Course Solutions And Notes - 070105PolymersGrizzell 25
| BUS3500ReviewExam1-F08.ppt Path: N.E. Illinois >> BUS >> 3500 Fall, 2009 Description: Review For Exam 1 (September 16, 2008) BUS3500 Abdou Illia, Fall 2008 1 Introduction to Information Systems 2 Summary Questions Notes 1) Distinguish between Data and Information 2) List/Explain main components of an information... Date Added: 2009-06-01 16:49:09 |
| 5230-EnergySummary.ppt Path: N.E. Illinois >> UX >> 5230 Fall, 2009 Description: Sum ar y of m Exer ci se M abol i sm et PED 5230 ATP- PC Gl ycol ysi s Gl ucose Fat t y Aci ds Bet a Ox i d Oxygen Fat t y Aci ds Aer obi c M abol i sm et Fat t y Aci ds Oxygen Gl ucose Exer c i s e M abol i s m and et Spec i f i c i t y ... Date Added: 2009-06-01 16:49:46 |
| Rethinking%20Metasearch%20for%20a%20Better%20User%20Experience%202.ppt Path: Rochester >> DOCUMENT >> 22360 Fall, 2009 Description: Rethinking Metasearch for a Better User Experience David Lindahl Director of Digital Library Initiatives dlindahl@library.rochester.edu Jeff Suszczynski Senior Web Developer jeffs@library.rochester.edu 1 Design Process Digital Initiatives Unit So... Date Added: 2009-06-01 16:52:07 |
| Resume.doc Path: St. Norbert >> CS >> 460 Fall, 2009 Description: 1861 Shelley Ln. De Pere, WI 54115 Matthew S. Frohliger Education (920) 336-2756 matthew.frohliger@snc.edu B.S. in Computer Science St. Norbert College (completed in May 2005) De Pere, WI Subjects studied include (but are not limited to) operatin... Date Added: 2009-06-01 16:54:14 |
| lec0.txt Path: CUNY Baruch >> CS >> 3157 Fall, 2009 Description: lecture #0 january 24 course intro - web page: http:/www1.cs.columbia.edu/~cs3157 - labs: coms-w3257-002: wed 10.25am-12.25pm, in the clic lab (486 CSB) coms-w3257-001: wed 12.25pm-2.25pm, in the clic lab (486 CSB) - the first lab will... Date Added: 2009-06-01 16:55:03 |
| Acceleration_and_You.doc Path: USF >> RET >> 2004 Fall, 2009 Description: Acceleration and You Introduction: Acceleration is the term used when an object changes its speed. The object can either speed up (positive acceleration) or slow down (negative acceleration).Because acceleration has a direction and a magnitude it is ... Date Added: 2009-06-01 16:56:27 |
| goofy.ppt Path: USF >> SS >> 799 Fall, 2009 Description: The History of Goofy Presented by Jayme Johnson 1932-The character who would later become Goofy makes his first on-screen appearance in Mickeys Revue. The only thing that remained from this earliest version of Goofy is his distinctive laugh. Goofy... Date Added: 2009-06-01 16:57:19 |
| find_it_1.doc Path: Ohio State >> ENGLISH >> 110 Fall, 2009 Description: Research Strategy: Using Finding Aids In this exercise, you will be: 1. Performing searches using Google 2. Identifying which category (background information, indepth information, facts and data, news and opinion, multimedia) your search results fa... Date Added: 2009-06-01 17:01:08 |
| chap6.ppt Path: Ohio State >> FILES >> 531 Fall, 2009 Description: Tables,QueriesandReports Load Transaction (Event) data and Master (Agents, Products/Services) data into separate tables Database Management System (DBMS) allows us to request information via a query These queries and tables can be the source of repor... Date Added: 2009-06-01 17:01:30 |
| BMI731_W2005-03-haplotype.ppt Path: Ohio State >> BMI >> 731 Fall, 2009 Description: BMI 731- Winter 2005 Haplotype reconstruction Catalin Barbacioru Department of Biomedical Informatics Ohio State University The problem We start with a collection of genotypes in the form of allelic determinations at tightly linked single nucleot... Date Added: 2009-06-01 17:01:45 |
| studyguide2ndtest.doc Path: W. Carolina >> PE >> 650 Fall, 2008 Description: PE 650 STUDY GUIDE FOR 2nd TEST Chapter 15 Anatomy of heart diastolic How controlled by vessels (vasoconstriction) During exercise Hypertension Capillary blood flow Venous return-... Date Added: 2009-06-01 17:02:09 |
| trigonometricfunctions.doc Path: Humboldt State University >> CMB >> 89 Fall, 2009 Description: Trigonometric Functions There are six trigonometric functions: sine (sin), cosine (cos), tangent (tan), cotangent (cot), secant (sec) and cosecant (csc). The three major trigonometric functions (sin, cos, tan) each have their own keys. However, the t... Date Added: 2009-06-01 17:02:46 |
| ch7notes.doc Path: Humboldt State University >> BA >> 250 Fall, 2008 Description: BA 250 Chapter 7 Inventory 1. Chapter 7 Learning Objectives 0. Define the key information needs of decision makers regarding inventory. 1. Account for common inventory transactions. 2. Apply the four major inventory costing methods. 3. Apply the lowe... Date Added: 2009-06-01 17:03:39 |
| SBP.ppt Path: George Mason >> OR >> 680 Spring, 2008 Description: Project Proposal Nathan Annis OR680/SYST798 2 February 2006 Ukrop\'s Dress Express Overview Sister Company of Ukrop\'s Supermarkets Located in Richmond Products Over $8 million in 2005 sales Clients such as Ukrops, Supervalu, Harris ... Date Added: 2009-06-01 17:06:24 |
| Lecture12_Ionosphere.ppt Path: George Mason >> CSI >> 12 Fall, 2009 Description: Topics in Space Weather Lecture 12 Ionosphere Robert R. Meier School of Computational Sciences George Mason University rmeier@gmu.edu CSI 769 22 November 2005 1 Topics Photoionization Chapman Layer Ionospheri... Date Added: 2009-06-01 17:08:12 |
| Lecture12_Ionosphere.ppt Path: George Mason >> CSI >> 769 Fall, 2008 Description: Topics in Space Weather Lecture 12 Ionosphere Robert R. Meier School of Computational Sciences George Mason University rmeier@gmu.edu CSI 769 22 November 2005 1 Topics Photoionization Chapman Layer Ionospheri... Date Added: 2009-06-01 17:08:12 |
| Manual_Lab1-6.doc Path: George Mason >> ASTR >> 112 Fall, 2008 Description: Name: 1 ASTRonomy 112 Laboratory Manual Fall 2005 Department of Physics and Astronomy George Mason University Name: 2 Name: 3 Table of Contents LABORATORY SAFETY AND CONDUCT RULES 1 Mathematical Tools 2 The Celestial Sphere 3 Kepler\'s Laws of ... Date Added: 2009-06-01 17:09:25 |
| JBreault-PowerPoint.ppt Path: George Mason >> I >> 2001 Fall, 2009 Description: Data Mining Diabetic Databases Are Rough Sets a Useful Addition? Joseph L. Breault, MD, MS, MPH joebreault@tulanealumni.net Tulane University (ScD student) Department of Health Systems Management & Alton Ochsner Medical Foundation Department of Famil... Date Added: 2009-06-01 17:09:42 |
| rarecats4.ppt Path: George Mason >> ASTR >> 113 Spring, 2008 Description: Stars EdwardMurphy RARECATS Summer2001 04/29/09 RARE CATS 1 StellarLuminosity Theluminosityofastaristherateat whichitisgivingoffenergy. Notallstarshavethesameluminosity. Theyrangefrom1/20to700,000timesthe luminosityoftheSun. Luminosityvarieswit... Date Added: 2009-06-01 17:10:58 |
| ex1_05.doc Path: George Mason >> GEOG >> 585 Fall, 2008 Description: GEOG 585 Quantitative Methods (This assignment worth 10 points out of the total 50) Assignment #1 Descriptive Statistics Download the Washington, DC data (in shapefile format, but zipped) from the course website. Unzipped the file to obtain the set o... Date Added: 2009-06-01 17:11:16 |
| PUBP781.doc Path: George Mason >> APR >> 06 Fall, 2009 Description: George Mason University Graduate Course Approval/Inventory Form Please complete this form and attach a copy of the syllabus for new courses. Forward it as an email attachment to the Secretary of the Graduate Council. A printed copy of the form with s... Date Added: 2009-06-01 17:13:16 |
| 301209.doc Path: George Mason >> SYLLFALL >> 04 Fall, 2009 Description: PSYCHOLOGY 301 LAB SYLLABUS RESEARCH METHODS IN PSYCHOLOGY Fall 2004; Thursdays 8.30am 10.20am (Section 209); 10.30am 12.20pm (Section 210) Innovation Hall, Room 333 Instructor: Susan C. Han Email: shan8@gmu.edu Office: Thompson Hall, Room 131 Offi... Date Added: 2009-06-01 17:13:17 |
| BOVMay15,2002.doc Path: George Mason >> DOCUMENT >> 5406 Fall, 2009 Description: LAND USE AND PHYSICAL FACILITIES COMMITTEE BOARD OF VISITORS May 15, 2002 AGENDA I. II. Call to Order Committee Meeting Minutes of March 20, 2002 are included in the full Board Minutes A-3 thru A-4. Old Business A. GMU Foundation Building at Arling... Date Added: 2009-06-01 17:13:21 |
| hw11.doc Path: Berkeley >> CS >> 150 Fall, 1996 Description: University of California at Berkeley College of Engineering Department of Electrical Engineering and Computer Sciences EECS150 Fall 2002 Homework #11 This homework is due on Tuesday Dec 3rd by 2pm. Homework will be accepted in the EECS150 homework bo... Date Added: 2009-06-01 17:16:18 |
| pilot_sup.doc Path: Berkeley >> CS >> 10 Fall, 1931 Description: Critical Incident Log 1. User clicks on the name of an episode in an attempt to expand a menu and instead plays the video. 2. User cannot find the plot summary even though it is on screen because it does not have a label. 3. User uses the browsers ba... Date Added: 2009-06-01 17:17:33 |
| pilot_sup.doc Path: Berkeley >> CS >> 160 Fall, 1931 Description: Critical Incident Log 1. User clicks on the name of an episode in an attempt to expand a menu and instead plays the video. 2. User cannot find the plot summary even though it is on screen because it does not have a label. 3. User uses the browsers ba... Date Added: 2009-06-01 17:17:33 |
| hw1.doc Path: Berkeley >> EE >> 40 Spring, 2007 Description: EE 40 Homework #1 Due February 4, 2003 Problem 1: 6 Points Possible Prof. Ross\'s lovely blue Honda Civic has a dead battery. A passerby offers to recharge her battery using his car battery. Unfortunately, he is one of the thousands of people in the B... Date Added: 2009-06-01 17:19:21 |
| assembler-instructions.txt Path: Berkeley >> CS >> 61 Fall, 2004 Description: File format: The input file consists of assembler commands delimited by newline characters. Legal assembler commands are: or REG, REG, REG add REG, REG, REG and REG, REG, REG sub REG, REG, REG lw REG, IMM sw REG, IMM lui REG, IMM ori REG, IMM j <LA... Date Added: 2009-06-01 17:19:46 |
| L18-ddg-singlecpu-control.ppt Path: Berkeley >> CS >> 61 Fall, 2004 Description: inst.eecs.berkeley.edu/~cs61c CS61C : Machine Structures Lecture #18 Single Cycle CPU Control CPS today! 2005-11-02 There is one handout today at the front and back of the room! Lecturer PSOE, new dad Dan Garcia www.cs.berkeley.edu/~ddgarcia Data... Date Added: 2009-06-01 17:19:51 |
| solutionhw6_cs188.doc Path: Berkeley >> CS >> 188 Spring, 2004 Description: Classification Homework Solution CS188 Spring 2007 1.1 For digits: Doing classification -Not doing odds ratio computation. data: digits classifier: naivebayes feature extractor: basic training set size: 100 Extracting features. Training. Validating. ... Date Added: 2009-06-01 17:21:05 |
| week12.doc Path: Berkeley >> CS >> 188 Spring, 2004 Description: CS188 Discussion Unsupervised Learning Wed 04/11 By Nuttapong Chentanez Unsupervised learning - Aka. Clustering - Detect patterns in unlabeled data Eg. group emails or search results - Useful when don\'t know what you\'re looking for - Require data but... Date Added: 2009-06-01 17:21:06 |
| lecture20_2.ppt Path: Berkeley >> EE >> 122 Spring, 2006 Description: EE 122: HyperText Transfer Protocol (HTTP) Ion Stoica Nov 25, 2002 Background World Wide Web (WWW): a set of cooperating clients and servers that communicate through HTTP HTTP history - First HTTP implementation - 1990 Tim Berners-Lee at CERN - ... Date Added: 2009-06-01 17:21:12 |
| week1_presentation.ppt Path: Berkeley >> EE >> 198 Fall, 2009 Description: Digital EECS98/198 Photography Nathan Yan DeCal About this course -Technology of Camera Systems -Photographic Technique -Digital Lightroom About Me ^-doesn\'t know anything about what he\'s talking about About You In case you were wondering, this is ... Date Added: 2009-06-01 17:22:30 |
| 0212-IanHaken.txt Path: Berkeley >> CS >> 162 Fall, 2008 Description: -CS 162 Notes 2/12/07- -Topics- -Process Syncronization with Condition Variables- -Linkers and Loaders- -Dynamic Storage Allocation- -Sharing Main Memory- -Process Syncronization with Condition Variables- /Condition Variables Threads cooperat... Date Added: 2009-06-01 17:22:33 |
| sc1.ppt Path: Berkeley >> MCB >> 140 Fall, 2008 Description: Question What is the chemical nature of the repressor? 1 MCB 140 11/8/2006 If you think about it . The repressor has to directly bind to a specific DNA sequence (the operator) in the E. coli genome. From a reverse-engineering perspective, the sim... Date Added: 2009-06-01 17:22:54 |
| img_history.txt Path: Berkeley >> ASTRO >> 00306793 Fall, 2009 Description: Version: 2.2 (Tue Mar 25 04:34:45 UTC 2008) Using 964 Counts, Exposure [s]= 40108.46 XRT/DSS Frame Offset: RA -1.600 , Dec -0.200 , 90% Conf. Error: 2.560 Using 8 X-ray Sources and 10 DSS Sources DSS Refined RA, Dec: 06 37 53.55 +23 56 34.6 ; 90% ... Date Added: 2009-06-01 17:24:13 |
| lect1.ppt Path: Berkeley >> UGBA >> 103 Fall, 2008 Description: Cor por at e Fi nance I ns t r uct or : Pr of essor Jonat han Ber k Em l : ai berk@berkeley.edu W W Hom Page: W e faculty.haas.berkeley.edu/berk/teaching/ugba103/ugba103.html GSI s There are three GSIs for this course Sara Holland (Sections 1&2) ... Date Added: 2009-06-01 17:24:35 |
| NP-Completeness.ppt Path: Berkeley >> CS >> 302 Fall, 2009 Description: NPCompleteness Lecture for CS 302 Traveling Salesperson Problem You have to visit n cities You want to make the shortest trip How could you do this? What if you had a machine that could guess? Nondeterministic polynomial time ... Date Added: 2009-06-01 17:26:00 |
| slides.ppt Path: Berkeley >> CS >> 294 Fall, 1924 Description: Active Learning, Experimental Design CS294 Practical Machine Learning April 29, 2008 Alex Shyr Original Slides by Barbara Engelhardt Motivation Unlabeled data abundant, but labels expensive Can query the world for labels Want to choose which data... Date Added: 2009-06-01 17:28:28 |
| sov_reg_g00.doc Path: Berkeley >> D >> 00 Fall, 2008 Description: V Variable CNTY SSPREC TOTREG TOTVOTE PR32Y PR32N PR33Y PR33N PR34Y PR34N PR35Y PR35N PR36Y PR36N PR37Y PR37N PR38Y PR38N PR39Y PR39N PRSDEM PRSREP PRSGRN PRSNLP PRSLIB PRSAIP PRSREF USSDEM USSREP USSAIP USSLIB USSNLP USSREF USSGRN CDDIST CNGDEM CNGR... Date Added: 2009-06-01 17:30:24 |
| sov_reg_g00.txt Path: Berkeley >> D >> 00 Fall, 2008 Description: V Variable CNTY SSPREC TOTREG TOTVOTE PR32Y PR32N PR33Y PR33N PR34Y PR34N PR35Y PR35N PR36Y PR36N PR37Y PR37N PR38Y PR38N PR39Y PR39N PRSDEM PRSREP PRSGRN PRSNLP PRSLIB PRSAIP PRSREF USSDEM USSREP USSAIP USSLIB USSNLP USSREF USSGRN CDDIST CNGDEM CNGR... Date Added: 2009-06-01 17:30:25 |
| NSPO_Proposal_Rev43.doc Path: Berkeley >> PLASMA >> 2 Fall, 2009 Description: 14 December, 2001 Stephen Mende UNIVERSITY OF CALIFORNIA Space Sciences Laboratory Centennial Drive at Grizzly Peak Blvd. Berkeley, CA 94720-7450 Tel: 510-642-0876 Dr. Yeou-Shin Chang ISUAL Project Manager National Space Programs Office, National S... Date Added: 2009-06-01 17:33:03 |
| ISUAL_PFR_1.doc Path: Berkeley >> PLASMA >> 2 Fall, 2009 Description: Report of Problem or Non-Conforming Material PFR-000 <Title> <Component> <Event Date> PFR-000 <Title> Originator: E-mail Address: Date: Assembly Dwg No: Part Dwg No : Failure Occurred During (Check one ) Initial Assembly or Inspection Ambient Therma... Date Added: 2009-06-01 17:33:20 |
| hw1.txt Path: UCF >> AST >> 2002 Fall, 2008 Description: UCF AST 2002H Sec 0201 Spring 2009 Partial solutions to homework #1 1. B. If Earth were a basketball, the Moon would be best portrayed with a baseball rather than a soccer ball, ping-pong ball, pea, or grain of sand. Although depending on what you... Date Added: 2009-06-01 17:36:56 |
| Compare.ppt Path: UCF >> EAS >> 5157 Fall, 2009 Description: Comparisons between the Momentum Theory (Disc Model) & Blade Element Model Flow Field Momentum Theory Blade Element Model Disc Uniform Non-uniform Thrust Momentum Theory Blade Element Model T = 2 A(Vc + vi ) vi i = CT 2 CT = 2i 1 1 2 CT = C ... Date Added: 2009-06-01 17:37:44 |
| Hw1_results.txt Path: UCF >> EEL >> 3470 Fall, 2008 Description: Hw1_P1 Problem 1, part(1), Lonngren 1.1.1 C = A+B C = -2 8 2 D = A-B D = 8 0 8 Problem 1, part(2), Lonngren 1.1.2 A.B A_dot_B = -14 A X B A_cross_B = -32 -16 32 Problem 1, part(3) Angle between A and B ... Date Added: 2009-06-01 17:38:46 |
| Student_Relations-Dunn.ppt Path: UCF >> SESSION >> 4 Fall, 2009 Description: Relationship Rescue: Coping with Conflict in the Classroom A Presentation for the Faculty Center for Teaching and Learning Winter Conference 2003 Stacey Tantleff Dunn, Ph.D. Associate Professor Department of Psychology University of Central Florida ... Date Added: 2009-06-01 17:41:15 |
| intro.ppt Path: Berkeley >> ME >> 012099 Spring, 2009 Description: ME39C Multimedia Case Studies of Engineering Design Alice Agogino Associate Dean for Special Programs, College of Engineering Professor of Mechanical Engineering Brandon Muramatsu Lecturer in Mechanical Engineering NEEDS Project Director Universit... Date Added: 2009-06-01 17:41:53 |
| intro.ppt Path: Berkeley >> ME >> 39 Fall, 2008 Description: ME39C Multimedia Case Studies of Engineering Design Alice Agogino Associate Dean for Special Programs, College of Engineering Professor of Mechanical Engineering Brandon Muramatsu Lecturer in Mechanical Engineering NEEDS Project Director Universit... Date Added: 2009-06-01 17:41:53 |
| lec16.ppt Path: Berkeley >> CS >> 150 Fall, 1996 Description: EECS 150 - Components and Design Techniques for Digital Systems Lec 16 Storage: DRAM, SDRAM David Culler Electrical Engineering and Computer Sciences University of California, Berkeley http:/www.eecs.berkeley.edu/~culler http:/www-inst.eecs.berkeley... Date Added: 2009-06-01 17:42:23 |
| i-ch4.doc Path: Berkeley >> BA >> 128 Spring, 2009 Description: Chapter I4 Gross Income - Exclusions Discussion Questions I4-1 The IRS and the courts must interpret the tax law passed by Congress. The efforts of the IRS and the courts may result in broad definitions of certain exclusions. Such broad definitions m... Date Added: 2009-06-01 17:44:21 |
| staplesgarvey.doc Path: MTSU >> ERA >> 7 Fall, 2009 Description: From www.pbs.org/greatspeeches/timeline/index.html Marcus Garvey calls for the establishment of a separate black nation, New York, NY, August 1, 1924. Delegates to the Fourth International Convention of the Negro Peoples of the World, ladies and gent... Date Added: 2009-06-01 17:45:26 |
| Chap013436.ppt Path: MTSU >> EF >> 32 Fall, 2009 Description: Chapter Thirteen Managing Nondeposit Liabilities and Other Sources of Borrowed Funds McGraw-Hill/Irwin 2008 The McGraw-Hill Companies, All Rights Reserved Customer Relationship Doctrine The First Priority of the Bank is to Make Loans to All Qualifi... Date Added: 2009-06-01 17:45:31 |
| Chap013436.ppt Path: MTSU >> EF >> 4360 Fall, 2009 Description: Chapter Thirteen Managing Nondeposit Liabilities and Other Sources of Borrowed Funds McGraw-Hill/Irwin 2008 The McGraw-Hill Companies, All Rights Reserved Customer Relationship Doctrine The First Priority of the Bank is to Make Loans to All Qualifi... Date Added: 2009-06-01 17:45:31 |
| Europe_04_PrimogenMurdered.doc Path: MTSU >> CLE >> 2 Fall, 2009 Description: I knew where the Toreador Primogen\'s place was so, I took a different route and tried to beat Akira and Lance there. I parked my bike down an Alleyway and hid using my obfuscate and quietus with my camera at the ready. Lance and Akira made it there s... Date Added: 2009-06-01 17:45:39 |
| SP25-ForkJoin.ppt Path: University of Illinois, Urbana Champaign >> CS >> 232 Fall, 2008 Description: (Easily) Exposing Threadlevel Parallelism Previously, we introduced MultiCore Processors - and the (atomic) instructions necessary to handle data races Today, a simple approach to exploiting one kind of parallelism. - Data vs. Control Parallelism -... Date Added: 2009-06-01 17:47:26 |
| exam2.doc Path: University of Illinois, Urbana Champaign >> ECE >> 390 Fall, 2008 Description: ECE291 Computer Engineering II Potts, Summer 2001 ECE291 Exam 2 Thursday July 26, 2001 200 Points For this exam, you are permitted to use any resource on the ECE291 website that requires no authentication. This includes lecture notes/slides, anyth... Date Added: 2009-06-01 17:48:40 |
| Fall_2007_Exam_2_Answers.doc Path: University of Illinois, Urbana Champaign >> MCB >> 421 Fall, 2008 Description: MCB 421 Exam #2 Fall 2007 There are 6 questions Be sure your name is on each page 1. 3. (10 points) You have a strain of Salmonella typhimurium that contains the plasmid pBR322. pBR322 carries a gene than encodes resistance to ampicillin (AmpR). Th... Date Added: 2009-06-01 17:49:02 |
| assignments.doc Path: University of Illinois, Urbana Champaign >> CI >> 336 Fall, 2009 Description: C&I 336 Spring 2004 Reese www.mste.uiuc.edu/courses/ci336sp04/ Assignments Weekly post to Math Tools and presentation of a Math tool to the class. Step1: Become a member of Math Tools http:/mathforum.org/mathtools/mytools/, subscribe to as many ema... Date Added: 2009-06-01 17:49:23 |
| Caches.ppt Path: University of Illinois, Urbana Champaign >> CS >> 232 Fall, 2008 Description: Timeforlwandsw Memoryhasmuchmoredelay Accessingmainmemory:100200cycles! Nochoice:stall(orincreasecycletime) Sowhybothersaving1measlycycleforcontrol/datahazards? 1 Answer:Caches! Hit cost % Avg.cost 1 99 Miss 100 1 2 Whycacheswork Programse... Date Added: 2009-06-01 17:50:43 |
| cs411-concurrency-others.ppt Path: University of Illinois, Urbana Champaign >> CS >> 411 Fall, 2008 Description: CS411 Database Systems 14: Concurrency Control Kazuhiro Minami Announcements Homework 5 is out. The due date is Dec 2. Donna\'s office has changed to 2106 Please NOT fill out ICES on-line evaluations Everything is recorded under Prof. Winslett nam... Date Added: 2009-06-01 17:51:02 |
| P04.doc Path: University of Illinois, Urbana Champaign >> PLOP >> 98 Fall, 2009 Description: Time Patterns Submission for EuroPLoP \'98 Time Patterns Author: Manfred Lange Hewlett-Packard GmbH NSL (Network Support Lab) Herrenberger Str. 130 71034 Boeblingen e-mail: Manfred_Lange@hp.com Abstract Many systems need to deal with time. Time can... Date Added: 2009-06-01 17:51:33 |
| Psych235_Lecture1_080114web.ppt Path: University of Illinois, Urbana Champaign >> P >> 235 Fall, 2009 Description: Psyc 235: Introduction to Statistics Lecture: Tuesday 10:30-11:45 12:00-1:15 Office Hours: Thursday 10:30-1:15 (Room 35) Instructors: Jason Finley & Melinda Jensen Jamie Marcus (Sections: AB2, AB3, BB3, BB4) Email: psyc235spring2008jm@gmail.com Chun... Date Added: 2009-06-01 17:52:38 |
| AtlantisSol.doc Path: University of Illinois, Urbana Champaign >> SHELLEY >> 1 Fall, 2009 Description: Atlantis Corporation The Atlantis Corporation makes and sells boots and coats. The following budgeted revenue and cost information from the company\'s activity-based costing system is available for 2001. Boot Division Revenues ($62.50 x 2,000; $100 x ... Date Added: 2009-06-01 17:54:31 |
| ._cpp_Design_040923.doc Path: University of Illinois, Urbana Champaign >> HDF >> 5 Fall, 2009 Description: # #2# #R#W8BNMSWD# # ## # # ... Date Added: 2009-06-01 17:55:23 |
| lec1003.ppt Path: University of Illinois, Urbana Champaign >> CS >> 173 Fall, 2008 Description: CS 173: Discrete Mathematical Structures C inda He re e n he re cs.uiuc.e e n@ du Rm2213 S be C nte ie l e r OfficeHours: W 9:30-11:30a CS 173 Announcements Midte 1: 10/05/06, 7-9p, location on we rm b. C on Thursday cance d. lass lle S ctions this ... Date Added: 2009-06-01 17:56:04 |
| assign5.txt Path: Cincinnati >> STAT >> 2005 Fall, 2009 Description: SAS PROGRAMMING TEST #1 February 11, 2005 NAME _ SHOW ALL YOUR WORK 1) Suppose the following data has been saved as: HW21.TXT on A:\\ 01/01/20... Date Added: 2009-06-01 18:01:08 |
| assign5.txt Path: Cincinnati >> STAT >> 534 Fall, 2009 Description: SAS PROGRAMMING TEST #1 February 11, 2005 NAME _ SHOW ALL YOUR WORK 1) Suppose the following data has been saved as: HW21.TXT on A:\\ 01/01/20... Date Added: 2009-06-01 18:01:08 |
| xxiii.ppt Path: University of Illinois, Urbana Champaign >> EEE >> 105 Fall, 2009 Description: Oceans Oceans cover 70% of the planets surface Ocean circulation Currents Surface currents Ocean circulation Clockwise in northern hemisphere Ocean circulation currents Ocean circulation Currents Oceans are a gigantic heat sink currents ... Date Added: 2009-06-01 18:02:35 |
| assign3.txt Path: Cincinnati >> SAS >> 1999 Fall, 2009 Description: SAS PROGRAMMING II ASSIGNMENT #3 Consider the following data set: 747 RALEIGH ATLANTA 7:20 8:30 534 ATLANTA TAMPA 9:30 10:30 149 TAMPA CHICAGO 12:00 13... Date Added: 2009-06-01 18:04:07 |
| assign3.txt Path: Cincinnati >> SAS >> 535 Fall, 2009 Description: SAS PROGRAMMING II ASSIGNMENT #3 Consider the following data set: 747 RALEIGH ATLANTA 7:20 8:30 534 ATLANTA TAMPA 9:30 10:30 149 TAMPA CHICAGO 12:00 13... Date Added: 2009-06-01 18:04:07 |
| 13.Mutex.ppt Path: University of Illinois, Urbana Champaign >> CS >> 241 Spring, 2008 Description: 04/30/09 CS241 2006 RHC and YZ, All Rights Reserved 1 CS 241 Fall 2006 System Programming More on Thread Synchronization CS 241 Lecture 13 (R: Chapter 13 pp 447-472, p487-501) Roy Campbell 04/30/09 CS241 2006 RHC and YZ, All Rig... Date Added: 2009-06-01 18:05:43 |
| lecture24_handout.ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 101 Fall, 2008 Description: Final q Today\'s Physics 101: Lecture 24 Ideal Gas Law and Kinetic Theory lecture will cover Textbook Chapter 13.5-13.8 Physics 101: Lecture 24, Pg 1 Molecular Picture of Gas q Gas is made up of many individual molecules Number density is number... Date Added: 2009-06-01 18:06:00 |
| Ch8Read.txt Path: UNF >> CH >> 2220 Fall, 2009 Description: The programs in this chapter run without modification runs as presented in the text with the exception of Program 8. It needs to be modified to include defined constants for TRUE and FALSE on the Borland compiler. Program 5 has been combined with pro... Date Added: 2009-06-01 18:07:37 |
| bcn4562-2005fall-ServicePanel.ppt Path: UNF >> BCN >> 4562 Fall, 2008 Description: How to Wire a Service Panel Evergreen Contractors By: Marc Hirst Todd Hagaman Major Harding Service Panel Overview What is a Service Panel, and what is its main function? The major parts of the service panel to give you a basic understanding of ho... Date Added: 2009-06-01 18:07:57 |
| type-inference-notes.txt Path: University of Illinois, Urbana Champaign >> CS >> 421 Spring, 2008 Description: let f = fun x -> (x, x) f : \'a -> \'a * \'a Gu[x:t] |- x : t1 | {t1 = t} Gu[x:t] |- x : t2 | {t2 = t} - Gu[x:t] |- (x, x) : t\' | {t\' = t1 * t2} u {t1 = t} u {t2 = t} -- G |- fun x -> (x, x) : t3 | {t\' = t1 * t2} u {t1 = t} u {t2 = t} ... Date Added: 2009-06-01 18:08:28 |
| ch2.ppt Path: Wichita State >> CS >> 540 Fall, 2008 Description: Chapter 2 Processes and Threads 2.1 Processes 2.2 Threads 2.3 Interprocess communication 2.4 Classical IPC problems 2.5 Scheduling 1 Processes The Process Model In the process model, all runnable software is organized as a collection of processes.... Date Added: 2009-06-01 18:10:17 |
| Starr.doc Path: University of Illinois, Urbana Champaign >> SG >> 1 Fall, 2009 Description: Chauncey Starr President Emeritus, EPRI, Palo Alto, CA National Energy SuperGrid Workshop Crowne Plaza Cabana Palo Alto Hotel: Nov 6, 2002 I\'ll preface my comments with a very personal expression of my pleasure in having this workshop managed by Pro... Date Added: 2009-06-01 18:12:37 |
| vladimirhistory.doc Path: University of Illinois, Urbana Champaign >> FULBRIGHT >> 04 Fall, 2009 Description: A HISTORY OF THE VLADIMIR REGION By Berry Binder & Peter York A SERENDIPITY-RUSSIA PROJECT CONTENTS Preface and Acknowledgements (2) Introduction and Background (3) Vladimir (6) Bogolyubovo (31) Suzdal (36) Kideksha (44) Kovrov (46) Yuryev-Polsky (48... Date Added: 2009-06-01 18:12:39 |
| 16.ppt Path: University of Illinois, Urbana Champaign >> CS >> 105 Spring, 2008 Description: Relative Macros What i s \"Offset\"? Rel ati ve M acr os? M essage Boxes and I nput Boxes Cour se Gui de p. 143 CS 105 Fal l 2005 Sl i de 1 Fi ndi ng the Stop Recor di ng button! We l ost our l i ttl e macr o r ecor der button I f you l ose yo... Date Added: 2009-06-01 18:12:46 |
| README.DOC Path: Washington >> ESC >> 414 Fall, 2009 Description: Dear User: re: code for the interactive one-layer version of MAGICThe MAGIC program consists of a series of 17 subroutines (contained in the 16 files :\"xxxx.cd1\"), plus a main program (\"main\"). Common blocks areincluded in each. A compiled and linked... Date Added: 2009-06-01 18:14:13 |
| Beljaars.ppt Path: Washington >> ARROWHEAD >> 200506 Fall, 2009 Description: ISSUES IN BOUNDARY LAYER PARAMETRIZATION FOR LARGE SCALE MODELS Anton Beljaars* (ECMWF) Boundary layer clouds Wind turning Momentum budget (heterogeneous terrain) With contributions from: Andy Brown, Sylvain Cheinet, Hans Hersbach, Martin Koehle... Date Added: 2009-06-01 18:14:44 |
| Assignment1.doc Path: Washington >> TCSS >> 588 Fall, 2009 Description: TCSS588A Bioinformatics Winter 2007 Assignment 1 Classification / Prediction with Parametric Methods Due date: Wednesday, February 14, 2007, midnight The goal of this assignment is to review classification and prediction principles and parametric... Date Added: 2009-06-01 18:14:54 |
| Summer_Quarter_NSG_522_Information.doc Path: Washington >> NSG >> 522 Fall, 2008 Description: USERNAME: cbull4 PASSWORD: Ben/# NSG 522: Lifespan Advanced Physiology/Pathophysiology Important Information for Students Starting the Course Summer Quarter Text: McCance, K. L. & Huether, S. (2006). Pathophysiology Online for Pathophysiology (User... Date Added: 2009-06-01 18:16:09 |
| Thompson_Micromagnetical.ppt Path: Fayetteville State University >> MCMC >> 05 Fall, 2009 Description: Micromagnetic Simulations of Systems with Shape-Induced Anisotropy S. Hill Thompson Florida State University Manufactured Single-Domain Iron Nanopillars Grown by STM-assisted CVD 1 200 nm 40 nm S. Wirth, M. Field, D. D. Awschalom, and S. von Molna... Date Added: 2009-06-01 18:18:19 |
| RomeSummary.ppt Path: Fayetteville State University >> CHAPTER >> 4 Fall, 2009 Description: The Geography of Rome Italy in 750 BCE Influence of the Etruscans Writing Religion The Arch The Mythical Founding of Rome: Romulus & Remus Republican Government 2 Consuls (Rulers of Rome) Senate (Representative body for patricians) Tribal A... Date Added: 2009-06-01 18:20:37 |
| lecture8.ppt Path: Cornell >> CS >> 430 Fall, 2008 Description: CS 430: Information Discovery Lecture 8 Collection-Level Metadata Vector Methods 1 Course Administration 2 Collection-level metadata Several of the most difficult fields to extract automatically are the same across all pages in a web site. The... Date Added: 2009-06-01 18:25:03 |
| gx2.ppt Path: Cornell >> EAS >> 781 Fall, 2008 Description: GX Technology Seismic Ray-trace Modeling Using GXII Ray-tracing Why use GXII? Forward modeling Inverse modeling Survey design Where is the program? 1. Start 2. Programs 3. Earthwave *Only 3 licenses Getting Started Model Building Window Mode... Date Added: 2009-06-01 18:25:11 |
| janeway_over_picard.txt Path: Cornell >> BS >> 16 Fall, 2009 Description: Janeway Over Picard REASONS WHY CAPTAIN JANEWAY IS BETTER THAN CAPTAIN PICARD 1. One word: hair 2. More hair than all previous Star Trek commanding officers combined. 3. Drinks coffee, not that sissy \"Earl Grey\" stuff. 4. Bea... Date Added: 2009-06-01 18:26:35 |
| lab_01b.doc Path: Cornell >> CEE >> 435 Spring, 2008 Description: Use of the Data Acquisition System for Wave Gauge Calibration. Hardware: Wave gauges consist of a small black box (the conditioner) with an aluminum rod extending from the bottom, followed by a C-shaped section with a wire strung between. The wave g... Date Added: 2009-06-01 18:28:14 |
| educ.ppt Path: ASU >> ECN >> 365 Fall, 2009 Description: Labor, Prices, Household, Black Market & Rural Sector Igor Lukashin ECN 365/ IBS 394 Lecture Goals for Today\'s Lecture Review mechanism of labor allocation Discuss different prices and compare their role to one in a market economy Examine the So... Date Added: 2009-06-01 18:29:18 |
| CS101.txt Path: Southern Oregon >> CS >> 200 Fall, 2008 Description: Fred Smith 1234 A Jane Doe 5678 C Sara Jones 9012 B ... Date Added: 2009-06-01 18:32:54 |
| LCS_Score1_20043.ppt Path: CSU LA >> CHEM >> 434 Fall, 2009 Description: Longest Common Subsequence (LCS) Scoring Dr. Nancy WarterPerez May 6, 2004 Reference Computational Molecular Biology An Algorithmic Approach, Pavel Pevzner June 25, 2003 LCS Scoring 2 Longest Common Subsequence (LCS) Problem Can have ... Date Added: 2009-06-01 18:33:47 |
| Law_MURI_Review.ppt Path: Vanderbilt >> MURI >> 2006 Fall, 2009 Description: Device Simulation for Single-Event Effects Mark E. Law Eric Dattoli, Dan Cummings NCAA Basketball Champions - University of Florida SWAMP Center Objectives Provide SEE device simulation environment Address SEE specific issues Physics - strain Nu... Date Added: 2009-06-01 18:34:53 |
| WebsiteReview1.doc Path: CSU Northridge >> ML >> 514 Fall, 2009 Description: SED514 Educational Website Review By: Miha Lee Site Name: Kaboom Web Address: http:/www.pbs.org/wgbh/nova/kaboom/anatomy.html#bottom Subject: Chemistry Audience: This site would be appropriate for Teachers Students Parents Author: Try to determine w... Date Added: 2009-06-01 18:36:06 |
| WebsiteReview1.doc Path: CSU Northridge >> ML >> 727939 Fall, 2009 Description: SED514 Educational Website Review By: Miha Lee Site Name: Kaboom Web Address: http:/www.pbs.org/wgbh/nova/kaboom/anatomy.html#bottom Subject: Chemistry Audience: This site would be appropriate for Teachers Students Parents Author: Try to determine w... Date Added: 2009-06-01 18:36:06 |
| upstream04.txt Path: Dartmouth >> BIO >> 06 Winter, 2009 Description: >upstream04 CGAATCAACGATTTTCTTTTCTCTCTACACGTATATATTTCGTATGTATT ATTACAAGGAATTATTATACAATATTATATTATTATTATATATAATATAT TATTAATATATACATTATACAATATACGTTTATATATTATTATAATTTAT ATATACAAGGAATTATGTTTCTCGGAATGCTGGCTGGCGTGTTTGGATGT ACGATCGTGTGTGTACAAAGTGTGGAGAGCACAA... Date Added: 2009-06-01 18:37:59 |
| upstream04.txt Path: Dartmouth >> BIO >> 68 Fall, 2009 Description: >upstream04 CGAATCAACGATTTTCTTTTCTCTCTACACGTATATATTTCGTATGTATT ATTACAAGGAATTATTATACAATATTATATTATTATTATATATAATATAT TATTAATATATACATTATACAATATACGTTTATATATTATTATAATTTAT ATATACAAGGAATTATGTTTCTCGGAATGCTGGCTGGCGTGTTTGGATGT ACGATCGTGTGTGTACAAAGTGTGGAGAGCACAA... Date Added: 2009-06-01 18:37:59 |
| 2009-Distinguished-Achievement-Awards-Guidelines-Nomination-Form.doc Path: Texas El Paso >> IA >> 206 Fall, 2009 Description: DISTINGUISHED ACHIEVEMENT AWARDS The University of Texas at El Paso Guidelines I. Introduction The University of Texas at El Paso annually presents awards to faculty and staff in recognition of outstanding achievement in the areas of teaching, resea... Date Added: 2009-06-01 18:38:35 |
| Exam1.doc Path: Cal Poly >> CSC >> 315 Fall, 2009 Description: Name: _ CPE 315 Exam 1 Fall 2003 Short Answer: MIPS Translation: MIPS Calling Convention: Hardware Multiply: /28 /52 /32 /16 /128 Short answer: (6)_What is not an advantage of single-precision floating-pointer over integers? a. Expresses fraction... Date Added: 2009-06-01 18:38:47 |
| acctng.ppt Path: Penn State >> COMM >> 488 Fall, 2009 Description: Telecom Management Accounting&Finance: APrimer AnneHoag,Ph.D. AssistantProfessor PennStateUniversity Anne Hoag, Penn State University Objectives Showyousomebasicfinancialanalysisand planningtools. q Teachsomebasicaccountingprinciples. q Giveyouskil... Date Added: 2009-06-01 18:39:32 |
| environmental.ppt Path: Penn State >> CE >> 300 Fall, 2009 Description: FOR SALE The Gherkin Building City of London Location: \".the most ingenious and elegant new Features: skyscraper built anywhere.\" Energy Efficiency Stirling Prize, Primary Design David Littlejohn, WSJ Emporis Skyscrape... Date Added: 2009-06-01 18:39:36 |
| environmental.ppt Path: Penn State >> CE >> 5004 Fall, 2009 Description: FOR SALE The Gherkin Building City of London Location: \".the most ingenious and elegant new Features: skyscraper built anywhere.\" Energy Efficiency Stirling Prize, Primary Design David Littlejohn, WSJ Emporis Skyscrape... Date Added: 2009-06-01 18:39:36 |
| FINALpwrpt.ppt Path: Penn State >> SDB >> 5028 Spring, 2009 Description: SMITH FAMILY FINANCIAL PORTFOILIO HamptonBaez Financial Inc. $100,000 Inheritance Investment Proposal Financial Evaluation Mr. and Mrs. John Smith Combined Annual Income Tax Bracket Dependents Combined Student Loans Debt Credit Card Debt Checkin... Date Added: 2009-06-01 18:39:48 |
| R_Cartifact3.doc Path: Loras >> LIB >> 319259 Fall, 2009 Description: Matt Carter Edu 100 Progress Report 4/26/07 1.a. What issues have been raised by your field experience? Which ones remain unresolved? There have been issues raised in the area of punishment. At first I was not sure what types of discipline should be ... Date Added: 2009-06-01 18:42:09 |
| R_Cartifact3.doc Path: Loras >> MC >> 305 Fall, 2009 Description: Matt Carter Edu 100 Progress Report 4/26/07 1.a. What issues have been raised by your field experience? Which ones remain unresolved? There have been issues raised in the area of punishment. At first I was not sure what types of discipline should be ... Date Added: 2009-06-01 18:42:09 |
| R_Cartifact3.doc Path: Loras >> MC >> 319259 Fall, 2009 Description: Matt Carter Edu 100 Progress Report 4/26/07 1.a. What issues have been raised by your field experience? Which ones remain unresolved? There have been issues raised in the area of punishment. At first I was not sure what types of discipline should be ... Date Added: 2009-06-01 18:42:09 |
| ex05.txt Path: Cooper Union >> CH >> 05 Fall, 2009 Description: <html> <p> To get on with your exploration of these pages, you can use the MENU or NEXT buttons. MENU sends you to the master list of available pages. NEXT takes you page by page through all the information here. </p> <p> Please spend some time expl... Date Added: 2009-06-01 18:44:14 |
| INFO.TXT Path: UCLA >> CACHE >> 10 Fall, 2009 Description: Sheet1 PVO Retarding Potential Analyzer Reduced Ion Mode data. Data are stored in single orbit binary files (*.DAT). All of the data files have the same internal structure which is described by the single format file ORPADATA.FMT. File structure char... Date Added: 2009-06-01 18:48:55 |
| INFO.TXT Path: UCLA >> CACHE >> 1701 Fall, 2009 Description: Sheet1 PVO Retarding Potential Analyzer Reduced Ion Mode data. Data are stored in single orbit binary files (*.DAT). All of the data files have the same internal structure which is described by the single format file ORPADATA.FMT. File structure char... Date Added: 2009-06-01 18:48:55 |
| ch10_2_v1.ppt Path: CSU Channel Islands >> NETSYS >> 270 Fall, 2009 Description: Chapter 10 Error Detection and Correction Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 10. Note The Hamming distance between two words is the number of differences between corresponding bits. 10. Ex... Date Added: 2009-06-01 18:51:37 |
| lewis_collaborative_filtering.ppt Path: Texas >> I >> 385 Fall, 2009 Description: Collaborative Filtering and Recommender Systems Brian Lewis INF 385Q Knowledge Management Systems November 10, 2005 Presentation Outline Collaborative filtering and recommender systems defined Novel example Readings - overview & key concepts ... Date Added: 2009-06-01 18:53:41 |
| topics1.ppt Path: Texas >> RHE >> 309 Fall, 2008 Description: Quantity Questions Asked by Topic: How much of the thing is there, and how much is good? General Structure of Claim: X is better than Y because of quantitative reasons (X has more of an accepted good/useful quality than Y). Fun Fact about Topics: Cer... Date Added: 2009-06-01 18:54:01 |
| exam3_spring02.doc Path: Maryland >> BSCI >> 440 Fall, 2008 Description: _ Please PRINT your name above BSCI 440; Spring 2002 Round III Drs. Perrino & Higgins Section #: _ TA Name: _ DIRECTIONS 1. 2. 3. Please PRINT your name on each page of examination immediately! NOW! Answer the questions using a pen if you wish the... Date Added: 2009-06-01 18:56:08 |
| exam3_spring02.doc Path: Maryland >> EXAM >> 440 Fall, 2009 Description: _ Please PRINT your name above BSCI 440; Spring 2002 Round III Drs. Perrino & Higgins Section #: _ TA Name: _ DIRECTIONS 1. 2. 3. Please PRINT your name on each page of examination immediately! NOW! Answer the questions using a pen if you wish the... Date Added: 2009-06-01 18:56:08 |
| 21456_TXT.txt Path: Maryland >> NEOPS >> 2001 Fall, 2009 Description: MODEL GRIDDED SOUNDING PLOTTING (Ver 5.014-LINUX-X11) Current filename: /home/data/hrs/eta/12071201.gbm Reading from grid file:/home/data/hrs/eta/12071201.gbm Searching the city database file for: KIAD . Searching file for grids. Date: 24 hour... Date Added: 2009-06-01 18:56:15 |
| CH02courts.ppt Path: U. Great Falls >> CRJ >> 211 Fall, 2009 Description: The Courts Functions of Courts A forum to resolve disputes Clarify and interpret Statutes Uphold law that is consistent with the applicable Constitutions Dual Court Systems Each State has its own court system that hand... Date Added: 2009-06-01 18:57:57 |
| H_Strain_FRFSUM_time_step_37.txt Path: Virginia Tech >> ESM >> 4714 Fall, 2008 Description: 2.0553e-014 1.8789e-014 6.8729e-015 0.025926 -0.028282 0.013719 0.089061 -0.094517 0.056612 0.153 -0.15133 0.12491 0.17809 -0.14968 0.21073 0.14183 -0.065343 0.29988 0.051769 0.083808 0.37225 -0.05706 0.24238 0.40624 -0.1381 0.34158 0.38522 -0.15509 ... Date Added: 2009-06-01 18:59:03 |
| H_Strain_FRFSUM_time_step_37.txt Path: Virginia Tech >> ESM >> 6 Fall, 2009 Description: 2.0553e-014 1.8789e-014 6.8729e-015 0.025926 -0.028282 0.013719 0.089061 -0.094517 0.056612 0.153 -0.15133 0.12491 0.17809 -0.14968 0.21073 0.14183 -0.065343 0.29988 0.051769 0.083808 0.37225 -0.05706 0.24238 0.40624 -0.1381 0.34158 0.38522 -0.15509 ... Date Added: 2009-06-01 18:59:03 |
| WANAFe11-UFL_20051023T1200_20051023T1200_20051028T0600_25trk_Z.txt Path: LSU >> WUFLAW >> 11 Fall, 2009 Description: # Date Created: Fri Mar 16 18:58:19 UTC 2007 # Host: sura-uf-pe6600-1.coastal.ufl.edu # Creation Script: /home/as/Create_TRK/e11/create-ens-e11.sh # Usage: /home/as/Create_TRK/e11/create-ens-e11.sh /home/as/Archive/ATCF/Subsetted/AL/2005/25/OFCI/2005... Date Added: 2009-06-01 19:01:29 |
| WANAFe11-UFL_20051023T1200_20051023T1200_20051028T0600_25trk_Z.txt Path: LSU >> WUFLAW >> 645104 Fall, 2009 Description: # Date Created: Fri Mar 16 18:58:19 UTC 2007 # Host: sura-uf-pe6600-1.coastal.ufl.edu # Creation Script: /home/as/Create_TRK/e11/create-ens-e11.sh # Usage: /home/as/Create_TRK/e11/create-ens-e11.sh /home/as/Archive/ATCF/Subsetted/AL/2005/25/OFCI/2005... Date Added: 2009-06-01 19:01:29 |
| wrappers.doc Path: Cornell >> CS >> 1130 Fall, 2009 Description: Wrapper classes An instance of class Integer contains a field of type int. We haven\'t given the name of the field because we don\'t know it. But there is a getter method for it, intValue(). In fact, one can obtain the int value as a primitive value of... Date Added: 2009-06-01 19:02:08 |
| Prjct1a2003.doc Path: Kentucky >> EE >> 640 Fall, 2008 Description: EE640 STOCHASTIC SYSTEMS SPRING 2003 COMPUTER PROJECT 1 PART A: SYNTHESIS(updated 4-8-03) Let N=1024: 1. Uniform pseudo-random numbers. Generate 6 random vectors,each with a different seed. The vectors are all Nx1 where each element is uniformly dist... Date Added: 2009-06-01 19:03:46 |
| notes-string-refresher.txt Path: Georgia Tech >> CS >> 1321 Fall, 2008 Description: Finishing chapter 6 READ THE BOOK! print variable, print variable2 chapter talks about printing out tabular info (HW) why functions? 1) Giving a name to a sequence of statements makes your program easier to read and debug. 2) Dividing a long prog... Date Added: 2009-06-01 19:04:47 |
| norlander5.doc Path: Michigan State University >> ASSGT >> 840 Summer, 2009 Description: Norlander 82 INFORMED CONSENT FORM WATER CONSUMPTION STUDY You are invited to participate in a study of water consumption. My name is Linda Norlander, and I am a student at Michigan State University, Department of Social Work. This study is being c... Date Added: 2009-06-01 19:07:05 |
| lecture5.ppt Path: Southern Oregon >> METR >> 1111 Fall, 2009 Description: Lecture 5 (10/07) METR 1111 Isolining and Upper Air Maps What are isolines? Isolines (also called isopleths)- lines that connect equal values of a variable In meteorology, we frequently use: - isobars (pressure) - isotherms (temperature) - isotach... Date Added: 2009-06-01 19:07:49 |
| HomeworkAssignment6.doc Path: Texas A&M >> FRSC >> 461 Fall, 2008 Description: Homework #6 Give a brief synopsis of GIS. For instance.What is GIS? What are some general applications of GIS? Give examples of the different tools and methods that we have used in ArcGIS this semester. What sort of things can be determined by using ... Date Added: 2009-06-01 19:07:58 |
| exam1-tl.txt Path: Michigan State University >> CPS >> 360 Fall, 2009 Description: CSE 360: Tasks List for First Midterm Note: Not guaranteed to be complete, should indicate basic classifications 1.0 Tasks Ability to recite definitions of alphabets, strings, languages, and language classes Ability to recite definitions of 4 pos... Date Added: 2009-06-01 19:08:32 |
| Sit-Cog-Prin1.doc Path: Minnesota >> CI >> 5336 Spring, 2008 Description: Table 3.4 Situated Cognition Principles Relating to Learning Environments _ 1 Table 3.4 Situated Cognition Principles Relating to Learning Environments __ Learning in context. Thinking and learning make sense only within particular situations. All ... Date Added: 2009-06-01 19:09:45 |
| Lecture1.ppt Path: Minnesota >> SENG >> 5811 Spring, 2008 Description: Software Testing and Verification Neil Bitzenhofer MSSE SE-5811 Lecture #1 Jan. 23, 2009 Introductory Lecture 05/01/09 Lecture #1 NAB-1 Agenda for Today Part I Introduction to the class Who am I? Expectations Syllabus Part II Why we test 05/01... Date Added: 2009-06-01 19:09:48 |
| Chain.txt Path: Duke >> SJB >> 23 Fall, 2009 Description: /* * Represents the chain in a unicycle. * @see Unicycle */ public class Chain { /* * How fast the chain moves. */ private double rollingVelocity; /* * One of the two <code>Gear</code>s connected to the chain. */ private Gear top; ... Date Added: 2009-06-01 19:12:10 |
| excel_basics_4421.doc Path: FIU >> ECO >> 4421 Fall, 2008 Description: Excel and Statistics Jonathan Hill In this document, we briefly explain how to use EXCEL to analyze data. For all examples, we use the following spreadsheet: 1 2 3 4 5 6 A EDUC 12 12 10 16 16 B WAGE 12 8 9 15 20 We discuss 1. 2. Sample Statistics Pl... Date Added: 2009-06-01 19:13:58 |
| CHECKSUM.TXT Path: UCLA >> CACHE >> 2025 Fall, 2009 Description: Sheet1 dc34df8b20540db6c952bd0ef0bf589a MGSM_2184/BROWSE/BROWINFO.TXT e270623efc55a088cacfd1aaf17aca27 MGSM_2184/BROWSE/MAG_CAL/HGAAZELD.PS b9fd3452f5b25209174eddf6fd178160 MGSM_2184/BROWSE/MAG_CAL/HGAAZELM.PS 85016e6b33e84e65e92d5be327c0cdbb MGSM_21... Date Added: 2009-06-01 19:15:13 |
| Ex53_07.doc Path: ESF >> EX >> 556 Fall, 2009 Description: FOR 556 Site Selection and Boolean Modeling Exercise 5.3 Due2/26 2007 Objectives of this exercise: 1. 2. 3. 4. 5. Use spatial modeling to plan Create and Use Boolean Images for Analysis Use the Modeler and sub-Models Use measurements (AREA) to ext... Date Added: 2009-06-01 19:16:36 |
| ENCh09FIGS.ppt Path: Rose-Hulman >> CSSE >> 333 Fall, 2009 Description: Copyright 2004 Pearson Education, Inc. Chapter 9 More SQL: Assertions, Views, and Programming Techniques Copyright 2004 Pearson Education, Inc. FIGURE 9.1 Two views specified on the database schema of Figure 5.5. Elmasri and Navathe, Fundament... Date Added: 2009-06-01 19:16:56 |
| problemset2spring2002.doc Path: Wisconsin >> HOMEWROK >> 530 Fall, 2009 Description: CEE/GLE 530 Seepage and Slopes Spring, 2002 Problem Set #2 Due 02/13/02 1. A highway cut is proposed through an area in which the soils consist of granular soils with occasional horizontal layers of sandy and/or silty clays. It is believed that the c... Date Added: 2009-06-01 19:18:31 |
| Teambasedpay.ppt Path: Colorado >> MGMT >> 4030 Fall, 2008 Description: Team-based Pay Team Definition (Katzenbach & Smith, 1993) Group of employees whose members are mutually accountable to each other for common goals. Team members interact on a regular basis. There is the possibility of synergy between team members.... Date Added: 2009-06-01 19:21:48 |
| Ch7EmployeeComputerData.txt Path: Fort Lewis >> CS >> 350 Fall, 2009 Description: INSERT INTO EMPLOYEE VALUES (101, \'Jack Jones\', \'JJones@somewhere.org\', \'Accounting\'); INSERT INTO EMPLOYEE VALUES (102, \'Jill Jones\', \'JJones2@anywhere.org\', \'Accounting\'); INSERT INTO EMPLOYEE VALUES (103, \'Jim Jones\', \'JJones3@anywhere.org\', \'A... Date Added: 2009-06-01 19:22:48 |
| set_2.ppt Path: SUNY Buffalo >> BIO >> 129 Fall, 2009 Description: Unity in Diversity Example: ATP hydrolysis drives muscle contraction Stages of embryo development Zygote Morula Blastula Gastrula a. turtle b. mouse c. human d. chick e. pig Asexual reproduction: simple fission (mitosis) Sexual reproduct... Date Added: 2009-06-01 19:23:03 |
| chapter14.ppt Path: NMSU >> PSYCH >> 375 Fall, 2009 Description: Chapter 14: Cognitive Functions Lateralization of Function Lateralization of function refers to the idea that each hemisphere of the brain is specialized for different functions. Each hemispheres controls the contralateral (opposite) side of the b... Date Added: 2009-06-01 19:23:46 |
| lesson7.ppt Path: Wisconsin >> AOS >> 101 Fall, 2009 Description: AOS 101 Severe Weather April 1/3 Lifting Condensation Level (LCL) Level at which a parcel lifted from the surface would reach saturation (i.e. level where temperature = dewpoint) Last week: DALR T decreases at 10oC/km In addition, dewpoint (... Date Added: 2009-06-01 19:25:17 |
| Splicers.ppt Path: SUNY Buffalo >> EE >> 566 Fall, 2009 Description: Splicers Rekha .V. Tranquebar e-mail: rvt@buffalo.edu definitions Splicer mechanical device for joining two pieces of paper or film or magnetic tape Splice joint made by overlapping two ends and joining them Splicing process of the... Date Added: 2009-06-01 19:25:30 |
| cs321-10a.ppt Path: MSOE >> CS >> 321 Fall, 2009 Description: Windowing Push-Pull Systems Application Events & Callbacks Windowing System Operating System Device Drivers Keyboard Fall 2004 Mouse Video CS-321 Dr. Mark L. Hornick Printer 1 Modern Windowing Systems Program flow is NOT sequential Order of ... Date Added: 2009-06-01 19:25:39 |
| ce591F07_r8.doc Path: Purdue >> CE >> 591 Fall, 2008 Description: CE 591 Advanced Structural Steel Design Fall 2007 Lecture 8 Lecture 8: Composite Beams; Examples Reading: AISC Manual Part 3, Section on Composite Beams (3-6 to 3-7, 3-29 to 3-32, Tables 3-19 to 3-21) AISC Manual Part 16, Commentary I3.1 If needed... Date Added: 2009-06-01 19:26:37 |
| answerstohomework5fall2006.doc Path: Wisconsin >> ECON >> 101 Fall, 2008 Description: Economics 101 Fall 2006 Answers to Homework #5 1. First and Second Price Discrimination (a) The equilibrium is decided by the intersection between MC curve and Demand Curve, so Q=9 and P= $12. The producer surplus is (12-3)*9*1/2= $40.50. (b) MR=-8Q+... Date Added: 2009-06-01 19:28:58 |
| Project3F07.txt Path: Michigan >> ECE >> 414 Fall, 2009 Description: 414 Design Project 3: DIY Op Amp The following are minimum specifications: CMRR > 3000 Input impedance > 50K Output impedance < 500 Ohm Avdm > 10,000 with a .5K load Bandwidth = Class A, AB, or B output with 1 point extra credit for class AB 5V pe... Date Added: 2009-06-01 19:28:59 |
| trk_2_21.txt Path: Washington University in St. Louis >> MEXMRS >> 0153 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = FIXED_LENGTH RECORD_BYTES = 80 DATA_SET_ID ... Date Added: 2009-06-01 19:32:47 |
| costacctg13e_ppt_ch02.ppt Path: CSU Bakersfield >> ACCT >> 303 Fall, 2008 Description: An Introduction to Cost Terms and Purposes 2009 Pearson Prentice Hall. All rights reserved. Basic Cost Terminology Cost sacrificed resource to achieve a specific objective Actual cost a cost that has occurred Budgeted cost a predicted cost Cost... Date Added: 2009-06-01 19:35:10 |
| 0917weather.doc Path: UNC >> HR >> 20363 Fall, 2009 Description: CLARIFICATIONS ON EMERGENCY EMPLOYEE PROVISIONS OF THE ADVERSE WEATHER POLICY IN GENERAL: The purpose of the emergency duty status is not punitive. It is meant to reflect accurately the requirements, responsibilities, and expectations of a particular... Date Added: 2009-06-01 19:36:20 |
| 09_sampling.ppt Path: UNC >> GEOG >> 391 Fall, 2008 Description: Sampling Chapter 7 of the textbook Pages 215-250 Introduction Descriptive statistics allow us to describe and summarize our data Inferential statistics allow us to infer unknown values and/or the probability of events occurring using the data we hav... Date Added: 2009-06-01 19:36:21 |
| Chap003.ppt Path: Cal Poly Pomona >> HRT >> 474 Fall, 2009 Description: Working With Financial Statements Chapter 3 McGrawHill McGrawHill/Irwin 2004 The McGrawHill Companies, Inc. All rights reserved. Key Concepts and Skills Know how to standardize financial statements for comparison purposes Know how to compute a... Date Added: 2009-06-01 19:37:28 |
| johnson251.txt Path: CSU Fresno >> MP >> 3 Fall, 2009 Description: From: abbysale@sundial.sundial.net (Abby Sale) To: ballad-l@indiana.edu, digitrad@world.std.com Subject: Wee wees Date: Thu, 20 Jun 1996 11:10:46 GMT Message-ID: <31c92f4a.610706@mailhost.sundial.net> X-Mailer: Forte Agent .99e/32.227 Sender: owner-b... Date Added: 2009-06-01 19:38:13 |
| stormwatermgmtfinal.doc Path: Wisc Green Bay >> CAPSTONE >> 05 Fall, 2009 Description: University of Wisconsin-Green Bay Stormwater Management: Regulations and Best Management Practices Aleeca A. Forsberg Jessica A. McCuskey Christian S. Waltman Environmental Science and Policy 763 Fall 2005 Final Paper 2 1 May 2009 Introduction..3 ... Date Added: 2009-06-01 19:38:16 |
| midterm2.txt Path: Carleton >> CS >> 337 Fall, 2009 Description: CS395 Due 11:10 AM, Monday, November 13, 1995 Midterm 2 Ondich You may use an publicly available on-line resource for this exam, and you may use any of your own notes and programs. You may consult with no person other than Jeff Ondich... Date Added: 2009-06-01 19:42:52 |
| MIDTERMEXAMVer7.doc Path: Wayne State University >> BE >> 1010 Fall, 2009 Description: BE1010 Fall 2002 MIDTERM EXAM 1. What type of RAM is primarily is used primarily for cache? (57) 2. What is (APM)? Give a brief def (255) 3. The cheapest form of read/write memory in wide use today is what? (34) 4. The BIOS will check for information... Date Added: 2009-06-01 19:43:17 |
| JobParent.txt Path: Millersville >> CS >> 380 Fall, 2009 Description: /JobParent.java class JobParent extends Thread { protected static volatile Semaphore mutex = new Semaphore(\"mutex\", 1); protected static volatile Semaphore itemIsReady = new Semaphore(\"itemIsReady... Date Added: 2009-06-01 19:44:06 |
| TDC368_Project1.doc Path: DePaul >> TDC >> 368 Fall, 2009 Description: TDC368 - UNIX and Network System Programming Programming Assignment 1 Due Date: April 22 1. Write a C program for generating a \"chain\" of processes. The program takes a single command line argument N that specifies the number of processes to create. ... Date Added: 2009-06-01 19:44:12 |
| mpml_info.txt Path: RIT >> JUL >> 01 Fall, 2009 Description: Message: 1 Date: Thu, 23 Jun 2005 11:01:37 -0700 (PDT) From: Ron Baalke <baalke@zagami.jpl.nasa.gov> Subject: Astronomers\' Holiday Special - A July 4 Comet Bash ASTRONOMERS\' HOLIDAY SPECIAL - A JULY 4 COMET BASH >From Lori Stiles, U... Date Added: 2009-06-01 19:44:32 |
| session25_obrienknowyourparcelhistory.ppt Path: Minnesota >> SESSION >> 25 Fall, 2009 Description: Agenda Know Your History How to Trace a for History Parcel\'s The LineageQuest Tabular Van O\'Brien Genealogy The Sidwell Company Spatial Genealogy October 3, 2008 Demonstration GIS/LIS 2008 The Sidwell Company St. Charles, Illinois G... Date Added: 2009-06-01 19:45:35 |
| p06918980614.txt Path: Auburn >> DIGDATA >> 1898 Fall, 2009 Description: 69 The man who has immediate charge of the practical work ought to be constantly at the experiments which are to be shown to students and visitors, Thus he could keep a constant lookout for prices of instruction work to be reserved for students and ... Date Added: 2009-06-01 19:47:54 |
| powerpoint.ppt Path: Auburn >> EDMD >> 3300 Fall, 2008 Description: Anne Joseph\'s Teaching Philosophy Teaching Being a teacher is the most rewarding job someone could have. It is our job to implement learning in every student that we come in contact with. We have the power to impact these students lives... Date Added: 2009-06-01 19:48:01 |
| TapChangers.doc Path: Iowa State >> EE >> 456 Fall, 2009 Description: Tap Changers 1.0 Introduction (Section 5.9) Section 5.9 discusses voltage regulators, tap changers, and phase shifters. Of these, tap changers are the most common at the transmission level, and that is what we will discuss in these notes. Tap chang... Date Added: 2009-06-01 19:48:51 |
| 24UsabSpec+Expt.ppt Path: Georgia Tech >> CS >> 4750 Fall, 2008 Description: Usability & Experiments Usability Specifications Experimental Design Agenda s Usability Specifications Running experiments Experimental design Variables Methods Results Process Techniques Why, How Oct 30, Fall 2000 CS 4750 2 One Model ... Date Added: 2009-06-01 19:52:18 |
| ENCh09FIGS.ppt Path: Georgia Tech >> CS >> 4400 Fall, 2008 Description: Copyright 2004 Pearson Education, Inc. Chapter 9 More SQL: Assertions, Views, and Programming Techniques Copyright 2004 Pearson Education, Inc. FIGURE 9.1 Two views specified on the database schema of Figure 5.5. Elmasri and Navathe, Fundament... Date Added: 2009-06-01 19:52:46 |
| 1012.txt Path: UGA >> CWT >> 33 Fall, 2009 Description: Forest Science, Vol. 40, No. 1, pp. 47-58 Effects of Light, Nitrogen, and Phosphorus on Red Pine Seedling Growth and Nutrient Use Efficiency KATHERINE J. ELLIOTT ALAN S. WHITE ABSTRACT. Growth and nutrient use efficiency were determined for red pine ... Date Added: 2009-06-01 19:52:49 |
| 02_calculator.txt Path: Laurentian >> MATH >> 2057 Fall, 2009 Description: / Main source: http:/www.engineering.usu.edu/cee/faculty/gurro/Scilab.html / Functions /- /Function \"sqrt\" returns the square root of a real or complex number. /- sqrt(2345.676) /-- /A plot of the square root function can only be produced for ... Date Added: 2009-06-01 19:54:07 |
| 20midActual.txt Path: Maple Springs >> CSE >> 2021 Fall, 2009 Description: COSC2021 - FALL 2000 - MIDTERM - VERSION 1 AND 2 QUESTIONS AND ANSWERS - QUESTION #1-V1 < 12 points > The following program is executed on a big endian machine (most-significant byte of a word is stored at t... Date Added: 2009-06-01 19:54:11 |
| enph131outline08.doc Path: UAB >> ENPH >> 131 Fall, 2009 Description: Grant MacEwan College ENGINEERING MECHANICS II ENPH 131 Sections 220/221 Winter 2008 Instructors: Office: Phone: Office Hours: Email: Lab Instructors: Office: Phone: Office Hours: Email: Shelley Lorimer, Ph.D., P.Eng. 6-118E 497 4631 TBA lorimers@m... Date Added: 2009-06-01 19:54:35 |
| Dome_Temp.txt Path: Allan Hancock College >> PHYSICS >> 001 Fall, 2009 Description: Time Time In Secs Dome Temp 2009_04_18 09:29:02 3322891742 23.2599 2009_04_18 09:29:03 3322891743 23.2599 2009_04_18 09:30:06 3322891806 23.3052 2009_04_18 09:31:09 3322891869 23.4864 2009_04_18 09:32:12 3322891932 23.4864 2009_04_18 09:33:15 3322891... Date Added: 2009-06-01 19:55:49 |
| allCourses.txt Path: Maple Springs >> CSE >> 1020 Fall, 2009 Description: 1020 1030 2011 2001 2021 2031 3001 3101 3201 3221 3211 3301 3311 3331 3401 3421 3461... Date Added: 2009-06-01 19:56:38 |
| log_server.txt Path: CSU Fullerton >> UNX >> 510 Fall, 2009 Description: fifo=/tmp/$(logname)_log_server_fifo trap \"echo \'log server ended\'; exit 0\" int if [ -e $fifo ] then rm -rf $fifo fi if ! mkfifo -m 600 $fifo then echo \"Error: could not create pipe\" > $fifo do echo $... Date Added: 2009-06-01 19:57:51 |
| 2210_Lecture_33.ppt Path: Laurentian >> GEOG >> 2210 Fall, 2009 Description: Agriculture & Location Theory Chapter 13 Questions? Review 2 lectures left! Agriculture Environmental Impact Von Thnen and Location theory Environmental Impact of Contemporary Agriculture Monoculture: specialization on a ... Date Added: 2009-06-01 19:58:24 |
| gord.doc Path: Laurentian >> NMED >> 3700 Fall, 2009 Description: Profile from CityTV site: http:/toronto.citytv.com/personalities/content/ martineau_gord.asp Gord Martineau Occupation: Anchor, \"CityPulse at Six\" SHOW DESCRIPTION: \"CityPulse\" is Toronto news. All Day, Every Day, the City is our Newsroom. Intensely-... Date Added: 2009-06-01 19:58:40 |
| lgafab2003457.txt Path: Allan Hancock College >> LGAFAB >> 2003457 Fall, 2009 Description: [Page Break] New South Wales Local Government Amendment (No Forced Amalgamations) Bill 2003 Contents Page 1 Name o... Date Added: 2009-06-01 19:59:25 |
| hs12_2.txt Path: Penn >> VHM >> 802 Fall, 2009 Description: Solution file for additional exercise 12.2 - (see exercise 12.1 for discussion of design and notation) MTB > # Opening worksheet from file: C:\\DATA.AVC\\teaching\\VHM802\\ex\\HS12_2.DAT MTB > # File was last modified on 2/27/102 MTB > name c1=\'lot\' MTB ... Date Added: 2009-06-01 20:00:41 |
| template.txt Path: Laurentian >> CS >> 210 Fall, 2009 Description: Generic Functions: (template functions) A generic function defines a general set of operations that will be applied to various types of data. A generic function has the type of data that will operate upon passed to it as a parameter. Using this me... Date Added: 2009-06-01 20:01:41 |
| Ch18_Rev.ppt Path: Charleston Law >> BU >> 205 Fall, 2009 Description: Chapter 18 Simple Linear Regression 1 18.1 Introduction In Chapters 18 to 20 we examine the relationship between interval variables via a mathematical equation. The motivation for using the technique: Forecast the value of a dependent variable ... Date Added: 2009-06-01 20:03:23 |
| Ch18_Rev.ppt Path: Charleston Law >> CHAPTER >> 205 Fall, 2009 Description: Chapter 18 Simple Linear Regression 1 18.1 Introduction In Chapters 18 to 20 we examine the relationship between interval variables via a mathematical equation. The motivation for using the technique: Forecast the value of a dependent variable ... Date Added: 2009-06-01 20:03:23 |
| HIST254D01.TXT Path: Sveriges lantbruksuniversitet >> HIST >> 20003 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 254-3 D01 TITLE: CHINA TO 1800 SEMESTER: 2000-3 LOCATION: SFU SECTION TYPE: LEC ENROL: 61 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown sepa... Date Added: 2009-06-01 20:03:38 |
| troomrates.txt Path: Wilfrid Laurier >> MGMT >> 331 Fall, 2009 Description: Double,100.00 Single,80.00 Suite,150.00 ... Date Added: 2009-06-01 20:04:41 |
| v02n614.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From - Wed Sep 30 16:13:03 1998 Received: from broadway.sfn.saskatoon.sk.ca (majordomo@broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id QAA29501; Wed, 30 Sep 1998 16:09:08 -0600 (CST) Received: (from maj... Date Added: 2009-06-01 20:05:35 |
| acar199911999n52532.txt Path: Allan Hancock College >> ACAR >> 199911999 Fall, 2009 Description: AIRPORTS (BUILDING CONTROL) AMENDMENT REGULATIONS 1999 (NO. 1) 1999 NO. 52 AIRPORTS (BUILDING CONTROL) AMENDMENT REGULATIONS 1999 (NO. 1) 1999 NO. 52 - TABLE OF PROVISIONS 1. 1 Name of regulations 2. 2 Commencement 3. 3 Amendment of Airports ... Date Added: 2009-06-01 20:07:21 |
| sofaa200842o2008444.txt Path: Allan Hancock College >> SOFAA >> 200842 Fall, 2009 Description: No 42 of 2008 assented to 6.11.2008 South Australia Summary Offences (Indecent Filming) Amendment Act 2008 An Act to amend the Summary Offences Act 1953. Contents Part 1-Preliminary 1 Short title 2 Commencement 3 Amendment pro... Date Added: 2009-06-01 20:07:39 |
| nsicb2004350.txt Path: Allan Hancock College >> NSICB >> 2004350 Fall, 2009 Description: Passed by both Houses New South Wales NSW Self Insurance Corporation Bill 2004 Contents Page... Date Added: 2009-06-01 20:08:20 |
| vatlavrar20072007n74770.txt Path: Allan Hancock College >> VATLAVRAR >> 20072007 Fall, 2009 Description: The legislation that is being viewed is valid for Sessional. Vehicle and Traffic (Driver Licensing and Vehicle Registration) Amendment Regulations 2007 (S.R. 2007, No. 74) -- ... Date Added: 2009-06-01 20:09:29 |
| Chapter07.ppt Path: CSU Northridge >> HCBUS >> 013 Fall, 2009 Description: Chapter 7 Profit Planning McGraw-Hill /Irwin The McGraw-Hill Companies, Inc., 2007 Learning Objective LO1 To understand why organizations budget and the processes they use to create budgets. 7-2 The Basic Framework of Budgeting A budget is a de... Date Added: 2009-06-01 20:11:37 |
| NaturalSelection1.doc Path: SEMO >> BI >> 151 Fall, 2009 Description: The Chips are down: Natural Selection by Predators on Prey The process of natural selection occurs because organisms vary in their heritable characteristics, and because some variants survive and reproduce better than others. As a result, the genetic... Date Added: 2009-06-01 20:12:14 |
| MGMT3102-Summer2009-Syllabus.doc Path: Clayton >> MGMT >> 3102 Fall, 2009 Description: MGMT 3102 Performance/Quality Management SYLLABUS Summer, 2009 This syllabus should be used by students taking MGMT 3102 during the Summer semester, 2009 Important Notes Applicable to this Summer Semester (1) A comprehensive final will be given durin... Date Added: 2009-06-01 20:12:22 |
| notes.txt Path: George Mason >> SCIENCE >> 753 Fall, 2009 Description: The locations being studied for the project is chosen based on the Pacific atoll stations, so if necessary later, the TRMM data can be compared with the gauge data, also the R-SD relation can be compared. The source about the Atoll locations: http:/... Date Added: 2009-06-01 20:13:01 |
| vlc.ppt Path: East Los Angeles College >> CE >> 53402 Fall, 2009 Description: Interactive Learning Systems Virtual Learning Communities R.J.Peglar@ staffs.ac.uk Interactive Learning Systems Beyond VLEs Even while VLEs are still being introduced people are looking beyond them. Education is regarded as a social as well as an ... Date Added: 2009-06-01 20:13:32 |
| MattBarberCV-WebDOC.doc Path: East Los Angeles College >> CAM >> 41030 Fall, 2009 Description: Matt Barber CV PERSONAL STATEMENT Web version of CV: Phone details omitted. matt1@progressive.org.uk Date of Birth: 4th February 1985 I am a dedicated enthusiastic individual. My passion lies within innovation in streaming ... Date Added: 2009-06-01 20:14:27 |
| ManchesterDileptons.ppt Path: East Los Angeles College >> FP >> 420 Fall, 2009 Description: Exclusive dileptons Startup physics and plans for FP420 Startup physics and plans for FP420 Jonathan Hollar (LLNL) Xavier Rouby, Severine Ovyn (Louvain) With contributions from J. Gronberg K. Piotorkowski, J. de Favereau, M. Grothe, M. Albrow, D. Den... Date Added: 2009-06-01 20:16:33 |
| syllabuschildrenslit.doc Path: DePaul >> HCI >> 201 Fall, 2009 Description: DE PAUL UNIVERSITY SCHOOL OF EDUCATION EE 347: CHILDREN\'S LITERATURE Spring 2006 Friday, 8:30-11:30 Roxanne Farwick Owens, Ph.D. Associate Professor, Teacher Education Department SAC 364, 773.325.4329, rowens@depaul.edu COURSE BLACKBOARD SITE: http:/... Date Added: 2009-06-01 20:21:14 |
| malta-eb.ppt Path: Iowa State >> CE >> 552 Fall, 2009 Description: Validation and Implication of Segmentation on Empirical Bayes for Highway Safety Studies Reginald R. Souleyrette, Robert P. Haas and T. H. Maze Iowa State University, SAIC and Iowa State University ENVIRONMENTAL HEALTH RISK 2007 Fourth International ... Date Added: 2009-06-01 20:22:09 |
| Chapter16Flash.doc Path: Iowa State >> CHEM >> 332 Fall, 2008 Description: Electrophilic Aromatic Substitution: Bromonation Reaction Mechanism Reactants Constraints Reaction + Mechanism Br 1.) + Br2 - FeBr3 Br + HBr Br FeBr3 + Br Br + Br H Br + Br H + HBr + FeBr3 + Br H + FeBr4- 2.) + Br + Br H FeBr3- R... Date Added: 2009-06-01 20:22:38 |
| FR.doc Path: Iowa State >> MAY >> 0212 Fall, 2009 Description: Parallel Electrical Supply System Final Report Team Number May02-12 Clients Name: Ms. Marge Trusty Faculty Advisors: Dr. John Lamont, Prof. Ralph Patterson, Prof. Glenn Hillsland Team Members: Luis Lobo, Andrew McArthur, Sean Smith, Joshua Linebaugh... Date Added: 2009-06-01 20:22:51 |
| VoIP.ppt Path: University of Hawaii - Hilo >> C >> 231 Fall, 2009 Description: VoIP Voice over Internet Protocol What is VoIP The transmission of voice traffic over IPbased networks. The Internet Protocol (IP) was originally designed for data networking. Moved to voice networking. VoIP calls can be placed across the Intern... Date Added: 2009-06-01 20:23:19 |
| team2_site_evaluations.doc Path: DePaul >> MIS >> 398 Fall, 2009 Description: MIS 398 BEST OF CLASS WEB SITE EVALUATIONS February 2, 2000 TEAM TWO MEMBERS AND SITES: Susan Driscoll Laura Merkin Imran Mukati Gordon Pennell Team site www.brittanica.com www.nhl.com www.funjet.com www.askjeeves.com www.amazon.com MIS #398 Best of... Date Added: 2009-06-01 20:23:50 |
| lecture23.ppt Path: Duke >> CPS >> 214 Fall, 2009 Description: CPS 214 Computer Networks and Distributed Systems \"Live\" Video and Audio Streaming End System Multicast Analysis of Akamai Workload 1 Presentations Monday, April 21 Abhinav, Risi Bi, Jie Jason, Michael Martin, Matt Amre, Kareem Wednesday, ... Date Added: 2009-06-01 20:24:07 |
| 02-Mammoth_Transps_w._Final.doc Path: UCSB >> ATT >> 0218 Fall, 2009 Description: Well Field and Basin Areas Ow ive r sR en Legend MCWD Wells St. Anton Creek Dry Creek Owens River Well Field Area Basin Area N 4 0 4 8 Kilometers Elevation (meters) 2104 - 2213 2214 - 2322 2323 - 2432 2433 - 2541 2542 - 2651 2652 - 2... Date Added: 2009-06-01 20:25:33 |
| hw2.txt Path: UCSB >> CS >> 472 Fall, 2009 Description: 1 (3.1). state: It describes the stage or situation of a particular problem. state space: The set of all states that can be reached from the inital state search tree: a search tree is a graph which represents the state space generated by the ... Date Added: 2009-06-01 20:25:46 |
| 09_11_08.ppt Path: N.C. State >> BCH >> 701 Fall, 2008 Description: What is a Mass Spectrometer? And what does it do? An analytical device that determines molecular weights by separating molecular ions according to their mass/ charge (M/Z) ratio. The ions are induced to be loss or gain of charge(electron ejection, pr... Date Added: 2009-06-01 20:26:29 |
| Chapter12.ppt Path: UC Riverside >> EE >> 134 Fall, 2008 Description: Integrated Circuits A Design Perspective Jan M. Rabaey Anantha Chandrakasan Borivoje Nikolic Semiconductor Memories December 20, 2002 Memories Digital Integrated Circuits2nd Chapter Overview Memory Classification Memory Architectures The Memor... Date Added: 2009-06-01 20:26:35 |
| L22.ppt Path: Wesleyan >> ASTR >> 105 Fall, 2009 Description: COSMOLOGY Lookback time: how long ago light left an object of a given redshift. It tells us how far into the past we are looking when we see an object (because light has a finite speed). The more distant an object, the farther in the past we are obse... Date Added: 2009-06-01 20:26:49 |
| 456.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Tue Nov 18 20:13:50 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.4 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-01 20:26:53 |
| hw9_solution_public.doc Path: USC >> CS >> 510 Fall, 2009 Description: .Homework 9 Software Economic Risk Analysis Solution Alternative A: Loss (Risk) = $360K (0.2) = $72K REbefore = ($72K) (0.2) = $14.4K REafter = ($72K) (0.1) = $7.2K RRL = (14.4 7.2) / 25 = 7.2/25 = 0.288 Not Worth doing Alternative B: REbefore... Date Added: 2009-06-01 20:26:57 |
| CMN_11_29_F06a_T11.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Team Assignment Client Meeting Report (15 Points) Contact Person: csci577@usc.edu WEEK Nine 11/27/2006 TO 12/03/2006 Write a report about your client\'s meeting. New Economics for Women (NEW) C... Date Added: 2009-06-01 20:27:02 |
| Week05_CMN_F04a_T06.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Team #06 `Bar-coding for Maternal-Child Virology Research Laboratory\' Minutes of Meeting Week #05 Meeting #6: Developer meeting with the client Date and time: 14th October, 2004. 10:30 am Participants: Patricia Anthony Patricia Yepez, Head lab techn... Date Added: 2009-06-01 20:27:14 |
| bifilar_06_energy.doc Path: Rose-Hulman >> PH >> 235 Fall, 2009 Description: 1 PH 235 The bifilar pendulum. MJM 7/31/06 The bifilar pendulum is a two-thread suspension. The object rotates about a vertical axis, and from the frequency of rotation we can relate the rotational inertia to the dimensions, and find a value of I... Date Added: 2009-06-01 20:28:55 |
| practiceexam2a.doc Path: Duke >> STA >> 101 Fall, 2008 Description: Statistics 101, Section 2: Practice Exam for Midterm II Instructions: Write your answers on the exam in the spaces after the questions. For maximum credit, show all work. Writing an answer without showing work may not receive full credit. You are p... Date Added: 2009-06-01 20:31:34 |
| lecture23.ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 101 Fall, 2008 Description: Physics 101: Lecture 23 Temperature and Ideal Gas q Todays lecture will cover Textbook Chapter 13.1-13.4 Hour exam2 curve: seescaled hour exams Hour e 3 xam Monday April 21 Lectures17-22 Review session, Sun. Apr. 20, 8pm, 100 MSEB uiuc.e Conf... Date Added: 2009-06-01 20:31:39 |
| Failed-induction.doc Path: Sanford-Brown Institute >> CS >> 016 Fall, 2009 Description: The following is an attempt at a detailed induction proof about the number of internal and external nodes of a binary tree. The theorem itself is true, but this particular approach to proving it doesn\'t work. Theorem: For a binary tree with n nodes (... Date Added: 2009-06-01 20:32:02 |
| lecture3-tolerantretrieval.ppt Path: UMBC >> CS >> 676 Spring, 2007 Description: CMSC 476/676 Chapter 3 Dictionaries and Tolerant Retrieval Recap of the previous lecture Tokenization problems: Hyphens, apostrophes, compounds, languages Numbers, case folding, stemming, lemmatization Encoding a tree-like structure in a postin... Date Added: 2009-06-01 20:33:18 |
| CH18_CLASS.ppt Path: Delaware >> MISY >> 830 Winter, 2008 Description: Chapter 18 KNOWLEDGE ACQUISITION, REPRESENTATION , AND REASONING Concepts of Knowledge Engineering Knowledge engineering The engineering discipline in which knowledge is integrated into computer systems to solve complex problems that normally requi... Date Added: 2009-06-01 20:34:23 |
| Barlow-ch14.ppt Path: CSU San Marcos >> PSYC >> 336 Fall, 2009 Description: Chapter 14 Developmental Disorders Developmental Psychopathology: An Overview Development Normal vs. Abnormal Psychopathology Etiology Course Developmental impact of early skill impairments Developmental Psychopathology: An Overview Developm... Date Added: 2009-06-01 20:35:06 |
| LEC_week_9-11-06.doc Path: Michigan State University >> STT >> 315 Fall, 2008 Description: STT 315 Exercises to be gone over in lectures M 9-11-06 and W 9-13-06 as part of the preparation for Exam 1 in recitations Thursday 9-14-06. Do not submit these. Remember, you may be called upon in lecture for +/- credit. 1. OIL. Suppose P(OIL) = 0.3... Date Added: 2009-06-01 20:35:40 |
| WBBJ_new_1_log.txt Path: Michigan State University >> D >> 2105 Fall, 2009 Description: Warning: parameter fixed_couplings not found setting it to default value T A PDF is used, so alpha_s(MZ) is going to be modified Old value of alpha_s from param_card: 0.118 New value of alpha_s from PDF cteq6l1: 0.13 ** * ... Date Added: 2009-06-01 20:35:45 |
| L20f.ppt Path: Rochester >> B >> 247 Fall, 2009 Description: 1 Lecture 20 -> 21 Outline I. What are general features of muscle and locomotion strategies (cont.) ? A. What are the main types of motility and locomotion? II. What properties determine muscle \"performance\" A. How are muscle size, speed, fatigue, a... Date Added: 2009-06-01 20:36:25 |
| Product1.doc Path: U. Houston >> CUIN >> 3112 Fall, 2008 Description: Product #1 Tuesday Sept. 9th It appears as though the NET standards and the TEKS are practically the same. Both the NETS and the TEKS have the same basic foundation for what is expected of the students at the various developmental levels. I noticed t... Date Added: 2009-06-01 20:37:24 |
| ComplexTest.txt Path: Cornell >> CS >> 211 Fall, 2008 Description: public class ComplexTest { public static void main(String[] args) { Comparable c1 = randomComplex(1,3); Comparable c2 = randomComplex(1,3); System.out.println(\"C1: \" + c1); System.out.println(\"C2: \" + c2); System.out.println(c1.compareTo(c2... Date Added: 2009-06-01 20:37:39 |
| F09.012.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F09.012 repeat_region no description available Chr09 205217.210644 tgttgtatctcaaaatgagatatgtcagtatgacaatacgtcaccctgaa cgttcataaaacacatatgaaacaaccttataacaaaacgaacaacatga gacaaaacccgaccttccctagctgaactacccaaagtataaatgcctga acaattagtttagatccgagattccgcg... Date Added: 2009-06-01 20:38:35 |
| manuresamplecollector.ppt Path: Wisconsin >> ENGR >> 160 Fall, 2009 Description: Manure Sample Collector Speakers: Arsenis Hadjiagapiou Andrew Burton John Lipor Matt Greuel Sonali Ray Lab Instructor: John Murphy Student Assistant: Jeff Lange Team Members: Justin Zingsheim, Theo Graphos, John Springmann, Andrew Timm, Ross Tillman... Date Added: 2009-06-01 20:41:57 |
| GBDII_ClientQuestionnaire.doc Path: Mt. Mercy >> INBS >> 540 Fall, 2009 Description: Bettini Week Two: Final Project Questionnaire Project Questionnaire: Gwen Bettini Designs 1 Project Questionnaire: Gwen Bettini Designs William L. Bettini Mercy College Web Site Management INBS-540 Bettini Project Questionnaire: Gwen Bettini Des... Date Added: 2009-06-01 20:49:55 |
| GBDII_ClientQuestionnaire.doc Path: Mt. Mercy >> WEEK >> 540 Fall, 2009 Description: Bettini Week Two: Final Project Questionnaire Project Questionnaire: Gwen Bettini Designs 1 Project Questionnaire: Gwen Bettini Designs William L. Bettini Mercy College Web Site Management INBS-540 Bettini Project Questionnaire: Gwen Bettini Des... Date Added: 2009-06-01 20:49:55 |
| lec7militaryleaders.ppt Path: East Los Angeles College >> HR >> 259 Fall, 2009 Description: Christian of Brunswick Ernst, Graf von Mansfeld Mansfeld\'s `Sweat-Bath\', 1622 Christian IV, King of Denmark Pappenheim Tilly Gustavus Adolphus, King of Sweden Bernhard of SaxeWeimar Turenne Johann von Werth ... Date Added: 2009-06-01 20:50:43 |
| Teaching Port Sections.doc Path: Illinois State >> ART >> 309 Fall, 2008 Description: Content Knowledge Interstate New Teachers Assessment Support Consortium (INTASC) Principle # 1 The teacher understands the central concepts, tools of inquiry, and structures of the discipline(s) he or she teaches and can create learning experiences t... Date Added: 2009-06-01 20:50:53 |
| 1_3_4.txt Path: SUNY Albany >> CSI >> 635 Fall, 2009 Description: 20 1 1 0 2 18 59 65 56 46 46 48 50 51 50 51 59 69 60 54 48 45 44 43 44 44 43 43 43 43 43 42 42 42 41 41 41 40 40 39 39 38 37 37 37 36 36 35 35 34 34 33 33 31 31 30 30 30 29 28 28 27 27 27 26 26 25 24 24 23 23 23 22 22 22 24 27 27 28 27 21 17 17 25 26... Date Added: 2009-06-01 20:52:46 |
| quaterback.doc Path: Iowa State >> MR >> 0915 Fall, 2009 Description: KCCI.com, IA 09-13-06 Wait Continues For Iowa\'s Quarterback Both Teams Are 2-0 IOWA CITY, Iowa - It\'s still wait and see for the University of Iowa\'s quarterback Drew Tate. Tate sat out last week\'s game against Syracuse University with an abdominal s... Date Added: 2009-06-01 20:53:18 |
| quaterback.doc Path: Iowa State >> PUBLIC >> 0915 Fall, 2009 Description: KCCI.com, IA 09-13-06 Wait Continues For Iowa\'s Quarterback Both Teams Are 2-0 IOWA CITY, Iowa - It\'s still wait and see for the University of Iowa\'s quarterback Drew Tate. Tate sat out last week\'s game against Syracuse University with an abdominal s... Date Added: 2009-06-01 20:53:18 |
| Intro to XSLT.ppt Path: Minnesota >> CSCI >> 4131 Spring, 2008 Description: Intro to XSL/XSLT/XPath An Introduction to eXtensible Stylesheet Language and Transformation and Navigation Acronym Primer XSL is a family of technologies: XSLT - Transformation XPath - Navigation XSL-FO Formatting (aka XSL) Copyright WolfWa... Date Added: 2009-06-01 21:00:06 |
| handout2.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:13 |
| handout3.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:13 |
| handout4.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:13 |
| handout5.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:13 |
| handout7.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:13 |
| handout1.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:13 |
| handout8.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout4.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout9.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout10.rtf Path: Middlebury >> PH >> 109 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout1.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout2.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout3.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:14 |
| handout10.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:15 |
| handout5.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:15 |
| handout7.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:15 |
| handout8.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:15 |
| handout9.rtf Path: Middlebury >> GL >> 104 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:15 |
| handout8.rtf Path: Middlebury >> FS >> 055 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:16 |
| handout9.rtf Path: Middlebury >> FS >> 055 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:16 |
| handout10.rtf Path: Middlebury >> FS >> 055 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:16 |
| handout1.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:16 |
| handout2.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout9.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout3.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout4.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout5.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout7.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout8.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:17 |
| handout10.rtf Path: Middlebury >> IS >> 454 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:18 |
| handout9.rtf Path: Middlebury >> BI >> 130 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:18 |
| handout10.rtf Path: Middlebury >> BI >> 130 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:18 |
| handout7.rtf Path: Middlebury >> MA >> 106 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:18 |
| handout8.rtf Path: Middlebury >> MA >> 106 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:19 |
| handout9.rtf Path: Middlebury >> MA >> 106 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:19 |
| handout10.rtf Path: Middlebury >> MA >> 106 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:19 |
| handout1.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:20 |
| handout3.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout4.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout5.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout7.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout8.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout2.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout9.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:21 |
| handout10.rtf Path: Middlebury >> MA >> 318 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:00:22 |
| Failed-induction.doc Path: Sanford-Brown Institute >> CSCI >> 0160 Fall, 2009 Description: The following is an attempt at a detailed induction proof about the number of internal and external nodes of a binary tree. The theorem itself is true, but this particular approach to proving it doesn\'t work. Theorem: For a binary tree with n nodes (... Date Added: 2009-06-01 21:05:17 |
| 20060320_Bettini_Week2_GBDQuestionnaire.doc Path: Mt. Mercy >> INBS >> 540 Fall, 2009 Description: Bettini Week Two: Final Project Questionnaire Project Questionnaire: Gwen Bettini Designs 1 Project Questionnaire: Gwen Bettini Designs William L. Bettini Mercy College Web Site Management INBS-540 Bettini Project Questionnaire: Gwen Bettini Des... Date Added: 2009-06-01 21:06:14 |
| handout1.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:56 |
| handout2.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:56 |
| handout5.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:57 |
| handout7.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:57 |
| handout8.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:57 |
| handout9.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:57 |
| handout3.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:57 |
| handout4.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:57 |
| handout1.rtf Path: Middlebury >> BI >> 195 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:58 |
| handout3.rtf Path: Middlebury >> BI >> 195 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:58 |
| handout7.rtf Path: Middlebury >> BI >> 195 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:58 |
| handout10.rtf Path: Middlebury >> FS >> 037 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:58 |
| handout7.rtf Path: Middlebury >> MA >> 113 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:59 |
| handout9.rtf Path: Middlebury >> BI >> 195 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:59 |
| handout10.rtf Path: Middlebury >> BI >> 195 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:59 |
| handout3.rtf Path: Middlebury >> MA >> 113 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:06:59 |
| handout9.rtf Path: Middlebury >> MA >> 113 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:07:00 |
| handout10.rtf Path: Middlebury >> MA >> 113 Fall, 2009 Description: This is an example Handout. ... Date Added: 2009-06-01 21:07:00 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 377 Fall, 2009 Description: 13079,28779,88,4433 \" 23356,24215,132,441 \' 27144,24237,132,152 , 12162,28801,44,33 , 15661,24193,155,152 , 13453,24259,44,305 - 27773,24237,132,203 - 26040,24215,155,900 -^ 25582,24237,132,356 -^ 28843,24326,44,339 . 26380,26785,88,118 .- 12655,28... Date Added: 2009-06-01 21:08:12 |
| hw2.ps Path: Washington University in St. Louis >> CS >> 201 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: hw2.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o hw2.ps hw2.dvi %DVIPSParameters: dpi=300, compressed, comm... Date Added: 2009-06-01 21:09:17 |
| Chapter 5 Handout.ppt Path: UNC Wilmington >> MKT >> 447 Fall, 2009 Description: Chapter Customer Perceptions of Service 5 Customer Perceptions Customer Satisfaction Service Quality five key dimensions Service Encounters: Moments of Truth Figure 5.1 Customer Perceptions of Quality and Customer Satisfaction McGrawHill/... Date Added: 2009-06-01 21:10:07 |
| 2006-05-31Strategic Victimhood in Sudan.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: May 31, 2006 Op-Ed Contributor Strategic Victimhood in Sudan By Alan J. Kuperman Austin, Tex. THOUSANDS of Americans who wear green wristbands and demand military intervention to stop Sudan\'s Arab government from perpetrating genocide against black ... Date Added: 2009-06-01 21:10:48 |
| ShneidermanChapter6.ppt Path: La Salle >> TEACH >> 650 Fall, 2009 Description: Chapter 6 Direct Manipulation and Virtual Environments 6.1 Introduction Good interfaces produce positive feelings Desirable: Visibility of objects Visibility of actions Rapid, reversible, incremental actions Direct manipulation of objects of ... Date Added: 2009-06-01 21:12:39 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 2681 Fall, 2009 Description: \" 38771,35771,458,880 (^ 41060,25765,1043,1655 274 18206,5855,1018,3274 ; 48667,11278,916,316 ; 39018,27879,891,352 a 37503,13443,687,915 about 47610,46388,636,4683 according 31200,44071,1374,8733 accounte 34721,54714,712,7254 aid 27538,54790,687,271... Date Added: 2009-06-01 21:13:41 |
| Ling448-asst2.doc Path: Penn State >> JML >> 448 Fall, 2009 Description: LINGUISTICS 448 (SOCIOLINGUISTICS GUIDELINES FOR ANALYSIS OF VISUAL SOURCE CHOOSE AN APPROPRIATE SOURCE (be sure to get my approval before proceeding with the analysis). This can be a film (DVD, VHS or 16 mm), a recording of a television program, or... Date Added: 2009-06-01 21:15:53 |
| 09.10.doc Path: UMass Lowell >> FACULTY >> 141 Fall, 2009 Description: [Go around with names] [Hand out time sheets] [Hand out / collect office hour compatibility sheets] Page 17: Note that the shift rule is easy to get backwards. Ditto with the stretch rule. Any questions about sections 1.1 and 1.2? Preparation for sec... Date Added: 2009-06-01 21:16:10 |
| bisc310all.txt Path: Sveriges lantbruksuniversitet >> SCI >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: BISC 310-3 ALL SECTIONS LOCATION: SFU OTH TITLE: PLANTS/ANIMALS-B.C. SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 5... Date Added: 2009-06-01 21:16:18 |
| bisc310all.txt Path: Sveriges lantbruksuniversitet >> BISC >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: BISC 310-3 ALL SECTIONS LOCATION: SFU OTH TITLE: PLANTS/ANIMALS-B.C. SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 5... Date Added: 2009-06-01 21:16:19 |
| Apr25.doc Path: UMass Lowell >> FACULTY >> 475 Fall, 2009 Description: Partitions of numbers (concluded): Let p_k (n) be the number of ways to write n as a sum of k positive integers, where order doesn\'t matter. Lemma 1: p_k (n) = p_k (n-k) + p_{k-1} (n-1) Lemma 2: p_k (n) is also equal to the number of partitions of n ... Date Added: 2009-06-01 21:16:44 |
| week1_presentation.ppt Path: Bergen CC >> EE >> 198 Fall, 2009 Description: Digital EECS98/198 Photography Nathan Yan DeCal About this course -Technology of Camera Systems -Photographic Technique -Digital Lightroom About Me ^-doesn\'t know anything about what he\'s talking about About You In case you were wondering, this is ... Date Added: 2009-06-01 21:18:07 |
| rozzi-CH1.ppt Path: North Texas >> PHIL >> 2500 Fall, 2008 Description: OverviewforOctober EarthsInsightsthroughOct.28th Syllabus: http:/www.phil.unt.edu/resources/syllabi/fall08/ MidtermonEarthsInsightsandStudentPowerpoints. Thursday,October30th Onechaptereachclass Studentpresentationsoneachchapter Pleaseemai... Date Added: 2009-06-01 21:19:14 |
| powerpoint.ppt Path: North Texas >> COURSEWEB >> 4100003 Fall, 2009 Description: 3 5 1 2 Fun with Fractions! By Amanda Story 9 13 4 7 Learning Objectives Write a fraction to describe what part of a region is shaded Identify the numerator and denominator Identify equal fractions TEKS 111.22. Mathematics, Grade 6. (a)... Date Added: 2009-06-01 21:19:18 |
| T-27a.pdf Path: GWU >> EBB >> 221 Fall, 2009 Description: ... Date Added: 2009-06-01 21:20:39 |
| 10_03_08.ppt Path: Colby >> PS >> 111 Fall, 2009 Description: Learning&BehaviorAnalysis 1. SimpleLearning(akaNon associativelearning) 1. ClassicalConditioning (akaPavlovianconditioning) 1. OperantConditioning 1. Simple forms of learning Habituation Gradual decrease in behavioral response to a stimulus 1. Sim... Date Added: 2009-06-01 21:22:41 |
| EE407-10Etch.pdf Path: Montana >> EE >> 407 Spring, 2008 Description: Week #5 Week #5 Photolithography Mask #2 n+ Etch Oxide Etch mask for n+ regions Montana State University TjK Reading: #11 1 Week #6 Week #6 RCA Clean n+ Diffusion Clean wafer and diffuse n+ regions for source and drain Montana Sta... Date Added: 2009-06-01 21:26:25 |
| 13816.txt Path: UCCS >> CS >> 591 Fall, 2009 Description: Rule - Sid 13816 - Summary: This event is generated when an attempt is made to exploit a known vulnerability in XML_RPC. - Impact: Denial of Service. Information disclosure. Loss of integrity. Complete admin access. - Detailed Information: Eval i... Date Added: 2009-06-01 21:26:58 |
| problem36_02.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 36.2: y1 = x x (0.600 m) (5.46 10 7 m) a = = 3.21 10 5 m. 3 a y1 10.2 10 m ... Date Added: 2009-06-01 21:28:21 |
| T0256.t04.bys-logo.pdf Path: UCSC >> T >> 0256 Fall, 2009 Description: T0256.t04 bys 5 4 3 2 1 E X Y PP G P S ELEHYPD P E Y T H H X XGPXNXNHGE XY P G E X EEE Y P Y X X X EP PE H D Y N X X X X X X X X X X X X 1 10 20 30 40 P E P H E 5 4 3 2 1 P S Y T X P E H D H G P E Y E P S G E P H G T P E P P PY... Date Added: 2009-06-01 21:29:13 |
| TR469.t04.near-backbone-11-logo.pdf Path: UCSC >> TR >> 469 Fall, 2009 Description: TR469.t04 near-backbone-11 4 3 2 1 3 10 20 30 40 A 4 3 2 1 J D G D I G D J G A G D G K G G A I A I H D H G H D G D I D I J G 53 B G A D K G E K 60 NV E DILRD LNALA G A 50 QK F TKDMT FAQALQTHPGVAGVLRSYN L GC I GC M G AQ N E S LE... Date Added: 2009-06-01 21:29:19 |
| 00000036.pdf Path: Carnegie Mellon >> TERA >> 05102785 Fall, 2009 Description: ... Date Added: 2009-06-01 21:38:30 |
| 00000036.pdf Path: Carnegie Mellon >> DISK >> 05102785 Fall, 2009 Description: ... Date Added: 2009-06-01 21:38:30 |
| week8_notes.pdf Path: Allan Hancock College >> ECTE >> 313 Fall, 2009 Description: ECTE313 Electronics Part II Week 8 Daniel R. Franklin ECTE313Electronics Part IIWeek 8 p. 1 Notes: Feedback in Ampliers - The End This week we will (really) nish off feedback with a look at ways to compensate for stability problems We will then s... Date Added: 2009-06-01 21:39:46 |
| 00000425.pdf Path: Carnegie Mellon >> TERA >> 05101040 Fall, 2009 Description: ... Date Added: 2009-06-01 21:42:56 |
| 00000425.pdf Path: Carnegie Mellon >> DISK >> 05101040 Fall, 2009 Description: ... Date Added: 2009-06-01 21:42:56 |
| 00000091.pdf Path: Carnegie Mellon >> TERA >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:11 |
| 00000091.pdf Path: Carnegie Mellon >> DISK >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:11 |
| 00000093.pdf Path: Carnegie Mellon >> TERA >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:13 |
| 00000093.pdf Path: Carnegie Mellon >> DISK >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:14 |
| 00000116.pdf Path: Carnegie Mellon >> TERA >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:23 |
| 00000116.pdf Path: Carnegie Mellon >> DISK >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:23 |
| 00000201.pdf Path: Carnegie Mellon >> DISK >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:59 |
| 00000201.pdf Path: Carnegie Mellon >> TERA >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:47:59 |
| 00000258.pdf Path: Carnegie Mellon >> TERA >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:48:29 |
| 00000258.pdf Path: Carnegie Mellon >> DISK >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:48:29 |
| 00000397.pdf Path: Carnegie Mellon >> TERA >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:49:36 |
| 00000397.pdf Path: Carnegie Mellon >> DISK >> 31004856 Fall, 2009 Description: ... Date Added: 2009-06-01 21:49:36 |
| 00000262.pdf Path: Carnegie Mellon >> TERA >> 31008261 Fall, 2009 Description: ... Date Added: 2009-06-01 21:56:40 |
| 00000018.pdf Path: Carnegie Mellon >> TERA >> 05101657 Fall, 2009 Description: ... Date Added: 2009-06-01 21:57:00 |
| 00000005.pdf Path: Carnegie Mellon >> TERA >> 31003480 Fall, 2009 Description: ... Date Added: 2009-06-01 21:58:21 |
| 00000229.pdf Path: Carnegie Mellon >> TERA >> 31003480 Fall, 2009 Description: ... Date Added: 2009-06-01 21:59:13 |
| 00000234.pdf Path: Carnegie Mellon >> TERA >> 31003480 Fall, 2009 Description: ... Date Added: 2009-06-01 21:59:14 |
| 00000072.pdf Path: Carnegie Mellon >> TERA >> 05102358 Fall, 2009 Description: ... Date Added: 2009-06-01 22:00:49 |
| 00000013.pdf Path: Carnegie Mellon >> TERA >> 31003794 Fall, 2009 Description: ... Date Added: 2009-06-01 22:01:42 |
| 00000013.pdf Path: Carnegie Mellon >> DISK >> 31003794 Fall, 2009 Description: ... Date Added: 2009-06-01 22:01:42 |
| 00000085.pdf Path: Carnegie Mellon >> TERA >> 31003791 Fall, 2009 Description: ... Date Added: 2009-06-01 22:03:44 |
| 00000004.pdf Path: Carnegie Mellon >> TERA >> 05101658 Fall, 2009 Description: ... Date Added: 2009-06-01 22:03:55 |
| 00000150.pdf Path: Carnegie Mellon >> TERA >> 31007860 Fall, 2009 Description: ... Date Added: 2009-06-01 22:05:02 |
| 00000150.pdf Path: Carnegie Mellon >> DISK >> 31007860 Fall, 2009 Description: ... Date Added: 2009-06-01 22:05:02 |
| 00000469.pdf Path: Carnegie Mellon >> TERA >> 31007860 Fall, 2009 Description: ... Date Added: 2009-06-01 22:06:35 |
| 00000469.pdf Path: Carnegie Mellon >> DISK >> 31007860 Fall, 2009 Description: ... Date Added: 2009-06-01 22:06:35 |
| 00000065.pdf Path: Carnegie Mellon >> TERA >> 05102541 Fall, 2009 Description: ... Date Added: 2009-06-01 22:07:36 |
| 00000065.pdf Path: Carnegie Mellon >> DISK >> 05102541 Fall, 2009 Description: ... Date Added: 2009-06-01 22:07:36 |
| 00000086.pdf Path: Carnegie Mellon >> TERA >> 31007438 Fall, 2009 Description: ... Date Added: 2009-06-01 22:09:40 |
| WhitneyM_2.pdf Path: Maryville MO >> ELE >> 282 Fall, 2009 Description: INTEGRA Dermal Regeneration Template Whitney Michalek November 9, 2005 Biomedical Engineering Seminar I The INTEGRA Dermal Regeneration Template is an artificial skin used as a treatment for life-threatening burn injuries, as well as for reconstructi... Date Added: 2009-06-01 22:13:00 |
| DaveM_1.pdf Path: Maryville MO >> ELE >> 382 Fall, 2009 Description: David Marcus BIO 382 09/26/05 Ultrasound Wearable System As we move farther and farther down the road of technology we create new and innovative ways to fix old problems. With broken bones we had to wait until our body healed itself. However, now sci... Date Added: 2009-06-01 22:13:13 |
| casey.pdf Path: Maryville MO >> ELE >> 535 Fall, 2009 Description: ... Date Added: 2009-06-01 22:14:34 |
| ex24.pdf Path: University of Illinois, Urbana Champaign >> AE >> 252 Spring, 2008 Description: ... Date Added: 2009-06-01 22:15:57 |
| Constants and Equations - Exam 2.pdf Path: Winthrop >> CHEM >> 105 Spring, 2008 Description: Useful Constants, Conversion Factors and Equations Constants and conversion factors: g = 9.8 m/s2 1 J = 1 kg m2/s2 h = 6.626 10-34 J.s 1 cal = 4.184 J c = 2.998 108 m/s 1 Cal = 1000 cal Equations: MiVi = MfVf EP = mgh E = q + w w = -PV q = mCT H =... Date Added: 2009-06-01 22:16:13 |
| hw1.pdf Path: Georgia Tech >> ME >> 3180 Fall, 2008 Description: GEORGIA INSTITUTE OF TECHNOLOGY George W. Woodruff School of Mechanical Engineering ME 3180 MANUFACTURING PROCESSES AND ENGINEERING Spring 2009 Homework #1 Due: Wednesday, January 14 Text problem 3-11 Text problem 3-38 Text problem 3-39 Text proble... Date Added: 2009-06-01 22:17:08 |
| problems07.pdf Path: RPI >> PHYS >> 2100 Fall, 2009 Description: PHYS-2100 Introduction to Methods of Theoretical Physics Homework Problem Set #7: Due Tuesday, October 19 at 5pm Fall 1999 1) A square pulse on a string with xed ends. A string of length L starts out from rest with a square kink with width a < L in... Date Added: 2009-06-01 22:21:17 |
| appdevwave80.pdf Path: Oakland University >> SOLARIS >> 801 Fall, 2009 Description: PV-WAVE 8.0 Application Developers Guide Helping Customers Solve Complex Problems Application Developers Guide P/N 10016 [ www.vni.com ] Copyright Visual Numerics, Inc. United States Corporate Headquarters 2000 Crow Canyon Place, Suite 270 San ... Date Added: 2009-06-01 22:21:22 |
| usccse2005-501.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Software Engineering Graduate Project Effort Analysis Report Zhihao Chen Center for Software Engineering, University of Southern California, Los Angeles 90089 California, USA {zhihaoch}@cse.usc.edu Abstract: In the graduate courses CSCI577ab, gradu... Date Added: 2009-06-01 22:25:11 |
| 4func.pdf Path: Sveriges lantbruksuniversitet >> ENSC >> 305 Fall, 2009 Description: Functional Specifications a World of Warcraft Input Device February 19, 2007 Lakshman One School of Engineering Science Simon Fraser University Burnaby, BC V5A 1S6 Re: ENSC 440 Functional Specifications for a World of Warcraft Input Device Dear Mr. O... Date Added: 2009-06-01 22:26:06 |
| bthdesi.pdf Path: Sveriges lantbruksuniversitet >> ENSC >> 305 Fall, 2009 Description: Beyond the Horizon School of Engineering Science Burnaby, BC V5A 1S6 staircraft-340@sfu.ca http:/www.staircraft.org November 9, 2000 Dr. Andrew Rawicz School of Engineering Science Simon Fraser University Burnaby, British Columbia V5A 1S6 Re: ENSC... Date Added: 2009-06-01 22:26:24 |
| difunc.pdf Path: Sveriges lantbruksuniversitet >> ENSC >> 305 Fall, 2009 Description: Functional Specification for a Dynamic Pupil in a Prosthetic Eye October 18, 2004 Dr. Andrew Rawicz School of Engineering Science Simon Fraser University Burnaby, British Columbia V5A 1S6 Re: ENSC 340 Functional Specifications for a Dynamic Pupil in ... Date Added: 2009-06-01 22:26:57 |
| 000426.pdf Path: Rose-Hulman >> CM >> 000000 Fall, 2009 Description: Material Safety Data Sheet acc. to OSHA and ANSI Printing date 06/23/1999 l Reviewed on 05/06/1999 1 Identification of substance: Product details: Trade name: Mercury (II) sulfide, red Stock number: 13482 Manufacturer/Supplier: Alfa Aesar, A John... Date Added: 2009-06-01 22:29:21 |
| homework03-part2.pdf Path: U. Houston >> MATH >> 3336 Fall, 2008 Description: Functions Exercise 1. Find the domain and range of these functions. Explain. a) the function that assigns to each negative integer its last digit; b) the function that assigns the next largest integer to a positive integer; b) the function that assig... Date Added: 2009-06-01 22:30:40 |
| 10-ActivationRecords-2x2.pdf Path: Princeton >> COS >> 320 Spring, 2009 Description: Midterm Exam! Lecture 10: Activation Records COS 320 Compiling Techniques Princeton University Spring 2007 Prof. David August 1 2 Closed book, notes In class, Thursday Guest Lecture Tuesday Activation Records The Stack 3 4 Example Example ... Date Added: 2009-06-01 22:31:17 |
| wmex116.pdf Path: Maryville MO >> PHY >> 520 Fall, 2009 Description: [mex116] Disk rolling on rotating track A disk of radius r and mass m rolls without slipping on a track of negligible mass which rotates with constant angular velocity . (a) Find the kinetic energy T (q, q). (b) Find the solution q(t) for initial co... Date Added: 2009-06-01 22:32:52 |
| ReadMe 20090222.doc Path: NYIT >> CSCI >> 300 Fall, 2009 Description: ReadMe 2/22/2009 Hi, Exam 1 is tomorrow, Monday, February 23, 2009. It covers Lectures 1, 2, and 3 which corresponds to Chapters 1, 2, and 3 in the textbook. You are permitted to use both sides of one sheet (up to 8.5 X 11) of notes during the exam.... Date Added: 2009-06-01 22:34:44 |
| 230.pdf Path: NYIT >> GB >> 355 Fall, 2009 Description: ... Date Added: 2009-06-01 22:35:59 |
| syl.ps Path: Earlham >> CS >> 310 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96.1 Copyright 2007 Radical Eye Software %Title: syl.dvi %CreationDate: Sat Aug 30 15:30:41 2008 %Pages: 5 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMR17 CMR12 CMTT12 CMSY10 CMBX10 CMR10 CMTI10 ... Date Added: 2009-06-01 22:40:59 |
| 511w03-ICN-030228v0.doc Path: USC >> CSCI >> 511 Fall, 2008 Description: USC C S E University of Southern California Center for Software Engineering CS511 Winter/Spring 2003 In Class Notes 02/28/03 2009 AW Brown & USC-CSE JP Alstad 252de30ead8719964418f9556951b135702e760b.doc1 252de30ead8719964418f9556951b135702e... Date Added: 2009-06-01 22:41:10 |
| ScreenShot.doc Path: Syracuse >> CSE >> 775 Spring, 2008 Description: DemoDialogOutput DemoDialogOutput ... Date Added: 2009-06-01 22:41:51 |
| run.doc Path: Syracuse >> CSE >> 775 Spring, 2008 Description: ... Date Added: 2009-06-01 22:42:09 |
| ReadMe.txt Path: Syracuse >> CSE >> 775 Spring, 2008 Description: = MICROSOFT FOUNDATION CLASS LIBRARY : WizFrameWin = AppWizard has created this WizFrameWin application for you. This application not only demonstrates the basics of using the Microsoft Foundation classes but is also a starting point for wr... Date Added: 2009-06-01 22:42:45 |
| ch10-LIDAR.doc Path: Eckerd >> ES >> 342 Fall, 2009 Description: ES 342 Remote Sensing: Ch 10 Analysis of LIDAR Imagery Due: Tuesday, April 21, 2009 Please turn in a hard copy at the beginning of class. Do not submit your assignment via email. After reading the chapter from the text, please answer the following q... Date Added: 2009-06-01 22:44:59 |
| 1.txt Path: Carnegie Mellon >> TERA >> 31005908 Fall, 2009 Description: 31005908... Date Added: 2009-06-01 22:46:08 |
| 1.txt Path: Carnegie Mellon >> TERA >> 31006475 Fall, 2009 Description: 31006475... Date Added: 2009-06-01 22:46:40 |
| 00000002.pdf Path: Carnegie Mellon >> DISK >> 05102492 Fall, 2009 Description: ... Date Added: 2009-06-01 22:47:31 |
| 00000002.pdf Path: Carnegie Mellon >> TERA >> 05102492 Fall, 2009 Description: ... Date Added: 2009-06-01 22:47:31 |
| 00000026.pdf Path: Carnegie Mellon >> TERA >> 05102492 Fall, 2009 Description: ... Date Added: 2009-06-01 22:47:38 |
| 00000026.pdf Path: Carnegie Mellon >> DISK >> 05102492 Fall, 2009 Description: ... Date Added: 2009-06-01 22:47:38 |
| 00000078.pdf Path: Carnegie Mellon >> TERA >> 05102492 Fall, 2009 Description: ... Date Added: 2009-06-01 22:48:12 |
| 00000078.pdf Path: Carnegie Mellon >> DISK >> 05102492 Fall, 2009 Description: ... Date Added: 2009-06-01 22:48:12 |
| 00000020.pdf Path: Carnegie Mellon >> TERA >> 05102488 Fall, 2009 Description: ... Date Added: 2009-06-01 22:49:33 |
| 00000020.pdf Path: Carnegie Mellon >> DISK >> 05102488 Fall, 2009 Description: ... Date Added: 2009-06-01 22:49:33 |
| plugin-Quiz3c Path: USC >> MATH >> 245 Spring, 2009 Description: Math245 Homework Quiz #3c, Spring 2009 circle section: llam, 12pm, Ipm Name: _ _ _ _ _ _ _ _ 1. (20pt) Find the general solution. y - y /I I 1 + -y = 4 0 (\'il-~ ~ . z 2.(20pt) Consider the initial-value problem with constant m. y\" + 3... Date Added: 2009-06-01 22:51:22 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 31003896 Fall, 2009 Description: ... Date Added: 2009-06-01 22:53:05 |
| 00000126.pdf Path: Carnegie Mellon >> TERA >> 31003896 Fall, 2009 Description: ... Date Added: 2009-06-01 22:53:27 |
| 00000281.pdf Path: Carnegie Mellon >> TERA >> 31003896 Fall, 2009 Description: ... Date Added: 2009-06-01 22:53:56 |
| 00000013.pdf Path: Carnegie Mellon >> TERA >> 05102364 Fall, 2009 Description: ... Date Added: 2009-06-01 22:54:14 |
| 00000097.pdf Path: Carnegie Mellon >> DISK >> 05103108 Fall, 2009 Description: ... Date Added: 2009-06-01 22:54:56 |
| 00000097.pdf Path: Carnegie Mellon >> TERA >> 05103108 Fall, 2009 Description: ... Date Added: 2009-06-01 22:54:56 |
| 00000093.pdf Path: Carnegie Mellon >> TERA >> 31003892 Fall, 2009 Description: ... Date Added: 2009-06-01 22:56:08 |
| 00000093.pdf Path: Carnegie Mellon >> DISK >> 31003892 Fall, 2009 Description: ... Date Added: 2009-06-01 22:56:08 |
| 00000319.pdf Path: Carnegie Mellon >> TERA >> 31003892 Fall, 2009 Description: ... Date Added: 2009-06-01 22:57:26 |
| 00000319.pdf Path: Carnegie Mellon >> DISK >> 31003892 Fall, 2009 Description: ... Date Added: 2009-06-01 22:57:26 |
| 00000211.pdf Path: Carnegie Mellon >> TERA >> 31003214 Fall, 2009 Description: ... Date Added: 2009-06-01 23:00:06 |
| 00000211.pdf Path: Carnegie Mellon >> DISK >> 31003214 Fall, 2009 Description: ... Date Added: 2009-06-01 23:00:06 |
| 00000053.pdf Path: Carnegie Mellon >> TERA >> 05102766 Fall, 2009 Description: ... Date Added: 2009-06-01 23:00:47 |
| 00000053.pdf Path: Carnegie Mellon >> DISK >> 05102766 Fall, 2009 Description: ... Date Added: 2009-06-01 23:00:47 |
| 00000016.pdf Path: Carnegie Mellon >> TERA >> 05102498 Fall, 2009 Description: ... Date Added: 2009-06-01 23:01:39 |
| 00000008.pdf Path: Carnegie Mellon >> TERA >> 05102500 Fall, 2009 Description: ... Date Added: 2009-06-01 23:02:07 |
| 00000046.pdf Path: Carnegie Mellon >> TERA >> 05103116 Fall, 2009 Description: ... Date Added: 2009-06-01 23:02:28 |
| 00000046.pdf Path: Carnegie Mellon >> DISK >> 05103116 Fall, 2009 Description: ... Date Added: 2009-06-01 23:02:28 |
| 00000016.pdf Path: Carnegie Mellon >> TERA >> 05101918 Fall, 2009 Description: ... Date Added: 2009-06-01 23:02:57 |
| 00000016.pdf Path: Carnegie Mellon >> DISK >> 05101918 Fall, 2009 Description: ... Date Added: 2009-06-01 23:02:57 |
| 00000046.pdf Path: Carnegie Mellon >> TERA >> 05102465 Fall, 2009 Description: ... Date Added: 2009-06-01 23:04:25 |
| 00000046.pdf Path: Carnegie Mellon >> DISK >> 05102465 Fall, 2009 Description: ... Date Added: 2009-06-01 23:04:25 |
| 00000081.pdf Path: Carnegie Mellon >> DISK >> 05102465 Fall, 2009 Description: ... Date Added: 2009-06-01 23:04:35 |
| 00000081.pdf Path: Carnegie Mellon >> TERA >> 05102465 Fall, 2009 Description: ... Date Added: 2009-06-01 23:04:35 |
| 00000362.pdf Path: Carnegie Mellon >> TERA >> 31003213 Fall, 2009 Description: ... Date Added: 2009-06-01 23:05:51 |
| 00000015.pdf Path: Carnegie Mellon >> TERA >> 31003843 Fall, 2009 Description: ... Date Added: 2009-06-01 23:06:21 |
| 00000015.pdf Path: Carnegie Mellon >> DISK >> 31003843 Fall, 2009 Description: ... Date Added: 2009-06-01 23:06:21 |
| 00000072.pdf Path: Carnegie Mellon >> TERA >> 31003843 Fall, 2009 Description: ... Date Added: 2009-06-01 23:06:43 |
| 00000072.pdf Path: Carnegie Mellon >> DISK >> 31003843 Fall, 2009 Description: ... Date Added: 2009-06-01 23:06:43 |
| 00000111.pdf Path: Carnegie Mellon >> TERA >> 31003843 Fall, 2009 Description: ... Date Added: 2009-06-01 23:06:56 |
| 00000111.pdf Path: Carnegie Mellon >> DISK >> 31003843 Fall, 2009 Description: ... Date Added: 2009-06-01 23:06:56 |
| 00000019.pdf Path: Carnegie Mellon >> TERA >> 05102502 Fall, 2009 Description: ... Date Added: 2009-06-01 23:11:20 |
| 00000145.pdf Path: Carnegie Mellon >> TERA >> 31006968 Fall, 2009 Description: ... Date Added: 2009-06-01 23:12:43 |
| 00000105.pdf Path: Carnegie Mellon >> TERA >> 31005431 Fall, 2009 Description: ... Date Added: 2009-06-01 23:13:15 |
| 2808TC.pdf Path: Michigan State University >> LIB >> 1928 Fall, 2009 Description: THE BULLETIN of the UNITED STATES GOLF ASSOCIATION GREEN SECTION Vol. 8 . Washington, D. C , August, 1928 Contents The Construction Period in the History of a Golf Course Golf Course ConstructionBy Kenneth Welton T H E A I M S OF GOOD CONSTRUCTION E... Date Added: 2009-06-01 23:17:47 |
| 2210278.pdf Path: Michigan State University >> LIB >> 1922 Fall, 2009 Description: 278 BUI~I~ETIN O:B\'GREEN SECTION OF THE Vol. II. No. 10 Sensible Golf That a $100,000 course is in no rl\'spect eSRl\'ntial to golf has again been demonstrated at Napoleon, Ohio, a town of about five thousand people, on the banks of the Maumee River... Date Added: 2009-06-01 23:18:33 |
| quiz22_soln_s06.pdf Path: SHSU >> MATH >> 142 Fall, 2009 Description: Math 142 Spring, 2006 Quiz 22 - 5.1, 5.2 Name: Solutions Complete the following problems. Show all work to receive full credit. 1. An object is dropped straight down from a helicopter. The object falls faster and faster but is acceleration decrease... Date Added: 2009-06-01 23:23:07 |
| Assignment_Linux.docx Path: Loras >> CIT >> 051423 Fall, 2009 Description: Linux Assignment Log into the http:/busweb.loras.edu/ web server using a telnet/ssh client program such as put ty. Edit the index.html file in your main directory using the pico editor Set the index.html file so it has links to the following: Your h... Date Added: 2009-06-01 23:24:07 |
| AL.docx Path: Loras >> LIB >> 338470 Fall, 2009 Description: Ryan Gerdes Gen Ed Portfolio 1/31/08 Active Lea rning I believe a person cannot t ruly call themselves educated unless he/she has demonstrated broad areas of interest. Although specialization in a particular field is important when entering the work... Date Added: 2009-06-01 23:24:40 |
| accessing internet.doc Path: Syracuse >> CSE >> 775 Spring, 2008 Description: ... Date Added: 2009-06-01 23:26:11 |
| 181-mid2-Spr2008-C.pdf Path: Delaware >> CIS >> 181 Fall, 2009 Description: Every problem starts with the same picture. Given the code, modify the picture to show what happens. Be sure to struct Node { 1) cross out pointers that go away; int data; 2) add any new pointers, structs, or data; Node * next; 3) follow the code, no... Date Added: 2009-06-01 23:27:04 |
| lab6.doc Path: Delaware >> EE >> 309 Fall, 2009 Description: Names _ Date _ Lab 6 The Common-Emitter Amplifier Introduction The purpose of this experiment is to demonstrate the operational characteristics of a small signal common emitter amplifier with a 180 degree phase shift. The input is applied to the ... Date Added: 2009-06-01 23:27:47 |
| hw2.pdf Path: Delaware >> EE >> 309 Fall, 2009 Description: ... Date Added: 2009-06-01 23:28:02 |
| levsol.doc Path: Charleston Law >> INFO >> 383 Fall, 2009 Description: BU383 Leverage Questions Leverage Questions Solutions Question 1 (20 Marks) InfoRom is a manufacturer and distributor of computer CD-Roms. Currently, they are using a rather manual process that has variable costs of $10.00 per disk and fixed cost... Date Added: 2009-06-01 23:29:09 |
| Chap9.ppt Path: Cal Poly Pomona >> PSY >> 335 Fall, 2009 Description: BHS 499-07 Memory and Amnesia Semantic Long-Term Memory Semantic Memory Semantic memory is general knowledge of the world. Are dogs safe? What happens in a restaurant? Generalizations that can apply to a variety of situations built from pr... Date Added: 2009-06-01 23:33:11 |
| GI-tract-objectives.pdf Path: UGA >> PHRM >> 3460 Fall, 2008 Description: GASTROINTESTINAL (GI) TRACT Pathophysiology II Dr. James V. Bruckner Room 356 bruckner@rx.uga.edu 542-5405 Chapter 24 in Seeley, Stephens & Tate 8th Edition FIRST LEARNING OBJECTIVES Get on intimate te... Date Added: 2009-06-01 23:34:05 |
| AntiderivativePost.ppt Path: Adelphi >> M >> 141 Fall, 2009 Description: Calculus I - Fall 2008 Section 4.8: The Antiderivative Antiderivative Definition We say F(x) is an antiderivative of f(x) if F(x) = f(x). Guiding question: Given a function f(x), what function F(x) did we take the derivative of to get f(x)? Exe1... Date Added: 2009-06-01 23:36:03 |
| BUS3500Class19.ppt Path: N.E. Illinois >> BUS >> 3500 Fall, 2009 Description: Managing Information Systems For Strategic Advantage (Part 2) (Week 12, Monday 11/7/2006) BUS3500 Abdou Illia, Fall 2006 1 LEARNING GOALS Describe the methods organizations use to choose strategic IS projects Balanced scorecard Tot... Date Added: 2009-06-01 23:37:33 |
| BUS3500FinalReviewF07.pdf Path: N.E. Illinois >> BUS >> 3500 Fall, 2009 Description: Final Exam Review (Part 2) (Thursday 12/6/2007) BUS3500 - Abdou Illia, Fall 2007 1 LEARNING GOALS Understand the advantages of a LAN vs. stand-alone computers. Identify hardware and software needed to implement a LAN. Choose between P2P and C/S Un... Date Added: 2009-06-01 23:37:36 |
| 00000030.pdf Path: Carnegie Mellon >> TERA >> 05101649 Fall, 2009 Description: ... Date Added: 2009-06-01 23:38:25 |
| ele_0240860000.pdf Path: Maryville MO >> D >> 024086 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Elementary Students (3-5) Frequency Distribution Report KEARNEY R-I School District Please select your Grade Level grade Frequency Percent 3 4 5 198 253 242 28.57 36.51 34.92 1 I am a: boy/girl sex Frequency Percent ... Date Added: 2009-06-01 23:40:49 |
| ele_0691040000.pdf Path: Maryville MO >> D >> 069104 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Elementary Students (3-5) Frequency Distribution Report MIDDLE GROVE C-1 School District Please select your Grade Level grade Frequency Percent 3 4 5 4 8 5 23.53 47.06 29.41 1 I am a: boy/girl sex Frequency Percent B... Date Added: 2009-06-02 20:03:34 |
| sup_0391350000.pdf Path: Maryville MO >> D >> 039135 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Support Staff Frequency Distribution Report ASH GROVE R-IV School District What is your sex? sup1 Frequency Percent MALE FEMALE 6 27 18.18 81.82 1 Frequency Missing = 1 Which best describes you? sup2 Frequency Percen... Date Added: 2009-06-02 20:05:13 |
| prt_0130540000.pdf Path: Maryville MO >> D >> 013054 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Parents Frequency Distribution Report BRECKENRIDGE R-I School District In what grade is your child? PRt1 Frequency Percent K-1 2ND 3RD 4TH 5TH 6TH 7TH 8TH 9TH 10TH 11TH 12TH 9 4 6 7 6 8 7 7 4 3 5 3 13.04 5.80 8.70 10.1... Date Added: 2009-06-02 20:09:34 |
| ele_0240904040.pdf Path: Maryville MO >> D >> 024090 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Elementary Students (3-5) Frequency Distribution Report FRANKLIN ELEM., LIBERTY 53 School District Please select your Grade Level grade Frequency Percent 3 4 5 44 40 38 36.07 32.79 31.15 1 I am a: boy/girl sex Freque... Date Added: 2009-06-02 20:10:11 |
| mid_0620704020.pdf Path: Maryville MO >> D >> 062070 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Mid Level Students (6-8) Frequency Distribution Report MARQUAND ELEM., MARQUAND-ZION R-VI School District Please select your Grade Level mid_grade Frequency Percent 6 13 100.00 1 What is your sex? mid1 Frequency Perc... Date Added: 2009-06-02 20:11:21 |
| mid_0370373000.pdf Path: Maryville MO >> D >> 037037 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Mid Level Students (6-8) Frequency Distribution Report OWENSVILLE MIDDLE, GASCONADE CO. R-II School District Please select your Grade Level mid_grade Frequency Percent 6 7 8 147 136 133 35.34 32.69 31.97 1 What is yo... Date Added: 2009-06-02 20:13:41 |
| 00000045.pdf Path: Carnegie Mellon >> TERA >> 05102068 Fall, 2009 Description: ... Date Added: 2009-06-02 20:15:34 |
| 00000013.pdf Path: Carnegie Mellon >> TERA >> 05101938 Fall, 2009 Description: ... Date Added: 2009-06-02 20:16:28 |
| 00000005.pdf Path: Carnegie Mellon >> TERA >> 05101806 Fall, 2009 Description: ... Date Added: 2009-06-02 20:16:36 |
| 00000031.pdf Path: Carnegie Mellon >> TERA >> 05101805 Fall, 2009 Description: ... Date Added: 2009-06-02 20:18:25 |
| 19611018_0000030843.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: . . . . . . . . . . 2 8 O C T 1961 I have your letter of U October and want to l e t you know hov much I sppreciate the kind t h o w t o eacgrossed by y ~ snd p x r staffr u I . . ._ . Auen w Thillcs . - ... Date Added: 2009-06-02 20:19:37 |
| 19620319_0000482719.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: 1 . . J\' .- 19 March 1962 i I concerning your f o r t h c d n g t r i p for t quiring w h a t reservations stay in London; asd suggesting that you might wish t o see add your &me t o the c world f o r the Defense Committee, but f reply you was... Date Added: 2009-06-02 20:20:04 |
| Homework 3 Solution.pdf Path: Penn State >> STAT >> 415 Fall, 2008 Description: Extra Problem 1 a).0.025 b). 0.025 c).0.05 d).0.59 Extra problem 2 a). 0.95 b). 0.01 c). 0.025 d). 0.925 Extra problem 3 T 2 = Z 2 /(U / r ) and Z 2 is 2 (1) . Thus T2 = Z 2 /1 is F(1,r) U /r ... Date Added: 2009-06-02 20:21:07 |
| m121q4a04.pdf Path: La Sierra >> M >> 121 Fall, 2009 Description: Math 121, Quiz 4, 25 October 2004 Name: Instructions. Complete questions 1(a), 2, 3(a) and 4. The others are for practice. 1. Determine the far right and far left behavior of the polynomials: (a) P (x) = -x7 + 2000000x5 + 7x2 - 12. (b) Q(x) = 10x4 - ... Date Added: 2009-06-02 20:21:47 |
| HM2 SP03.doc Path: Washington >> MSIS >> 512 Fall, 2009 Description: Rice Due April 30 Homework #2: Should We Do the Project? MSIS Econ-Finance Spring 2003 I. A widget manufacturer currently produces 200,000 units per year. It buys widget lids from an outside supplier at a price of $2 a lid. The plant manager believ... Date Added: 2009-06-02 20:23:09 |
| on Personal Essay Film.pdf Path: NC Arts >> MIS >> 330 Fall, 2009 Description: ... Date Added: 2009-06-02 20:23:30 |
| Special Assign Sampling Theorem.doc Path: Dallas >> CPB >> 021000 Fall, 2008 Description: Sampling Theorem Special Assignment Read Class Notes, and any additional information you can find on the Sampling Theorem in Proakis. For example, you can read Soliman & Srinath Chapter 4.4.3 pp. 194-199, Chapter 7.5-7.51 pp. 351-357. Read Introducti... Date Added: 2009-06-02 20:24:02 |
| Problem 6.pdf Path: Dallas >> CPB >> 021000 Fall, 2008 Description: SYSTEMS AND CONTROL HW #5 6. Using the Bode plots shown: (a) (b) (c) (d) Sketch the asymptotes Mark the breakpoints. Determine the slopes of the asymptotes. on the Bode plots shown below. Identify the frequency response components ... Date Added: 2009-06-02 20:24:29 |
| artsci.pdf Path: USF >> CAT >> 0001 Fall, 2009 Description: COLLEGE OF ARTS AND SCIENCES UNIVERSITY OF SOUTH FLORIDA - 2000/2001 UNDERGRADUATE CATALOG The College of Arts and Sciences is a community of scholars dedicated to the idea that educated people are the basis of a just and free society. The essences ... Date Added: 2009-06-02 20:25:27 |
| rfc305.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group Ralph Alter RFC #305 BBN NIC #9078 23 February 1972 UNKNOWN HOST NUMBERS ... Date Added: 2009-06-02 20:28:14 |
| rfc3817.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group W. Townsley Request for Comments: 3817 cisco Systems Category: Informational R. da Silva ... Date Added: 2009-06-02 20:29:03 |
| rfc736.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: NWG/RFC# 736 MRC 31-OCT-77 23:28 42213 Telnet SUPDUP Option Network Working Group Mark Crispin Request for Comments 736 SU-AI NIC 42... Date Added: 2009-06-02 20:29:11 |
| rfc1188.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group D. Katz Request for Comments: 1188 Merit/NSFNET Obsoletes: RFC 1103 October 1990 A Propose... Date Added: 2009-06-02 20:32:42 |
| slac-pub-5827.pdf Path: Stanford >> PUBS >> 5750 Fall, 2009 Description: SLAC-PUB-5827 GSI-92-35 May 1992 CW .^ SyStematics _ _, .- of Charm Production R. Vogt in Hadronic Collisions Gesellschaft fiir Schwerionenforschung (GSI) D-W-6100 Darmstadt, Germany S. J. Brodsky* Stanford Linear Accelerator Center Stanford Uni... Date Added: 2009-06-02 20:33:44 |
| 2.2 Graphs of Equations.doc Path: Miami Dade >> FACULTY >> 1105 Fall, 2009 Description: 2.2: Graphs of Equations The graph of an equation is the set of all points that satisfy the equation. For two-variable graphs, to find some of the points, substitute some numbers for x and solve for y. Be sure to find sufficient points to show the pa... Date Added: 2009-06-02 20:34:28 |
| Ch04.ppt Path: WPUNJ >> CS >> 230 Fall, 2008 Description: 4 Using C+ Functions Object-Oriented Programming Using C+ Second Edition 4 Objectives In this chapter, you will learn: About using function How to use procedural abstraction About scope rules How to construct function headers and prototypes H... Date Added: 2009-06-02 20:37:07 |
| m-alloc.pdf Path: Virgin Islands >> CSC >> 360 Fall, 2009 Description: CSc 360 Operating Systems Memory Allocation Jianping Pan Summer 2006 6/28/06 CSc 360 1 Review Memory access 6/28/06 CSc 360 2 1 Contiguous allocation Single-partition allocation one for OS the other one for user process Multi-partition a... Date Added: 2009-06-02 20:40:05 |
| 00000132.pdf Path: Carnegie Mellon >> TERA >> 31004157 Fall, 2009 Description: ... Date Added: 2009-06-02 20:42:45 |
| 00000312.pdf Path: Carnegie Mellon >> TERA >> 31004155 Fall, 2009 Description: ... Date Added: 2009-06-02 20:44:52 |
| 00000312.pdf Path: Carnegie Mellon >> DISK >> 31004155 Fall, 2009 Description: ... Date Added: 2009-06-02 20:44:53 |
| 00000033.pdf Path: Carnegie Mellon >> TERA >> 05102202 Fall, 2009 Description: ... Date Added: 2009-06-02 20:45:44 |
| 00000112.pdf Path: Carnegie Mellon >> TERA >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:46:31 |
| 00000112.pdf Path: Carnegie Mellon >> DISK >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:46:31 |
| 00000382.pdf Path: Carnegie Mellon >> TERA >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:47:50 |
| 00000382.pdf Path: Carnegie Mellon >> DISK >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:47:50 |
| 00000418.pdf Path: Carnegie Mellon >> TERA >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:48:00 |
| 00000418.pdf Path: Carnegie Mellon >> DISK >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:48:00 |
| 00000442.pdf Path: Carnegie Mellon >> TERA >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:48:06 |
| 00000442.pdf Path: Carnegie Mellon >> DISK >> 31003390 Fall, 2009 Description: ... Date Added: 2009-06-02 20:48:06 |
| 00000042.pdf Path: Carnegie Mellon >> TERA >> 05101770 Fall, 2009 Description: ... Date Added: 2009-06-02 20:50:36 |
| 00000042.pdf Path: Carnegie Mellon >> DISK >> 05101770 Fall, 2009 Description: ... Date Added: 2009-06-02 20:50:37 |
| 00000077.pdf Path: Carnegie Mellon >> TERA >> 31003876 Fall, 2009 Description: ... Date Added: 2009-06-02 20:51:09 |
| 00000077.pdf Path: Carnegie Mellon >> DISK >> 31003876 Fall, 2009 Description: ... Date Added: 2009-06-02 20:51:09 |
| 00000092.pdf Path: Carnegie Mellon >> DISK >> 31003396 Fall, 2009 Description: ... Date Added: 2009-06-02 20:56:06 |
| 00000092.pdf Path: Carnegie Mellon >> TERA >> 31003396 Fall, 2009 Description: ... Date Added: 2009-06-02 20:56:06 |
| 00000058.pdf Path: Carnegie Mellon >> TERA >> 05101953 Fall, 2009 Description: ... Date Added: 2009-06-02 20:56:40 |
| 00000126.pdf Path: Carnegie Mellon >> TERA >> 05101953 Fall, 2009 Description: ... Date Added: 2009-06-02 20:56:52 |
| 00000048.pdf Path: Carnegie Mellon >> TERA >> 31004029 Fall, 2009 Description: ... Date Added: 2009-06-02 20:58:42 |
| 00000282.pdf Path: Carnegie Mellon >> TERA >> 31004274 Fall, 2009 Description: ... Date Added: 2009-06-02 21:01:04 |
| 00000282.pdf Path: Carnegie Mellon >> DISK >> 31004274 Fall, 2009 Description: ... Date Added: 2009-06-02 21:01:04 |
| 00000049.pdf Path: Carnegie Mellon >> TERA >> 31004268 Fall, 2009 Description: ... Date Added: 2009-06-02 21:01:23 |
| 00000049.pdf Path: Carnegie Mellon >> DISK >> 31004268 Fall, 2009 Description: ... Date Added: 2009-06-02 21:01:23 |
| 00000100.pdf Path: Carnegie Mellon >> TERA >> 31004268 Fall, 2009 Description: ... Date Added: 2009-06-02 21:01:37 |
| 00000100.pdf Path: Carnegie Mellon >> DISK >> 31004268 Fall, 2009 Description: ... Date Added: 2009-06-02 21:01:37 |
| 00000070.pdf Path: Carnegie Mellon >> TERA >> 31004381 Fall, 2009 Description: ... Date Added: 2009-06-02 21:03:41 |
| 00000066.pdf Path: Carnegie Mellon >> TERA >> 05102637 Fall, 2009 Description: ... Date Added: 2009-06-02 21:04:47 |
| 00000066.pdf Path: Carnegie Mellon >> DISK >> 05102637 Fall, 2009 Description: ... Date Added: 2009-06-02 21:04:48 |
| 00000011.pdf Path: Carnegie Mellon >> TERA >> 05101097 Fall, 2009 Description: ... Date Added: 2009-06-02 21:06:18 |
| 00000057.pdf Path: Carnegie Mellon >> TERA >> 31004380 Fall, 2009 Description: ... Date Added: 2009-06-02 21:08:58 |
| 00000041.pdf Path: Carnegie Mellon >> TERA >> 05101250 Fall, 2009 Description: ... Date Added: 2009-06-02 21:09:45 |
| 00000241.pdf Path: Carnegie Mellon >> TERA >> 31003979 Fall, 2009 Description: ... Date Added: 2009-06-02 21:10:52 |
| 00000091.pdf Path: Carnegie Mellon >> TERA >> 31004324 Fall, 2009 Description: ... Date Added: 2009-06-02 21:13:13 |
| 00000091.pdf Path: Carnegie Mellon >> DISK >> 31004324 Fall, 2009 Description: ... Date Added: 2009-06-02 21:13:13 |
| 00000108.pdf Path: Carnegie Mellon >> TERA >> 31003978 Fall, 2009 Description: ... Date Added: 2009-06-02 21:16:14 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
