Course Solutions And Notes - 3621_mat 22
| Communication.doc Path: Indiana State >> CARBON >> 432 Fall, 2009 Description: Communication intra and extracellular signals signals translated into responses signal transduction requires inducers to transfer, amplify signal ... Date Added: 2009-06-07 12:00:10 |
| openfile1.txt Path: Indiana State >> CS >> 256 Fall, 2009 Description: #include <stdio.h> #include <stdlib.h> #define FILENAME \"story.txt\" main() { FILE *fd; /* file descriptor */ char c; fd = fopen(FILENAME,\"r\"); if(fd = NULL){ fprintf(stderr,\"cannot open %s\ \", FILENAME); exit(0); } for(;){ ... Date Added: 2009-06-07 12:00:18 |
| Lec4.ppt Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: Lecture4:Assembly Language ComputerEngineering211 Spring2002 MemoryAddressing Byteaddressable B 0 1 2 3 H=232=4G EndiannessofMemory Addressing Cohen\'sarticle:OnHolyWarsandaPleaforPeace, IEEEComputer,Oct81. bits,bytes words , pages CPU Me... Date Added: 2009-06-07 12:00:30 |
| eqnbalancingpractice.pdf Path: Wisc Eau Claire >> CHEM >> 101 Fall, 2009 Description: Balancing Chemical Equations Balance the equations below: 1) 2) 3) 4) 5) 6) 7) 8) 9) 10) 11) 12) 13) 14) 15) 16) 17) 18) 19) 20) 21) _ N2 + _ H2 _ KClO3 _ NH3 _ KCl + _ O2 _ NaF + _ Cl2 _ H2O _ H2O + _ PbCl2 _ KBr + _ Al2(SO4)3 _ NaCl + _ F2 _ H2 +... Date Added: 2009-06-07 12:04:35 |
| hw6.pdf Path: UCSC >> CMPS >> 101 Spring, 2008 Description: CMPS 101 Spring 2009 Homework Assignment 6 1. (1 Point) p.547: 22.3-1 Make a 3-by-3 chart with row and column labels WHITE, GRAY, and BLACK. In each cell (i, j ) , indicate whether, at any point during a depth-first search of a directed graph, there ... Date Added: 2009-06-07 12:06:29 |
| Making%20Screen%20Captures%20in%20Windows.pdf Path: Trinity U >> CS >> 1300 Fall, 2009 Description: Making Screen Captures in Windows If you are using a desktop computer, press the print screen button when the screen you want to capture is open. This places a \"picture\" of the screen on your clipboard. You will not see anything until you put it into... Date Added: 2009-06-07 12:07:16 |
| ComprehensiveExperiment.pdf Path: U. Houston >> ISAM >> 5636 Fall, 2009 Description: COMPREHENSIVE EXPERIMENT In this experiment you will work with Cisco Etherswitches and Routers. You will use MLS, PPP and ACLs Before you start your experiment you will need to clear all the prior configuration from the switches and routers. When you... Date Added: 2009-06-07 12:12:02 |
| RouterManagementExp-II-old.doc Path: U. Houston >> ISAM >> 5636 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|09 Feb 2007 00:52:32 -0000 vti_extenderversion:SR|6.0.2.8161 vti_author:SR|UHCL\\Gercek vti_modifiedby:SR|UHCL\\Gercek vti_timecreated:TR|09 Feb 2007 00:52:32 -0000 vti_cacheddtm:TX|09 Feb 2007 00:52:32 -... Date Added: 2009-06-07 12:12:11 |
| SurfacePressureMap.pdf Path: Washington >> ATMOS >> 101 Fall, 2009 Description: 1018 1009 1016 1008 1017 997 1011 1015 1007 1001 1015 1012 1016 1011 1005 998 1000 1012 1002 1014 1018 1010 1008 1003 1015 1007 1004 1014 1017 1007 1007 1012 1011 1009 1008 1009 1010 1011 1008 1011 1013 1013 1014 1016 1016 1013 1016 1017 1007 1014 10... Date Added: 2009-06-07 12:12:44 |
| page4.pdf Path: Washington >> ATMOS >> 101 Fall, 2009 Description: ... Date Added: 2009-06-07 12:12:47 |
| q6sol.pdf Path: UC Davis >> AMOS >> 518 Fall, 2009 Description: ... Date Added: 2009-06-07 12:13:24 |
| art_chap4-1.pdf Path: Oakland University >> PHYS >> 10262 Fall, 2009 Description: 4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of the cells. The cells control the operation of b... Date Added: 2009-06-07 12:17:03 |
| CS219_FIND_Presentation_final.ppt Path: UCLA >> CS >> 219 Fall, 2008 Description: CS 219 : Wireless Urban Sensing Systems FIND Proposal Presentation Andrew Parker Sasank Reddy 1 Overview Introduction Sensing Contexts System Architecture Technical Approach Applications 2 FIND Challenge FIND (Future Internet Network Desi... Date Added: 2009-06-07 12:17:31 |
| lecture19.pdf Path: Oakland University >> CSE >> 40567 Fall, 2009 Description: Computer Security CSE 40567/60567 Fall 2008 Lecture 19: Security Management Department of Computer Science and Engineering University of Notre Dame 1 Lecture Overview Lecture Overview Physical security Risk assessment Legal issues Privacy CS... Date Added: 2009-06-07 12:17:37 |
| Service_Organizations_Day_Invitation_2008.pdf Path: Northwestern MN >> PDFS >> 226 Fall, 2009 Description: NORTHWESTERN COLLEGE SERVICE ORGANIZA TlONS DA Y Friday, September s\". 2008 August 4, 2008 Northwestern encouraging College Campus Ministries Day! would like to invite two representatives from your organization to our annual Service Organizations ... Date Added: 2009-06-07 12:18:11 |
| Revenue Lab.doc Path: Arizona >> MATH >> 120 Fall, 2008 Description: Math 120R Lab 3 Revenue Lab Furniture Barn is a chain of furniture in the northeastern corner of South Dakota. In the past few weeks, the revenue produced from the sale of their luxury recliners has disappointed them. In an effort to find a solution... Date Added: 2009-06-07 12:20:14 |
| Lin-Jonassen.pdf Path: UGA >> EDIT >> 6100 Fall, 2008 Description: IT Leader IT Leader Dr. David Jonassen: Theory Into Practice Professional Preparation 1977-85: Computer Science, Statistics, Philosophy, University of North Carolina at Greensboro Educational Media & Educational Psychology, Temple University Elem... Date Added: 2009-06-07 12:21:07 |
| Australia_Forecast.pdf Path: Clark U >> ECON >> 208 Fall, 2009 Description: Economist.com | Country Briefings: Australia http:/www.economist.com/countries/Australia/PrinterFriend. Go Forecast Mar 9th 2004 From the Economist Intelligence Unit Source: Country Forecast The revival in support for the main opposition centre-l... Date Added: 2009-06-07 12:21:31 |
| USG_Faculty_Council_Bylaws_FinalDraft3.pdf Path: UGA >> UC >> 262 Fall, 2009 Description: University System of Georgia Faculty Council Bylaws Proposed: March 14, 2008 Drafted By: Russell Porter (Clayton State University), Elizabeth Combier (North Georgia College and State University), Craig Turner (Georgia College and State University), T... Date Added: 2009-06-07 12:21:35 |
| swineID.pdf Path: Iowa State >> NR >> 101787 Fall, 2009 Description: Iowa 4-H Youth Development County Swine Identification Report Street/RR City Due to ISU Extension County Office by May 15 Name of 4-H\'er_County_ Address__ Zip+four Phone (_)_-_Your birth date_/_/_Grade in school_ Name of 4-H Club__Date_ I (we) he... Date Added: 2009-06-07 12:24:51 |
| Ch4MoleculesCompoundsChemicalReactions.pdf Path: MNSU >> CHM >> 100 Fall, 2009 Description: _ Chemistry in Focus 3rd edition Tro _ _ S L I D E Chapter 4 Molecules, Compounds, and Chemical Reactions __ _ _ _ _ __ _ 1 S L I D E In all of science history, an exception to this rule has never been found. _ Molecules cause the behavior ... Date Added: 2009-06-07 12:26:33 |
| learning-objectives-vestib.doc Path: Maryville MO >> PT >> 8690 Fall, 2009 Description: 8690 Case Management III Evaluation & Management Patient with Vestibular Balance Disorders Learning Objectives 1. Differentiate between peripheral and central vestibular disorders with an emphasis on the TBI patient. 2. Describe vestibular adaptation... Date Added: 2009-06-07 12:26:43 |
| EDU_360_Initial_Assessment_Cover_Sheet_&_Summary.doc Path: MO Western >> EDU >> 360 Fall, 2009 Description: Initial Emergent/Early Student Assessment Summary Student First Name: _ Grade: _ Classroom teacher: _ Reading Interest Survey RI LI High Medium or Low (circle one) *Letter Identification Score letters known by name sound or word _/54 *Concep... Date Added: 2009-06-07 12:27:17 |
| 2006FairresultsDog.pdf Path: Iowa State >> FF >> 41021 Fall, 2009 Description: 2006 Clay County Fair 4-H/FFA Dog Show Name Kyle Kyle Kyle Patrick Patrick Patrick Charlene Charlene Charlene Jennessa Jennessa Jennessa Chelsea Chelsea Chelsea Chelsea Nicholas Nicholas Anna Anna Sara Sara Sara Sara Andrew Andrew Andrew Madella Made... Date Added: 2009-06-07 12:35:36 |
| S2009_04_22.ppt Path: Skidmore >> CS >> 102 Fall, 2009 Description: CS 102 Computers In Context (Multimedia) 04 / 22 / 2009 Instructor: Michael Eckmann Today\'s Topics Questions/comments? Making movies, animations Michael Eckmann - Skidmore College - CS 102 - Spring 2009 If your files are stored as frame01.jpg, ... Date Added: 2009-06-07 12:36:19 |
| ATPC_DraftDC_AIR_IIVV_F08a_T13_V1.0.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: 224fa6d412218ea0aec55c72bf1c58faba2b729c.xls - Areas of Concern Log Project Name: Artifact: Module: MBASE Phase/level: Activity: Exit Criteria: Reviewer: Review Leader email: Review Leader phone: Author: Acme Research Engine for USC-WB Archives AT... Date Added: 2009-06-07 12:42:09 |
| application.pdf Path: Ohio State >> AGED >> 489 Fall, 2009 Description: Agricultural & Extension Education 489 Internship in Agricultural Occupations Internship Application Date: Name: Local Address: City, State, Zip: Telephone: Email: I am applying for enrollment in the AGR EDUC 489 Internship Program. My agricultural e... Date Added: 2009-06-07 12:42:40 |
| christmas_2005.pdf Path: CSU Northridge >> VCEED >> 002 Fall, 2009 Description: Christmas, 2005 Dear friends, We hope you have a joyous Christmas! We appreciate this season and the opportunity it affords to reflect on life and the goodness of God. Last year at this time Stephen was in a wheel chair with two fractured feet. The r... Date Added: 2009-06-07 12:44:05 |
| T0262.t04.w0.5-logo.pdf Path: UCSC >> T >> 0262 Fall, 2009 Description: T0262.t04 w0.5 3 2 1 L A XXXXXXXXX L A M F Y L SR E G K L I VS M LRX X Y KN I S A D V F R E Q Q H E P A L I V F L K G X X X X E XXXXX M G E D L I WV V L I XXXXXXXLXXXXX X A I D S E E G Y F L A V I L D A V IL F V I D E E X X L... Date Added: 2009-06-07 12:44:06 |
| 21sideeffects.pdf Path: UMBC >> CMSC >> 331 Spring, 2003 Description: Side Effects 1 Side effects in functional languages Pure function languages dont have sidedon sideeffects except for things like printing e.g., no assignment operator! Most successful languages arent pure, tho. aren tho. Lisp has many built in func... Date Added: 2009-06-07 12:44:48 |
| design.ppt Path: Sveriges lantbruksuniversitet >> UNIT >> 100 Fall, 2009 Description: Engineering Design October 29, 2008 Requirement: a teapot suitable for preparing up to two litres of tea Constraints: Must cost less than $20 No electrical or electronic parts Suitable for use by a blind person If you are working in a group, assign... Date Added: 2009-06-07 12:46:56 |
| quiz141_1a.pdf Path: Centre >> MAT >> 141 Fall, 2009 Description: MAT 141, Quiz 1 February 4, 2008 Name: Please show all relevant work clearly and in order. 1. (5 points) Give a rational function dened everywhere except at x = 0 and x = 2, whose only root is at x = 1, and has a hole at x = 2. 2. (5 points) Exp... Date Added: 2009-06-07 12:54:48 |
| se6ch10B.ppt Path: TN Tech >> CSC >> 3700 Fall, 2009 Description: Slide 10B.1 Object-Oriented and Classical Software Engineering Sixth Edition, WCB/McGraw-Hill, 2005 Stephen R. Schach srs@vuse.vanderbilt.edu The McGraw-Hill Companies, 2005 CHAPTER 10 Unit 10B Slide 10B.2 REQUIREMENTS The McGraw-Hill Compan... Date Added: 2009-06-07 12:54:50 |
| Trees.ppt Path: NYU >> CS >> 102 Fall, 2009 Description: Trees this is a tree 2004 Goodrich, Tamassia Trees 1 What is a Tree? In computer science, a tree is an abstract model of a hierarchical structure A tree consists of nodes with a parentchild relation Inspiration: family trees Applications:... Date Added: 2009-06-07 12:57:06 |
| 2_4.pdf Path: University of Iowa >> MATH >> 133 Fall, 2009 Description: Ta (Rn ) = {(a, x) | x Rn } (ax) = x a canonical basis {Eia = 1 (ei ) | i = 1, ., n} Let C (a) = {f : X Rn R C | a domf } f g if U open s.t. a U and f (x) = g(x)x U . fi : Ui R C (a) implies f1 + f2 : U1 U2 R C (a) and fi : Ui R C... Date Added: 2009-06-07 12:58:36 |
| ARANZ_UN_DIRKS(Koga).pdf Path: Arizona >> DLIST >> 2601 Fall, 2009 Description: (A Paper for the Archives and Records Association of New Zealand (ARANZ) 2007 Conference in Auckland, New Zealand, Jul. 12-14, 2007) Implementation of the DIRKS Methodology by International Organizations: The Case of the United Nations * Takashi Ko... Date Added: 2009-06-07 13:09:01 |
| 14875g.pdf Path: Arizona >> AZ >> 1487 Fall, 2009 Description: Use of Velocity for Post Emergence Control of (AB) in Overseeded Turf D.M. Kopec, J. Gilbert, S. Nolan and M Pessarakli . University of Arizona. Abstract Velocity herbicide was applied alone, or with mixtures of Tourney fungicide and/or Primo PGR fo... Date Added: 2009-06-07 13:09:03 |
| prolog.ps Path: Marlboro >> APR >> 800 Fall, 2009 Description: %BeginProlog 50 dict begin % This is a standard prolog for Postscript generated by Tk\'s canvas % widget. % SCCS: @(#) prolog.ps 1.5 96/02/17 17:45:11 % % % % The definitions below just define all of the variables used in any of the procedures here. T... Date Added: 2009-06-07 13:10:25 |
| procmem.ps Path: Duke >> X >> 110 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - procmem.ppt %Creator: Windows NT 4.0 %CreationDate: 15:49 3/4/1999 %Pages: (atend) %BoundingBox: 13 13 599 780 %LanguageLevel: ... Date Added: 2009-06-07 13:13:07 |
| a11.pdf Path: California State University, Monterey Bay >> CS >> 624 Fall, 2009 Description: CS 624: Analysis of Algorithms Assignment Due: Monday, April 27, 2009 1. Exercise 1.2 in the Prims algorithm handout. 2. Exercise 22.3-8 (page 548). 3. Exercise 23.1-1 (page 566). 4. Exercise 23.1-4 (page 566). 5. Exercise 23.1-6 (page 566). 6. Exer... Date Added: 2009-06-07 13:13:21 |
| H11-15.ps Path: Bowdoin >> CS >> 231 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: H11-15.dvi %Pages: 11 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR17 CMR10 CMTI12 CMR8 CMBX12 CMR12 CMMI12 CMR7 CMSY10 %+ CMCSC10 CMMI8 CMTT12 %End... Date Added: 2009-06-07 13:14:49 |
| asn-01-n-up2.pdf Path: W. Alabama >> ECE >> 327 Fall, 2009 Description: ASN-01 Preliminaries 69 ASN-01: 1.8.1 Flops, Latches, and Combinational Circuitry 70 ASN-01: VHDL Syntax Lecture Notes Sections: 1.8 1.8.6 University of Waterloo Dept of Electrical and Computer Engineering E&CE 427 Digital Systems Engineer... Date Added: 2009-06-07 13:19:12 |
| JUVENILEJUSTICECHAPTER3.ppt Path: University of Hawaii - Hilo >> AJ >> 210 Fall, 2008 Description: JUVENILE JUSTICE Chapter 3 Growth and Development The First 18 Years INFLUENCES ON CHILD\'S GROWTH AND DEVELOPMENT Community Police, Courts, Corrections, Businesses, Church, Gangs, Youth Groups, Neighbors, Civic Groups, Health Care Providers Scho... Date Added: 2009-06-07 13:24:48 |
| handout3.pdf Path: University of Hawaii - Hilo >> ICS >> 311 Fall, 2009 Description: ICS311 Assignment 3: Algorithm Design www2.hawaii.edu/~akinsey Anthony Kinsey akinsey@hawaii.edu Algorithm: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50... Date Added: 2009-06-07 13:28:04 |
| EXAM1_2001.pdf Path: Maryville MO >> NRS >> 409 Fall, 2009 Description: NRS 409/509 Exam 1 Name _ Read every question carefully. You may use a calculator if you wish. Conversion tables are provided at the end of the exam. If you have any questions, raise your hand. Be sure to show your work on computational questions. ... Date Added: 2009-06-07 13:28:06 |
| 07w.pdf Path: University of Hawaii - Hilo >> MATH >> 373 Fall, 2009 Description: Math 373 Hw 7 Worked examples and comments. Hw 201: 5.40, 5.42, 5.46. Rec 201: 5.41. 5.43, 5.45. 3DJH. Let x be the number of successes observed in a sample of n = 5 items selected from N = 10. Suppose that, of the N = 10 items, 6 are considered \"... Date Added: 2009-06-07 13:32:07 |
| Consequence_of_disease.pdf Path: Laurentian >> HLSC >> 200801 Fall, 2009 Description: Habit Outcome Consequence ... Date Added: 2009-06-07 13:35:13 |
| Norwalk Virus.pdf Path: Laurentian >> HLSC >> 200801 Fall, 2009 Description: NORWALK VIRUS (NORWALK, OHIO, 1972) IS THE PROTOTYPE OF THE GENUS NORWALK-LIKE VIRUS (NLV) IN THE CALICIVIRIDAE FAMILY INCLUDES LARGE NUMBER OF GENETICALLY RELATED STRAINS THAT CAUSE GASTROENTERITIS WORLD WIDE HUMANS ARE THE ONLY KNOWN HOSTS NLV ACCO... Date Added: 2009-06-07 13:35:15 |
| FinalKeyW03.pdf Path: BYU >> CHEM >> 105 Fall, 2008 Description: Some Data You Might Need Standard Reduction Half-Reactions K1+ + e1! = K(s) Zn2+ + 2e1! = Zn(s) Pb2+ + 2e1! = Pb(s) 2H1+ + 2e1! = H2(g) I2(s) + 2e1! = 2I1! NO31! + 4H1+ + 3e1! = NO(g) + 2H2O Br2(R) + 2e1! = 2Br1! ClO41! + 2H1+ + 2e1! = ClO31! + H2O C... Date Added: 2009-06-07 13:35:54 |
| README.txt Path: Acton School of Business >> ELEC >> 431 Fall, 2009 Description: This file describes various files in this folder. implementation.m: %code to generate binaural sound samples using all of the other functions. run this to obtain our results. sonyl.wav - impulse response for the sony headphones, left ear sonyr... Date Added: 2009-06-07 13:38:00 |
| hw2sol.doc Path: Berkeley >> ME >> 252 Fall, 2009 Description: ME 252 Homework 2 Problem 1 E = mcT + q\" dx in b, x w =perimeter Eout = mcTb , x + dx d (mcTb ) dx - qw dx = 0 dx \" for case (a), m = B, qw( a ) dx = A (1) (2) d ( BcTb ,( a ) ) (2) dx ... Date Added: 2009-06-07 13:38:32 |
| DM_Solution1.pdf Path: Georgia Tech >> ISYE >> 7406 Fall, 2008 Description: ISyE 7406, Spring-2007 Instructor: Kwok-Leung Tsui Assignment # 1 (Solution) Question 1: If you use this command home< read.csv(hmeq.csv, na.strings= ), you may not be able to get the correct number of rows after removing NA cells by complete.cases. ... Date Added: 2009-06-07 13:41:09 |
| Solutions_Chem205_Midterm_2_W2004.doc Path: Contra Costa College >> CHEM >> 205 Fall, 2009 Description: CHEM205 MIDTERM #2 W2004 - Rogers ... Date Added: 2009-06-07 13:44:40 |
| NguyenT.pdf Path: Maryland >> MATH >> 246 Fall, 2008 Description: Extra credit b)For the matrix A= m+1-13m-1 % with m= [-2; 2] %We have: (delta)= (m)^2- det(A) %= (m)^2- [(m)^2-2] %= 2 or (delta)^(1/2)= 2^(1/2) % Since (delta)>0, we can conclude that there are 2 simple real roots. And % thus, the plot of it can ei... Date Added: 2009-06-07 13:46:46 |
| ReviewQuestions2009Feb23.doc Path: UWI Mona >> IO >> 2914 Fall, 2009 Description: Some ACS-2914 Review Questions Feb 23, 2009 1. Consider the tables described in the appendix. Patrons are people who borrow books from the library. The Borrow table keeps track of books that patrons have borrowed. The dateReturned attribute records... Date Added: 2009-06-07 13:48:10 |
| micheletti_folding.pdf Path: UC Davis >> ECS >> 229 Fall, 2008 Description: PROTEINS: Structure, Function, and Bioinformatics 62:1723 (2006) SHORT COMMUNICATION Are Structural Biases at Protein Termini a Signature of Vectorial Folding? Alessandro Laio1 and Cristian Micheletti2* 1 Computational Science, Department of Chemist... Date Added: 2009-06-07 13:51:15 |
| assign6latin.doc Path: Colgate >> GEOG >> 210 Fall, 2009 Description: GEOG 210: Geog. of the World Economy/Fall 99 GEOGRAPHY 210: GEOGRAPHY OF THE WORLD ECONOMY ASSIGNMENT 6: Global Forces and Regional Fortunes/Latin America chapter Due: Friday December 4th Suggested Length: 4 singlespaced (double between paragraphs... Date Added: 2009-06-07 13:52:21 |
| 2.pdf Path: UT Arlington >> RANGER >> 6392 Fall, 2009 Description: Privacy Protection: Hype or Hallelujah? Nan Zhang Recal l Privacy is about hiding everything It is about choice Self-possession, Autonomy, and Integrity Critical Accounts of Privacy Legally ungrounded Pri vacy never appears i the Consti on or ... Date Added: 2009-06-07 13:52:29 |
| Problem3_answer.pdf Path: Berkeley >> MCB >> 150 Fall, 2009 Description: Answers to problem set 3 A. Winoto 1. Mice with b, s and q haplotypes have no E molecules on the cell surface due to mutations at the E gene. AKR: Ek; Balb/c:Ed; B10: No E molecule on the cell surface; B10.A:Ek; B10.A(5R):EkEb;B10.A(4R):No E molecu... Date Added: 2009-06-07 13:52:57 |
| USATODAYsudoku.pdf Path: GWU >> CS >> 133 Fall, 2009 Description: USATODAY.com 3/17/09 10:14 AM Cars Auto Financing Event Tickets Jobs Real Estate Online Degrees Business Opportunities Shopping Search How do I find it? Subscribe to paper Become a member of the USA TODAY community now! Home News Travel Mon... Date Added: 2009-06-07 13:54:04 |
| lecture23.pdf Path: Harvard >> LECTURE >> 124 Fall, 2009 Description: nnrxrfri c beda )`YW V|hxn0 \'pUrjoc Qh p z h qp w U X U p yl w T p krsl m@oxr|hx%nc7omomi\'jxqiXkxckrzsn0nob\'|hxroyoj|wyo#rhkc zhp w qp p y w h q w hj h y wplp z zhp w zph h l w zh q yh qp z zh w RSxcAk Ci kxrqpkh nhTw ... Date Added: 2009-06-07 13:58:13 |
| homework05.ps Path: Harvard >> EDU >> 124 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f %DVIPSParameters: dpi=600, compressed %DVIP... Date Added: 2009-06-07 13:58:36 |
| 12-13_ArtBilly_Torture.pdf Path: Dallas >> PDFS >> 200905 Fall, 2009 Description: 12 Summer 2009 Volume 5 Department of (In)Justice Memos by billy easley billyeasley2@gmail.com Tort If you are an American, you owe it to yourself and your country to read the recently released Department of Justice (DOJ) memoranda. Those 80... Date Added: 2009-06-07 14:02:50 |
| i2c_protocol.pdf Path: Arizona >> ECE >> 474 Fall, 2009 Description: THE I2C-BUS SPECIFICATION VERSION 2.1 JANUARY 2000 document order number: 9398 393 40011 Philips Semiconductors The I2C-bus specification CONTENTS 1 1.1 1.2 1.3 1.4 2 2.1 2.2 3 4 5 6 6.1 6.2 7 7.1 7.2 8 8.1 8.2 8.3 9 10 10.1 10.1.1 10.1.2 10.1.3 1... Date Added: 2009-06-07 14:03:51 |
| syllabus-0708.pdf Path: Berkeley >> G >> 481 Fall, 2009 Description: ASTRO/EPS C12 Course Syllabus Dr. Michael H. Wong Summer Session 2008 This lecture schedule shows the order in which topics will be covered in the class. Read the assigned book chapters before they are discussed in class, for maximum benefit. The te... Date Added: 2009-06-07 14:06:40 |
| KeoganVita.doc Path: Montclair >> MEDIA >> 1192 Fall, 2009 Description: Curriculum Vitae KEVIN KEOGAN Department of Sociology Montclair State University Upper Montclair, NJ 07043 keogank@mail.montclair.edu www.montclair.edu/~keogank 0-57 Whitehall Street Fair Lawn, NJ 07410 (201) 475-1685 EDUCATION Ph. D. Sociology, Rut... Date Added: 2009-06-07 14:09:25 |
| extended-odmrp-milcom02-slides.ppt Path: UCLA >> CS >> 234 Fall, 2009 Description: Unicast Performance Analysis of Extended ODMRP in a Wired-to-Wireless Hybrid AdHoc Network Sang Ho Bae Sungwook Lee Mario Gerla UCLA Computer Science {sbae, swlee, gerla}@cs.ucla.edu ODMRP Overview Sources build routes on demand by flooding Update... Date Added: 2009-06-07 14:10:14 |
| 060508.pdf Path: Mt. Holyoke >> DPS >> 062008 Fall, 2009 Description: Mount Holyoke College Dispatch Log From: 06/05/2008 Thru: 06/05/2008 0000 - 2359 Printed: 06/09/2008 Page: 1 For Date: 06/05/2008 Call Number Time - Thursday Action BLDG/AREA CHECKED/OK BLDG/AREA CHECKED/OK BLDG/AREA CHECKED/OK BLDG/AREA CHECKED... Date Added: 2009-06-07 14:11:21 |
| assign01.pdf Path: Laurentian >> MATH >> 1410 Fall, 2009 Description: Math 1410a Summer 2009 Assignment 1 (Due Wednesday May 13) 3 3 1) Draw a = and b = in standard position in 2 . 0 -2 2) Draw c = [ 0, 2, 0 ] and d = [ 3, 1, 2 ] in standard position in 3 . 3) Let A = ( 1, 3 ) and B = ( 1 , 0 ). Draw the ... Date Added: 2009-06-07 14:12:42 |
| ora-start.pdf Path: NMT >> CS >> 373 Fall, 2009 Description: Oracle on the TCC Startup Accessing the Oracle DBMS on the TCC Subhasish Mazumdar Computer Science Department (mazumdar@nmt.edu) Page 1 of 2 1. First, you need to be logged in to a TCC Linux machine, e.g., rainbow.nmt.edu (or boardwalk.nmt.edu or ... Date Added: 2009-06-07 14:16:38 |
| T0446.t06.alpha-logo.pdf Path: UCSC >> T >> 0446 Fall, 2009 Description: T0446.t06 alpha 3 2 1 1 10 20 30 40 B H 3 2 1 S I H B H E H S B E H E A D E S E 51 60 70 80 90 I B S B 3 2 1 D B E B I H E A F A E A G E S E H E A D S E B 101 110 H E B D B S B H 120 PL V KELKK GTDVVGIQKTIANFSL 100 ... Date Added: 2009-06-07 14:22:42 |
| 1805Lec06A_Ethics.pdf Path: Allan Hancock College >> WEEK >> 1805 Fall, 2009 Description: ENGG1805 Professional Engineering & IT Lecture 6A Ethics in Engineering and Computing ENGG1805 Lecture 06A- 1 Dr Lu 2009 By the end of this lecture you will be able to: Understand the importance of professional ethics Recognise the difficulty in ... Date Added: 2009-06-07 14:27:33 |
| ED5.pdf Path: San Diego State >> GB >> 0405 Fall, 2009 Description: Education Courses Acceptable on Masters and Doctoral Degree Programs in Education (ED) UPPER DIVISION COURSE ED 516. Foundations of Bilingual Education (1) Prerequisite: Credit or concurrent registration in Education 451. Overview of models of bilin... Date Added: 2009-06-07 14:28:39 |
| Bridges_bc.txt Path: UNI >> FACULTY >> 023 Fall, 2009 Description: venkman@jet:~$ bc < bc.data 16 16 1048576 1048576 <- 1M or 1Meg, about 1 million 1073741824 1073741824 <- 1G or 1Gig, about 1 billion venkman@jet:~$ 1,048,576 is close to 1 million ... Date Added: 2009-06-07 14:29:17 |
| response_archive_hw0-1.txt Path: Iowa State >> COMS >> 342 Fall, 2009 Description: From leavens@cs.iastate.edu Tue Aug 28 20:15:20 2001 Date: Tue, 28 Aug 2001 20:15:08 -0500 (CDT) From: \"Gary T. Leavens\" <leavens@cs.iastate.edu> To: dheck@iastate.edu CC: cs342s@cs.iastate.edu, leavens@cs.iastate.edu In-reply-to: <200108290023.TAA... Date Added: 2009-06-07 14:30:22 |
| CAAM353_S2008_Grades1-10.pdf Path: Acton School of Business >> CAAM >> 353 Fall, 2009 Description: Rice University M. Heinkenschloss CAAM 353, 2008 Spring GRADESHEET HW1 HW2 HW3 HW4 HW5 HW6 HW7 HW8 HW9 HW10 HW11 68 70 28 70 70 20 65 65 45 61 65 57 50 55 45 83 90 77 72 75 68 73 75 68 62 75 32 49 75 20 100 100 100 CLASS SUMMARY Average Highest Sco... Date Added: 2009-06-07 14:30:22 |
| L27AdvSchedIII-4up.pdf Path: Acton School of Business >> COMP >> 412 Fall, 2009 Description: COMP 412 FALL 2008 Background ! List scheduling ! Basic greedy heuristic used by most compilers ! Forward & backward versions ! Recommend Schielkes RBF (5 forward, 5 backward, randomized) Instruction Scheduling, III Software Pipelining Comp 412 ! ... Date Added: 2009-06-07 14:30:30 |
| ch1.pdf Path: Washington >> TH >> 022 Fall, 2009 Description: 1 Chapter 1 An Introduction to Haptics - A New Paradigm for Human-Computer Interaction Some classes of animals have all the senses, some only certain of them, others only one, the most indispensable, touch. Aristotle, 350 B.C. 1.1 Touch and the Six... Date Added: 2009-06-07 14:33:14 |
| source4_output.txt Path: San Diego State >> CS >> 530 Fall, 2008 Description: *source4.asm* Line Address Label Opcode Operand Machine Code = = = = = = 1 00000 2 00000 ... Date Added: 2009-06-07 14:33:47 |
| GEOG111ALL.TXT Path: Sveriges lantbruksuniversitet >> GEOG >> 19983 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: GEOG 111-3 ALL SECTIONS LOCATION: SFU OTH TITLE: PHYSICAL GEOGRAPHY SECTION TYPE: LEC SEMESTER: 1998-3 ENROL: 236 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 stude... Date Added: 2009-06-07 14:36:00 |
| redcirclesummary.doc Path: East Los Angeles College >> LEEDS >> 200708 Fall, 2009 Description: Role Analysis: The University of Leeds Experience Background In June 2006, following role analysis (RA) using a HERA based scheme, Leeds University wrote to 96 academic-related (AR) staff informing them that theyd been downgraded (red-circled). Most... Date Added: 2009-06-07 14:36:13 |
| faith17.txt Path: Colgate >> ZEN >> 325 Fall, 2009 Description: 17 Climbing the Crystal Mountain ~ If the mind does not discriminate, All dharmas are of one suchness. The essence of one suchness is profound; Unm... Date Added: 2009-06-07 14:36:19 |
| 582prob_part1.pdf Path: Washington >> MATH >> 582 Winter, 2008 Description: qI @ j \' 4 \' 1 S rGldH(f\' c \' rFu(58kdGF c rw F c A(% FUGR\"Fv\"(E HU4 \' \' 9 wT 1 1 \' 1 T 1 E 9 \'T 1 E \' GFx$U%UE eE 0U4 C c $ c e\' db t E j q... Date Added: 2009-06-07 14:37:19 |
| keypad.pdf Path: UF >> EEL >> 4744 Fall, 2009 Description: 4-Jul-032:15 PM Keypad EEL 4744 EEL 4744 Keypad 3 6 9 # Pin 4 Pin 2 Pin 7 Pin 6 1 4 7 * 2 5 8 0 Most keypads work the same way > Only the pin numbers vary > Many ways to solve the keypad problem 1 University of Florida, EEL 4744 File # ? ... Date Added: 2009-06-07 14:38:27 |
| Experiment_1.doc Path: U. Houston >> ECE >> 4117 Fall, 2008 Description: ECE 4117 Experiment 1 Modeling Equations with TIMS; Getting Acquainted with PICOSCOPE The purpose here is to become acquainted with how equations are modeled using the TIMS modules, and to become acquainted with the Picoscope virtual oscilloscope and... Date Added: 2009-06-07 14:40:24 |
| intro_lab.pdf Path: Boise State >> M >> 333 Fall, 2009 Description: MAT 333 Introduction to Matlab Lab 1 January 25, 2007 Starting Matlab click Matlab icon on the left side of the screen Commands in Matlab enter commands at the prompt > ; will suppress output , separates commands > help elfun lists elementary... Date Added: 2009-06-07 14:41:05 |
| 665Fall2000.pdf Path: Maryland >> ENME >> 665 Fall, 2008 Description: FALL 2000 ENME665: ADVANCED TOPICS IN VIBRATIONS Instructor: B. Balachandran, Associate Professor of Mechanical Engineering Office: EGR 2133; Ph: (301)405-5309; E-Mail: balab@eng.umd.edu Textbooks: Nayfeh, A. H. and Mook, D. T. (1979). Nonlinear Osc... Date Added: 2009-06-07 14:41:35 |
| NJ-party.pdf Path: Harvard >> CSCIE >> 20061114 Fall, 2009 Description: United States 109th Congress, Page 1 of 1 United States 109th Congress New Jersey Democrat Official Name Andrews, Robert E. Holt, Rush D. Menendez, Robert Pallone, Frank Jr. Pascrell, Bill Jr. Payne, Donald M. Rothman, Steven R. State New Jersey New... Date Added: 2009-06-07 14:43:30 |
| Ely8.doc Path: TCU >> ETD >> 01162009 Fall, 2009 Description: EPILOGUE: Texas\' secession vote in February 1861 prompted Congress a few weeks later to reroute the overland mail service from the southern route to a central route through the country\'s mid-section, far away from the southern states. Congress order... Date Added: 2009-06-07 14:49:04 |
| case1.txt Path: Berkeley >> CS >> 267 Fall, 2008 Description: n_fish: 3 0 (0): 0: (0.5, 0.5) 1: (0.85, 0.5) 2: (0.87, 0.5) cg: (0.503466, 0.5) 0.005281 (0.00031254): 0: (0.500001, 0.5) 1: (0.849893, 0.508926) 2: (0.869577, 0.512398) cg: (0.503466, 0.500088) 0.010347 (0.00032115): 0: (0.500004,... Date Added: 2009-06-07 14:49:40 |
| 090501PathSplicing.pdf Path: UCLA >> CS >> 217 Fall, 2008 Description: Path Splicing Murtaza Motiwala, Megan Elmore, Nick Feamster and Santosh Vempala College of Computing, Georgia Tech http:/www.gtnoise.net/splicing Presented by Alex Wang CS 217B UCLA, Spring 2009 What is Path Splicing? Scalable mechanism for providi... Date Added: 2009-06-07 14:59:23 |
| Topic12.pdf Path: North Texas >> FINA >> 5170 Fall, 2008 Description: Basics of Option Pricing Theory & Applications in Business Decision Making Purpose: Provide background on the basics of Option Pricing Theory (OPT) Examine some recent applications -1- What are options? Options are financial contracts whose val... Date Added: 2009-06-07 15:00:31 |
| 113a-ps3-soln.pdf Path: Columbia >> MATH >> 113 Fall, 2009 Description: Mathematics 113, Problem Set 3 Solutions Alexander P. Ellis 1. Let T be a triangle, and say f is holomorphic on T - {w}, and bounded around w. We integrate over the contour which is the union of T and a small, negatively oriented circle around w (t... Date Added: 2009-06-07 15:01:24 |
| FRCP.pdf Path: Columbia >> MR >> 2651 Fall, 2009 Description: FEDERAL RULES OF CIVIL PROCEDURE: 34 Rule 34. Production of Documents and Things and Entry Upon Land for Inspection and Other Purposes (a) Scope. Any party may serve on any other party a request (1) to produce and permit the party making the request,... Date Added: 2009-06-07 15:04:16 |
| McIver-Birdsall.pdf Path: Duke >> X >> 182 Fall, 2009 Description: Technological Evolution and the Right to Communicate: The Implications for Electronic Democracy William J. McIver, Jr. School of Information Science and Policy University at Albany, State University of New York Albany, New York 12222 USA. e-mail: mci... Date Added: 2009-06-07 15:14:34 |
| big_pharma_list.pdf Path: UCSB >> ENGR >> 192 Fall, 2009 Description: The following is a list of the 50 largest pharmaceutical and biotech companies ranked by healthcare revenue.[1] Some companies (eg, Bayer, Johnson and Johnson and Procter & Gamble) have additional revenue not included here. The phrase Big Pharma is o... Date Added: 2009-06-07 15:16:11 |
| Problem_3.pdf Path: UGA >> PHIL >> 2400 Fall, 2008 Description: DUE: Tuesday, October 25, at the beginning of class PHIL 2400HProblem Set #3 NAME: _ I. Is each of the following statements true or false? (7.5 points each) If your answer is true, no explanation is necessary. If it is false, provide a diagram illu... Date Added: 2009-06-07 15:30:15 |
| 217Fall04Final.pdf Path: Michigan >> MATH >> 217 Fall, 2008 Description: NAME: Professor/Section: For each problem show ALL your steps and clearly BOX your final answer. Problem 1 2 3 4 5 6 7 8 9 10 Total Points Possible 10 10 15 5 10 10 10 15 10 5 100 Points Earned 1 4 0 1 1. Let A = -2 1 0. -2 0 1 a) Find a basis for... Date Added: 2009-06-07 15:32:05 |
| regpractice.pdf Path: Duke >> X >> 004 Fall, 2009 Description: Regex Practice: CPS 004G Owen Astrachan October 25, 2007 Name: Login: Honor code acknowledgment (signature) 1 PROBLEM 1 : (Being Regular with Regex (22 points) Part A (4 points) We used a program in class that processed regular expressions and l... Date Added: 2009-06-07 15:36:38 |
| sectcnfgramS.pdf Path: Duke >> X >> 140 Spring, 2009 Description: Section: Transforming grammars (Ch. 6) Methods for Transforming Grammars We will consider CFL without . It would be easy to add to any grammar by adding a new start symbol S0, S0 S | 1 Theorem (Substitution) Let G be a CFG. Suppose G contains A ... Date Added: 2009-06-07 15:37:39 |
| partialdiffspeedboards.pdf Path: University of Dayton >> MTH >> 218 Fall, 2009 Description: Speedboards Th Oct 16, 2003 QUESTION 1 > f:=(x,y)->x^2-x*y+y^2; f := ( x, y ) x2 - x y + y2 > diff(f(x,y),x); 2x-y > diff(f(x,y),y); -x + 2 y QUESTION 2 > f:=(x,y)->(x^2-1)*(y+2); f := ( x, y ) ( x2 - 1 ) ( y + 2 ) > diff(f(x,y),x); 2 x (y + 2) > d... Date Added: 2009-06-07 15:39:09 |
| index.pdf Path: Temple >> MATH >> 011 Fall, 2009 Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Summer1 2007 Course Syllabus Course: Mathematics 2032.011. Course Title: Discrete Mathematics. Time: 12:55-2:25 MTWR. Place: BB 103. Instructor: Michael Tepper. Instructo... Date Added: 2009-06-07 15:41:18 |
| quiz5sol.doc Path: UF >> STA >> 6166 Summer, 2008 Description: STA 6166 Quiz 5 Solutions 1. y-hat = 4.6 + 2.6X 2. 60 3. 0.80 4. (0.80 , 9.20) 5. 240 +/- 10.5 6. 0.75 7. 33.75 8. > 2.621 9. 2.5 10.False 11.False 12.True ... Date Added: 2009-06-07 15:44:42 |
| essay.pdf Path: UWO >> INSTRUCT >> 023 Fall, 2009 Description: ES 123a The Dynamic Earth ESSAY REQUIREMENT Thesis: The Earth is a dynamic planet show and discuss. Topics As part of the course requirements for students enrolled in ES 123a, each student will submit an original essay of her/his own effort on any ... Date Added: 2009-06-07 15:46:20 |
| le09_06.pdf Path: Rose-Hulman >> ES >> 205 Fall, 2009 Description: ES205 Analysis and Design of Engineering Systems Homework Problems Lesson 09 Problem 9.1 In the electromechanical system shown below, iA is the current passing through the motor, L, L, and L are the load position, velocity, and acceleration, and TL ... Date Added: 2009-06-07 15:48:28 |
| WA_20080327.pdf Path: Washington >> ESS >> 200803 Fall, 2009 Description: WA 2008/ 3/27 0:00:00; 1.5 5.0 Hz; Envelope lowpass at 0.05 Hz 0 SNBZ 50 1 MCWZ 20 2 RPWZ 30 3 B001Z 20 4 SQMZ 150 5 B013Z 20 6 HDWZ 80 7 GNWZ 60 8 CPWZ 10 9 D04AZ 240 10 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 48N 122... Date Added: 2009-06-07 15:56:53 |
| WrappingMovement.pdf Path: Eastern Oregon >> MM >> 419 Fall, 2009 Description: MM 419 Classroom Challenge: Sprite Motion I Purpose The purpose of completing this on-going series of assignments is twofold: first to provide you with a series of tools that you can use as building blocks for games (both entertainment and for so-cal... Date Added: 2009-06-07 15:57:09 |
| lec14.pdf Path: MIT >> AA >> 984030 Fall, 2009 Description: 7.88 Lecture Notes - 14 7.24/7.88J/5.48J The Protein Folding Problem Chaperonins Chaperonins and Protein Misfolding Segue into GroEL Misfolding > Kinetically trapped aggregates A. Chaperonins Just three experiments: 1) original RUBISCO set a, b, c... Date Added: 2009-06-07 15:57:10 |
| lista.pdf Path: Stanford >> SLAC >> 030527 Fall, 2009 Description: L.Lista, G.De Nardo Luca Lista Outline Current status of persistency Event data persistency User data persistency Other issues Unique candidate id map Tcl configuration Plan for July Luca Lista Event User Data persistency Persistency implem... Date Added: 2009-06-07 15:57:28 |
| md5-rfc1321.txt Path: Colorado >> CSCI >> 5273 Fall, 2008 Description: Network Working Group R. Rivest Request for Comments: 1321 MIT Laboratory for Computer Science and RSA Data Security, Inc. ... Date Added: 2009-06-07 16:00:10 |
| pols1101_wk4ppt.pdf Path: University of West Georgia >> POLS >> 1101 Fall, 2008 Description: POLS1101 American Government What Kind of Nation? What Kind of Nation? Antebellum politics are dominated by fundamental questions How does power extend to the federal government? Directly people empower federal govt. Indirectly people empower ... Date Added: 2009-06-07 16:00:15 |
| Wild Carrot GR.pdf Path: Michigan State University >> WEB >> 434 Fall, 2009 Description: Controlling Wild Carrot WILD CARROT, otherwise known as Queen Annes lace, is a deep-rooted biennial. Wild carrot usually becomes a problem in continuous no-till production systems. Similar in appearance to cultivated carrots, leaves of wild carrot ar... Date Added: 2009-06-07 16:00:32 |
| hw2breakup.pdf Path: UF >> COT >> 3100 Fall, 2008 Description: WebID HW2 EC2 1 324 2 3 288 4 296 5 96 6 344 7 326 8 316 9 10 11 342 12 242 13 287 14 333 15 265 16 346 17 300.5 18 324 19 280.5 20 281 21 316 22 327 23 228.5 24 344 25 328 26 353 27 353 28 360.5 29 312 30 282.5 31 302.5 32 123 33 252 34 266 35 340.5... Date Added: 2009-06-07 16:04:11 |
| syllabus.pdf Path: Auburn >> CS >> 531 Fall, 2009 Description: CS 531 Advanced Computer Architecture Syllabus Spring 2007 M 3:00 - 5:30pm, Cramer Hall 227 Instructor: Dr. Xiao Qin Office Hours: W 1:30-3:00pm Phone/Office: 835-5902 / Cramer 231A Email: xqin@cs.nmt.edu Class Web Page Homeworks and announcements ... Date Added: 2009-06-07 16:05:37 |
| 07TreeIndex-handout.pdf Path: Texas San Antonio >> CS >> 5443 Fall, 2008 Description: Overview Given a file, how to search for records that contain a specific value or a value in a specific range? Indexing Weining Zhang Have to do a sequential scan for a heap file Can do a binary search if records are sorted on search key How can w... Date Added: 2009-06-07 16:07:21 |
| Outcome1.pdf Path: St. John Fisher >> NS >> 04175 Fall, 2009 Description: Outcome 1: WineBid, Inc. Nathan Sunseri Analytical case study regarding information system integration and its past and present effects on business transactions. CSCI 155-01 1/24/2009 Company Overview: WineBid, Inc. is an online auction company est... Date Added: 2009-06-07 16:08:56 |
| meta_data.doc Path: Texas State >> G >> 4427 Fall, 2009 Description: Census2 Metadata also available as Metadata: Identification_Information Data_Quality_Information Spatial_Reference_Information Entity_and_Attribute_Information Distribution_Information Metadata_Reference_Information Identification_Informatio... Date Added: 2009-06-07 16:14:43 |
| Information_Sheet_Attach.doc Path: Benedictine IL >> ALUMNI >> 1962 Fall, 2009 Description: Information Sheet for Class of 1962 Alumni WebPage Email Attachment Please use this form to update your information on the Class of 62 website, Note that addresses, phone numbers and e-mail addresses are password protected on the site. Enter your inf... Date Added: 2009-06-07 16:14:55 |
| 38nov29p2.pdf Path: Air Force Academy >> RHF >> 330 Fall, 2009 Description: ... Date Added: 2009-06-07 16:15:04 |
| outlinefinal.pdf Path: Texas >> M >> 316 Fall, 2008 Description: M316L - Final Outline For the final, you should be comfortable with the following definitions and ideas. The concepts listed are IN ADDITION to those from the first two midterms - the final is cumulative. Chapter 10.3 Volume of polyhedra and 3D figu... Date Added: 2009-06-07 16:18:08 |
| supplement_table3.pdf Path: Air Force Academy >> BINF >> 300 Fall, 2009 Description: Supplemental table 3. Literature evidences to verify the relationship between the top ten risk pathways and each phenotype (BD, CAD, HT, CD and T2D). Pathway Name BD Oral choline supplementation resulted in a significant decrease in brain purine leve... Date Added: 2009-06-07 16:19:05 |
| CS123A_Reading_Guidelines_F09.pdf Path: San Jose State >> CS >> 123 Fall, 2009 Description: Bio/CS 123A May 2009 Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: May 1, 2009 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science background: o Page v, ... Date Added: 2009-06-07 16:23:26 |
| 9feb.09.ppt Path: Queens Charlotte >> H >> 352 Spring, 2009 Description: A REVOLUTION IN JOURNALISM! The Birth of the \"PENNY PRESS\" 1830s 1860s REVIEW: isn\'t the U.S. media . just . well . there? NO! The U.S. media grows, changes, shifts styles, shifts technologies Some characteristics die out Others go on to the ne... Date Added: 2009-06-07 16:24:15 |
| p100HW_2.pdf Path: USC >> PH >> 100 Fall, 2009 Description: Physics Lxg 100, 2007 (Spring) Problem assignment #2 Due: 2 pm, before class starts on Tuesday, February 6 Chapter 4 Exercises: 27, 28, 41, 57 Problems: 6, 7 Chapter 5 Exercises: 13, 21, 28 Problems: 2 Chapter 6 Exercises: 3, 31, 49 Problems: 3, 7... Date Added: 2009-06-07 16:24:36 |
| contenu_A2007.pdf Path: NSULA >> GEL >> 66398 Fall, 2009 Description: Facult des sciences et de gnie Dpartement de gnie lectrique et de gnie informatique GEL21943 / GEL-66398 Optolectronique Professeur Pierre Tremblay, ing. Contenu du cours Session automne 2007 c Pierre Tremblay 2002, 2004, 2005, 2006, 2007 ii Tabl... Date Added: 2009-06-07 16:29:16 |
| LewisTREE2001.pdf Path: Utah State >> BIOL >> 6750 Spring, 2008 Description: 30 Review TRENDS in Ecology & Evolution Vol.16 No.1 January 2001 Phylogenetic systematics turns over a new leaf Paul O. Lewis Long restricted to the domain of molecular systematics and studies of molecular evolution, likelihood methods are now bei... Date Added: 2009-06-07 16:31:13 |
| model.txt Path: UPenn >> TEST >> 2477 Fall, 2009 Description: - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - Linear Model: (n=362) SS 33366.4 -> 1916.69 R2 = 0.942556 Model has 2 explanatory variables. - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ... Date Added: 2009-06-07 16:31:15 |
| U_Toprak_Biol_990_Abstract.pdf Path: Air Force Academy >> HOME >> 990 Fall, 2009 Description: UMUT TOPRAK1,2, DOUG BALDWIN2, MARTIN ERLANDSON2, CEDRIC GILLOTT1, always on guard\": Characterization of insect intestinal mucins in Mamestra configurata (Lepidoptera: Noctuidae) 1Department of Biology, University of Sa... Date Added: 2009-06-07 16:32:12 |
| chap11.pdf Path: Rose-Hulman >> ME >> 597 Fall, 2009 Description: Chapter 11 Neural Control The emulation of human cognitive ability is one of the primary fields of research interest in Computational Intelligence. The human is nowhere near as fast or as accurate in calculating as a modern computer, yet even at a v... Date Added: 2009-06-07 16:37:35 |
| NANO_792_ne_HW3.pdf Path: SDSMT >> HW >> 792 Spring, 2009 Description: NANO 792 Spring 2009 Ho omework 3 Show all work a discuss results. w and 1) U Using a partic cular represe entation, an a arbitrary stat can be wri te itten as = c1 1 + c2 2 + c3 3 , wher the basis v re vectors are orthonormal: i j = ij . In matr... Date Added: 2009-06-07 16:45:34 |
| week5_09.pdf Path: UCSD >> ECE >> 107 Fall, 2008 Description: ECE 107: Electromagnetism Set 5: Electrostatics Instructor: Prof. Eric Fullerton Department of Electrical and Computer Engineering University of California, San Diego, CA 92093 Coulomb\'s Law (1) linear superposition electric dipole Coulomb\'s Law (... Date Added: 2009-06-07 16:46:31 |
| Chapter3Overheads.pdf Path: Colby >> CH >> 118 Fall, 2008 Description: Ch 3 pg. 1 Chapter 3: Chemical Reactions Chemical reactions: Processes in which one or more substances are converted into other substances. Chemical equation: A representation of a chemical reaction using the chemical formulas of the reactants and p... Date Added: 2009-06-07 16:54:09 |
| sanford.pdf Path: Nevada >> NRES >> 400 Fall, 2008 Description: Valuing the loss of mangrove ecosystems and the contamination of water resources following the Asian Tsunami Monte P Sanford Ecology, Evolution and Conservation Biology University of Nevada, Reno Introducing the Problem Valuing necessities Do natio... Date Added: 2009-06-07 16:54:40 |
| pctcurve.doc Path: Texas A&M >> STAT >> 303 Fall, 2008 Description: P( Z -3.00) 0.0015 P( Z -2.00) 0.0250 = P( Z 2.00) P( Z -1.00) 0.16 P( Z 0.00) 0.50 P( Z 1.00) 0.84 P( Z 2.00) 0.9750 P( Z 3.00) 0.9985 P( -z* Z z* ) = 0.50, then z* = Q1 and z* = Q3 Standardized value z = (x )/ Nonstandardized val... Date Added: 2009-06-07 16:58:46 |
| 11.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: Character palette overview The Character palette provides options for formatting characters. Some formatting options are also available from the options bar. You can display the Character palette by doing one of the following: Choose Window > Charact... Date Added: 2009-06-07 17:01:56 |
| 346N_S09_assignment7_due042109.doc Path: Texas >> ARE >> 346 Fall, 2009 Description: ARE 346N Building Environmental Systems Homework Assignment 7 DUE: April 21, 2009 April 14, 2009 20 points total The objectives of this assignment are for you to demonstrate your ability to do lighting calculations for a real space. . 1. Go to a s... Date Added: 2009-06-07 17:02:29 |
| lecture6_bw.pdf Path: UWO >> CS >> 1033 Fall, 2009 Description: MULTIMEDIA and COMMUNICATIONS Todays Agenda LAST WEEK: Do I Need To Set Up A Website? (YES!) IP Addresses and the Internet Domain Names Web Hosting TODAY: 1. Announcements 2. Web Design 3. Website Creation stages 4. Working with Dreamweaver Tips a... Date Added: 2009-06-07 17:03:19 |
| Sol06_07_371.pdf Path: East Los Angeles College >> SHEF >> 371 Fall, 2009 Description: PAS371 Linear Models - Semester 1: SOLUTIONS OF EXAM PAPER 2006-07 1. (a) Sr = (y X )T (y X ) = y T y y T X(X T X)1 X T y = y T M y so M = I n X(X T X)1 X T . M 2 = (I n X(X T X)1 X T )2 (I n X(X T X)1 X T ) = I n X(X T X)1 X T X(X T X)1 ... Date Added: 2009-06-07 17:04:56 |
| comp-projections-beyond2010-v5.ppt Path: Stanford >> SLAC >> 20081125 Fall, 2009 Description: BaBar C puting Ne ds om e Proje ctions for the Be yond 2010 Task Force By H. Neal on Nov. 24th, 2008 @ SLAC 1 basis for estimates 2009: Y(2S,3S) reprocessing, skim cycles, SP10 run1,2 redo, new signals, extra generics steady state: new signal produc... Date Added: 2009-06-07 17:04:57 |
| t02AIntroToOO.ppt Path: IUPUI >> CSCI >> 240 Fall, 2008 Description: CSCI 240 Concepts in Object-Oriented Design Dale Roberts, Lecturer Computer Science, IUPUI E-mail: droberts@cs.iupui.edu Example: Classroom Attending the lecture we have several individuals Wade - loves Chinese food George - an outdoorsman We... Date Added: 2009-06-07 17:10:26 |
| syl.doc Path: ASU >> CET >> 488 Fall, 2009 Description: Division of Computer Studies 1 CET488/598 System Administration of Unix SYLLABUS Fall 2005 Instructor: Bruce R. Millard Office: Sutton 140P Phone: 7271734 Office Hours: see the class Web site Teaching Assistant: we will see Lecture: 9:00 10:1... Date Added: 2009-06-07 17:17:17 |
| Sample Syllabus.doc Path: Penn State >> VMM >> 123 Fall, 2009 Description: Reflection of creating a Sample Syllabus In developing this media, it was very challenging at first, but as I took my time and narrowed my ideas and thoughts, I feel that I was able to produce an effective and creative syllabus that would be appealin... Date Added: 2009-06-07 17:20:20 |
| Bourne-Off-Targets.pdf Path: UCSD >> PHAR >> 230 Fall, 2008 Description: BIOM/PHAR 230 - Bourne, Nov. 6, 2008 Off-Targets Philip E. Bourne University of California San Diego pbourne@ucsd.edu http:/www.sdsc.edu/pb/edu/biom230/off-targets.ppt Motivation When you add a foreign chemical into something as complex as a human ... Date Added: 2009-06-07 17:25:12 |
| 5-40b.doc Path: Cornell >> CHAPTER >> 313 Fall, 2009 Description: 5-40 b First, remember the following definitions from P. Chem: = 1 V ( )P V T 1 V = - ( )T V P Thus it becomes clear that we should try to set up a total differential that takes advantage of both of these definitions so we use V = V(T,P): dV = ( ... Date Added: 2009-06-07 17:27:30 |
| 11Internet.pdf Path: MSOE >> MS >> 485 Fall, 2009 Description: Objectives It is intended to be a basic introduction to WorldCom\'s Data Products, peppered with some technical tidbits. Introduction to the Internet: Behind the Web This module is geared toward those with a basic understanding of data communicati... Date Added: 2009-06-07 17:39:43 |
| ch8ed6deadlocks.pdf Path: MSOE >> CS >> 384 Fall, 2009 Description: Chapter 7: Deadlocks January 29, 2002 Module 8: Deadlocks The Deadlock Problem System Model Deadlock Characterization Methods for Handling Deadlocks Deadlock Prevention Deadlock Avoidance Deadlock Detection Recovery from Deadlock Combin... Date Added: 2009-06-07 17:39:48 |
| 242-6_revision.pdf Path: Cal Poly >> X >> 222 Fall, 2009 Description: ... Date Added: 2009-06-07 17:41:20 |
| proj1-hints_s.pdf Path: Portland >> CS >> 322 Fall, 2008 Description: Project 1 Hints Jingke Li Portland State University Jingke Li (Portland State University) CS322 Project 1 Hints 1 / 10 Basic Information The Compiler Infrastructure - Same as last term\'s: ast/ - the source-language\'s AST nodes symbol/ - the sy... Date Added: 2009-06-07 17:48:19 |
| Ch01_12ed.ppt Path: Brookdale >> PPT >> 3315 Fall, 2009 Description: Electronic Presentations in Microsoft PowerPoint Accounting: The Key to Success C H A P T E R 1 2007 McGraw-Hill Ryerson Ltd. Learning Objectives 1. 2. 3. 4. 5. Describe accounting and its goals and uses. Describe forms of business organizati... Date Added: 2009-06-07 17:56:40 |
| Best_Before_Dates.pdf Path: Kansas State >> FOODSAFETY >> 586 Fall, 2009 Description: What do the dates on food labels mean? The durable life of food products is defined by the Canadian Food and Drug Regulations as the amount of time, starting on the day a food is packaged, that the unopened food will retain its normal wholesomeness, ... Date Added: 2009-06-07 17:56:58 |
| PDF_2007Virginia.pdf Path: Virginia Tech >> PUBS >> 424 Fall, 2009 Description: X. 2007 Virginia Corn Board Nematode Survey Results Submitted by: Keith Balderson, Extension Agent, ANR, Essex County During the 2007 growing season, the Virginia Corn Board provided funding for a corn nematode survey in an effort to better understan... Date Added: 2009-06-07 17:59:22 |
| 420-530.pdf Path: Virginia Tech >> PUBS >> 420 Fall, 2009 Description: publication 420-530 Sustaining America\'s Aquatic Biodiversity S Paul D. Johnson, Research scientist, Tennessee Aquarium Research Institute, Cohutta, Ga. Freshwater Snail Biodiversity and Conservation ix hundred fifty different species of snails ... Date Added: 2009-06-07 18:01:08 |
| 172p36-devlin.pdf Path: UNC >> INLS >> 172 Fall, 2008 Description: 36 September 2003/Vol. 46, No. 9 COMMUNICATIONS OF THE ACM BY KEITH DEVLIN, Guest Editor COMPUTER SCIENCE STUDENTS The main benefit of learning and doing mathematics is that it develops the ability to reason about formally defined abstract struct... Date Added: 2009-06-07 18:02:45 |
| 172p36-devlin.pdf Path: UNC >> INLS >> 509 Fall, 2008 Description: 36 September 2003/Vol. 46, No. 9 COMMUNICATIONS OF THE ACM BY KEITH DEVLIN, Guest Editor COMPUTER SCIENCE STUDENTS The main benefit of learning and doing mathematics is that it develops the ability to reason about formally defined abstract struct... Date Added: 2009-06-07 18:03:08 |
| syllabus.doc Path: Portland >> SBA >> 534 Fall, 2009 Description: MIM 534 Global Logistics Term 4, 2008 Class Time: Tuesday, 5:30-10:00 Instructor: Ron Williams Email: ronw@pdx.edu Office Hours: By appointment Course Objectives: The first objective of this class is to familiarize you with different aspects of Globa... Date Added: 2009-06-07 18:05:32 |
| cs641_19.ps Path: UWO >> CS >> 641 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 98 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where {... Date Added: 2009-06-07 18:09:26 |
| cs457_5.ps Path: UWO >> CS >> 457 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 30 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where {... Date Added: 2009-06-07 18:10:14 |
| Bridges_bc.txt Path: UNI >> CNS >> 023 Fall, 2009 Description: venkman@jet:~$ bc < bc.data 16 16 1048576 1048576 <- 1M or 1Meg, about 1 million 1073741824 1073741824 <- 1G or 1Gig, about 1 billion venkman@jet:~$ 1,048,576 is close to 1 million ... Date Added: 2009-06-07 18:25:35 |
| PreviousRetirementPlanConfirmationform.pdf Path: Middlebury >> BEF >> 60925 Fall, 2009 Description: ... Date Added: 2009-06-07 18:28:10 |
| docnfpjT8nAMi.doc Path: Harvard >> GOV >> 2305 Fall, 2009 Description: The Deconstruction of Realignments Justin Grimmer The authors of the readings this week consider elections from two different perspectives. Bartels and Mayhew analyze macro level election results to explain emergent election patterns. The second grou... Date Added: 2009-06-07 18:30:08 |
| XML.ppt Path: Oregon State >> BA >> 378 Fall, 2008 Description: XML Carlee Tanya John Wei Tera Agenda Overview History Pros&Cons Examples XBRL Future Overview WhatisXML? Whatdoesitdo? XMLdoesnotDOanything.XMLwascreatedtostructure,storeandshare information. XMLwasnotdesignedtodisplaydata.Itdef... Date Added: 2009-06-07 18:32:56 |
| problem6_solution_step1.pdf Path: Utah State >> MATH >> 1010 Fall, 2008 Description: Adding and Evaluating Polynomial Functions Problem 6: Find (f + g)(-3), where f (x) = 4x2 - 2x - 12 and g(x) = 2x + 7. Solution: (f + g)(-3) = 31 ... Date Added: 2009-06-07 18:33:17 |
| metadata.pdf Path: Harvard >> P >> 143 Fall, 2009 Description: Variable Site Variable name P1 P2 S1 S2 W1 W2 B C D E F 1 2 3 4 5 6 7 8 9 10 FF MIN Variable Description Plow 1 Plow 2 Pasture 1 Pasture 2 Woodlot 1 Woodlot 2 Row B within Site Row C within Site Row D within Site Row E within Site Row F within Site... Date Added: 2009-06-07 18:34:29 |
| LMod01.doc Path: Colorado >> MBAC >> 6060 Fall, 2009 Description: CORPORATE FINANCE: AN INTRODUCTORY COURSE DISCUSSION NOTES MODULE #11 COURSE INTRODUCTION NOTE TO THE READER: Reading these discussion notes should not be viewed as a substitute for attending class and carefully taking your own notes. These discussio... Date Added: 2009-06-07 18:45:53 |
| InternetResourceEval_WM.doc Path: North Texas >> COURSEWEB >> 4100 Fall, 2009 Description: Name: Kanako \"Nina\" Stephens Date: 10/8/2004 Evaluating Internet Resources Form 1. URL of Web site: 2. Name of Web site: 3. Primary use: http:/school.discovery.com/lessonplans/programs/weathermaps/ Weather Maps Earth Science Lesson Plan (grades 5-... Date Added: 2009-06-07 18:46:50 |
| a1060igsa.txt Path: Mt. Holyoke >> ASOL >> 1060 Fall, 2009 Description: -11.0748 660 -11.0295 652 -10.9842 644 -10.9389 633 -10.8936 658 -10.8483 685 -10.8030 665 -10.7577 637 -10.7124 635 -10.6671 642 -10.6218 643 -10.5765 639 -10.5312 650 -10.4859 669 -10.4406 667 -10.3953 642 -10.3500 636 -10.3047 651 -10.2595 652 -10... Date Added: 2009-06-07 18:52:14 |
| YDR214W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YDR >> 214 Fall, 2009 Description: YDR214W.t2k EBGHSTL 3 2 1 CC X C S S EEEEEECTE TEG S B S S T E T T T G X X X X X X X X CCCCCSC ST H XXXXXXXC E E C C C T S S C H X X X X 1 10 20 30 40 S 3 2 1 E H T E T E EEEEEEE X X X X X X ESCC C C S CCCCCCCTTEESCCCC C S XSSGX... Date Added: 2009-06-07 18:56:50 |
| YJR107W.t2k.w0.5-logo.pdf Path: UCSC >> YJR >> 107 Fall, 2009 Description: YJR107W.t2k w0.5 5 4 3 2 1 Y Y XXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXX R L D L R E I R L Y V L E D L D I L L A A A X E N G F L L R L S A A V A A A A C G N S Y G I L L L G A S L D L L L A L X X X XX R 10 2... Date Added: 2009-06-07 18:56:59 |
| Schedule_PSYC2700_Spring_2009_rev_09.03.05.pdf Path: Colorado >> PSYC >> 2700 Fall, 2008 Description: Revised version 3/5/2009 THE PSYCHOLOGY OF CONTEMPORARY AMERICAN WOMEN SPRING 2009 Part 1: Introduction to the Psychology of Women DATES READINGS Hyde Ch. 1: Introduction READINGS Crawford & Unger, website The History of Psychology Revisited Or, ... Date Added: 2009-06-07 18:58:26 |
| YIL017C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YIL >> 017 Fall, 2009 Description: YIL017C.t2k EBGHSTL 3 2 1 CC X E E S H E H X X X X X X CC CC EEHHH G T H H XXGTTXXXH X X X X HH 10 H H H X H X H H H X X XXXX T H HH H H X X C H S E H S CCEXTCHEXE H H H H S H H S S H C H H H C E X X X X X X X X X X X X X X X X X X X... Date Added: 2009-06-07 19:00:32 |
| YMR286W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YMR >> 286 Fall, 2009 Description: YMR286W.t2k EBGHSTL 3 2 1 CC EEEEEE X ECC S X X X E E C X X X X E S T S G S C X X X X X X XXXX X CCEECT EC 10 CS T TS C CC S H STH T S 20 30 40 T S H T S E H 3 2 1 HTTE TH G S E X X SC C T E E GH C G TTTC TTS GXCCXCCCCCCSESHTGX... Date Added: 2009-06-07 19:00:45 |
| lab6.pdf Path: Berkeley >> CS >> 150 Fall, 1996 Description: University of California at Berkeley College of Engineering Department of Electrical Engineering and Computer Sciences EECS 150 Spring 2001 J. Wawrzynek and N. Weaver Revised by R. Fearing, K. Cho, and I. Nuri Lab 6 Nasty Realities 1 Objectives I... Date Added: 2009-06-07 19:06:25 |
| labmemoformat.pdf Path: Mich Tech >> GE >> 3850 Fall, 2008 Description: MEMO DATE: TO: FROM: SUBJECT: August 30, 2004 GE 3850 Students A. Mayer, Geological and Mining Engineering and Sciences Suggested memo format [Type your memo text here.] This memo describes a suggested format for a memo report. The purpose of a memo... Date Added: 2009-06-07 19:09:21 |
| comhw5.pdf Path: UCLA >> SELIM >> 1065 Fall, 2009 Description: HOM EW ORK 5 Ch 7.5 1. (b) g(x) = 0 an xn . an xn = 3x(an-1 xn-1 ) - 2x2 (an-2 xn-2 ) + 2xn n = 2 an x = 3x( 2 an-1 xn-1 ) - 2x2 ( 2 an-2 xn-2 ) + 2 2 xn 2 2 2 = g(x) - a1 x - a0 = 3x(g(x) - a0 ) - 2x g(x) + 2x (1 + x + x + x3 + .) 2x2 = g(x) - ... Date Added: 2009-06-07 19:12:28 |
| cor_leo.pdf Path: UCLA >> CS >> 216 Winter, 2009 Description: ... Date Added: 2009-06-07 19:14:17 |
| q5.pdf Path: UNC Wilmington >> M >> 261 Fall, 2009 Description: MATH 261 Quiz 5 Show all work. 5 points each. Name: Section: . 1) Find the directional derivative of f (x, y) = 5xy 2 4x3 y at the point P (1, 2) in 5 the direction ofu = 13 , 12 . 13 2) Find the critical point(s) of f (x, y) = 9 2x + 4y x2 4... Date Added: 2009-06-07 19:14:55 |
| newfeatures.pdf Path: Rutgers >> MATH >> 251 Fall, 2008 Description: New features of Maple and other updates Spring 2006 In order to refer to results computed earlier in a worksheet, it is common to assign those results to a name. An alternative, introduced in Maple 10, is an equation label used to identify the last r... Date Added: 2009-06-07 19:18:43 |
| chap10.pdf Path: Washington >> MENGR >> 354 Fall, 2009 Description: 10. COMPRESSION AND BUCKLING Whenever a structural member is designed, it is necessary that it satisfies specific strength, deflection and stability requirements. Typically strength (or in some cases fracture toughness) is used to determine failure, ... Date Added: 2009-06-07 19:20:54 |
| lynch.doc Path: UNC >> PSYC >> 433 Fall, 2008 Description: Decision Making in Jury Selection Carter Lynch Statement of the Topic and Background: This paper will present a hypothetical situation involving jury selection at a high-profile criminal trial in Orange County, NC. The defendant, a former state prose... Date Added: 2009-06-07 19:26:34 |
| BUSI_701_10_Financials.ppt Path: UNC >> BUSI >> 701 Fall, 2008 Description: BUSI 701 Artistic Entrepreneurship Intro to Financials Agenda 3 Steps to Financials Sources of Funding Goal of Financials 1. Is venture viable? 2. How much $ will it take to get there? 3. How will we monetize and distribute the value we create? ... Date Added: 2009-06-07 19:31:00 |
| ema605_hw4_f08.pdf Path: Wisconsin >> ENGR >> 605 Fall, 2009 Description: EMA 605, Homework Assignment #4 Assigned: 9/26/08, Due: 10/01/08 (NOTE the short 5-day assignment) 1. An object subject to body forces and surface tractions deforms in the x-y plane such that its horizontal and vertical components of displacement are... Date Added: 2009-06-07 19:36:30 |
| final_solns.pdf Path: Salem State >> MSM >> 703 Fall, 2009 Description: Final Exam MSM 703 Spring, 2009 DIRECTIONS. A necessary part of a complete solution is a clear and thorough explanation of how you arrived at your answer. Good luck. 1. The graph of a function f (x) is shown below. On the axes provided, sketch a gr... Date Added: 2009-06-07 19:40:41 |
| e304s.pdf Path: SUNY Albany >> MATH >> 367 Fall, 2009 Description: Math 367 1. Suppose that Exam 3 Spring \'04 6 (7 - z) is the generating function for a random variable X. Find a) P(X > 2) b) E(X) c) Var(X) f (z) = 2. Consider the transition 1 0 4 1 0 4 0 1 2 0 0 1 2 0 0 1 4 0 0 0 0 a) b) c) d) e) ... Date Added: 2009-06-07 19:42:26 |
| tao-wang.pdf Path: East Los Angeles College >> PROG >> 260409 Fall, 2009 Description: Rural Electrification in China: Experience and Lessons Tao Wang Tyndall Centre Programme 4 Workshop Cape Town, 26th March 2009 Leaders Professor Kate Brown, UEA Professor David Thomas, Oxford Sussex Energy Group SPRU - Science and Technology Policy ... Date Added: 2009-06-07 19:44:17 |
| log.txt Path: Washington >> V >> 11695 Fall, 2009 Description: 000 (26240.000.000) 12/03 13:18:18 Job submitted from host: <128.95.94.28:4757> . 001 (26240.000.000) 12/03 15:49:27 Job executing on host: <172.25.101.68:1057> . 006 (26240.000.000) 12/03 16:09:34 Image size of job updated: 472336 . 006 (26240.000.0... Date Added: 2009-06-07 19:51:27 |
| submit.txt Path: Washington >> V >> 11500 Fall, 2009 Description: executable = allgamma_11930.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11500-11999/11... Date Added: 2009-06-07 19:51:34 |
| Exam2Sample2009.pdf Path: Minnesota >> D >> 1162 Fall, 2009 Description: 1 Chemistry 1162, Second Exam Name_ This is a closed book exam Work must be shown or no credit will be given 2 Total:_/100 points 1. (6 points) If for specific reaction equilibrium constant K = 10000, would you expect a small or a large reaction... Date Added: 2009-06-07 19:54:58 |
| handout-pplpst.pdf Path: Minnesota >> CSCI >> 5421 Spring, 2008 Description: Outline Planar Point Location Using Persistent Search Trees N. Sarnak Persistence + sweep\" paradigm Making Red-Black trees persistent Amortized analysis Dis... Date Added: 2009-06-07 19:55:09 |
| aah2888.pdf Path: East Los Angeles College >> OPEN >> 4351 Fall, 2009 Description: A Astrophysics A study of the spectral evolution during dipping in XB 1323619 with Rossi-XTE and BeppoSAX R. Barnard1 , M. Baluciska-Church1,2 , A. P. Smale3 , and M. J. Ch... Date Added: 2009-06-07 19:58:40 |
| 1020001COSummer09.pdf Path: UWO >> ECONOMICS >> 1020001 Fall, 2009 Description: The University of Western Ontario London Canada Department of Economics ECONOMICS 1020 - 001 INTRODUCTORY ECONOMICS COURSE OUTLINE SUMMER 2009 Instructor: Office: Office phone: E-mail Class times: Office Hours: Website address: Bruce Hammond 4035 S... Date Added: 2009-06-07 20:05:30 |
| HWP3 Path: Georgia Tech >> MATH >> 2401 Spring, 2009 Description: ... Date Added: 2009-06-07 22:42:00 |
| pg1 Path: Georgia Perimeter >> MATH >> 2652 Spring, 2008 Description: ... Date Added: 2009-06-07 23:13:56 |
| 1_15_09_HodgkinHuxley Path: USC >> BME >> 575L Spring, 2009 Description: Outline of the Lecture Hodgkin-Huxley Model Channels Membrane Currents Gating Mechanisms Voltage-dependent Gating Mechanisms Mediate Action Potentials This circuits function depend on nonlinear synaptic mechanisms. Today, we will focus on mod... Date Added: 2009-06-08 02:03:37 |
| CheatSheet4 Path: USC >> BME >> 513 Spring, 2009 Description: Trigonometric Fourier Series: Convolution f (t ) = a0 + an cos(n0t ) + bn sin( n0t ) n =1 n =1 y (t ) = h(t ) x(t ) y (t ) = h( ) x(t )d 1 a0 = T0 an = 2 T0 T0 f (t )dt f (t ) cos( nw0 t ) dt T0 Trig Identities: bn = 2 T0 ... Date Added: 2009-06-08 03:39:20 |
| FourierSeries1 Path: USC >> BME >> 513 Spring, 2009 Description: Fourier Series In Lecture 2, we discussed basis functions and signal decomposition: The idea that a signal can be represented as a sum of weighted basis functions. These basis functions are usually easy to understand and represent. An important set o... Date Added: 2009-06-08 03:39:32 |
| CreateChildForm.csproj.FileList.txt Path: Syracuse >> CSE >> 681 Fall, 2008 Description: bin\\Debug\\CreateChildForm.exe bin\\Debug\\CreateChildForm.pdb obj\\Debug\\ResolveAssemblyReference.cache obj\\Debug\\CreateChildForm.Form2.resources obj\\Debug\\CreateChildForm.Form1.resources obj\\Debug\\CreateChildForm.csproj.GenerateResource.Cache obj\\Debug... Date Added: 2009-06-08 06:31:39 |
| tute_09_sol.pdf Path: Allan Hancock College >> MATH >> 11218 Fall, 2009 Description: MATH11218 Engineering Foundation Mathematics Tutorial Sheet 9 Solutions 1. (i) Cramer\'s rule gives 2 1 -1 -1 0 1 1 -1 0 2 1 -1 0 1 1 -1 -1 = 1, -1 Term 1 2005 x= = y= = -2 = 2. -1 (ii) Using the inverse matrix from Tutorial Sheet 8, Exercise 9... Date Added: 2009-06-08 06:31:57 |
| Topology_Oct_2004.pdf Path: McGill >> MUMT >> 611 Fall, 2009 Description: ... Date Added: 2009-06-08 06:32:39 |
| lab6-classical_ipc.doc Path: St. Xavier >> WEB >> 301 Fall, 2009 Description: CMPSC 301 Lab Assignment #6 Classical IPC Problems Semaphore solutions Spring 2007 Remember: The semaphore data type is available in BACI. The only allowable operations on semaphores are: initialsem (s, value) where s is a semaphore type varia... Date Added: 2009-06-08 06:34:30 |
| NBayesLogReg.pdf Path: Oregon State >> CS >> 534 Fall, 2008 Description: CHAPTER 1 GENERATIVE AND DISCRIMINATIVE CLASSIFIERS: NAIVE BAYES AND LOGISTIC REGRESSION Machine Learning Copyright c 2005. Tom M. Mitchell. All rights reserved. *DRAFT OF September 21, 2006* *PLEASE DO NOT DISTRIBUTE WITHOUT AUTHORS PERMISSION* This... Date Added: 2009-06-08 06:34:53 |
| Wpf_Wizard_App.csproj.FileListAbsolute.txt Path: Syracuse >> CSE >> 784 Fall, 2008 Description: C:\\su\\CSE681\\code\\Wpf_Wizard_App\\Wpf_Wizard_App\\bin\\Debug\\Wpf_Wizard_App.exe C:\\su\\CSE681\\code\\Wpf_Wizard_App\\Wpf_Wizard_App\\bin\\Debug\\Wpf_Wizard_App.pdb C:\\su\\CSE681\\code\\Wpf_Wizard_App\\Wpf_Wizard_App\\obj\\Debug\\ResolveAssemblyReference.cache C:\\su\\C... Date Added: 2009-06-08 06:35:41 |
| fin00.pdf Path: SUNY Albany >> MATH >> 524 Fall, 2009 Description: Math 424-524 Final Exam Fall 00 1. Let T L(V, V ), and suppose that minT (x) = (x 5)4 (x 4)2 and chT (x) = (x 5)8 (x 4)3 . a) List all possible Jordan canonical forms for T . b) For each Jordan form, give its rational canonical form. c) For e... Date Added: 2009-06-08 06:43:20 |
| LetterofRecommendationSTACYBESTUL.pdf Path: Wisc Stevens Point >> TSTEW >> 892 Fall, 2009 Description: March 30, 2009 To Whom It May Concern: It is my pleasure to write this letter of recommendation for Mrs. Tami Stewart. Mrs. Stewart has completed her first nine weeks of student teaching in Family and Consumer Education at Iola-Scandinavia High Schoo... Date Added: 2009-06-08 06:44:19 |
| YIR031C.t2k.str2-logo.pdf Path: UCSC >> YIR >> 031 Fall, 2009 Description: YIR031C.t2k STR2 4 3 2 1 C H Y X MZ ZACCSCCYM MCYZSS ZZTCS SH Y C M C H S ZYHHTCYYEZMZQQSCCSBBSTTSHTHGGGHHH T S XXXXXXX Y A CZZZ Y Z E S C E S Q X A TTZZYZYACC S A AA AZ TTCC X X A CCSC Y T Z Z C C S Y C X XXXXTGGXXSXXXXXGXXXXXX X X X CC T ... Date Added: 2009-06-08 06:46:18 |
| PS.LewisStructures-1.Q.pdf Path: Youngstown >> CHEM >> 1506 Fall, 2008 Description: Problem Set - Lewis Structures - Questions For each of the following molecules, draw in their correct Lewis structures. H N H C C O H H H Si F C C H C H Br H C C H C C C C H H Page 1 of 3 Problem Set - Lewis Structures - Questions H P ... Date Added: 2009-06-08 06:55:42 |
| phys212ln5.pdf Path: Berkeley >> P >> 212 Fall, 2009 Description: Physics 212: Statistical mechanics II, Fall 2006 Lecture V In the previous lecture we finished the derivation of the BBGKY hierarchy and started considering conservation laws in the Boltzmann equation. These conservation laws will enable us to deriv... Date Added: 2009-06-08 06:56:37 |
| expoe5iii.pdf Path: Harvard >> EXTENSION >> 22863 Fall, 2009 Description: EXPO E-5: FUNDAMENTALS OF GRAMMAR Spring 2008 Harvard University Extension School Instructor: Benjamin Wise Expository Writing Program Harvard College Texts: The Borzoi Handbook for Writers, 3rd Edition. Ed. Crews, Schor, Hennessy; McGraw Hill T... Date Added: 2009-06-08 06:57:30 |
| 10_antialias.ps Path: Duke >> X >> 124 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: head.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: ZapfDingbats %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips hea... Date Added: 2009-06-08 06:59:35 |
| Tongass_metadata.pdf Path: Penn State >> TMH >> 270 Fall, 2009 Description: Geography 488 Update to Lesson Two Post Tom Heutte In my previous post I stated that the Tongass National Forest does not maintain metadata for its GIS library. This is not an accurate statement, although one does have to have some knowledge and d... Date Added: 2009-06-08 07:02:51 |
| 8212-Notes1.pdf Path: Minnesota >> ECON >> 8212 Fall, 2009 Description: 1 Outline. 1. MSL. 2. MSM and Indirect Inference. 3. Example of MSM-Berry(1994) and BLP(1995). 4. Ackerberg\'s Importance Sampler. 2 Some Examples. In this chapter, we will be concerned with examples of the form: f (y|x, ) = Z f (y|x, )g(|)... Date Added: 2009-06-08 07:05:44 |
| feb20.pdf Path: Michigan State University >> SEC >> 205 Fall, 2009 Description: Jupiter: 63 known moons No Need to Copy Down this Table! Orbit semi-major axis (km) Moons diameter (km) Some planets and moons shown in correct relative sizes Earth Venus Mars Metis Adrastea Amalthea Thebe Io Europa Ganymede Callisto Leda Himalia L... Date Added: 2009-06-08 07:06:40 |
| RR103beef.pdf Path: LSU >> EB >> 4301 Fall, 2009 Description: Research Anna Rakipova and Jeffrey Gillespie1 Louisiana beef cattle producers use a wide range of production practices. Because climate, landscape, and soil type vary across the state, cattle are raised under different environmental conditions. Produ... Date Added: 2009-06-08 07:10:51 |
| sievers-j-08i.pdf Path: Pittsburgh >> AEI >> 8036 Fall, 2009 Description: Managing diversity: The European Arrest Warrant and the potential of mutual recognition as a mode of governance in EU Justice and Home Affairs Julia Sievers PhD student, University of Bremen Paper to be presented at the EUSA Tenth Biennial Internat... Date Added: 2009-06-08 07:20:00 |
| 001899_1.pdf Path: Pittsburgh >> AEI >> 4249 Fall, 2009 Description: ... Date Added: 2009-06-08 07:20:37 |
| hague_1969.pdf Path: Pittsburgh >> AEI >> 1451 Fall, 2009 Description: MEETING OF THE HEADS OF STATE OR GOVERNMENT THE HAGUE 2 DECEMBER 1969 Documents in this collection include: The Hague Summit reproduced from the Bulletin of the European Communities , No. , 1970. Background Speech by Jean Rey, President of the Comm... Date Added: 2009-06-08 07:35:05 |
| 001973_1.pdf Path: Pittsburgh >> AEI >> 4502 Fall, 2009 Description: ... Date Added: 2009-06-08 07:35:06 |
| yesilada-b-08e.pdf Path: Pittsburgh >> AEI >> 8027 Fall, 2009 Description: Yeilada/\"Benefits of Turkey\'s EU Membership\" 1 Some expected and some not-so-expected Benefits of Turkey\'s EU Membership for both Parties Birol A. Yeilada Mark Hatfield School of Government Portland State University (Yesilada@pdx.edu) Paper prepa... Date Added: 2009-06-08 07:36:20 |
| 24 Points setblank.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: 241_Project 3_Your Name principle(s): Illusion (Value) principle(s): Emphasis (focal point) principle(s): principle(s): principle(s): principle(s): ... Date Added: 2009-06-08 07:40:52 |
| 001779_1.pdf Path: Pittsburgh >> AEI >> 4488 Fall, 2009 Description: ... Date Added: 2009-06-08 07:47:40 |
| billy 2.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: PLANES Studying in school versus wathcing TV and becoming useless. B C A little brother nagging his older sibling, thinking he\'s right, the realizing the older sibling was just as right. B C Planting a garden with only one successful flower. ... Date Added: 2009-06-08 07:51:20 |
| 002522_1.pdf Path: Pittsburgh >> AEI >> 2396 Fall, 2009 Description: ... Date Added: 2009-06-08 07:52:42 |
| 001639_1.pdf Path: Pittsburgh >> AEI >> 4178 Fall, 2009 Description: ... Date Added: 2009-06-08 07:56:04 |
| Spectroscopy.pdf Path: Colorado >> ECEN >> 5606 Fall, 2008 Description: Spectroscopy lecture ECE 5606 Adv. Optics Lab Outline Prism spectrometer Grating spectrometer Scanning Fabry-Perot spectrometer 1 Prism spectrometer ECE 5606 Adv. Optics Lab Dispersing prism Basics i1 t1 i 2 t2 n= sin ( i1 ) sin ( t... Date Added: 2009-06-08 07:57:35 |
| 31735055279396_1.pdf Path: Pittsburgh >> AEI >> 9094 Fall, 2009 Description: ... Date Added: 2009-06-08 07:59:56 |
| 11-Soames-01-31-75.pdf Path: Pittsburgh >> AEI >> 8309 Fall, 2009 Description: ... Date Added: 2009-06-08 08:02:54 |
| 000860_1.pdf Path: Pittsburgh >> AEI >> 4294 Fall, 2009 Description: ... Date Added: 2009-06-08 08:03:02 |
| ECE4007PDR.ppt Path: Georgia Tech >> ECE >> 4007 Fall, 2008 Description: Air Coupled Ultrasonic Imaging For Non-Destructive Testing GTL Ultrasonics David Lavery Andrew Ray Mario Malave Preliminary Design Review March 10, 2009 Project Overview Current State of the Project Current Needs Ongoing Development Projected Sc... Date Added: 2009-06-08 08:05:28 |
| slac-pub-12099.pdf Path: Stanford >> PUBS >> 12000 Fall, 2009 Description: SLAC-PUB-12099 September 2006 Sulfur K-Edge XAS and DFT Calculations on P450 Model Complexes: Effects of Hydrogen Bonding on Electronic Structure and Redox Potentials Abhishek Dey, Taka-aki Okamura, Norikazu Ueyama,*, Britt Hedman,*, Keith O. Hodgso... Date Added: 2009-06-08 08:11:32 |
| dst_index_1971_04.txt Path: UCLA >> PT >> 1971 Fall, 2009 Description: 1971 4 1 0 -42 1971 4 1 1 -41 1971 4 1 2 -41 1971 4 1 3 -40 1971 4 1 4 -47 1971 4 1 5 -45 1971 4 1 6 -49 1971 4 1 7 -47 1971 4 1 8 -39 1971 4 1 9 -34 1971 4 1 10 -31 1971 4 1 11 -28 1971 4 ... Date Added: 2009-06-08 08:13:48 |
| Scan Wizard 5 in IMS.doc Path: Trinity U >> CS >> 1300 Fall, 2009 Description: Scan Wizard 5 in IMS 1. Place the scan material face down against front right hand side of scanner. 2. Start > All Programs > Microtec ScanWizard for Windows > Scanwizard5 3. You may see an image from a previous scan. If so, click Overview to see ma... Date Added: 2009-06-08 08:23:55 |
| 24 Points setblank.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: 241_Project 3_Your Name principle(s): Illusion (Value) principle(s): Emphasis (focal point) principle(s): principle(s): principle(s): principle(s): ... Date Added: 2009-06-08 08:24:34 |
| Potter.pdf Path: Stanford >> ERE >> 1980 Fall, 2009 Description: -31 6EFFECT OF TEMPERATURE AND SOLUTION COMPOSITION ON THE PERMEABILITY OF ST. PETERS SANDSTONE: ROLE OF IRON (111) J.M. Potter, A. Nur, Stanford Rock Physics Project W.E. Dibble Jr., Dept. of Geology, Stanford University, Stanford, California 94305... Date Added: 2009-06-08 08:24:35 |
| ExamIans.pdf Path: Purdue >> MA >> 315 Fall, 2009 Description: MA 315, Spring 2009 Exam I You must write in complete sentences with correct spelling, punctuation and grammar. (1) Negate the following statement, and explain your reasoning. ( > 0)( > 0)(x) |x - a| < and |f (x) - f (a)| . SOLUTION: To negate a qu... Date Added: 2009-06-08 08:29:06 |
| F13.071.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F13.071 repeat_region TEL13R (XIII right telomeric region) Chr13 923539.924429 tcaatatgtttattttgtaaagttgaaagataattatttttatgtttagg tgattttggtgttgaattttctgtaatattaacataagagtaatacattg agtggttagtatatggtgtaaaagtggtataacgcatgtattaagagcag ttatacaatatttggg... Date Added: 2009-06-08 08:39:21 |
| assignment1.pdf Path: Virgin Islands >> SENG >> 310 Fall, 2009 Description: SENG 310 Assignment 1: Interviews Due: May 21st in Class Complete this assignment with your project group. Submit the assignment in class on paper. Your group has been hired by the University of Victoria to design an online system to assist professor... Date Added: 2009-06-08 08:51:08 |
| eXtreme Programming.ppt Path: NJIT >> CS >> 602 Fall, 2009 Description: Extreme Programming Kent Beck, Ward Cunningham NJIT Software Development History During the 1970s, it was discovered that most large software development projects failed. During the 1980s, many of the reasons for those failures began to be re... Date Added: 2009-06-08 08:52:14 |
| Classwork0403.pdf Path: UConn >> MATH >> 2110 Fall, 2009 Description: ... Date Added: 2009-06-08 08:53:29 |
| lecture18.pdf Path: Oakland University >> CSE >> 40833 Fall, 2009 Description: Graph algorithms 10/12/07 Topics Introduction to graphs Prim\'s Minimum Spanning Tree (MST) algorithm Finding connected components in parallel 1 Basic definitions A graph G is a pair (V,E) such that: V is a finite set of points called vertices... Date Added: 2009-06-08 08:55:34 |
| 19980304_165928_antstep.txt Path: St. Mary MD >> CDF >> 001 Fall, 2009 Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd22/19980304_165928_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 1000 Hertz Unambig_veloc... Date Added: 2009-06-08 08:56:13 |
| exam3_practice.pdf Path: UConn >> ADAM >> 113 Fall, 2009 Description: Mathematics 113Q, Section 2 Practice Exam 3, Fall 2004 Instructor: Adam Bowers Name: Answer the questions in the space provided. If you need more space, continue on some other sheet of paper. All answers must include supporting work or an explanati... Date Added: 2009-06-08 08:56:57 |
| 74LS155.pdf Path: George Mason >> ECE >> 332 Fall, 2008 Description: DM74LS155 DM74LS156 Dual 2-Line to 4-Line Decoders/Demultiplexers August 1986 Revised April 2000 DM74LS155 DM74LS156 Dual 2-Line to 4-Line Decoders/Demultiplexers General Description These TTL circuits feature dual 1-line-to-4-line demultiplexers... Date Added: 2009-06-08 08:57:18 |
| 206_16.2.ppt Path: San Jose State >> CS >> 257 Spring, 2008 Description: 16.2 ALGEBRAIC LAWS FOR IMPROVING QUERY PLANS Ramya Karri ID: 206 Optimizing the Logical Query Plan The translation rules converting a parse tree to a logical query tree do not always produce the best logical query tree. It is often possible to op... Date Added: 2009-06-08 08:58:19 |
| chapter08.ppt Path: Gordon MA >> CS >> 111 Fall, 2009 Description: Chapter8:Introductionto HighLevelLanguage Programming Invitation to Computer Science, Java Version, Third Edition Objectives In this chapter, you will learn about Where do we stand? High-level languages Introduction to Java Virtual data storag... Date Added: 2009-06-08 08:58:41 |
| 103a_13.4.ppt Path: San Jose State >> CS >> 257 Spring, 2008 Description: Data Representation Recovery from Disk Crashes 13.4 Presented By: Deepti Bhardwaj Roll No. 223_103 SJSU ID: 006521307 Contents 13.4.5 Recovery from Disk Crashes 13.4.6 Mirroring as a Redundancy ... Date Added: 2009-06-08 08:58:54 |
| attachment.pdf Path: Berkeley >> DEMOG >> 20090202 Fall, 2009 Description: 20092010 PRB Fellows Program in Population Policy Communications T he Population Reference Bureau (PRB) is now accepting applications for its 20092010 Fellows Program in Population Policy Communications. The Program is funded by the U.S. Agency fo... Date Added: 2009-06-08 08:59:23 |
| attachment.pdf Path: Berkeley >> DEMOG >> 20081222 Fall, 2009 Description: 20092010 PRB Fellows Program in Population Policy Communications T he Population Reference Bureau (PRB) is now accepting applications for its 20092010 Fellows Program in Population Policy Communications. The Program is funded by the U.S. Agency fo... Date Added: 2009-06-08 08:59:24 |
| Chapter 15.ppt Path: Oregon State >> BA >> 340 Fall, 2008 Description: Chapter 15 Financial Ratios and Firm Performance Financial Statements Internal Uses of Financial Statements Financial Ratios External Uses of Financial Statements Financial Statements Review from Chapter 10 Three Amigos Income Statement Bala... Date Added: 2009-06-08 09:02:06 |
| 07b - Slides.pdf Path: Oakland University >> CSE >> 40547 Fall, 2009 Description: Lecture 07 - Multicore Computation 1 Lecture 07 Multicore Computation Lecture based on notes from John Mellor-Crummey Department of Computer Science Rice University & Jernej Barbic University of Notre Dame Lecture 07 - Multicore Computation 2 T... Date Added: 2009-06-08 09:03:58 |
| psat_ps4_barplots_wrap_base18b_February.pdf Path: UC Riverside >> CERT >> 308 Fall, 2009 Description: PSAT MAP 1800 1584 1368 1152 936 720 504 288 72 2 -144 -360 -576 -792 -1008 -1224 -1440 -1656 -1872 -2088 -2736 -2412 -2088 -1764 -1440 -1116 -792 -468 -144 180 504 828 1152 1476 1800 2124 2448 17 14 16 1 7 16 15 6 11 9 4 13 10 15 3 16 12 5 8 14 18 1... Date Added: 2009-06-08 09:05:24 |
| nm_emis.xls Path: UC Riverside >> CERT >> 308 Fall, 2009 Description: NM01 unit # name 350310008 Giant Refining, Ciniza Refinery, 4 B&W CO boiler LCC X (km) LCC Y (km) -1027.85 -434.36 Stack height(m) Elevation (m) Stack diameter(m) Exit velocity(m/s) Exit temperature (K) SO2 Rate (g/s) 36.58 2133.6 2.44 7.3 561 35.... Date Added: 2009-06-08 09:05:43 |
| sectcnfgramH.pdf Path: Duke >> X >> 140 Spring, 2009 Description: CPS 140 - Mathematical Foundations of CS Dr. S. Rodger Section: Transforming Grammars Ch. 6 handout Methods for Transforming Grammars Read Ch 6 in Linz Book We will consider CFL without . It would be easy to add to any grammar by adding a new start ... Date Added: 2009-06-08 09:07:33 |
| berman_rm10_ppt_02.ppt Path: Lincoln U. CA >> MTKG >> 3351 Fall, 2009 Description: Chapter 2 Building and Sustaining Relationships in Retailing RETAIL MANAGEMENT: A STRATEGIC APPROACH, 10th Edition BERMAN EVANS Chapter Objectives To explain what \"value\" really means and highlight its pivotal role in retailers\' building and susta... Date Added: 2009-06-08 09:16:02 |
| 70228gymnastics-weekly.pdf Path: Seattle Pacific >> MEDIA >> 0607 Fall, 2009 Description: S E AT T L E P A C I F I C U N I V E R S I T Y Falcon News SPORTS INFORMATION OFFICE Frank MacDonald, SID 206/281-2772 voice | 206/281-2266 fax | frmacdon@spu.edu | www.spu.edu/falconsonline FOR IMMEDIATE RELEASE February 28, 2007 2007 WOMEN\'S GYM... Date Added: 2009-06-08 09:17:29 |
| Lect_12p.pdf Path: Rochester >> AST >> 142 Fall, 2009 Description: Astronomy 142, Spring 2009 24 February 2009 Today in Astronomy 142 Interstellar dust Extinction, reddening and polarization of starlight Composition and structure of dust grains The Lund Observatory painting of the sky, dominated by the Milky Way ... Date Added: 2009-06-08 09:17:30 |
| hw03-07.pdf Path: Michigan >> PERSONAL >> 102 Fall, 2009 Description: Econ 102 Winter Term 2007 Alan Deardorff Homework #3 Econ 102 Savings, Investment, and the Financial System Due in Sections, Feb 2, 2007 1. Be sure to read your copy of the Wall Street Journal every weekday, looking especially for items related to ... Date Added: 2009-06-08 09:21:04 |
| Oct11.ppt Path: Michigan >> PSYCH >> 341 Fall, 2008 Description: Hypothesis Testing Thursday, October 11 Sampling distribution Impossible to observe all instances of a particular behavior Instead, make inferences from samples of the population Sampling distribution = \"distribution of means from different sample... Date Added: 2009-06-08 09:22:33 |
| Lecture9-Projections.pdf Path: Colorado >> GEOG >> 3040 Fall, 2009 Description: Lecture 9 Coordinates finished Map Projections begun Notes Midterm #1 is two weeks from today (October 9th)! You are doing well - maps are good, participation is good - keep it up. Characteristics Angular Meridians and parallels intersect perpe... Date Added: 2009-06-08 09:23:00 |
| Gonzales.pdf Path: UVA >> PLAP >> 101 Fall, 2008 Description: SUPREME COURT OF THE UNITED STATES No. 03-1454 ALBERTO R. GONZALES, ATTORNEY GENERAL, et al., PETITIONERS v. ANGEL McCLARY RAICH et al. ON WRIT OF CERTIORARI TO THE UNITED STATES COURT OF APPEALS FOR THE NINTH CIRCUIT [June 6, 2005] Justice Stevens ... Date Added: 2009-06-08 09:25:17 |
| Chap05nonstar.doc Path: Michigan >> MGT >> 511 Fall, 2009 Description: Chapter 5 Solutions: 1. a. Head, Head (H,H) Head, Tail (H,T) Tail, Head (T,H) Tail, Tail (T,T) x = number of heads on two coin tosses Outcome (H,H) (H,T) (T,H) (T,T) d. 2. a. b. c. 3. a. b. c. Experimental Outcome Value of N 4. 5. a. b. Experimental ... Date Added: 2009-06-08 09:28:27 |
| OscarSanchez.ppt Path: University of Illinois, Urbana Champaign >> CS >> 598 Fall, 2008 Description: IMPROVED TECHNIQUES FOR THE IDENTIFICATION OF PSEUDOGENES L. Coin and R. Durbin Wellcome Trust Sanger Institute BIOINFORMATICS 2004 Presented by: Oscar Sanchez Plazas Outline Problem definition Previous works on pseudogene identification Propose... Date Added: 2009-06-08 09:28:29 |
| methods.txt Path: Arkansas Tech >> CS >> 2213 Fall, 2009 Description: 1> Envelop methods => Env:Env() - initialize an Env void Env:init() - initialize an Env void Env:reinit() - reinitialize after done void Env:done() - destroy an Env void Env:copy (Env A) - initialize A ... Date Added: 2009-06-08 09:30:30 |
| methods.txt Path: Arkansas Tech >> BACKUP >> 2213 Fall, 2009 Description: 1> Envelop methods => Env:Env() - initialize an Env void Env:init() - initialize an Env void Env:reinit() - reinitialize after done void Env:done() - destroy an Env void Env:copy (Env A) - initialize A ... Date Added: 2009-06-08 09:30:32 |
| final_2004_fall_prob.pdf Path: Michigan >> PERSONAL >> 217 Fall, 2009 Description: NAME: Professor/Section: For each problem show ALL your steps and clearly BOX your final answer. Problem 1 2 3 4 5 6 7 8 9 10 Total Points Possible 10 10 15 5 10 10 10 15 10 5 100 Points Earned 1 4 0 1 1. Let A = -2 1 0. -2 0 1 a) Find a basis for... Date Added: 2009-06-08 09:32:28 |
| YMR086W.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YMR >> 086 Fall, 2009 Description: YMR086W.t2k EBGHTL 3 2 1 CC 1 HGH C T T CCH THH T TEECTTTTHGTGTCH T H C T X T H E E H H E G X X X X X X X X X C CC H C C C C T X X X X X 10 20 30 40 H 3 2 1 H T H E E T H C H H H H H H H X X X X X X X X X X X X X X X X X X X X X X X ... Date Added: 2009-06-08 09:36:50 |
| YMR099C.t2k.w0.5-logo.pdf Path: UCSC >> YMR >> 099 Fall, 2009 Description: YMR099C.t2k w0.5 5 4 3 2 1 D N E X XXXXXXX L T G L L V R G X XXXXXXXXX L L L G D H L G E N I V X L I P L XXXXXXX V A V L F A S Q L L L XXX S A 1 10 20 30 40 E 5 4 3 2 1 P D G A T E S T E T E T E G XXXXXXXXXXXXXXX... Date Added: 2009-06-08 09:37:33 |
| YMR004W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YMR >> 004 Fall, 2009 Description: YMR004W.t2k EBGHSTL 3 2 1 CC X S T S C C G T S S T E C T T S S C T T S T S H T T T S S E S E T S T S T T T E T S T T S S T T T T T T S S H T H G H T H T H S G G T B T H H H H G H H H E E H T H H H G G S X X X X X X X X X X X X X X X X X X X X X X X... Date Added: 2009-06-08 09:38:22 |
| canyoumakeitlesson.pdf Path: Wisc Stevens Point >> CMODR >> 916 Fall, 2009 Description: Can You Make It? Grade Levels: 3-4 Objectives and Content Standards: Students will complete an experiment to gather data on the probability of an event occurring or not occurring. o NCTM Standard: Formulate questions that can be addressed with data ... Date Added: 2009-06-08 09:42:26 |
| How to solve it.pdf Path: Washington >> WEEK >> 590 Fall, 2009 Description: ... Date Added: 2009-06-08 09:42:28 |
| chapter10.doc Path: Auburn >> BIOL >> 1020 Fall, 2008 Description: BIOL 1020 CHAPTER 10 LECTURE NOTES Chapter 10: Photosynthesis I. Organisms can be classified based on how they obtain energy and how they obtain carbon A. energy source 1. chemotrophs can only get energy directly from chemical compounds 2. phototrop... Date Added: 2009-06-08 09:47:30 |
| 11a8bk.pdf Path: RPI >> HC >> 35274 Fall, 2009 Description: MC68HC11A8 HCMOS Single-Chip Microcontroller Motorola reserves the right to make changes without further notice to any products herein. Motorola makes no warranty, representation or guarantee regarding the suitability of its products for any particu... Date Added: 2009-06-08 09:47:45 |
| PDF_section15.pdf Path: Virginia Tech >> PUBS >> 450 Fall, 2009 Description: 52 XV. EVALUATION OF SEED TREATMENTS FOR CONTROL OF EARLY-SEASON DISEASES OF PEANUT (Duke farm) A. PURPOSE: To compare the efficacy of experimental fungicides to reference standard seed treatments for control of early season diseases of peanut. B. EX... Date Added: 2009-06-08 10:03:11 |
| section_5_4_The_Quarter_Wave_Transformer_package.pdf Path: E. Kentucky >> ITTC >> 723 Fall, 2009 Description: 3/30/2009 5_4 The Quarter Wave Transformer 1/1 5.4 The Quarter-Wave Transformer Reading Assignment: pp. 73-76, 240-243 By now you\'ve noticed that a quarter-wave length of transmission line ( = 4 , 2 = ) appears often in microwave engineering pr... Date Added: 2009-06-08 10:04:56 |
| oun12z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20081126 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/08112600_upa.wxp Date: 0000Z 26 NOV 08 Searching for KOUN. Searching the city database file for: KOUN . Date:0000Z 26 NOV 08 Station: KOUN... Date Added: 2009-06-08 10:13:06 |
| 11agriculture.ppt Path: Cal Poly Pomona >> GEO >> 351 Fall, 2009 Description: Califor nia Agr icultur e GEO 351 Federal water supply may be cut off from California. Monday, February 23, 2009 LA Times Federal water managers say they might have to cut off water supplies to some of California\'s largest farms, thanks to state... Date Added: 2009-06-08 10:16:20 |
| Drop.MGT.450.pdf Path: Kentucky >> USC >> 50703 Fall, 2009 Description: APPLICATION TO DROP A COURSE Submitted by College of ~usiness 3 Effective Date Fall 2003... Date Added: 2009-06-08 10:18:39 |
| Paper1.pdf Path: Cal Poly Pomona >> BIOPHY >> 410 Winter, 2009 Description: Paper #1: Physics and engineering: milestones in medicine / P.N.T. Wells 1. Bring three (3) well thought out questions about the paper to class 2. Questions about the paper: According to the article, how can physicists and engineers use their tal... Date Added: 2009-06-08 10:20:26 |
| chapter08.ppt Path: Gordon MA >> CPS >> 111 Fall, 2009 Description: Chapter8:Introductionto HighLevelLanguage Programming Invitation to Computer Science, Java Version, Third Edition Objectives In this chapter, you will learn about Where do we stand? High-level languages Introduction to Java Virtual data storag... Date Added: 2009-06-08 10:20:33 |
| HW8.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 124 Fall, 2008 Description: Math 124 C1 Homework #8 Ch. 2.1 #1,5,24,30,34 Note! If you are able to solve #34 and understand how to translate back and forth between systems of equations and matrices, you should be able to do well on the quiz this week. Be sure to practice these ... Date Added: 2009-06-08 10:22:01 |
| Matrices2.pdf Path: SUNY Fredonia >> CSIT >> 241 Fall, 2009 Description: X }| P!g| t#Y br b X a e g e s g e Y b a Y X e s g r | b X g Y s g s i h q q e i g Y f e Y b a Y X r q h s hp$h#t#xF#` 4hpC6h ut4ptt!(# # V4m U$4h4q#t4#m X aeg e a X V eqe e s bV#(etpe$etgap#qoX`X#tq4$sh4e#46 q s e Y i ... Date Added: 2009-06-08 10:24:41 |
| fa-2.pdf Path: Berkeley >> CS >> 152 Spring, 2008 Description: CS152 Fall \'99 Midterm II Page 1 University of California, Berkeley College of Engineering Computer Science Division EECS Fall 1999 John Kubiatowicz Midterm II November 17, 1999 CS152 Computer Architecture and Engineering Your Name: SID Number:... Date Added: 2009-06-08 10:25:14 |
| sp-1-sol.pdf Path: Berkeley >> CS >> 162 Fall, 2008 Description: University of California, Berkeley College of Engineering Computer Science Division EECS Spring 2000 Midterm Exam #1 SOLUTIONS February 28, 2000 CS 162 Operating Systems Prof. Michael J. Franklin Your Name: SID and 162 Login: TA Name: Discussion ... Date Added: 2009-06-08 10:25:22 |
| section7-2.txt Path: MO Southern >> MATH >> 030 Fall, 2009 Description: Assignment page(s): 411-413 Problems: 1, 2, 7-75 odd ... Date Added: 2009-06-08 10:26:05 |
| hcourse_syllabus.pdf Path: UNL >> ACCT >> 201 Summer, 2008 Description: Course Introduction Page 1 of 6 Department: Accounting University of NebraskaLincoln Lincoln, NE 68588 Nancy Cassidy 382 CBA (402) 472-2345 ncassidy2@unl.edu Instructor: Office Location: Phone: Introductory video by Dr. Cassidy E-mail: Use the f... Date Added: 2009-06-08 10:29:33 |
| kde-filesystem-4-1.noarch.rpm.txt Path: UNL >> I >> 386 Fall, 2009 Description: -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 SHORT PACKAGE INFO Name: kde-filesystem-4-1 Summary:KDE filesystem layout Group: System Environment/Base CHANGELOG (recent): * Mon Nov 19 2007 Rex Dieter <rdieter[AT]fedoraproject.org> 4-1 - - Version: 4 - - %c... Date Added: 2009-06-08 10:33:53 |
| jac_methods_Ch04.ppt Path: St. Francis IL >> BSAD >> 391 Fall, 2009 Description: Chapter 4 Survey Designs Winston Jackson and Norine Verberg Methods: Doing Social Research, 4e Table 1.2, Qualitative and Quantitative Research Contrasted QUALITATIVE QUANTITATIVE Multiple realities Reality is socially constructed Reality is con... Date Added: 2009-06-08 10:45:52 |
| OS_Ch1_part2.ppt Path: U. Houston >> PSYC >> 6036 Fall, 2009 Description: Percentiles Types of scales Frequencies Tables Distributions Probability Distribution Density Skew Positive Negative None Kurtosis Leptokurtic Platykurtic Summation Notation x , N, n Linear Transformations ... Date Added: 2009-06-08 10:48:47 |
| 06.11.27.VariabilityProbabilityBaseRates.ppt Path: U. Houston >> PSYC >> 6036 Fall, 2009 Description: Variability, Probability and Base Rates Overview Quiz Administrative Variability Probability Base Rates Course evaluations Quiz Administrative CPHS due today Final next week Review will be posted to the web by Friday Will give feedback o... Date Added: 2009-06-08 10:49:02 |
| 06.10.25.Observational-surveys-web.ppt.pdf Path: U. Houston >> PSYC >> 6036 Fall, 2009 Description: Collecting Data Observations and Surveys Overview Administrative Cool demos Questions about test Observational research Survey research Next time Administrative Introduction due next week Needs to be upload before class time (in MSWord, RTF... Date Added: 2009-06-08 10:49:04 |
| EP05_agile_people_factor.pdf Path: USC >> CS >> 510 Fall, 2009 Description: SOFTWARE MANAGEMENT Agile Software Development: The People Factor Alistair Cockburn, Humans and Technology Jim Highsmith, Cutter Consortium and skills of individuals and molds process to specic people and teams, not the other way around. AGILE IS ... Date Added: 2009-06-08 10:51:18 |
| YDL148C.t2k.alpha-logo.pdf Path: UCSC >> YDL >> 148 Fall, 2009 Description: YDL148C.t2k ALPHA 3 2 1 B H X X H X C C HXHHHHHXXIHHEHX I X X XXXX X X XXX B I H H HHH T BA H E S S B B H D H I B X C T XXX H H H X X X X X X X H H H H H XX H S H E H X XXXX E B E E H B H S X X X X X H H XX H S H X X... Date Added: 2009-06-08 11:04:39 |
| YDL122W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YDL >> 122 Fall, 2009 Description: YDL122W.t2k EBGHSTL 3 2 1 CC X 1 10 20 30 40 H 3 2 1 H H H H H H H C H H C H H H H X X X X X X X X X X 51 60 70 80 90 H 3 2 1 CECH C H E E H EXHXXXSX X X H E E 3 2 1 C CSC T T S H H H T T X X XXXXX S C E C C H X X H C ... Date Added: 2009-06-08 11:04:41 |
| YDL175C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YDL >> 175 Fall, 2009 Description: YDL175C.t2k DSSP-EHL2 2 1 CCCCC X CEHEXXEXXXHH C C C C C C E X X X X X X X H X X X 1 10 20 30 40 E 2 1 C H T S T H T H T S H X 51 60 70 80 90 H 2 1 C E X H H T T G T H T T E E T 2 1 S H G T T E T T H H T CC... Date Added: 2009-06-08 11:05:19 |
| n16.pdf Path: Duke >> X >> 237 Spring, 2009 Description: DNF counting Rare events if p small, huge sample size importance sampling biases samples toward event. Complexity: P-complete. PRAS, FPRAS Coverage algorithm given Ai V , count Ai problem: random a V too rarely satises work in Ai size known... Date Added: 2009-06-08 11:07:24 |
| dentlecture27.pdf Path: Ill. Chicago >> PCOL >> 331 Fall, 2008 Description: Lam Anti-anemic Agents _ Category Functional Defect Common causes _ Aplastic anemias Disturbed stem cell chemical, radiation, renal insufficiency, carcinomatosis, idiopathic vitamin B12/folate deficiency Megaloblastic anemias Hypochromic anemias Im... Date Added: 2009-06-08 11:10:10 |
| quiz_11_grav&Energy.pdf Path: SC State >> P >> 250 Fall, 2009 Description: PHYSICS 201 01 QUIZ 11 Dr. Dan Smith Name_ 1. Energy is measured in units of (a) kgm/s2 (b) Nm 2 (e) none of these (c) J (d) kgm 2/s November 10, 1995 ID_ 2. A 3kg block starting from rest is pushed along a horizontal, frictionless surface by a hori... Date Added: 2009-06-08 11:18:03 |
| key_practice_exam_2_F08.pdf Path: Western Washington >> CHEM >> 121 Fall, 2008 Description: ... Date Added: 2009-06-08 11:22:17 |
| specifications.txt Path: Iowa State >> COMS >> 641 Fall, 2009 Description: CS 641 meeting -*- Outline -*- * Specifications (Cohen\'s chapter 4) Note Hesselink uses a different notation, so no need to emphasize. Skip over 4.1 (it\'s obvious) * what is programming? (omit) - EQUATION WITH UNKNOWN SPECIFIED consider x*x +... Date Added: 2009-06-08 11:25:32 |
| ECON.pdf Path: San Diego State >> GB >> 0506 Fall, 2009 Description: Economics In the College of Arts and Letters OFFICE: Nasatir Hall 305 TELEPHONE: 619-594-1675 FAX: 619-594-5062 Faculty Mark A. Thayer, Ph.D., Professor of Economics, Chair of Department (Graduate Adviser) Renatte K. Adler, Ph.D., Professor of Econo... Date Added: 2009-06-08 11:35:13 |
| excel-asg5a.doc Path: FIU >> CS >> 2518 Fall, 2009 Description: Computer Data Analysis CGS 2518 Instructor: Greg Shaw Assignment #5 Chapter 4 Working with Large Worksheets and Tables 1. The Assignment Our next assignment is the Capstone Exercise on page 299 of the textbook. The workbook to be used is available... Date Added: 2009-06-08 11:39:37 |
| chap5_cap_airlines.txt Path: FIU >> CS >> 2518 Fall, 2009 Description: TripID,MarktingRep,Passengers,Catering,Customs,ContractStatus,Amount 1,Kenny,100,Snack,TRUE,Signed,\" $25,000 \" 2,Frank,125,Breakfast,FALSE,Proposal,\" $75,000 \" 3,Diane,50,Snack,TRUE,Signed,\" $55,000 \" 4,Kenny,120,Lunch,TRUE,Proposal,\" $45,000 \" 5,Ken... Date Added: 2009-06-08 11:39:38 |
| ENSO_Quick_Look.pdf Path: Columbia >> IRI >> 200208 Fall, 2009 Description: ENSO QUICK LOOK August 16, 2002 A monthly summary of the status of El Nio, La Nia and the Southern Oscillation , or \"ENSO\" There is greater than a 95% probability that current conditions represent the early stage of an El Nio event that will persist ... Date Added: 2009-06-08 11:44:58 |
| 1AutoFltAs.doc Path: MSCD >> AES >> 4530 Fall, 2008 Description: Auto Flight Answers 1. How many flight control computers are there and how are they represented to the pilots? 2: They are represented by green LEDs on either side of all mode selection buttons. 2. How is an armed mode presented for the pilot? In th... Date Added: 2009-06-08 11:45:46 |
| Chap1ReviewSolution.doc Path: Loyola Chicago >> MATH >> 131 Fall, 2009 Description: Math 131 Summer 2009 Haught Functions Review Chapter 1 1. (1.1#3) The value of a car, V = f (a ) , in thousands of dollars, is a function of the age of the car, a, in years. (a) Interpret the statement f(5) = 6. The value of a 5 year old car is $6... Date Added: 2009-06-08 11:46:23 |
| Abnormal Material.ppt Path: Acton School of Business >> PSYC >> 101 Fall, 2008 Description: Abnormal Psychology 101 Section 002 Cases Andrea Yates Ted Kaczynski: the unibomber \"Nancy\" Mark David Chapman (shot John Lennon) John Hinckley (shot Pres. Reagan) Jeffrey Dahmer, Ted Bundy John Nash \"A Beautiful Mind\" \"Abnormal\" is Difficul... Date Added: 2009-06-08 11:46:27 |
| classnotes-16.pdf Path: ECCD >> LING >> 220 Fall, 2009 Description: LING 220 Class Notes Tuesday, April 21st Spring 2009 We began analyzing wh -questions, noting that they have the same basic order as yes-no questions, except that a wh -pronoun (such as who or what ) appears at the beginning, in front of the inver... Date Added: 2009-06-08 11:46:46 |
| YLR318W.t2k.w0.5-logo.pdf Path: UCSC >> YLR >> 318 Fall, 2009 Description: 4 3 2 1 K K E LY IL FF I 1 10 20 30 40 E 6 5 4 3 2 1 R I L H H T 51 60 70 80 90 H 6 5 4 3 2 1 H T T E T E E XXXXXX XXXXXXXXXXXXXXX H H S I R Q S K N E N G L I K L K K S W S K F I N L L L I V R N R D S G L X X ... Date Added: 2009-06-08 11:46:48 |
| HW4_Solutions.pdf Path: Arizona >> GEO >> 519 Fall, 2009 Description: Problem Set #4: Fall 2007 . Spherical Harmonics 1. Use Eqn 23, p13 of Notes, to work out the formula for P 5(), and Eqn 28, p17 to find P 51(m). You will need P 5 first, and note that P 5=P50. 1 dn Pn ( ) = n ( 2 - 1) n n 2 n! d 1 1 = = 2.604x10-... Date Added: 2009-06-08 11:47:55 |
| presentation-midterm.ppt Path: USC >> CSCI >> 586 Fall, 2008 Description: Google Maps Representation of Geo-scientific Data Team Members 1.Jing Huang 2.Samar Bajaj 3.Neha Majithia 4.Sudeep Singla Team Advisor Rami Al Ghanmi Outline Introduction Need for mapping API Midterm Deliverables The Mapping API Sample Dat... Date Added: 2009-06-08 11:48:06 |
| COE2001.pdf Path: Georgia Tech >> ECE >> 20041027 Fall, 2009 Description: NEW COURSE PROPOSAL GRADUATE Level I Level II UNDERGRADUATE DATE: 27 Sept 2004 LAB/RECITATION 0 SEMESTER CREDIT 2 X SCHOOL, DEPARTMENT, COLLEGE: College of Engineering 1. Proposed Course Number: COE2001 (Verify with Registrar\'s Office) 2. Hours: ... Date Added: 2009-06-08 11:49:29 |
| bk.txt Path: Mt. Holyoke >> PHYS >> 302 Fall, 2009 Description: 2827.57 10000 2872.11 10000 2878.57 10000 2884.77 10000 2889.8 10000 2893.66 10000 2910.65 10000 2926.49 10000 2927.91 10000 2941.71 10000 2951.76 10000 2969.13 10000 2987.76 10000 3178.47 10000 3239.72 10000 3247.26 10000 3252.19 10000 3263.47 10000... Date Added: 2009-06-08 11:49:58 |
| COS 13813.pdf Path: Texas El Paso >> MATH >> 1320 Fall, 2008 Description: THE UNIVERSITY OF TEXAS AT EL PASO COLLEGE OF SCIENCE DEPARTMENT OF MATHEMATICS Course #: Course Title: Credit Hrs: Term: Course Meetings: Location: Prerequisite Courses: Math 1320, CRN 13813 & 15649 Mathematics for the Social Sciences I 3.0 Fall 200... Date Added: 2009-06-08 11:51:41 |
| FRD_LCA_F06a_T01_V2.1.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Feasibility Rationale Description (FRD) California Science Center Newsletter System Team 1 Jeremy Stoller Vincent Tsan Nisarg Patel Harsh Vardhan Saboo Abhilash Augustine Jaimin Vaidya Mitesh H Shah Mustanshir Kanchwalla Miguel Collins Client Sys... Date Added: 2009-06-08 11:52:54 |
| EWW_LCO_F05a_T16_V01.00.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Easy Win-Win Report (EWW) Intelligent, `diff\'ing CodeCount Superstructure Team 16 Lead - Robert F. Huber Operation Concept - Sunil C. Raga System Architect - Thomas Ackenhausen Proto-typist - David Naumann UML Modeler - Kevin Sigmund 09/26/2005 2... Date Added: 2009-06-08 11:54:29 |
| COQUALMO_LCA_SSAD_F01a_T01.pdf Path: USC >> CS >> 577 Fall, 2009 Description: Form SPD-8 COQUALMO Details Summaries -1. Project Title: Team 1 2. Project ID No. 1 LCA-SSAD 3. Rev No. SSAD-0.5 4. Date Prepared: 12/03/2001 5. Originator: Wenkuang Chang -6. Defect Introduction by Stage and Artifact Number of Defects Introduced Inc... Date Added: 2009-06-08 11:55:26 |
| ATPC_DCP_F08a_T14_V1.5.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Acceptance Test Plan and Cases Version: 1.5 Version no x.xx Acceptance Test Plan and Cases (ATPC) The Virtual Assistant Living and Education Program Team # 14 Team Members: Name Swetha Suryanarayanan Nikita Valechha Kartik Sethi ATPC_DCP_F08a_T1... Date Added: 2009-06-08 11:58:00 |
| 20020326.txt Path: USC >> CS >> 577 Fall, 2009 Description: Meeting Agenda & Minutes (03/26/02 6:00 PM - 7:00 PM) - From Last Meeting: ALL: All iteration 1 documents need to be ready for release on 03/28/02. Send Mike the status of your tasks on Sunday 03/24/02. - Done. Lucy: Work on DART to remove... Date Added: 2009-06-08 11:59:04 |
| TeachingPhilosophy.pdf Path: Wisc Stevens Point >> HMALI >> 924 Fall, 2009 Description: I believe every child has the right to a quality education. I recognize that while some of my students will have home lives which support their education, some students will not; therefore, every moment spent at school is precious. Time at school is ... Date Added: 2009-06-08 11:59:41 |
| GreatBlueHeron8-25-08.pdf Path: USC >> SCF >> 480 Fall, 2009 Description: The Great Blue Heron By Brian Firenzi Draft #4 8/26/08 1 INT. LIVING ROOM - NIGHT Cracks snake up the walls, framing the dilapidated TV set. The channels FLIP BY, with alternating bursts of STATIC and early-morning infomercials until the remote sto... Date Added: 2009-06-08 11:59:48 |
| book.pdf Path: Kentucky >> MA >> 322 Fall, 2008 Description: Linear Algebra Jim Hefferon 1 3 2 1 1 3 2 1 x1 1 3 2 1 x1 x3 2 1 6 8 2 1 6 8 2 1 Notation R N C {. . . . . .} . V, W, U v, w 0, 0V B, D En = e1 , . . . , en , RepB (v) Pn Mnm [S] M N V W = h, g H, G t, s T, S RepB,D (h) hi,j |T | R(h), N... Date Added: 2009-06-08 12:00:35 |
| OCD_LCO_F06a_T07_V2.1.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Operational Concept Description (OCD) USC CCR Web Application Team 7 Andrew Hart (SSAD Person) Kailash Karol (FRD Person) Eva Lee (Prototyper) Betty Liu (IV&V) Skanda Ramesh (LCP Person) Carlo Stearns (OCD Person) Karim Vidhani (SSRD Person) OCD_LC... Date Added: 2009-06-08 12:08:18 |
| HobbsPustejovsky2004.pdf Path: Washington >> LING >> 575 Winter, 2008 Description: Annotating and Reasoning about Time and Events Jerry Hobbs USC/ISI 4676 Admiralty Way Marina del Rey, CA 90292 hobbs@isi.edu James Pustejovsky Dept. of Computer Science Brandeis University Waltham, MA 02454 jamesp@cs.brandeis.edu Abstract In this p... Date Added: 2009-06-08 12:08:58 |
| exam2studyguide.pdf Path: Auburn >> CTMU >> 7520 Fall, 2009 Description: CTMU 7520-7526 End-Term Exam Study Guide If you can answer these study questions, you should be well-prepared! National Standards 1. Suzanne Shull suggests that music education professionals may have made curriculum choices that will eventually resul... Date Added: 2009-06-08 12:09:49 |
| exam01_v1.pdf Path: SFASU >> MATH >> 128 Fall, 2009 Description: Name: Math 128 Exam I (Version 1) Wednesday, February 11, 2009 Problem Number 1 2 3 4 5 6 7 8 9 Total Possible Score Points 6 8 10 4 4 6 5 8 8 59 Directions-Please Read Carefully! You have 75 minutes to take this exam. Make sure to use correct mat... Date Added: 2009-06-08 12:09:50 |
| Weslee Hall.doc Path: Kentucky >> ECO >> 202 Fall, 2008 Description: Weslee Hall 04 February 2008 Assignment 1 ECO 202 - 001 I believe that the most important macroeconomic goal is full employment because increases or declines in the labor force strongly affect our nation and contribute to stable prices and the growth... Date Added: 2009-06-08 12:10:19 |
| single.txt Path: Kent State >> CS >> 23021 Summer, 2008 Description: single ... Date Added: 2009-06-08 12:10:32 |
| charge_booklet.pdf Path: SFASU >> SPE >> 516 Summer, 2008 Description: &KDUJH6\\QGURPH H6 Charge syndrome is a genetic mutation in a single gene. CHARGE /Amanda Bowdoin syndrome is inherited in Cathryn King an autosomal dominant Silvia Le pattern, which means one Kathleen McGann copy of the altered gene Elizabeth Meek in... Date Added: 2009-06-08 12:11:23 |
| hw14ans.ps Path: Maryland >> CMSC >> 250 Fall, 2007 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw14ans.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hw14ans %DVIPSParameters: ... Date Added: 2009-06-08 12:11:52 |
| philosophy.ps Path: Texas >> CS >> 343 Fall, 2008 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Pages: (atend) %PageOrder: (atend) %DocumentFonts: (atend) %DocumentNeedsFonts: (atend) %DocumentSuppliedFonts: (atend) %Creator: Frame 5.5 %DocumentData: Clean7Bit %EndComments %BeginProlog % % Frame ps_prolog 5... Date Added: 2009-06-08 12:13:12 |
| AssgnMay16.ps Path: Stanford >> HRP >> 262 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.72 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: C:\\PCTeXv4\\btex\\hrp262Spring01\\AssgnMay16.DVI %CreationDate: Wed May 23 17:02:14 2001 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %Documen... Date Added: 2009-06-08 12:18:28 |
| epa.bmp.3.4.2009.pdf Path: Texas A&M >> MEDIA >> 13119 Fall, 2009 Description: Best Management Practices (BMPs): We Know Enough, Lets Implement! EPA, Region 6 , g March 2009 Deanna Osmond Soil Science Department NC State University NC STATE UNIVERSITY DEPARTMENT of SOIL SCIENCE Why Agricultural BMPs? Protect and preserve natu... Date Added: 2009-06-08 12:18:56 |
| Consequence_of_disease.pdf Path: Laurentian >> HLSC >> 3003 Fall, 2009 Description: Habit Outcome Consequence ... Date Added: 2009-06-08 12:19:21 |
| Influenza_Landmarks.pdf Path: Laurentian >> HLSC >> 3003 Fall, 2009 Description: ... Date Added: 2009-06-08 12:19:24 |
| Norwalk_West_Nile_Virus.pdf Path: Laurentian >> HLSC >> 3003 Fall, 2009 Description: NORWALK VIRUS (NORWALK, OHIO, 1972) IS THE PROTOTYPE OF THE GENUS NORWALK-LIKE VIRUS (NLV) IN THE CALICIVIRIDAE FAMILY INCLUDES LARGE NUMBER OF GENETICALLY RELATED STRAINS THAT CAUSE GASTROENTERITIS WORLD WIDE HUMANS ARE THE ONLY KNOWN HOSTS NLV ACCO... Date Added: 2009-06-08 12:19:25 |
| public.pdf Path: Maryville MO >> CANLASM >> 050109 Spring, 2009 Description: Public Abstract First Name:Michael Middle Name:Talens Last Name:Canlas Adviser\'s First Name:W. Adviser\'s Last Name:Jang Co-Adviser\'s First Name: Co-Adviser\'s Last Name: Graduation Term:SP 2009 Department:Industrial Engineering Degree:MS Title:A PRACT... Date Added: 2009-06-08 12:21:27 |
| OntologiesKISSES.pdf Path: George Mason >> INFS >> 770 Spring, 2008 Description: Trends & Controversies Editor: Steffen Staab University of Karlsruhe sst@aifb.uni-karlsruhe.de Ontologies\' KISSES in Standardization collection of use cases implicating the yetto-be-defined Web ontology language turned up many of those properties t... Date Added: 2009-06-08 12:22:07 |
| iw3htp3_06.ppt Path: Benjamin Franklin Institute of Technology >> ECE >> 3553 Fall, 2009 Description: Chapter 6 - Cascading Style SheetsTM (CSS) Outline 6.1 6.2 6.3 6.4 6.5 6.6 6.7 6.8 6.9 6.10 6.11 6.12 Introduction Inline Styles Embedded Style Sheets Conflicting Styles Linking External Style Sheets W3C CSS Validation Service Positioning Elements Ba... Date Added: 2009-06-08 12:22:42 |
| oh-Ch1.doc Path: Southern Oregon >> CH >> 411 Fall, 2009 Description: ... Date Added: 2009-06-08 12:23:50 |
| barretts.pdf Path: MIT >> HST >> 120 Fall, 2009 Description: The Progression of Barrett\'s Esophagus Jocelyn Songer First Prev Next Last Go Back Full Screen Close Quit The Basic Progression Gastroesophageal Reflux Disease (GERD): 5% US population Barrett\'s Esophagus: 10-15% of GERD patients Esophageal Ad... Date Added: 2009-06-08 12:24:01 |
| q.pdf Path: U. Memphis >> HISTORY >> 7000 Fall, 2009 Description: Q REF Z 1605 H23 REF F 1408 W423x Z 1601 H853 REF Z 1601 A2 G76 1976 REF Z 1601 G75 REF Z 1601 G4 REF Z 1610 K38 1920a Z 1601 B34 LATIN AMERICA Handbook of Latin American Studies David P. Werlich, Research Tools for Latin American Historians: A Se... Date Added: 2009-06-08 12:24:56 |
| lesson11.pdf Path: Allan Hancock College >> MMST >> 11001 Fall, 2009 Description: Introduction to Multimedia MMST 11001 Lesson 11 - Technology & Convergence Technology, Convergence and Culture In this course we have been developing some foundational multimedia skills, and developing an understanding of how multimedia works as com... Date Added: 2009-06-08 12:25:42 |
| CHAP11.doc Path: Texas A&M >> INTERNATIO >> 445 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>223d10d2dd9db2fa6ed9f2bb189047c349c53b06.doc</Key><RequestId>B 658FB59F663633B</RequestId><HostId>SRhcav3kSxtEEos6lqYsySwQyMp... Date Added: 2009-06-08 12:25:55 |
| complexity.txt Path: Puget Sound >> CS >> 261 Fall, 2009 Description: Complexity of EntryStats: - Consider the case where a text sample consisting of multiple lines is fed to EntryStats via repeated calls to generateText(). We\'ll just consider what happens when processing a single line, for now, and we\'ll neglect th... Date Added: 2009-06-08 12:26:53 |
| midterm 1 review.pdf Path: UCSC >> ECON >> 111 Fall, 2009 Description: MIDTERM.ONE.REVIEW CHAPTER 13 [Homework to look at: E13-12] 1. At the beginning of 2008, Gabriel Corporation began offering a 2-year warranty on its products. The warranty program was expected to cost Gabriel 4% of net sales. Net sales made under war... Date Added: 2009-06-08 12:27:05 |
| 1035DPW.TXT Path: Texas A&M >> ODP >> 1035 Fall, 2009 Description: Sheet1 SiteHoleCoreTypeSectionPosition (cm)Depth (mbsf)P-Wave Vel m/s 1035D1H1100.11480.2 1035D1H1110.111479.9 1035D1H1120.121468 1035D1H1130.131481.2 1035D1H1140.141480.9 1035D1H1150.151479.6 1035D1H1160.161481.5 1035D1H1170.171494.9 1035D1H1180.181... Date Added: 2009-06-08 12:29:17 |
| set8.ps Path: Maryland >> STAT >> 430 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: set8.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips set8 -o set8.ps %DVIPSParamet... Date Added: 2009-06-08 12:29:38 |
| B_1059B.TXT Path: Texas A&M >> ODP >> 1059 Fall, 2009 Description: Sheet1 SiteHoleCoreTypeSectionInt1Int2mbsfRaw b*Sm b*Offsetmcd 1059B1H188.10.0810.7310.730.320.4 1059B1H11212.10.128.488.480.320.44 1059B1H11616.10.168.348.340.320.48 1059B1H12020.10.26.646.640.320.52 1059B1H12424.10.245.626.250.320.56 1059B1H12828.1... Date Added: 2009-06-08 12:32:59 |
| Exp.9_F-08.pdf Path: Puget Sound >> C >> 110 Fall, 2009 Description: _University of Puget Sound Department of Chemistry Chem 110 EXP. 9UNKNOWN GASES You will work on your own in this experiment. As part of the lab this week you will, individually, be assigned three unknown gases from the following list: Air, Nitrogen... Date Added: 2009-06-08 12:33:08 |
| Middle Adulthood Psychosocial Development student version.ppt Path: SEMO >> PY >> 220 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>2219be508c310389d13673c8b18e60834b2c310e.ppt</Key><RequestId>E 3157C19C0AC34B4</RequestId><HostId>2/Y7C7IA9J1Z8WJ0jeHeshbROGD... Date Added: 2009-06-08 12:33:34 |
| Lecture_02.pdf Path: UConn >> P >> 1501 Fall, 2009 Description: Physics 1501 Spring 2009 Mechanics, Thermodynamics, Waves, Fluids Chapters 1- 19 Textbook: R. Wolfson Essential University Physics ( vol. 1) Prof. Vasili Kharchenko E-mail: kharchenko@phys.uconn.edu Slide 1-1 Lecture 2 Motion in a Straight Line ... Date Added: 2009-06-08 12:33:35 |
| Syllabus 2004.rtf Path: Washington University in St. Louis >> PSY >> 565 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|23 May 2004 13:11:01 -0000 vti_extenderversion:SR|5.0.2.6417 vti_backlinkinfo:VX| vti_author:SR|STRUBE\\Mike Strube vti_modifiedby:SR|STRUBE\\Mike Strube vti_timecreated:TR|01 Jun 2004 12:27:00 -0000 ... Date Added: 2009-06-08 12:34:15 |
| Week6.pdf Path: Princeton >> ME >> 451 Fall, 2009 Description: ME 451C Winter Quarter, 2004-05 Week # 6 Harvey Lam lam@princeton.edu February 8, 2005 Abstract What happens when different species experience different body forces? A most interesting case is an ionized gas or an electrolyte in the presence of elec... Date Added: 2009-06-08 12:35:33 |
| Week04_PR_F08a_T07.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: Team Number: Week: 7 4 Program Size (SLOC) Actual Base Added Deleted Modified Reused From COTS Total New SLOC 0 0 0 0 0 0 Progress Description: Describe the progress on the project during the past week, both in qualitative and quantitative. A. L... Date Added: 2009-06-08 12:36:25 |
| OEDIPUS Handout Wk2.doc Path: Allan Hancock College >> DRAM >> 1010 Fall, 2009 Description: DRAM1010 Week 2 Greek Theatre, the Gods and Spectacle Athenian Society Golden Age of Athens: 5th Century BC Gods: The Religious and the Political \"were fabrics of thought and behaviour woven from the same threads\" Politics: Earliest form of \"democr... Date Added: 2009-06-08 12:38:23 |
| Lab3_EE422.pdf Path: Kentucky >> EE >> 422 Fall, 2009 Description: EE 422G - Signals and Systems Laboratory Lab 3 FIR Filters Written by Kevin D. Donohue Department of Electrical and Computer Engineering University of Kentucky Lexington, KY 40506 February 8, 2009 Objectives: Use filter design and analysis tools to... Date Added: 2009-06-08 12:40:04 |
| class2_2.pdf Path: Texas A&M >> CHEM >> 107 Fall, 2008 Description: CHEM 107, Spring 1999 Chemical Reactions Class 2.2 Introduction to Chemical Reactions CHEM 107 L.S. Brown Texas Areactants\" \"products\" FPlanning a synthesis is a ... Date Added: 2009-06-08 12:40:09 |
| 1stday.pdf Path: Texas A&M >> CHEM >> 107 Fall, 2008 Description: CHEM 107, Spring 1999 CHEM 107 on TV Introduction to CHEM 107 Telecourse Dr. Larry Brown Texas A&M University FGeneral Chemistry for Engineering Students FLectures delivered on TV instead of in large class FBroadcast available to community viewers a... Date Added: 2009-06-08 12:40:09 |
| zhang.pdf Path: Texas A&M >> CS >> 637 Fall, 2009 Description: STOC 2005 Best Paper Undirected ST-Connectivity in Log-Space Omer Reingold ABSTRACT We present a deterministic, log-space algorithm that solves st-connectivity in undirected graphs. The previous bound on the space complexity of undirected st-connec... Date Added: 2009-06-08 12:40:19 |
| ia3.pdf Path: Texas A&M >> M >> 412 Fall, 2009 Description: M412 Assignment 3, due Friday September 16 1. [10 pts] Use the method of characteristics to solve the PDE ux - uy + 2y =0 u(x, y) = xy on the line x + 2y = 1. 2. [10 pts] For the PDE ut + f (u)x = 0 u(0, x) = g(x), use the method of characteristics t... Date Added: 2009-06-08 12:56:16 |
| CEA_Lacks_Credibility.pdf Path: Bowling Green >> RMI >> 3500 Fall, 2009 Description: ... Date Added: 2009-06-08 13:01:09 |
| L07Algorithms3.pdf Path: UMBC >> CSEE >> 104 Spring, 2001 Description: 1 2 Quiz1 Question Add Binary Numbers a) b) c) d) e) 101010 010011 010001 010111 none 1011 +1 0 0 0 10011 001011 001000 010011 Quiz1 question What is the largest decimal number you can represent using 3 bits ? a) b) c) d) e) f) g) 7 8 9 15 16 ... Date Added: 2009-06-08 13:05:17 |
| notes & joining.pdf Path: Penn State >> CAO >> 5021 Fall, 2009 Description: Editors Notes Greetings, patrons of Problem Child! With great pleasure I proffer my presence in a plug to proactively present a production plentiful in prose and poetry. In all probability my plans to impermanently prevaricate the purpose of thi... Date Added: 2009-06-08 13:09:26 |
| slides5.ps Path: Bowling Green >> CS >> 4710 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: slides5.dvi %Pages: 24 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: ZapfDingbats %EndComments %DVIPSCommandLine: /usr/local/bin/dvips -f slides5.d... Date Added: 2009-06-08 13:12:49 |
| PRR_IOC2_S07b_T02_V1.10.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>22b246fd062ed60d012a9ebcf38eb2886d897002.doc</Key><RequestId>3 E753270F61BAF8D</RequestId><HostId>DPUghBCh1mOlpHYuFvjH9LCroF2... Date Added: 2009-06-08 13:14:38 |
| handout7.pdf Path: UCLA >> O >> 245 Fall, 2009 Description: ... Date Added: 2009-06-08 13:15:59 |
| lect10.ps Path: University of Illinois, Urbana Champaign >> CS >> 101 Spring, 2008 Description: #%-12345X@PJL JOB @PJL SET HOLD=OFF @PJL SET RESOLUTION = 300 @PJL SET BITSPERPIXEL = 2 @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - lect10.htm %Creator: PScript5.dll Version 5.2.2 %CreationD... Date Added: 2009-06-08 13:20:50 |
| Exam1-solutions.doc Path: UF >> CIS >> 3023 Fall, 2008 Description: 1. Analysis Design Implementation Verification Maintenance 2. Initial state of the class must be that location is Gainesville. We always return to Gainesville Pre-conditions: travelToNewYork() location is Gainesville travelToOrlando() locatio... Date Added: 2009-06-08 13:21:47 |
| Prelab4_1.rtf Path: Dallas >> EE >> 3120 Fall, 2008 Description: `timescale 1ns / 1ps / Lab 4 Design Problem 1 module OvenController(H, L, Q, Qn); input H; input L; /input clk; output Q; output Qn; jkff jkff0(H, L, 1, Qn, Q); endmodule -`timescale 1ns / 1ps module jkff(J, K, clk, Q, Qn); input J; input K; input cl... Date Added: 2009-06-08 13:22:47 |
| ch12.pdf Path: MN State >> C >> 160 Fall, 2009 Description: Chapter 12 Oxidation-Reduction Reactions 12-1 Oxidation occurs when an atom or molecule loses electrons in the course of a reaction. Reduction occurs when an atom or molecule gains electrons in the course of a reaction. 12-2 A half-reaction is a rea... Date Added: 2009-06-08 13:24:01 |
| OpenSourceIP.pdf Path: Wake Forest >> CSC >> 101 Fall, 2008 Description: CSC 101 Section C Open Source/Intellectual Property Examples To Try 11/14/2007 1. [This question should reinforce your understanding of the different types of intellectual property protection mechanisms]. Match each of the following real world conce... Date Added: 2009-06-08 13:24:20 |
| table06uplandlintyield.xls Path: Cornell >> ERS >> 89004 Fall, 2009 Description: Appendix table 6-Upland cotton: Lint yield, by State, 1965/66-2002/03 Crop year AL AZ AZAR CA FL CA AL AR GA IL KS GA FL KY LA MS KS IL MO 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1... Date Added: 2009-06-08 13:24:44 |
| table43domesticshipmentsofmanmadefibers.xls Path: Cornell >> ERS >> 89004 Fall, 2009 Description: Appendix table 43-Domestic shipments of manmade fibers by major category, 2002-2004 1/ 2002 Fiber type 1Q 2Q 3Q 4Q Total 1Q 2Q Million pounds Woven products: Total 385.2 406.4 395.0 370.7 1,557.3 396.5 361.2 Polyester 252.4 265.1 251.1 229.4 998.0 26... Date Added: 2009-06-08 13:25:14 |
| table50rawwoolequivalentofusimports.xls Path: Cornell >> ERS >> 89004 Fall, 2009 Description: Appendix table 50-Raw-wool-equivalent of U.S. imports of wool-containing textile manufactures, 2002-2004 Yarn, thread, and fabric Apparel Year Yarn, Narrow, and thread, Broadindustrial, month Noils cordage, woven and Suits and and (inc. pile) Knit mi... Date Added: 2009-06-08 13:25:15 |
| Motor Systems 2006.ppt Path: Texas A&M >> CHAP >> 689 Fall, 2009 Description: Psychopharmacology Training Program NEURO Module Motor Systems (Chap 8) March 17, 2006 Paul J. Wellman Behavioral Neuroscience Program Texas A&M University Properties of Muscle Tissue Excitability Muscle responds to chemical messengers (neurotrans... Date Added: 2009-06-08 13:25:33 |
| test2_1.txt Path: TN Tech >> CSC >> 202 Fall, 2009 Description: 1 egy 2 ketto\" 3 ha\'rom 4 ne\'gy 5 o:t 6 hat 7 he\'t 8 nyolc 9 kilence 10 ti\'z 11 tizenegy 12 tizenketto\" 13 tizenha\'rom 14 tizenne\'gy 15 tizeno:t 16 tizenhat 17 tizenhe\'t 18 tizennyolc 19 tizenkilenc 20 husz 21 huszonegy 22 huszonketto\" 23 huszonha\'r... Date Added: 2009-06-08 13:26:09 |
| Notes_2.doc Path: UF >> CEN >> 6070 Fall, 2008 Description: Problem Set 2 Solution Notes 1. a) BINARY(list,N,key:IN; found,mid:OUT) Control-Flow Graph: lo := 1 s1 hi := N found := FALSE REPEAT s2 s3 mid := (lo + hi) div 2 IF key=list[mid] THEN found := TRUE ELSE s4 IF key<list[mid] THEN hi := mid-1 ELSE s5 ... Date Added: 2009-06-08 13:26:12 |
| Group 8.is_comp.pdf Path: Washington >> ENGR >> 100 Fall, 2008 Description: Engr 100 - Compression of Structures to Failure Group ID Weight [grams] Height [inch] Group 8 294.00 Load vs. Extension 7.50 400 Compressive load (lbf) 300 200 100 0 -0.1 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 Compressi... Date Added: 2009-06-08 13:26:51 |
| housten_A_2.txt Path: Rutgers >> MLIS >> 551 Fall, 2009 Description: <html> <!- #BeginTemplate \"/Templates/catalog.dwt\" -> <head> <!- #BeginEditable \"doctitle\" -> <title>Visiocom Catalog</title> <!- #EndEditable -> <meta http-equiv=\"Content-Type\" content=\"text/html; charset=iso-8859-1\"> <SCRIPT LANGUAGE=\"JavaScript... Date Added: 2009-06-08 13:28:24 |
| 106.Week6.doc Path: Rochester >> MAIL >> 106 Fall, 2009 Description: Pol Sci 106: International Relations LECTURE #10: THREE IMAGES and THE CAUSES OF WAR Housekeeping Business I. Introduction *we are going to pick up where we left off on levels of analysis - the question what causes war can be posed in two ways: 1) w... Date Added: 2009-06-08 13:29:01 |
| section02.pdf Path: Rochester >> MAIL >> 106 Fall, 2009 Description: PSC 106: Introduction to International Relations Weeks 2-3 Spring 2007 1 Power Factors - population, geography, governance, values, wealth, leadership, military power, etc. Four functions Defense - to protect you, i.e., minimize damages and hop... Date Added: 2009-06-08 13:29:02 |
| set1.pdf Path: New Mexico >> ECE >> 533 Spring, 2008 Description: ... Date Added: 2009-06-08 13:30:08 |
| resumeMJS.docx Path: Penn State >> MJS >> 5096 Fall, 2009 Description: Michael J. Sanwald 1095 Bancroft Lane Yardley, PA 19067 MJS5096@psu.edu School/Mobile: (215) 378-4918 Home: (215) 321-1878 OBJECTIVE: I am a goal oriented individual with great aspirations in the business world. I would like to work for a large busi... Date Added: 2009-06-08 13:32:20 |
| lecture 28.pdf Path: Southern Oregon >> METR >> 5113 Fall, 2009 Description: 1 METR 5113, Advanced Atmospheric Dynamics I Alan Shapiro, Instructor Friday, 26 Rocktober 2007 (lecture 28) Vorticity and Circulation Dynamics (Ch5 Kundu) Kelvin\'s Circulation Thm (continued) Let (t) u dl be circulation around closed material cur... Date Added: 2009-06-08 13:33:04 |
| hw2_sol_sp03.pdf Path: UF >> HW >> 4141 Fall, 2009 Description: HW#2 -1- HW#2 -2- HW#2 -3- HW#2 -4- ... Date Added: 2009-06-08 13:33:44 |
| AsteriskTeam_HTD.ppt Path: UCSC >> CMPS >> 231 Fall, 2009 Description: Hierarchical Task Diagram Phone interface Plan 0: Do 1.0 to 5.0 in order 0.0 Interacting with the diet diary system 1.0 Calling into system 2.0 System recognizes number from CallerID 3.0 System confirms ID by prompting to enter PIN 4.0 User i... Date Added: 2009-06-08 13:43:29 |
| Campaigns Chapters 1 and 2-Part4.pdf Path: Appalachian State >> COM >> 4400 Fall, 2009 Description: Lecture Notes 1/30/2007 Advertising Campaigns Focus and Situation Analysis Part 4 Consumer Analysis Objectives Upon completing this class, you will be able to: Identify the questions to ask consumers or ask about them Determine what factors le... Date Added: 2009-06-08 13:45:28 |
| 38.pdf Path: Penn State >> ASPRING >> 471 Fall, 2009 Description: Theorems about congruent triangles. B C\' SSS. If the corresponding sides of two triangles ABC and A\'B\'C\' have equal length, then two triangles are congruent. A C B\' C\' A\' ASA . If two triangles have two angles and the side between them equal, then... Date Added: 2009-06-08 13:55:21 |
| rasa.pdf Path: Texas >> PAGES >> 356 Fall, 2009 Description: - - rasa and bhava Basic emotions ripe for aesthetic transformation (bhava), according to the Natya-sastra: . (a) sexual feeling (b) mirth (c) grief (d) anger (e) energy (f) fear (g) repulsion (h) astonishment. Abhinava adds: (i) indifference/equa... Date Added: 2009-06-08 13:57:36 |
| Consequence_of_disease.pdf Path: Laurentian >> HLSC >> 200401 Fall, 2009 Description: Habit Outcome Consequence ... Date Added: 2009-06-08 14:03:04 |
| hwk2.ps Path: Texas A&M >> M >> 401 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: hwk2.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips hwk2 %DVIPSParameters: dpi=600, compressed, comments removed... Date Added: 2009-06-08 14:03:35 |
| web_Resume.pdf Path: Penn State >> DSY >> 109 Fall, 2009 Description: Derek S. Young Contact Information Department of Statistics The Pennsylvania State University 333 Thomas Building University Park, PA 16802 Work: (814) 863-3374 Fax: (814) 863-7114 E-mail: dsy109@stat.psu.edu WWW: www.stat.psu.edu/dsy109 Professiona... Date Added: 2009-06-08 14:17:16 |
| Sanyal2.pdf Path: Stanford >> ERE >> 1979 Fall, 2009 Description: w f . FRACTURE DETECTION FROM GEOTHERMAL GIELL LOGS b Y L.E. 6fells and R.E. S.K. Sanyal , Stanford University, Bickham, Scientific Software Corp. INTROOUCT I N O Most of the geothermal systems i n the world are fractured. In many systems, fract... Date Added: 2009-06-08 14:20:26 |
| Spring+2006+Rush+Events%5B1%5D.doc Path: UNC >> READ >> 3187203 Fall, 2009 Description: SUNDAY MONDAY 24 January/ February 2006 Service EventsTHURSDAY TUESDAY WEDNESDAY 25 Informal Rush Meeting Student Union Room 3203 6PM 8PM 26 Formal Rush Meeting 27 Informal Rush Meeting Student Union Room 3201 7PM FRIDAY 28 SATURDAY Studen... Date Added: 2009-06-08 14:35:38 |
| travel.doc Path: Iowa State >> MR >> 0126 Fall, 2009 Description: Des Moines Register 01-15-07 ISU adds training for international study semesters Staff who accompany students overseas will be taught how to handle harassment issues. By LISA ROSSI REGISTER AMES BUREAU Ames, Ia. - Iowa State University employees who ... Date Added: 2009-06-08 14:39:11 |
| Label.pdf Path: San Diego State >> ART >> 240 Fall, 2008 Description: Poster Timothy Kolstad Project 2 15 April 2009 Art 240 Digital Media: Section 01 Russ Prior San Diego State University ... Date Added: 2009-06-08 14:43:20 |
| 11.pdf Path: San Diego State >> ART >> 240 Fall, 2008 Description: Character palette overview The Character palette provides options for formatting characters. Some formatting options are also available from the options bar. You can display the Character palette by doing one of the following: Choose Window > Charact... Date Added: 2009-06-08 14:43:38 |
| vv.pdf Path: Midwestern State University >> CS >> 442 Fall, 2009 Description: local coordinates (x,y) M modeling matrix world coordinates (xw,yw) V view matrix eye coordinates (xe,ye) ... Date Added: 2009-06-08 14:43:58 |
| hw3.pdf Path: UNL >> MATH >> 902 Fall, 2008 Description: Math 902 Homework # 3 Due: Wednesday, February 14th Throughout R denotes a ring with identity. 1. Let F be an additive functor on module categories. Prove that F preserves split short exact sequences. 2. Let A be a right R-module and {Bi }iI a collec... Date Added: 2009-06-08 14:52:00 |
| may04.pdf Path: Texas >> CS >> 352 Spring, 2002 Description: CS352 Computer Architecture May 4, 2009 Herb Schwetman May 5, 2009 1 Today Today (Monday, May 4, 2009) Interconnections networks Classifying multiprocessor systems Trends in computer architecture Wednesday (May 6, 009) Review Course evaluat... Date Added: 2009-06-08 15:10:21 |
| present.ps Path: Carnegie Mellon >> CS >> 294 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 Copyright 1986-91 Radical Eye Software %Title: manuscript.dvi %Pages: 12 1 %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: tex.pro /TeXDict 200 dict def TeXDict begin /N /def load def /B{bind def}N /S /exch l... Date Added: 2009-06-08 15:11:06 |
| integration-tutorial-3d.pdf Path: W. Alabama >> ME >> 201 Fall, 2009 Description: M E 201 -1- Project 2 - Tutorial Sphere: rsph ( , ) := 10 xsph ( , ) := rsph ( , ) cos ( ) sin ( ) ysph ( , ) := rsph ( , ) sin ( ) sin ( ) zsph ( , ) := rsph ( , ) cos ( ) ( ( ) ) ( ) | | | | | | | | | | | | Cylinder pa... Date Added: 2009-06-08 15:15:00 |
| FLEDDAY1.pdf Path: Wisc Stevens Point >> JWITT >> 324 Fall, 2009 Description: Day #1: November 12, 2007 Standards: Use English to participate in social interaction Use English to interact in the classroom Use English to obtain, process, construct, and provide subject matter information in spoken and written form Use the ap... Date Added: 2009-06-08 15:15:49 |
| FLEDDAY1.pdf Path: Wisc Stevens Point >> JWITT >> 344 Fall, 2009 Description: Day #1: November 12, 2007 Standards: Use English to participate in social interaction Use English to interact in the classroom Use English to obtain, process, construct, and provide subject matter information in spoken and written form Use the ap... Date Added: 2009-06-08 15:15:49 |
| quiz_answers_Quiz1_answers.pdf Path: Washington >> CHEM >> 239 Fall, 2008 Description: ... Date Added: 2009-06-08 15:24:16 |
| Glossry.pdf Path: Texas >> EDC >> 371 Fall, 2008 Description: Term Byte Definition Term Definition viewed in a name (detail) mode. The standard settings in a program, such as singlespaced and a one inch margin in a word processing document. See file From the users viewpoint, this term is synonymous with a c... Date Added: 2009-06-08 15:24:37 |
| slides1.pdf Path: Duke >> X >> 100 Fall, 2009 Description: CPS 100, Fall 1997 q q q q q q Program Design and Methodology II (aka Data Structures) theoretical and practical study of data structures, algorithms, and program design In theory there is no difference between theory and practice, but not in pr... Date Added: 2009-06-08 15:26:41 |
| SurfacePressureMap.pdf Path: Washington >> PDF >> 101 Fall, 2009 Description: 1018 1009 1016 1008 1017 997 1011 1015 1007 1001 1015 1012 1016 1011 1005 998 1000 1012 1002 1014 1018 1010 1008 1003 1015 1007 1004 1014 1017 1007 1007 1012 1011 1009 1008 1009 1010 1011 1008 1011 1013 1013 1014 1016 1016 1013 1016 1017 1007 1014 10... Date Added: 2009-06-08 15:42:27 |
| home3.pdf Path: UWI Mona >> WEB >> 0364350 Fall, 2009 Description: 03-64-350 Homework #3 assigned: Oct.17, due: Oct. 24 1. Problem 4.8 page 144 T.L.Chow 2. Problem 4.9 page 144 T.L.Chow ... Date Added: 2009-06-08 15:43:53 |
| Rabies Leslieppt.pdf Path: Washington >> ZEPI >> 526 Fall, 2009 Description: Rabies Current Issues in Rabies Mira J. Leslie, D.V.M., M.P.H. April 4, 2007 Among the oldest infectious disease known. MOST FATAL disease known Prevention costs: health care, animal control, public health, laboratory. Centuries of Fear Rabhas... Date Added: 2009-06-08 15:44:05 |
| Lec5.pdf Path: San Jose State >> EE >> 176 Fall, 2008 Description: Today\'s Outline San Jose State University EE176-SJSU Computer Architecture and Organization Review of Last lecture Review ALU Design Designing a Multiplier Shifter Design Review Booth\'s algorithm EE176SJSU Lec5.Design&Multiplier.2 http:/www.engr.sj... Date Added: 2009-06-08 15:44:25 |
| feature_analysis.ppt Path: University of Alaska Fairbanks >> NRM >> 338 Fall, 2009 Description: Intersect Tool Cuts features Joins attribute tables Points, Lines, Polygons inside intersect polygons Points on lines Clip Tool Does not join tables Cuts points, lines or polygons using clipping polygons Erase Tool Opposite of Clip Does not... Date Added: 2009-06-08 15:44:42 |
| intsrwrittenrecordquestions2.doc Path: Iowa State >> NR >> 99174 Fall, 2009 Description: Clinton County Bucket Bottle Calf Management Record Due: June 26th to the Extension Office (If necessary use a separate sheet of paper. You could also use a typewriter or a computer) Name: _ Are you an Intermediate or Senior member, circle one, what... Date Added: 2009-06-08 15:46:38 |
| 304_Test-1.doc Path: N. Arizona >> GER >> 304 Fall, 2009 Description: DEUTSCH 304 Test 1 take home Name: XXXXXXXXXXXXXXXXXXXXXXXX When done, print ths document and submit the printed copy at BAA 222 (office). Please slide it under my office door, if the door is not open. Teil 1: Leitfragen zu 36-44 55 Punkte Doub... Date Added: 2009-06-08 15:50:26 |
| 222 vocabulary list 3:27.pdf Path: Hudson VCC >> JAPN >> 222 Fall, 2009 Description: ! ! ! + , 0% % -./ !\"#$% #$%#/0123 45-/01 67 3458/01 33593/01 :; <=;> (v5r,vt) to take (a photo); to make (a film); (P); EP ?@ABAC@DEFDGH?@ABAC@DIJ# I:P*)M7 Q0 <RS0> (v5s,vt) (1) to search (for something ... Date Added: 2009-06-08 15:54:21 |
| 122 vocabu list 1:23:08.pdf Path: Hudson VCC >> JAPN >> 122 Fall, 2009 Description: 122 08/1/23 (n) board game; ED (n,vs) lodging together; training camp; boarding house; (P); EP (v1,vt) to overeat; (P); EP and (conj); thereupon; because of that; KD besides; moreover; KD graduate; LW2 (v5r,vi) to turn back; to retur... Date Added: 2009-06-08 15:54:26 |
| s97e1.pdf Path: Washington >> IS >> 320 Fall, 2009 Description: IS 320 A/B-Spring 97 Exam 1 Page 1 Please use the paper supplied by the instructor to answer the questions. Question point values are shown in parentheses. 1. (18) What output is generated by the three MsgBox procedures in the cmdExam1 click event ... Date Added: 2009-06-08 15:56:04 |
| rasa.pdf Path: Texas >> PAGES >> 302 Fall, 2009 Description: - - rasa and bhava Basic emotions ripe for aesthetic transformation (bhava), according to the Natya-sastra: . (a) sexual feeling (b) mirth (c) grief (d) anger (e) energy (f) fear (g) repulsion (h) astonishment. Abhinava adds: (i) indifference/equa... Date Added: 2009-06-08 16:04:44 |
| HatNet.pdf Path: Caltech >> AY >> 218 Spring, 2008 Description: Draft version December 5, 2008 submitted to ApJ A Preprint typeset using L TEX style emulateapj v. 05/04/06 HATNET FIELD G205: FOLLOW-UP OBSERVATIONS OF 28 TRANSITING-PLANET CANDIDATES AND CONFIRMATION OF THE PLANET HAT-P-8b David W. Latham1 , Ga... Date Added: 2009-06-08 16:06:12 |
| RulesLivestockJudgingContest.doc Path: Iowa State >> D >> 95236 Fall, 2009 Description: LIVESTOCK JUDGING CONTEST Superintendents: Ed Hansen, Mike Cooley, Dennis Adkisson, Austin Swafford 1. Contest is for Adair County 4-H & FFA members only. FFA members must have been in high school during the past year to compete as a youth or as part... Date Added: 2009-06-08 16:15:10 |
| musiced.pdf Path: South Florida >> UGS >> 0102 Fall, 2009 Description: COLLEGE OF FINE ARTS UNIVERSITY OF SOUTH FLORIDA - 2001/2002 UNDERGRADUATE CATALOG MUSIC EDUCATION The music education curriculum is designed to serve students who wish to develop a high level of musical expertise and have a commitment to help dev... Date Added: 2009-06-08 16:32:57 |
| Green Sheet ISE 201 S07.doc Path: San Jose State >> ISE >> 201 Spring, 2008 Description: Green Sheet - Spring 2007 ISE 201 - Software Engr Analysis (#25816) Section 1 - W 6:00-8:45pm - Engr 486 Instructor: Steve Kennedy Office: Engr 485B Office Hours: W 5:00-5:45pm W 8:45-9:15pm Course description: Mathematical concepts, techniques rel... Date Added: 2009-06-08 16:40:13 |
| problem5a.pdf Path: Duke >> BIO >> 118 Fall, 2009 Description: Bio 118 Spring 2004: Study Problem #1a / Discussion Problem #5a The \"universality\" of the genetic code suggests that protein-coding genes from one organism may be expressed in other organisms, even in other kingdoms or across the eukaryote-prokaryo... Date Added: 2009-06-08 16:41:47 |
| mock midterm 2 - in.pdf Path: UNC >> ECON >> 132 Fall, 2008 Description: Definitions (20 points 5 points each) Purchasing Power Parity Tax Multiplier Autonomous Consumption Floating Exchange Rates Multiple Choice (50 points 5 pts each) 1. If the nominal exchange rate falls 8%, the domestic price level rises 4%, and ... Date Added: 2009-06-08 16:42:09 |
| Space Unit plan.doc Path: SUNY Cortland >> AED >> 34107 Fall, 2009 Description: How Can We Eradicate Bullying While Maintaining Our Civility? Social Warfare: A Thematic Unit Jonathan Space AED 341 Sarver Dr. 1 How Can We Eradicate Bullying While Maintaining Our Civility? Social Warfare: A Thematic Unit Pla... Date Added: 2009-06-08 16:42:15 |
| notes-2pp.pdf Path: Kentucky >> CS >> 471 Fall, 2009 Description: NOTES Chapter 27 (and a little of 13) Routing Routing Scalability Routing to millions of hosts can cause scalability problems. Example WAN Topology Routers connect to Routers to form the interconnect Hosts (sometimes LANs) connect to edge Router... Date Added: 2009-06-08 16:44:31 |
| hrdv5000.pdf Path: Webster FL >> UTAH >> 0809 Fall, 2009 Description: The School of Business & Technology Course Syllabus Course Term HRDV 5000-29 Introduction to Human Resources Development Fall 2 2008 October 20-December 19 Hill AFB Campus Building: 383 Room: 233 Day: Mondays Time: 5:30 p.m. to 9:30 p.m. Name: Dr. W... Date Added: 2009-06-08 16:45:56 |
| lecture04.pdf Path: CSU Northridge >> LECTURE >> 429 Fall, 2009 Description: COMP429 Computer Network Software Lecture 04: Address Resolution Protocol (ARP) Jeff Wiegley, Ph.D. Computer Science jeffw@csun.edu Revised: February 15, 2006 1 Introduction So now we have the following: Ethernet network segments rely on a 48 bit ... Date Added: 2009-06-08 16:49:23 |
| KNguyen.doc Path: San Jose State >> B >> 188 Fall, 2009 Description: K. Nguyen Average Rating: 4.58 1. 2. 3. 4. 5. 6. 7. 8. 9. Couldn\'t hear her from the back of the room. I think she did her presentation on a clothing store. Her reports look very organized. I like how she had the option to delete, make a new record... Date Added: 2009-06-08 16:51:11 |
| 11-LoopArrayExercisesAnswers.doc Path: UNC >> COMP >> 110 Fall, 2007 Description: 110-11.1 COMP 110 Loop and array self-help exercises: Answers 1. Write a loop to display the integers 0 through 9 in ascending order. for (var i=0; i<10; i+) { alert(i);} 2. Write a loop to display the integers 9 through 0 in descending order. for (v... Date Added: 2009-06-08 16:51:17 |
| CH14.pdf Path: Laurentian >> MGT >> 200603 Fall, 2009 Description: CHAPTER 14 CURRENT LIABILITIES AND CONTINGENCIES ASSIGNMENT CLASSIFICATION TABLE Brief Exercises Writing Assignments 2 Topics 1. Concept of liabilities; definition and classification. 2. Accounts and notes payable; dividends payable. 3. Short-term... Date Added: 2009-06-08 16:51:20 |
| finalSD2.ppt Path: RIT >> P >> 09713 Fall, 2009 Description: Sifting and Screening Equipment and Action Items from MSD I Sifting Equipment Update SWECO Separators family of machine sizes Machine Spout Diameter diameter (inches) (inches) Square feet of screen surface area* Motion Generator Horse Power Maximum ... Date Added: 2009-06-08 16:51:48 |
| 02propogate.ppt Path: CSU San Marcos >> HTM >> 430 Spring, 2008 Description: How is radio signal propagated Comparison of wired and wireless transmissions Wired Bandwidth Signal reception Security Interference Mobility Cost Expansion Depending on the media used, can be large Reliable due to dedicated link High, difficult to ... Date Added: 2009-06-08 16:55:09 |
| Discussion 13b.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 231 Fall, 2008 Description: Math 230/249 Fall 2005 Recitation 25 (Week 13b) R. Ghrist D. Beck Name: _ More Second Order Differential Equations 1. Warmup: Let\'s finish the beam bending problem we started some time ago. Recall that the differential equation that governs the sh... Date Added: 2009-06-08 16:55:56 |
| test3_sol.pdf Path: Utah >> MATH >> 2270 Summer, 2008 Description: Math 2270-1 Midterm 3, March 27, 2009 Solutions Problem 1 (20 points). Consider the vectors 1 -1 1 1 u = , v = 1 1 1 1 in R4 . Find a) their lengths u and v ; b) the angle between u and v. Solution: We have u = and v = Moreover, cos ... Date Added: 2009-06-08 16:56:04 |
| Ashenfelter__Auction_Survey.pdf Path: North-West Uni. >> DECS >> 452 Fall, 2009 Description: Art Auctions: A Survey of Empirical Studies Orley Ashenfelter Princeton University and NBER and Kathryn Graddy University of Oxford and CEPR April 2002 Abstract This paper contains a review of the burgeoning research that has been designed to shed... Date Added: 2009-06-08 17:01:47 |
| quiz7.pdf Path: Oakland University >> EE >> 40471 Fall, 2009 Description: Quiz 7 A DFT of length 16384 has to be calculated. What is the computational effort needed for the FFT compared to the DFT? (DFT=100%) A: 0.1 %. B: 1 %. C: 10 %. University of Notre Dame Department of Electrical Engineering EE 40471: Digital Sign... Date Added: 2009-06-08 17:04:36 |
| 1194_62.pdf Path: Pittsburgh >> AEI >> 6589 Fall, 2009 Description: Centre for European Policy Studies CEPS Policy Brief No. 62/February 2005 The Impact of Turkey\'s Membership on EU Voting Richard Baldwin and Mika Widgrn Abstract Thinking ahead for Europe This policy brief investigates the decision-making impact... Date Added: 2009-06-08 17:06:11 |
| lab1_2.rtf Path: UF >> CLAS >> 3514 Fall, 2009 Description: ANT 3514 Introduction to Biological Anthropology Human Osteology LAB 2, Week of 9/1/02 NOTE: Some of the following questions may require you to look up the answers at home using a textbook or an osteology website. The questions asterisked (*) must b... Date Added: 2009-06-08 17:06:56 |
| IndividualRatingFinal.doc Path: N.C. State >> NR >> 300 Fall, 2008 Description: Natural Resources Measurements Individual Effort Rating for Team Members Please rate everyone on your project team, including yourself, on the degree to which s/he fulfilled his or her responsibilities in completing work on the final project. Your i... Date Added: 2009-06-08 17:07:22 |
| Ch10IntroApril14.ppt Path: Purdue >> JPNS >> 202 Fall, 2008 Description: X I z L Jl L Additional Extra Point Activity on Blackboard w w L % L L 15 points will be added to homework. Jl L Iz L Final Exam v I z L Comprehensive, Ch.10 is included but not focused. 15% of final grade. p Recomme... Date Added: 2009-06-08 17:07:58 |
| MapReduce.ppt Path: UC Riverside >> CS >> 253 Fall, 2008 Description: MAPREDUCE:SIMPLIFIED DATAPROCESSINGON LARGECLUSTERS JeffreyDeanandSanjayGhemawat Authors ChongDing Presenter Google,Inc MOTIVATION:LARGESCALEDATA PROCESSING Manyspecialpurposetasksthatoperateonand producelargeamountsofdata Crawleddocuments,webreq... Date Added: 2009-06-08 17:08:15 |
| slac-pub-2586.pdf Path: Stanford >> PUBS >> 2500 Fall, 2009 Description: SLAC-PUB-2586 August 1980 (T/E) QUARK-GLUON SEPARATIONIN THREE-JET-EVENTS* H. P. Nilles and K. H. Streng 94305 Stanford Linear Accelerator Center Stanford University, Stanford, California ABSTRACT We discuss qqg-three tests jet the necessity of a s... Date Added: 2009-06-08 17:09:18 |
| syl-574-su-07.pdf Path: Los Angeles Southwest College >> MATH >> 574 Fall, 2009 Description: MATH 574 - Summer 2007 Professor: Office: Office Phone: e-mail: web site: Office Hours: Text Book: Prof. Kustin 300-B LeConte 777-3510 or 777-4224 kustin@math.sc.edu www.math.sc.edu (Click on Department Directory. Click on Kustin. Click on Teachin... Date Added: 2009-06-08 17:09:51 |
| CS774DesignProject.pdf Path: Loyola Maryland >> CS >> 774 Fall, 2009 Description: Loyola College Computer Science Dept Spring 2004 CS774 Human Computer Interaction Design Assignment In this project you will carry a complete lo fi design of a new user interface. You will go from high concept to a tested prototype. Phase 1. High co... Date Added: 2009-06-08 17:12:01 |
| 000106_1.pdf Path: Pittsburgh >> AEI >> 3975 Fall, 2009 Description: ... Date Added: 2009-06-08 17:12:11 |
| p3.ppt Path: Southern Oregon >> TEACH >> 3033 Fall, 2009 Description: PROJECT 3 A. Problem 4, Page 112 B. Problem 8, Page 113 C. Problem 10, Page 115 D. Problem 12, Page 116 Project 3 A, B, C, D For all four (4) programs please provide: 1. .cpp file 2. .obj file 3. .exe file a. printed out on paper and b. saved on flo... Date Added: 2009-06-08 17:14:05 |
| Patient_Education_2006.ppt Path: FIU >> PHT >> 5524 Fall, 2008 Description: Patient Education Patient Education Planned Learning experience Uses a combination of methods Teaching Counseling Behavior modification Influences patient\'s knowledge and health behavior What PTs Teac... Date Added: 2009-06-08 17:14:49 |
| Tutorial_2.pdf Path: Allan Hancock College >> ELEC >> 3601 Fall, 2009 Description: Tutorial 2 ELEC3601 1. =e Np What sets the size of ? What does this mean regarding increasing the sensitivity in a NMR experiment? Describe the following equation N ap - E kT 2. 3. Consider the human body at a temperature of 310K. Considering ... Date Added: 2009-06-08 17:16:08 |
| G8ET1_Powerpoint.ppt Path: Lincoln U. CA >> INFO >> 3321 Fall, 2009 Description: ROBO SKELETON: Sci-fi? Now its Reality. Group 8 Tiffany Duhamel Elizabeth Sewell Katherine Watson New Discovery made in Medical Technology: It is now possible for the physically paralyzed to walk! Robo Skeleton A hardware device referred to as th... Date Added: 2009-06-08 17:16:27 |
| PA7 Grading Sheet.doc Path: UF >> CIS >> 3020 Fall, 2008 Description: Group member names_ Programming Assignment 7 Grading: 70 points Grading TA_ Lab Instructor_ _/7 _/2 _/2 35 points: their analysis/design/implementation Analysis, Design and Documentation with UML Diagrams (7 pts) Encipher(encode, key, message) and ... Date Added: 2009-06-08 17:17:40 |
| slac-pub-1115.pdf Path: Stanford >> PUBS >> 1000 Fall, 2009 Description: SLAC-PIIB-1115 (m)and (m) August 1972 EMPIRICAL OBSERVATION THE ENERGYDEPENDENCE ON OF VARIOUS PARTICLE CROSSSECTIONSj\' F. Martin Stanford Linear Accelerator Center Stanford University, Stanford,California ABSTRACT The energy dependence of total e... Date Added: 2009-06-08 17:19:10 |
| hw6.ps Path: Maryland >> HW >> 250 Spring, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.55 Copyright 1986, 1994 Radical Eye Software %Title: hw6.dvi %CreationDate: Sat Mar 10 17:55:29 2001 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips hw6 %DVIPSParameters: d... Date Added: 2009-06-08 17:24:00 |
| Hollenbeck, DeRue, & Guzzo (2004) HRM.pdf Path: Acton School of Business >> MGMT >> 37250208 Fall, 2009 Description: BRIDGING THE GAP BETWEEN I/O RESEARCH AND HR PRACTICE: IMPROVING TEAM COMPOSITION, TEAM TRAINING, AND TEAM TASK DESIGN John R. Hollenbeck, D. Scott DeRue, and Rick Guzzo This article identifies a series of critical gaps between the scientific body o... Date Added: 2009-06-08 17:27:57 |
| HCI 440 FLUID Project 2.doc Path: DePaul >> HCI >> 440 Fall, 2009 Description: Dinner Splitter HCI 440 - Spring 2007 Project 2 For Lucid User Interface Design Julie Albrecht Lynette Morales Douglas Svehla Kurtis Todd Table of Contents Introduction..3 Usability Goals.4 Prioritized Feature List.4 Conceptual Model A..5 Pros and ... Date Added: 2009-06-08 17:45:04 |
| MATH107A38152086.doc Path: MD University College >> ASIA >> 2095 Fall, 2009 Description: MATH 107 College Algebra (3) (flex) Summer Session 1 2008-09 Yokota Air Base MW 1930 - 2210 University of Maryland University College Faculty Contact Information: Name - M. A. Tisher E-address - mtisher@asia.umuc.edu Cell Phone - 090-9574-4827 O... Date Added: 2009-06-08 17:45:24 |
| 1 Framework.pdf Path: Cal Poly Pomona >> COM >> 108 Fall, 2009 Description: COM 108 Framework Information Resources Books, journals, newspapers and periodicals, reports, archives, moving image media, electronic data-bases, Internet, people, observation. COM 108 FRAMEWORK (4) Audience Characteristics Mass, special interest, ... Date Added: 2009-06-08 17:46:39 |
| snapshots_logx.doc Path: NJIT >> CIS >> 602 Fall, 2009 Description: F(x) = logx+2^x*logx F(x) = x+2/4^3+logx F(x) = 2*logx*4+x F(x) = 2*x^2-x^5 F(x) = 2x-5^x+2/4 ... Date Added: 2009-06-08 17:47:35 |
| studyguide_test1_sp04.doc Path: Bowling Green >> CS >> 324 Fall, 2008 Description: CS 324 - Barnes Study Guide T1: 2/19/04 Test 1 - Usability Introduction (POET, History, Usability definitions and models) - Process of Usability Engineering - Early System Analysis Activities - Fatal Error Major points, terms and concepts 1. POET.... Date Added: 2009-06-08 17:50:12 |
| LectureNotes17.pdf Path: Utah >> MATH >> 5620 Spring, 2008 Description: ... Date Added: 2009-06-08 17:52:04 |
| section_24.pdf Path: Iowa State >> ENGR >> 101 Fall, 2008 Description: Engineering 101 - Section 24 Fall 2001 Attendance Open House X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X Career Fair X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X X UNIV... Date Added: 2009-06-08 17:56:04 |
| email0.txt Path: New Mexico >> ECE >> 542 Spring, 2008 Description: Subject: Huffman Encoder Date: Fri, 21 Feb 2003 03:16:34 -0700 From: \"BRADLEY M RATLIFF\" <bradratliff77@msn.com> To: \"Majeed Hayat\" <hayat@eece.unm.edu> Hi Majeed, Attached you will find an executable file called encoder.exe. This is my Huffman... Date Added: 2009-06-08 17:56:54 |
| faf0405050.pdf Path: LA Tech >> DOCS >> 0405 Fall, 2009 Description: Verification of Untaxed Income Dependent Student On your original application you reported a total of $_ of untaxed income received by you in 2003; and your parent(s) reported a total of $_ of untaxed income received by your parent(s) in 2003. On th... Date Added: 2009-06-08 18:00:44 |
| rtlt.pdf Path: Clemson >> ECE >> 496 Fall, 2009 Description: Real-Time Linux Target For Use with MATLAB, Simulink and Real-Time Workshop User\'s Guide Version 1.2 Table of Contents INTRODUCTION .. 5 TYPOGRAPHICAL CONVENTIONS. 6 GETTING STARTED .. 7 SYSTEM REQUIREMENTS . 7 INSTALLING RTLT.. 7 What is Included ... Date Added: 2009-06-08 18:17:20 |
| slac-pub-0726.pdf Path: Stanford >> PUBS >> 0500 Fall, 2009 Description: (Presented at the 12th Scintillation and Semiconductor Counter Symposium, Washington D.C., Mwch 11-13, 1970) SLAC-PUB-726 (MPI) and (EXP) August 1970 A WIRE SPARK CHAMBER SPECTROMETER WITH A CAPACITOR R. Piccioni MEMORY AND FET READOUT* R. Coomb... Date Added: 2009-06-08 18:20:33 |
| slac-pub-0722.pdf Path: Stanford >> PUBS >> 0500 Fall, 2009 Description: SLAC-PUB-722 April 1970 (TH) California 94720 Y. S. T... Date Added: 2009-06-08 18:20:33 |
| ex0314.txt Path: Minnesota >> STAT >> 3022 Fall, 2008 Description: \'Year\' \'Sales\' 2000 28.9 2001 35.9 2002 51.5 ... Date Added: 2009-06-08 18:23:17 |
| HMW6_Notes.doc Path: Rutgers >> SCILS >> 614 Fall, 2009 Description: Reuters\' collection Parsing: To parse document collection in its original format (Reuters29Orig.xml), I created the following parameter file: parse_reuters_param file: <parameters> <outputFile>reuters_ParserReuters_orig_stop</outputFile> <docFormat>... Date Added: 2009-06-08 18:31:55 |
| Lab_06_s07.pdf Path: Wittenberg >> P >> 200 Fall, 2009 Description: Physics 200 Lab 6: Passive Forces and Newton\'s Laws OBJECTIVES To explore tension forces and understand their origin. To apply Newton\'s laws of motion to mechanical systems that include tension. To incorporate frictional forces into Newton\'s first... Date Added: 2009-06-08 18:32:08 |
| 273st.doc Path: Arizona >> VAS >> 273 Fall, 2009 Description: SAMPLE QUESTIONS: Please note that the three questions below are generally more difficult than the exam questions, which is why these questions were not included on the exam (Answers appear at bottom of page). SAMPLE 1: A band of neighborhood kids li... Date Added: 2009-06-08 18:32:29 |
| Web sites[1].doc Path: N. Georgia >> JMHOLC >> 4035 Fall, 2009 Description: Janna Allen CSCI 1200 1. www.funbrain.com On this website the children can go to Change Maker and learn to make change using their brain instead of a calculator. 2. www.nasa.gov On this site students can read articles about space facts and/or play ga... Date Added: 2009-06-08 18:34:56 |
| HCI.pdf Path: Michigan >> SI >> 110 Fall, 2008 Description: Interfaces: Life at the Screen Goals of this module Defining interfaces as points of entry controlled gateways cultural/epistemological boundaries between different ways of seeing Elements of good interface design Good interfaces form junctions betw... Date Added: 2009-06-08 18:38:04 |
| Psychological Approach to Ethics.ppt Path: Minnesota >> MGTS >> 4461 Fall, 2009 Description: A Psychological Approach to Ethics Geoffrey G. Bell, PhD, CA University of Minnesota Duluth October, 2003 Sources for the lecture The text. Web site TBA. Frank, R.H. (1988). Passions within Reason: The strategic role of the emotions, W.W. Norton &... Date Added: 2009-06-08 18:39:35 |
| Activity.rtf Path: N. Georgia >> MAHOLT >> 7933 Fall, 2009 Description: GEORGIA ON MY MIND: Name:_ Date:_ Part 1) Complete all of the following questions with the correct answer. Utilize the webpage to answer them. 1. What is the state capital of Georgia? 2. What is the state bird of Georgia? 3. What is the state flower... Date Added: 2009-06-08 18:39:41 |
| Kevin Maxwell.doc Path: Georgia Tech >> CEE >> 200202 Fall, 2009 Description: Kevin Maxwell CEE 6120/Ind. Assn.2 February 8, 2002 Dr. Jorge Vanegas, I am pleased to be finished with my research of the assignment I was issued. My first step of the process was asking myself what exactly is rapid payback or a high Sustainability ... Date Added: 2009-06-08 18:45:01 |
| Chapter V.doc Path: Duke >> PPS >> 255 Fall, 2009 Description: ChapterVRecentDevelopments:ImpactofCurrentProposal ChapterV.RECENTDEVELOPMENTS: IMPACTOFCURRENTPROPOSAL CURRENTPROPOSEDPRIVACYREGULATIONS On March 21, 2002, the Bush Administration unveiled sweeping proposed changes to the PR, the comment period for... Date Added: 2009-06-08 18:49:16 |
| lecture26.pdf Path: Berkeley >> CS >> 164 Fall, 2008 Description: Lecture #26: Project Strategy class B (Object): m = 3 a1 = 3 def f1(x2, y2): b2 = False while y2 > 0: if b2: print a1 + x2 + d2 b2 = True d2 = b1.m y2 -= 1 b1: B b1 = B() Must process assignments to d2, b1 before can handle their (earlier) uses. B... Date Added: 2009-06-08 18:50:48 |
| Lecture 10 part 1.pdf Path: Sveriges lantbruksuniversitet >> C >> 122 Fall, 2009 Description: TODAY\'S LECTURE \"Chemical Equilibria\" Le Chtelier\'s Principle Effect of Catalysts 1 Le Chtelier\'s Principle \"When an equilibrium system is subjected to a change of conditions the system responds by attaining a new equilibrium that partially off... Date Added: 2009-06-08 18:52:15 |
| problem1_solution_step1.pdf Path: Utah State >> MATH >> 0900 Fall, 2008 Description: Quotient Rule Problem 1. Simplify the expression using the quotient rule. 39 36 Solution Step 1: Use the quotient rule for exponents. After this step, you should have: 33 ... Date Added: 2009-06-08 19:01:05 |
| finals_MET_321_S01_Condensed.doc Path: SDSMT >> MET >> 321 Fall, 2009 Description: South Dakota School of Mines and Technology Department of Materials and Metallurgical Engineering Met 321 Final Exam April 10, 2001 1a. What cell potential would be required to produce Mg(l) and Cl2(g) from MgCl2(l)? The activity of the MgCl2 is 0.5... Date Added: 2009-06-08 19:08:08 |
| lorentz.ps Path: Utah >> PHYCS >> 5110 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.60 Copyright 1986, 1996 Radical Eye Software %Title: lorentz.dvi %CreationDate: Fri Mar 23 09:58:50 2001 %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMBX12 CMR10 CMMI10 CMEX10 CMMI8 C... Date Added: 2009-06-08 19:18:55 |
| ele2300_exercices_final_solution_asynchrone.pdf Path: Cal Poly >> ELE >> 2300 Fall, 2009 Description: Solution asynchrone : On commence par une diagramme d\'tats : L = \'Loonie\', Q = \'Quarter\', T = \'Timeout\' On remplit la table de squences primaires : V = \'Vingt Minutes (+), C = \'Cinq Minutes (+)\', E = Expir (LED) tat A: Expir B: 1$ + 20 mins C: 25 +... Date Added: 2009-06-08 19:20:38 |
| CPT 450, Lecture 8.ppt Path: NJIT >> CPT >> 450 Fall, 2009 Description: CPT 450 Computer Graphics 8th Lecture Intro to Bitmap or Raster Images What is the difference between bitmap and vector graphics? A bitmap or raster image is a collection of pixels (picture element), each with its own independent color. A vector ... Date Added: 2009-06-08 19:21:19 |
| billy 2.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: PLANES Studying in school versus wathcing TV and becoming useless. B C A little brother nagging his older sibling, thinking he\'s right, the realizing the older sibling was just as right. B C Planting a garden with only one successful flower. ... Date Added: 2009-06-08 19:25:39 |
| RWECch1.pdf Path: Appalachian State >> READ >> 3030 Fall, 2009 Description: g About Readingand Writing .1o o k i n g Aheod sesss The next nine chapters of Reading and writing in Elementary classrooms will descibe the maior components of effective reading and. writing instruction, the theoretical ... Date Added: 2009-06-08 19:36:53 |
| danda-quality.ppt Path: E. Kentucky >> EECS >> 814 Fall, 2009 Description: Philip Crosby Presented by Matt Danda EECS814 Fall 2007 1 Agenda Introduction to Phil Crosby Definition of Quality Quality Improvement Program Managing Quality in the 21st Century 2 Biography of Phil Crosby June 18, 1926- August 18, 2001 On... Date Added: 2009-06-08 19:37:03 |
| electric_light.pdf Path: Roanoke >> HNRS >> 301 Fall, 2009 Description: Electric Light Extravaganzas 1. Public communication was the norm. Private/intimate communication was new. Public ceremonies and gatherings were common. Theater and a demonstration of vested power. Note that textual knowledge was not required. Why ar... Date Added: 2009-06-08 19:43:13 |
| Timeline.doc Path: Rutgers >> MID >> 425 Fall, 2009 Description: 1914 Early Anime/Silent Films http:/www.animeinfo.org/animeu/hist101-l1.html 1963 Astro Boy http:/home.alphalink.com.au/~roglen/astroboy.htm Copyright Osamu Tezuka 1967 Speed Racer http:/www.speedracer.com Copyright Tatsuo Yoshida and Tatsunoko Produ... Date Added: 2009-06-08 19:46:02 |
| PDD601_Summer09_syllabus.doc Path: Cleveland State >> UST >> 601 Fall, 2009 Description: Applied Quantitative Reasoning I Maxine Goodman Levin College of Urban Affairs Cleveland State University Date/Time: Monday/Wednesday, 6:00 PM 9:00PM Location: UR 108 (Lecture) and UR 39 (SPSS Lab) College of Urban Affairs Instruct... Date Added: 2009-06-08 19:51:10 |
| ust601_class_roster2.xls Path: Cleveland State >> UST >> 601 Fall, 2009 Description: CSU ID . 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 PAD/PDD/UST 601 Applied Quantitative Reasoning I, Fall 2006, Instructor: Dr. Sugie Lee NAME Aug. 29 Sep. 5 Sep. 12 ... Date Added: 2009-06-08 19:51:11 |
| hw6.pdf Path: Washington >> UW >> 351 Fall, 2009 Description: y w xw y 0 b!y w y w Aa2 x u x y w 3u q0fq yx 6w v4t #\") sr E #\" 7 # \'7) # 7 8uAT@H$13`q1p)$I`$8ihgf$a3@P1H % d \" \' ) THe4B`$b4cb4Q7a`Y@#ETHXW3@#VH@EETRH%D3$\"S1RHQPI@IAG1@5$$!D$BA@9$86!3210(\' # H ... Date Added: 2009-06-08 19:51:34 |
| naked heme.pdf Path: Sveriges lantbruksuniversitet >> C >> 333 Fall, 2009 Description: ... Date Added: 2009-06-08 19:59:15 |
| New light on a Greek city.pdf Path: East Los Angeles College >> CORP >> 0057 Fall, 2009 Description: Universit degli Studi G. d\'Annunzio di Chieti Dipartimento di Scienze dell\'Antichit Cirenaica: studi, scavi e scoperte Atti del X Convegno di Archeologia Cirenaica Chieti 24-26 Novembre 2003 Nuovi dati da citt e territorio a cura di Emanuela Fabbri... Date Added: 2009-06-08 20:10:28 |
| GDPGrowth.doc Path: Western Kentucky University >> ONLINE >> 203 Fall, 2009 Description: INTRODUCTION Economists are decidedly less rosy in their outlooks than they were earlier this summer, but still expect growth to pick up by year end. The 55 economists queried in the August forecasting survey on average expect GDP growth of 3.8% in t... Date Added: 2009-06-08 20:14:16 |
| lecture13.pdf Path: Montana >> PHYS >> 311 Fall, 2008 Description: Lecture 13 The Origin of Our Solar System A planet orbiting in triple star system HD 188753 (JPL) Guiding Questions 1. 2. 3. 4. 5. 6. Why are some elements (like gold) quite rare, while others (like carbon) are more common? How do we know the age o... Date Added: 2009-06-08 20:16:28 |
| Review Items.doc Path: RIT >> P >> 08005 Fall, 2009 Description: KGCOE MSD Meeting Purpose (clearly state objectives of the meeting): Technical Review Materials Reviewed (list all documents reviewed at the meeting including revision): Attendees (name and discipline / role of all participants): Recorded by (nam... Date Added: 2009-06-08 20:20:30 |
| hw5a.pdf Path: CSU Channel Islands >> MATH >> 162 Fall, 2009 Description: ... Date Added: 2009-06-08 20:21:17 |
| save.txt Path: Midwestern State University >> CS >> 442 Fall, 2009 Description: donut.png 400 400 1 0.9 0.9 0 1 2 5 200 10 300 50 250 300 120 380 60 40 4 90 190 200 180 300 120 100 110 ... Date Added: 2009-06-08 20:22:24 |
| starhole.txt Path: Midwestern State University >> CS >> 442 Fall, 2009 Description: donut.png 400 400 1 0.9 0.9 0 1 2 5 200 10 300 50 250 300 120 380 60 40 4 90 190 200 180 300 120 100 110 ... Date Added: 2009-06-08 20:22:24 |
| 110-haiku.DOC Path: MN State >> CCGE >> 110 Fall, 2009 Description: MDS 110 / Frederickson HAIKU SHIKI (1867-1902) What a wonderful day! No one in the village doing anything. ASSIGNMENT: Begin with a general statement, then give a surprising reason for it-\"How happy I am! I couldn\'t go / to sleep last night\"; \"New... Date Added: 2009-06-08 20:23:00 |
| lec12_99.doc Path: Wisconsin >> AAE >> 760 Fall, 2009 Description: AAE 760 DynamicNaturalResource Economics Lectures 12 Bang-Bang Control and Most Rapid Approach Paths Often problems which are linear in the control variable are characterized by BangBang solutions in which at the optimum, the control variable is eit... Date Added: 2009-06-08 20:25:29 |
| Chapter 11 Model Selection.doc Path: UNC Wilmington >> ECN >> 422 Fall, 2009 Description: 63 Chapter 11 Model Selection: Criteria & Tests Specification bias (error) An incorrect model has been estimated. A better model can be estimated. Chapter outline 1) Attributes of a good or correct model 2) Possible types of specification errors 3)... Date Added: 2009-06-08 20:30:31 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
