path: Carnegie Mellon >> DISK >> 05101986 Fall, 2009 Description: ... Date Added: 2009-06-04 18:11:27 |
| hierarchy.pdf Path: Texas Tech >> BA >> 6341 Fall, 2009 Description: VeriSign Key Hierarchy VeriSign Class 1 Public Primary Certification Authority self-signed 01/29/97 - 01/07/04 (v1, 1024 bit key) 1/29/96 - 1/7/20 (v2, 1024 bit key) 01/29/96 - 8/1/28 (v3, 1024 bit key) 05/18/98 - 05/18/18 (G2, 1024 bit key) 10/01/99... Date Added: 2009-06-04 18:13:44 |
| 00000010.pdf Path: Carnegie Mellon >> DISK >> 05101288 Fall, 2009 Description: ... Date Added: 2009-06-04 18:13:52 |
| Chapter 4 Defining the Project.ppt Path: Benedictine IL >> MBA >> 683 Fall, 2009 Description: Defining the Project Chapter 4 Copyright 2007, 2009 by The McGraw-Hill Companies, Inc. and John Kevin Doyle All Rights Reserved. Defining the Project Step 1: Defining the Project Scope Step 2: Establishing Project Priorities Step 3: Creating the ... Date Added: 2009-06-04 18:15:53 |
| notes3.pdf Path: Washington >> AA >> 320 Fall, 2009 Description: AA320 ... Date Added: 2009-06-04 18:16:29 |
| count-controlled loop 1.doc Path: Benedictine IL >> CISCMSC >> 200 Fall, 2009 Description: CIS/CMSC 200: Computer Programming Count-controlled Loop 1 Sample Program Here is the first count-controlled loop program: #include <iostream> using namespace std; void main() { int count; count = 4; while(count > 0) { cout < count < endl; count-; }... Date Added: 2009-06-04 18:16:32 |
| ps4_rev.pdf Path: Washington >> AA >> 527 Fall, 2009 Description: AA527 - Fall 2008 Problem Set 4. Due Thu, Dec. 4. Revised 12/1/08. 1. Thermoelectrics. A radioisotope thermoelectric system generates a source heat of 2400 W at a to-be-determined temperature TH and rejects waste heat via a radiator at temperature TL... Date Added: 2009-06-04 18:17:06 |
| Gradesheet_Dec 8.pdf Path: Washington >> AA >> 101 Fall, 2009 Description: ID # 0140 0239 0333 0401 0525 0553 0569 0671 0811 1096 1341 1349 1406 1524 1879 2031 2142 2551 2996 3353 3469 3801 3947 4000 4003 4010 4145 4391 4506 4803 5179 5438 5679 5904 6172 6292 6454 6725 7108 7116 8216 8357 8373 8401 8588 8727 8839 9128 9335 ... Date Added: 2009-06-04 18:17:08 |
| 023_2006_Happiness_col.pdf Path: UWO >> PDFS >> 023 Fall, 2009 Description: Three Minute Review TREATMENT history of treatment 2 major approaches Biological Psychotherapy Psychopharmacology Antipsychotic Drugs deinstitutionalization dopamine differences between older and newer generation drugs Anti-anxiety drugs ... Date Added: 2009-06-04 18:17:15 |
| good temp2.txt Path: Benedictine IL >> CISCMSC >> 300 Fall, 2009 Description: Date: 10/15/03 Collection Report Page: 1 ID Number Artist Title Tracks 1303 Creedence Clearwater Revival Chronicle ... Date Added: 2009-06-04 18:17:58 |
| Subarray pre and postconditions.doc Path: Benedictine IL >> CISCMSC >> 200 Fall, 2009 Description: CIS/CMSC 200: Subarray Pre- and Post-conditions int Initialize_Array(int Array[], int& Size) Pre-condition(s) Storage for Array[] and Size have been declared in calling routine. Maximum size of Array[] (i.e., maximum valid value of Size) is the glo... Date Added: 2009-06-04 18:18:22 |
| Additional vector identity.doc Path: Washington >> AA >> 506 Fall, 2009 Description: Additional vector identity r r r A = grad (divA) - curl (curlA) 2 ... Date Added: 2009-06-04 18:20:51 |
| MATH012A85227082.doc Path: MD University College >> ASIA >> 2092 Fall, 2009 Description: Syllabus for MATH012A852 Intermediate Algebra Instructor: Ron Munsee Email Address: rmunsee @asia.umuc.edu {use MATH012 in the subject line} Course Description: (Not open to students who have already successfully completed a higher level ... Date Added: 2009-06-04 18:22:48 |
| ENTC 303 -25- Spring_09.ppt Path: Texas A&M >> ENTC >> 303 Fall, 2008 Description: ENTC 303: Announcements No more labs Check your grades on-line Final Exam Wednesday, May 13th at 1 PM Review in class Thursday, April 30th (last day of classes for ENTC 303) ASME Tech Officer Elections All interested students are encouraged to ... Date Added: 2009-06-04 18:24:06 |
| Lab1.pdf Path: Texas A&M >> ENTC >> 455 Fall, 2008 Description: ENTC 455 LABS Spring 2008 LAB #1 AM/FM MODULATION SPECTRUM ANALYSIS OBJECTIVE: To become familiar with the use of spectrum analyzers EQUIPMENT: 1. Oscilloscope 2. Spectrum Analyzer 3. RF Signal Generator Agilent N9310A EXPERIMENTS: 1. Sinusoidal S... Date Added: 2009-06-04 18:24:15 |
| BIOL102A80151940.doc Path: MD University College >> ASIA >> 2095 Fall, 2009 Description: Syllabus for BIOL102 A801 Laboratory in Biology Instructor: Dr. James C. Cummings DVM E-mail: james.c.cummings@us.army.mil Course Description for Laboratory in Biology (For students not majoring in a science. Fulfills the laboratory science requireme... Date Added: 2009-06-04 18:24:49 |
| rose-summary.doc Path: UMKC >> CS >> 451 Fall, 2009 Description: Rose/Architect: A tool to visualize architecture Introduction Rose/Architecture is a tool attempt to deal with complexity by using patterns and heuristics to extract relevant information from a system\'s model. Conceptual model of Rose/Architecture i... Date Added: 2009-06-04 18:24:55 |
| s18.txt Path: Cal Poly >> CIV >> 1120 Fall, 2009 Description: xmin=301824 ymin=5050506 xmax=302264 ymax=5050946 ... Date Added: 2009-06-04 18:24:57 |
| 6761-pa2.ps Path: Columbia >> PA >> 6761 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: pa2.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -tletter -opa2.ps pa2 %DVIPSPa... Date Added: 2009-06-04 18:27:21 |
| 03-Phillips_Truth_of_Ecology.pdf Path: UC Davis >> ATT >> 200901 Fall, 2009 Description: ... Date Added: 2009-06-04 18:27:32 |
| Lecture1.pdf Path: Maryland >> BSCI >> 410 Fall, 2008 Description: Instructor: Dr. Zhongchi Liu 3236 H.J. Pattersom Hall Phone: 5-1586 Zhongchil@gmail.com zliu@umd.edu www.life.umd.edu/CBMG/faculty/liu/liu.html TA: Minh Bui 3236 H. J. Patterson Hall Phone: 5-7927 minhbui82@hotmail.com About the course: www.life.u... Date Added: 2009-06-04 18:28:34 |
| Gallaher_R.pdf Path: Washington >> ATMS >> 111 Fall, 2009 Description: Bleaching Coral Reefs and Ocean Acidification By Rachel Gallaher Warming Oceans, Increasing Acidification About 25% of all CO2 released from anthropogenic sources enters the ocean where it then reacts with the water to produce carbonic acid. Throug... Date Added: 2009-06-04 18:29:54 |
| iquiz4.ps Path: RPI >> ECSE >> 4730 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - iquiz4.ppt %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 11/13/98 10:42:50 %BoundingBox: 15 12 597 777 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (atend) %DocumentSupplied... Date Added: 2009-06-04 18:31:07 |
| A4_Solutions.pdf Path: McGill >> CIM >> 250 Fall, 2009 Description: COMP 250, Winter 2009 Assignment 4 Solutions Prof. Michael Langer Prepared by Mansoor Siddiqui, Neeraj Tickoo and Julien Villemure. Question 1 (25 points) IntegerSet ADT The following pseudocode assumes elements are sorted in ascending order. a) ... Date Added: 2009-06-04 18:31:26 |
| notes_ans_titration.pdf Path: Ill. Chicago >> CHEM >> 112 Fall, 2008 Description: Notes on titration problems. 1) You have already done all of these problems. They are either simple solutions (one substance present) or mixtures. 2) For mixture problems, be careful to convert remaining moles into molarity again; moles/total volume ... Date Added: 2009-06-04 18:31:28 |
| chem_equil.pdf Path: Ill. Chicago >> CHEM >> 112 Fall, 2008 Description: Chemistry 112/116 Prelab Assignment Some Examples of Chemical Equilibria TA: Fall 03 NAME: 1. Define \"a state of equilibrium.\" 2. What is the difference between an exothermic and an endothermic reaction? How can you distinguish these two types of... Date Added: 2009-06-04 18:31:38 |
| inl12z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20081221 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/08122100_upa.wxp Date: 0000Z 21 DEC 08 Searching for KINL. Searching the city database file for: KINL . Date:0000Z 21 DEC 08 Station: KINL... Date Added: 2009-06-04 18:32:31 |
| abr00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090214 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09021412_upa.wxp Date: 1200Z 14 FEB 09 Searching for KABR. Searching the city database file for: KABR . Date:1200Z 14 FEB 09 Station: KABR... Date Added: 2009-06-04 18:32:58 |
| chapter2_04.pdf Path: Washington >> PHYS >> 554 Fall, 2008 Description: Chapter 2 Baryons, Cosmology, Dark Matter and Energy 2.1 Hubble expansion We are all aware that at the present time the universe is expanding. However, what will be its ultimate fate? Will it continue to expand forever, or will the expansion slow and... Date Added: 2009-06-04 18:33:26 |
| grb00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090306 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09030612_upa.wxp Date: 1200Z 6 MAR 09 Searching for KGRB. Searching the city database file for: KGRB . Date:1200Z 6 MAR 09 Station: KGRB... Date Added: 2009-06-04 18:35:07 |
| Business Plan.doc Path: SIU Edwardsville >> MKTG >> 466 Spring, 2008 Description: Confidential Document Confidential Document Intellectual Property Laws Protect the Ideas and Concepts Included in this Document Executive Summary Following is a business plan presented for review by the board of directors for Venture Capital USA, ... Date Added: 2009-06-04 18:35:23 |
| Photoshop_basics_handout.pdf Path: UCSC >> CMPS >> 080 Fall, 2009 Description: Adobe Photoshop Basic Skills Main Toolbar Selection tools Painting tools Drawing tools Color tools Options for each tool are shown in the area right under the menu bar. Selection tools Rectangular, Elliptical, Row, and Column Lasso, Polygon... Date Added: 2009-06-04 18:35:36 |
| ch1.ps Path: Washington >> STAT >> 581 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96 Copyright 2005 Radical Eye Software %Title: ch1.dvi %CreationDate: Wed Oct 8 00:29:22 2008 %Pages: 19 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMBX12 CMBX10 CMMI10 CMSY10 CMSL10 CMR8 CM... Date Added: 2009-06-04 18:35:55 |
| ams2-hwks.txt Path: UCSC >> AMS >> 002 Spring, 2009 Description: Homework #1 (due 4-10) = Chapter 4: Exercise set P.1 (pg. 242): - Practice problems: 7, 21, 65, 93. Hand-in problems: 10, 16, 18, 22, 24, 26, 32, 36, 54, 56, 66, 70, 82, 94, 96. Exercise set P.2 (pg. 253): - Practice problems: 13, 15, 21, 135. Ha... Date Added: 2009-06-04 18:36:09 |
| slac-pub-7320.pdf Path: Stanford >> PUBS >> 7250 Fall, 2009 Description: SLAC-PUB-7320 October 1996 A E I The polarized electron beam for the SLAC Linear Collider M. Woods Stanford Linear Accelerator Center Stanford University, Stanford, CA 94309 Abstract. The SLAC Linear Collider has been colliding a polarized electron... Date Added: 2009-06-04 18:36:23 |
| Schedule.doc Path: Arizona >> SPS >> 032101 Fall, 2009 Description: Contracting with Industry Time Topic Speaker Kathy Larmett Bob Killoren Kim Moreland Dick Seligman Mike Champness Kathy Irwin Slide Nos. 11:30 - 11:40 Introduction 11:40 - 12:00 Setting the Stage a. Institutional perspectives of research collaborati... Date Added: 2009-06-04 18:37:09 |
| Topall.S2002.pdf Path: UCLA >> CS >> 181 Fall, 2009 Description: Computer Science 181 INTRODUCTION TO FORMAL LANGUAGES AND AUTOMATA THEORY TOPICS COVERED - Spring 2002 YOU ARE RESPONSIBLE FOR EVERYTHING DONE IN CLASS,SECTION,READING ASSIGNMENT EVEN IF NOT LISTED 1. INTRODUCTION A. B. INTRODUCTION and COMMENTS BA... Date Added: 2009-06-04 18:37:16 |
| 2302 Outline Spring 2009.doc Path: Winston Salem State >> ENG >> 2302 Fall, 2009 Description: DEPARTMENT OF ENGLISH AND FOREIGN LANGUAGES Winston-Salem State University Winston-Salem, North Carolina ENGLISH (ENG) 2302 WORLD LITERATURE II COURSE OUTLINE Spring 2009 Three Semester Hours Texts: Paul Davis et al., eds. The Bedford Anthology of W... Date Added: 2009-06-04 18:37:40 |
| Lec11_cs153_F08.ppt Path: Harvey Mudd College >> CS >> 153 Fall, 2000 Description: Highlights Seam Carving Highlights Seam Carving An unsuccessful ? example Highlights Seam Carving An unsuccessful ! example Highlights Seam Carving An unsuccessful ? example Highlights Seam Carving Recognition anyone? Highligh... Date Added: 2009-06-04 18:38:12 |
| exam1solQ6-7.pdf Path: Pittsburgh >> CS >> 1502 Fall, 2008 Description: ... Date Added: 2009-06-04 18:38:57 |
| Get Physical!.ppt Path: Slippery Rock >> PETE >> 6120201 Fall, 2009 Description: Get Physical! By: Amanda Wise Getting Started Develop positive attitudes in fitness You need to maintain fitness on your own Being fit is not just physical Do Not Use Excuses Like. \"I don\'t have the time.\" 30 minutes of daily activity ... Date Added: 2009-06-04 18:39:47 |
| AdvV.pdf Path: Illinois State >> MATH >> 119 Fall, 2009 Description: Advanced Functions and Equations Part V Script 4-04 -Slide 1 Title This section introduces yet another function, the exponential function. We will investigate its formula and see how it affects the graph. -Slide 2 Title We will also look at its inver... Date Added: 2009-06-04 18:40:58 |
| ch3.ppt Path: Illinois State >> MATH >> 111 Fall, 2009 Description: Confidence intervals Chapter 3 Terminology A parameter is a number that describes the population. It\'s a fixed number that we do not know. We usually estimate it with sample data. Examples are the true average household income, age, political affili... Date Added: 2009-06-04 18:41:06 |
| log.txt Path: Washington >> JOBS >> 20269 Fall, 2009 Description: 000 (54265.000.000) 02/09 14:59:34 Job submitted from host: <128.95.94.28:1098> . 001 (54265.000.000) 02/09 15:10:16 Job executing on host: <172.25.101.91:1056> . 005 (54265.000.000) 02/09 15:11:20 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 18:43:11 |
| log.txt Path: Washington >> JOBS >> 20009 Fall, 2009 Description: 000 (54005.000.000) 02/09 14:58:23 Job submitted from host: <128.95.94.28:1098> . 001 (54005.000.000) 02/09 14:59:22 Job executing on host: <172.25.101.83:1056> . 005 (54005.000.000) 02/09 15:00:22 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 18:43:47 |
| log.txt Path: Washington >> JOBS >> 20029 Fall, 2009 Description: 000 (54025.000.000) 02/09 14:58:26 Job submitted from host: <128.95.94.28:1098> . 001 (54025.000.000) 02/09 15:00:32 Job executing on host: <172.25.101.62:1063> . 005 (54025.000.000) 02/09 15:07:36 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 18:45:20 |
| output.txt Path: Washington >> JOBS >> 20393 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-9Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2136 02/09/2008 04:58 PM <DIR> . 02/09/2008 04:58 ... Date Added: 2009-06-04 18:45:31 |
| submit.txt Path: Washington >> JOBS >> 20010 Fall, 2009 Description: executable = pass6_20010.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs20000-20499/20010... Date Added: 2009-06-04 18:45:45 |
| error.txt Path: Washington >> JOBS >> 20050 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 09 16:33:55 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Application failed, returning error code 1 Current time: Sat Feb 09 16:34:29 2008 ( ... Date Added: 2009-06-04 18:46:29 |
| submit.txt Path: Washington >> JOBS >> 20369 Fall, 2009 Description: executable = pass6_20369.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs20000-20499/20369... Date Added: 2009-06-04 18:47:55 |
| noon10.txt Path: University of Louisiana at Lafayette >> AVM >> 1260 Fall, 2009 Description: From magidin@uclink.berkeley.edu Subject: Red Iguana Noon:Wrath of Knowledgius, Chapter 10 Date: 17 Apr 1994 07:41:51 GMT Message-ID: <2oqp7v$p1s@agate.berkeley.edu> [When last we saw our hero, Publius the Mighty Red Iguana, he was in his office ins... Date Added: 2009-06-04 18:50:26 |
| 08.au.24.ppt Path: Washington >> FIT >> 100 Fall, 2009 Description: Test Your Tech The dangers of phishing include A. B. C. Sharp hooks and nightcrawlers. Credit-card fraud at a look-alike Web site that mimics your bank. High mercury content in fish from polluted oceans. D.A. Clements, UW Information School 1 Te... Date Added: 2009-06-04 18:51:47 |
| Crabapple Tree.doc Path: Uni. Westminster >> MSF >> 0317 Fall, 2009 Description: Miles Fuller The Crabapple Tree Thirty-six divided by its multiplier, six can still be divided again. Now for the hard stuff: A man about my age is held in a cell and after meals when he has strength, can climb & stand on the steel shelf that is his ... Date Added: 2009-06-04 18:54:18 |
| hw_student5.txt Path: Creighton >> HW >> 571 Fall, 2009 Description: ATS 571 HW6 Name: _ 1. Answer N9 from p. 61, except change the vertical temperature gradient to -2.04999495 degree C per meter. WARNING: The point of this problem is to show you that fluxes by conduction are very small. ... Date Added: 2009-06-04 18:54:37 |
| Interactivity_hypothesis.ppt Path: Université du Québec à Montréal >> INFO >> 9340 Fall, 2009 Description: Debating the Issue of Tutoring Interactivity: Intuition vs. Experimentation Tanner Jackson It\'s a MAD MAD MAD MAD Morning Effective Tutoring Chi, M. T. H., Siler, S., Jeong, H., Yamauchi, T., & Hausmann, R. G. (2001). Learning from human tuto... Date Added: 2009-06-04 18:55:16 |
| Class_MTH145_12_02_08_1205.pdf Path: Wisc La Crosse >> MATH >> 145 Fall, 2009 Description: MTH 145 12/2/08 12:05 Tuesday, December 02, 2008 12:38 PM Section_08 Page 1 Section_08 Page 2 ... Date Added: 2009-06-04 18:57:25 |
| EOC_Solution_02_24.pdf Path: Georgia Tech >> PHYSICS >> 2211 Fall, 2009 Description: 2.24. Model: We will represent the skier as a particle. Visualize: Note that the skier\'s motion on the horizontal, frictionless snow is not of any interest to us. Also note that the acceleration parallel to the incline is equal to g sin10. Solve: Us... Date Added: 2009-06-04 19:04:04 |
| sp06-t1.pdf Path: Purdue >> AAE >> 421 Fall, 2009 Description: March 28, 2006 AAE 421 Spring 2006 Test One Problem 1 Obtain a state space representation of the following system. 4 d2 q d4 q + q 2 + sin q = 8 dt4 dt Problem 2 Obtain a state space representation of the following system. . q 1 + q2 + sin q1 = 0 ... Date Added: 2009-06-04 19:04:53 |
| finalexams03.pdf Path: Acton School of Business >> MATH >> 211 Fall, 2008 Description: Math 211 Final Exam Spring 2003 You have 3 hours to complete this test. Make sure to show your work and justify your arguments. Calculator policy: You may use calculators to evaluate standard functions on oating point numbers (like 3.12, ln(35/7), o... Date Added: 2009-06-04 19:10:29 |
| Chapter13.pdf Path: N.C. State >> MAE >> 302 Fall, 2008 Description: I I I I r I I II \'I I II I I II I I I 1: OIAIl. I I)\'> ~ , , IS }4 jo I I\' I I,., tJ II , I-U fl.! S I I , ! I ~: III L I!t4l5}~ \"$ t;l tl. Ii\' 51: ~ II I. ! \' \' iii I I \"~4 ~ . I . 4) c:t(i\'aS ~S\" ri: ~L1w I I I ... Date Added: 2009-06-04 19:16:01 |
| Chap20.ppt Path: Hudson VCC >> WHITTENBEN >> 143 Fall, 2009 Description: Chapter 20 Systems Operations and Support McGrawHill/Irwin Copyright 2007 by The McGrawHill Companies, Inc. All rights reserved. Objectives Define systems operations and support. Describe relative roles of a repository, program library, and da... Date Added: 2009-06-04 19:29:58 |
| set 4 solution.pdf Path: University of Illinois, Urbana Champaign >> PHYS >> 221 Fall, 2009 Description: ... Date Added: 2009-06-04 19:33:14 |
| Chap20.ppt Path: University of Hawaii - Hilo >> ITM >> 353 Fall, 2009 Description: Chapter 20 Systems Operations and Support McGrawHill/Irwin Copyright 2007 by The McGrawHill Companies, Inc. All rights reserved. Objectives Define systems operations and support. Describe relative roles of a repository, program library, and da... Date Added: 2009-06-04 19:42:18 |
| Chestnut and Mill on Acid Rain Program.pdf Path: Ohio State >> AED ECON >> 531 Fall, 2009 Description: Journal of Environmental Management 77 (2005) 252266 www.elsevier.com/locate/jenvman A fresh look at the benefits and costs of the US acid rain program Lauraine G. Chestnut*, David M. Mills Stratus Consulting Inc., P.O. Box 4059, Boulder, CO 80306-4... Date Added: 2009-06-04 19:48:01 |
| PA-all.pdf Path: Dickinson State >> EE >> 421 Fall, 2009 Description: ECE 421/621 PA - 2 Vcc = V1m = Vcc = (a) RL = V1m/I1m = Pout = VccI1m/2 = (b) 21 = Homework - Power Amplifiers S. Yuvarajan 24 V; I1m = 24 1A 24 12 W 160 deg or 1 = 80 deg I1m = Solving, Icm = I cm sin21 1 2 2.565 A Idc = Solving,... Date Added: 2009-06-04 20:08:23 |
| Swine7st.pdf Path: Penn State >> SOILS >> 418 Fall, 2008 Description: (814) 863-0841 Fax (814) 863-4540 Agricultural Analytical Services Laboratory The Pennsylvania State University University Park PA 16802 http:/www.aasl.psu.edu SOIL TEST REPORT FOR: MR. E. Z. MONEY R.D. 1 BOX 25 ELIZABETHVILLE PA 17023 DATE LAB # S... Date Added: 2009-06-04 20:09:59 |
| TourPrelude.pdf Path: Allan Hancock College >> COMP >> 1100 Fall, 2009 Description: A tour of the Haskell Prelude Bernie Po, 2001 bjpop@cs.mu.oz.au Minor updates by Clem Baker-Fin, 2007 1 Haskell The Haskell language was conceived during a meeting held at the 1987 Functional Programming and Computer Architecture conference (FPCA... Date Added: 2009-06-04 20:15:02 |
| IndykMetric.pdf Path: Princeton >> COS >> 598 Fall, 2009 Description: ... Date Added: 2009-06-04 20:19:03 |
| 03-Velocity.pdf Path: Princeton >> COS >> 598 Fall, 2009 Description: Velocity is Lecture 3: The Velocity Compiler COS 598C Advanced Compilers ! \" # % $ COS 598C - Advanced Compilers Prof. David August Why a new compiler? ) \" % ) Velocity compiler goals ) # \" COS 598C ... Date Added: 2009-06-04 20:19:32 |
| final04hints.pdf Path: UWO >> SS >> 359 Fall, 2009 Description: A few hints about the 2004 Final Exam 4. (c) The required condence interval is given by n 2 tnp,.025 M SE/ i=1 Pj2 (xi ) where p = 4 and n = 24, so we use t20,.025 = 2.09. M SE = 27 is given. In order to see that i=1 Pj2 (xi ) = 3, use the fact ... Date Added: 2009-06-04 20:22:51 |
| seqAucEbay.pdf Path: Duke >> X >> 296 Fall, 2009 Description: The Sequential Auction Problem on eBay: An Empirical Analysis and a Solution Adam I. Juda Division of Engineering and Applied Sciences Harvard University, Harvard Business School David C. Parkes Division of Engineering and Applied Sciences Harvard ... Date Added: 2009-06-04 20:25:05 |
| cps270_first_order_logic.pdf Path: Duke >> X >> 270 Fall, 2009 Description: CPS 270: Artificial Intelligence http:/www.cs.duke.edu/courses/fall08/cps270/ First-Order Logic Instructor: Vincent Conitzer Limitations of propositional logic So far we studied propositional logic Some English statements are hard to model in pr... Date Added: 2009-06-04 20:25:58 |
| lecture4.ppt Path: Duke >> X >> 296 Fall, 2009 Description: Vague idea Expe e Life rim ntal cycle Initial observations Boundary of system under test, workload & system Hypothesis parameters that affect behavior. Model Questions that test the model. metrics to answer questions, factors to vary, levels of fact... Date Added: 2009-06-04 20:26:26 |
| 03_behavior.ppt Path: Duke >> X >> 049 Fall, 2009 Description: CPS 49S Google: The Computer Science Within and its Impact on Society Shivnath Babu Spring 2008 Teams Search Internals Bryan, Jason Non-Google Search Karima, Minerva Advertising Casey, Nick Fraud Detection A.J., Eddie Economy Dan, Danny, S... Date Added: 2009-06-04 20:27:31 |
| animal.txt Path: Duke >> X >> 100 Fall, 2009 Description: #Q:Does it have feathers #Q:Does it live in a barnyard Is it a chicken #Q:is it wise Is it an owl #Q:does it gobble Is it a turkey #Q:does it say \"Nevermore!\" Is it a raven Is it an eagle #Q:Is it a mammal #Q:does it have stripes Is it a tiger #Q:doe... Date Added: 2009-06-04 20:27:40 |
| ThompsonJN1999b.pdf Path: LSU >> BIOL >> 7901 Fall, 2009 Description: ... Date Added: 2009-06-04 20:29:51 |
| lsq.pdf Path: George Mason >> P >> 263 Fall, 2009 Description: p XXy pp ijAihsvstvioveX... Date Added: 2009-06-04 20:31:35 |
| digsim1.pdf Path: UMBC >> CMSC >> 313 Summer, 2002 Description: CMSC 313, Computer Organization & Assembly Language Programming Spring 2002 Section 0101 DigSim Assignment 1: Getting Started Due: Thursday April 11, 2002 Objective The objective of this assignment is to make sure that everyone has access to DigSim... Date Added: 2009-06-04 20:32:07 |
| vert_coords1.pdf Path: San Jose State >> WEEK >> 121 Fall, 2009 Description: TRANSFORMATION OF THE VERTICAL COORDINATE Thus far we have used z to describe our elevation above the surface. Other possibilities exist 1) Isobaric coordinates use pressure (p) as vertical coordinate Advantages: Observations are made on pressure s... Date Added: 2009-06-04 20:32:14 |
| Avery_et_al_1944.pdf Path: Bard >> BIO >> 310 Fall, 2009 Description: Induction of Transformation by a Desoxyribonucleic Acid Fraction Isolated from Pneumococcus Type III By Oswald T. Avery, M.D., Colin M. MacLeod, M.D., and Maclyn McCarty, M.D. History Biologists have long attempted to induce predictable and specific... Date Added: 2009-06-04 20:37:21 |
| Lab_Title_Page.pdf Path: Bard >> BIO >> 301 Fall, 2009 Description: Laboratory Manual Biology 301: Biochemistry Compiled by John B. Ferguson Professor, Biology Program Division of Science, Mathematics and Computing Bard College, PO Box 5000 Annandale-on-Hudson, NY 12504-5000 Fall 2007 Title Page Illustration Dim... Date Added: 2009-06-04 20:37:37 |
| sigma_metabolic_pathways.pdf Path: Eastern Washington University >> ORG >> 351 Fall, 2009 Description: Metabolic Pathways P O L Y S A C C H A R I D E S GLYCOPROTEINS GANGLIOSIDES MUCINS AcNH CHOH CHOH BLOOD GROUP ALGINATES O-ANTIGENS HYALURONIC ACID DERMATAN STARCH SUBSTANCES PEPTIDOCHITIN CHONDROITIN PECTIN INULIN CELLULOSE GLYCAN CH OH 2 CONH 2 C... Date Added: 2009-06-04 20:38:09 |
| math215fesSAMPLE.pdf Path: Ill. Chicago >> M >> 215 Fall, 2009 Description: MATH 215 Final Examination with Solution Radford 12/05/05 Name (print) (1) With the exception of part a) of Problem 1, write yours answers in the exam booklet provided. (2) The last problem, Problem 8, has two versions. Do one or the other but not ... Date Added: 2009-06-04 20:41:23 |
| P4.doc Path: Rose-Hulman >> TEAM >> 374 Fall, 2009 Description: Architecture Document for Brogl Revision History Date January 31, 2006 Version 1.0 Description Initial Draft Edited by Nathan Marks, Nathan Carlson, Aaron Milam Decomposition View Section 1: Primary Presentation TCP/IP Web Server DataAccess Data... Date Added: 2009-06-04 20:45:28 |
| P5-take2.doc Path: Rose-Hulman >> TEAM >> 374 Fall, 2009 Description: Architecture Document Critique for Fridge Thing Blankenbaker, Pelcer, Krall 1. What parts of the Architecture Document were helpful or easy to use? Decomposition view of modules made it easy to tell what classes needed to be implemented. Interface in... Date Added: 2009-06-04 20:46:44 |
| diff.pdf Path: UCSC >> PHYS >> 242 Fall, 2009 Description: Physics 115/242 Numerical Dierentiation: Approximation and Roundo Errors Peter Young I. INTRODUCTION We have already talked about roundo errors, which are due to the limited precision of the numbers stored in the computer. He we also discuss the o... Date Added: 2009-06-04 20:51:06 |
| srs_template.doc Path: Villanova >> CSC >> 4700 Spring, 2004 Description: Software Requirements Specification for <Project> Version 1.0 approved Prepared by <author> <organization> <date created> Copyright 1999 by Karl E. Wiegers. Permission is granted to use, modify, and distribute this document. Software Requireme... Date Added: 2009-06-04 21:03:19 |
| grip_lighting.pdf Path: NC Arts >> MIS >> 151 Fall, 2009 Description: SCHOOL OF FILMMAKING 1533 S. Main Street Winston-Salem, North Carolina 27127 COURSE NAME AND NUMBER: PROD. #: PRODUCTION TITLE: PRODUCER: DIRECTOR: YEAR ONE WINTER LIGHTING STAGE PACKAGE Production Equipment Request Form - Pag... Date Added: 2009-06-04 21:08:02 |
| Newton.ppt Path: Winthrop >> PHYS >> 611 Fall, 2009 Description: Isaac Newton (1642-1727) Newton\'s Laws Laws of motion, can be used to analyze motion of ordinary objects. Not valid for speeds close to the speed of light. Need to use the theory of relativity. Not valid for atomic sized particles. Need to use qu... Date Added: 2009-06-04 21:12:39 |
| quantum047.pdf Path: Colorado State >> PH >> 452 Fall, 2008 Description: Classical treatment Example: Deflection of electron beam by a constant force , eE y = dV dy The force acts along the distance, s, during the time t = s ms = vx px Fig. 4.10 px = mv x = m s ; Force is not acting in x-direction no acceleration ... Date Added: 2009-06-04 21:20:00 |
| quantum394.pdf Path: Colorado State >> PH >> 452 Fall, 2008 Description: XII.8. THE PAULI EQUATION We investigate the motion of the electron in a magnetic field taking into account the spin. The magnetic moment associated with the spin is r eh r m= = B 2 m0c r H = ( Hx , H y , Hz ) (12.8.1) The electron has therefor... Date Added: 2009-06-04 21:20:05 |
| lecture23.pdf Path: Washington >> LECTURE >> 124 Fall, 2009 Description: nnrxrfri c beda )`YW V|hxn0 \'pUrjoc Qh p z h qp w U X U p yl w T p krsl m@oxr|hx%nc7omomi\'jxqiXkxckrzsn0nob\'|hxroyoj|wyo#rhkc zhp w qp p y w h q w hj h y wplp z zhp w zph h l w zh q yh qp z zh w RSxcAk Ci kxrqpkh nhTw ... Date Added: 2009-06-04 21:20:52 |
| LM3914.pdf Path: Dickinson State >> ECE >> 723 Fall, 2009 Description: LM3914 Dot/Bar Display Driver February 2003 LM3914 Dot/Bar Display Driver General Description The LM3914 is a monolithic integrated circuit that senses analog voltage levels and drives 10 LEDs, providing a linear analog display. A single pin change... Date Added: 2009-06-04 21:28:11 |
| agenda.pdf Path: Stanford >> PPA >> 199212 Fall, 2009 Description: ... Date Added: 2009-06-04 21:43:53 |
| ss_6.pdf Path: Stevens >> E >> 344 Fall, 2009 Description: Core 7.4 a) 6.67wt%C Wt%C Cx 0.02wt %C Z X (Distance) Z` b) Wt %C 0.6 Z Z` X At 1000 C this alloy is a single phase solid solution of C dissolved in FCC c) . would be converted to ` (Martensite) which is a After a rapid quench, the supe... Date Added: 2009-06-04 21:51:04 |
| CppHTP6e_11-final.ppt Path: Benjamin Franklin Institute of Technology >> ECE >> 2552 Fall, 2009 Description: 1 1 1 Operator Overloading; String and Array Objects 2008 Pearson Education, Inc. All rights reserved. 2 The whole difference between construction and creation is exactly this: that a thing constructed can only be loved after it is constructed; ... Date Added: 2009-06-04 21:53:14 |
| review.pdf Path: Youngstown >> CC >> 1572 Fall, 2009 Description: Review Problems 1. Calculate. a. csc-1 2 2. Given that loga b = 1, simplify a - b. 3. Given that loga b = -1, simplify a b. 1 4. Given that loga b = 2 , simplify a . b b. sin (tan-1 3) 5. Given the graph of f, sketch the graph of f . 6 6 -1 - ... Date Added: 2009-06-04 22:04:44 |
| homework5.doc Path: Harvard >> COMP >> 232 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>InternalError</Code><Message>We encountered an internal error. Please try again.</Message><RequestId>F07B5C47CEEEFE92</RequestId><HostId>UCqGyawamS1JSSvZXgFc0m7JYtmSx1ePcbOqSJ8uG1PVcC3m3uuwxk2RPrHvP... Date Added: 2009-06-04 22:07:28 |
| Lec12b.pdf Path: UCSC >> CMPE >> 264 Spring, 2008 Description: Department of Computer Engineering University of California at Santa Cruz Image Motion Analysis CMPE 264: Image Analysis and Computer Vision Hai Tao Department of Computer Engineering University of California at Santa Cruz Image sequence and motio... Date Added: 2009-06-04 22:10:53 |
| Cs252s06-lec07-dynamic-sched.pdf Path: Maryland >> CS >> 411 Fall, 2008 Description: Review from Last Time EECS 252 Graduate Computer Architecture Lec 7 Instruction Level Parallelism David Patterson Electrical Engineering and Computer Sciences University of California, Berkeley http:/www.eecs.berkeley.edu/~pattrsn http:/vlsi.cs.berk... Date Added: 2009-06-04 22:14:18 |
| Black Bean Tacos .pdf Path: Penn State >> AGM >> 120 Fall, 2009 Description: Print Full Page - Kitchen Assistant - Cooking Light Page 1 of 1 Black Bean Tacos From Seitan has a neutral flavor and a chewy, meatlike texture. Look for it in the refrigerated sections of health food stores or Asian markets. It may also be labeled... Date Added: 2009-06-04 22:19:15 |
| fe-f92.ps.pdf Path: Berkeley >> CS >> 188 Spring, 2004 Description: j p v doyhvgdibw h u h p iwdievpo yxrh5rBeyez5#pp wmb icyxp #xf upthp rutqwe w|wqyeb hiole5ip #vlifypiphgueh 4dtwiebppf wxy yeihb weuvdwb 2weioywf#vkfx igypxwpx #yiyhvb tgucpv db ibwv ihsw gewu p 4b#pwiem7bgvrdrtuwyp iewBuh... Date Added: 2009-06-04 22:30:48 |
| macromodeling.pdf Path: Oakland University >> CSE >> 598 Fall, 2009 Description: Power Macromodeling for High Level Power Estimation Subodh Gupta and Farid N. Najm ECE Dept. and Coordinated Science Lab. University of Illinois at Urbana-Champaign Urbana, Illinois 61801 y Abstract A modeling approach is presented that captures th... Date Added: 2009-06-04 22:52:48 |
| Problem Set 6 Rev03.pdf Path: ECCD >> C >> 97251 Fall, 2009 Description: Problem Set 6 (Posted for Tuesday Oct. 24/06) 6.1 An uncharged 10F capacitor is charged by the current i (t ) = 10 cos(10 3 t ) mA; take i(t<0)=0 and v(t<0)=0. a) Find the expression for the voltage across the capacitor. b) Sketch the voltage across ... Date Added: 2009-06-04 22:54:23 |
| matec_5100.pdf Path: Penn State >> P >> 457 Fall, 2009 Description: ... Date Added: 2009-06-04 23:08:44 |
| YGL129C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YGL >> 129 Fall, 2009 Description: YGL129C.t2k CB_BURIAL_14_7 2 1 AAA 1 A BBBA B CCC C D D D D X X X X X A ABAB FFFF A F F A A BB A B B A GGGGF G B G A B A E D D D D D D D D X X X X XXXXXXXXXXCCXXXXXCCXCXXXEEEXEEE X X X X X X X X X X X B B A B A C C C A D F C A A A AA A A B E ... Date Added: 2009-06-04 23:10:13 |
| 74HC14 -- Hex Schmitt-trigger inverter.pdf Path: Rose-Hulman >> ECE >> 333 Fall, 2009 Description: SN54HC14, SN74HC14 HEX SCHMITT-TRIGGER INVERTERS SCLS085B DECEMBER 1982 REVISED MAY 1997 D Package Options Include Plastic Small-Outline (D), Thin Shrink Small-Outline (PW), and Ceramic Flat (W) Packages, Ceramic Chip Carriers (FK), and Standard ... Date Added: 2009-06-04 23:12:23 |
| OCloxidn.pdf Path: TN Tech >> CHEM >> 312 Fall, 2009 Description: Oxidation of an Alcohol O H R C R\' H O R C R\' Conversion of alcohol to carbonyl compound 1o alcohol 2o alcohol 3o alcohol aldehyde carboxylic acid ketone no reaction Oxidizing agents Na2Cr2O7, Na2CrO4, CrO3, all equivalent to H2CrO4 (chromic ... Date Added: 2009-06-04 23:22:36 |
| ps3soln.ps Path: Caltech >> GE >> 128 Fall, 2009 Description: %!PS-Adobe-3.0 %XpPrinter-Model: Generic Printer %Creator: Wind/U Xprinter Version 3.1.0 (sol2) (Compile Date: Mar 9 2000 12:01:23) (kessler) %Title: %CreationDate:Mon Jun 11 14:43:01 2001 %DocumentSuppliedResources: (atend) %Pages: (atend) %Language... Date Added: 2009-06-04 23:23:49 |
| VenkatesanRakeshGrading.pdf Path: Illinois Tech >> CS >> 560 Fall, 2009 Description: Venkatesan, Rakesh Team 2 Research Paper on Grading Research Paper on Grading 1 Venkatesan, Rakesh Team 2 Research Paper on Grading Grades are a measure of the performance of a student in individual courses. Each student shall be judged on the ba... Date Added: 2009-06-04 23:24:41 |
| chap554.xls Path: UMKC >> BA >> 544 Fall, 2009 Description: Item Cost Materials cost/unit $10 Inventory holding cost/unit/month $2 Marginal cost of stockout/unit/month $5 Hiring and training cost/worker $300 Layoff cost/worker $500 Labor hours required/unit 4 Regular time cost/hour $4 Over time cost/hour $6 M... Date Added: 2009-06-04 23:25:58 |
| EE551_451_class26.ppt Path: Boise State >> EE >> 451 Fall, 2009 Description: EE 551/451, Fall, 2007 Communication Systems Zhu Han Department of Electrical and Computer Engineering Class 26 Dec. 11th, 2007 Overivew Convolutional code Encoder Decoder: Viterbi decoding Turbo Code LDPC Code TCM modulation Exam, 3 10 p... Date Added: 2009-06-04 23:26:40 |
| potential.doc Path: Iowa State >> MR >> 0420 Fall, 2009 Description: Agri News, MN 04-17-07 Bioeconomy loaded with potential for Iowa By Jean Caspers-Simmet Agri News staff writer AMES, Iowa - The potential impact from the bioeconomy dwarfs the creation of hybrid seed, says Iowa State University President Gregory Geof... Date Added: 2009-06-04 23:26:45 |
| potential.doc Path: Iowa State >> PUBLIC >> 0420 Fall, 2009 Description: Agri News, MN 04-17-07 Bioeconomy loaded with potential for Iowa By Jean Caspers-Simmet Agri News staff writer AMES, Iowa - The potential impact from the bioeconomy dwarfs the creation of hybrid seed, says Iowa State University President Gregory Geof... Date Added: 2009-06-04 23:26:45 |
| Lesson03-Proj1-Memo1Hahn-w.COMMENTS.doc Path: Penn State >> JYH >> 5006 Fall, 2009 Description: HOLIDAY BONUS To: All Employees From: Jean Hahn, Human Resources Manger Date: 17 December, 2007 Subject: Holiday Bonus This year has been yet another journey for our company and we want to thank all of you for being SimuTech\'s source of pride. As we ... Date Added: 2009-06-04 23:26:48 |
| q910_160_2.pdf Path: Boise State >> PDF >> 160 Fall, 2009 Description: MATH 160 004 Quiz Answers 9/10/07 Mon Sep 10 12:35:23 MDT 2007 1 /m160.fa07/handouts160/q910/q910 160 These are alleged answers. For each error herein, you get extra-credit points for being the first to report it by e-mail. 1 MATH 160 expects yo... Date Added: 2009-06-04 23:27:33 |
| q309_143_1.pdf Path: Boise State >> PDF >> 143 Fall, 2009 Description: MATH 143 013 Quiz 3/9/06 Name: Thu Mar 9 14:38:25 MST 2006 Pencils and Erasers Only No Calculators Allowed. 1 /m143.sp06/handouts143/q309/q309 143 1 Compute the difference quotient (also known as N Q) for f (x) = 1 - 3x2 . Simplify. 2 Let f (x... Date Added: 2009-06-04 23:28:20 |
| hw01.ps Path: Maryland >> CMSC >> 250 Fall, 2007 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw01.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hw01.dvi %DVIPSParameters: dp... Date Added: 2009-06-04 23:29:31 |
| prod_Function.xls Path: Uni. Westminster >> ECON >> 499 Fall, 2009 Description: Output 312951.63 265662.27 885047.49 72401.06 12383.47 557859.28 # 536313.98 # 587318.38 230956.02 901938.43 282593.2 250817.31 840486.69 64812.13 11397.19 487212.28 # 454978.55 # 350860.95 207497.78 732619.08 300759.74 268057.41 892325.3 65164.42 97... Date Added: 2009-06-04 23:31:07 |
| v02n813.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Digest V2 #813 Reply-To: cdn-firearms-digest@sfn.saskatoon.sk.ca Sender: owner-cdn-firearms-digest@sf... Date Added: 2009-06-04 23:31:51 |
| strpbul2.xls Path: Wyoming >> CE >> 3600 Fall, 2008 Description: 0.063 Pressure Bulbs under an Infinitely Long Strip Footing 1000 Surface Load = 1000 psf. To determine stress at any other pressure q\', multiply the stress by q\'/1000. q = z/B 0.000 0.000 0.063 0.125 0.188 0.250 0.313 0.375 0.438 0.500 0.563 0.625... Date Added: 2009-06-04 23:32:04 |
| magfields-lab05-011-07S.pdf Path: St. Mary's CA >> PHYS >> 011 Fall, 2009 Description: Physics 11, Spring 2007 Lab 5: Magnetic fields and field effects Determine the direction of the Earth\'s magnetic field. Make a note of this (a room diagram?) Run a large current through a length of wire. Map B with a compass. Sketch the field line... Date Added: 2009-06-04 23:32:20 |
| HW4.pdf Path: BYU >> PHYSICS >> 321 Fall, 2009 Description: Physics 321 Homework 4 Due at midnight on the day of Hour 5. By now, you are probably getting fairly proficient with solving problems using Maple. If not, you should invent a few differential equations and try working through solutions, plotting resu... Date Added: 2009-06-04 23:33:57 |
| HW4.pdf Path: BYU >> HW >> 321 Fall, 2009 Description: Physics 321 Homework 4 Due at midnight on the day of Hour 5. By now, you are probably getting fairly proficient with solving problems using Maple. If not, you should invent a few differential equations and try working through solutions, plotting resu... Date Added: 2009-06-04 23:33:57 |
| section5.6.pdf Path: Texas Tech >> MATH >> 1351 Fall, 2008 Description: Section 5.6 I. Differential Equation A. Definition dy = -3 y , xy + y = cos x , dx y - 3 y + 2 y = 0 y = 2 e -3 x , y = y = e 2 x + 4e x B. Solution sin x 4 - , x x C. General Solution y = Ae -3 x , y = y = Ce 2 x + De x sin x + c x D. E.... Date Added: 2009-06-04 23:34:51 |
| numerical-summary.pdf Path: Texas Tech >> MATH >> 1351 Fall, 2008 Description: Right-Hand End-Point Rule Mid-Point Rule Trapezoid Rule Simpson\'s Rule I f ( xk ) x k =1 n I f ( xkm ) x k =1 n 1 f ( x0 ) + 1 f ( xn ) 2 2 x n -1 I + f ( xk ) k =1 (b - a ) 3 | En | M 12n 2 where M = max | f ( x ) | x[ a ,b ] ... Date Added: 2009-06-04 23:34:52 |
| letter_special_eminence.doc Path: Yale >> APTS >> 0405 Fall, 2009 Description: Appendix E Letter for Candidates of Special Eminence Sample letter to be used only for candidates of widely acknowledged preeminence, as recommended by a Divisional Advisory Committee and approved by the Steering Committee. Dear : The Department o... Date Added: 2009-06-04 23:34:59 |
| Jiang-04.pdf Path: Sveriges lantbruksuniversitet >> K >> 812 Fall, 2009 Description: RyR2 mutations linked to ventricular tachycardia and sudden death reduce the threshold for store-overload-induced Ca2 release (SOICR) Dawei Jiang*, Bailong Xiao*, Dongmei Yang, Ruiwu Wang*, Philip Choi*, Lin Zhang*, Heping Cheng, and S. R. Wayne Chen... Date Added: 2009-06-04 23:35:43 |
| YDR479C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YDR >> 479 Fall, 2009 Description: YDR479C.t2k DSSP-EHL2 2 1 CC 1 C X X X C C C X X C C C C C X X X X X X X X E E C C C E H E X X X X X X X C CCCCC C C C X X X C C C C CCXCXCEEX E E X X X X X C E C X X X X CC C C E C C E C X X X X X X X X X X X X X C C C C E E E E ... Date Added: 2009-06-04 23:36:21 |
| YDR435C.t2k.str2-logo.pdf Path: UCSC >> YDR >> 435 Fall, 2009 Description: YDR435C.t2k STR2 5 4 3 2 1 C HHH X X HH C X X G X C H CT HH S S HCHHHH STTGGXXXXXXXXXCSHTHTXXXXXXXXXXXXXXXCTHCCCC C H H T S T T H H H T C G C T C T T T T S S T C T G S T H S X X X XXXT X X X X X X X C X X HH HH 10 20 30 40 H 5 4 3 2 1 H H... Date Added: 2009-06-04 23:36:59 |
| YDR461C-A.t2k.w0.5-logo.pdf Path: UCSC >> YDR >> 461 Fall, 2009 Description: YDR461C-A.t2k w0.5 1 M L E I V XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX A D G S K S DIN L V E H Y F L E PLPVDPP YEE I V K A K T T A E I L F L M L I V D E S T Q K K V EEIE L DE E HRE K D A T T S S A 1 10 20 30... Date Added: 2009-06-04 23:37:14 |
| schedule.txt Path: Iowa State >> ECON >> 1934 Fall, 2009 Description: Date,Visitor,Home,Location,Site,Time,Playoff,Notes 07/01/1934,Bedford,Corning,2,0, 07/01/1934,Cedar Falls,Sumner,1,0, 07/01/1934,Clear Lake,Britt,1,0, 07/01/1934,Corning,Lenox,2,0, 07/02/1934,Bedford,College Springs,2,0, 07/02/1934,Cedar Falls,Vinton... Date Added: 2009-06-04 23:38:32 |
| CS4744f03P03.pdf Path: Cal Poly >> CS >> 4744 Fall, 2009 Description: ASSIGNMENT 2 Due September 25, 2003 Problem 3 Implement Algorithm 4.8 QR iteration with shifts for computing the eigenvalues of a general real matrix A. Repeat until convergence: 1. = an,n (using the lower right-hand corner entry as shift) 2. Compu... Date Added: 2009-06-04 23:39:44 |
| 666aFrancis06.ppt Path: McGill >> GEOPHYS >> 666 Fall, 2009 Description: Extrasolar Planets We ride across the universe on a ball of rock tethered to a star The Extra Solar Enclopaedia: http:/exoplanet.eu/ GC Lupi with 2.5 MJupiter planet at distance of Neptune Planet Transits Algol Lambda Tau More than half of t... Date Added: 2009-06-04 23:43:45 |
| A-103.pdf Path: Penn State >> AIK >> 5011 Fall, 2009 Description: ... Date Added: 2009-06-04 23:45:47 |
| submit.txt Path: Washington >> V >> 15520 Fall, 2009 Description: executable = allgamma_15520.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15500-15999/15... Date Added: 2009-06-04 23:47:35 |
| error.txt Path: Washington >> V >> 15500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 17:41:52 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 18:54:07 2008 ( 4335 s elapsed) ... Date Added: 2009-06-04 23:48:06 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now! |
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses. |
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now! |
||
