Course Solutions And Notes - P1-mapleIntro 26
| 388Food Safety Outreach_2009.pdf Path: Idaho >> FCS >> 388 Spring, 2008 Description: FCS 388 ASSIGNMENT: POINTS: 100 Food Safety Outreach (FSO) Project PROCEDURES: CPD students will participate in a week long, campus-wide Food Safety Outreach campaign to University of Idaho students. Each student will participate in planning, delive... Date Added: 2009-06-13 03:20:06 |
| hw2key.ps Path: Acton School of Business >> STAT >> 310 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: hw2key.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips hw2key %DVIPSParameters: dpi=3... Date Added: 2009-06-13 03:21:50 |
| sam2673f06t3.pdf Path: Youngstown >> M >> 2673 Fall, 2009 Description: ... Date Added: 2009-06-13 03:22:23 |
| Concept Selection Matrices by Subgroup.pdf Path: RIT >> P >> 08001 Fall, 2009 Description: Tilt Resistance A B C (reference) Bushing EM shock Movable/spring Rating Weighted Rating Weighted Rating Weighted Score Score Score Concepts D E F G Selection Criteria Tilt Range Bike Capacity Portability Adjustment tools Service intervals level... Date Added: 2009-06-13 03:22:28 |
| AHA Primer Turbo Product Codes.pdf Path: UCSD >> ECE >> 111 Fall, 2008 Description: comtech aha corporation AHA Application Note Primer: Turbo Product Codes ANTPC01_0499 A subsidiary of Comtech Telecommunications Corporation 1126 Alturas Drive Moscow ID 83843 tel: 208.892.5600 fax: 208.892.5601 www.aha.com comtech aha corp... Date Added: 2009-06-13 03:24:34 |
| IE 361 Exam 2 Key Fall 2005.pdf Path: Iowa State >> IE >> 361 Fall, 2009 Description: ... Date Added: 2009-06-13 03:25:20 |
| pCR oriLC r.txt Path: Illinois Tech >> IPRO >> 302 Fall, 2009 Description: CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC ATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGA GATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTC CAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACC CTAATC... Date Added: 2009-06-13 03:26:28 |
| bonding.txt Path: Carnegie Mellon >> ECE >> 1212 Fall, 2009 Description: <html> <head> <meta http-equiv=\"Refresh\" content=\"0;URL=https:/webiso.andrew.cmu.edu/\"> </head> <body bgcolor=\"#ffffff\"> </body> </html> ... Date Added: 2009-06-13 03:26:40 |
| Macfarlane2003.pdf Path: ASU >> GLG >> 494 Fall, 2008 Description: ABSTRACT Nuclear waste disposal in the USA is a difficult policy issue infused with science, technology, and politics. This issue provides an example of the co-production of scientific knowledge and politics through public policy. The proponents of a... Date Added: 2009-06-13 03:27:29 |
| Bats_in_Question_Wilson1997.pdf Path: Idaho >> WLF >> 314 Fall, 2008 Description: ... Date Added: 2009-06-13 03:29:15 |
| Exam2_Review.pdf Path: Western Michigan >> ECE >> 4700 Fall, 2008 Description: Exam #2 Review Lecture Chapter 9: Stability in the Frequency Domain Mapping Contours in the s-plane (Nyquist plots) The Nyquist Stability Criterion Relative Stability and the Nyquist Criterion Gain and Phase Margins The Stability of Control Systems ... Date Added: 2009-06-13 03:29:25 |
| StorytellingtoWriting.ppt Path: UH Clear Lake >> B >> 3308 Fall, 2009 Description: FromStorytellingtoWriting Using storytelling as a pre-writing activity Beth Hammett College of the Mainland Greater Houston Area Writing Project mbhammett@aol.com/bhammett@com .edu copyright2003 We could learn a lot from crayons: some are pretty,... Date Added: 2009-06-13 03:29:59 |
| Logic1.pdf Path: Purdue >> ECE >> 559 Fall, 2008 Description: EE559 MOS VLSI Design Combinational Logic Gates in CMOS References: Adapted from: Digital Integrated Circuits: A Design Perspective, J. Rabaey, Prentice Hall UCB Principles of CMOS VLSI Design: A Systems Perspective, N. H. E. Weste, K. Eshraghian,... Date Added: 2009-06-13 03:30:29 |
| FED_DCP_F08a_T16_V6.0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Feasibility Evidence Description (FED) Theater Script Online Database Team No 16 Jae Young Bang Gary Lam Young Chan Noh Ka Ho Au Shi Heng Guan Sandeep Mikkilineni Nory Kealii Nishimura John Christopher Reynolds Julie Sanchez Project Manager Require... Date Added: 2009-06-13 03:31:22 |
| LCP_DCP_F08a_T16_V6.0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Life Cycle Plan (LCP) Theater Script Online Database Team No 16 Jae Young Bang Sandeep Mikkilineni Gary Lam Shi Heng Guan Young Chan Noh Ka Ho Au Nory Kealii Nishimura John Christopher Reynolds Julie Sanchez Project Manager Operational Concept Eng... Date Added: 2009-06-13 03:31:22 |
| ACC 302 Ch 18 Quiz NO.rtf Path: St. Leo >> ACC >> 302 Fall, 2009 Description: ACC 302 Quiz Chapter 18 Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. _ 1. A contract, traded on an exchange, that allows a company to buy a specified quantity of a commodity or a financi... Date Added: 2009-06-13 03:31:51 |
| graphicorganizers.pdf Path: Wisc Stevens Point >> ED >> 584 Fall, 2009 Description: ... Date Added: 2009-06-13 03:33:36 |
| output.txt Path: Washington >> V >> 26500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-8T51PB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3368 12/26/2007 12:24 PM <DIR> . 12/26/2007 12:24 ... Date Added: 2009-06-13 03:34:49 |
| log.txt Path: Washington >> V >> 26500 Fall, 2009 Description: 000 (38906.000.000) 12/26 07:43:29 Job submitted from host: <128.95.94.28:1084> . 001 (38906.000.000) 12/26 12:25:58 Job executing on host: <172.25.101.93:1057> . 006 (38906.000.000) 12/26 12:46:06 Image size of job updated: 408952 . 006 (38906.000.0... Date Added: 2009-06-13 03:37:29 |
| Tables.doc Path: Willamette >> M >> 141 Fall, 2009 Description: Extra Practice Name_ Use the values in the table below to answer the following: x f ( x) g ( x) h( x ) f ( x) g ( x) h( x) f ( x) 0 1 2 3 0 3 1 2 1 2 0 3 2 1 3 0 -1 3 -2 4 4 -2 3 2 -5 -4 2 -3 0 -4 1 2 1. Determine if y = f ( x) g ( x) has ... Date Added: 2009-06-13 03:41:08 |
| Bonen08.pdf Path: UF >> PCB >> 6528 Fall, 2008 Description: Available online at www.sciencedirect.com Mitochondrion 8 (2008) 2634 www.elsevier.com/locate/mito Review Cis- and trans-splicing of group II introns in plant mitochondria Linda Bonen * Biology Department, University of Ottawa, 30 Marie Curie, Ott... Date Added: 2009-06-13 03:41:26 |
| PCH.ppt Path: Berkeley >> CS >> 160 Fall, 1931 Description: UC Berkeley Pyramid Communications Hub CS160 User Interface Design, Prototyping, and Evaluation University of California, Berkeley Chris AlvaradoDryden Levi Chang Matthew Davis Jenny Li Fall 2007 User Need Live Demo! Lots of work to communicat... Date Added: 2009-06-13 03:41:43 |
| lec31.pdf Path: Wisc La Crosse >> PHY >> 343 Fall, 2009 Description: PHY 343 - Lecture 31 The picture of the Rankine cycle changes somewhat with regeneration. Two pumps are used, and the regeneration heat is added after the water is pumped through the rst pump. Bleeding steam from the turbine changes the mass ow rates... Date Added: 2009-06-13 03:41:46 |
| 8 waller_taxation.pdf Path: UCSD >> MONETARY >> 213 Fall, 2009 Description: Dynamic Taxation ECON 213 S2008 \"Dynamic Taxation, Private Information and Money\" by Chris Waller (2007) Irina A. Telyukova UCSD ECON 213 Advanced Monetary Theory Spring 2008 1 Irina A. Telyukova Dynamic Taxation ECON 213 S2008 Introduction ... Date Added: 2009-06-13 03:41:51 |
| tableb-05.xls Path: Cornell >> ERS >> 89022 Fall, 2009 Description: Table B-5-Apples, fresh: Monthly prices received by growers, United States, 1980 to date Year Jan. Feb. Mar. Apr. May June July Aug. -Dollars/pound-1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 20... Date Added: 2009-06-13 03:41:58 |
| Lect2_F06.doc Path: Rutgers >> CHEM >> 327 Fall, 2009 Description: Lecture 2. (2) Photoelectric Effect (Hertz 1886) 1 in sec-1 (Hz); = c/ (~tilde) = 1/ = /c (cm-1, if is in Hz and c is in cm/s (3x1010 cm/s). 1 eV = 8065.54 cm-1 = 1.602x10-19 J 1 cm-1 = 3x1010 s-1 = 30 GHz (a) No electrons are emitted from sol... Date Added: 2009-06-13 03:42:30 |
| MOTheory.pdf Path: Rutgers >> CHEM >> 542 Fall, 2009 Description: Foundations of Molecular Orbital Theory One-Electron Atoms Schroedinger Equation: H = E Helel = Eelel or For an H-like atom, a one-electron atom (H, He+, Li2+.) with nuclear charge Z : -e r +Ze Hel = Te + VNe = p2/2me - Ze2/r = -0.52 - Z/r (atomi... Date Added: 2009-06-13 03:42:39 |
| hw5416sol.pdf Path: Iowa State >> STAT >> 416 Spring, 2008 Description: Stat 416X Homework 5 Solutions 1. It is not hard to verify that the first row and first column determine the rest of the entries in a 3-by-3 Latin square. There are 3!=3*2*1=6 ways to pick the first row. Once the first row is picked, there are 2!=... Date Added: 2009-06-13 03:43:23 |
| 152e3asol.pdf Path: Texas A&M >> MATH >> 152 Fall, 2008 Description: Solutions to Test 3 Page 1 Form A 15201a3 Part I: Multiple Choice (4 points each) There is no partial credit. You may not use a calculator. 1. Suppose that the n th partial sum of the series n=1 an is given by sn = 1 - ln n . Then n the serie... Date Added: 2009-06-13 03:44:48 |
| freqpjdrop1.pdf Path: Acton School of Business >> ELEC >> 301 Fall, 2009 Description: Frequency reponse of \"Plastic Jesus\" <20Hz, >20kHz removed 2500 2000 normalized magnitude 1500 1000 500 0 0 0.5 1 1.5 samples 2 2.5 x 10 3 5 ... Date Added: 2009-06-13 03:44:56 |
| Exercise Ch1#08.pdf Path: LSU >> EXST >> 7087 Fall, 2008 Description: Exercises 8 1. Concatenating SAS Data Sets The goal is to create a second-quarter data set for International Airlines\' Vienna hub. Combine target information for April, May, and June into one data set. This data is currently stored in separate data s... Date Added: 2009-06-13 03:45:02 |
| ps03.pdf Path: University of Illinois, Urbana Champaign >> CS >> 477 Fall, 2008 Description: Homework Problem Set 3 CS 477 Spring 2009 Assigned On: Due On: April 23, 2009 April 30, 2009 Instructions: You are welcome to collaborate while working out the ideas for a solution. However, you must write down the solutions independently, and must... Date Added: 2009-06-13 03:46:23 |
| assgn2.ps Path: Western Washington >> CS >> 352 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: assgn2.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMR12 CMR10 CMTI10 CMSY10 CMTT10 CMBX10 CMBX12 %DocumentPaperSizes: a4 %EndComments ... Date Added: 2009-06-13 03:46:31 |
| A0470keystone_21_dem.txt Path: Washington University in St. Louis >> MER >> 0470 Fall, 2009 Description: The file A470_keystone21_dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0345216 2) Add -8.80300 The x & y scales are 0.030 mm / pixel. Maximum value for DEM, co... Date Added: 2009-06-13 03:46:51 |
| mar23.rtf Path: St. Rose >> CIS >> 321 Fall, 2009 Description: ComicBook(ComicID, title, dateofpub, publisher, issueno) Character(CharacterID, Power, alterego, gender, placeoforigin, uniform) Villain(CharacterID, beef, obsession) Superhero(CharacterID, weakness, motivation) IsIn(ComicID, CharacterID) Enemies(Vil... Date Added: 2009-06-13 03:47:46 |
| HWK602.pdf Path: U. Houston >> ECE >> 3317 Fall, 2008 Description: ECE 3317 Homework #6 1. Find the surface current density on the inner conductor of a coaxial line. Then calculate the total current on it. Compare the total current with I ( z ) defined for the line. 2. Find the following for a transmission line whi... Date Added: 2009-06-13 03:48:30 |
| eiben5.ppt Path: U. Houston >> CS >> 6367 Fall, 2009 Description: Evolutionary Programming Chapter 5 A.E. Eiben and J.E. Smith, Introduction to Evolutionary Computing Evolutionary Programming EP quick overview Developed: USA in the 1960s Early names: D. Fogel Typically applied to: traditional EP: machine ... Date Added: 2009-06-13 03:49:26 |
| Evaluation_BMJ.pdf Path: Washington >> PHARM >> 560 Fall, 2008 Description: Clinical review ABC of learning and teaching in medicine Evaluation Jill Morrison Evaluation is an essential part of the educational process. The focus of evaluation is on local quality improvement and is analogous to clinical audit. Medical schools... Date Added: 2009-06-13 03:53:12 |
| Mennella et al 2001.pdf Path: Maple Springs >> PSYCH >> 4010 Fall, 2009 Description: Prenatal and Postnatal Flavor Learning by Human Infants Julie A. Mennella, Coren P. Jagnow and Gary K. Beauchamp Pediatrics 2001;107;88DOI: 10.1542/peds.107.6.e88 This information is current as of December 24, 2004 The online version of this articl... Date Added: 2009-06-13 03:54:08 |
| ch09probs.doc Path: N. Arizona >> ECO >> 486 Fall, 2008 Description: CHAPTER 9 PROBLEMS 1. The arguments for free trade in this quote include: Free trade allows consumers and producers to make decisions based upon the marginal cost and benefits associated with a good when costs and prices are undistorted by gov... Date Added: 2009-06-13 03:54:20 |
| test A spr 1 solution.xls Path: Pace >> CIS >> 101 Fall, 2008 Description: A B Test A spr 1 C D E F G H I J K L M 2 3 4 5 6 7 8 9 10 11 12 13 14 1 Stud1 2 Stud2 3 Stud3 4 Stud4 5 Stud5 6 Stud6 7 Stud7 8 Stud8 9 Stud9 Combin Class Exam Exam Exam Exam ed Final Ass. #1 Ass. #2 Pres. Avg #1 #2 #3 Avg Avg Bonus A... Date Added: 2009-06-13 03:54:23 |
| Syllabus_Chemistry 2320_spring 06.doc Path: Utah State >> CHEM >> 2320 Fall, 2008 Description: Chemistry 2320 Organic Chemistry, Spring 2006 Instructor: Dr. Tom Chang Office: Widtsoe 337 Phone: 797-3545 Email: chang@cc.usu.edu Meeting Time/Place: MWF 3:30 - 4:20am, ENGR 103, Thr 3:30 -4:20pm, Main 225. Office Hour: M-F 8:30 am to 9:30 am, or ... Date Added: 2009-06-13 03:55:49 |
| slides12.ppt Path: Harvey Mudd College >> CS >> 121 Fall, 2000 Description: Intro to S oftware De Patte sign rns De Patte sign rns q Focus of a gre de of curre atte at al nt ntion in softwarede lopm nt re arch and practice ve e se What starte theide d a Two books on archite cture(not software ) by C hristophe Ale r xande ... Date Added: 2009-06-13 03:55:52 |
| visualsquiz.doc Path: MNSU >> ENG >> 2712008 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>267bc2219d5c6e7f7445684342866d2818a5ec16.doc</Key><RequestId>8 3379ABA5156430A</RequestId><HostId>XvezbB0e3AzsW38LvNlomDs3C5u... Date Added: 2009-06-13 03:55:58 |
| hale woodruff fifty years of his art part 2.pdf Path: Delaware >> ARTH >> 231 Fall, 2008 Description: ... Date Added: 2009-06-13 03:56:25 |
| Recursion.ppt Path: Benjamin Franklin Institute of Technology >> CSE >> 5100 Fall, 2009 Description: Introduction to Recursion Please fasten your seat belts. 1 Recursion is difficult to master Recursionyieldelegant,concisecode Yet,itisdifficulttodebug. Minormistakescanbedisastrousfortheprogram Infiniterecursionisthemostcommonproblem Infiniterecur... Date Added: 2009-06-13 03:57:36 |
| Stacks_and_Queues.ppt Path: Benjamin Franklin Institute of Technology >> CSE >> 5100 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|28 Sep 2002 22:58:50 -0000 vti_extenderversion:SR|4.0.2.3406 vti_cacheddtm:TX|28 Sep 2002 22:58:50 -0000 vti_filesize:IR|333824 vti_cachedlinkinfo:VX| vti_cachedsvcrellinks:VX| vti_cachedtitle:SR|No Sli... Date Added: 2009-06-13 03:57:39 |
| T0286.t04.near-backbone-11-logo.pdf Path: UCSC >> T >> 0286 Fall, 2009 Description: T0286.t04 near-backbone-11 3 2 1 IJJ IJ A I D JKK JI B D D B D E G D C E A F HHGHHHGHH F E G G G G G G G X X X XX XXXHXXXHXXXXXX X X A AA BB X JKKKIIKKK KJJ J I I I G G I A G G X XX D C I A A G E G G X XXX DD G E EB H E F F F E B F HC... Date Added: 2009-06-13 03:59:29 |
| f25.xls Path: Texas El Paso >> MATH >> 0002 Fall, 2009 Description: Sheet1 vti_encoding:SR|utf8-nl vti_author:SR|MINERS\\agarciareyes vti_modifiedby:SR|MINERS\\agarciareyes vti_timelastmodified:TR|02 Aug 2004 18:57:49 -0000 vti_timecreated:TR|02 Aug 2004 18:57:49 -0000 vti_cacheddtm:TX|02 Aug 2004 18:57:49 -0000 vti_fi... Date Added: 2009-06-13 04:01:19 |
| tenurenewfacultyappointeesboardorder.pdf Path: North Texas >> BORAUG >> 212003 Fall, 2009 Description: Board Order Title: TENURE FOR NEW FACULTY APPOINTEES Board of Regents Order 2003-75 At an official meeting of the Board of Regents of the University of North Texas System properly posted and held on August 21, 2003, pursuant to a motion made by Regen... Date Added: 2009-06-13 04:01:29 |
| Exam 3 scores.txt Path: Utah >> SOC >> 7130 Fall, 2008 Description: - log: d:\\vincent\\Exam 3 scores.log log type: text opened on: 27 May 2009, 13:02:08 . tab exam3 exam3 | Freq. Percent Cum. -+- 67.5 | 2 40.00 40.00 81.5 | 1 20.00 ... Date Added: 2009-06-13 04:02:23 |
| Word .doc Path: East Los Angeles College >> PY >> 071 Fall, 2009 Description: Word up Joemontana100 eat me! ... Date Added: 2009-06-13 04:04:39 |
| gcnR_flux.txt Path: Berkeley >> ASTRO >> 00305288 Fall, 2009 Description: 122.688 5.377132e-04 9.905044e-05 none no 151.2 5.841854e-04 2.152219e-05 R no 151.2 2.200649e-04 3.648370e-05 R no 184.896 6.405466e-04 4.719722e-05 ... Date Added: 2009-06-13 04:04:42 |
| Pre02d_IMPROVE_Statistics.txt Path: UC Riverside >> MAY >> 308 Fall, 2009 Description: AllSite_AllDay SO4 NO3 NH4d OC EC TCM SOIL CM PM25 RCFM PM10 Fraction... Date Added: 2009-06-13 04:05:30 |
| Phys132 - Spring 2007 - HW4Solutions.pdf Path: Delaware State >> PHYS >> 132 Fall, 2009 Description: ... Date Added: 2009-06-13 04:08:48 |
| 045.pdf Path: UNI >> FACTBOOK >> 0607 Fall, 2009 Description: Fall On-Campus Headcount and Full-Time Equivalent (FTE) Enrollment by Level 1997 Headcount Enrollment Annual Percent Change Undergraduate Freshman Sophomore Junior Senior Unclassified Graduate Master\'s Advanced 13,108 1.2 11,654 2,524 2,275 3,025 3,5... Date Added: 2009-06-13 04:10:01 |
| YMR316C-B.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YMR >> 316 Fall, 2009 Description: YMR316C-B.t2k EBGHSTL 3 2 1 CC E B X X T H H H T H H T S S CCCC SSS X X X T T H X X C X E X X X X X X X X H E H H H EEE H H H C H X X XXXXXXXXXHXXX X C S C C E T T C C ECSSSC ECECCCS T TT C C H H X H E E E E X X X X X X HH 1 10 ... Date Added: 2009-06-13 04:12:41 |
| Obrien_Response to Glassman Re Dewey&Vygotsy_v31n5_2002.pdf Path: UNC Wilmington >> EDN >> 500 Fall, 2009 Description: A Response to \"Dewey and Vygotsky: Society, Experience, and Inquiry in Educational Practice\" by Leigh M. O\'Brien In the May 2001 Educational Researcher, Michael Glassman presented an interesting comparison between the theories of two towering figures... Date Added: 2009-06-13 04:15:56 |
| 02_IOM-speakingHLTH-race.pdf Path: CSU San Marcos >> ID >> 340 Fall, 2009 Description: July 2002 INSTITUTE OF MEDICINE Shaping the Future for Health SPEAKING OF HEALTH: ASSESSING HEALTH COMMUNICATION STRATEGIES FOR DIVERSE POPULATIONS I dentifying communication strategies that positively influence basic lifestyle behaviors has beco... Date Added: 2009-06-13 04:16:51 |
| 99a0767df.pdf Path: Wisconsin >> LAW >> 518 Fall, 2009 Description: ... Date Added: 2009-06-13 04:18:44 |
| PA11.doc Path: Ohio State >> H >> 192 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|FEHWEBSERVER\\beams vti_modifiedby:SR|FEHWEBSERVER\\beams vti_timelastmodified:TR|31 Dec 2007 01:14:27 -0000 vti_timecreated:TR|31 Dec 2007 01:14:27 -0000 vti_cacheddtm:TX|31 Dec 2007 01:14:27 -0000 vti_filesize:IR... Date Added: 2009-06-13 04:19:00 |
| DA05A.doc Path: Ohio State >> H >> 192 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|FEHWEBSERVER\\beams vti_modifiedby:SR|FEHWEBSERVER\\beams vti_timelastmodified:TR|31 Dec 2007 01:14:24 -0000 vti_timecreated:TR|31 Dec 2007 01:14:24 -0000 vti_cacheddtm:TX|31 Dec 2007 01:14:24 -0000 vti_filesize:IR... Date Added: 2009-06-13 04:19:05 |
| nickels.pdf Path: CSU Sacramento >> IMET >> 282 Fall, 2009 Description: Name_ Date _ Count the coins and write the amounts two different ways. ... Date Added: 2009-06-13 04:19:17 |
| hw6.pdf Path: University of Illinois, Urbana Champaign >> CS >> 473 Fall, 2008 Description: CS 473G: Combinatorial Algorithms, Fall 2005 Homework 6 Practice only; nothing to turn in. 1. A small airline, Ivy Air, flies between three cities: Ithaca (a small town in upstate New York), Newark (an eyesore in beautiful New Jersey), and Boston (a... Date Added: 2009-06-13 04:19:21 |
| Correlation.ppt Path: North Texas >> RSS >> 3610 Fall, 2009 Description: Correlation (and a bit on regression) Correlation (Linear) Scatterplots Linear Correlation / Covariance Pearson Product-Moment Correlation Coefficient Factors that Affect Correlation Testing the Significance of a Correlation Coefficient ... Date Added: 2009-06-13 04:20:29 |
| wack_score.txt Path: Princeton >> COS >> 325 Fall, 2009 Description: 0 1.7 0.769 1500 0.769 1.3 1550 0.2 0.2 1600 0.9 0.9 1650 0.1 1.1 1660 0.2 0.1 1670 0.4 1.1 1680 0.8 0.1 1690 1.6 1.1 ... Date Added: 2009-06-13 04:20:57 |
| SBL1-sequence.txt Path: Emory >> IBS >> 574 Fall, 2009 Description: > SBL-1 (P19762) hemagglutinin-neuraminidase mepsklfims dnatvapgpv vnaagkktfr tcfrilvlsv qavtlilviv tlgelirmin dqglsnqlss itdkiresaa viasavgvmn qvihgvtvsl plqiegnqnq llstlatict nrnqvsncst niplvndlrf inginkfiie dyathdfsig npl... Date Added: 2009-06-13 04:21:07 |
| TF9_3.53.xls Path: SMU - Cox School of Business >> EMIS >> 8361 Fall, 2009 Description: 3.53 (TF9, p.71) P= 18,300 A= 4,300 P/A = 4.26 r= 10.000% 1-e-15r = 0.78 er -1 = 0.1051709 [P/A,r,15] = 7.39 ... Date Added: 2009-06-13 04:24:06 |
| IntroductoryConcepts.ppt Path: Southern New Orleans >> CS >> 1201 Fall, 2009 Description: Introductory Concepts ANSI-C Types: Integer types All data values are stored in memory using a binary representation char signed char unsigned char short int long unsigned short unsigned unsigned long int : +/- 2 billion Char: 0.255 Short: -12... Date Added: 2009-06-13 04:25:26 |
| IterationII.ppt Path: Southern New Orleans >> CS >> 1201 Fall, 2009 Description: Repetition and Iteration, Part II ANSI-C For loop Syntax : for (initialization; condition; increment) statement; This is equivalent to: initialization; while (condition){ statement; increment; } For loop example int fact(int number){ int result... Date Added: 2009-06-13 04:25:27 |
| slides06.pdf Path: Maryland >> ASTR >> 380 Fall, 2008 Description: Pre-Darwinian Thinking and Charles Darwin http:/nayagam.files.wordpress.com/2006/02/397px-Charles_Darwin_by_G._Richmond.jpg Outline Pre-Darwinian ideas on life The voyage of the Beagle The Origin of Species and fallout Post-Darwinian ideas NOT... Date Added: 2009-06-13 04:25:40 |
| prob1.ps Path: Maryland >> ASTR >> 688 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -f %DVIPSParameters: dpi=300, comments removed %D... Date Added: 2009-06-13 04:25:43 |
| mentor.doc Path: East Carolina >> ENG >> 6625 Fall, 2009 Description: Caroline Brooks Mentor Project English 6625 November 4, 2004 Table of Contents Introduction.3 Observation Report 1..3 Observation Report 2.6 Activity Report..8 2 Introduction I really enjoyed observing two English 1200 composition classes, and di... Date Added: 2009-06-13 04:26:48 |
| asgn4.pdf Path: Montana >> CS >> 309 Fall, 2009 Description: 1 CS 309 Assignment 4 1. What does the following script do? #! /bin/bash [ $# -lt 1 ] $@\" -type d -depth -print | while read dir do [ `ls \"$dir\" | wc -l` -lt 1 ] | continue echo >$0: removing empty directory: $dir\" rmdir \"$dir\" ... Date Added: 2009-06-13 04:26:50 |
| Verilog tutorial.ppt Path: CSU LA >> EE >> 449 Fall, 2009 Description: VerilogLab Thispresentationincludessome materialthatisselectedfrom BUCKNELLVERILOGHANDBOOK. Instructor:Dr.CharlesLiu PreparedbyJohnRen Modified5/13/04 VerilogObjective .VerilogandHDL .Structurallevelmodelingandsimulation Behavioralmodelinga... Date Added: 2009-06-13 04:28:02 |
| 24_delighted.pdf Path: Michigan State University >> HST >> 320 Fall, 2008 Description: At the opening and closing of the twentieth century a president of the United Stateswas the featured speaker at graduation ceremoniesat Michigan State Universify. Roger L. Rosentreterwasn\'t around to enjoy \"Roosevelt Duy\" in 1907,but he did get a cha... Date Added: 2009-06-13 04:28:14 |
| P03_06.xlsx Path: Uni. Westminster >> AKS >> 0605 Fall, 2009 Description: Household Income Data for Selected U.S. Metropolitan Areas Metropolitan_Area Abilene, TX Akron, OH Albany, GA Albany-Schenectady-Troy, NY Albuquerque, NM Alexandria, LA Allentown-Bethlehem-Easton, PA Altoona, PA Amarillo, TX Anchorage, AK Ann Arbor, ... Date Added: 2009-06-13 04:28:24 |
| Ziemssen 2008.pdf Path: CSU LA >> BIOL >> 520 Fall, 2009 Description: J Neurol (2007) 254 [Suppl 2]: II/8II/11 DOI 10.1007/s00415-007-2003-8 Tjalf Ziemssen Simone Kern Psychoneuroimmunology Cross-talk between the immune and nervous systems Abstract Psychoneuroimmunology is a relatively new field of study that inve... Date Added: 2009-06-13 04:29:53 |
| HIPPA and the GLB.doc Path: Santa Clara >> COEN >> 150 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|17 May 2004 13:15:26 -0000 vti_extenderversion:SR|4.0.2.2717 vti_cacheddtm:TX|17 May 2004 13:15:26 -0000 vti_filesize:IR|50176 vti_cachedlinkinfo:VX|H|http:/www.watsonwyatt.com/ H| http:/www.csoonline.c... Date Added: 2009-06-13 04:30:00 |
| T0344.t04.dssp-ebghstl-logo.pdf Path: UCSC >> T >> 166 Fall, 2009 Description: T0344.t04 dssp-ebghstl 3 2 1 C X B E X EEEEEE CCCCC X XSSXSXCCCC X X S S T X CC EE 166 170 180 190 200 E 3 2 1 T E T E T E 210 LI IGL PRYMEVNI KDGKIIGRSLDPRE G G L YG S A EV S V PE G VK WE IY P NP H EEEE TT EE CCS E T X X X X X... Date Added: 2009-06-13 04:31:06 |
| think sheet.doc Path: San Diego State >> ARCHIVED >> 240 Fall, 2009 Description: Jennifer Pero 10/4/06 Think Sheet 1. Virtice and Bezier: A Bzier curve is a parametric curve important in computer graphics. Virtice is a point where two line segments meet. By placing virtice points on an already existing line or curve, you can man... Date Added: 2009-06-13 04:31:43 |
| yM147PS6Key.pdf Path: Boise State >> MATH >> 144 Fall, 2008 Description: Math 147 Precalculus Summer 2005 Chapter 5 Problem Set #6 Match each function with its graph. _ C _ 1. y = 1 + sin x _ K _ 2. y = - cos x _ A _ 3. y = sin 2 x _ B _ 4. y = 2 cos x _ G _ 5. y = - csc x _ J _ 6. y = sin x - _ K _ 7. y = - tan x _ F _ ... Date Added: 2009-06-13 04:32:17 |
| 2. Macedon & Philip.pdf Path: UGA >> CLAS >> 4040 Fall, 2008 Description: CLAS: 4040/6040 Rise of the Macedonian State Greece Occupied by 6000 BCE Central fertile plain High mountains in upper Macedonia Horses, ... Date Added: 2009-06-13 04:32:41 |
| 49E-Chemoreception.ppt Path: Montana >> BIO >> 102 Fall, 2009 Description: CHAPTER 49 SENSORY AND MOTOR SYSTEMS Section E: Chemoreception Taste And Smell 1. Perceptions of taste and smell are usually interrelated Copyright 2002 Pearson Education, Inc., publishing as Benjamin Cummings 1. Perceptions of taste and smell a... Date Added: 2009-06-13 04:34:10 |
| hartford_week_10.ppt Path: Allan Hancock College >> COIS >> 20010 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26213f7d31384fd386d53033143f2f9684524208.ppt</Key><RequestId>E CA54E55D23E9475</RequestId><HostId>+WtXP8xi8T1/KZx6siLq6VfgSFU... Date Added: 2009-06-13 04:36:47 |
| 25-DesignMethod.ppt Path: Berkeley >> CS >> 150 Fall, 1996 Description: Digital Design Methodology (Revisited) Design Methodology Design Specification Verification Synthesis Full Custom VLSI Standard Cell ASIC FPGA Technology Options CS 150 Spring 2007 - Lec #25 Design Methodology 1 Design Methodology: Big ... Date Added: 2009-06-13 04:37:09 |
| slides14.ppt Path: Duke >> CPS >> 100 Fall, 2009 Description: A Rose by any other name.C or Java? q Why do we use Java in our courses (royal we?) Object oriented Large collection of libraries Safe for advanced programming and beginners Harder to shoot ourselves in the foot Why don\'t we use C+ (or C)? Stan... Date Added: 2009-06-13 04:38:10 |
| Lect6StrainHardening.ppt Path: Alaska Anch >> CE >> 334 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|02 Oct 2004 01:19:39 -0000 vti_extenderversion:SR|5.0.2.5012 vti_title:SR|Strain Hardening, Ductile/Brittle Fractures vti_lineageid:SR|{69F3EFD3-1B63-46AA-882B-6315C8216837} vti_backlinkinfo:VX|ce334/20... Date Added: 2009-06-13 04:39:31 |
| Examples of CMOS Logica Gates filled.pdf Path: E. Kentucky >> ITTC >> 312 Fall, 2009 Description: 11/14/2004 Examples of CMOS Logica Gates filled.doc 1/3 Examples of CMOS Logic Gates See if you can determine the Boolean expression that describes these pull-down networks: Y =A +B Y =AB Y = A + BC See now if you can determine the Boolean alg... Date Added: 2009-06-13 04:39:52 |
| Introduction.pdf Path: SUNY Buffalo >> CSE >> 115 Fall, 2009 Description: CSE115 Lab exercises for week 1 of recitations Introduction Spring 2009 In this first lab you will be introduced to the computing environment in the Baldy 21 lab. If you are familiar with Unix or Linux you may know how to do some or all of the foll... Date Added: 2009-06-13 04:40:03 |
| 14-VaR5f.ppt Path: Stanford >> MSANDE >> 345 Fall, 2009 Description: Value-at-Risk Primbs, MSE 345 2 VaR (Value-at-Risk) is a measure of the risk in a por... Date Added: 2009-06-13 04:41:18 |
| CTR4b.ppt Path: Colorado >> PHYS >> 2130 Fall, 2008 Description: y\' D y D S\' x\' S x1 x2 x The time for the light pulse to travel to the mirror and back is t\', viewed from the car, or t, as viewed from the ground. Which is longer? a) t<t\' b) t=t\' c) t>t\' A clock on the ground (frame S) measures 1 sec. What... Date Added: 2009-06-13 04:41:27 |
| hw10.doc Path: Hudson VCC >> BCOR >> 102 Fall, 2009 Description: HW 10 1. What is the average relatedness between grandparents and grandchildren? A. 0.75 B. 0.5 C. 0.25 D. 0.125 E. 0.0625 2. Some mammals give alarm calls to warn of approaching predators. Imagine that calling increases your chance of being eaten by... Date Added: 2009-06-13 04:41:34 |
| week1_1.ps Path: Berkeley >> CS >> 150 Fall, 1996 Description: %!PS-Adobe-3.0 %P8BIT %Title: Microsoft PowerPoint - week1_1.ppt %Creator: Adobe Printer Driver 3.0 for Windows 3.1 %CreationDate: 03/16/97 15:22:05 %BoundingBox: 18 8 593 784 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (... Date Added: 2009-06-13 04:42:32 |
| Psy168L5.pdf Path: UCSB >> PSYC >> 168 Winter, 2009 Description: DEVELOPMENT AND PLASTICITY OF THE BRAIN Psychology 168/268 Lecture 5 January 23, 2007 Physiology of Behavior: Chapters 2 & 3 A Colorful Introduction to the Anatomy of the Human Brain: Chapter 4 DEVELOPMENT OF THE NERVOUS SYSTEM VERY EARLY EMBRYO ... Date Added: 2009-06-13 04:47:50 |
| Class13_Feb27_web.pdf Path: Ohio State >> AEDE >> 501 Fall, 2009 Description: AEDE 501 Class 13 CHAPTER 6 PRICING STRATEGY: Managing Your Market Proactively # Three generic pricing strategies: C C C Skim Penetration Neutral Today=s lab - Team Pricing Projects HOMEWORK - SKIM Chapters 7 and 8 - Finish HW #4 (Ajax Case) -1... Date Added: 2009-06-13 04:48:44 |
| hw4.pdf Path: Cornell >> PH >> 6553 Fall, 2009 Description: Physics 6553 : Problem Set 4 Due Thursday , Oct 2, 2008 1. The two sphere: [5 points] Consider the unit two-sphere {(x, y, z) | x2 + y 2 + z 2 = 1} with coordinates (, ). a. Suppose that is a connection on the two-sphere for which the geodesics are... Date Added: 2009-06-13 04:50:25 |
| Proxy_Protocols_macklem-hopkins.ppt Path: Michigan State University >> CSE >> 870 Fall, 2008 Description: Proxy Protocols SOCKS 4, 4a, and 5 Advanced Software Engineering (CSE870) Instructor: Dr. B. Cheng Contact info: chengb at cse dot msu dot edu Kayra Hopkins Loretta Macklem Outline Introduction Frameworks Demo Extra Credit Implementation Demo... Date Added: 2009-06-13 04:51:03 |
| wk15.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 221 Fall, 2008 Description: Tuesday, 14th October, 2008 Merit Workshop L\'H^pital\'s Rule: o \"Take it to the hospital and fix it.\" 1. Which of the following are in an indeterminate form? Which can L\'Hospital help with? 0 0 0- + 0 sin(0) 0 sin(x) x0 x lim cos(/2)sin(0) limx sin(1... Date Added: 2009-06-13 04:51:56 |
| Receivables.xls Path: Mississippi State >> ACC >> 8112 Fall, 2009 Description: ch_rec 2.3 -2.07 2.38 -3.87 2.46 1.79 2.28 0.89 -4.57 -2.49 7.33 -0.81 -3.69 0.13 2.14 -1.17 1.07 -2.07 -2.22 SUMMARY OUTPUT Regression Statistics Multiple R R Square Adjusted R Square Standard Error Observations ANOVA df Regression Residual Total 2 ... Date Added: 2009-06-13 04:52:26 |
| Receivables1.xls Path: Mississippi State >> ACC >> 8112 Fall, 2009 Description: ch_rec 2.3 -2.07 2.38 -3.87 2.46 1.79 2.28 0.89 -4.57 -2.49 7.33 -0.81 -3.69 0.13 2.14 -1.17 1.07 -2.07 -2.22 SUMMARY OUTPUT Regression Statistics Multiple R R Square Adjusted R Square Standard Error Observations ANOVA df Regression Residual Total 2 ... Date Added: 2009-06-13 04:52:26 |
| a1.ps Path: Sveriges lantbruksuniversitet >> CMPT >> 126 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: a1.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMBX12 CMSY10 CMBX10 CMTT10 %DocumentPaperSizes: Letter %EndComments %DVIPSWebPage... Date Added: 2009-06-13 04:53:12 |
| 07_SSE_More_Badcode.pdf Path: Taylor IN >> COS >> 342 Fall, 2009 Description: Secure Software Engineering More Bad Code COS342 Information Security Fri 11-Jan-2008 More Bad Code Examples. char * src = user_supplied_data; char * copy = NULL; copy = new char[strlen(src)]; strcpy(copy, src); do_something_odd(copy); delete copy... Date Added: 2009-06-13 04:53:34 |
| rfc0653.txt Path: Arkansas Tech >> CS >> 4303 Fall, 2009 Description: TELNET OUTPUT HORIZONTAL TABSTOPS OPTION RFC 653, NIC 31156 (Oct. 25, 1974) D. Crocker (UCLA-NMC) Online file: [ISI]<DCROCKER>NAOHTS.TXT TELNET OUTPUT HORIZONTAL TABSTOPS OPTION 1. Command name and code NAOHTS 11 (Negotiate Abou... Date Added: 2009-06-13 04:54:17 |
| rfc0756.txt Path: Arkansas Tech >> CS >> 4303 Fall, 2009 Description: RFC: 756 July 1979 The NIC Name Server-A Datagram Based Information Utility by John R. Pickens, Elizabeth J. Feinler, and James E. Mathis ... Date Added: 2009-06-13 04:54:23 |
| A6.ps Path: UMass Lowell >> FACULTY >> 192 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f %DVIPSParameters: dpi=1200, compressed %DVI... Date Added: 2009-06-13 04:55:13 |
| P-Set21SS09.pdf Path: Hamline >> CH >> 1140 Fall, 2009 Description: P-Set 21 1. Polymer: a very large molecule made up of a number of smaller molecules repeatedly linked together. Monomer: the small molecules that are linked together to form a polymer. a) C-C bond 346 kJ/m, C=C bond 602 kJ/m. Note that 2 carbon-carbo... Date Added: 2009-06-13 04:55:23 |
| butt_bio.pdf Path: Allan Hancock College >> DOCS >> 1002 Fall, 2009 Description: POLICY RESEARCH FORUM Judicial responses to corruption in Indonesia Simon Butt is teaching Indonesian law at the University of Sydney in 2007 and 2008. He holds a PhD from the University of Melbourne in 2007, after earning his Bachelor of Arts in Asi... Date Added: 2009-06-13 04:55:52 |
| 08.xls Path: Bethel VA >> ASSIGNMENT >> 308 Fall, 2009 Description: Project Name: Project Number: DIVISION 5 METALS Division No. Description Metal Studs, 10\' High Walls, 18 Ga. 05410400410 X3 5/8\" wide X 16\" OC Date: Total +O&P Unit $45.50 L.F. Project Total UNIT TOTAL 65 LF $2,957.50 DIVISION 6 Division No. Descr... Date Added: 2009-06-13 04:56:03 |
| channels.pdf Path: University of Illinois, Urbana Champaign >> UP >> 405 Fall, 2008 Description: ... Date Added: 2009-06-13 04:56:59 |
| ACSP Disaster Recovery Oct05 Olshansky.pdf Path: University of Illinois, Urbana Champaign >> UP >> 595 Fall, 2008 Description: How do Communities Recover from Disaster? A Review of Current Knowledge and an Agenda for Future Research Robert B. Olshansky, University of Illinois at Urbana-Champaign Presented at th 46 Annual Conference of the Association of Collegiate Schools of... Date Added: 2009-06-13 04:57:05 |
| Problems1KEY.pdf Path: Kentucky >> CHE >> 230 Fall, 2008 Description: CHE 230 Practice Problems 1 1. Draw the structures of the following compounds. Be sure to indicate the relevant stereochemistry. S 1-Bromo-1-chloroethane. Br Cl CH3 Cl Br H CH3 R-2-butanol OH 2. Draw the molecular formula for an unsaturated alkyl ... Date Added: 2009-06-13 04:57:14 |
| 12_indexsorting.pdf Path: Kentucky >> CS >> 505 Fall, 2008 Description: Instructor: Jinze Liu J Fall 2008 Index and Data File Organization 2 Heap file vs. B+-tree Index file p Header Page Data Page Data Page Data Page Data Page Data Page Data Page Full Pages Pages with Free Space Jinze Liu @ University of Kentucky 1... Date Added: 2009-06-13 04:57:42 |
| attachment-0001.doc Path: UVA >> CS >> 20080715 Fall, 2009 Description: s_spreader s_spreader height interface Spreader width HotSpot 4.1 Temperature.c void populate_package_R(.) /* lateral R\'s of spreader and sink */ p->r_sp1_x = getr(K_CU, (s_spreader-width)/4.0, (s_spreader+3*height)/4.0 * t_spreader); void popula... Date Added: 2009-06-13 04:59:43 |
| persistence.ppt Path: UPenn >> PSYCH >> 900 Fall, 2008 Description: Irrational Belief Persistence Psychology 600 9/27/06 Myside bias Once an opinion is formed or a hypothesis favored, other possibilities are not fairly considered Selective information search Biased interpretation of information Order principle If t... Date Added: 2009-06-13 05:02:56 |
| fcs 396 interview lesson plan.pdf Path: Wisc Stevens Point >> KNICO >> 997 Fall, 2009 Description: Grade: 12th Unit: Job Force Lesson: Interviewing Objectives: 1) Demonstrate knowledge of appropriate interview dress 2) Know P.R.A.I.S.E. WI Standards: 1) F.4. : Demonstrate the ability to use self-evaluations Skills Standards Addressed 1) Basic Skil... Date Added: 2009-06-13 05:03:20 |
| angle brace.pdf Path: Oakland University >> ME >> 463 Fall, 2009 Description: Angle Brace ... Date Added: 2009-06-13 05:04:27 |
| Myers_etal_2007.pdf Path: CSU Northridge >> SD >> 51881 Fall, 2009 Description: Current Biology Vol 17 No 1 R10 Saving endangered whales at no cost Ransom A. Myers1, Stephanie A. Boudreau1, Robert D. Kenney2, Michael J. Moore3, Andrew A. Rosenberg4, Scott A. Sherrill- Mix1 and Boris Worm1 The North Atlantic right whale is one o... Date Added: 2009-06-13 05:04:50 |
| PBC6.pdf Path: CSU Northridge >> M >> 24771 Fall, 2009 Description: 6-1 FRACTIONS basics Fractions arise to express PART of a UNIT 1 What part of an HOUR is thirty minutes? (The UNIT here is HOUR.) MATH 210 F8 Fifteen minutes? tw elve minutes? 2 What fraction of the children are happy? ; ; ; ; (The UNIT here is... Date Added: 2009-06-13 05:05:08 |
| Iampoem.pdf Path: Wisc Stevens Point >> CMODR >> 916 Fall, 2009 Description: I Am. Directions: 1. Using the template below, create a poem about yourself. It is important that the poem includes detail and appropriate word choice. 2. A final copy of your poem should be displayed somewhere on your selfportrait. 3. Use details fr... Date Added: 2009-06-13 05:05:27 |
| BUSH energy plan1.pdf Path: Utah >> MET >> 1001 Fall, 2009 Description: BUSH-CHENEY ENERGY PLAN MISSES THE MARK ON ENERGY EFFICIENCY For further information, contact: Howard Geller or Steven Nadel at 202-429-8873 FOR IMMEDIATE RELEASE May 17, 2001 WASHINGTON, D.C. - As President Bush highlights energy efficiency during ... Date Added: 2009-06-13 05:05:50 |
| 11_GraphingGuide&HW_sol.pdf Path: ASU >> MATH >> 270 Fall, 2009 Description: ... Date Added: 2009-06-13 05:06:25 |
| 04_FourGraphs.pdf Path: ASU >> MATH >> 270 Fall, 2009 Description: ... Date Added: 2009-06-13 05:06:25 |
| CEVE512_Lab4.ppt Path: Acton School of Business >> ENVI >> 512 Fall, 2008 Description: Topographic Maps vs DEM Topographic Map 1:24,000 Scale http:/www.tnrcc.state.tx.us/gis/raster.html 20 ft contour 100 ft contour Stream Center Line Flow in Direction of Steepest Descent Watershed Delineation by Hand Digitizing Watershed divide D... Date Added: 2009-06-13 05:06:45 |
| outline-retailmgmt.pdf Path: Michigan State University >> FIM >> 335 Fall, 2008 Description: FIM 335 Food Marketing Management Introduction to the Retail Management Objectives: Discuss the changing food consumer and its impact on the food system 1. Discuss the changes and current trends occurring in the food system 2. Illustrate the complex... Date Added: 2009-06-13 05:07:10 |
| c05.pdf Path: RPI >> HC >> 35274 Fall, 2009 Description: SECTION 5 INSTRUCTION SET This section contains general information about the instruction set. It is organized into instruction summaries grouped by function. If an instruction has a special purpose, such as aiding indexed operations, it appears in t... Date Added: 2009-06-13 05:08:17 |
| EWW_IVV_LCA_F06a_T21_V1.0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Team 21 Updated Easy WinWin Evaluation Status Problem if any Category ? Comments Classification 12/11/2006 Sl No. Win Condition 1 [W178] Grassroots Organizations shall have the ability to register with MicroNet Donation Site New [W5] Non profit... Date Added: 2009-06-13 05:08:23 |
| Modernity and tradition.pdf Path: East Los Angeles College >> KU >> 15905 Fall, 2009 Description: Collecting Now Venetia Porter 6 August 2003 This talk will focus on three artists whose work we hold in the British Museum : Khusrow Hasan Zade, who lives and works in Iran; Laila Shawa, Palestinian from Gaza who lives most of the time in London, an... Date Added: 2009-06-13 05:08:49 |
| ARIMA-monthlyV3.xls Path: UMKC >> BDS >> 545 Fall, 2008 Description: ARIMA p d 1 q 1 C 1 P D Q S 12 144 Observations. This spreadsheet can support the fitted up to: Press \'Ctrl+a\' to increase the number of observation. Usable Observation Degree of Freedom RBar2 Ave(Yt): Standard error of dependent variable Su... Date Added: 2009-06-13 05:09:13 |
| Directions for ACFs & PACFs .doc Path: UMKC >> BDS >> 545 Fall, 2008 Description: Direction for computing ACFs and PACFs on this Excel spreadsheet This excel spread sheet is designed for computing up to ACF(36) and PACF(36). This requires at least 37 observations and without modification it can support up to 144 observations. The ... Date Added: 2009-06-13 05:09:15 |
| ex01_040.txt Path: Minnesota >> STAT >> 5021 Fall, 2008 Description: \"earth.density\" \"1\" 5.5 \"2\" 5.61 \"3\" 4.88 \"4\" 5.07 \"5\" 5.26 \"6\" 5.55 \"7\" 5.36 \"8\" 5.29 \"9\" 5.58 \"10\" 5.65 \"11\" 5.57 \"12\" 5.53 \"13\" 5.62 \"14\" 5.29 \"15\" 5.44 \"16\" 5.34 \"17\" 5.79 \"18\" 5.1 \"19\" 5.27 \"20\" 5.39 \"21\" 5.42 \"22\" 5.47 \"23\" 5.63 \"24\" 5.34 \"25\" ... Date Added: 2009-06-13 05:09:52 |
| R119605_HBK_2116A_Attachment to SOW.docx Path: Maryland >> R >> 119605 Fall, 2009 Description: ATTACHMENT TO SCOPE OF WORK RFQ R119605 Current Environment Description The system will be installed in the College of Information Studies multi-purpose room, located on the second floor of Hornbake South, on the campus of the University of Maryland ... Date Added: 2009-06-13 05:12:27 |
| SlidesPIBCanada.pdf Path: Université du Québec à Montréal >> R >> 16374 Fall, 2009 Description: Instructor\'s Resource Disk - Textbook Graphics Page 1 sur 1 Copyright 2004, Pearson Education Canada Inc. http:/www.pearsoned.ca/williamson/viewer.html 10/22/2004 Instructor\'s Resource Disk - Textbook Graphics Page 1 sur 1 Copyright 2004, Pe... Date Added: 2009-06-13 05:13:33 |
| SlidesCours6.pdf Path: Université du Québec à Montréal >> R >> 16374 Fall, 2009 Description: Instructor\'s Resource Disk - Textbook Graphics Page 1 sur 1 Copyright 2004, Pearson Education Canada Inc. http:/www.pearsoned.ca/williamson/viewer.html 10/22/2004 Instructor\'s Resource Disk - Textbook Graphics Page 1 sur 1 Copyright 2004, Pe... Date Added: 2009-06-13 05:13:33 |
| h270.ps Path: Arizona >> Q >> 1542 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:56:17 2001 %DocumentData: Clean... Date Added: 2009-06-13 05:14:05 |
| n270.ps Path: Arizona >> Q >> 0916 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:16:35 2001 %DocumentData: Clean... Date Added: 2009-06-13 05:14:10 |
| 226Wi09 OL07.pdf Path: Michigan >> C >> 226 Fall, 2009 Description: CHEMISTRY 226, WINTER 2009 LECTURE OUTLINE #7 WEEK OF FEBRUARY 23, 2009 1. Addition of primary amines and derivatives of NH3 (cont.) b. Imines as disguised carbonyl groups c. Formation of carbonyl derivatives 2. Addition of secondary amines: formatio... Date Added: 2009-06-13 05:14:17 |
| Nucleophilic Substitution of CA Derivatives.pdf Path: Michigan >> C >> 226 Fall, 2009 Description: CHEMISTRY 226 NUCLEOPHILIC SUBSTITUTION REACTIONS OF CARBOXYLIC ACID DERIVATIVES 1. Carboxylic acid derivatives General structure: Y = OH OR\' hal OCOR NH2 (Ocarboxylic acid ester acid (alkanoyl) halide anhydride amide (includes NHR, NR2) carboxylate... Date Added: 2009-06-13 05:14:22 |
| Basicity of amines.pdf Path: Michigan >> C >> 226 Fall, 2009 Description: CHEMISTRY 226 BASICITY OF AMINES 1. \"Dissociation\" of a primary amine in aqueous solution. CH3CH2NH2 + H2O CH3CH2NH3 + OH Note also that the ammonium ion is acidic. CH3CH2NH3 + H2O CH3CH2NH2 + H3O 2. Quantitative measure of basicity: pKb CH3CH2NH3... Date Added: 2009-06-13 05:14:23 |
| CS667s08HW05.pdf Path: Cal Poly >> CS >> 6673 Spring, 2009 Description: ASSIGNMENT 5 Due May 6, 2008 (before start of class) Use a discrete Hopfield neural network to store the following two patterns: (1, 0, 1, 1) and (1, 1, 1, 0). Make sure you use the same transfer function as we used in the lecture: The transfer funct... Date Added: 2009-06-13 05:17:02 |
| lecture13.pdf Path: UVA >> PHYS >> 831 Spring, 2008 Description: ... Date Added: 2009-06-13 05:17:17 |
| lecture24.pdf Path: UVA >> PHYS >> 521 Fall, 2008 Description: ... Date Added: 2009-06-13 05:18:00 |
| 24760.txt Path: UNC >> DOCS >> 24760 Fall, 2009 Description: The Project Gutenberg EBook of Aunt Kitty\'s Stories, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg ... Date Added: 2009-06-13 05:19:02 |
| Electric Force.pdf Path: Syracuse >> PHY >> 106 Fall, 2009 Description: The Standard Model of Particle Physics EM STRONG WEAK 1 The Electric Force In the old days, we believed that \"force\" was transmitted more or less instantaneously by a \"field of force\". Lines of force Lines of force P p p p p The proton to th... Date Added: 2009-06-13 05:19:08 |
| dil_probs.pdf Path: Western Washington >> BIOL >> 346 Fall, 2008 Description: DILUTION PROBLEMS 1. One ml of a sample was mixed with 99 ml of sterile diluent. One ml of this was transferred (using the pour plate method) to melted nutrient agar. Plates were poured and incubated at 37C for 48 h. After incubation, 133 colonies we... Date Added: 2009-06-13 05:20:22 |
| w96-quiz-3-pre-handout-ai-in-industry.ps Path: CSU Channel Islands >> ICS >> 171 Fall, 2009 Description: %! /GlSave save def /TeXDict 200 dict def TeXDict begin /Resolution 300 def /Inch {Resolution mul}def /Mtrx 6 array def /letter where{pop}{/letter{}def}ifelse /legal where{pop}{/legal{}def}ifelse /note where{pop}{/note{}def}ifelse /@letter{72 Resolut... Date Added: 2009-06-13 05:20:41 |
| dyndemo.xls Path: Michigan >> FTP >> 610 Fall, 2009 Description: Description of the Problem Assume two states { {H, L} (chance p of H) and two actions {a H, aL}, with a{ appropriate for state A . Consider a decision maker DM who ultimately wishes to make a decision with payoff 1 for doing action aA in state A and... Date Added: 2009-06-13 05:20:43 |
| ziou98edge.pdf Path: UT Arlington >> CSE >> 6392 Fall, 2008 Description: yrXu~F~ yzrS~~ ybrP rhA~b~rhzPxz~U`PU x&~ ... Date Added: 2009-06-13 05:21:10 |
| lecture1.pdf Path: UC Davis >> ECS >> 152 Fall, 2009 Description: ECS152A Computer Networks Dipak Ghosal Department of Computer Science University of California, Davis 9/30/2004 1 Lecture 1 - Overview Course Information Introduction Signals and frequency domain representations 9/30/2004 ECS152 Computer Netwo... Date Added: 2009-06-13 05:21:28 |
| UCF_Generator_BASYS_Rev_0.xls Path: MNSU >> EET >> 340 Spring, 2008 Description: UCF Generator for BASYS FPGA Board REV 1 Made By: Dr. Edward Doering Department of Electrical and Computer Engineering Rose-Hulman Institute of Technology Last Update: 7 Jan 2008 Modified By: Prof. Andrew Miner ECET Department Minnesota State Univers... Date Added: 2009-06-13 05:21:59 |
| Extremely Loud2.pdf Path: Hudson VCC >> HCOL >> 196 Fall, 2009 Description: Extremely Loud and Incredibly Close Discussion Questions Day 2 Despite adoring the book, I have to admit that some of the graphic embellishments detract from the power of the novel. In particular, the red pen corrections desecrated the grandfather\'s... Date Added: 2009-06-13 05:22:58 |
| Summary and Critique.doc Path: S. New Hampshire >> EFL >> 537 Fall, 2009 Description: Hui-An Yu Cindy Mar. 6, 2006 Dr. Katherine McCarthy EFL 525 1 Summary and Critique Chapter Nine Reflecting on Your Pedagogical Plans for Teaching Writing Main Issues: Reflecting on the pedagogical plans for teaching writing may be adopted for ESL ... Date Added: 2009-06-13 05:23:24 |
| purpose of education.doc Path: Uni. Westminster >> JLK >> 0627 Fall, 2009 Description: Jodi Kent Peggy Cain 11/04/04 Philosophy of Education There are many opposing opinions about the purpose of education. Some believe teaching children successfully can be achieved through standardized testing and text book basics. On the other hand, I... Date Added: 2009-06-13 05:24:09 |
| DiscreteDependent.pdf Path: UCSB >> ESM >> 206 Fall, 2008 Description: ... Date Added: 2009-06-13 05:25:39 |
| Stiglitz - Tax Incidence.pdf Path: UCSB >> ESM >> 204 Fall, 2008 Description: ... Date Added: 2009-06-13 05:25:40 |
| CS477_hw3_part2.pdf Path: Barry >> CS >> 477 Fall, 2009 Description: CS47701Fall2008Homework#3Part2(DueonNovember12th) PGPemailsecurity Instructions: In the second part of the homework, you are given a question encrypted using your public key and signedbymyprivatekey.Whatyouneedtodoistodecryptthequestion,verifymysigna... Date Added: 2009-06-13 05:27:09 |
| hitt1.pdf Path: UCSD >> ECE >> 103 Fall, 2008 Description: H-itt Questions Monday 6-27-05 Q1. Why are you taking this class? a) I am going to be 3rd year in ECE at UCSD and want to get ahead b) I am going to be a 4th year in ECE at UCSD and need to take this class before I can take my depth classes c) I go ... Date Added: 2009-06-13 05:27:50 |
| cois23001_exam_guide.doc Path: Allan Hancock College >> COIS >> 23001 Fall, 2009 Description: #C#cois23001_exam_guide.doc#[#xT? #.[]@#E[R#XZ#`jk%#V e$ X*k{gbdv#so {# ~;{# #(BvC#; +#61Q ~#u y_.D]#6M ;d G2>~v<|vm *7#7@ dW9 D~&\\k vo#}oB# +... Date Added: 2009-06-13 05:28:06 |
| 08S1SPA111T.pdf Path: Augsburg >> AFA >> 0809 Fall, 2008 Description: Spa 111 Beginning Spanish I Augsburg College, Summer 09 Instructor: Required textbook: Peter (Martn) Morales 651 253 4907 moralesp@augsburg.edu Viva Vistas Higher Learning Online workbook/lab manual English-Spanish/Spanish-English dictionary Course ... Date Added: 2009-06-13 05:29:38 |
| 22-Outline.pdf Path: Duke >> X >> 130 Fall, 2009 Description: CPS 130 Lecture 22 Outline - Union-Find 20 June 2005 Before Class: Journal Up 1. Disjoint Data Sets Minimum Spanning Tree Example Set of sets of n items Each item only in one set (Disjoint!) Representative elements Operations: Make-Set, Unio... Date Added: 2009-06-13 05:29:55 |
| kinematicsParticles2.pdf Path: UPenn >> MEAM >> 211 Fall, 2008 Description: MEAM 211 Lecture 3: Kinematics of Particles Recap: Numerical integration [Appendix A, 2.1] 2 and 3-Dimensional Motion Resolving vectors in 3-Dimensions Differentiation of vectors leading into a review of Polar coordinates [2.3] Path coordinates [2.4... Date Added: 2009-06-13 05:30:24 |
| sn1990b_1990_03_25.ps Path: Southern Oregon >> D >> 1990 Fall, 2009 Description: ... Date Added: 2009-06-13 05:31:24 |
| Assignment1.pdf Path: Allan Hancock College >> ASSIGNMENT >> 209 Fall, 2009 Description: ICT209 Assignment 1 2009 Objectives: Demonstrate that you can design and write Object Oriented programs using C+. Demonstrate that you can design and write programs using both user defined data structures and one from STL. Demonstrate that you can... Date Added: 2009-06-13 05:31:50 |
| sn1999ex_1999_11_18.ir.ps Path: Southern Oregon >> D >> 1990 Fall, 2009 Description: ... Date Added: 2009-06-13 05:32:03 |
| syntaxe.pdf Path: Neumont >> IFT >> 2030 Fall, 2009 Description: Structure syntaxique IFT 2030, v 1.0 Universit de Montral e e Syntaxe 1 Structure Langage : lexique+syntaxe+smantique e lexique : mots du langage syntaxe : r`gles de combiner les mots (grame maire) smantique : tout ce qui n\'est pas syntaxe mais e... Date Added: 2009-06-13 05:32:38 |
| CprE308.Lab1.F05.pdf Path: Iowa State >> ECE >> 308 Fall, 2009 Description: CprE 308 Laboratory 1: Introduction to Linux Department of Electrical and Computer Engineering Iowa State University Fall 2005 \"Experience is not what happens to you; it is what you do with what happens to you.\" - Aldous Huxley Submission: There is ... Date Added: 2009-06-13 05:33:11 |
| 31 Measures of Variation in Regression 312 LRS.doc Path: Cal Poly >> STAT >> 312 Fall, 2009 Description: Statistics 312 31 Measures of Variation in Regression 1 The coefficient of determination (r2) is a measure of association based on a comparison the amount of error made in estimating y using two different estimates- the sample mean, y , (i.e., not... Date Added: 2009-06-13 05:33:59 |
| Problem Set 5.pdf Path: Maryland >> ECON >> 454 Fall, 2008 Description: ECON 454, Spring 2009 Department of Economics, University of Maryland Jessica Hennessey Problem Set #5 Question 1 Suppose a nation has a tax rate of 10% on the .rst $20,000 of taxable income, then 25% on the next $30,000, then 50% on all taxable inc... Date Added: 2009-06-13 05:34:14 |
| cs1301_hw5.doc Path: Georgia Tech >> CS >> 1301 Fall, 2008 Description: CS 1301 Fall 2006 Homework 5 Python goes to the Picnic Due: Friday, October 6, 2006 at 6 PM EST Files to submit: hw5.py Functions to include in hw5.py: ibeforee(item) shortword(item) doublevowel(item) lettersandwich(item) palindrome(item) ma... Date Added: 2009-06-13 05:34:27 |
| Fall Quarter E145 - Bios.doc Path: Stanford >> ENGR >> 145 Fall, 2009 Description: FALLQUARTERE145 OPPORTUNITYANALYSISPROJECT TEAMMENTORS AnnCarneyNelson Associate,MenloVentures AnnjoinedMenloVenturesin1999andhasbeenactiveinawiderangeofinvestmentsinearly stageinfrastructure,softwareandInternetcompanies.Thisincludescompaniessuchas ... Date Added: 2009-06-13 05:34:48 |
| lect12_1_Qualitative Methods_Content Analysis.ppt Path: USC >> COMM >> 301 Fall, 2009 Description: COMM 301: Empirical Research in Communication Lecture 12 Kwan M Lee 1 Qualitative Methods Definition Research procedure that produce descriptive data AKA: interpretive research; naturalistic research; phenomenological research; descriptive resea... Date Added: 2009-06-13 05:34:49 |
| L19.pdf Path: UCSD >> ECE >> 264 Fall, 2009 Description: ... Date Added: 2009-06-13 05:35:01 |
| midt3v4.pdf Path: CSU Northridge >> MATH >> 1051 Fall, 2009 Description: V4 Last Name: First Name: ID: Math 1051 Midterm #3. 1 2 3 4 5 6 Section: November 22, 2002 Attention! Please, note that this is the closed book test. You are not allowed to use graphing calculator. Simple calculators are allowed. Please, show... Date Added: 2009-06-13 05:37:06 |
| l7activities.pdf Path: Western Washington >> J >> 101 Fall, 2009 Description: JAPN 101 Lesson 7 Q: \"Independence Day\" \"Veterans\' Day\" \"Memorial Day\" \" artin Luther King Jr. Day\" \"Labor Day\" \" t. Patrick\'s Day\" A: Situation: Q: A: Q: A: VU (Bus Stop) ... Date Added: 2009-06-13 05:37:16 |
| lab9.pdf Path: Berkeley >> EE >> 1301 Fall, 2008 Description: University of Minnesota EE 1301: Introduction to Computing Systems Spring 2003 Lab 9 Source-level debugging (35 points) Reading: Chapters 12 and 15 of Patt and Patel, and the manual pages for gdb and ddd. (Type man gdb and man ddd from the command li... Date Added: 2009-06-13 05:38:03 |
| Solution Set 4.pdf Path: Princeton >> PH >> 509 Fall, 2009 Description: PH 509 Solutions 4 Instructor: Alexander Polyakov TA: Arvind Murugan Department of Physics, Princeton University (Dated: Nov 17,08) I. PARTICLE DECAY The amplitude is represented by just one Y shaped Feynman diagram, showing the decay of one parti... Date Added: 2009-06-13 05:38:07 |
| BiologicalEffectsGandhi.pdf Path: Utah >> ECE >> 3300 Fall, 2008 Description: ... Date Added: 2009-06-13 05:38:15 |
| GPS_measurement_strategies.pdf Path: Purdue >> CE >> 511 Spring, 2008 Description: GPS measurement strategies Pseudorange vs. phase Using pseudorange measurements only: C/A code: 10 m (100 m if S/A on) P code: 1 m Real time possible One receiver is sufficient Using phase measurements: Precision varies from 1 mm to 10 cm, de... Date Added: 2009-06-13 05:38:59 |
| Learning Guide, The Mitten.docx Path: Uni. Westminster >> KSS >> 0130 Fall, 2009 Description: Gradual Release of Responsibility Model of Instruction The Mitten, By Jan Brett Learning Guide Designed by: Kelly Stevens Grade level: 1st Grade Approximate length of time: 1 hour Curriculum Areas: Reading, Language Arts, Math Utah State Core Obj... Date Added: 2009-06-13 05:40:55 |
| Slide2.doc Path: Texas San Antonio >> SOC >> 1013 Fall, 2008 Description: EDUCATION: DEFINED I. Institution to transfer KNOWLEDGE and SKILLS to NEW MEMBERS II. Education is always A. Grounded in cultural values B. Related to the societys economy III. Education serves to unify society A. Transmitting common base of knowledg... Date Added: 2009-06-13 05:41:24 |
| BPLDIS presentation.pdf Path: Simmons >> LIS >> 486 Fall, 2009 Description: Digital Imaging Labs at Boston Public Library A presentation to the director of the Digital Library team for the Boston Public Library Goal Centralized systems that provides Way for curators to request images needing digitization Schedule of dig... Date Added: 2009-06-13 05:41:40 |
| JuvenileTypes.doc Path: Texas San Antonio >> CRIM >> 3113 Fall, 2009 Description: Types of Juveniles the System Handles: 1. Dependant Those who need social care 2. Disruptive Those who are problems, but not really delinquent or dangerous 3. Delinquent Those who have been adjudicated 4. Disturbed Those with psychological problems 5... Date Added: 2009-06-13 05:41:48 |
| 604UnixHelp.ppt Path: NJIT >> CIS >> 604 Fall, 2009 Description: Unix Hints Working with Unix in CIS 604 NJIT Computer Lab Hours Student Mall Mon-Fri: 7:00 AM - 11:15 PM Sat & Sun: 8:00 AM - 9:00 PM Student assistants are available for general inquiries during open hours Summer Hours: Mon-Fri: 9:00 AM - 9:00 P... Date Added: 2009-06-13 05:41:53 |
| Implementing-Subprograms_2up.ps Path: Virginia Tech >> CS >> 3304 Fall, 1999 Description: %!PS-Adobe-3.0 %Title: (Implementing-Subprograms.ppt) %Creator: (Microsoft PowerPoint: PSPrinter 8.3.1) %CreationDate: (2:54 PM Friday, August 25, 2000) %For: (Computer Science Department) %Pages: 12 0 %DocumentFonts: Charcoal Wingdings Arial-BoldMT ... Date Added: 2009-06-13 05:42:25 |
| Lexical relations.ppt Path: Acton School of Business >> SEMANTICS >> 315 Fall, 2009 Description: Introduction to semantics Lexical relations Organization We have seen that the lexicon was organized. We talked about domains of experience (at the conceptual level). When different parts of these domains are lexicalized with different wor... Date Added: 2009-06-13 05:42:49 |
| ASol3.pdf Path: Allan Hancock College >> MATH >> 337 Fall, 2009 Description: Math337 Group Theory Semester 1, 2004 Assignment 3A Solutions 1. (2001 Exam Question adapted) The following is a partially completed character table (over C) for a nite group G. class size 1 2 3 4 5 1 1 1 2 1 1 0 1 3 1 0 0 1 1 4 12 1 1 5 12 1 1 ... Date Added: 2009-06-13 05:42:59 |
| project2_class_practice.xls Path: S.F. State >> FIN >> 825 Fall, 2008 Description: Date riskfree SP500 3/1/2007 0.432% 1402.06 59.14 29.09 71.1 107700 19.11 2/1/2007 0.412% 1406.82 64.26 31.9 71.68 106190 19.86 1/3/2007 0.406% 1438.24 70.37 32.6... Date Added: 2009-06-13 05:44:45 |
| 1.PhoneBill.txt Path: Virginia Tech >> CS >> 1044 Fall, 2000 Description: Programmer: Rich Wheaton CS 1044 Project 3 Fall 2003 Customer: John McBryde Account: 540.231.2346 Billing date: 02/24/2003 Minutes Charge == Peak: ... Date Added: 2009-06-13 05:46:03 |
| li6 2007 inflection and derivation SHORT.ppt Path: East Los Angeles College >> LI >> 230 Fall, 2009 Description: Li6 Phonology and Morphology inflection and derivation 12-3-2007 Today\'s topics inflection vs derivation why do linguists make this distinction? arguments and evidence for and against the distinction larger implications of the (non)distinction ... Date Added: 2009-06-13 05:46:26 |
| LectureNotes10BJTHBJT.doc Path: Texas Pan American >> ELEE >> 4328 Fall, 2008 Description: Junction Transistors ELEE4328 BJT Bipolar Junction Transistor Page 1 of 6 Fall 2008 The basic Bipolar transistor terminal equations relating collector current IC, base current IB, and emitter current IE by the constants beta and alpha : I E = IC +... Date Added: 2009-06-13 05:46:43 |
| hw3.doc Path: UNC >> LING >> 101 Fall, 2008 Description: Linguistics 30 Section 2 Homework #3 Phonetics Name _ Pledge _ September 19, 2005 Describe the following consonant sounds according to the accepted convention. 1. 2. 3. 4. 5. [dZ] __ [N] [p] [l] [T] _ _ _ _ Describe the following vowel sounds acco... Date Added: 2009-06-13 05:48:46 |
| inbus_excel_ppt_06.ppt Path: Oregon >> DSC >> 240 Winter, 2008 Description: Microsoft Office Excel 2007 In Business Core Chapter 6 Applying Core Competency Skills Financial Planning and Accounting In Business Series Prentice Hall 2007 1 Chapter Introduction Excel Skill Sets Common Mistakes Quick References Video W... Date Added: 2009-06-13 05:50:04 |
| pmtcalculators.xls Path: Oregon >> DSC >> 240 Winter, 2008 Description: PV FV PMT Rate Calculators *Positive and Negative signs are important for payment, PV, and FV Even Cash Flows Present Value General Form = PV(rate,#periods,payment,FV,type) type = 0 if end of period, 1 if beginning of period Rate per period 0 # peri... Date Added: 2009-06-13 05:50:06 |
| esc4id.doc Path: East Los Angeles College >> U >> 2304 Fall, 2009 Description: System Identification - Reminder from Year 2 Obtaining a system model by experiment Earlier in your course, examples were given to explain how a system can be mathematically modelled from first principles by applying appropriate scientific principles... Date Added: 2009-06-13 05:50:21 |
| M58.0405.pdf Path: Wisconsin >> INSTR >> 0405 Fall, 2009 Description: July 21, 2004 MEMORANDUM (Via E-Mail Only) TO: FROM: SUBJ: Budget Officers Tim Norris 2004-05 Mid-Year Budget Transfer Processing The 2004-05 Red Book budget summary data will be loaded to the accounting master file and interfaced to SFS by the midd... Date Added: 2009-06-13 05:50:34 |
| Ex2Diag0.pdf Path: UF >> PHY >> 2054 Summer, 2008 Description: ... Date Added: 2009-06-13 05:51:07 |
| Course Outline Spring 2008 CHEM 1000.pdf Path: Laurentian >> CHEM >> 200801 Fall, 2009 Description: CHEM 1000 - Spring 2008 Section A: A Textbook Websites Monday, Wednesday, Friday Instructor Michael Gerken E-mail michael.gerken@uleth.ca General Chemistry 1 University Hall C610 Office Hours TBA Phone 329-2173 Office E860 8:00-8:50 am General Che... Date Added: 2009-06-13 05:53:31 |
| class29.4up.pdf Path: Maryland >> AMSC >> 662 Fall, 2008 Description: 15-213 \"The course that gives CMU its Zip!\" Shared Variables in Threaded C Programs Question: Which variables in a threaded C program are shared variables? n Programming with Threads Dec 5, 2002 Topics n n n n n The answer is not as simple as \"glo... Date Added: 2009-06-13 05:56:47 |
| nicotine and dependence.pdf Path: UCSD >> COGS >> 260 Winter, 2007 Description: Psychopharmacology (2006) 184: 577588 DOI 10.1007/s00213-005-0080-x ORIGINA L IN VESTI GATION Michael N. Smolka . Mira Bhler . Sabine Klein . Ulrich Zimmermann . Karl Mann . Andreas Heinz . Dieter F. Braus Severity of nicotine dependence modulates... Date Added: 2009-06-13 05:57:06 |
| T0447.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> T >> 0447 Fall, 2009 Description: T0447.t2k dssp-ebghstl 3 2 1 1 10 20 30 40 H 3 2 1 T G H T E H T T S E 51 60 70 80 90 T 3 2 1 H T E S T T T 101 110 120 130 140 E 3 2 1 H G H S H T G T E 151 160 170 180 190 H 3 2 1 S S T S E S ... Date Added: 2009-06-13 05:57:38 |
| 23.txt Path: SUNY Stony Brook >> CSE >> 506 Fall, 2008 Description: struct net_device: char name[IFNAMSIZ]; unsigned long base_addr; /* device I/O address */ unsigned int irq; /* device IRQ number */ unsigned char if_port; /* Selectable AUI, TP,.*/ unsigned char dma; /* DMA channel */ unsigned long sta... Date Added: 2009-06-13 05:59:13 |
| note12.pdf Path: Texas A&M >> G >> 390 Fall, 2009 Description: Data Acquisition and Input for GIS Types of Data Analog data vs Digital Data Vector data vs Raster data Ground Survey 1. Finding horizontal position Traverse (Dead reckoning) Consists of a series of legs; From a know point (control point) whose po... Date Added: 2009-06-13 05:59:43 |
| 321_au00_MT1_solutions.pdf Path: Washington >> PHYS >> 321 Fall, 2008 Description: 321 midterm 1 October 2000 1 2 3 4 ... Date Added: 2009-06-13 06:00:06 |
| 3.ps Path: Berkeley >> CS >> 172 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: 3.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMR10 CMBX12 CMSY10 CMBX10 CMTT10 CMMI10 CMR7 CMCSC10 %+ CMTT9 CMR9 CMSS10 CMMI7 CMTI10 CM... Date Added: 2009-06-13 06:00:17 |
| definitions_3.pdf Path: Minnesota >> PSY >> 3301 Fall, 2008 Description: What is Culture? SPRING 2006 Today\'s Outline Complexity of defining culture Understanding more specific domains of culture (race, ethnicity, and nationality) Going beyond simple classification, categories, and identification of culture How do you d... Date Added: 2009-06-13 06:00:42 |
| BIOC530_2008_lecture_1s.pdf Path: Washington >> BIOC >> 530 Fall, 2008 Description: Alan Weiner Biochemistry 530 November 19, 2008 RNA, and why you should care about it Part 1 Crick\'s \"Central Dogma\"? DNA makes RNA makes protein (makes us) or Crick\'s \"Central Dogma\"? DNA makes RNA makes protein (makes us) Crick\'s \"Central Dogma... Date Added: 2009-06-13 06:01:55 |
| CSU.pdf Path: San Diego State >> ES >> 0607 Fall, 2009 Description: The California State University The individual California State Colleges were brought together as a system by the Donahoe Higher Education Act of 1960. In 1972 the system became the California State University and Colleges, and in 1982 the system be... Date Added: 2009-06-13 06:02:02 |
| MSC1.ps Path: Michigan State University >> CSE >> 470 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: (Unsaved Publication) %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 11/27/00 01:01:29 %BoundingBox: 19 9 593 784 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend... Date Added: 2009-06-13 06:04:36 |
| slac-pub-4783.pdf Path: Stanford >> PUBS >> 4750 Fall, 2009 Description: SLAC-PUB-4783rev ssc-194 FN-500 April 1989 (4 . REACTIVE IMPEDANCE OF A SMOOTH BELOW THE RESONANCE TOROIDAL REGION* CHAMBER KING-YUEN NG~ Superconducting c/o Lawrence Super Berkeley Collider Laboratory, and Central Design Group $ Berkeley, CA... Date Added: 2009-06-13 06:06:57 |
| C4300L6.4u.pdf Path: Allan Hancock College >> COMP >> 4300 Fall, 2009 Description: COMP4300: Embarrassingly Parallel Problems Chapter 3: Wilkinson and Allen 6.2 Example#1: Computation of the Mandelbrot Set Alistair Rendell COMP4300 Lecture 6-1 Copyright c 2007 The Australian National University COMP4300 Lecture 6-3 Copyright c... Date Added: 2009-06-13 06:08:32 |
| cs146-lecture16.pdf Path: Harvard >> CS >> 146 Fall, 2009 Description: Computer Science 146 Computer Architecture Spring 2004 Harvard University Instructor: Prof. David Brooks dbrooks@eecs.harvard.edu Lecture 16: Even more on Caches Computer Science 146 David Brooks Lecture Outline How to improve cache performance? ... Date Added: 2009-06-13 06:08:36 |
| Dividend-taxes-01.pdf Path: Temple >> BA >> 950 Fall, 2009 Description: Saez, E. and Chetty, R. Dividend Taxes and Corporate Behavior: Evidence from the 2003 Dividend Tax Cut. Quarterly Journal of Economics, 120(3): 791-833. Abstract This paper analyzes the effects of dividend taxation on corporate behavior using the lar... Date Added: 2009-06-13 06:08:39 |
| Argentina-FDI.doc Path: Temple >> BA >> 804 Fall, 2009 Description: IMPACT OF GLOBALIZATION ARGENTINA Until 1999 Globalization was a story of success in Argentina. Real GDP growth rate reached 8.1 percent in 1997. The turning point came at the end of the 1990s. Argentina\'s economy has gone through three years of dee... Date Added: 2009-06-13 06:08:42 |
| slac-pub-6885.pdf Path: Stanford >> PUBS >> 6750 Fall, 2009 Description: SLAC-PUB-95-6885 LBL-37216 High-FieldStrong-Focusing UndulatorDesignsfor X-Ray Linac CoherentLight Source(LCLS) Applications* S. Caspit, R. Schluetert, R. Tatchyn Stanford Linear Accelerator Center, Stanford, CA 94305, USA tLawrence Berkeley Laborat... Date Added: 2009-06-13 06:09:05 |
| LQ11.pdf Path: Cornell >> P >> 213 Fall, 2009 Description: Physics 213 Lecture questions October 3, 2002 A. A point charge Q is placed within an electrically neutral hollow conducting sphere. What is the charge on the inner surface of the sphere? +Q 1. zero 2. +Q 3. Q B. What is the charge on the outer... Date Added: 2009-06-13 06:09:10 |
| CH5 unmodified computer_applications_presentation.pdf Path: Oregon State >> NE >> 112 Fall, 2009 Description: Computer Applications Chapter 5 Jump to first page Objectives n Use your engr email address to send and receive messages Access the World-Wide Web to find the NE112 website and other sites. Use an electronic spreadsheet such as Excel or Quattro. E... Date Added: 2009-06-13 06:10:15 |
| notes_1.pdf Path: Hudson VCC >> MATH >> 337 Fall, 2009 Description: MATH 337, by T. Lakoba, University of Vermont 5 1 1.1 Simple Euler method and its modifications Simple Euler method for the 1st-order IVP y (x) = f (x, y), y(x0 ) = y0 . (1.1) Consider the IVP Let: xi = x0 + i h, i = 0, 1, . . . n yi = y(xi ) - t... Date Added: 2009-06-13 06:10:17 |
| Chemistry 240 Alcohol.pdf Path: University of Louisiana at Lafayette >> CHEM >> 240 Fall, 2008 Description: Chemistry 240 Alcohol Reactions 1. Complete the following reactions: OH H2CrO4 OH SOCl2 OH HCl B2H6 H2O2/OH - 1. Hg(OAc)2/H3O 2. NaBH4 + 2. Show how you might bring about the following conversions. For any conversion involving more than one ... Date Added: 2009-06-13 06:11:22 |
| Assign8.doc Path: IUP >> NSM >> 201 Spring, 2009 Description: Assignment 8 Modify the personal Web Site you created in the previous assignments as indicated in the \"In the Lab\" exercise 2 at the end of Project Four of your Front Page 2003 text book. The details can be found on pages 334-335. You are asked to su... Date Added: 2009-06-13 06:12:52 |
| polyatm1.pdf Path: Idaho >> SGHCHEM >> 101 Fall, 2009 Description: NAMES AND FORMULAS OF SOME COMMON POLYATOMIC IONS AND ACIDS POLYATOMIC IONS NH4+ CO32HCO3C2H3O2ClO ClO 2ClO 3ClO 4OHNO2NO3PO43HPO42H2PO4SO32HSO3SO42HSO4ammonium ion carbonate ion hydrogen carbonate ion (bicarbonate) acetate ion hypochlorite ion chlo... Date Added: 2009-06-13 06:13:11 |
| Hw03.txt Path: N.C. State >> CSC >> 651 Fall, 2009 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Transitional/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\" lang=\"en-US\" xml:lang=\"en-US\"> <head> <title>Login Required</title> <link rev=\"made\" hr... Date Added: 2009-06-13 06:13:39 |
| 02-unsigned-sol.pdf Path: N.C. State >> CSC >> 234 Fall, 2008 Description: 1. Unsigned binary add/convert. Was there an unsigned overflow? * Yes 11111 1010 + 0101 0000 111 1111 = 17510 0001 = 08110 0000 = 25610 2. Unsigned binary sub/convert Was there an unsigned overflow? *No 0111 1000 - 0000 0111 1 1111 0000 = 12810 ... Date Added: 2009-06-13 06:14:35 |
| Solutions to Chapter 13 Even Questions.pdf Path: USC >> CHEM >> 105 Fall, 2009 Description: Solutions to Chapter 13 Even Questions 22. For the reaction: N2 (g) + 2 Cl2 (g) 2 NCl3 (g) an analysis of an equilibrium mixture is performed at a certain temperature. It is found that [NCl3] = 1.9 x 10-1 M, [N2] = 1.4 x 10-3 M, and [Cl2] = 4.3 x 10... Date Added: 2009-06-13 06:15:22 |
| Process Writing Checklist Narratives handout 4th.doc Path: Valdosta >> ECED >> 4300 Fall, 2008 Description: Narrative Process Writing Checklist Prewriting _ List and describe at least 2 characters. _ List the conflict or problem. _ Setting: Describe at least 2 elements of setting. Name _ _ Events: Have at least 4 events and give details for each event.... Date Added: 2009-06-13 06:16:04 |
| ITC_SPR.pdf Path: UMass (Amherst) >> CH >> 728 Fall, 2009 Description: Isothermal Titration Calorimetry (ITC) i ci i ( aq ) = ( aq ) + RT ln c 0 i r 1 Isothermal Titration Calorimetry (ITC) i ci i ( aq ) = ( aq ) + RT ln c 0 i r Standard chemical potential at standard concentration (usually 1 M) ... Date Added: 2009-06-13 06:16:20 |
| chap1.pdf Path: Sveriges lantbruksuniversitet >> BUEC >> 333 Fall, 2009 Description: Econometrics Regression Sampling Regression P. Lavergne - BUEC 333 2008 Outline Econometrics Regression 1 Econometrics Sampling 2 Regression Probability background Regression analysis 3 Sampling Econometrics Quantitative measurement and a... Date Added: 2009-06-13 06:16:20 |
| Chapter12.pdf Path: Texas A&M >> STAT >> 303 Fall, 2008 Description: Statistics 303 Chapter 12 ANalysis Of Variance (ANOVA) What is ANOVA? ANOVA setting: One variable (explanatory) is categorical. This variable forms the groups (populations) to be compared. We will denote by I the number of groups (number of values... Date Added: 2009-06-13 06:17:08 |
| PracticeTest1Spring06Answers.pdf Path: Arizona >> CS >> 127 Fall, 2008 Description: Answers to C Sc 127A PracticeTest #1 Spring 2006 1. 2. Read the problem, Ask questions Do some sample problems Write an \"analysis deliverable\" Variable Names pennies nickels dimes totalAmount 3. Input or Output in in in out Sample Problem 1 ... Date Added: 2009-06-13 06:18:52 |
| Paradoxical_Vocal_Fold_Movement.pdf Path: Wisc Stevens Point >> SBENJ >> 679 Fall, 2009 Description: Plan for Paradoxical Vocal Fold Movement session with XXX XXX 1) Breathing exercises 2) Practice breathing in the nose and out the mouth and focus on tummy breathing, not clavicular breathing while: a. Resting quietly b. Reading short passage c. Lo... Date Added: 2009-06-13 06:18:57 |
| Path2WKB.pdf Path: New Mexico >> PHYS >> 521 Fall, 2009 Description: ... Date Added: 2009-06-13 06:19:18 |
| lab1ch141spring04.pdf Path: Colby >> CH >> 141 Fall, 2009 Description: CH141t SPRING 2004 Determination of the Elemental Molar Masses of Chlorine and Bromine PRE-LAB ASSIGNMENT Reading: expected prior to your lab 1. Sections 2.3 -2.9 in Chemistry by Brown, LeMay, Bursten. 2. The remainder of this experiment in this ha... Date Added: 2009-06-13 06:19:50 |
| 41381q3b.pdf Path: Pittsburgh >> MATH >> 41381 Fall, 2009 Description: t s v ss vwz s v y@hDCAU}f@vcwD@Yy@h yA!DyvU}6XyegU4UyzwcwvDwawi@gggEDmilIl } k s } } s ssd w z z f wsv s t| { | { | { } s k s fd f f u w z s z wxhv pg@VzgGDvwvixgecwDpsmtvs aUgpywavyweu t lw fdw s xgerwcwv | k | { ... Date Added: 2009-06-13 06:21:09 |
| ExpLog_AARSummary_SSAD_RSM_LCODraft_F07a_T07.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Explanation Log AAR Summary of LCO Draft SSAD & RSM Team 7 10/31/2007 CSCI 577a, Fall 2007 Location Typist Use Case.emx Description The Typist use case diagram should be derived use cases for each of the 10 different types of report generation u... Date Added: 2009-06-13 06:22:00 |
| TF9_3.53.xls Path: SMU - Cox School of Business >> ENGR >> 8361 Fall, 2009 Description: 3.53 (TF9, p.71) P= 18,300 A= 4,300 P/A = 4.26 r= 10.000% 1-e-15r = 0.78 er -1 = 0.1051709 [P/A,r,15] = 7.39 ... Date Added: 2009-06-13 06:22:55 |
| CRfac.txt Path: San Diego State >> STA >> 350 Fall, 2009 Description: CR design with 2x4 factorial treatments a) ANOVA Stat > ANOVA > Two-way. Responses: yield Row factor: nitrogen Column factor: sulphur Click OK This model will include an interaction term between the two treatment factors. If you want to leave out... Date Added: 2009-06-13 06:23:27 |
| divide.doc Path: MIT >> I >> 386 Fall, 2009 Description: #PCE version 4#C# man_module#name#space#id_table#modified# current_idO#I#xN# class/divideN# referenceC# hash_table#refer#sizeO#I#xaI#sN#C./C#man_class_card# # # identifier#module# last_modified#name#summary#description#see_also#inherit#user_inte rfa... Date Added: 2009-06-13 06:24:25 |
| extrinfo.txt Path: Washington University in St. Louis >> MEXMRS >> 0868 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2008-08-22 NOTE ... Date Added: 2009-06-13 06:27:14 |
| extrinfo.txt Path: Washington University in St. Louis >> MEXMRS >> 0876 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2008-08-22 NOTE ... Date Added: 2009-06-13 06:27:20 |
| extrinfo.txt Path: Washington University in St. Louis >> MEXMRS >> 0870 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2008-08-22 NOTE ... Date Added: 2009-06-13 06:27:28 |
| handout21.pdf Path: Cornell >> PHYS >> 213 Fall, 2008 Description: ... Date Added: 2009-06-13 06:27:40 |
| slac-pub-3300.pdf Path: Stanford >> PUBS >> 3250 Fall, 2009 Description: SLAC-PUB-3300 March 1984 (T/E) HEAVY PARTICLE PRODUCTION AT THE SSC* Stanley J. Brodsky Stanford Linear Accelerator Center Stanford University, Stanford, CA 94305 Howard E. Haber Department of Physics University of California, Santa Cruz, CA 95... Date Added: 2009-06-13 06:27:51 |
| beautycontest.pdf Path: Wesleyan >> ECON >> 311 Spring, 2009 Description: \"One, Two, (Three), Infinity: Newspaper and Lab Beauty-Contest Experiments\" by Rosemarie Nagel, Antoni Bosch-Domnech, Albert Satorra, and Jose Garca-Montalvo Universitat Pompeu Fabra, Barcelona November 21, 1999 Acknowledgments: We wish to thank Er... Date Added: 2009-06-13 06:29:22 |
| Euromerica.doc Path: Johns Hopkins >> MTS >> 361 Fall, 2009 Description: Euromerica Liquors Setup the problem as we did for the St. Joseph\'s Model: Then enter the objective function and constraint information in the Solver dialogue box as before don\'t forget nonnegativity: When we click Solve, we get the following aler... Date Added: 2009-06-13 06:30:11 |
| width.txt Path: University of Hawaii - Hilo >> ICS >> 212 Fall, 2009 Description: /*see width.txt*/ #include <iostream> #include <iomanip> using namespace std; int main(){ cout.width(5); cout<123<endl; / 123 cout<setw(5)<123456<endl; /123456 return 0; } ... Date Added: 2009-06-13 06:30:33 |
| am465assn2.doc Path: UWO >> AM >> 465 Fall, 2009 Description: 1. Results from function double e(int n) that computes the sum of the first n terms in the series expansion: From the output of the source code we notice that the accuracy peaks at 8 terms. 2. Results from function double exponential(double x) that... Date Added: 2009-06-13 06:31:13 |
| dollar cost averaging class 15 prob 12 ch 16.xls Path: St. Josephs NY >> BUS >> 219 Fall, 2009 Description: Dollar Cost Averaging Prob 12 ch 16 year Investment Price nr shares 2004 $3,000 $40 75 2005 $3,000 $50 60 2006 $3,000 $60 50 2007 $3,000 $45 66.7 $12,000 251.7 @ Return -3.8% $45 = $11,325.0 What if price cycles up again? year Investment Price nr ... Date Added: 2009-06-13 06:32:01 |
| hw8.pdf Path: Old Dominion >> CS >> 471 Fall, 2008 Description: CS471: Operating System Concepts Spring 2009 (Lecture: T 7:10-9:50 PM) Homework #8 Points: 20 Due: April 21, 2009 Textbook (8th Edition) Question 1 [Points 4] Question 2 [Points 4] Question 3 [Points 4] Question 4 [Points 4] Question 5 [Points 4] 17... Date Added: 2009-06-13 06:32:55 |
| 140_sp09_ps1.pdf Path: CSU Sacramento >> ECON >> 140 Fall, 2009 Description: California State University, Sacramento Department of Economics Econ 140, Quantitative Economic Analysis Spring 2009 Due Friday, February 13, 2009 Problem Set 1 M. Dowell Instructions: Keep all answers as brief as possible. Include key Excel output ... Date Added: 2009-06-13 06:33:02 |
| vel_dist_Hubble_Humason.pdf Path: Virgin Islands >> ASTR >> 405 Fall, 2009 Description: ... Date Added: 2009-06-13 06:33:41 |
| Perplexity.xls Path: Benjamin Franklin Institute of Technology >> ECE >> 5527 Fall, 2009 Description: Search and Decoding Final Project Business Corpus Appendix I: Detail Result1/2 by Chih-Ti Shih Test Message B1 B1% B2 B2% B3 B3% B4 B4% H1 H1% H2 H2% H3 H3% H4 H4% C1 C1% C2 C2% C3 C3% C4 C4% perplexity 704.91 846.77 526.39 589.85 698.33 992.91 76... Date Added: 2009-06-13 06:34:23 |
| slac-pub-9815.pdf Path: Stanford >> PUBS >> 9750 Fall, 2009 Description: SLAC-PUB-9815 May 2003 STUDY OF NEAR-FIELD VIBRATION SOURCES FOR THE NLC LINAC COMPONENTS F. Asiri, F. Le Pimpec, A. Seryi SLAC, CA USA Abstract The vibration stability requirements for the Next Linear Collider (NLC) are far more stringent than for... Date Added: 2009-06-13 06:35:38 |
| Lecture36.pdf Path: Wisconsin >> CS >> 538 Fall, 2008 Description: Speculative Parallelism Prolog also lends itself nicely to speculative parallelism. In this form of parallelism, we \"guess\" or speculate that some computation may be needed in the future and start it early. This speculative computation can often be d... Date Added: 2009-06-13 06:35:57 |
| timeline.doc Path: Mt. Holyoke >> CLASSICS >> 224 Fall, 2009 Description: Athenian Empire Rough timeline (not to scale) of mid-sixth to late fifth century BCE (Before the Common Era) Croesus 560547 Pisistratus 561528 Ionian Revolt 499 494 ? \"Fifty-Years\" rise of Athenian power (c. 480-430) Marathon Plataea 490 478 Part... Date Added: 2009-06-13 06:36:24 |
| Lecture 9.doc Path: CSU Long Beach >> SMIN >> 470 Fall, 2009 Description: Lecture 9 Questionnaire Design In the previous chapter, we looked at one particular aspect of questionnaire design measurement scales. We concluded that as we move up from nominal scales to ratio scales, we get more information and that we should al... Date Added: 2009-06-13 06:37:01 |
| chapter7.ppt Path: Old Dominion >> CS >> 775 Fall, 2008 Description: CS 775/875: Fall 2000 Chapter 5: Security Threats and attacks Threats (to information): Leakage, tampering, Vandalism Attacks (on channels): Eavesdropping, Masquerading, Message tampering, Replaying, Denial of Service Threats from mobile code (e.... Date Added: 2009-06-13 06:37:07 |
| 2710 Comments 12_5.doc Path: U. Memphis >> PUBLIC >> 2710 Fall, 2009 Description: 2710 Comments 12/5/05 Don\'t forget we have tutoring time Wednesday, 2-4pm Now I can finish my notebook! Great class Understand everything This was confusing Today was interesting, I like the real-world examples Good class, errors make sense now I\'... Date Added: 2009-06-13 06:37:44 |
| Campbell_2007.doc Path: Université du Québec à Montréal >> INFO >> 7002 Fall, 2009 Description: La combinaison de matrices de distance pour l\'infrence phylogntique Les gnes provenant d\'un mme organisme peuvent avoir des modles d\'volution diffrents. Certains auteurs suggrent de s\'assurer de la congruence de ceux-ci avant de les combiner dans une... Date Added: 2009-06-13 06:38:08 |
| Domain Specific Role of Technology.doc Path: Sveriges lantbruksuniversitet >> EDUC >> 864 Fall, 2009 Description: Perceived role of technology 1/8 Job-specific Perceived Role of Technology This questionnaire is designed to assess your perception of the role of technology in your profession. Demographic Information 1. What is your age? a. b. c. d. 25 or under ... Date Added: 2009-06-13 06:40:53 |
| wc1_Lower_Klamath.pdf Path: Humboldt State University >> KBWQMCG >> 080408 Fall, 2009 Description: Lower Klamath en re G k ee Cr ek Cre es oi n sM De Creek ranite G C Mill reek C Cedar reek Sutcliffe Creek Cre lley a ar V ek Be Ru n rk I Creek Fo Clau s p Co k ee Cr r pe on C Sout h F n di an or k I reek k Cree Sl i de Dee reek ... Date Added: 2009-06-13 06:41:29 |
| harwood.pdf Path: Texas A&M >> PUBS >> 359 Fall, 2009 Description: Crop Insurance and Disaster Assistance Joy Harwood, Economic Research Service, USDA James L. Novak, Auburn University Background The 1996 Federal Agricultural Improvement and Reform (FAIR) Act implemented farm program contract payments that do not i... Date Added: 2009-06-13 06:42:22 |
| 112 Syllabus--Old.pdf Path: BYU >> MATH >> 112 Fall, 1998 Description: Syllabus Math 112, Section 14 Winter 2007 Bill Evans January 10, 2007 1 Class Info. / Contact Info. / etc. Bill Evans 300 TMCB 422-3681 billevans@math.byu.edu 5:00-6:00pm TTh (In my Office) 10:00-11:00am MW (In my Office) (In general, if you can ... Date Added: 2009-06-13 06:42:36 |
| lecture-static.pdf Path: San Diego State >> MATH >> 543 Spring, 2008 Description: The Singular Value Decomposition Dynamic Pattern Formation Numerical Matrix Analysis Lecture Notes #24 - The Singular Value Decomposition Application to Signal and Data Analysis Peter Blomgren, blomgren@terminus.sdsu.edu Department of Mathematics an... Date Added: 2009-06-13 06:43:55 |
| windhorst.pdf Path: ASU >> GLG >> 410 Fall, 2008 Description: CURRICULUM VITAE Name: Address: Rogier Arnold Windhorst School of Earth (480) 965 8102 (FAX), or (4... Date Added: 2009-06-13 06:44:16 |
| Campbell_2007.doc Path: Université du Québec à Montréal >> BIF >> 7002 Fall, 2009 Description: La combinaison de matrices de distance pour l\'infrence phylogntique Les gnes provenant d\'un mme organisme peuvent avoir des modles d\'volution diffrents. Certains auteurs suggrent de s\'assurer de la congruence de ceux-ci avant de les combiner dans une... Date Added: 2009-06-13 06:44:41 |
| hw5sol.pdf Path: Iowa State >> STAT >> 521 Fall, 2008 Description: ... Date Added: 2009-06-13 06:45:23 |
| exam 3 key.pdf Path: Purdue >> IE >> 486 Fall, 2008 Description: ... Date Added: 2009-06-13 06:45:25 |
| philofound.pdf Path: E. Kentucky >> PSY >> 853 Fall, 2008 Description: Philosophical Foundations A number of philosophical issues are foundational in psychology. While we may not be able to resolve all the philosophical issues, it is critical that every psychologist be aware of the issues. Ages in Human Thought o Dark... Date Added: 2009-06-13 06:45:34 |
| Bertenthal et al ChDev_1980.pdf Path: Maple Springs >> PSYCH >> 6635 Fall, 2009 Description: Development of Visual Organization: The Perception of Subjective Contours Bennett I. Bertenthal; Joseph J. Campos; Marshall M. Haith Child Development, Vol. 51, No. 4. (Dec., 1980), pp. 1072-1080. Stable URL: http:/links.jstor.org/sici?sici=0009-3920... Date Added: 2009-06-13 06:46:46 |
| 2065s05ex3.pdf Path: LSU >> M >> 2065 Fall, 2009 Description: Name: Exam 3 Instructions. Answer each of the questions on your own paper. Put your name on each page of your paper. Be sure to show your work so that partial credit can be adequately assessed. Credit will not be given for answers (even correct one... Date Added: 2009-06-13 06:46:50 |
| 2065s08review2a.pdf Path: LSU >> M >> 2065 Fall, 2009 Description: Math 2065 Review Exercises for Exam II (With Answers) The syllabus for Exam II is Sections 3.2 3.6 and 3.8 of Chapter 3 and Sections 4.1 and 4.3 of Chapter 4. You should review all of the assigned exercises in these sections. In addition, Section 3.... Date Added: 2009-06-13 06:46:52 |
| proj.pdf Path: Fayetteville State University >> ECH >> 4323 Fall, 2009 Description: ECH 4323: Chemical Process Control FINAL PROJECT Propylene glycol is produced by the hydrolysis of propylene oxide in a CSTR. The reaction is normally conducted using excess water. To get propylene glycol of the desired final specification, the react... Date Added: 2009-06-13 06:47:49 |
| q1.pdf Path: Wilfrid Laurier >> CPSC >> 413 Fall, 2009 Description: ... Date Added: 2009-06-13 06:48:18 |
| MAE170-F08 syllabus.doc Path: UCSD >> MAE >> 170 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|10 Oct 2008 15:29:56 -0000 vti_extenderversion:SR|5.0.2.6790 vti_backlinkinfo:VX|index.html ... Date Added: 2009-06-13 06:48:34 |
| p2quizstudyguide.doc Path: Arizona >> MATH >> 115 Fall, 2009 Description: Project 2 Quiz: Friday April 27th, 2007 Study Guide Format: This is a paper-and-pencil quiz. Any computer-related questions will have the relevant dialogue box for you to write in your answers by hand. The quiz consists entirely of short answer/show-... Date Added: 2009-06-13 06:49:35 |
| treasurehunt.doc Path: Arizona >> MATH >> 115 Fall, 2009 Description: Navigating your MBD textbook - An Electronic Treasure Hunt *Team Members: START: Content Page. GO TO: About Mathematics for Business Decisions section. Instruction: Read pages 1 through 3. Task: How does MBD prepare you for your business career? * W... Date Added: 2009-06-13 06:49:35 |
| README.txt Path: Loyola Maryland >> ASN >> 702 Fall, 2009 Description: Here is some example source code related to the assignment. Feel free to approach the problem differently and treat this source code simple as FYI. ... Date Added: 2009-06-13 06:50:30 |
| Final_fall_1999.pdf Path: Idaho >> ENGL >> 201 Spring, 2008 Description: Final Exam for English 201 Key Concepts and Terms - Fall 1999 I. Identify the pattern of the following sentences (Pattern I, II, III, etc., 1 point each, 7 points total): That train always runs on time. Thinking about the Holocaust produces disturbi... Date Added: 2009-06-13 06:50:36 |
| OralGradeSheet.doc Path: Wisconsin >> ST >> 411 Fall, 2009 Description: NAME_ 1. Delivery a. Verbal Aspects i. Volume ii. Speed iii. Enunciation iv. General Clarity b. Non-verbal Aspects i. Eye Contact ii. Appearance iii. Nervous Habits iv. Enthusiasm 2. Content a. Brief explanation of what the project is about, includ... Date Added: 2009-06-13 06:51:21 |
| handouts_Molecular shapes_2.pdf Path: Washington >> CHEM >> 162 Fall, 2008 Description: Molecular shapes # of Electron Domains 4 2D Bonding Representation (including nonbonding electron pairs) Compiled by Prof. Andri Smith, Quinnipiac College 3D Bonding Representation (including nonbonding electron pairs) Molecular Formula (AXm En) AX... Date Added: 2009-06-13 06:52:15 |
| Phys101_Grades 96.pdf Path: Acton School of Business >> PHYS >> 101 Fall, 2008 Description: RICE UNIVERSITY - PHYS101 - FALL 2007 S01076953 QUIZZES(20) Quiz 1 Quiz 2 Quiz 3 Quiz 4 Quiz 5 Quiz 6 Quiz 7 Quiz 8 Quiz 9 Quiz 10 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 PLEDGED(30) Pledged 1 Pledged 2 Pledged 3 Pledged 4 Pledged 5 Pledged... Date Added: 2009-06-13 06:52:43 |
| lines.ppt Path: Bethel VA >> ASTRO >> 401 Fall, 2009 Description: Motivation: Detailed spectra of stars differ from pure blackbodies: 0 The Bohr Model of the Hydrogen Atom 0 Postulate: L = n Bohr radius: a0 = 2 / (mee2) = 5.29*10-9 cm = 0.529 Hydrogen Line Series Infrared Optical 0 Ultraviolet The Balmer... Date Added: 2009-06-13 06:53:25 |
| 7Nus.pdf Path: Michigan State University >> LIB >> 1984 Fall, 2009 Description: ... Date Added: 2009-06-13 06:53:58 |
| peercollabprojecteval.doc Path: Purdue >> ENG >> 420 Fall, 2009 Description: Collaborative Project Evaluation Form YOUR NAME: _ Project: _ TEAM MEMBERS\' NAMES: _ __ DIRECTIONS: Respond to each question as openly and honestly as you can. I will be the only person to see your evaluation of your teams performance and will use ... Date Added: 2009-06-13 06:54:06 |
| iconmanIVZ.pdf Path: RIT >> SCHP >> 740 Fall, 2009 Description: Contents Chapter 1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 1.1 1.2 1.3 1.4 1.5 1.6 1.7 What is ICON-NMR? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ... Date Added: 2009-06-13 06:55:31 |
| diff.doc Path: Minnesota >> HEIK >> 0032 Fall, 2009 Description: Lesson 1: 2/8 and 2/10 Teacher class Date and time Subject/Lesson focus The topic will be introduced to students. Problems concerning the study of American Indians will be addressed: stereotypes, oral tradition, and European bias. Personal Objective:... Date Added: 2009-06-13 06:55:56 |
| Exercices_8_Cox_Tests.pdf Path: Université du Québec à Montréal >> EXERCICESS >> 5120 Fall, 2009 Description: Exercices 8 Modle de Cox - Introduction Exercice 1 Les donnes suivantes portent sur un groupe de patients souffrant du cancer du larynx. Variables Stade : Delai : Age : Annee : dj : (1=stade 1, 2=stade2, 3=stade 3, 4=stade 4) temps d\'attente jusqu\'... Date Added: 2009-06-13 06:56:34 |
| quiz4.ps Path: Duke >> X >> 170 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: quiz4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips quiz4 %DVIPSParameters: dpi=600... Date Added: 2009-06-13 07:03:32 |
| YDR098C-B.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YDR >> 098 Fall, 2009 Description: 3 2 1 AAA B B A B X X X X X B C A B D D D C D CB DEBACA D B A A C C CDCDABCEGCCDFDDFCCCCDCEDB D C C A D C C D C C D D B C B D D D D C B E E C E C D CDXXXXEXBXBBCADEDCXEDCFCXBBXX D F CECDAAXDBXGXXXCX D F A E D D D A A C D X X X X X X XXXXAADXCBXXDXX... Date Added: 2009-06-13 07:04:34 |
| YDR064W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YDR >> 064 Fall, 2009 Description: YDR064W.t2k EBGHSTL 3 2 1 C SSEETEEEEEES ES E C T EECCSECCEESSSSSSSSSTESSSECCSSXXX E E B E T T XCXXX X X X X X X X X XX X X XXXX T X E EE CSSCCC X TT CCCCCCCCCC S X X X T E X CC E CCEE S S C X X 1 10 20 30 40 E 3 2 1 T E H T H ... Date Added: 2009-06-13 07:04:38 |
| YKR026C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YKR >> 026 Fall, 2009 Description: YKR026C.t2k CB_BURIAL_14_7 3 2 1 AA BB X X B AD D CCCCDCFEDEFADCCXX C C E CXXXAXXCCDA D DD D D D X X D X B B A X B EDBDEBB C X A E B D D F F E D X A X X X D E D X X X X GFFFFFFGFFEFECBCB B EG EE EDEFBA A C E G G E X X X X 1 10 20 3... Date Added: 2009-06-13 07:09:41 |
| YML057W.t2k.str2-logo.pdf Path: UCSC >> YML >> 057 Fall, 2009 Description: YML057W.t2k STR2 4 3 2 1 CC B T CS CH CSCCZYCCCTSCC Q Y H T HHHTSSCZZZZCCTSC CCHCHHHHTCCCHH C Y ST T CH T S H SC S H H H XXHHHXXSSHSCCXXXXXXT X XX X X X X X XXXXXXXXXXXXXXX X X XXXXSSTXX C C H H X X X T CHH C X HHHHHH T T T T C X C H C Y Z ... Date Added: 2009-06-13 07:09:44 |
| YER182W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YER >> 182 Fall, 2009 Description: YER182W.t2k EBGHSTL 3 2 1 C C T CC H S E E E S S E S S E E S H E C E E C E T C X X X X X X X X X X XTHXSXXXXCSXXXXXXXXE X X X X X X C H HHH HHHHH T EEE S E HHTCTC S C CEE C X SS CCCCC CCSEEEEE C E T G E E C C S S T S C H E G C H H E C G C H... Date Added: 2009-06-13 07:10:04 |
| YBR196C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YBR >> 196 Fall, 2009 Description: YBR196C.t2k EBGHTL 3 2 1 CCTTT X C G TTCCCCTTCTCCCCH G X X X XXX X E E E X X X X X X 1 10 20 30 40 T 3 2 1 T T H H H H HHH 51 E C E C C H H T T T H T T E H G T G H E C X X X X X X X X X X X X X X X X X X X 60 70 80 90 T 3 2 1 E ... Date Added: 2009-06-13 07:11:30 |
| YPL127C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YPL >> 127 Fall, 2009 Description: YPL127C.t2k EBGHTL 3 2 1 CC X B CCCCCCCCCHHCCCCC TTTCTTTTTTTTTTTTTTTTHTHHHHCCHHHHHTTTTTTTTC H H H H T H THHH T T T T T T T X X X X X X X X X H H H H H H X CTCCC CCCCCCCCCC H H E X X X X X X X X X X X X X X X X X X X X X X X X X X X X T T T CCC... Date Added: 2009-06-13 07:11:42 |
| YPL116W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YPL >> 116 Fall, 2009 Description: YPL116W.t2k EBGHSTL 3 2 1 CTT G X CGGCCCCEEE HTH H CCCC S S H HHS SSGGXCCHTGTHTCSTTTECCCS SX S G E C S X X XSE X X T T H S T C S H C T S G C T H T C C G G X X X X X X X X E X X TT X X X S S S X X X X CH T 10 20 30 40 T 3 2 1 H T E H ... Date Added: 2009-06-13 07:11:49 |
| 2008C542HW-L38-02.pdf Path: Idaho >> CE >> 542 Spring, 2008 Description: Design Project: 3 Span Bridge 1 (Live Load+IM) Moment - Per Lane 4,000,000 4 000 000 3,000,000 2,000,000 Moment (ft-lb) 1,000,000 , , 0 0 25 50 75 100 125 150 175 200 225 250 275 300 325 350 375 400 425 -1,000,000 -2,000,000 -3,000,000 Min... Date Added: 2009-06-13 07:12:41 |
| 22-Outline.pdf Path: Duke >> CPS >> 130 Fall, 2009 Description: CPS 130 Lecture 22 Outline - Union-Find 20 June 2005 Before Class: Journal Up 1. Disjoint Data Sets Minimum Spanning Tree Example Set of sets of n items Each item only in one set (Disjoint!) Representative elements Operations: Make-Set, Unio... Date Added: 2009-06-13 07:13:16 |
| laboratory6.pdf Path: Missouri S&T >> ME >> 584 Fall, 2009 Description: ME 584 Computer Control of Manufacturing Systems LABORATORY #6 PROCESS CONTROL Winter 2000 (due April 10) In this laboratory, your group will develop three subroutines in the C language to implement two force process controllers for a face milling... Date Added: 2009-06-13 07:14:33 |
| YOR063W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YOR >> 063 Fall, 2009 Description: YOR063W.t2k EBGHSTL 3 2 1 CC T B E X X CCC CCCCCCSCCS SS S TTS S T TT S S E STTSGGTT T C S C B S E G S C H T T B H G T H S T H T T T S E C E H G S T G C E H G E B T E H E X X X X X XXXXXXXXXEHXXXGSSXTTXXXSETGXTXXXTXXXCCCXXXH X X X X X X X X X X X... Date Added: 2009-06-13 07:15:23 |
| Lecture13_class.ppt Path: Minnesota >> LIB >> 8152 Fall, 2009 Description: Overlapping Orders Any equivalent m combinations will share values. For Example: 1st Order = 400 nm 2nd Order = 200 nm 3rd Order = 133 nm d(sin + sin ) = m Calculate the free spectral range: f = /(m+1) Douglas A. Skoog and James J. Leary, Prin... Date Added: 2009-06-13 07:15:39 |
| YML076C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YML >> 076 Fall, 2009 Description: YML076C.t2k CB_BURIAL_14_7 2 1 AAA X 1 10 20 30 40 A 2 1 D A D B D A D B D B D A D B A B E B D A AAA B X X C C C D C D C C C CDC C C B CCCCCCCCCCCX A C B C CDXDXAXBBDXDDDDXDDDDDDBXXXXXXCDXDDDADDDDXDDXXDDDXD CCCBCCCCCCCDACCCEC D A D D ... Date Added: 2009-06-13 07:16:24 |
| Setting_up_pegasus_homepage.pdf Path: UCF >> DO >> 714476 Fall, 2009 Description: Setting up your Pegasus Homepage. On the UCF main website, I googled, \"pegasus homepage\" and I found a tutorial on \"How to set up a home page on Pegasus\" here: http:/pegasus.cc.ucf.edu/homepagesetup.html and it was the WORST TUTORIAL EVER! So I mad... Date Added: 2009-06-13 07:17:56 |
| 2006112_r01k_0111464.pdf Path: Stanford >> CVS >> 1020 Fall, 2009 Description: US District Court Civil Docket as of 01/12/2006 Retrieved from the court on Thursday, February 23, 2006 United States District Court District of Massachusetts (Boston) CIVIL DOCKET FOR CASE #: 1:01-cv-11464-JLT Turberg v. CVS Corporation, et al Ass... Date Added: 2009-06-13 07:18:16 |
| Chap4.ppt Path: North Texas >> CSCE >> 0150 Fall, 2009 Description: Chapter 4 Performance Measure, Report, and Summarize Make intelligent choices See through the marketing hype Key to understanding underlying organizational motivation Why is some hardware better than others for different programs? What factors o... Date Added: 2009-06-13 07:20:56 |
| ch6-pll-clk.pdf Path: Montana >> ECEN >> 4002 Fall, 2009 Description: Chapter 6 PLL and Clock Generator The DSP56300 core features a Phase Locked Loop (PLL) clock generator in its central processing module. The PLL allows the processor to operate at a high internal clock frequency derived from a low-frequency clock inp... Date Added: 2009-06-13 07:24:06 |
| midtermpractice.pdf Path: UCSB >> MATH >> 104 Fall, 2009 Description: Math 104B Practice Midterm 1. Consider the initial value problem: y + y = t2 , 0t1 (1) with y(0) = -1, y (0) = 1, y (0) = 1. (a) Transform this problem into an initial value problem for a first order system of ODEs. (b) Take the time step size h = 0... Date Added: 2009-06-13 07:24:52 |
| email023Feb21st2006.txt Path: UNI >> CNS >> 023 Fall, 2009 Description: From jacobson@math-cs.cns.uni.edu Tue Feb 21 21:32:48 2006 Date: Tue, 21 Feb 2006 15:32:11 -0600 (CST) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-023-01@uni.edu Subject: [810-023-01] CSMA/CD, repeater, segment definitions Hi 023 stud... Date Added: 2009-06-13 07:29:05 |
| osi7layers.ppt Path: UNI >> CNS >> 023 Fall, 2009 Description: Why Networking Standards Are Needed s Chapter 2 s s s To help ensure that manufacturers build equipment that can intercommunicate To protect customer from wasted time and expense dealing with incompatibility To advance networking technologies in... Date Added: 2009-06-13 07:30:19 |
| metrodomestory.pdf Path: Minnesota >> BORNX >> 040 Fall, 2009 Description: A quiet goodbye to the Dome | mndaily.com - Serving the Unive. http:/www.mndaily.com/2008/11/20/quiet-goodbye-dome Advertising Buy Textbooks Classifieds Promotions Login Register Front Page PDF Follow the Daily: STADIUM A quiet goodbye to the D... Date Added: 2009-06-13 07:30:38 |
| Coordinates.pdf Path: Caltech >> EC >> 123 Spring, 2008 Description: CALIFORNIA INSTITUTE OF TECHNOLOGY Division of the Humanities and Social Sciences Continuity of the coordinate map KC Border October 15, 2002 revised May 2006 This handout proves the following theorem, which everyone seems to take for granted. 1 Th... Date Added: 2009-06-13 07:30:45 |
| Lab8.pdf Path: Purdue >> CS >> 250 Fall, 2008 Description: Lab 8 CS 250 Spring 2009 Instruction Pipelining In this you are given a MIPS program. Execute the MIPS instruction in the DLXView simulator from /opt/dlxview-0.9/bin/dlxview. You will find certain stages in the pipeline where the CPU is stalled ,... Date Added: 2009-06-13 07:41:07 |
| sec6a.pdf Path: Allan Hancock College >> STAT >> 378 Fall, 2009 Description: 6. Regression Computation I: Simple linear regression (continued) (8) Computation of 2 For simple linear model yi = 0 + 1xi + i, i = 1, , n we have assumed i iid N(0, 2), where 2 is var(i) (also the variance of yi). Often what we have is the data on ... Date Added: 2009-06-13 07:46:29 |
| lab8.pdf Path: UWO >> CS >> 262 Fall, 2009 Description: CS 262 Lab Exercise 8 In this lab, you will be implementing a GUI for a simple game, which you will complete in next week\'s lab. Prepare for the lab session Review chapter 12 and your notes on GUI programming. Download the folder called Lab8.zip f... Date Added: 2009-06-13 07:58:08 |
| YNR053C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YNR >> 053 Fall, 2009 Description: YNR053C.t2k DSSP-EHL2 2 1 CC C E E E X X X X 1 10 20 30 40 T 2 1 C C C C C C C H C H H H X X X X T T T E H T H 51 60 70 80 90 T 2 1 H HHCCCCCCH H C C X X X H 2 1 H X T E S CCCHHH H C X X T S 2 1 C X H T E T E T E E ... Date Added: 2009-06-13 08:06:01 |
| YBR014C.t2k.str2-logo.pdf Path: UCSC >> YBR >> 014 Fall, 2009 Description: YBR014C.t2k STR2 4 3 2 1 1 10 20 30 40 T 4 3 2 1 A E A Z E Z A Y Z T Y Z Y Z H H CCCCC C CS HHCTSTTSCTCCSSCTTCCCSC T C C G T T S S T T H S H S T S T S S C S T H S H H T H H C H H H T H H H H S T H S G X X X X X X X X X X X X X X X X C... Date Added: 2009-06-13 08:24:16 |
| YBR044C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YBR >> 044 Fall, 2009 Description: YBR044C.t2k EBGHTL 3 2 1 C X E EE CC T TCCCCCC H E E T H X X X X X X XXXXTXTXX T H H H T T TT 10 X X T E E E X X X X X X X E H H T C C HXXXXHCT G H X G E HHHH H T X C H X 1 20 30 40 H 3 2 1 T E T E H H CCTT E T C T CCEC E X... Date Added: 2009-06-13 08:24:45 |
| YBR058C.t2k.str2-logo.pdf Path: UCSC >> YBR >> 058 Fall, 2009 Description: YBR058C.t2k STR2 5 4 3 2 1 CC XX Z Y S S B Z C Q Z H Z X XH X Q S CCC X HH X T G T T T G T X X X X X HHHHHHHHHHHHH C XXTTXXTTTTHXXXX X X X X X X X C C H H Z Z C S T T CSCSC XXXSCS X C H CTT 30 T T H X X X HAZZA XXXXXXXXX H A Z ZAHH H Y... Date Added: 2009-06-13 08:25:06 |
| YGL059W.t2k.alpha-logo.pdf Path: UCSC >> YGL >> 059 Fall, 2009 Description: YGL059W.t2k ALPHA 2 1 XXH X E E H H X X HHHH X X X I H X X H H H X X X X X X X XX B H H H H H XXXCX X S B E B E A B E H X E H XX H X X H E H H HSHIIIIII B H H I I H I H S I H X X X X X X X X X X X X X X X X X H H H HHHH HH B ... Date Added: 2009-06-13 08:26:45 |
| The Mac Farlane Plot80.pdf Path: Paul Smith's College >> SHARE >> 111506 Fall, 2009 Description: ... Date Added: 2009-06-13 08:33:06 |
| resume.doc Path: St. Cloud >> IAJO >> 0301 Fall, 2009 Description: JoAuna Iacovino PERMANENT ADDRESS 5950 SE 158th Street Blooming Prairie, MN 55917 (507) 438-1039 (cell) UNIVERSITY ADDRESS 909 Fifth Ave So. Apt # 302 St. Cloud, MN 56301 iajo0301@stcloudstate.edu Objective To gain an internship experience in the ma... Date Added: 2009-06-13 08:41:01 |
| Lecture 3.pdf Path: Acton School of Business >> BIOE >> 322 Fall, 2009 Description: Lecture 3 Cellular Metabolism & Kinetics Please join the UT BME Department for the worldwide movie premiere of the BME377 Internship Documentary Come celebrate the achievements of our spectacular BME undergraduates - the stars of this years summer i... Date Added: 2009-06-13 09:01:22 |
| la04-v Path: Cornell >> TAM >> 455 Fall, 2009 Description: ... Date Added: 2009-06-13 15:11:15 |
| CS 117 Lec 1A (cont) ad hoc Path: UCLA >> CS >> M117 Spring, 2009 Description: Ad Hoc Networks Lecture 1B CS 117 Spring 2009 Mario Gerla Computer Science Dept UCLA Infrastructure vs Ad Hoc Infrastructure Network (cellular or Hot spot) Ad Hoc, Multihop wireless Network General Ad Hoc Network Characteristics Instantly ... Date Added: 2009-06-14 04:01:19 |
| Lecture_3-Position_Vector___Force_Vector.ppt Path: Michigan State University >> CE >> 221 Spring, 2009 Description: Force Vectors Lecture 3Position Vector and Force Vector Directed Along a Line (Sections 2.7 and 2.8) Learning Objectives Be able to represent a position vector in Cartesian coordinate form, from given geometry. Be able to represent a force vect... Date Added: 2009-06-14 20:41:55 |
| DMMsound.ppt Path: Montana >> CS >> 304 Fall, 2009 Description: Sound DigitalMultimedia,2ndedition NigelChapman&JennyChapman Chapter9 Thispresentation2004,MacAvonMediaProductions 9 275276 TheNatureofSound Conversionofenergyintovibrationsintheair(or someotherelasticmedium) Mostsoundsourcesvibrateincomplexw... Date Added: 2009-06-14 22:42:56 |
| solidstate.pdf Path: UT Arlington >> BMC >> 0720 Fall, 2009 Description: Chapter 4 Solid-State Gas Sensors Chapter 4 Solid-State Gas Sensors hen scientists were doing research work related to semiconductor p-n junctions,1 they discovered that these junctions were sensitive to environmental background gases. At that ti... Date Added: 2009-06-14 22:54:44 |
| 10.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: 241_Project 3_Charmaine Mejos principle(s): rhythm principle(s): unity principle(s): symmetry principle(s): proximity principle(s): illusion (scale) principle(s): asymmetry ... Date Added: 2009-06-14 22:55:16 |
| YOR166C.t2k.w0.5-logo.pdf Path: UCSC >> YOR >> 166 Fall, 2009 Description: YOR166C.t2k w0.5 5 4 3 2 1 L 1 10 20 30 40 T 5 4 3 2 1 E T S E H E T E T S E H 51 60 70 80 90 E 5 4 3 2 1 D T T E T S E E G H S IVDHP IE I C H Y L D L VR V I XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXLXXXXXFMXXXXXXXXXX X X E R K Q... Date Added: 2009-06-14 23:05:18 |
| MRpp.pdf Path: Laurentian >> CLASSES >> 200401 Fall, 2009 Description: The Meaning of Remembrance Museum of the Regiments Remembrance Program Introduction What is Remembrance Day? Happens 11 November every year. This special day helps us to remember soldiers, sailors and air force from World War One, World War Two, ... Date Added: 2009-06-14 23:11:45 |
| binaryTraversals.txt Path: UNI >> FACULTY >> 080 Fall, 2009 Description: Date: Thu, 13 Dec 2001 22:52:45 -0600 (CST) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-080-01@uni.edu, 810-080-02@uni.edu Subject: Re: Binary tree questions (fwd) Some further help on determining and drawing the binary tre... Date Added: 2009-06-14 23:17:53 |
| finalOutlineReview2004.txt Path: UNI >> FACULTY >> 080 Fall, 2009 Description: The final exam will be comprehensive. The questions you that can be certain will be on the exam are: 1. do the proof and list the reasons and step numbers for each step of the proof. mt modus tollens, mp modus ponens, ... Date Added: 2009-06-14 23:18:03 |
| 12756.pdf Path: East Los Angeles College >> LSA >> 12756 Fall, 2009 Description: PROGRAMME DETAIL SPECIFICATION Programme Summary 1 Awarding institution 2 Teaching institution university 3a Programme accredited by: 3b Description of accreditation 4 Final award Liverpool John Moores University LIVERPOOL JOHN MOORES UNIVERSITY N... Date Added: 2009-06-14 23:23:12 |
| ggg.ps Path: Harvey Mudd College >> E >> 180 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.86 p1.5d Copyright 1996-2001 ASCII Corp.(www-ptex@ascii.co.jp) %based on dvipsk 5.86 Copyright 1999 Radical Eye Software (www.radicaleye.com) %Title: ggg.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %En... Date Added: 2009-06-14 23:30:48 |
| Lecture33.pdf Path: S.F. State >> PHYS >> 230 Fall, 2009 Description: Phys 23o-cz ?mrnst^man :r 33 Sttd,onf trtro.uq5 GnSidor- a rncia.\\ shac-{ p6v\'* rsi}4, vc-\\oci\\ C bq}wqa,v1 4!ges.<zwct\' {re po\\u of a rtaqvrot. E \\ediyo\\ in me-}a\"\\\' a,.-.-.a ,15 - A r n p z r e \' s\\ 4 \' r e= Crsate\\ aLn crvs,tel ,t Chavl4r ,.4 ... Date Added: 2009-06-14 23:32:31 |
| Algebra_QBE.ppt Path: Oregon State >> CS >> 540 Fall, 2008 Description: Homework #4 It\'s OK to drop problems 5h and 6d. . or you can fake it. Algebra_QBE Relational algebra . Usual operations: Projection Selection Product ( ) onto columns ( ) of row criteria ( x ) of tables Join ( ) of tables, criteria Set ... Date Added: 2009-06-14 23:33:08 |
| ER_L05.ppt Path: Oregon State >> CS >> 540 Fall, 2008 Description: Entity-Relationship Modeling An E-R model is a data model that includes Entity classes Attributes of each class Relationship types between classes Constraints Types of attributes Designation of key attributes Cardinalities of relationship typ... Date Added: 2009-06-14 23:33:09 |
| radvt.txt_dtot_haar_mod.txt Path: Berkeley >> ASTRO >> 00156467 Fall, 2009 Description: tmin 5.7925562e-05 tmin 0.00032201293 ... Date Added: 2009-06-14 23:34:59 |
| F04_hw3.pdf Path: UCSD >> ECE >> 103 Fall, 2008 Description: ECE103 Summer 2004 Homework #3 Due Thursday, October 14, 2004 1. Problem #5, chapter 3, page 81. Here you should use Figure 3 and trial and error to find ND and n. 2. Problem #6. 3. Problem #9. 4. Consider a homogeneous gallium arsenide semiconducto... Date Added: 2009-06-14 23:35:33 |
| t12.doc Path: NJIT >> SA >> 239 Fall, 2009 Description: Time Sheet Srujana Adusumilli Date 25th Oct ,2008 28th Oct,2008 Time Sheet Time 11.00 A.M 7.00 P.M 7.30 29th Oct,2008 30th Oct ,2008 2nd Nov,2008 10.30 A.M 12.00 6.00 P.M 10:00 P.M Total Time For 7.6 Program Task Read Chapter 7 in text book Read and ... Date Added: 2009-06-14 23:36:53 |
| CS414 Section 2.pdf Path: Cornell >> CS >> 414 Spring, 2008 Description: CS414 Section 2 Project 2: Preemption, . Krzysztof Ostrowski krzys@cs.cornell.edu Slides modified from previous years\' slides What do you have to do? Required Adding preemption to your scheduler You will heavily rely on clock interrupts in this proj... Date Added: 2009-06-14 23:38:50 |
| MPP_LCO_F07a_T05_V1.1.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 % Complete Task Name 20% 62% 99% 100% 100% 100% 75% 100% 100% 100% 100% 54% 100% 100% 100% 100% 100% 50% 100% 100% 100% 100% 100% 100% 93% 100% 100% 100% 50% 4... Date Added: 2009-06-14 23:39:38 |
| Week06_MPP_F07a_T05.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 % Complete Task Name 20% 62% 99% 100% 100% 100% 75% 100% 100% 100% 100% 54% 100% 100% 100% 100% 100% 50% 100% 100% 100% 100% 100% 100% 93% 100% 100% 100% 50% 4... Date Added: 2009-06-14 23:39:43 |
| syllabus06.pdf Path: Dickinson State >> PLSC >> 211 Fall, 2009 Description: PLSC 211-HORTICULTURE SCIENCE LAB (1 Credit) Fall Semester, 2006 Department of Plant Sciences I. GENERAL INFORMATION 1. Instructors: Dr. Chiwon William Lee, Professor Office: Room 266-F, Loftsgard Hall Phone: 701-231-8062, fax 701-231-8474 E-mail: < ... Date Added: 2009-06-14 23:39:48 |
| 120hw1.4.pdf Path: Arizona >> MATH >> 120 Fall, 2008 Description: ... Date Added: 2009-06-14 23:40:33 |
| labor.pdf Path: U. Houston >> DT >> 1305 Fall, 2009 Description: Labor Choices in the Chesapeake and Lower South Middle Passage Size of Atlantic Slave Trade Creole Staple Crops Transition from servants to slaves Bacon\'s Rebellion Stono Rebellion ... Date Added: 2009-06-14 23:40:56 |
| lab8.pdf Path: Texas A&M >> ELEN >> 468 Fall, 2009 Description: ELEN 468: Advanced Logic Design Lab 8: MIPS Microprocessor (3-week lab; 50 points) Lab Overview In this project, you will implement the MIPS pipeline microprocessor and write a testbench file for verification. Lab Description 1. MIPS pipeline micro... Date Added: 2009-06-14 23:41:21 |
| Minelli_TeamX.pdf Path: Santa Clara >> MECH >> 372 Fall, 2009 Description: MECH/ENGR 372 Concurrent Design and Team-X Case Study Giovanni Minelli Research Assistant, Robotic Systems Laboratory, Santa Clara University E-mail: gminelli@scu.edu, Web: http:/rsl.engr.scu.edu Outline Concurrent Design Description Parametric ... Date Added: 2009-06-14 23:41:23 |
| Euromerica.doc Path: Johns Hopkins >> AMS >> 361 Fall, 2009 Description: Euromerica Liquors Setup the problem as we did for the St. Joseph\'s Model: Then enter the objective function and constraint information in the Solver dialogue box as before don\'t forget nonnegativity: When we click Solve, we get the following aler... Date Added: 2009-06-14 23:47:00 |
| rute.pdf Path: Carnegie Mellon >> CLASS >> 95799 Fall, 2009 Description: LINUX: Rute User\'s Tutorial and Exposition Paul Sheer August 14, 2001 Pages up to and including this page are not included by Prentice Hall. 2 \"The reason we don\'t sell billions and billions of Guides,\" continued Harl, after wiping his mouth, \"is ... Date Added: 2009-06-14 23:47:44 |
| vectors.pdf Path: Grinnell >> CSC >> 151 Fall, 2009 Description: Fundamentals of CS I (CS151 2001S) Vectors Introduction Indexing Mutating Displaying Vectors DrScheme\'s Display Variations Vector Procedures vector make-vector vector? vector-length vector-ref vector-set! vector->list and list->vector vector-fill! I... Date Added: 2009-06-14 23:55:27 |
| 09VirtualMachines.pdf Path: Sanford-Brown Institute >> CS >> 169 Fall, 2009 Description: Virtual Machines CS 167 IX1 Copyright 2006 Thomas W. Doeppner. All rights reserved. IX1 Its 1964 IBM wants a multiuser time-sharing system TSS project large, monolithic system lots of people working on it for years total, complete flop ... Date Added: 2009-06-15 00:03:56 |
| input.txt Path: Uni. Westminster >> CS >> 465 Fall, 2009 Description: Smith, John 78 Brown, Mary 86 Johnson, Alice 93 Khann, Omar 89 Davidson, Allan 59 White, Rod 71 Williams, Evelyn 77 Christmas, Don 75 Sharif, Ali 85 Green, Andy 46 Brown, Don 52 Fredericks, Bob 6... Date Added: 2009-06-15 00:04:08 |
| fa99-prereq-soln.ps Path: Berkeley >> CS >> 252 Fall, 2008 Description: %!PS-Adobe-3.0 %Title: Microsoft Word - prereq-soln.doc %Creator: Windows NT 4.0 %CreationDate: 19:43 9/12/1999 %Pages: (atend) %BoundingBox: 13 13 599 780 %LanguageLevel: 2 %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend) %EndComments %... Date Added: 2009-06-15 00:07:53 |
| Luo et al. 1998.pdf Path: Colorado >> MCDB >> 4426 Fall, 2008 Description: Cell, Vol. 94, 481490, August 21, 1998, Copyright 1998 by Cell Press Bid, a Bcl2 Interacting Protein, Mediates Cytochrome c Release from Mitochondria in Response to Activation of Cell Surface Death Receptors Xu Luo, Imawati Budihardjo, Hua Zou, Cliv... Date Added: 2009-06-15 00:46:31 |
| sp09_outline06.pdf Path: Minnesota >> BIOSCI >> 4004 Fall, 2009 Description: C. Silflow Biol 4004 section1 Lecture 6; Feb. 2, 2009 Chromosome Structure/Function Centromeres DNA sequences that direct segregation of chromatids to daughter cells at division Kinetochore proteins associate with centromeric DNA (Fig. 17-36) Sister... Date Added: 2009-06-15 01:01:52 |
| 4l24.pdf Path: Duke >> X >> 100 Fall, 2009 Description: On the Limits of Computing On the Limits of Computing Reasons for Failure 1. Intractable Algorithms 2. 3. Runs too long o Real time requirements o Predicting yesterday\'s weather Non-computable ! Don\'t know the algorithm Time Space Computer... Date Added: 2009-06-15 01:12:15 |
| C-mini-day2.ppt Path: Sanford-Brown Institute >> CS >> 169 Fall, 2009 Description: C Minicourse Day 2 Memory Management Functions Outline more on pointers malloc/free dynamic arrays functions main arguments pass by: value / pointer function pointers 2 C Minicourse (cs123 & cs167) May 14, 2009 Pointers and Arrays int main()... Date Added: 2009-06-15 01:27:08 |
| tcas-experience.pdf Path: Hudson VCC >> CS >> 208 Fall, 2009 Description: EXPERIENCES FROM SPECIFYING THE TCAS II REQUIREMENTS USING RSML Mats P.E. Heimdahl, University of Minnesota, Minneapolis, MN Nancy G. Leveson, Massachusetts Institute of Technology, Cambridge, MA Jon Damon Reese, Safeware Engineering Corporation, Sea... Date Added: 2009-06-15 01:30:51 |
| Schedule2005.pdf Path: Washington University in St. Louis >> CLASSWORK >> 352 Fall, 2009 Description: 2005 Tentative Schedule: Updates Provided in Class Week of: Aug. 31 Sept. 5 Sept. 12 Sept. 19 Sept. 26 Oct. 3 Oct. 10 Oct. 17 Oct. 24 Oct. 31 Nov. 7 Nov. 14 Nov. 21 Nov. 28 Mineralogic Topics Define mineral, earth\'s chemistry, element partitioning [S... Date Added: 2009-06-15 01:38:07 |
| scan0031 Path: UT Arlington >> MAE >> 4344 Fall, 2007 Description: ... Date Added: 2009-06-15 02:00:53 |
| FlashWorms-Staniford.pdf Path: Georgia Tech >> ECE >> 6110 Fall, 2008 Description: The Top Speed of Flash Worms Stuart Staniford Nevis Networks David Moore CAIDA Vern Paxson ICSI Nicholas Weaver ICSI ABSTRACT Flash worms follow a precomputed spread tree using prior knowledge of all systems vulnerable to the worms exploit. In pr... Date Added: 2009-06-15 02:23:40 |
| Lecture_12_GSM.ppt Path: Harding >> CENG >> 385 Fall, 2009 Description: GSM GlobalSystemforMobile Communications ENGR475Telecommunications October31Halloween! HardingUniversity JonathanWhite Outline Europeanhistory OperatingFrequencies/General Characteristics Whydigital ISDNinterface EuropeanHistory Inthemid198... Date Added: 2009-06-15 02:27:02 |
| radvt.txt_dtot_haar_mod.txt Path: Berkeley >> ASTRO >> 00176620 Fall, 2009 Description: tmin 5.7925562e-05 tmin 0.00032201293 ... Date Added: 2009-06-15 02:27:23 |
| CH123_Exam3_Su02A.pdf Path: Alabama Huntsville >> PEXAM >> 123 Fall, 2009 Description: CH 123 General Chemistry Exam 3 July 29, 2002 KEY Name:_ (please print) SSN: * * * - * * -_ (last 4 digits) Each question is worth 1 point. Circle your answer clearly, otherwise no credit will be given. Circle only one answer. If you circle two or... Date Added: 2009-06-15 02:28:35 |
| 1.31.2007.pdf Path: Duke >> CPS >> 082 Fall, 2009 Description: 1/31/2007 Why is copyright more protected now than ever? code Playing a DVD on linux What are the rights you get with copyright? Right to reproduce the work Right to prepare derivative works Right to distribute copies Right to perform the work p... Date Added: 2009-06-15 03:30:26 |
| Sol8.doc Path: SMU - Cox School of Business >> ENGR >> 2360 Fall, 2009 Description: SOLUTIONS TO SELECTED PROBLEMS Student: You should work the problem completely before referring to the solution. CHAPTER 8 Solutions included for problems 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, and 43 8.1 (a) The rate of return on the ... Date Added: 2009-06-15 03:30:47 |
| hi440 Quiz 1 info Path: N.C. State >> HI >> 440 Spring, 2009 Description: 1. Old World and New, Rejoined Outline 1) Old Worlds a) Pangaea b) Eurasia/Africa c) The Americas 2) Rejoining Pangaea a) Contact b) Commonalities c) Differences Key words/concepts: Exchange Continental Drift Tectonics Columbian Exchange Neo-Europe \"... Date Added: 2009-06-16 11:49:18 |
| viewports.pdf Path: Hudson VCC >> CS >> 274 Fall, 2009 Description: Screen Coordinates r o w s (i, j) cols (0, 0) The OpenGL command glViewport(i, j, rows, cols); denes a viewport. World Coordinate y h (x, y) w x The OpenGLU command gluOrtho2D(x, y, x + w, y + h); denes the window, and the window-to-viewpor... Date Added: 2009-06-16 13:36:18 |
| 19441216_0000031690.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: . .: ,\'.* . 1 6 December 1944 . . . / I \' . . . . . ., % . . a I w i l l be at the American Consulate I n Geneva between 4:30 and about 5 o\'ulook. Telephone number , is 27025. 1f\'pos3iblei\'\\ me word .there 8 8 t o the give, result. However, ... Date Added: 2009-06-16 13:37:05 |
| hw3.09.pdf Path: Arizona >> A >> 300 Fall, 2008 Description: ASTRONOMY 300B Homework No. 3 Due: in class, Wednesday, February 4, 2009 1. Flux density unit conversions. In class, we discussed a quantity called the \"flux\" of a radiation field, F , which has cgs units of ergs cm-2 s-1 Hz-1 . Sometimes F is referr... Date Added: 2009-06-16 13:37:25 |
| PS119.lec_03.09.29.2006.pdf Path: Concordia Chicago >> WEB >> 119 Fall, 2009 Description: Phy Sci 119a Lecture 3 Orbits, Newton\'s Laws 09.29.06 Opening music; Franz Haydn (1732-1809): Symphony No. 94, the \"Surprise\". Date of first performance, 1791. The performance date is near the time of the Cavendish Experiment that established the val... Date Added: 2009-06-16 13:38:07 |
| 19631119_0000481280.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: * . . . . . . . . . . . . -. . . . . . . . . :.\' , \' \' . . 3620 Proapoct SL, NW W.-hing.Eon 7, D c . . . . . . I . . , . : . 0 . . . . . . \' , . ._\'. \'. . . . . . \' . , . e . \' . . . . . . . . . . . . . .,. . . .: . . . . . . I 19... Date Added: 2009-06-16 13:38:11 |
| 19440605_0000035553.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: \' . . . . ._ . \'. . * I , . \' . . . . . . . . . . . . * . .< ,; t. T e h e r a n Xo. , Dated: June .5, 1944, . . .,.:.:,. . , . . . ,. . . . . . .;. . . . . .; t. I :;\' ~ .: D t ETAT . .: .* . . , \' . , : . .*; \'i .) - . . . . .:. ... Date Added: 2009-06-16 13:38:14 |
| submit.txt Path: Washington >> V >> 23000 Fall, 2009 Description: executable = allgamma_23227.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs23000-23499/... Date Added: 2009-06-16 13:39:11 |
| ABCCo.xls Path: Toledo >> MGT >> 220 Fall, 2009 Description: ERROR CORRECTION Amortization Schedule Computer Systems Cost = $500,000 Purchased January 1, 1997 Estimated life = 10 years Estimated salvage value = $10,000 Method = SLN Year Amort. Exp Accum. Amort. 1997 1998 1999 2000 2001 2002 2003 2004 2005 200... Date Added: 2009-06-16 13:39:49 |
| Phy1110Exam2.pdf Path: Colorado >> PHYS >> 1110 Fall, 2008 Description: Chap. 4. Forces, static equilibrium 1. A pack of mass m is hung on a rope between two trees. The ropes make an angle = 60 with the horizontal on each side. What is the tension in the rope? A) mg sin 60 C) mg / (2 cos 60) E) (m g sin 60)/2 2. The acc... Date Added: 2009-06-16 13:40:07 |
| project.doc Path: Michigan >> PERSONAL >> 510 Fall, 2009 Description: Biostatistics 510 Final Project Fall, 2002Due Tuesday, Dec. 10th 4:30 p.m. Instructions: For the final project, you are asked to use both of the major computer packages we have studied to answer questions about data taken from the Tecumseh Project (s... Date Added: 2009-06-16 13:42:19 |
| submit.txt Path: Washington >> V >> 26360 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>26092b958695477e03b565e0cf10cdd7eb58917e.txt</Key><RequestId>530C7F13E194A5FC</RequestId><HostId>rACewDkhL0sYbDUOfZY2otcXha/s... Date Added: 2009-06-16 13:42:35 |
| 2007 Boating and birds Ballin.pdf Path: Virgin Islands >> GEOG >> 453 Fall, 2009 Description: Birds, Boats and Planes: traffic patterns around the Tofino Mudflats WMA and water bird response. By Leah Ballin December 9th, 2007 A paper submitted in partial fulfillment of Geography 453:Coastal Resource Management to Dr. Rosaline Canessa at the... Date Added: 2009-06-16 13:44:02 |
| Jenkins.pptx Path: SIU Edwardsville >> CS >> 490 Fall, 2008 Description: Computer Science 490.002 John Jenkins Topical Paper The Emissary Design Pattern Presentation #07 Click to edit Master subtitle style The Emissary Design Pattern by Ramiro Gonzlez Maciel LIFIA La Plata National University, Argentina 6/6/09 Pa tte r... Date Added: 2009-06-16 13:44:24 |
| VA.pdf Path: BYU >> CE >> 414 Fall, 2008 Description: VIABLE PARCELS FOR WALMART SUPERSTORE AREA OWNER ADDRESS 226239.399441 14796.842536 224249.447988 STEWART, RALPH P ET AL TEE 214842.314715 0.063903 217752.858144 PASKETT, UNKNOWN RONALD J LEHI DIST ... Date Added: 2009-06-16 13:44:26 |
| Midterm 2b.pdf Path: Maryland >> ECON >> 454 Fall, 2008 Description: ECON 454, Fall 2007 Department of Economics, University of Maryland Jessica Hennessey Midterm Exam #2 (20) Question 1 (6) (a) Suppose that the Unemployment Insurance program was changed so that there was no longer a cap on receiving benets at 26 wee... Date Added: 2009-06-16 13:46:53 |
| tj.500m.2009050500.txt Path: U. Houston >> SERVER >> 2009050500 Fall, 2009 Description: 2 REAL 9 5 5 0 24 REAL 9 5 5 0 24 12FORWARD OMEGA 9 5 5 0 29.696 -95.499 500.0 9 5 5 0 29.670 -95.129 500.0 9 5 5 0 30.039 -94.075 5... Date Added: 2009-06-16 13:47:04 |
| lec11.ps Path: Washington >> LEC >> 482 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.94a Copyright 2003 Radical Eye Software %Title: E:/qsci482/lectures/lec11/lec11.dvi %CreationDate: Tue Jul 19 21:59:34 2005 %Pages: 21 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: LCMSS8 LCMSSB8 CMS... Date Added: 2009-06-16 13:47:20 |
| London and Literary Business.doc Path: Uni. Westminster >> ADP >> 0717 Fall, 2009 Description: London and Literary Business May Term, 2005 Business or English 300 (4 credits) In this May Term course and trip, we will spend one week on Westminsters campus learning about the intersections between literature and business. Well look at how busines... Date Added: 2009-06-16 13:48:17 |
| 350-231.pdf Path: Virginia Tech >> PUBS >> 350 Fall, 2009 Description: publication 350-231 Long-distance Care-Giving: Five Steps to Providing Effective Care Nancy Brossoie, Center for Gerontology, Virginia Tech For years, Jan kept in contact with her parents by a weekly telephone call, and managed to make the 12-hour ... Date Added: 2009-06-16 13:48:37 |
| tj.10m.2006091606.txt Path: U. Houston >> SERVER >> 2006091606 Fall, 2009 Description: 2 REAL 6 9 15 18 0 REAL 6 9 15 18 0 12BACKWARDOMEGA 6 9 16 6 29.696 -95.499 10.0 6 9 16 6 29.670 -95.129 10.0 6 9 16 6 30.039 -94.075 ... Date Added: 2009-06-16 13:48:47 |
| PDF_acknowledgments.pdf Path: Virginia Tech >> PUBS >> 424 Fall, 2009 Description: Acknowledgements Sincere thanks are given to the many cooperators and contributors who have made the Soybean Variety Evaluation Tests possible. The cooperation and support offered by commercial seed companies, state crop improvement associations, and... Date Added: 2009-06-16 13:49:30 |
| Orem A6 Best 4 PDF.pdf Path: Oregon >> J >> 408 Fall, 2008 Description: ... Date Added: 2009-06-16 13:50:07 |
| tj.1500m.2006081006.txt Path: U. Houston >> SERVER >> 2006081006 Fall, 2009 Description: 2 REAL 6 8 9 18 0 REAL 6 8 9 18 0 12BACKWARDOMEGA 6 8 10 6 29.696 -95.499 1500.0 6 8 10 6 29.670 -95.129 1500.0 6 8 10 6 30.039 -94.075 15... Date Added: 2009-06-16 13:50:47 |
| RevisionExercises.ppt Path: Benjamin Franklin Institute of Technology >> CSE >> 1001 Fall, 2009 Description: Exercise 1: Arrays What is the output of the following program? char [] a = new char[3] ; char [] b ; int i ; for (i=0; i<a.length; i+) a[i] = x ; b = a ; System.out.println(a[1] = System.out.println(a[2] = b[2] = y ; System.out.println(a[1] = System... Date Added: 2009-06-16 13:51:02 |
| YBR059C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YBR >> 059 Fall, 2009 Description: YBR059C.t2k CB_BURIAL_14_7 3 2 1 C AAAABBB BBBB C CCC X X X E A B CD D A A AC C B A BBBCB BCDCBCCCCCCBDDDDDCADCADC AC B B B D E C C C C C C C CAEABCCDEDCXXXEDFD F C D D D D D C D A D D D D D D D D D D A D A D D D D D D D D D D D D D X X X X X X X X... Date Added: 2009-06-16 13:51:11 |
| Problem1.ps Path: Wilfrid Laurier >> CPSC >> 501 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Pages: (atend) %PageOrder: (atend) %DocumentFonts: (atend) %Creator: Frame 5.1 %DocumentData: Clean7Bit %EndComments %BeginProlog %- Frame ps_prolog 5.0, for use with Frame 5.0 products %- This ps_prolog file is ... Date Added: 2009-06-16 13:52:29 |
| tj.pt04.2009051812.txt Path: U. Houston >> SERVER >> 2009051812 Fall, 2009 Description: 2 REAL 9 5 18 0 0 REAL 9 5 18 0 0 4BACKWARDOMEGA 9 5 18 12 27.765 -97.434 10.0 9 5 18 12 27.765 -97.434 500.0 9 5 18 12 27.765 -97.434 10... Date Added: 2009-06-16 13:53:07 |
| log.txt Path: Washington >> V >> 22000 Fall, 2009 Description: 000 (34385.000.000) 12/24 09:31:44 Job submitted from host: <128.95.94.28:1084> . 001 (34385.000.000) 12/24 18:05:11 Job executing on host: <172.25.101.185:1056> . 006 (34385.000.000) 12/24 18:25:20 Image size of job updated: 436548 . 005 (34385.000.... Date Added: 2009-06-16 13:53:33 |
| submit.txt Path: Washington >> V >> 22000 Fall, 2009 Description: executable = allgamma_22307.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs22000-22499/... Date Added: 2009-06-16 13:54:50 |
| YBR261C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YBR >> 261 Fall, 2009 Description: YBR261C.t2k EBGHTL 3 2 1 CC 1 CT TTTCCH H X X X H T C T T H H H T T X X X X X X 10 20 30 40 H 3 2 1 E T T H HHHHHHH X X X X X HC HCHCGGE C T G C T C C C H H TXXXXTEXXCT C H G X X X X X X X X TC T TTTTC C CCE X X 51 60 70 80 90 ... Date Added: 2009-06-16 13:54:54 |
| YIL142C-A.t2k.w0.5-logo.pdf Path: UCSC >> YIL >> 142 Fall, 2009 Description: YIL142C-A.t2k w0.5 2 1 M L L Y V I I V 1 10 20 30 40 H 2 1 P M L V I T T E H T T E W F XX 51 60 70 80 90 H 2 1 PLFYC L L Y I I V V T H XXXXXX 101 H E A F V L L LVF Y I I L V V I S A X XXX 110 PL FYC SALVF 100 XXXXXXXXX... Date Added: 2009-06-16 13:55:23 |
| log.txt Path: Washington >> V >> 22000 Fall, 2009 Description: 000 (34036.000.000) 12/24 09:29:46 Job submitted from host: <128.95.94.28:1084> . 001 (34036.000.000) 12/24 14:32:13 Job executing on host: <172.25.101.165:1059> . 006 (34036.000.000) 12/24 14:52:20 Image size of job updated: 401648 . 006 (34036.000.... Date Added: 2009-06-16 13:56:25 |
| squiz0926.pdf Path: Utah >> MATH >> 2270 Summer, 2008 Description: ... Date Added: 2009-06-16 13:56:30 |
| diagintro.doc Path: Cal Poly Pomona >> PHL >> 202 Fall, 2009 Description: A Familiar Argument S1: There was no oil on the driveway when I parked the car on it last night. S2: There was oil on the driveway the next morning right where I park my car. S3: I did not move the car once I parked it last night. -C1: The car has an... Date Added: 2009-06-16 13:58:47 |
| tj.500m.2006092918.txt Path: U. Houston >> SERVER >> 2006092918 Fall, 2009 Description: 2 REAL 6 9 29 6 0 REAL 6 9 29 6 0 12BACKWARDOMEGA 6 9 29 18 29.696 -95.499 500.0 6 9 29 18 29.670 -95.129 500.0 6 9 29 18 30.039 -94.075 5... Date Added: 2009-06-16 14:00:56 |
| watervalve.ppt Path: UNC Charlotte >> ETGR >> 3233 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|24 Jan 2006 17:44:08 -0000 vti_extenderversion:SR|6.0.2.6353 vti_author:SR|MOSAIC\\gkwatkin vti_modifiedby:SR|MOSAIC\\gkwatkin vti_timecreated:TR|17 Dec 2005 16:53:38 -0000 vti_title:SR|Slide 1 vti_backli... Date Added: 2009-06-16 14:02:33 |
| Exam3-2008-Solutions.pdf Path: Tulsa >> ME >> 4024 Fall, 2009 Description: ... Date Added: 2009-06-16 14:03:45 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1012 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:05:28 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1012 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:05:31 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1012 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:05:46 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2080 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:06:22 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2080 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:06:24 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2080 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:06:39 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2100 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:07:12 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2100 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:07:14 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2100 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:07:31 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2199 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:08:09 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2199 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:08:11 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2199 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:08:30 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1082 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:09:03 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1082 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:09:05 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1082 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:09:18 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1007 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:09:52 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1007 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:09:54 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1007 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:10:12 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1000 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:10:44 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1000 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:10:46 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1000 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:11:02 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1004 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:11:38 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1004 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:11:40 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1004 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:11:58 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1075 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:12:29 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1075 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:12:31 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1075 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:12:47 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1024 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:13:22 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1024 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:13:23 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1024 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:13:39 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1044 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:14:12 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1044 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:14:14 |
| log.txt Path: Washington >> V >> 1044 Fall, 2009 Description: 000 (83866.000.000) 06/02 07:34:45 Job submitted from host: <128.95.94.28:1064> . 001 (83866.000.000) 06/02 07:36:55 Job executing on host: <172.25.101.187:1076> . 006 (83866.000.000) 06/02 07:57:03 Image size of job updated: 164768 . 006 (83866.000.... Date Added: 2009-06-16 14:14:26 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1044 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:14:33 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1061 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:15:16 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1061 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:15:18 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1061 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:15:42 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1057 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:16:23 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1057 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:16:25 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1057 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:16:42 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2189 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:17:17 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2189 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:17:20 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2189 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:17:39 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2049 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:18:12 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2049 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:18:14 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2049 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:18:30 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2035 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:19:52 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2035 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:19:54 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2035 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:20:12 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1053 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:20:45 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1053 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:20:47 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1053 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:21:02 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2031 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:21:36 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2031 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:21:38 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2031 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:21:56 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1092 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:22:28 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1092 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:22:30 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1092 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:22:46 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2088 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:23:21 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2088 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:23:23 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2088 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:23:38 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1068 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:24:11 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1068 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:24:12 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1068 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:24:28 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2076 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:25:02 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2076 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:25:04 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2076 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:25:19 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1043 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:25:52 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1043 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:25:55 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1043 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:26:14 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2096 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:26:46 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2096 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:26:47 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2096 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:27:03 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1005 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:27:36 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1005 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:27:38 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1005 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:27:54 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1090 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:28:28 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1090 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:28:30 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1090 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:28:47 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2183 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:29:21 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2183 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:29:23 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2183 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:29:39 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1084 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:30:13 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1084 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:30:15 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1084 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:30:32 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2041 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:31:04 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2041 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:31:06 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2041 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:31:23 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 1013 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:33:50 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 1013 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:33:52 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 1013 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:34:12 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2079 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:34:46 |
| DC2_J1823p0020Log.txt Path: Washington >> V >> 2079 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1823p0020 * Name : DC2_J1823p0020 * * Position : (RA,Dec)=(275.82,0.3471) ; (l,b)=(30.02,6.42064) * * Flux above 100 MeV : 4.08e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file use... Date Added: 2009-06-16 14:34:48 |
| Ba447-Caremore_Brands.doc Path: Alaska Anch >> BA >> 447 Fall, 2009 Description: Caremore Company Evaluation On Behalf of AllStar By Glenn Roose & Robert Luttio Caremore Brands: Clean and White: Sold in Mexico and Brazil Caregate: We have no idea or data that shows where this is sold! From this lack of data, it must be assumed t... Date Added: 2009-06-16 14:34:50 |
| PSR_J1734m3827Log.txt Path: Washington >> V >> 2079 Fall, 2009 Description: * PulsarSpectrum Log for pulsarPSR_J1734m3827 * Name : PSR_J1734m3827 * * Position : (RA,Dec)=(263.7,-38.46) ; (l,b)=(350.731,-3.14655) * * Flux above 100 MeV : 1.18e-008 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file u... Date Added: 2009-06-16 14:35:05 |
| DC2_J1807m0108Log.txt Path: Washington >> V >> 2095 Fall, 2009 Description: * PulsarSpectrum Log for pulsarDC2_J1807m0108 * Name : DC2_J1807m0108 * * Position : (RA,Dec)=(271.8,-1.136) ; (l,b)=(26.8189,9.30248) * * Flux above 100 MeV : 2.65e-009 ph/cm2/s * Enphmin: 10000 keV | Enphmax: 3e+008 keV ** * FT2 file us... Date Added: 2009-06-16 14:35:36 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
