Course Solutions And Notes - everettc 25
| Ephedra trifurca Path: Texas A&M >> RLEM >> 304 Spring, 2008 Description: Ephedra trifurca Classification Information Family: Ephedraceae Genus: Ephedra Identification Data Stems jointed Leaves 5 mm long or longer Gray with age and shredded Terminal buds spinose Common Name: Mormon tea ... Date Added: 2008-03-27 13:56:44 |
| AppendixC.pdf Path: Virginia Tech >> LIB >> 12082001 Fall, 2008 Description: Appendix C Code Book Strategic Planning and Organizational Learning at NASA C-1 Strategic Planning and Organizational Learning at NASA C-2 Strategic Planning and Organizational Learning at NASA C-3 Strategic Planning and Organizational Learnin... Date Added: 2009-02-18 01:18:14 |
| 1737.126.ps Path: Hawaii >> SOEST >> 1737 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207372345.0388276 Float: 1737 Profile: 126 Location: 31.5N 160.8E Date: 03/09... Date Added: 2009-02-17 20:17:11 |
| engl104lesson12 Path: UIllinois >> ENGL >> 104 W Spring, 2008 Description: Kyle King Engl. 104 Lesson 12 Essay 4/4/07 \"All right, Mr. DeMille, I\'m ready for my close up.\" This famous line from Sunset Boulevard must have been repeated several times over by the characters in La Passion de Jeanne D\'Arc. It is traditional in fi... Date Added: 2008-04-07 21:18:13 |
| 1996scan101.pdf Path: Cornell >> HORT >> 636 Fall, 2008 Description: ... Date Added: 2009-01-09 07:55:16 |
| 1996scan101.pdf Path: Cornell >> HORT >> 115 Spring, 2008 Description: ... Date Added: 2009-01-09 07:55:15 |
| 1996scan101.pdf Path: Cornell >> HORT >> 243 Fall, 2008 Description: ... Date Added: 2009-01-09 07:55:15 |
| 1996scan101.pdf Path: Cornell >> HORT >> 499 Fall, 2008 Description: ... Date Added: 2009-01-09 07:55:15 |
| ch05 Finance.ppt Path: Clemson >> M B A >> 819 Fall, 2008 Description: Introduction to Valuation: The Time Value of Money Chapter Five Key Concepts and Skills Be able to compute the future value of an investment made today Be able to compute the present value of cash to be received at some future date Be able to comput... Date Added: 2009-02-02 13:54:55 |
| 063-093.pdf Path: DeAnza College >> PSYC >> 063 Fall, 2008 Description: COLLEGE OF ARTS AND SCIENCES DEAN: Frank E. Scully, Jr., Ph.D. OFFICE: 202 Bobet Hall ASSOCIATE DEANS: Laurie M. Joyner, Ph.D., Thomas A. Smith, Ph.D. UNIVERSITY HONORS PROGRAM DIRECTOR: William T. Cotton, Ph.D. WRITING ACROSS THE CURRICULUM PROGRAM ... Date Added: 2009-02-02 14:04:40 |
| dist.pdf Path: Texas Tech >> ISQS >> 5347 Fall, 2008 Description: 1DPH 6SHFLDO 7\\SHV RI \'LVFUHWH \'LVWULEXWLRQV I; [ 0HDQ I; b S I; IRU [ RU S S 9DULDQFH S b S %HUQRXOOL ZLWK SDUDPHWHU S %LQRPLDO ZLWK SDUDPHWHUV S DQG Q +\\SHUJHRPHWULF ZLWK SDUDPHWHUV Q 1 U DQG Z 1 b U 3RLVVRQ ZLWK SDUDPHWHU w bQc [ Qb[ [ ... Date Added: 2009-04-15 20:06:46 |
| 132A_F97_Exam1.pdf Path: UCLA >> CHEM >> 30A Fall, 2008 Description: ORGANIC CHEMISTRY 132A (Prof. Yves Rubin) UCLA, FALL 1997 MIDTERM EXAM I On my honor, I have neither given nor received any aid on this exam (Please sign in ink, this page only): _ Signature _ I. D. Number _ Full Name (Please Print !) Circle the... Date Added: 2009-01-09 19:51:06 |
| psychoanalytic_personality_tests.pdf Path: La Verne >> PSY >> 215 Fall, 2009 Description: PSY 215 Theories of Personality Psychoanalytic Personality Test Instructions: 1) Have an individual sitting near you draw an animal, any animal they wish, in the space below. Ask them to be as detailed as they can, and remind them that they do not ha... Date Added: 2009-04-15 23:31:59 |
| flusher_sc.pdf Path: Michigan State University >> ME >> 332 Fall, 2008 Description: ME332 Group Project Summer 2000 Figure 1: Flusher schematic with dimensions. height of water in the main holding tank o fthe flusher 4.50 4.00 3.50 height (inches) 3.00 2.50 2.00 1.50 1.00 0.50 0 10 20 30 40 50 60 time (sec) Figure 2: Experim... Date Added: 2009-01-11 16:36:49 |
| update_april.pdf Path: IUPUI >> PHIL >> 328 Fall, 2008 Description: UPDATE Vol. XXXIV, No. 4 C. Coleman Harris U.S. Department of Education April 2004 =-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= DATES TO REMEMBER May June 1 Contact National FFA Center for online membership in 05-06 15 ... Date Added: 2009-02-02 14:33:30 |
| exam2Bs.pdf Path: Concordia Moorhead >> MATH >> 121 Fall, 2009 Description: Lenarz Math 121 Exam #2 Form B October 29, 2007 Name: Directions: Answer the following questions in the space provided. You may not use a calculator. If you do not show your work, you will receive no credit. The point value of each question is ind... Date Added: 2009-04-15 23:23:42 |
| bibliography.pdf Path: Rutgers >> CWGL >> 03 Fall, 2008 Description: 16 DAYS OF ACTIVISM AGAINST GENDER VIOLENCE November 25 - December 10 Bibliography and Resource List Afkhami, Mahnaz and Haleh Vaziri. (1996) Claiming Our Rights: A Manual for Womens Human Rights Education in Muslim Societies, Bethesda, Maryland, US... Date Added: 2009-02-04 14:55:19 |
| ee357_hw1_sol Path: USC >> EE >> 357 Fall, 2008 Description: EE 357 Homework 1 Fall 08 Dubois Name: _ Due: Fri. Aug. 29th by 5PM on blackboard Score: _ Note: Attach all work to receive full credit /100 _ Data Representation 1.) (20) Each C declaration of the variable x is initialized to a value in decimal. S... Date Added: 2009-04-11 13:04:53 |
| Lecture9_exceptions Path: Michigan >> EECS >> 215 Winter, 2008 Description: Lecture 9 Exceptions! E i ! What happens when something pp g goes wrong? Z. Morley Mao Wednesday Feb 6 , 2008 Wednesday Feb 6th, 2008 61 Some slides from Copyright 2008 Pearson AddisonWesley. All rights reserved Exception handling Exception hand... Date Added: 2008-04-04 14:46:42 |
| 04-03-UML-class-notes Path: Michigan State University >> CSE >> 435 Fall, 2007 Description: The OO Solution The OO model closely resembles the problem domain Base your model on the objects in the problem domain Iteratively refine the high-level model until you have an implementation Attempt to avoid big conceptual jumps during the deve... Date Added: 2008-07-25 12:56:17 |
| CIS R023B CS.doc Path: Oxnard College >> CIS >> R023b Fall, 2008 Description: COURSE OUTLINE COVER SHEET OXNARD COLLEGE 1. COURSE IDENTIFICATION & CHANGE INFORMATION COURSE ID: CIS R023B / REV X / SUSP / DEL / 1st Reading DCSL 2nd Reading Governing Board 1st CHANGE TYPE: NEW APPENDICES: CO-LISTED AS: PREREQ-COREQ-ADV (Not ap... Date Added: 2009-02-02 15:19:40 |
| HW5-PA Path: Michigan State University >> MATH >> 421 Fall, 2007 Description: ... Date Added: 2008-07-25 11:41:01 |
| psyc9_2 Path: Michigan State University >> PSYCH >> 101 Fall, 2008 Description: Methods of Psychology Basic Goal- Increase understanding of the psychological world through systematic collection and analysis of objective, publicly observe data. (page 25) Pieces of information Scores on tests would be data (something objective t... Date Added: 2008-10-28 14:33:22 |
| OR-080038.pdf Path: Washington State >> PNN >> 08 Fall, 2008 Description: FOR DISTRIBUTION AND USE ONLY WITHIN THE STATE OF OREGON PRINCEP CALIBER 90 EPA Reg. No. 100-603 EPA SLN No. OR-080038 This label valid until December 31, 2014 or until otherwise amended, withdrawn, cancelled, or suspended. For Control Of Weeds In ... Date Added: 2009-02-18 13:34:45 |
| OR-080038.pdf Path: Martin Luther >> PNN >> 08 Fall, 2008 Description: FOR DISTRIBUTION AND USE ONLY WITHIN THE STATE OF OREGON PRINCEP CALIBER 90 EPA Reg. No. 100-603 EPA SLN No. OR-080038 This label valid until December 31, 2014 or until otherwise amended, withdrawn, cancelled, or suspended. For Control Of Weeds In ... Date Added: 2009-02-18 13:34:45 |
| test1ReviewSheet Path: Clemson >> CPSC >> 120 Fall, 2008 Description: Test 1 CHP 1 computer fluency computers in the workforce data mining RFID tags biomtric implants Physiome Project computer forensics smart shirts robotic devices technology of tomorrow nanoscience biomedical chip implants AI RFID biometrics CHPS 2 &... Date Added: 2008-04-09 05:58:54 |
| VeterinaryScience.pdf Path: Missouri (Mizzou) >> MO >> 4 Fall, 2008 Description: Missouri 4-H University of Missouri 4-H Center for Youth Development Veterinary Science Project Brief Learning Objectives Learn definition of words and names Understand details about the different systems in an animals body Learn advanced informatio... Date Added: 2009-02-17 22:44:19 |
| 112.pdf Path: University of Illinois, Urbana Champaign >> AFAS >> 112 Fall, 2008 Description: Course Schedule - Spring 2006 Air Force Aerospace Studies 112 Found of the US Air Force II Credit: 1 hours. Continuation of AFAS 111. Survey course focusing on the organizational structure and missions of Air Force organizations, military customs and... Date Added: 2009-02-02 18:04:47 |
| Serway_CP_poll_ch20 Path: UCSD >> PHYS 1B >> 1B Spring, 2009 Description: An RL circuit in which L = 0.4 H and R = 5 W is connected to a battery with E = 22 V at time t = 0. What energy is stored in the inductor when the current in the circuit is 0.5 A? 25% 25% 25% 25% 1. 2. 3. 4. 1 21 41 2 22 42 500 mJ 1.0 J 2.0 J 5.0 J... Date Added: 2009-04-09 01:36:17 |
| 051021M&A.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Big Money Pursuing Big Prey in Europe - New York Times October 21, 2005 Big Money Pursuing Big Prey in Europe By HEATHER TIMMONS LONDON, Oct. 20 - After being thwarted in several big deals, some private equity firms are considering a new tack in Eur... Date Added: 2009-02-11 17:43:38 |
| 051004EU1.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: EU opens Croatia membership talksprint Tue 4 Oct 2005 7:09am (UK) EU opens Croatia membership talks close The European Union has opened membership talks with Croatia after the United Nations war crimes tribunal\'s chief prosecutor said the governmen... Date Added: 2009-02-11 20:32:41 |
| 11-9-2005 Path: UC Irvine >> ENG >> 1a Fall, 2005 Description: 11.9.2005 Jim o Presented as a slave and a father o Jim is a lot bigger than Huck but is in a subservient position o Huck feels as though he should turn him in but doesn\'t because they are friends o Huck has a human impulse to look at Jim as a friend... Date Added: 2008-04-08 00:15:28 |
| AddictAbusepuz.doc Path: Purdue >> EDPS >> 265 Fall, 2008 Description: 4 2 5 1 1 3 4 2 ADDICTIONS AND ABUSE ACROSS (grayed bars with #s at the beginning) 1. A fear of dependency is called_ 2. A sexual relationship within the _system has especially bad outcomes on a child. 3. Anger directed everywhere and concentration ... Date Added: 2009-01-09 09:57:08 |
| AddictAbusepuz.doc Path: Purdue >> EDPS >> 270 Fall, 2008 Description: 4 2 5 1 1 3 4 2 ADDICTIONS AND ABUSE ACROSS (grayed bars with #s at the beginning) 1. A fear of dependency is called_ 2. A sexual relationship within the _system has especially bad outcomes on a child. 3. Anger directed everywhere and concentration ... Date Added: 2009-01-09 09:57:08 |
| peereval.pdf Path: Delaware >> CISC >> 672 Fall, 2008 Description: Assessment of Individual Performance in a Group Project For PROGRAMMING CONTEST PROJECT YOU SHOULD FILL THIS OUT INDIVIDUALLY AND IN PRIVATE, NOT WITH YOUR GROUP MEMBERS. PLEASE BE HONEST IN YOUR ANSWERS. THIS PEER EVALUATION WILL BE USED TO ASSESS Y... Date Added: 2009-01-10 03:34:03 |
| peereval.pdf Path: Delaware >> CISC >> 601 Fall, 2008 Description: Assessment of Individual Performance in a Group Project For PROGRAMMING CONTEST PROJECT YOU SHOULD FILL THIS OUT INDIVIDUALLY AND IN PRIVATE, NOT WITH YOUR GROUP MEMBERS. PLEASE BE HONEST IN YOUR ANSWERS. THIS PEER EVALUATION WILL BE USED TO ASSESS Y... Date Added: 2009-01-10 03:34:03 |
| 1000413.pdf Path: Cornell >> MS >> 7 Fall, 2008 Description: Student and Academic Services Research Group Master Calendar of Cornell Undergraduate Surveys 2008-2015 Year 2008-2009 Fall IRP CIRP (all FY students) Campus Life Campus Life 6 Weeks Survey (20% sample of residential undergraduates) Sponsoring Prog... Date Added: 2009-02-18 02:12:35 |
| tr195.pdf Path: NMSU >> TR >> 195 Fall, 2008 Description: ... Date Added: 2009-02-06 20:58:35 |
| BSciAppF.pdf Path: BC >> ISC >> 1995 Fall, 2008 Description: A P P E N D I X F Appendix F ACKNOWLEDGMENTS TIMSS was truly a collaborative effort among hundreds of individuals around the world. Staff from the national research centers, the international management, advisors, and funding agencies worked... Date Added: 2009-02-17 23:53:38 |
| BSciAppF.pdf Path: Southeastern Bible >> TIMSS >> 1995 Fall, 2008 Description: A P P E N D I X F Appendix F ACKNOWLEDGMENTS TIMSS was truly a collaborative effort among hundreds of individuals around the world. Staff from the national research centers, the international management, advisors, and funding agencies worked... Date Added: 2009-02-17 23:54:03 |
| BSciAppF.pdf Path: BC >> TIMSS >> 1995 Fall, 2008 Description: A P P E N D I X F Appendix F ACKNOWLEDGMENTS TIMSS was truly a collaborative effort among hundreds of individuals around the world. Staff from the national research centers, the international management, advisors, and funding agencies worked... Date Added: 2009-02-17 23:54:03 |
| BSciAppF.pdf Path: Southeastern Bible >> TIMSSANDPI >> 1995 Fall, 2008 Description: A P P E N D I X F Appendix F ACKNOWLEDGMENTS TIMSS was truly a collaborative effort among hundreds of individuals around the world. Staff from the national research centers, the international management, advisors, and funding agencies worked... Date Added: 2009-02-17 23:56:34 |
| BSciAppF.pdf Path: BC >> TIMSSANDPI >> 1995 Fall, 2008 Description: A P P E N D I X F Appendix F ACKNOWLEDGMENTS TIMSS was truly a collaborative effort among hundreds of individuals around the world. Staff from the national research centers, the international management, advisors, and funding agencies worked... Date Added: 2009-02-17 23:56:34 |
| BSciAppF.pdf Path: Southeastern Bible >> ISC >> 1995 Fall, 2008 Description: A P P E N D I X F Appendix F ACKNOWLEDGMENTS TIMSS was truly a collaborative effort among hundreds of individuals around the world. Staff from the national research centers, the international management, advisors, and funding agencies worked... Date Added: 2009-02-17 23:53:38 |
| Hist 2110 midterm cheat sheet Path: Western Michigan >> HIST >> 2110 Spring, 2006 Description: Great Strike of 1877, RR workers facing more cuts in pay, hours begin strike, becomes national strike, first major labor battle of the new era, public sided with railroads, fed. Gov working closely with railroad owners, intervenes to put down the str... Date Added: 2008-04-02 09:47:40 |
| Lecture 21 Path: Penn State >> C E >> 361 Spring, 2007 Description: Prepared by T. Wagener & P. Reed Penn State University Water Resources Engineering W t R E i i - Lecture 21 1 Content 1. 1 2. 3. 3 4. Data Analysis Probability Concepts Commonly U d P b bilit Di t ib ti C l Used Probability Distributions Hydrologic... Date Added: 2008-04-11 09:10:40 |
| Chapter 3, 9-5-08 Path: Texas >> BIO >> 311C Fall, 2008 Description: Chapter 3 (pp.46-56): pH, properties of water, and concentrations of solutions Learning objectives: Define: Acids, bases, and buffers. Be cognizant of what the pH scale is, and its application in expressing acidity. Explain the uniqueness of wat... Date Added: 2008-10-23 14:26:11 |
| Jonesch02_5e.ppt Path: San Jose State >> BUS3 >> 161b Fall, 2008 Description: Organizational Theory, Design, and Change Fifth Edition Gareth R. Jones Chapter 2 Stakeholders, Managers, and Ethics Copyright 2007 Prentice Hall 2- 1 Learning Objectives 1. Identify the various stakeholder groups and their interests on an organiz... Date Added: 2009-01-10 00:10:42 |
| MCDB 101A syllabus \'07 .pdf Path: UCSB >> MCDB >> 101a Fall, 2008 Description: MCDB 101A Molecular Genetics of Prokaryotes Instructor: Peggy A. Cotter, Ph.D. Lectures: MWF 12:00-12:50pm CHEM 1171 Course Website: http:/mentor.lscf.ucsb.edu/course/winter/mcdb101a/ Dr. Cotters Office Hours: Mon and Tues 2:00-3:00pm, and by appoint... Date Added: 2009-02-02 17:38:36 |
| Houpt047.pdf Path: FSU >> MAGNET >> 047 Fall, 2008 Description: Neuroscience Letters 372 (2004) 230234 Alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor subunit expression in rat olfactory bulb Michelle S. Horning, Bumsup Kwon, Laura J. Blakemore, Corinne M. Spencer, Marion Goltz, Thomas A. Houpt, Pa... Date Added: 2009-02-17 19:06:36 |
| Houpt047.pdf Path: S.F. State >> MAGNET >> 047 Fall, 2008 Description: Neuroscience Letters 372 (2004) 230234 Alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor subunit expression in rat olfactory bulb Michelle S. Horning, Bumsup Kwon, Laura J. Blakemore, Corinne M. Spencer, Marion Goltz, Thomas A. Houpt, Pa... Date Added: 2009-02-17 19:06:36 |
| grl1997_mccarthyetal.pdf Path: UCSD >> WWW-PORD >> 1997 Fall, 2008 Description: ... Date Added: 2009-02-17 18:22:56 |
| g02def_fl19.pdf Path: Wisconsin Milwaukee >> G >> 02 Fall, 2009 Description: G02 Correlation and Regression Analysis G02DEF NAG Fortran Library Routine Document Note. Before using this routine, please read the Users Note for your implementation to check the interpretation of bold italicised terms and other implementation-d... Date Added: 2009-04-16 00:36:09 |
| chap2.pdf Path: Virginia Tech >> LIB >> 111597 Fall, 2008 Description: 2.0 Literature Review In 1986, the modern era of neural networks was ushered in by the derivation of back propagation. In the short ten years since the rewriting of parallel distributed processing (Rumelhart and McClelland, 1986), an enormous amount ... Date Added: 2009-02-18 01:28:40 |
| I1547-3465-01-075.pdf Path: Hawaii >> SCHOLARSPA >> 10125 Fall, 1989 Description: Tobacco Basket Michelle L. Stevens Gathering gray willow Along flooded Putah Creek, Swallows dart and turn As we women softly Talk, bend, cut willow. Voices sing through willow Into my hands, Teaching me to weave A tobacco basket. This basket Focusi... Date Added: 2009-02-17 19:27:01 |
| I1547-3465-01-075.pdf Path: Hawaii >> SCHOLARSPA >> 133 Fall, 2008 Description: Tobacco Basket Michelle L. Stevens Gathering gray willow Along flooded Putah Creek, Swallows dart and turn As we women softly Talk, bend, cut willow. Voices sing through willow Into my hands, Teaching me to weave A tobacco basket. This basket Focusi... Date Added: 2009-02-17 19:27:01 |
| 020417_Quiz_4.pdf Path: Cincinnati >> MTEN >> 634 Winter, 2008 Description: 020417 Quiz 4 Properties 1) Flory defined the persistence length, using the equation a = l\'/(1-). Explain each of the terms in this equation. Define the persistence length using a sketch of a polymer coil. Explain how the persistence length could be... Date Added: 2009-01-10 02:35:43 |
| NR-051B-F06(1).DOC Path: College of the Desert >> NR >> 051b Spring, 2008 Description: COLLEGE OF THE DESERT Course Outline of Record 1. Course Code: NR-051B Course Code: NR-051B 2. a. Long Course Title: b. Short Course Title: 3. a. Catalog Description: Migrant Birds - Spring MIGRANT BIRDS - SPRING This course introduces students t... Date Added: 2009-02-02 13:56:55 |
| hmwk2 Path: Cornell >> CHEM >> 2090 Fall, 2007 Description: Homework Assignment due 9/7/2007 Chapter 1: 10, 18, 30, 52, 69, 79, 80 ... Date Added: 2008-01-31 10:47:29 |
| Endosyll.pdf Path: N. Arizona >> BIO >> 300 Summer, 2008 Description: SYLLABUS COLLEGE OF ARTS AND SCIENCES Biology 545: Endocrinology Fall 2002 (3 credit hr) Room BS 419 Tues-Thurs 11:10-12:25 Organizer: Dr. Catherine Propper Office Hours: M: 2:00-3:00, W: 3:00-4:00 or by appt. Building 88 Biology/Biochemistry 215 Pho... Date Added: 2009-01-09 05:12:25 |
| Endosyll.pdf Path: N. Arizona >> BIO >> 545 Fall, 2008 Description: SYLLABUS COLLEGE OF ARTS AND SCIENCES Biology 545: Endocrinology Fall 2002 (3 credit hr) Room BS 419 Tues-Thurs 11:10-12:25 Organizer: Dr. Catherine Propper Office Hours: M: 2:00-3:00, W: 3:00-4:00 or by appt. Building 88 Biology/Biochemistry 215 Pho... Date Added: 2009-01-09 05:12:51 |
| PAST1a.pdf Path: BYU >> PHSCS >> 529 Fall, 2008 Description: Senior Thesis Form PAST 1a Department of Physics and Astronomy Section 1: Student Contact Information Please fill in the following information carefully. Give an address where the copies of the thesis can be shipped upon completion. This is especial... Date Added: 2009-01-11 04:52:31 |
| PAST1a.pdf Path: BYU >> PHSCS >> 329 Winter, 2008 Description: Senior Thesis Form PAST 1a Department of Physics and Astronomy Section 1: Student Contact Information Please fill in the following information carefully. Give an address where the copies of the thesis can be shipped upon completion. This is especial... Date Added: 2009-01-11 04:52:31 |
| intro_re_program4.doc Path: Missouri (Mizzou) >> FINANC >> 4500 Fall, 2008 Description: Introduction to the MU Real Estate Program: The Real Estate Program is administered through the Department of Finance in the College of Business, at the University of Missouri Columbia. All undergraduate Real Estate majors take courses in accounting... Date Added: 2009-02-03 14:01:00 |
| L13_CHEM480_JCCYu Path: SHSU >> CHM >> 480 Spring, 2009 Description: Forensic Instrumental Analysis Forensic Instrumental Analysis focuses on solving forensic related problems and applying analytical procedures that are defendable in front of a court. Chromatography (separation science) and mass spectroscopy are two ... Date Added: 2009-04-02 04:57:35 |
| PS6.pdf Path: Concordia Chicago >> GEO >> 232 Fall, 2008 Description: Geosci 232 Problem Set 6 Fall Quarter 2007 November 27, 2007 6 Problem Set:Blackbody radiation review problems, and thin atmospheres 1, Problem 6.1 h/kT Show that if both 1 and 2 are in the frequency range where then the total ux per steradian em... Date Added: 2009-04-15 21:58:02 |
| ScienceCenter_00.ppt Path: Harvard >> SCICTR >> 00 Fall, 2009 Description: Erosion, Landfill Politics At 9 P.M., I hope you have some idea of: What we understand about how s... Date Added: 2009-04-16 00:10:42 |
| ps3.pdf Path: Concordia Chicago >> P >> 141 Fall, 2008 Description: Physics 141 Problem Set 3 Due Monday, Oct. 20 (hand in in class). Monday, Oct. 13, 2008 H. J. Frisch; 702-7479 = General: Organization, Web page, Labs, Syllabus: See the (yellow) P141 Poop Sheet. No class Wed.- will be made up. Labs begin this week-... Date Added: 2009-04-15 21:58:18 |
| christensonNathan.pdf Path: Berkeley >> STAT >> 110 Fall, 2008 Description: Tackling PageRank with R by Erica Christenson & Sadhana Nathan I. Introduction to PageRank PageRank is a method developed by Larry Page and Sergey Brin at Stanford University that uses the link structure of the web to rank the importance of web pages... Date Added: 2009-02-18 14:19:58 |
| christensonNathan.pdf Path: Berkeley >> STATISTICS >> 110 Fall, 2008 Description: Tackling PageRank with R by Erica Christenson & Sadhana Nathan I. Introduction to PageRank PageRank is a method developed by Larry Page and Sergey Brin at Stanford University that uses the link structure of the web to rank the importance of web pages... Date Added: 2009-02-18 14:24:42 |
| Blood Wedding Path: Cal Poly Pomona >> DAN >> 202 Winter, 2007 Description: Bryan (Daejin) Kim DAN202 2/13/07 Blood Wedding In the play by Garcia Lorca, Blood Wedding, he portrays a scene of unique wedding. Choreographed by Antonio Gades, the dance that is shown in this play is flamenco dance style. Flamenco dance emphasis ... Date Added: 2008-03-10 22:02:14 |
| Chapter 8 Questions Path: UCF >> EUH >> 2100 Spring, 2008 Description: What is your impression of the city within those walls? In which direction have buildings grown b/c of the city\'s confinement within these walls? What sort of opportunities did the glacis offer urban planners? Source 2 What kind of housing did s... Date Added: 2008-04-19 00:09:25 |
| Univariate ChiSquare Test- 5 Step Path: Temple >> STAT >> 2102 Spring, 2008 Description: Univariate Chisquare Test: Goodness of Fit test One Qualitative Random Variable; several or more groups Similar to Ztest for 2 sample proportions, but can extend to 3 or more groups Step One: State the Research Hypotheses Null (Ho): Pwa=.20; Pdunk=.... Date Added: 2008-04-08 18:32:01 |
| sample1.pdf Path: San Jose State >> MATH >> 31 Spring, 2008 Description: Sample Exam 1 Math 31, Spring 2007 1. (24 points) Compute the following. x (a) Let g(x) = 0 sin(t2 ) dt. Calculate g (x). dx (b) (c) (d) 0 5 + 4e2x x x2 cos(5x3 2) dx 3 x2 x dx +2 2. (12 points) Find the area of the region enclosed by the c... Date Added: 2009-01-09 07:03:55 |
| 1579.071.ps Path: Hawaii >> SOEST >> 1579 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1208577103.0388276 Float: 1579 Profile: 071 Location: 31.8N 156.9E Date: 06/03... Date Added: 2009-02-17 19:55:20 |
| M 315C syllabus_SP08.doc Path: Texas >> M >> 315c Fall, 2008 Description: M 315C/M375T-Functions and Modeling Spring 2008 TTH 9:30-11am #58590 PAI 4.08 Dr. Mark Daniels - Instructor Email mdaniels@math.utexas.edu Office: PAI 4.04 512-232-5767 FAX 512-232-1491 Office hours: Email/call for appt. or try dropping by, MF 1 2 p... Date Added: 2009-02-03 14:13:44 |
| stat_98.pdf Path: Texas Tech >> STAT >> 98 Fall, 2009 Description: Preliminary Exam: Statistics and Probability May 1998 Work any 8 problems and clearly indicate which problems you wish to be graded. Begin each problem on a new page, using one side of the sheet. A table of the standard normal distribution is attach... Date Added: 2009-04-15 20:07:43 |
| ringbuf.ps Path: Harvey Mudd College >> CS >> 105 Fall, 2003 Description: CS 105, Spring 2007 Ring Buer April 11, 2007 1 Introduction A ring buer, also called a circular buer, is a common method of sharing information between a producer and a consumer. In class, we have seen an elegant implementation of a ring buer usin... Date Added: 2009-03-19 00:14:11 |
| 1743.251.ps Path: Hawaii >> SOEST >> 1743 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207374772.0388276 Float: 1743 Profile: 251 Location: 29.2N 140.8E Date: 11/24... Date Added: 2009-02-17 20:14:52 |
| courseinfo_s01.pdf Path: Mississippi State >> ECE >> 4521 Fall, 2009 Description: MEMORANDUM TO: FROM: DATE: SUBJECT: CPE Design Website See ECE Homepage courses link to ECE4521 Texts: Project Management and Teamwork by Karl Smith Times: ... Date Added: 2009-04-15 21:27:08 |
| Lecture191 Path: Rensselaer >> BMED >> 4540 Fall, 2007 Description: Objectives How to predict fracture (Failure theories based on concept of principal Stress/strain & maximum shear stress/strain) Are material properties same in all direction (Theory of material Anisotropy)? What is the influence of loading rate (T... Date Added: 2008-09-07 17:17:05 |
| Int_prop.pdf Path: Mich Tech >> EE >> 4910 Fall, 2008 Description: Intellectual Property, Conflict of Interest Legal Definitions and Considerations Conflict of Interest: A situation in which regard for one duty results in disregard for another. Doing work for or with two parties whose interests are adverse potential... Date Added: 2009-01-11 16:39:35 |
| Int_prop.pdf Path: Mich Tech >> BE >> 4901 Fall, 2008 Description: Intellectual Property, Conflict of Interest Legal Definitions and Considerations Conflict of Interest: A situation in which regard for one duty results in disregard for another. Doing work for or with two parties whose interests are adverse potential... Date Added: 2009-01-11 16:39:35 |
| Int_prop.pdf Path: Mich Tech >> EE >> 4900 Fall, 2008 Description: Intellectual Property, Conflict of Interest Legal Definitions and Considerations Conflict of Interest: A situation in which regard for one duty results in disregard for another. Doing work for or with two parties whose interests are adverse potential... Date Added: 2009-01-11 16:39:35 |
| Int_prop.pdf Path: Mich Tech >> EE >> 4901 Fall, 2008 Description: Intellectual Property, Conflict of Interest Legal Definitions and Considerations Conflict of Interest: A situation in which regard for one duty results in disregard for another. Doing work for or with two parties whose interests are adverse potential... Date Added: 2009-01-11 16:39:35 |
| Self help exercise- evaluating new expressions Path: Cornell >> CS >> 101 Spring, 2008 Description: Self-help exercises: evaluating new-expressions As mentioned in the lecture, evaluation of a new expression like new Animal() is a two-step process: 1. Create (or draw) a new manila folder (object) of class Animal; 2. Yield as value of the new-expres... Date Added: 2008-07-07 22:21:26 |
| 020314Ossies.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Economist.com Eastern Germany\'s economy and voters In the dumps again Mar 14th 2002 | BERLIN From The Economist print edition The ex-communist east is in recession: bad news for Gerhard Schrder TO WIN Germany, pundits say, you must win the east. Th... Date Added: 2009-02-11 17:58:56 |
| samplef.pdf Path: UF >> PHY >> 3513 Fall, 2008 Description: PHY 3513 Fall 2000 Information Concerning Final Exam The nal term will take place between 12:30 and 2:30 p.m. on Friday, December 15. The exam will be held in room NPB 1220. The exam will focus on material relating to Callen Chapters 1-7. The foll... Date Added: 2009-01-10 18:20:46 |
| ch14IQgender.doc Path: Amherst >> PSYC >> 33 Fall, 2008 Description: Individual Differences in Cognition: IQ and Gender _ 1) Review the distinction between nomothetic and idiographic research. 2) Discuss the overarching questions that must be considered when conducting individual differences research. 3) Describe the ... Date Added: 2009-02-11 21:47:46 |
| 460.pdf Path: University of Illinois, Urbana Champaign >> FSHN >> 460 Fall, 2008 Description: Course Schedule - Spring 2005 Food Science and Human Nutrition 460 Food Processing Engineering Credit: 3 hours. (FSHN 360) Examines application of process engineering principles to the conversion of raw agricultural materials into finished food produ... Date Added: 2009-02-02 18:48:35 |
| Gr18.ppt Path: Delaware >> CIEG >> 125 Fall, 2008 Description: Group 18 Amanda Duggins Hendrik Martinez Marcus Hammond Alex Henderson Chris prepares for presentation on engineering excellence at De Tocqueville University (DTU) Chris graduated from DTU School of Engineering 12 years ago Chris was unsure ... Date Added: 2009-01-11 22:36:38 |
| Gr18.ppt Path: Delaware >> CIEG >> 831 Fall, 2008 Description: Group 18 Amanda Duggins Hendrik Martinez Marcus Hammond Alex Henderson Chris prepares for presentation on engineering excellence at De Tocqueville University (DTU) Chris graduated from DTU School of Engineering 12 years ago Chris was unsure ... Date Added: 2009-01-11 22:37:22 |
| HW10soln.pdf Path: Martin Luther >> CHEM >> 0 Fall, 2003 Description: P*blr^s\"t *to - (-t77 -(rrt.lotror ) .trlt) lzlr f.;+ \"/- -K o*-.na\'c .,i- 4L !-!efEU clL= rl/-l\"t-l+ tlo. , \"- lL-t<po 1.3+\'{Yllf =Llz.usax,or)/1r) U-\" = 4Jl5 x1Q-3 = P,+nn 4.lqtJ.le:(\'r -rr\\ la... Date Added: 2009-02-18 13:50:11 |
| HW10soln.pdf Path: Martin Luther >> CHEM >> 331 Fall, 2003 Description: P*blr^s\"t *to - (-t77 -(rrt.lotror ) .trlt) lzlr f.;+ \"/- -K o*-.na\'c .,i- 4L !-!efEU clL= rl/-l\"t-l+ tlo. , \"- lL-t<po 1.3+\'{Yllf =Llz.usax,or)/1r) U-\" = 4Jl5 x1Q-3 = P,+nn 4.lqtJ.le:(\'r -rr\\ la... Date Added: 2009-02-18 13:50:11 |
| HW10soln.pdf Path: Washington State >> CHEM >> 0 Fall, 2003 Description: P*blr^s\"t *to - (-t77 -(rrt.lotror ) .trlt) lzlr f.;+ \"/- -K o*-.na\'c .,i- 4L !-!efEU clL= rl/-l\"t-l+ tlo. , \"- lL-t<po 1.3+\'{Yllf =Llz.usax,or)/1r) U-\" = 4Jl5 x1Q-3 = P,+nn 4.lqtJ.le:(\'r -rr\\ la... Date Added: 2009-02-18 13:50:11 |
| HW10soln.pdf Path: Washington State >> CHEM >> 331 Fall, 2003 Description: P*blr^s\"t *to - (-t77 -(rrt.lotror ) .trlt) lzlr f.;+ \"/- -K o*-.na\'c .,i- 4L !-!efEU clL= rl/-l\"t-l+ tlo. , \"- lL-t<po 1.3+\'{Yllf =Llz.usax,or)/1r) U-\" = 4Jl5 x1Q-3 = P,+nn 4.lqtJ.le:(\'r -rr\\ la... Date Added: 2009-02-18 13:50:11 |
| 030701russia.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: WSJ.com - Belarus Pres Puts Off Order Allowing Use Of Russian Ruble July 1, 2003 3:11 p.m. EDT Belarus Pres Puts Off Order Allowing Use Of Russian Ruble DOW JONES NEWSWIRES MINSK, Belarus (AP)-Belarusian President Alexander Lukashenko has decided to... Date Added: 2009-02-11 19:06:11 |
| Anthro2November 14 Path: UCSB >> ANTH >> 2 Fall, 2007 Description: November 14, 2007 1) Review of Kinship 2) Reciprocity a. Logics of exchange i. Reciprocity: exchange between social equals (generally related by kinship, marriage, or close personal ties) 1. Associated with subsistence pattern(s) of: a. Foraging and ... Date Added: 2008-04-07 18:30:06 |
| J Lecture 16 - Is the Endangered Species Act Endangered Path: UMass (Amherst) >> BIO >> 105 Fall, 2007 Description: Is the Endangered Species Act Endangered? 1972 Asked Congress to pass comprehensive endangered species legislation 1973 Endangered Species Act of 1973 signed into law by Nixon on December 28, 1973 1973 continued. The Convention on International Tr... Date Added: 2008-05-18 19:31:25 |
| 23_06.pdf Path: Wisconsin >> ZOOLOGY >> 430 Fall, 2008 Description: ... Date Added: 2009-02-04 14:14:48 |
| hw2.pdf Path: UMBC >> STAT >> 601 Fall, 2001 Description: HW2, Stat601, Fall 2005, Due: Wednesday, Sept. 27 Do not give me unnecessary output; Answer Q3 and Q4 in report format 1. Consider a random variable Y with nite variance. Show that for any other random variable X, the function of X with nite variance... Date Added: 2009-02-17 23:09:04 |
| LCS 151 PAPER Path: Bryant >> LCS >> 151 Fall, 2008 Description: Michael Blasius LCS 151 Professor Coughlin 2/27/08 Libidinal Urges in Society Instinctually, the nature of man is neither peaceful nor cooperative. Instead, man is a naturally violent and aggressive towards other men. This very principle makes the fo... Date Added: 2008-04-20 13:04:31 |
| e-SketchbookEntry012308AT.pdf Path: Texas Tech >> ARCH >> 252 Spring, 2009 Description: ... Date Added: 2009-04-15 20:15:48 |
| e-SketchbookEntry012308AT.pdf Path: Texas Tech >> ARCH >> 5604 Fall, 2008 Description: ... Date Added: 2009-04-15 20:15:48 |
| CE 473 Spring 08 Homework 02.pdf Path: Purdue >> CE >> 473 Spring, 2008 Description: CE473 CE 473 HW2 Spring 2008 Homework #2 Name_ Grade _/_ a) For the section shown below, compute the magnitude of the stress in the reinforcement and the maximum stress in the concrete caused a moment of 100-kip-ft. Assume f\'c=4000psi. Assume 3 A... Date Added: 2009-02-02 15:45:39 |
| patternsofexposition.doc Path: Wisconsin >> HISTORY >> 397 Fall, 2008 Description: EPD397 McGlamery OrganizingyourFormalReport SinceseveraldifferenttypesofreportsarewrittenforEPD397,itisuptoyoutodecidethebestpatternof expositionforyourproject.Here,however,aresometypicalorganizationalpatternsthatyoumightfindhelpful. I.ReportAnalyz... Date Added: 2009-02-03 14:35:01 |
| 4 R Path: Texas A&M >> POLS >> 206 Fall, 2007 Description: POLS 206-508 R 10/4 I. History of Public Participation II. Political Socialization American Political Culture III. Polling I. History of Public Participation Founding fathers feared government involvement Today\'s view of Democracy II. Political Socia... Date Added: 2008-04-04 08:19:50 |
| TMAccessforweb.pdf Path: BYU >> FLANG >> 201r Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 384r Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> MUSIC >> 351 Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 655r Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> FLANG >> 202r Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 387 Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 187 Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> HFL >> 380 Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 419a Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 215r Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> MUSIC >> 251 Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 462 Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 419b Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 285 Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> MUSIC >> 256 Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 565r Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> FLANG >> 102r Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 351 Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> MUSIC >> 257 Winter, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-09 18:55:10 |
| TMAccessforweb.pdf Path: BYU >> TMA >> 652r Fall, 2008 Description: TMAccess Department of Theatre and Media Arts Weekly Student News Information in this newsletter is provided as a service for TMA students. Organizations are not endorsed by BYU or TMA. WDA Staged Readings will be December 9-11 from 5-7pm in the Ha... Date Added: 2009-01-11 04:55:21 |
| 2393.007.ps Path: Hawaii >> SOEST >> 2393 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207381771.0388276 Float: 2393 Profile: 007 Location: 32.4N 146.2E Date: 07/03... Date Added: 2009-02-17 20:03:25 |
| GP109.pdf Path: Minnesota >> APG >> 109 Fall, 2008 Description: Exp Brain Res (1999) 125:115121 Springer-Verlag 1999 R E S E A R C H A RT I C L E Giuseppe Pellizzer Hans Richter Apostolos P. Georgopoulos Drawing under visuomotor incongruence Received: 13 July 1998 / Accepted: 10 October 1998 Abstract Six ... Date Added: 2009-02-17 21:21:17 |
| rocks.rtf Path: Idaho >> INTER >> 103 Fall, 2008 Description: Mickey\'s Rock part A. Introduction rock = mineral(s) glued together <polars B. Classification & formation igneous = form from cooling magma fast = can\'t see minerals (less than 63 m) slow = can see minerals (greater than 63 m) sediment... Date Added: 2009-02-06 20:40:46 |
| Lecture5_MitosisMeiosis Path: Washington >> BIOL >> 180 Fall, 2007 Description: Dihybrid crosses, mitosis, and meiosis Predict the results of a cross between PPTT and pptt parents, assuming that alleles of different genes do NOT stay together. Parental genotypes: PPTT pptt Gametes produced: F1 offspring from cross Gametes produc... Date Added: 2008-04-10 21:18:25 |
| nt-2006.pdf Path: UC Irvine >> ICS >> 2006 Fall, 2008 Description: Authentication of Outsourced Databases using Signature Aggregation and Chaining Maithili Narasimha and Gene Tsudik {mnarasim, gts}@ics.uci.edu Computer Science Department School of Information and Computer Science University of California, Irvine Ab... Date Added: 2009-02-06 18:59:54 |
| CS102B041123.ppt Path: Skidmore >> CS >> 102 Fall, 2009 Description: Tuesday, 11/23/04, Slide #1 CS102BRobotDesign Tuesday,11/23/04 TodaysClass: Exam2Information:Thursday,12/2/04 BuildingRoverbotstoshare Robotnavigation FerrariChap.13 Reading: Tuesday, 11/23/04, Slide #2 Exam2Information Similar... Date Added: 2009-04-15 21:05:27 |
| g02bkf_fl19.pdf Path: Wisconsin Milwaukee >> G >> 02 Fall, 2009 Description: G02 Correlation and Regression Analysis G02BKF NAG Fortran Library Routine Document Note. Before using this routine, please read the Users Note for your implementation to check the interpretation of bold italicised terms and other implementation-d... Date Added: 2009-04-16 00:47:23 |
| syllabus126 - sp06.pdf Path: Spokane Falls Community College >> MATH >> 126 Winter, 2008 Description: Syllabus Text Calculus By Stewart Math 126 Instructor: Jim Brady Office 212C Phone: 533-3674 Office Hours: 8:30 9:30, 1:00 2:00 e-mail: jimb@spokanefalls.edu Material Covered See tentative schedule Attendance I do not take attendance. Just keep... Date Added: 2009-02-02 16:15:16 |
| Lecture 1 CH02 StudentNotes Path: N.C. State >> CH >> 221 Fall, 2008 Description: Alkane: CnH2n+2 Section 2.5 All carbons are sp3 hybridized Methane H H H C H _ C-H bonds Kay Sandberg Ethane (C2H6) H H H C H C H H Section 2.5 _ C-C bond _ C-H bonds Kay Sandberg Propane (C3H8) H C HH Section 2.5 H C H C H H H _ C-C... Date Added: 2008-10-31 09:25:53 |
| 030421EU.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Budapest Business Journal - Article Last updated: 24th Apr 2003, 7:23 Banking Telecom Exchanges Real Estate Retail Advertising & Media Industry Politics Other News This week\'s BBJ Enter keyword(s): Advanced Search Cover Feature Whos... Date Added: 2009-02-11 19:07:42 |
| socialbonds.pdf Path: Duke >> ENVIRON >> 357l Fall, 2008 Description: REPORTS creased proliferation, growth, and survival by means other than RasV12 are not sufficient to cause the metastatic progression of scrib/ cells. Thus, the metastasis-promoting effect of scrib inactivation is highly dependent on its specific coo... Date Added: 2009-01-12 14:56:27 |
| H05.doc Path: NYU >> V83 >> 0017 Fall, 2008 Description: Life and Death 7/03/07 Rosenbaum, How to be dead and not care: a defense of Epicurus Dying: the process whereby one comes to be dead or the process where certain causes operate to being about ones being dead. Death (roughly): the time at which a per... Date Added: 2009-01-09 04:40:44 |
| Week4.PDF Path: Oregon State >> CH >> 545 Fall, 2008 Description: Figure 5.2. The first coordination shell plus examples rrom other shells for the NaCl structure. Table 5.2. Values of the Madelung constant for various structures. Zinc blende (ZnS) Wurtzite (ZnS) Sodium chloride Cesium chloride Cuprite (Cu,O) /]-Qu... Date Added: 2009-01-11 20:48:00 |
| Week4.PDF Path: Oregon State >> CH >> 445 Fall, 2008 Description: Figure 5.2. The first coordination shell plus examples rrom other shells for the NaCl structure. Table 5.2. Values of the Madelung constant for various structures. Zinc blende (ZnS) Wurtzite (ZnS) Sodium chloride Cesium chloride Cuprite (Cu,O) /]-Qu... Date Added: 2009-01-11 20:48:00 |
| Cellstructure.ppt Path: Minot State University >> BIOL >> 347 Fall, 2008 Description: Gram + and Gram - cocci Streptococci Streptococcus pyogenes Bacilli Escherichia coli Spirals spirochetes & spirillum Filament Filaments QuickTime and a YUV420 codec decompressor are needed to see this picture. Vibrio Vibrio cholerae Vibrio T... Date Added: 2009-01-09 08:15:05 |
| Cellstructure.ppt Path: Minot State University >> BIOL >> 111 Fall, 2008 Description: Gram + and Gram - cocci Streptococci Streptococcus pyogenes Bacilli Escherichia coli Spirals spirochetes & spirillum Filament Filaments QuickTime and a YUV420 codec decompressor are needed to see this picture. Vibrio Vibrio cholerae Vibrio T... Date Added: 2009-01-09 08:15:05 |
| Cellstructure.ppt Path: Minot State University >> BIOL >> 142 Fall, 2008 Description: Gram + and Gram - cocci Streptococci Streptococcus pyogenes Bacilli Escherichia coli Spirals spirochetes & spirillum Filament Filaments QuickTime and a YUV420 codec decompressor are needed to see this picture. Vibrio Vibrio cholerae Vibrio T... Date Added: 2009-01-09 08:15:05 |
| IntroPharGPShortLect.ppt Path: Rutgers >> 718 >> 320 Fall, 2008 Description: CYTOCHROME P450 POLYMORPHISM AND CLINICAL SIGNIFICANCE ANTHONY Y. H. LU DEPT OF CHEMICAL BIOLOGY COLLEGE OF PHARMACY RUTGERS UNIVERSITY PISCATAWAY, NEW JERSEY CYTOCHROME P450: GENERAL INTRODUCTION DUAL FUNCTION OF CYTOCHROME P450 CYTOCHROME P450 S... Date Added: 2009-01-11 19:33:20 |
| Bhagwati booklet.pdf Path: Columbia >> JB >> 38 Fall, 2008 Description: jagdish bhagwati Celebrating Seventy Years Jagdish Bhagwatis intellectual arc has taken him from profound theoretical analysis of international trade to deep insights into the political economy of globalization. No economist now living has displaye... Date Added: 2009-02-06 17:51:08 |
| Dec 3 criticism Path: USC >> CTCS 190 >> 18000 Fall, 2008 Description: o o o o o o o o o o o o o o o o o o o o o o o o ... Date Added: 2009-03-04 02:19:42 |
| H1 Path: N.C. State >> ECE >> 403 Spring, 2009 Description: Homework 1 ECE 403 Prof. Bilbro Note: H1 is due before the lecture in class on Friday 1/16/09. 1) If the current flowing through the diode in this circuit follows the ideal V V Schockley model I = I S e T 1 with saturation current I S = 1pA ... Date Added: 2009-03-30 15:08:09 |
| JWang-scattering-2008-part1.pdf Path: Harvard >> EPS >> 238 Fall, 2009 Description: A Introduction to the light scattering in the atmosphere Jun Wang & Kelly Chance April 8, 2008 Outline Radiation from single and double dipoles Scattering by a single (multi-dipole) particle Lorentz-Mie theory Single scattering properties Stok... Date Added: 2009-04-16 00:10:25 |
| chapter12_signal_transdxn.ppt Path: Alabama >> CH >> 562 Spring, 2008 Description: Iongradients&Transporters Bynow,youshouldbefamiliarwiththeconcept thatelectrochemicalgradientsrepresentenergyin biologicalsystems theytakeenergytomake theycanbeusedtodowork(e.g.ATPsynthase). Ingeneral,ionsandpolarmoleculescannot diffusecrossmemb... Date Added: 2009-01-09 15:40:52 |
| chapter12_signal_transdxn.ppt Path: Alabama >> CH >> 461 Fall, 2008 Description: Iongradients&Transporters Bynow,youshouldbefamiliarwiththeconcept thatelectrochemicalgradientsrepresentenergyin biologicalsystems theytakeenergytomake theycanbeusedtodowork(e.g.ATPsynthase). Ingeneral,ionsandpolarmoleculescannot diffusecrossmemb... Date Added: 2009-01-09 15:40:52 |
| chapter12_signal_transdxn.ppt Path: Alabama >> CH >> 561 Fall, 2008 Description: Iongradients&Transporters Bynow,youshouldbefamiliarwiththeconcept thatelectrochemicalgradientsrepresentenergyin biologicalsystems theytakeenergytomake theycanbeusedtodowork(e.g.ATPsynthase). Ingeneral,ionsandpolarmoleculescannot diffusecrossmemb... Date Added: 2009-01-09 15:40:52 |
| St Path: NYU >> WRIT >> 2 Spring, 2008 Description: St. Stephans Cathedral, Vienna It must have been the summer of 2003. I went to stay in Poland for three months with my mother. We stayed at my Aunt Annas house. I hated it, I was trapped with my six year old cousin and as a moody teenager, I did not ... Date Added: 2008-04-15 12:07:12 |
| amendment02-08S.pdf Path: St. Mary MD >> SGA >> 07 Fall, 2008 Description: Amendment 02-08S Author: Samantha Aikins, Maryland Higher Education Commission Student Advisory Council Member, Chair of Legislative Advisory Council and Ad Hoc SGA Textbook Committee Sponsor: Christopher Rodkey, Senate Leader Co-Sponsor: Sunny Schni... Date Added: 2009-02-11 20:52:52 |
| quiz2 practice Path: Colorado >> REAL >> 3000 Spring, 2007 Description: Spring 2007 University of Colorado at Boulder Leeds School of Business Real Estate 3000: Principles of Real Estate Practice Practice Questions for Quiz 2 Note: The following questions are designed to help you prepare for quiz 2. However, they do NOT... Date Added: 2008-04-23 14:45:26 |
| Chapter 13 Path: Maryland >> ECON >> 200 Spring, 2008 Description: 13 The Costs of Production PRINCIPLES OF MICROECONOMICS FOURTH EDITION N. G R E G O R Y M A N K I W PowerPoint Slides by Ron Cronovich 2007 Thomson South-Western, all rights reserved ACTIVE LEARNING Brainstorming You run General Motors. 1: ... Date Added: 2008-04-08 19:22:18 |
| Lec07112005.pdf Path: San Jose State >> CS >> 151 Spring, 2008 Description: More of the Case Study CS151 Chris Pollett Nov. 7, 2005. Outline Iterations 2-4 State Pattern More on Iteration2 Recall the goal of iteration 2 was to add menus, dialogs, and to support saving and loading. Last day, we showed how menus could be... Date Added: 2009-02-02 16:07:01 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 114 Fall, 2008 Description: ... Date Added: 2009-01-09 01:37:20 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 313 Fall, 2008 Description: ... Date Added: 2009-01-09 01:38:10 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 405 Fall, 2008 Description: ... Date Added: 2009-01-09 01:38:10 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 113 Fall, 2008 Description: ... Date Added: 2009-01-10 17:08:02 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 101l Fall, 2008 Description: ... Date Added: 2009-01-09 01:36:39 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 100 Fall, 2008 Description: ... Date Added: 2009-01-11 05:12:33 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 153 Fall, 2008 Description: ... Date Added: 2009-01-09 01:36:56 |
| torsion_balance.pdf Path: Idaho State >> PHYS >> 533 Fall, 2008 Description: ... Date Added: 2009-01-11 05:12:33 |
| suppresources.pdf Path: Rutgers >> CWGL >> 04 Fall, 2008 Description: 16 DAYS OF ACTIVISM AGAINST GENDER VIOLENCE November 25 - December 10, 2004 Additional Resources Reproductive Health and VAW Bringing Rights to Bear: an Analysis of the Work of the UN Treaty Monitoring Bodies on Reproductive and Sexual Rights, Cen... Date Added: 2009-02-04 14:55:18 |
| Lecture 33 sect 6.9 Path: Michigan State University >> ME >> 221 Summer, 2007 Description: ME 221 Statics Lecture #33 Section 6.9 ME221 Lecture 33 1 Homework #11 Chapter 6 problems: 2, 3, 6 53 Method of Sections 68 & 75 Due Friday, November 21 ME221 Lecture 33 2 Homework #12 Chapter 8 proble... Date Added: 2008-07-25 14:31:55 |
| SP07.523.J.Phillips.pdf Path: Rutgers >> 253 >> 523 Spring, 2008 Description: Sociology 523: Proseminar in Demography and Health Spring 2007: Mondays 1:10-3:50 pm Julie Phillips, Ph.D. Department of Sociology Office: A356 Lucy Stone Hall / Room 203, IHHCPAR, 30 College Avenue Email: jphillips@sociology.rutgers.edu Phone: 445-7... Date Added: 2009-02-02 15:54:04 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> HIST >> 254b Fall, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-11 21:41:10 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 257a Fall, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-10 02:10:32 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 250 Spring, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-11 21:41:10 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 154 Fall, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-10 02:13:16 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 254b Fall, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-11 21:41:10 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 254c Fall, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-10 02:13:16 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 199 Fall, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-10 02:13:46 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 254a Winter, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-10 02:13:46 |
| f32-book-parallel-pres-pt1.ppt Path: UCSB >> ECE >> 1 Spring, 2008 Description: Fundamental Concepts Part I Spring 2006 Parallel Processing, Fundamental Concepts Slide 1 About This Presentation This presentation is intended to support the use of the textbook Introduction to Parallel Processing: Algorithms and Architectures ... Date Added: 2009-01-10 02:10:32 |
| Beam 527 SP06.pdf Path: Ill. Chicago >> PA >> 527 Fall, 2008 Description: Jan. 9, 3:00 PM, 2006 Public Administration 527 PUBLIC MANAGEMENT THEORY Spring 2006 Mondays 2114 ADH 12-3pm Professor George Beam 141 CUPPA Hall Email: gbeam@uic.edu Phone: 312.413.2288 Office Hours: By appointment; send me an email and well set up ... Date Added: 2009-02-03 13:49:11 |
| 203-fall08.pdf Path: University of Iowa >> 131 >> 203 Fall, 2008 Description: Course policies are governed by the College of Liberal Arts and Sciences. Please visit the url, http:/www.clas.uiowa.edu/students/academic_handbook/ in order to get familiar with the following; i. University policies regarding student rights and resp... Date Added: 2009-02-02 19:20:12 |
| Review_for_Final Path: Abilene Christian >> BIBL >> 111 Fall, 2006 Description: Review for Life and Teachings Final Introductory and Background Material 4 Gospels, 4 creatures/images Difference between a Gospel and the gospel What type or genre of literature is a Gospel? Source criticism? 3 Synoptic Gospels? Which Gospel was wri... Date Added: 2008-04-29 09:30:15 |
| EconNotes2 Path: Penn State >> SPAN >> 100 Spring, 2008 Description: Production Possibilities Frontiers and Trade-Offs2/7/2008 4:52:00 PM Production Possibilities Frontier: A curve showing the maximum attainable combinations of two products that may be produced with available resources. Analyzes trade-offs and opportu... Date Added: 2008-03-18 19:56:24 |
| EconNotes2 Path: Penn State >> ECON >> 002 Spring, 2008 Description: Production Possibilities Frontiers and Trade-Offs2/7/2008 4:52:00 PM Production Possibilities Frontier: A curve showing the maximum attainable combinations of two products that may be produced with available resources. Analyzes trade-offs and opportu... Date Added: 2008-03-22 16:29:14 |
| Required Resources Path: Colorado >> MKTG >> 4400 Fall, 2008 Description: Required Resources 1. Proquest: Wall Street Journal 12/23/1988 p.B1 5/24/2001 p.6 2. Business Source Complete: Journal of Change Management 3. Global 500: Fortune Magazine: CNN Money 4. Academy of International Business: AIB Newsletter 4/28/1986 Vo... Date Added: 2009-03-18 14:57:12 |
| 420.pdf Path: University of Illinois, Urbana Champaign >> ABE >> 420 Fall, 2008 Description: Course Schedule - Spring 2006 Electrical and Computer Engineering 420 Digital Signal Processing Lab Credit: 2 hours. Development of real-time digital signal processing (DSP) systems using a DSP microprocessor; several structured laboratory exercises,... Date Added: 2009-02-02 17:59:35 |
| mediaplanv2.pdf Path: Uni. Westminster >> TJW >> 0924 Fall, 2009 Description: THE SMART CAR PRO POS A L AN D A DV ERTI S I NG PL AN PRESENTED BY: TRAVIS WILLIAMSEN JUSTIN PARKHURST CHARLIE CARR AND PHILIP POTTER 2 Executive Summary When analyzing the smart car there are certain trends, challenges, and opportunities to keep ... Date Added: 2009-04-15 21:49:57 |
| Feild et al 2003.pdf Path: Minnesota >> PBIO >> 8081 Fall, 2008 Description: Int. J. Plant Sci. 164(3 Suppl.):S129S142. 2003. 2003 by The University of Chicago. All rights reserved. 1058-5893/2003/16403S-0010$15.00 THE ANCESTRAL ECOLOGY OF ANGIOSPERMS: EMERGING PERSPECTIVES FROM EXTANT BASAL LINEAGES Taylor S. Feild,1 Nan Cr... Date Added: 2009-02-17 21:12:45 |
| nss.pdf Path: Rutgers >> 640 >> 348 Spring, 2008 Description: ON MUNSHIS PROOF OF THE NULLSTELLENSATZ RICHARD G. SWAN Abstract. We use an idea from Munshis proof of Hilberts Nullstellensatz to give a very short but less elementary proof using some basic facts about localization and integral extensions. 1. Int... Date Added: 2009-01-11 18:04:29 |
| nss.pdf Path: Rutgers >> 640 >> 356 Fall, 2008 Description: ON MUNSHIS PROOF OF THE NULLSTELLENSATZ RICHARD G. SWAN Abstract. We use an idea from Munshis proof of Hilberts Nullstellensatz to give a very short but less elementary proof using some basic facts about localization and integral extensions. 1. Int... Date Added: 2009-01-11 18:04:29 |
| 312.pdf Path: Michigan >> MKT >> 312 Winter, 2008 Description: FRENCH PEOPLE\'S STRUGGLES, 1598-1984 Charles Tilly University of Michiean . February 1984 CRSO Working Paper 312 Copies available throueh: Center for Research on Social Organization University of Michiean 330 Packard Street Ann Arbor, Michiean 4... Date Added: 2009-02-02 19:37:56 |
| journal 8 Path: Quinnipiac >> EN >> 101 Fall, 2007 Description: Kyle Garrity Professor Sharyn Nelson EN-101I Journal 8 Due 11/16/07 The story I picked to trace is the Heinrich Himmler story. This story is about a young boy whose father was a Nazi. His father has Heinrich write journals and he teaches Heinrich to... Date Added: 2008-04-07 14:11:37 |
| HA220.doc Path: N. Arizona >> HON >> 345 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 342 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> POS >> 313 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 243 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 313 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> DH >> 227 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> ART >> 380 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUS >> 307 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> UC >> 208 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> AIS >> 350 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> ANT >> 365 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 365 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> TH >> 112 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 244 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 315 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> DH >> 366 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 145 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> ART >> 381 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUS >> 307l Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> GCS >> 485 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HUM >> 485 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 366 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> TH >> 404 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 245 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 324 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> DH >> 370 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 240 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MKT >> 490 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> MUS >> 309 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> ART >> 182 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 368 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> TH >> 423 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 340 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 325 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> DH >> 470 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 241 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 243 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> PHI >> 110 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> ART >> 263 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 375 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> TH >> 485 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> GLG >> 190l Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> HON >> 344 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 341 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> PHY >> 262r Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> HON >> 242 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 312 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> PHI >> 363 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> ART >> 281 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| HA220.doc Path: N. Arizona >> MUP >> 435 Spring, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:48 |
| HA220.doc Path: N. Arizona >> FOR >> 407 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:49 |
| HA220.doc Path: N. Arizona >> GLG >> 303 Fall, 2008 Description: Proposal for Course Change or Deletion 1. Course change effective what term and year? (ex. Spring 2003, Summer 2004) 2. College SHRM HA 220 Fall 2004 3. Department SHRM 4. Current course subject/catalog number 5. Current catalog title and course de... Date Added: 2009-01-09 04:58:47 |
| WebIntro.pdf Path: UCF >> EEL >> 6897 Fall, 2008 Description: Introduction to Java The Java architecture consists of: a high-level object-oriented programming language, a platform-independent representation of a compiled class, a pre-defined set of run-time libraries, a virtual machine. This book is mainly... Date Added: 2009-01-10 02:32:48 |
| lect29.pdf Path: Mich Tech >> EE >> 3160 Fall, 2008 Description: ... Date Added: 2009-01-12 03:39:02 |
| Multi.pdf Path: Berkeley >> ENV SCI >> 10 Fall, 2008 Description: JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 109, D23S11, doi:10.1029/2004JD004513, 2004 Multiscale simulations of tropospheric chemistry in the eastern Pacific and on the U.S. West Coast during spring 2002 Youhua Tang,1 Gregory R. Carmichael,1 Larry W. Ho... Date Added: 2009-01-09 19:29:17 |
| XavierHall01.pdf Path: Loyola Chicago >> WWW >> 1 Fall, 2008 Description: N W S E One Bedroom 340 SF. Unit # 101, 201, 301, 401 ... Date Added: 2009-02-17 23:57:46 |
| 010406Newmodel.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: The Wall Street Journal Interactive Edition April 6, 2001 International Commentary The New Swedish Model By Richard Miniter, editorial page writer for The Wall Street Journal Europe STOCKHOLM - \"What are two things that are red and walk backward?\" as... Date Added: 2009-02-11 18:18:14 |
| CoastalFisheries1963-pg479.pdf Path: TAMU Galveston >> COASTAL >> 1963 Fall, 2008 Description: Job Report Roy B. Johnson Marine Biologist Project No. Project Name: MF-R-5 Date April 13, 1964 _ Analysis of Populations of Sports and Commercial Fin-Fish and of Factors Which Affect These Populations in the Coastal Bays of Texas Job No. 19 P... Date Added: 2009-02-06 18:02:44 |
| medicare_revisedjune23_gv.pdf Path: NYU >> G31 >> 1026 Spring, 2008 Description: Financing Medicare: A General Equilibrium Analysis Orazio Attanasio University College London, CEPR, IFS and NBER Sagiri Kitao University of Southern California, Marshall School of Business Giovanni L. Violante New York University, CEPR and NBER June... Date Added: 2009-01-10 17:17:14 |
| medicare_revisedjune23_gv.pdf Path: NYU >> G31 >> 2403 Fall, 2008 Description: Financing Medicare: A General Equilibrium Analysis Orazio Attanasio University College London, CEPR, IFS and NBER Sagiri Kitao University of Southern California, Marshall School of Business Giovanni L. Violante New York University, CEPR and NBER June... Date Added: 2009-01-10 17:17:15 |
| clns-08-2036.pdf Path: Cornell >> LNS >> 08 Fall, 2008 Description: CLNS 08/2036 CLEO 08-19 Search for CP Violation in the Dalitz-Plot Analysis of D K +K P. Rubin,1 B. I. Eisenstein,2 I. Karliner,2 S. Mehrabyan,2 N. Lowrey,2 M. Selen,2 E. J. White,2 J. Wiss,2 R. E. Mitchell,3 M. R. Shepherd,3 D. Besson,4 T. K. Pe... Date Added: 2009-02-17 21:39:49 |
| ch12sc6skeleton.pdf Path: UPenn >> MATH >> 241 Fall, 2008 Description: 12.6 The Fourier-Bessel Series x 2 y + xy + 2 x 2 2 y = 0 parametric _ of order Math 241 - Rimmer ( ) has general solution on ( 0, ) of y = c1 J ( x ) + c2Y ( x ) very important in the study of __ involving partial differential equations exp... Date Added: 2009-02-06 17:43:36 |
| HiMe01_s064 Path: Clemson >> CE >> 206 Fall, 2007 Description: From Mechanics of Materials, Sixth Edition by R. C. Hibbeler, ISBN 0-13-191345-X. 2005 R. C. Hibbeler. Published by Pearson Prentice Hall, Pearson Education, Inc., Upper Saddle River, NJ. All rights reserved. This material is protected under all cop... Date Added: 2008-05-25 16:16:08 |
| wqlablecture.pdf Path: Purdue >> ABE >> 325 Fall, 2008 Description: Liwei Yang Edward Lu Ground Water ABE 325 Soil & Water Conservation Engineering Water quality lab site: http:/pasture.ecn.purdue.edu/~eql/WaterQuality Lecture site: http:/pasture.ecn.purdue.edu/~abe325/syllabus.html For Oct. 24 groundwater.pdf Gr... Date Added: 2009-01-09 06:31:05 |
| HMT 360 - New Course.pdf Path: Kentucky >> A-S >> 360 Fall, 2008 Description: ... Date Added: 2009-02-03 13:50:59 |
| 1735.121.ps Path: Hawaii >> SOEST >> 1735 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207371569.0388276 Float: 1735 Profile: 121 Location: 35.8N 148.3E Date: 02/09... Date Added: 2009-02-17 20:17:28 |
| s09hwk1.pdf Path: Southern Methodist >> MATH >> 3315 Fall, 2008 Description: Math 3315/CSE 3365 Spring Semester 2009 Homework 1 Tuesday 20 January The SMU honor code applies. This homework is due at the beginning of class on Tuesday 27 January. The homework assignment consists of answering the following problems from the l... Date Added: 2009-02-02 16:12:43 |
| sn2rp1_out.txt Path: Texas Tech >> VENUS >> 96 Fall, 2009 Description: CL(-) + CH3CL SN2 REACTION (March 1994) REACTION PATH FOLLOWING - PES2 Tue Mar 6 16:28:59 CST 2007 NUMBER OF ATOMS= 6 NUMBER OF HARMONIC STRETCHES= 0 NUMBER OF ... Date Added: 2009-04-15 20:03:28 |
| lab_geoprocess.pdf Path: Arizona >> RNR >> 420 Spring, 2008 Description: RNR/GEOG 420/520 Spring 2008 Geoprocessing and Scripting INTRODUCTION This exercise is designed to integrate methods in geoprocessing. The assignment begins with processing some data for the San Diego area using the ModelBuilder, includes some ArcToo... Date Added: 2009-04-15 23:06:01 |
| Chapter13PracticeQuiz Path: Michigan State University >> PSY >> 101 Spring, 2008 Description: 1. Subjective well-being among college students is _ with the extent to which love is valued and _ with the extent to which money is valued. A) positively correlated; positively correlated B) positively correlated; uncorrelated C) uncorrelated; posit... Date Added: 2008-03-27 20:08:22 |
| hw3_soln_p17 Path: Mich Tech >> CM >> cm3110 Spring, 2003 Description: ... Date Added: 2009-04-15 05:02:34 |
| 208labcal-honors.doc Path: Delaware >> BISC >> 208 Fall, 2008 Description: LABORATORY SCHEDULE 2007 Honors BISC208 Introductory Biology II Georgia Giebel, TA Lab Week of # 1 Feb. 12 Topic Introductory Activities Evolution: Hardy, Weinburg, and Kuru (computer-based simulation) Systematics: Phylogenetic Analysis Part A Pla... Date Added: 2009-01-10 03:26:02 |
| 208labcal-honors.doc Path: Delaware >> BISC >> 100 Fall, 2008 Description: LABORATORY SCHEDULE 2007 Honors BISC208 Introductory Biology II Georgia Giebel, TA Lab Week of # 1 Feb. 12 Topic Introductory Activities Evolution: Hardy, Weinburg, and Kuru (computer-based simulation) Systematics: Phylogenetic Analysis Part A Pla... Date Added: 2009-01-10 03:26:00 |
| 208labcal-honors.doc Path: Delaware >> BISC >> 207 Fall, 2008 Description: LABORATORY SCHEDULE 2007 Honors BISC208 Introductory Biology II Georgia Giebel, TA Lab Week of # 1 Feb. 12 Topic Introductory Activities Evolution: Hardy, Weinburg, and Kuru (computer-based simulation) Systematics: Phylogenetic Analysis Part A Pla... Date Added: 2009-01-10 03:26:00 |
| Priscu1995Nutrient.pdf Path: Montana >> AG >> 280 Fall, 2008 Description: ... Date Added: 2009-01-11 18:54:22 |
| FP-18_Exhibit_A.doc Path: ETSU >> FP >> 18 Fall, 2008 Description: File Number:_ EAST TENNESSEE STATE UNIVERSITY SUPPLEMENTAL RECORD OF ILLNESS/INJURY STUDENT STAFF FACULTY VISITOR (circle one) Name: _SSAN:_ Home Address:__ Campus Address: (if applicable):_ Age:_ Sex:_ Date of illness or injury: _ Place of accident... Date Added: 2009-02-17 23:40:56 |
| Final Exam Acronyms sorted Path: Georgia Tech >> ECE >> 4607 Spring, 2008 Description: 3GPP 3G Partnership Project ACCH Associated Control Channel ACI Adjacent Channel Interference ADC Administration Center AGCH Access Grant Channel AICH Acquisition Indicator Channel AMPS Advanced Mobile Phone System AUC AUthentication Center AUX BCCH ... Date Added: 2008-04-28 15:44:31 |
| JM034.pdf Path: Minnesota >> APG >> 034 Fall, 2008 Description: ... Date Added: 2009-02-17 21:21:38 |
| cheat sheet Path: UWO >> BUSINESS >> 020/257 Spring, 2008 Description: SITUATION Role, Time, Issue(s), C/C? WANTS Implications: \"Staying consistent w/ consumer wants *how will KSF meet needs and wants of customers? d) Competitve Analysis ... Date Added: 2008-04-23 16:23:14 |
| Jewish Civ Essay 2 Path: SUNY Albany >> HIST >> 101 Spring, 2008 Description: Josh Landsman Survey of Jewish Civilization Compare the Treatment of the Jews in Western Europe to Those in Eastern Europe in the 19th Century The treatment of the Jews in western Europe and Eastern Europe during the 19th century were very differe... Date Added: 2008-04-24 01:26:45 |
| nov 1 Path: Endicott >> ART >> 101 Spring, 2008 Description: Samantha Need Art History Geometric Period: 8th century BCE Orientalizing Period: 7th Century BCE Archaic Period: 600-480 BCE local flavor with epic themes -death/ mortality/ immortality -warriors/ occupations (masculinity) -sacrifice of one\'s self -... Date Added: 2008-05-20 11:50:26 |
| 132-91JA02446.pdf Path: UCLA >> PHYSICS >> 132 Winter, 2008 Description: JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 97, NO. A3, PAGES 2873-2879, MARCH 1, 1992 On the Formof the Flow in the Magnetosheath DAVIDJ. SOUTHWOOD MARGARET KIVELSON 1 AND G. 2 Instituteof Geophysics PlanetaryPhysics, and University California,LosAngeles... Date Added: 2009-02-02 17:20:20 |
| PowerFactor.pdf Path: George Mason >> ECE >> 280 Fall, 2008 Description: ... Date Added: 2009-01-11 04:56:46 |
| NST10 0915 Path: Berkeley >> NUTRI SCI >> 10 Fall, 2008 Description: NST 10 - Proteins 2008-09-15 Plant vs Animal Proteins Different properties What is protein? Units of proteins are amino acids (have a nitrogen) Proteins are series of connected amino acids make up bulk of cell structure and act as enzymes for... Date Added: 2008-10-12 19:18:40 |
| CS223-0228-Graph Path: MSU Bozeman >> CS >> 223 Spring, 2007 Description: Graph Neil Tang 02/28/2008 CS223 Advanced Data Structures and Algorithms 1 Class Overview Basic concepts Applications Adjacency matrix Adjacency list CS223 Advanced Data Structures and Algorithms 2 Basic Concepts Graph (V, E) CS223 Advan... Date Added: 2008-04-17 21:56:00 |
| Lecture Notes - Scripting.doc Path: UConn >> OPIM >> 3507 Fall, 2008 Description: OPIM 207 Lecture Notes Scripting L. Price, New Riders, 2002, ISBN: 0735711518 What genre are you writing for? Idea #1: Shorten ... Date Added: 2009-01-10 02:42:32 |
| 050909PM.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Low-Key Technocrat to Form New Cabinet News Features Front Page News Business Opinion Arts & Ideas Nightlif... Date Added: 2009-02-11 19:59:05 |
| 730-367.pdf Path: Rutgers >> 730 >> 367 Fall, 2008 Description: AMERICAN PHILOSOPHY Rutgers University School of Arts and Science Department of Philosophy Fall 2008 Course 730:367 Meets M & W, 1:10-2:30 p.m. CAC, Scott Hall, Room 202 Dr. Kathleen Hull Office: CAC, Old Queens Bldg., Room 111 Office Hours: Usually ... Date Added: 2009-02-02 15:54:15 |
| homework2.pdf Path: Clarkson >> MA >> 381 Fall, 2009 Description: Mf\\\'~ I ways to- Ghoos~ a. ~ 0.\\ f \'#~. He \'-\"o.s\\x s r 0. csh,(t So- / j\'~r ho.s ~cl N~ 1~ h~\'S \\.l.\'( W ~$ -tAr Ghoo~e 0 S S lD-L ks / 6 x~ =- 2. ~ CtA Y\\ <A-Y G> \'YY\\ l Yl.a-\\-)lJ)\\~ \'b 1-e- We.o. ( . oJQ tf\'\\~ s;k -t&- ~ri~t\\.... Date Added: 2009-04-15 22:06:56 |
| Midterm1 - Sweezey Path: SIU Edwardsville >> IS >> 386 Spring, 2008 Description: Midterm 1 Sweezey Computer Music Sequencer Performance Word Processor Converting Digital Audio Files Lossless - full file Lossy - redundant information removed; cannot be returned to original sound MIDI - Musical Instrument Digital Interface o Multi... Date Added: 2008-04-09 13:34:42 |
| Stat543-4-25-05.pdf Path: Iowa State >> STAT >> 543 Fall, 2008 Description: Page 1 of 8 mhtml:file:/C:\\Documents%20and%20Settings\\vardeman\\My%20Documents\\Class\\543\\Lectures\\Stat%20543%204-25-05.mht 4/25/2005 Page 2 of 8 mhtml:file:/C:\\Documents%20and%20Settings\\vardeman\\My%20Documents\\Class\\543\\Lectures\\Stat%20543%204-25... Date Added: 2009-01-11 16:21:03 |
| EO_chapter.pdf Path: BYU >> EE >> 562 Fall, 2008 Description: ... Date Added: 2009-02-17 17:21:49 |
| 21Notes.pdf Path: Okaloosa-Walton >> MAT >> 0002 Fall, 2009 Description: MAT 002A Section 2.1 Notes DATE_ Textbook Highlights 1. The helpful hint on page 115 is a reference to the fact that a mixed number is the sum of a whole number and a fraction --Fraction: any number that can be written as where a and b are whole numb... Date Added: 2009-04-15 23:42:09 |
| Lec6-Class021108-f.pdf Path: Berkeley >> EECS >> 235 Fall, 2008 Description: EE 235/NSE 203 Summary of Lecture 6 Contents: Discussions on Quantization Critical dimensions Critical temperature Carrier concentration What it means in a nanostructure? Uniformity issue Comparison between 3D, 2D, 1D, 0D structures The be... Date Added: 2009-02-18 14:18:05 |
| exam1solp1 Path: UF >> PHY >> 2048 Spring, 2008 Description: ... Date Added: 2008-04-11 07:37:30 |
| 498 Syl.pdf Path: University of North Carolina, Wilmington >> COM >> 498 Fall, 2008 Description: COM 498: INTERNSHIP IN COMMUNICATION STUDIES Internship Director: Tammala A. Bulger Office: Office Hours: Leutze Hall #239 Monday by appointment Tuesday by appointment Friday by appointment (910) 96... Date Added: 2009-02-02 19:59:10 |
| 2003Exam1.pdf Path: Delaware >> PHYS >> 245 Fall, 2008 Description: NAME:_ Code to post your grade (not ss # ):_ PHYS245 Exam I, Spring 2003 This is a closed book exam. One 3\"x5\" note card is permitted; this card should be turned in with your exam papers. Programmable calculators and graphing calculators may be used... Date Added: 2009-01-10 03:35:12 |
| 602_15a.ppt Path: Maryland >> SOCY >> 602 Fall, 2008 Description: Sociology 602 (Martin) Lecture 15: May 14, 2002 Details about next weeks final exam. Review for next weeks final exam. conceptual skills math skills examples for practice Final course evaluation Details about the final Time and date: Tuesda... Date Added: 2009-02-03 13:59:46 |
| Response 2 McCormick 5376.pdf Path: Texas Tech >> ENGL >> 5376 Fall, 2008 Description: Staci McCormick Response Paper 2 November 30, 2005 Sven Birkerts and the Erosion of Language Since pre-Elizabethan times, language purists have argued that English as both an independent language and a tool for communication is being lost. This comp... Date Added: 2009-02-03 13:35:25 |
| Case Study Reading.pdf Path: Auburn >> COMP >> 7700 Fall, 2008 Description: 9-807-061 SEPTEMBER 26, 2006 WILLIAM A. SAHLMAN ALISON BERKLEY WAGONFELD Earthbound Farm It was April 2006 and Charles Sweat, chief operating officer for Earthbound Farm, was pleased that it had finally stopped raining in San Juan Bautista, Califor... Date Added: 2009-02-02 13:36:17 |
| 101bquiz7.pdf Path: Ohlone >> MATH >> 101b Fall, 2008 Description: Name _ Spring 08 Show all work & give exact simplified answers 1. (5 pts) Find the length of the curve y = 3x 4 + Practice Quiz 7 Math 101B 1 on the interval 1 x 1. 2 96x 2 2. (5 pts) Rob threw a rock upward at an angle of 45 with the horizon... Date Added: 2009-02-02 15:18:09 |
| lec4seq.pdf Path: UCSD >> CSE >> 231 Spring, 2002 Description: General Data Flow Framework Goal: single framework for all data flow problems Single algorithm, analysis of termination, complexity Approach: Domain of program properties, organized as Lattice Lattice =( ) , Domain Meet operator Ex = All sets of defs... Date Added: 2009-02-18 00:40:06 |
| chapter10.pdf Path: UCSD >> MATH >> 240c Fall, 2008 Description: 4<3 E UX F H N1 G U LY H U | 431 Kloehuw Vsdfhv 43141 Kloehuw Vsdfhv Edvlfv1 Ghqlwlrq 43141 Ohw K eh d frpsoh{ yhfwru vsdfh1 Dq lqqhu surgxfw rq K lv d ixqfwlrq/ k > l = K K $ F> vxfk wkdw 41 kd{ . e|> }l @ dk{> }l . ek|> }l l1h1 { $ k{> }l lv o... Date Added: 2009-01-10 01:49:41 |
| chapter10.pdf Path: UCSD >> MATH >> 240b Winter, 2008 Description: 4<3 E UX F H N1 G U LY H U | 431 Kloehuw Vsdfhv 43141 Kloehuw Vsdfhv Edvlfv1 Ghqlwlrq 43141 Ohw K eh d frpsoh{ yhfwru vsdfh1 Dq lqqhu surgxfw rq K lv d ixqfwlrq/ k > l = K K $ F> vxfk wkdw 41 kd{ . e|> }l @ dk{> }l . ek|> }l l1h1 { $ k{> }l lv o... Date Added: 2009-01-10 01:49:41 |
| syllibus f04.doc Path: UH Clear Lake >> PSYC >> 5831 Fall, 2008 Description: UNIVERSITY OF HOUSTON-CLEAR LAKE PSYC 5831 Gender and Cultural Perspectives in Therapy Course Number Course Title Credit Hours: Prerequisites Semester and Year Instructor Class days and times Class Room Number Office: Office Hours: Office Phone: E-M... Date Added: 2009-02-02 17:58:56 |
| sol2.pdf Path: UPenn >> CIS >> 511 Fall, 2009 Description: ... Date Added: 2009-04-15 21:28:04 |
| Comm130News Path: Cornell >> COMM >> 1300 Spring, 2008 Description: Shot-by-Shot Analysis of NBC Nightly News News clips must quickly convey much information in an appealing way, in order to hold the attention of viewers. By ensuring viewers\' attention, television networks can receive high ratings-the most important ... Date Added: 2008-04-26 13:02:46 |
| 781.pdf Path: Cornell >> MATH >> 781 Fall, 2008 Description: ... Date Added: 2009-02-02 13:59:06 |
| memasociativa.xls Path: TCU >> CS >> 40503 Fall, 2008 Description: AssociativeMemoryModel Frmulas orthogonality normalization Neuroni NeuronalMatrix AxonLineari AxonStepi CompensationLinear Compfornpatterns examplewithanscalar cor a(in) na(in) 0.30 1.00 1.00 0.3 LinearNormalizedVector nu 1.00 cor a(in) na(in) 0.20 ... Date Added: 2009-02-11 16:28:56 |
| Finished__guiding_questions_4.0_overview_of_the_history_and_philosophy_of_science Path: Masters CA >> LS >> 200 Spring, 2008 Description: Guiding Questions: Foundations of Science Module #4 An Ancient History and Philosophy of Science Overview: In the lecture we will be studying the history of science starting with ancient Greece. In the reading we will also be considering the ideas of... Date Added: 2008-04-17 11:40:47 |
| Crosier, The London Cholera Epidemic of 1854.doc Path: UCSD >> PS >> 204 Fall, 2008 Description: John Snow: The London Cholera Epidemic of 1854 By Scott Crosier Background John Snow (1813-1855) was educated at a private school until, at the age of fourteen, he was apprenticed to a surgeon living at Newcastle-on-Tyne. After serving as a colliery... Date Added: 2009-02-18 01:34:28 |
| Stupid gift Path: Allegheny >> ENIVRON SC >> ES 110 Spring, 2008 Description: The stupid gift that I chose for this assignment is a Yodeling Pickle. It is made mainly of plastic but also has metal parts within that form the sound device. Life cycle analyses of plastic products begin with mining. The major raw materials extract... Date Added: 2008-04-18 09:35:35 |
| myers9_ppt_ch01.ppt Path: MN State >> PSY >> 220 Fall, 2008 Description: Introducing Social Psychology CHAPTRE 1 Social Psychology by David G. Myers 9th Edition Introducing Social Psychology Copyright 2008 by The McGraw-Hill Companies, Inc. Introducing Social Psychology What is Social Psychology? What is the diffe... Date Added: 2009-02-11 16:50:50 |
| solution03.pdf Path: Purdue >> MATH >> 03 Fall, 2001 Description: PROBLEM OF THE WEEK Solution of Problem No. 3 (Fall 2003 Series) Problem: How long (in minutes) should the Earth day be so that persons at latitude 42 will experience zero gravity? (Consider the Earth as a sphere of radius 6371km and gravity 981cm/se... Date Added: 2009-02-06 18:28:54 |
| 2.in.txt Path: LSU >> ACM2004 >> 2004 Fall, 2008 Description: 4 1 Ted Bill 25 4 Ray James 40 James Beelzebub 17 Ray Mark 75 Ted Ray 20 4 Ted Ray 96 Ray James 1 James Tim 1 Tim Marc 1 7 Jenn Thomas 20 Ted Tim 76 Tim CB 24 Jenn Meg 20 Tim Bailey 24 Ted Jenn 80 Ted Jennifer 80 ... Date Added: 2009-02-17 18:48:32 |
| 2.in.txt Path: LSU >> CSC >> 2004 Fall, 2008 Description: 4 1 Ted Bill 25 4 Ray James 40 James Beelzebub 17 Ray Mark 75 Ted Ray 20 4 Ted Ray 96 Ray James 1 James Tim 1 Tim Marc 1 7 Jenn Thomas 20 Ted Tim 76 Tim CB 24 Jenn Meg 20 Tim Bailey 24 Ted Jenn 80 Ted Jennifer 80 ... Date Added: 2009-02-17 18:48:53 |
| RTP paper 2 Path: Mass Colleges >> HIST >> 32.369 Spring, 2008 Description: 1 Patrick Moran RTP paper 2 April 15, 2008 The council has met at Jerusalem, where King of France and Germany, as well as papal leaders and leaders of the Latin Kingdom have met and decided as a majority to go through with the Crusade. The question n... Date Added: 2008-04-21 20:09:09 |
| syllabus03.pdf Path: Berkeley >> E >> 240 Fall, 2008 Description: Economics 240B, Second Half, 2003 GSI: Hui Tong (htong@econ.berkeley.edu) Daniel McFadden, 655 Evans Office Hours Tue 4-6 or by appt (mcfadden@econ.berkeley.edu) COURSE OUTLINE AND SYLLABUS 70 Evans Hall, Monday 12:10-2:00, Wednesday 12:40-2:00 Tex... Date Added: 2009-02-17 17:46:18 |
| syllabus03.pdf Path: Berkeley >> E >> 240 Fall, 2008 Description: Economics 240B, Second Half, 2003 GSI: Hui Tong (htong@econ.berkeley.edu) Daniel McFadden, 655 Evans Office Hours Tue 4-6 or by appt (mcfadden@econ.berkeley.edu) COURSE OUTLINE AND SYLLABUS 70 Evans Hall, Monday 12:10-2:00, Wednesday 12:40-2:00 Tex... Date Added: 2009-02-17 17:47:41 |
| syllabus03.pdf Path: Berkeley >> ECON >> 240b Spring, 2008 Description: Economics 240B, Second Half, 2003 GSI: Hui Tong (htong@econ.berkeley.edu) Daniel McFadden, 655 Evans Office Hours Tue 4-6 or by appt (mcfadden@econ.berkeley.edu) COURSE OUTLINE AND SYLLABUS 70 Evans Hall, Monday 12:10-2:00, Wednesday 12:40-2:00 Tex... Date Added: 2009-01-09 19:26:21 |
| syllabus03.pdf Path: Berkeley >> ECON >> 240 Fall, 2008 Description: Economics 240B, Second Half, 2003 GSI: Hui Tong (htong@econ.berkeley.edu) Daniel McFadden, 655 Evans Office Hours Tue 4-6 or by appt (mcfadden@econ.berkeley.edu) COURSE OUTLINE AND SYLLABUS 70 Evans Hall, Monday 12:10-2:00, Wednesday 12:40-2:00 Tex... Date Added: 2009-02-17 17:39:09 |
| lecture4.ppt Path: Oklahoma State >> BAE >> 5413 Fall, 2008 Description: Response of First Order Systems to Sinusoidal Input 2/7/2006 BAE 5413 1 of 9 First Order System - Sinusoidal Input Consider the following first order system: dO (t ) + O (t ) = I (t ) O( s )(s + 1) = I ( s ) dt I (t ) = A sin(t ) O( s) 1 G ( s)... Date Added: 2009-02-02 21:42:07 |
| propostas ex3 Path: Uni. São Paulo >> FISICA >> FAP Spring, 2008 Description: JULIO CESAR PESTANA N USP: 3466152 2 Semestre de 2008 PROPOSTAS E PROJETOS PARA O ENSINO DE FSICA EXERCCIO 3 1. Em sua opinio, quais so os principais problemas para se selecionar um livro texto? Precisamos atentar aos seguintes aspectos: se o livr... Date Added: 2008-08-21 08:57:46 |
| ps10 Path: Penn State >> EE >> 350 Fall, 2007 Description: EE 350 PROBLEM SET 10 DUE: 10 December 2007 Reading assignment: Lathi Chapter 6, Sections 6.4 and 6.5 Laboratory sections meet the week of December 3. Problem 50: (20 points) Consider the circuit shown in Figure 1. 15 10 f(t) + - 1 F 2 + ... Date Added: 2008-07-23 11:31:12 |
| InstructionForLab6.doc Path: MTSU >> CSCI >> 5560 Fall, 2008 Description: Using Oracle SQL*PLUS: 1. Log in to shemp.cs.mtsu.edu using your own account. If you dont have a shemp account, go to the page: www.cs.mtsu.edu to get one or ask help from assistants at the Computer Lab. 2. The SQL*PLUS can be found at Start All Pro... Date Added: 2009-01-09 03:11:49 |
| Easy.txt Path: California State University, Monterey Bay >> OLD >> 6 Fall, 2009 Description: 1 / Easy.java 2 / 3 / Ethan Bolker 4 5 package edu.umb.cs.game; 6 import java.util.*; 7 import edu.umb.cs.io.Terminal; 8 9 /* 10 * Primitives for a simple game. 11 * 12 * Writt... Date Added: 2009-04-15 19:32:40 |
| Easy.txt Path: California State University, Monterey Bay >> OLD >> 680 Fall, 2009 Description: 1 / Easy.java 2 / 3 / Ethan Bolker 4 5 package edu.umb.cs.game; 6 import java.util.*; 7 import edu.umb.cs.io.Terminal; 8 9 /* 10 * Primitives for a simple game. 11 * 12 * Writt... Date Added: 2009-04-15 19:32:40 |
| a room Path: Wittenberg >> ENGL >> 101 Spring, 2008 Description: Haidet 1 Allie Haidet English 101 Dr. Buckman 4/1/08 Equality Between The Sexes It seems as though ever since the beginning of time, men and women have consistently sought superiority over the other. Each thinks that they are doing their gender good ... Date Added: 2008-04-07 18:24:20 |
| EE562a_Lecture_10_100107 Path: USC >> EE >> EE562a Fall, 2007 Description: Oct 1-5:01 PM 1 Oct 1-5:03 PM 2 Oct 1-5:07 PM 3 Oct 1-5:11 PM 4 Oct 1-5:20 PM 5 Oct 1-5:26 PM 6 Oct 1-5:31 PM 7 Oct 1-5:37 PM 8 Oct 1-5:39 PM 9 Oct 1-5:42 PM 10 Oct 1-5:47 PM 11 Oct 1-5:57 PM 12 Oct 1-6:01 PM 13 Oct 1-6:03 P... Date Added: 2008-02-28 10:24:03 |
| everettc.pdf Path: BU >> CFA MU >> 152 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 623 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 342 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 681 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 409 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> GRS MB >> 907 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-11 18:29:46 |
| everettc.pdf Path: BU >> CFA MU >> 482 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 596 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 334 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 668 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 397 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 978 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 456 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 146 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 263 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 657 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 373 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 827 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 438 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 571 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 153 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 627 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 343 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 686 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 416 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> GRS MB >> 908 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-11 18:29:46 |
| everettc.pdf Path: BU >> CFA MU >> 485 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 606 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 336 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 671 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 398 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 986 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 463 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 147 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 276 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 658 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 376 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 830 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 439 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 572 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 184 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 628 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 351 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 708 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 421 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 488 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 148 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 611 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 338 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 676 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 401 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 988 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 471 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 295 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 659 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 377 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 850 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 442 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 573 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 204 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 651 Spring, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 352 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 777 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 432 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 492 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 149 Spring, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 615 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 339 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 678 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 405 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> SAR HS >> 488 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 477 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 296 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 665 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 394 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 851 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 446 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 125 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 576 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 208 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 655 Spring, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 361 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 779 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 433 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 497 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 151 Spring, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 620 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 340 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 679 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 407 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> GRS LL >> 986 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-11 18:29:46 |
| everettc.pdf Path: BU >> CFA MU >> 479 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 595 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| everettc.pdf Path: BU >> CFA MU >> 329 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 667 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 395 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 891 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:11 |
| everettc.pdf Path: BU >> CFA MU >> 450 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 145 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:05 |
| everettc.pdf Path: BU >> CFA MU >> 228 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:06 |
| everettc.pdf Path: BU >> CFA MU >> 656 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 371 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:07 |
| everettc.pdf Path: BU >> CFA MU >> 790 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:10 |
| everettc.pdf Path: BU >> CFA MU >> 437 Summer, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:08 |
| everettc.pdf Path: BU >> CFA MU >> 567 Fall, 2008 Description: Everett Public Schools (C)1 Tom Stella and The Parlin School It was 4:30 in the afternoon and the halls of the Parlin Junior High School in Everett, Massachusetts were deserted. Tom Stella, the school\'s principal, was sitting at his desk and sorting... Date Added: 2009-01-09 07:34:09 |
| Lesson_6.pdf Path: N. Illinois >> PHYS >> 375 Fall, 2008 Description: Amplifier and feedback systems Amplifier system Feedback system P. Piot, PHYS 375 Spring 2008 Amplifier Rg ie ve source amplifier +VCC Ze vs Zs il vg -VEE RL load vL Function: amplify the signal power amplifiers are powered by an externa... Date Added: 2009-01-09 05:19:24 |
| ECON lecture 11 Path: Cornell >> ECON >> 1110 Spring, 2008 Description: ... Date Added: 2008-03-02 17:29:04 |
| 2.18 (incentives, material, Hawthorne, salaries) Path: Virginia Tech >> ISE >> 4004 Spring, 2008 Description: Guy who worked in Africa, didn\'t get paid a lot, was a teacher, loved his job, so he had incentives that weren\'t material. The goal of the organization was enough for him Incentives - four specific (can be given) o 1. Material Money, Barnard says, \"... Date Added: 2008-03-31 09:05:34 |
| 050406unrest.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: TCS: Tech Central Station - What Color for Minsk? HOME > EUROPEAN UNION Bogdan Klich Member of the European Parliament - Poland Biographical related articles Nordic Combined TCS EU Summit Coverage: Summit of All Fears When the EU Blogs The Real Thr... Date Added: 2009-02-11 19:45:18 |
| sm2_16 Path: Iowa State >> EM >> 324 Spring, 2008 Description: MECHANICS OF MATERIALS, 6th Edition 2-16* From a free-body diagram of the block A, the equations of equilibrium give RILEY, STURGES AND MORRIS Fx = 0 : Fy = 0 : 700 - FAC cos - FAE cos = 0 FAE sin - FAC sin = 0 700 N 2 cos FAC FAC = FAE = ... Date Added: 2008-04-05 13:06:30 |
| CCO MGT 2990.doc Path: SLCC >> MGT >> 2990 Fall, 2008 Description: Mgt. 2990 Current Topics in Management This course will vary semester to semester; will present a forum where students will be introduced to topics of current interest and worth in the field of management. Prerequisites: Variable Number of Credits: 1... Date Added: 2009-02-02 15:57:25 |
| Fuhrer.pdf Path: Millsaps >> CORE >> 4 Fall, 2008 Description: BEETHOVEN AS FUHRER 1 Esteban Buch In Germany, with the Nazi accession to power and their strict control over the nations cultural life, the great musical hero was now the composer of Die Meistersinger.2 Winifred Wagners Bayreuth3 was for the Fhre... Date Added: 2009-02-11 21:46:21 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> CHE >> 1314 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-11 16:45:49 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> PHY >> 2254 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-09 04:15:03 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> PHY >> 2424 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-12 03:42:21 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> PHY >> 2524 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-09 04:15:15 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> BIO >> 1314 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-09 04:14:13 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> BIO >> 1134 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-11 16:45:36 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> CHE >> 1214 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-09 04:14:33 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> BIO >> 1144 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-11 16:45:36 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> CHE >> 1224 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-09 04:14:33 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> BIO >> 2924 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-11 16:45:44 |
| NERVOUSTAKEHOME.doc Path: MGCCC >> PHY >> 2244 Spring, 2008 Description: NAME _ BIO 2514 DATE _ NERVOUS WORKSHEET CLASS TIME _ _1. STRUCTURE OF A NEURON WITH ONLY ONE DENDRITE. _2. INABILITY TO USE OR COMPREHEND WORDS. _3. EMBRYONIC AREA OF THE BRAIN CALLED THE FOREBRAIN. _4. THE WHITE COLOR OF THE WHITE MATTER OF THE... Date Added: 2009-01-09 04:14:55 |
| OWY1.pdf Path: UC Davis >> FRE >> 021 Winter, 2008 Description: Three Scales of Strategies 45 Ranch: ~ 70,000 acres Owyhee Borderlands Trust: ~ 150,000300,000 acres Owyhee Initiative: ~ 5 million acres 45 Ranch: Opportunities & Liabilities Legally responsible for grazing preferences/costs of management Best... Date Added: 2009-01-11 20:26:57 |
| OWY1.pdf Path: UC Davis >> FRE >> 022 Fall, 2008 Description: Three Scales of Strategies 45 Ranch: ~ 70,000 acres Owyhee Borderlands Trust: ~ 150,000300,000 acres Owyhee Initiative: ~ 5 million acres 45 Ranch: Opportunities & Liabilities Legally responsible for grazing preferences/costs of management Best... Date Added: 2009-01-11 20:26:57 |
| OWY1.pdf Path: UC Davis >> TNCINVASIV >> 1 Fall, 2008 Description: Three Scales of Strategies 45 Ranch: ~ 70,000 acres Owyhee Borderlands Trust: ~ 150,000300,000 acres Owyhee Initiative: ~ 5 million acres 45 Ranch: Opportunities & Liabilities Legally responsible for grazing preferences/costs of management Best... Date Added: 2009-02-06 18:20:24 |
| 6.1 - Conic Sections Path: Alamo Colleges >> MATH >> 2412 Spring, 2008 Description: Name_ 6.1: Conic Sections PARABOLA A parabola is the set of points in the plane that are equidistant from a fixed line (the directrix) and a fixed point (the focus) not on the directrix. The midpoint of the line segment between the focus and the d... Date Added: 2008-04-13 19:53:00 |
| halfspaces.pdf Path: Rochester >> ME >> 223 Fall, 2009 Description: ME 223 Initial Value Problem for Two Half Spaces In this notebook, we look at the solution for the problem of two half-spaces, each with a different constant initial temperature, put in contact at time t = 0. We assume that the temperature depends on... Date Added: 2009-04-15 22:33:36 |
| hw3.pdf Path: Arizona >> C SC >> 473 Fall, 2008 Description: CSc 473 Homework 3 Fall 2006 This homework is due Tuesday November 7 at the start of class. Questions are drawn from the material in Sections 2.1 and 2.2 of the text on context-free grammars and pushdown automata. The homework is worth 100 points.... Date Added: 2009-01-09 15:51:53 |
| hw3.pdf Path: Arizona >> CS >> 473 Fall, 2009 Description: CSc 473 Homework 3 Fall 2006 This homework is due Tuesday November 7 at the start of class. Questions are drawn from the material in Sections 2.1 and 2.2 of the text on context-free grammars and pushdown automata. The homework is worth 100 points.... Date Added: 2009-04-15 22:56:35 |
| BestBuyModel Path: St. Thomas >> ACCT >> 205 Spring, 2008 Description: Financial Analysis Project: Best Buy, Inc. Part 1: Company Information Dave Johnson Video Menu From Yahoo Finance-Profile-Expanded Business Description: Incorporated in Minnesota in 1966 as Sound of Music, Inc., Best Buy Company is a specialty ret... Date Added: 2008-04-07 21:30:37 |
| word_spr07_19.doc Path: Sierra >> BIOSCI >> 1 Fall, 2008 Description: PUK2 #19 Combined sequence with ends edited and overlap removed: CGGGTAGCTACCATGCAGCCGAGCGGTATTTCTTCTTCGGAAGAGAGAGAGCG GCGTACGGGTGCGTAACACGTGTGCAACCTACCTTTATCTGGGGGATAGCCTTT CGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCATTTAATATTGAAA ACTCCGGTGGATAGAGATGG... Date Added: 2009-01-12 05:28:02 |
| word_spr07_19.doc Path: Sierra >> BIOSCI >> 2 Fall, 2008 Description: PUK2 #19 Combined sequence with ends edited and overlap removed: CGGGTAGCTACCATGCAGCCGAGCGGTATTTCTTCTTCGGAAGAGAGAGAGCG GCGTACGGGTGCGTAACACGTGTGCAACCTACCTTTATCTGGGGGATAGCCTTT CGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCATTTAATATTGAAA ACTCCGGTGGATAGAGATGG... Date Added: 2009-01-12 05:28:02 |
| word_spr07_19.doc Path: Sierra >> BIOSCI >> 4 Fall, 2008 Description: PUK2 #19 Combined sequence with ends edited and overlap removed: CGGGTAGCTACCATGCAGCCGAGCGGTATTTCTTCTTCGGAAGAGAGAGAGCG GCGTACGGGTGCGTAACACGTGTGCAACCTACCTTTATCTGGGGGATAGCCTTT CGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCATTTAATATTGAAA ACTCCGGTGGATAGAGATGG... Date Added: 2009-01-12 05:28:02 |
| n10.pdf Path: UCSD >> PHYS >> 100b Fall, 2008 Description: ... Date Added: 2009-01-10 01:56:34 |
| hw2020c.ps Path: ETSU >> PHYS >> 2020 Fall, 2008 Description: PHYS-2020-201: General Physics II Problem Set 3, Spring 2008 There are 9 problems you are to complete via the web at http:/capa.etsu.edu/ You will gain access to this set by typing in your CAPA Student Number and CAPA ID which will be supplied to yo... Date Added: 2009-02-17 23:43:04 |
| K4.ppt Path: Kansas >> SOE >> 50 Fall, 2008 Description: Enhancing Efficiency of Para-Educators Through Professional Development of Certified Staff Claudia Reinfelds Career Teacher, Olathe District Schools Doctoral student with the University of Kansas Para-Educators Defined The prefix para (beside, al... Date Added: 2009-02-17 22:40:19 |
| K4.ppt Path: W. Kentucky >> SOE >> 50 Fall, 2008 Description: Enhancing Efficiency of Para-Educators Through Professional Development of Certified Staff Claudia Reinfelds Career Teacher, Olathe District Schools Doctoral student with the University of Kansas Para-Educators Defined The prefix para (beside, al... Date Added: 2009-02-17 22:40:19 |
| Lesson6_Part2.pdf Path: Minnesota >> BIOSTAT >> 6 Fall, 2008 Description: Overview Lesson 6 Part 2 Binomial Distribution Poisson Distribution Lesson 6 Part 2 covers two probability distributions for discrete variables Binomial Distribution Poisson Distribution PubH 6414 Lesson 6 Part 2 2 Review: Probability Distributi... Date Added: 2009-02-17 21:05:45 |
| NSE252.doc Path: N. Arizona >> BIO >> 346 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> ENG >> 406 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> CM >> 401 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> BIO >> 375 Spring, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> SHP >> 303 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> PAS >> 224 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> BIO >> 376 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> ANT >> 211 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> VC >> 355 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> DH >> 430 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> MKT >> 338 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> AS >> 250 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> VC >> 356 Spring, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> DIS >> 408 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> CENE >> 281l Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> BA >> 470c Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:32 |
| NSE252.doc Path: N. Arizona >> VC >> 408 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> ECI >> 311 Fall, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| NSE252.doc Path: N. Arizona >> CJ >> 495 Spring, 2008 Description: Proposal for New Course 1. New course effective what term and year? (ex. Spring 2003, Summer 2004) 2. College Undergraduate Studies NSE 252 3. Department Fall 2005 International Office 5. Units (credit hours) 1-6 4. Course subject/catalog number 6. ... Date Added: 2009-01-09 05:10:33 |
| EE249_PetriNets1.pdf Path: Berkeley >> EE >> 249 Fall, 2009 Description: EE249 Discussion Petri Nets: Properties, Analysis and Applications - T. Murata Chang-Ching Wu 10/9/2007 What are Petri Nets A graphical & modeling tool. Describe systems that are concurrent, asynchronous, distributed, parallel, nondeterministic, an... Date Added: 2009-04-16 01:44:01 |
| june2007.pdf Path: Tufts >> HR >> 1171973088 Fall, 2008 Description: periscope TUFTS DENTAL FACILITIES They have a calling to serve DEPARTMENT OF HUMAN RESOURCES JUNE 2007 www.tufts.edu/hr/index Inside HEALTH & WELLNESS 2 DO YOU COMMUTE? 4 WELCOME PETER PRUYNE Tufts Dental Facility at the Wrentham Developmental C... Date Added: 2009-02-04 14:31:46 |
| review3.pdf Path: San Jose State >> MATH >> 10 Spring, 2008 Description: QXphyqhth F Y tF c e V a W x s V c } } x s e s h qh hrfvP2Qtm f tF rrfhrvt tFR B E Q w o c q s h d q h x s h g V w x c h g q c q w h se x q h ! D % XQXp&rfn... Date Added: 2009-01-09 07:03:01 |
| PSCI3810.21JUN2007.Notes Path: North Texas >> PSCI >> 3810 Summer, 2008 Description: 21JUN2007 Huntington 1993 -What is a civilization? -Why will civilizations war? Clash of Civilizations -evolution of conflict -Princes states Ideologies Civilizations -Argument: International relations is beginning to move out of its West-centered... Date Added: 2008-04-16 14:08:45 |
| 11-03-03-Monday(39696) Path: RIT >> CS >> 334 Fall, 2003 Description: ... Date Added: 2008-04-11 21:13:39 |
| rock_worksheet_9 Path: UNC Greensboro >> MUS >> 329 Spring, 2008 Description: History of Rock and Roll Videotape 9: Punk 1. How did conditions in London (1975) spawn the punk movement? 1975: London is a city in decay people felt hopeless: no future class warfare: resentment spreading punk: hope among hopelessness punk = c... Date Added: 2008-04-10 15:17:58 |
| review.pdf Path: Michigan >> WWW-PERSON >> 535 Fall, 2004 Description: The structure and function of complex networks M. E. J. Newman Department of Physics, University of Michigan, Ann Arbor, MI 48109, U.S.A. and Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, NM 87501, U.S.A. Inspired by empirical studies of network... Date Added: 2009-02-17 16:03:34 |
| L30-sb-parallel.pdf Path: Berkeley >> CS >> 61 Fall, 2004 Description: inst.eecs.berkeley.edu/~cs61c CS61C : Machine Structures 2007-8-15 Scott Beamer, Instructor Lecture #30 Parallel Computing Ion Wind Cooling Developed by Researchers at Purdue CS61C L30 Parallel Computing (1) www.bbc.co.ukBeamer, Summer 2007 UCB... Date Added: 2009-04-16 01:45:07 |
| Frame of Reference Path: Ohio State >> SOCIOLOGY >> 321 Fall, 2008 Description: The Frame of Reference: Earth\'s Location Grid, Time Zones, and the International Date Line LATITUDE AND LONGITUDE BecauseEarth\'ssurfaceis vast and complex.we need a uniformsystemfor identifyinglocations, especially locationsrelative to other places.... Date Added: 2008-04-22 21:53:07 |
| 483 grading policies Fall 2007.pdf Path: Delaware >> ECON >> 483 Fall, 2008 Description: Grading policies 483 fall 2007.doc Economics 483 Fall 2007 Grading Procedures Table of Contents Grade trackspage 1 Debate.page 2 Article reviews for A and B tracks page 3 Term paper for A trackpages 4-5 The Contractpages 6-7 Student copy of signa... Date Added: 2009-02-02 17:48:52 |
| 060217border.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Mexican Border Town Remains Troublesome - New York Times February 17, 2006 Mexican Border Town Remains Troublesome By THE ASSOCIATED PRESS Filed at 4:34 p.m. ET NUEVO LAREDO, Mexico (AP) - The weary residents of this border city at the center of an ... Date Added: 2009-02-11 17:44:30 |
| 060217border.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Mexican Border Town Remains Troublesome - New York Times February 17, 2006 Mexican Border Town Remains Troublesome By THE ASSOCIATED PRESS Filed at 4:34 p.m. ET NUEVO LAREDO, Mexico (AP) - The weary residents of this border city at the center of an ... Date Added: 2009-02-11 18:27:58 |
| Deb_Bipasha_Thesis.pdf Path: Texas Tech >> ETD >> 11022007 Fall, 2009 Description: POTENTIAL ENERGY FUNCTION AND DYNAMICS OF ENERGY TRANSFER AND FRAGMENTATION FOR COLLISIONS OF PROTONATED PEPTIDE IONS WITH ORGANIC SURFACES by BIPASHA DEB M.S. A THESIS in CHEMISTRY Submitted to the Graduate Faculty in Partial Fulfillment of the Requ... Date Added: 2009-04-15 20:18:08 |
| notes_7.pdf Path: SUNY Albany >> PAD >> 504 Fall, 2008 Description: RPAD 504 Eighth Class Midterm Quiz plus Introduction to DataBases March 22, 2006 Midterm Quiz (until around 7:15 PM) Introduction to Databases Setting up a Personal Rolodex One Table Databases Entities vs. Attributes Records vs. Fields Computer Impl... Date Added: 2009-02-04 14:35:40 |
| 15. groundwater_06 Path: Mines >> SYGN >> 101 Spring, 2008 Description: OBJECTIVES FOR GROUNDWATER 1) What is the largest reservoir of fresh water and what is the largest reservoir of useable fresh water? Largest reservoir is in ice sheets and glaciers Largest usable is groundwater 2) Know the definitions of the followin... Date Added: 2008-04-16 12:08:51 |
| 110-Hillery-09-12-75.pdf Path: Pittsburgh >> ECON >> 110 Spring, 2008 Description: ... Date Added: 2009-02-02 20:08:32 |
| 01_InstSolManual_PDF_Part4 Path: Pitt. State >> PHYS >> 114 Spring, 2008 Description: 1-4 Chapter 1 (b) 1 1100 ft / s 2 (c) 1 60 mi / h 2 (d) 1 9.8 m / s2 2 1 1.15. Set Up: In each case, round the last signicant gure. Solve: (a) 3.14, 3.1416, 3.1415927 (b) 2.72, 2.7183, 2.7182818 (c) 3.61, 3.6056, 3.6055513 Reect: All of these re... Date Added: 2009-03-06 15:29:00 |
| ApprovedMinutes-2005-02-04.doc Path: Alaska Pacific >> X >> 9051 Fall, 2008 Description: STAFF ADVISORY COUNCIL APPROVED MINUTES February 4, 2005 Attended: In Stockton: Wendy Cornwall, Robert Miller, Sara Kleinert, Lisa Rodriguez, Ed Garrick At McGeorge: Peggy Kay, Dan Campbell, Lisa Cooper, Cheryll Bautista-Reale, Lupe Mazuka, Pat Spree... Date Added: 2009-02-18 13:56:37 |
| ApprovedMinutes-2005-02-04.doc Path: Alaska Pacific >> CMSPROD >> 9051 Fall, 2008 Description: STAFF ADVISORY COUNCIL APPROVED MINUTES February 4, 2005 Attended: In Stockton: Wendy Cornwall, Robert Miller, Sara Kleinert, Lisa Rodriguez, Ed Garrick At McGeorge: Peggy Kay, Dan Campbell, Lisa Cooper, Cheryll Bautista-Reale, Lupe Mazuka, Pat Spree... Date Added: 2009-02-18 14:00:08 |
| BTMD_WSDSM00.ps Path: Rutgers >> WSDSM >> 2000 Fall, 2008 Description: BTMD: Small, Fast Diffs for WAN-Based DSM Michael D. Rogers Christopher Diaz Raphael Finkel James Grifoen James E. Lumpp, Jr. University of Kentucky Lexington, KY Abstract The performance of distributed shared memory (DSM) over a wide area netw... Date Added: 2009-02-04 14:50:50 |
| cstarr2.pdf Path: UCM >> MATH-CS >> 2 Fall, 2008 Description: COMPLEMENTARY GRAPHS AND THE CHROMATIC NUMBER Colin L. Starr and Galen E. Turner III Abstract. Zykov proved that if G and G are complementary graphs having chromatic numbers and , respectively then is at least the number of vertices of G. Nordhau... Date Added: 2009-02-06 20:04:13 |
| appeni.pdf Path: Cornell >> CSS >> 674 Fall, 2008 Description: Appendix I Co-Composter Description and User\'s Manual October 2001 Available at: http:/compost.css.cornell.edu/CoComposter.xls Introduction Cornells Department of Biological and Environmental Engineering and Waste Management Institute have developed... Date Added: 2009-01-11 18:38:34 |
| ermentrout.pdf Path: Ohio State >> WS >> 1 Fall, 2002 Description: Learning Synchrony Oscillations and Spike-time dependent plasticity Bard Ermentrout University of Pittsburgh October 2002 Learning Synchrony p.1/25 And what if all of animated nature Be but organic harps diversely framd That tremble into thought,a... Date Added: 2009-02-17 22:28:49 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


