Course Solutions And Notes - Lecture Notes (Full Set) 29
| 7.R1.pdf Path: UCSD >> BIOLOGY >> 231 Fall, 2008 Description: Molecular Mechanisms of Germline Stem Cell Regulation Annu. Rev. Genet. 2005.39:173-195. Downloaded from arjournals.annualreviews.org by University of California - San Diego on 09/16/06. For personal use only. Marco D. Wong, Zhigang Jin, and Ting Xi... Date Added: 2009-02-18 00:32:39 |
| (13) Electronic Surveillance and Other Searches Path: Middlesex CC >> CRJ >> 152 Spring, 2005 Description: CJ 1123 Criminal Evidence and Procedure Chapter 13: Electronic Surveillance and Other Searches Electronic Surveillance and Other Searches 13-1 Eavesdropping and Electronic Surveillance SC key distinction in eavesdropping and electronic surveillance i... Date Added: 2008-06-25 07:02:40 |
| EME154_2008S_Homework 9.doc Path: UC Davis >> EME >> 154 Fall, 2008 Description: Department of Mechanical and Aeronautical Engineering University of California, Davis Prof. K. Yamazaki EME-154 Submission Deadline: 12:00 noon, Tuesday, Jun 3. Only submission by E-mail can be accepted. Homework 9 The homework answer should be s... Date Added: 2009-01-09 19:37:23 |
| 354 syllabus.pdf Path: Cal Poly >> CHEM >> 354 Spring, 2008 Description: Chemistry 354 Instructor: John Hagen Email: jhagen@calpoly.edu Phone 756-1651 Office: 25 119 Course page: http:/chemweb.calpoly.edu/chem/hagen/~hagen.htm you will also be able to access this page, and your grades, on the Blackboard website at the Cal... Date Added: 2009-02-02 13:47:34 |
| MAVROMMATIS Path: GWU >> PSC >> 144 Fall, 2008 Description: MAVROMMATIS o Greece vs. Britain o Greece: Delaying approval of plans Violated intl obligation by article 11 of Mandate Hostility displayed to him o Britain: No provision giving Court jurisdiction Court only has jurisdiction to deal w/ alleged b... Date Added: 2008-04-13 19:20:01 |
| WebServerArchitecture.ppt Path: BYU >> C S >> 360 Winter, 2008 Description: WebServerArchitecture WebServerArchitecture Complex Itemstoconsider ResponseTime Features Helpfultoconsiderbestdesignpractices Useconcurrency HTTP/1.1 CGI WebServerArchitecture Client http usedup2toredirect stdinandstdoutback tothewebserv... Date Added: 2009-01-10 17:02:16 |
| 9hw Path: Western Michigan >> IME >> 310 Spring, 2007 Description: IME 310: Chapter 9 solution 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 $379 31 $136.80 $1,198.78 13.35X $383.42 $338,725 $111,130 $1,160,700 $144,373 $357,526 $6,108.08 $3,430.78 1.3 X 1035 $2,094.42 $7,967 61 $1... Date Added: 2008-04-07 12:49:09 |
| Class32RS1000.ppt Path: Missouri (Mizzou) >> RS >> 1 Fall, 2008 Description: Welcome To Rural Sociology 1000 Introduction to Rural Sociology Mary Grigsby Associate Professor of Rural Sociology Division of Applied Social Sciences 1 Topics of Discussion Class Business Social Stratification Chintz and Shag game Negatively ... Date Added: 2009-02-17 22:44:32 |
| HW4_solution Path: Washington State >> ME >> 414 Fall, 2007 Description: ... Date Added: 2008-04-09 01:00:50 |
| f_s2002.pdf Path: SUNY Albany >> EPI >> 514 Fall, 2009 Description: EPI 514 - SPRING 2002- FINAL EXAM Your diskette contains THREE files: adr00_#.txt dth00_# pop00_# raw data file with discharge data from one hospital for one year SAS data set with 2000 death data for one county SAS data set with 2000 population data... Date Added: 2009-04-15 21:47:11 |
| MATH 1324.pdf Path: Collin College >> MATH >> 1324 Fall, 2008 Description: Revised Spring 2009 COLLIN COUNTY COMMUNITY COLLEGE COURSE SYLLABUS COURSE NUMBER: COURSE TITLE: CREDIT HRS: 3 PREREQUISITE: COREQUISITE: TEXTBOOK: SUPPLIES: Math 1324 Finite Mathematics LECTURE HRS: 3 Math 1332 or TSI placement None Mathematical App... Date Added: 2009-02-17 17:49:53 |
| rowop82.txt Path: Salem State >> MAT >> 108 Fall, 2009 Description: \\START82\\ \\COMMENT= \\NAME=ROWOP \\FILE=C:\\MYPROGS\\TI_NEW~1\\ROWOP.82P :Lbl A :Pause [A]\\>Frac\\ :Pause [A] :Disp \"1 TO DIVIDE\" :Disp \"2 TO *ROW+\" :Disp \"3 TO REVERT\" :Disp \"4 TO SWAP ROWS\" :Input (\"5 TO STOP \",V) :If V=5 :Then :Stop :Else :If V=3 :Then ... Date Added: 2009-04-15 23:31:24 |
| faircast.pdf Path: UCLA >> CS >> 468 Fall, 2008 Description: 1 FairCast: Fair Multi-Media Streaming in Ad Hoc Networks through Local Congestion Control Gustavo Mara , Paolo Lutterotti , Stephan J. Eidenbenz , Giovanni Pau , Mario Gerla Computer Science Department - University of California, Los Angeles, CA 9... Date Added: 2009-03-19 00:11:06 |
| lecture01.ps Path: UNC >> MATH >> 221 Fall, 2008 Description: CHAPTER 1 Overview of frequently encountered PDEs 1. PDEs in the natural sciences Ordinary and partial dierential equations (ODEs and PDEs henceforth) are frequently encountered in numerous areas of study. A knowledge of the basic scientic backgroun... Date Added: 2009-02-18 01:44:10 |
| G_Y_assoc_comments.pdf Path: George Mason >> CDAW >> 1 Fall, 2009 Description: #GMS Date 1996/10/23 1997/04/22 1997/05/15 1997/10/11 1997/11/07 1997/11/23 1998/02/18 1998/03/11 1998/05/04 1998/06/26 1998/10/19 1998/11/08 1998/11/14 Time 05:00 00:00 13:00 04:00 12:00 13:00 01:00 00:00 13:00 05:00 16:00 12:00 04:00 DST -105 -10... Date Added: 2009-04-16 01:12:08 |
| 84-323 Scribner.doc Path: UWO >> GERMAN >> 323 Fall, 2008 Description: Comparative Constitutionalism Syllabus-1 PS323: Comparative Constitutionalism University of Wisconsin, Oshkosh Fall Semester 2008 Meeting Time: T/Th 11:30-1pm Meeting Room: S. Halsey 310 Professor Druscilla Scribner Department of Political Science O... Date Added: 2009-02-02 20:44:05 |
| 040806thugs.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: washingtonpost.com: In Turkmenistan, Thugs and Tyranny washingtonpost.com In Turkmenistan, Thugs and Tyranny By Saparmurad Ovezberdiyev Friday, August 6, 2004; Page A19 On Sept. 11, 2003, the U.S. Embassy in Ashgabat, Turkmenistan, held a ceremony to... Date Added: 2009-02-11 20:23:53 |
| Relativity-5.pdf Path: Rice >> LANG >> 306 Fall, 2005 Description: Linguistic Relativity V Testing for Behavioral Correlates: Spatial Orientation Learning as Construction instead of children having to find meanings in a cognitive space which can be presumed to be shared between themselves and adults, children act... Date Added: 2009-02-06 20:13:49 |
| FSU USM V.02 Instructions.902.doc Path: Frostburg >> PSYC >> 385 Fall, 2008 Description: FSU - V.02 Instructions INSTRUCTIONS FOR PREPARATION OF A NEW PROGRAM PROPOSAL OR A PROPOSAL FOR A SUBSTANTIAL MODIFICATION, OR OFF-CAMPUS DELIVERY, OF AN EXISTING PROGRAM USING THE SHORT FORM (5 PAGES) NEW DEGREE PROGRAM ONLY USM Review The BOR Com... Date Added: 2009-01-10 17:03:38 |
| FSU USM V.02 Instructions.902.doc Path: Frostburg >> PSYC >> 470 Fall, 2008 Description: FSU - V.02 Instructions INSTRUCTIONS FOR PREPARATION OF A NEW PROGRAM PROPOSAL OR A PROPOSAL FOR A SUBSTANTIAL MODIFICATION, OR OFF-CAMPUS DELIVERY, OF AN EXISTING PROGRAM USING THE SHORT FORM (5 PAGES) NEW DEGREE PROGRAM ONLY USM Review The BOR Com... Date Added: 2009-01-10 17:03:38 |
| FSU USM V.02 Instructions.902.doc Path: Frostburg >> HIST >> 470 Fall, 2008 Description: FSU - V.02 Instructions INSTRUCTIONS FOR PREPARATION OF A NEW PROGRAM PROPOSAL OR A PROPOSAL FOR A SUBSTANTIAL MODIFICATION, OR OFF-CAMPUS DELIVERY, OF AN EXISTING PROGRAM USING THE SHORT FORM (5 PAGES) NEW DEGREE PROGRAM ONLY USM Review The BOR Com... Date Added: 2009-01-10 17:03:38 |
| Prelab assign 2 3 Path: Pittsburgh >> BIOSCI >> 0050 Fall, 2007 Description: PRE-LAB ASSIGNMENT FOR LAB EXERCISES #2 and #3 PRE-LAB ASSIGNMENT: Read the background information and complete all of the activities. This entire assignment is due at the beginning of Lab #2: Microbes: Good or Bad. OBJECTIVES: By the end of this pre... Date Added: 2008-04-07 13:18:13 |
| 4032-notes.pdf Path: Georgia Tech >> MATH >> 4032 Fall, 2008 Description: MATH 4032: COMBINATORIAL MATHEMATICS WILLIAM T. TROTTER Abstract. In this set of notes, we will develop a series of elegant combinatorial theorems, with selections made from graph theory, ramsey theory, discrete geometry, combinatorial optimization... Date Added: 2009-02-02 21:30:07 |
| CH_318N_Lecture9-08_Spring_08 Path: Texas >> CH >> 318N Spring, 2008 Description: Lecture 9 More on Aromatics February 14, 2008 Chemistry 318N First Midterm Exam When: Wednesday, 2/20 When: 7-9PM Where: WEL 1.308 What: Covers material through this Thursday Review: 2/18 6:00 PM Lecture Room Review: 2/19 6:00 PM Painter 3.02 Pra... Date Added: 2008-04-07 19:40:43 |
| 15%20lecture%20SUSTAINABILITY-2 Path: Texas A&M >> RLEM >> RLEM 301 Spring, 2008 Description: ECOSYSTEM SUSTAINABILITY AND CONDITION BIOPHYSICAL PROPERTIES OF ECOSYSTEMS P ECOSYSTEMS: < HAVE SPATIAL AND TEMPORAL VARIATION < EXHIBIT TROPHIC STRUCTURE < VARY IN RESILIENCY TO DISTURBANCE ECOSYSTEMS ARE OPEN SYSTEMS P THE FUNCTIONING OF ECOSYS... Date Added: 2008-05-04 20:54:56 |
| Lab six Path: Vanderbilt >> MSE >> 232 Spring, 2008 Description: Chase Machemehl October 18, 2007 Mrs. JoAnn Scales Section 10, Thursday 1-4pm Materials Science and Engineering Vanderbilt University Nashville, TN 37235 Bolted Joints Dear Mrs. Scales, The following report details the results of the lab experiment p... Date Added: 2008-04-07 09:01:24 |
| ch310n-iverson-hw07-spring2008 Path: Texas >> CH >> 310n Spring, 2008 Description: Homework Problem Set 7 Iverson CH310N Due Wednesday, March 19 NAME (Print): _ SIGNATURE: _ Chemistry 310N Dr. Brent Iverson 7th Homework March 5, 2008 Please print the first three letters of your last name in the three boxes Homework Problem Se... Date Added: 2008-04-21 19:52:46 |
| 050715yuan.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / Asia-Pacific / Renminbi - US expects Chinese currency revaluationSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Thursday Jul 21 2005 . All times are London time. Roger Bove Edit Profile Take a Tour Log out Asia-Pacific / Renm... Date Added: 2009-02-11 17:28:19 |
| Career Memo Path: USC >> WRIT >> 340 Fall, 2007 Description: To: From: Subj: Potential Career Paths in the Accounting Industry Date: March 23, 2006 I have always been a person of analytics and mathematics. I enjoy problem-solving and number crunching, whether it is has been in an algebra or statistics class. I... Date Added: 2008-03-03 19:44:28 |
| ps1.pdf Path: Brandeis >> CS >> 190 Fall, 2008 Description: Computer Science 190 (Autumn Term, 2003) Programming Language Theory Problem Set 1 Due Friday, September 19. Exercise 2.2.5: Substitution on terms. Exercise 2.2.6(a): Substitution identities. (Use induction on terms.) Exercise 2.2.7: Derivable infe... Date Added: 2009-02-06 20:03:08 |
| exam1key Path: Alabama >> CH >> 101 Spring, 2008 Description: ... Date Added: 2008-04-07 10:52:41 |
| 351Lab6 Path: Maryland >> ENME >> 000 Spring, 2008 Description: Laboratory 6 VIBRATION MEASUREMENT Time Aigbe Partners (Tuesday, Group A): Chris Barrow Mark Bellingham Amandeep Chhabra ENME 351 Section 0102 Date of Experiments: 11/27/07 Tuesday, Group A ENME 351 Sec 0102 Lab 7 Page 1 OBJECTIVES: The object... Date Added: 2008-04-17 22:17:51 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> ME >> 463 Spring, 2008 Description: ... Date Added: 2009-02-02 15:45:47 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDST >> 504 Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDPS >> 463 Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDST >> 511 Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDPS >> 504 Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDST >> 514 Spring, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDPS >> 576 Summer, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDST >> 609 Summer, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDPS >> 609 Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDST >> 695 Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| EDPS 463 Education for Individuals with Severe Disabilities Fall 2000.pdf Path: Purdue >> EDPS >> 695a Fall, 2008 Description: ... Date Added: 2009-01-09 09:58:03 |
| readership_study_report.pdf Path: Arizona >> DLIST >> 2313 Fall, 2008 Description: INFORMATION LITERACY COMPETENCY AND READERSHIP STUDY OF FIVE SPECIFIC LOCALITIES IN URBAN, INDUSTRIAL AND SEMI-URBAN AREAS OF KOLKATA METROPOLITAN CITY Information Literacy Competency and Readership Study of Five Specific Localities in Urban, Indust... Date Added: 2009-02-04 13:57:31 |
| Newsletter_Feb_2008 Path: Alabama >> CSE >> 493 Spring, 2008 Description: SMI accuracy. flexibility. speed. Christmas! National Pie Day! More fun to come . . . Mardi Gras: Tuesday February 5th Valentines Day: Thursday February 14th . . . So don\'t miss out! Julie\'s Top 10: 10 Great Tips for Losing Weight 1. Drink lots... Date Added: 2008-04-09 19:54:14 |
| 32 10-15-1875.pdf Path: Caribbean >> LAW >> 1875 Fall, 2008 Description: 246 THE TEXAS CONSTITUTIONAL CONVENTION or 1875 THIRTY-FIFTH DAY FRIDAY, OCTOBER 15, 187572 Public Lands and the Land Oce Colonel Crawfords substitute was the question penAll unsatisfied genuine land certificates barred by ... Date Added: 2009-03-19 00:27:13 |
| Lecture07HO.pdf Path: UF >> ZOO >> 3713c Fall, 2008 Description: 10 September 2008 ZOO 3713C Lecture 7: Tissues and Bone Connective Tissue: Definition: Loose fibrous connective tissue 1 10 September 2008 ZOO 3713C Dense connective tissue 2 10 September 2008 ZOO 3713C Dense connective tissue (cont.) Car... Date Added: 2009-01-10 18:37:45 |
| syl2028sprtr.pdf Path: ETSU >> PHYS >> 2028 Fall, 2008 Description: PHYS-2028-001: Great Ideas in Science II Syllabus Spring 2009 Course ID: Lecture Times: Lecture Location: Lecturers: PHYS-2028-001 T R 12:45 p.m. 2:05 p.m. Yoakley Hall, Room 109 Dr. Donald Luttermoser, Dept. of Physics & Astronomy Dr. David Harker... Date Added: 2009-02-17 23:42:50 |
| psychology 336.doc Path: Maryland >> PSYC >> 336 Fall, 2008 Description: PSYCHOLOGY 336: PSYCHOLOGY OF WOMEN AND GENDER FALL 2005 Instructor: Email: Office Hours: Time Thurs. (10:45 12:30) or by appointment Tues. & Thurs. at 12:30 1:45 in BPS 2283 Crawford, ... Date Added: 2009-02-03 13:59:16 |
| EDUC 3110 Summer 2008.doc Path: Vanderbilt >> EDUC >> 3110 Fall, 2008 Description: PSY 334/EDUC 3110: Psychological Foundations of Education Summer 2008 Instructor: Leigh Wadsworth Class: MTWR 1:10-3:00 Office: Hobbs 217B Office Hours: By Appointment Email: Leigh.Wadsworth@Vanderbilt.Edu Phone: 322-5566 or 509-5682 Required Text Al... Date Added: 2009-02-02 20:50:05 |
| USM_BOR_Bylaws_SectionI_I700.pdf Path: Maryland >> MS >> 07 Fall, 2008 Description: http:/www.usmh.usmd.edu/Leadership/BoardOfRegents/Bylaws/SectionI/I700.html I 7.00 POLICY ON PUBLIC ETHICS OF MEMBERS OF THE BOARD OF REGENTS (Approved by the Board of Regents, August 27, 1999) A. Purpose The purpose of this policy is to comply wit... Date Added: 2009-02-17 18:52:16 |
| 153C_Syllabus_Winter03.pdf Path: UCLA >> CHEM >> 153c Fall, 2008 Description: Chem 153C Metabolism and Its Regulation Winter 2003 INSTRUCTORS: Prof. Carla Koehler TEACHING ASSISTANTS: Mr. Arun Divakaruni, Mr. Edward Leverich, Mr. Stuart Sievers LECTURES: M,T,W 2.00-2.50, Young Hall CS24 Stuart Sievers Arun Divakaruni Arun D... Date Added: 2009-02-02 17:18:55 |
| ws1.doc Path: Michigan State University >> ME >> 391 Fall, 2008 Description: ME 391 In-class Group Assignment 1 Esteemed Colleagues _ _ _ _ INSTRUCTIONS AND COMMENTS: Work in a group or your choice consisting of n esteemed colleagues (with 2 n 4 ) to complete the following problems. Submit one paper per group, and be sure... Date Added: 2009-01-12 03:36:46 |
| stratigraphic.pdf Path: N.E. Illinois >> UX >> 1 Fall, 2009 Description: ... Date Added: 2009-04-15 22:12:27 |
| f2006Solns2 Path: University of Toronto >> ECE >> 190 Fall, 2006 Description: ECE 190 - Fall, 2006 Assignment 2 Solutions Section 1.1 6 (a) s i (b) s i 8 (a) h w s (b) w h s (c) h w s (d) w s h (e) w (h s) 15 p T T F F q T F T F p q T F F F (p q) F T T T p q T T T F (p q) (p q) T T T T 32 Thi... Date Added: 2008-04-19 00:39:21 |
| CLS 308 - Editorial Change.pdf Path: E. Kentucky >> CLS >> 308 Fall, 2008 Description: Editorial Change - Curriculum Form (Present only one curriculum editorial change per form) (Complete only the section(s) applicable.) Part I INFORMATIONAL Department Name College *Course Prefix & Number *Course Title (30 characters) *Program Title C... Date Added: 2009-02-02 14:10:56 |
| Sample_researchpaper.pdf Path: North Texas >> ENGL >> 1320 Fall, 2008 Description: Gibbons 1 Orlando Gibbons Professor Schoolfield English 1320.004/007 December 5, 2008 Abstract Aslfj asldfj asldfj asdlfj aslfjas dlfjas ldfkj asdlfkjas dlfkjas dflkjasd flkjasd flkasdfj lkasjdf laskfj lasdkfj asldfj asdlfkj asdl;fkj asdlfkj asdlfkj ... Date Added: 2009-02-03 14:09:37 |
| 09-08.pdf Path: Rochester >> CHAP >> 09 Fall, 2009 Description: D object D view, B view, B:A view A B:A fields D vtable (D/B part) B:A A methods B (only) methods D (only) methods D vtable (C part) B C d B (only) fields D C view, C:A view C:A fields C (only) C:A fields D (only) methods C (only) methods ... Date Added: 2009-04-15 22:59:46 |
| Emilys_chap7-12_review Path: UC Irvine >> BIO SCI >> 45 Winter, 2008 Description: AIDS FUNDAMENTALS REVIEW BOOK REVIEW CHATPER 7\' Biological Basis of HIV Transmission -Virus is quite fragile in the external environment Sources of Infectious HIV 12/4/2007 3:26:00 PM -Macrophages, Langerhans cells and T helper lymphocytes are susc... Date Added: 2008-04-13 03:02:43 |
| intdiv.ppt Path: Nevada >> MGT >> 496 Fall, 2008 Description: Market Scope Integration 3 Dimensions of Corporate Scope Vertical Integration Geography Product Market Source: Collis and Montgomery, 1997 Global Product/Market Approach Multidomestic Product/Market Strategy Handle product design, assembly and ... Date Added: 2009-02-02 19:52:03 |
| VanTreesWebResume.pdf Path: George Mason >> C >> 4 Fall, 2009 Description: Dr. Harry L. Van Trees EDUCATION Sc.D.E.E., Massachusetts Institute of Technology (1961) My doctoral thesis advisor was Professor Yuk Wing Lee, a protg of Norbert Wiener, who led the Statistical Communications Group. Professor Amar Bose, whose acoust... Date Added: 2009-04-16 01:08:25 |
| Chapter 02 - Components of Matter Handout I-1 Path: Alamo Colleges >> CHEM >> 1311 Spring, 2008 Description: Chapter 2 The Components of Matter Atoms, Elements, Molecules, Compounds, and Mixtures 2-1 Components of Matter: Definitions Element - the simplest type of substance with unique physical and chemical properties An element consists of only one ty... Date Added: 2008-04-13 19:32:13 |
| HW1.pdf Path: N. Arizona >> MAT >> 667 Fall, 2008 Description: MAT 667 (Dynamical Systems) Homework due Friday, Sept. 15, 2006 Here are some denitions that were covered in class, but its good to have them collected here. They follow the notation of Chaos An Introduction to Dynamical Systems by Alligood et. al. T... Date Added: 2009-01-09 05:12:12 |
| plan.pdf Path: Bemidji State >> SESSION >> 2 Fall, 2009 Description: Data Analysis Lesson Plans Grade 9, 10, Abby Bateman Resources: The use of the New York Stock Exchange is required, as well as spreadsheet. Day 1: A. Introduce students general ideas about he stock market. *People buy and sell s... Date Added: 2009-04-15 22:20:30 |
| 073Q7 Path: USC >> BUAD >> 250A Fall, 2007 Description: Name_ 4-Digit #_ Section_ Accounting for Marketable Securities: [073Q7] The Amarone Company has the following portfolios with information as indicated. FMV means fair market value. Cost FMV Year 2 Sale FMV Year 3 Sale Basis at 12/31/01 Proceeds at 12... Date Added: 2008-04-20 21:40:36 |
| loose.ends.pdf Path: Southern Utah >> MUS >> 395 Fall, 2009 Description: Some loose ends. 1. Vocal-instrumental connections (summarizing previous observations) -Vedas: scale system developed as evolution from Vedic chants -kriti: precomposed vocal piece that a melody instrument might perform in a performance segment -gama... Date Added: 2009-04-15 20:41:27 |
| templateschapter1 Path: Maryland >> ACCT >> Acct 220 Spring, 2009 Description: Chapter1,P6. 1. 2. Accountsarrangedinequationform Effectsoftransactionsshown Assets Cash Accounts Receivable Computer Supplies Equipment Systems Library = a. b. bal. c. bal. d. bal. e. bal. f. bal. g. bal. h. bal. i. bal. j. bal. Liabilities Accoun... Date Added: 2009-02-18 09:43:32 |
| 08-065.pdf Path: DeAnza College >> E S >> 065 Fall, 2008 Description: ~ ~OISE UNIVERSITY STATE Request for Curriculum Action 1. Curriculum Action Proposal 2. Affected Departments Signature Page Attach: To: E$J o Graduate Council University Curriculum Committee (Undergraduate!AppliedTechnology)From: (Graduate) ~ ~ ... Date Added: 2009-02-02 14:04:06 |
| tutorial12Solution Path: UWA >> ELEC >> 3305 Spring, 2007 Description: The University of Western Australia School of Electrical, Electronic and Computer Engineering Solutions - Tutorial Sheet 12, 2006 Electromagnetic Theory ENGT 3303 Question 1 A medium has the following constitutive parameters: = 0 , = 9 0 , = 5 ... Date Added: 2008-04-17 22:53:55 |
| 210 sylabus 2004.pdf Path: Michigan State University >> ABM >> 210 Spring, 2008 Description: ABM/FIM 210 Professional Seminar in Agribusiness Management/Food Industry Management January 20-March 2, 2004 Tuesday evenings 6:30 pm-8: 30 pm Agribusiness Management Dr. Dave Schweikhardt Room 202 Agriculture Hall 517-355-2320 517-432-1800 schweikh... Date Added: 2009-02-02 14:48:21 |
| hw6-110-fa08.pdf Path: Caltech >> CDS >> 110b Winter, 2008 Description: CALIFORNIA INSTITUTE OF TECHNOLOGY Control and Dynamical Systems CDS 110a R. M. Murray Fall 2008 Problem Set #6 Issued: Due: 10 Nov 08 17 Nov 08 Note: In the upper left hand corner of the second page of your homework set, please put the number o... Date Added: 2009-01-12 14:45:07 |
| Introduction to lasers.pdf Path: UConn >> CHEM >> 336 Spring, 2008 Description: Lasers Laser experimental arrangement Skoog, Hollier & Nieman, 5th edn, 1998, p148 fig. 7-4 Laser characteristics directional intense monochromatic coherent Emission of radiation Boltzman distribution N1 g1 (E1 E0 )/kT = e N0 g0 N2 and N1 ... Date Added: 2009-01-10 02:40:42 |
| Introduction to lasers.pdf Path: UConn >> CHEM >> 340 Fall, 2008 Description: Lasers Laser experimental arrangement Skoog, Hollier & Nieman, 5th edn, 1998, p148 fig. 7-4 Laser characteristics directional intense monochromatic coherent Emission of radiation Boltzman distribution N1 g1 (E1 E0 )/kT = e N0 g0 N2 and N1 ... Date Added: 2009-01-10 02:40:42 |
| Introduction to lasers.pdf Path: UConn >> ARE >> 234 Spring, 2008 Description: Lasers Laser experimental arrangement Skoog, Hollier & Nieman, 5th edn, 1998, p148 fig. 7-4 Laser characteristics directional intense monochromatic coherent Emission of radiation Boltzman distribution N1 g1 (E1 E0 )/kT = e N0 g0 N2 and N1 ... Date Added: 2009-02-02 17:46:20 |
| OUT664W08.doc Path: Oakland University >> CSE >> 664 Winter, 2008 Description: COURSEOUTLINEWinter2008 CSE664ParallelandDistributedProcessing CRN: 16568 INSTRUCTOR:Professor.SubraGanesan,OaklandUniversity OFFICE:105DHE,OaklandUniversity.PHONE:(248)3702206;Fax:3704625. Email:ganesan@oakland.edu LECTURE:OnlineCourse.Everyweekaset... Date Added: 2009-02-02 15:14:46 |
| 480final_review_handout.pdf Path: Humboldt State University >> CIS >> 480 Spring, 2008 Description: CIS 480 - Final Examination Review Suggestions p. 1 CIS 480 Final Examination Review Suggestions * * last modified: 12-07-05 remember: YOU ARE RESPONSIBLE for course reading, lectures/labs, and especially anything that\'s been on a homework, in-lect... Date Added: 2009-01-09 01:35:21 |
| Marketing_Final_Prep Path: USC >> BUAD >> 307 Spring, 2007 Description: Marketing BUAD 307 Final Preparation 1. Differentiate between the three dimensions of a product (core, branded, and augmented). A. Core The product in its most basic from. The category or function in which they belong.(Category :Automobile) B. Bran... Date Added: 2008-04-06 01:16:05 |
| Chapter 2 Path: Cornell >> BTRY >> 4080 Fall, 2007 Description: Chapter 2 Conditional Probability Suppose that we have partial knowledge of the result of a trial of the experiment - we know that event A occurred on the trial - but we do not know which outcome in A occurred; only that the ... Date Added: 2007-09-28 19:42:41 |
| The Essentials of Computer Organization and Architecture Path: A.T. Still University >> EE >> 557 Spring, 2008 Description: the essentials of Linda Null and Julia Lobur JONES AND BARTLETT COMPUTER SCIENCE the essentials of Pennsylvania State University Linda Null Pennsylvania State University Julia Lobur World Headquarters Jones and Bartlett Publishers 40 Tall Pin... Date Added: 2008-02-03 15:03:39 |
| Toledoth structure Path: Gordon MA >> OT >> Bi104 Fall, 2007 Description: Toledoth structure These are the generations (toledoth) o Gen 2:4, 5:1, 6:9, 10:1, 11:10. 27, 25:19 Tablet structure: rhythm o History on the front of the tablet o Genealogy on the back Note that oscillation on history and the genealogy Genesis table... Date Added: 2008-04-16 06:43:32 |
| wikiHow.doc Path: TAMU Commerce >> ARTS >> 524 Spring, 2008 Description: Final Exam, Wednesday, May 30, 2007 As a group, choose one of these activities: 1. using this wikiHow guide, start your own group 2. edit this guide 3. instead of this wikiHow, create a new one 4. ? Welcome to wikiHow wikiHow is a collaborative writ... Date Added: 2009-01-09 07:25:08 |
| wikiHow.doc Path: TAMU Commerce >> ELED >> 524 Fall, 2008 Description: Final Exam, Wednesday, May 30, 2007 As a group, choose one of these activities: 1. using this wikiHow guide, start your own group 2. edit this guide 3. instead of this wikiHow, create a new one 4. ? Welcome to wikiHow wikiHow is a collaborative writ... Date Added: 2009-01-09 07:25:08 |
| Histology-Connective tissue Path: USP >> BS >> 131 Spring, 2008 Description: Histology- Connective Tissue A Introduction 1. support and binding 2. Cells, fibers, matrix (grand substance 3. Cell types a. Fibroblast- a cell that makes fibers - important for growing, embryo adulthood - repair damage tissue - less fibroblast whe... Date Added: 2008-04-07 16:36:23 |
| ricardocompstaticex Path: Wisconsin >> ECON >> 464 Spring, 2008 Description: ... Date Added: 2008-08-08 15:31:23 |
| ricardocompstaticex.pdf Path: Wisconsin >> SSC >> 464 Fall, 2008 Description: ... Date Added: 2009-02-04 14:14:06 |
| Women in the Media2 Path: Iona >> MTH >> 101 Spring, 2008 Description: The Media and the Self-Image of Women Distorted and unattainable sexist mass images are the inevitable consequences of a social system in which those who are thin and big breasted benefit most. We as a society have created an environment so image ob... Date Added: 2008-07-10 07:52:13 |
| starving.doc Path: Wagner >> FILESTORE >> 2 Fall, 2009 Description: Free Trade and the \'Starving Child\' Defenseby VARIOUS CONTRIBUTORS [The Nation, April 24, 2000] In the wake of Seattle, defenders of the neoliberal model of development put forth what seemed to many a compelling new argument in favor of free trade. T... Date Added: 2009-04-15 19:48:48 |
| 2-29-08 anatomy notes Path: TCU >> BIOL >> 20204 Fall, 2007 Description: 2-29-08 anatomy notes 1. Circulatory System a. Cardiovascular System i. Electrocardiogram (EKG) 1. Valve-diagnostic tool for detecting abnormalities related to HR and conduction of action potentials through the heart a. Normal HR: 70-80 beats/minute ... Date Added: 2008-04-02 16:45:40 |
| EXAM1 Fall06 9 am key Path: Arizona >> BIOC >> 460 Spring, 2006 Description: EXAM I - KEY (September 20, 2006) BIOCHEMISTRY 460 9:00 am section Using 2D gel electrophoresis Professor DoGood has identified a protein involved in premature cell death (PCD) in individuals with chronic illness. She finds PCD is a heme protein whic... Date Added: 2008-04-07 01:30:33 |
| Voting and Elections Path: GCSU >> POLS >> 1150 Spring, 2008 Description: Public Opinion, Voting, and Elections Reference: Ch. 6 Public Opinion Public Opinion has become more important over time in politics \"Myth of the Popular Will\"; Andrew Jackson and the \"Common Man,\" Trends toward direct democracy Public Opinion... Date Added: 2008-04-10 10:21:18 |
| 100208_Lecture_10.pdf Path: Arizona >> GEOS >> 218 Fall, 2008 Description: Oct. 2, 2008: Volcanism Abbott Ch. 8 Homework: Due Oct. 9 Magma properties, eruption styles, and types of volcanoes Geos 218: Geological Disasters & Society The 3 Vs of volcanism: viscosity, volatiles, and volume 1 Explosiveness of Eruptions les... Date Added: 2009-01-09 19:10:00 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 188 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:15:55 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 250s Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:03 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> C261 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:41 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 129a Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-11 20:04:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 129c Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:39 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 152 Summer, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:59 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 24 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:15:55 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 280d Spring, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:03 |
| bam!nov98.pdf Path: Berkeley >> FOLKLOR >> C261 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:41 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 136c Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-11 20:04:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 136j Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:39 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 181 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:59 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 121c Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:38 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> C103 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:03 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 119 Spring, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:15:54 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 122f Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:03 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 176 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-11 20:04:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 180 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:39 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 149 Summer, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:22:28 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 122g Spring, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:38 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 134a Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:35 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 122c Spring, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:15:54 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 128m Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:03 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 179 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-11 20:04:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 250v Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 171 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:22:28 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 123c Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:39 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 162ac Summer, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:35 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 128 Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:15:55 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 183 Spring, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:03 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 250e Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-11 20:04:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> C100 Spring, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:40 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 125b Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-11 20:04:39 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 128a Fall, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-09 19:16:39 |
| bam!nov98.pdf Path: Berkeley >> ANTHRO >> 136b Summer, 2008 Description: the jawbone anthropology department university of california berkeley INTERVIEW WITH JOHN H. ROWE, HONOREE OF ANTHROPOLOGYS EIGHTH EMERITI LECTURE particularly interested in the Incas. Most people were saying that the Incas disappeared when the Spa... Date Added: 2009-01-10 01:21:59 |
| 36_donazzan-m.pdf Path: Ohio State >> MUSIC >> 886 Spring, 2008 Description: Proceedings of the 20th North American Conference on Chinese Linguistics (NACCL-20). 2008. Volume 2. Edited by Marjorie K.M. Chan and Hana Kang. Columbus, Ohio: The Ohio State University. Pages 597-610. Presupposition on Times and Degrees: The Seman... Date Added: 2009-01-10 03:18:56 |
| 36_donazzan-m.pdf Path: Ohio State >> CHINALINKS >> 20 Fall, 2008 Description: Proceedings of the 20th North American Conference on Chinese Linguistics (NACCL-20). 2008. Volume 2. Edited by Marjorie K.M. Chan and Hana Kang. Columbus, Ohio: The Ohio State University. Pages 597-610. Presupposition on Times and Degrees: The Seman... Date Added: 2009-02-17 22:36:53 |
| Lecture_14.doc Path: Penn State >> I E >> 497e Spring, 2008 Description: E Sc. 497E Engineering Applications of Wave, Particle & Ensemble Concepts Lecture #14 We will now use the Schroedinger time-independent wave equation to solve several different problems. These problems will all involve an electron but in different f... Date Added: 2009-02-02 15:28:18 |
| RN 21 Outline FA99.doc Path: Fresno City College >> RN >> 21 Fall, 2008 Description: FRESNO CITY COLLEGE COURSE OUTLINE OF RECORD Course Subject and Number Registered Nursing 21 Discipline(s) Nursing Course Title Transcultural Health Care Term Effective Fall 1999 Catalog Description: Prerequisite: Corequisite: Advisory: [ ] no ch... Date Added: 2009-02-02 14:20:13 |
| rocket Path: Case Western >> MATH >> 224 Spring, 2008 Description: ... Date Added: 2008-05-09 20:21:37 |
| chem 211 lab report 8 Path: Cornell >> CHEM >> 211 Fall, 2007 Description: Trial Number 1 2 3 4* 5 0.16M KI 40mL 20mL 20mL 40mL 40mL 0.0055M S2O3 20mL 20mL 20mL 20mL 20mL 0.12M S2O8 20mL 40mL 20mL 20mL 40mL H2O 20mL 20mL 40mL 20mL 20mL Concentrations Trial Number 1 2 3 4 5 (mol/L) KI 0.064 0.032 0.032 0.064 0.064 S2O... Date Added: 2008-06-17 17:22:32 |
| Stat Paper Path: CUNY Baruch >> PSY >> 3042 Fall, 2005 Description: Justin Joseph Stat 2000 Prof. Gourgey 2/27/2006 Take me out to the Ballgame? More like, take me out to a Movie or Concert! You smell the hot buttery popcorn, you hear the crowd cheering fervently, and you see the excitement all around you. If you\'r... Date Added: 2008-04-29 23:04:28 |
| 03auth.ppt Path: Caribbean >> CS >> 378 Fall, 2008 Description: CS 378 User Authentication Vitaly Shmatikov slide 1 Basic Problem ? How do you prove to someone that you are who you claim to be? Any system with access control must solve this problem slide 2 Many Ways to Prove Who You Are x What you know Pas... Date Added: 2009-03-19 00:17:23 |
| Bild 2_Ch 42 Path: UCSD >> BILD >> 2 Winter, 2008 Description: Ch. 42: Circulation and Gas Exchange 2/22/2008 8:52:00 PM 1. Explain the advantage of double circulation over a single circuit. In single circuit, blood pressure drop substantially and so oxygenrich blood leaving the gills of fish flows to the syst... Date Added: 2008-04-15 22:36:56 |
| 1.FirstClass.HistoricGrading128.2009.doc Path: Mary Baldwin >> ACADEMIC >> 128 Fall, 2008 Description: PolS 128: United States Foreign Policy Agenda: Tues. Jan. 13, 2009 I. Introductions -introduction to the course: books introduced, the syllabus, course website, daily notes, the term paper, etc. -digital photos for instructors seating chart -about ... Date Added: 2009-02-11 21:43:48 |
| mohave.pdf Path: Arizona >> SGA >> 2004 Fall, 2008 Description: Mohave Small Grain Advisory March 7, 2004 Crop Development Planted Dec 15 Early-maturing Barley Late-maturing Barley Early-maturing Durum Late-maturing Durum Planted Jan 15 Early-maturing Barley Late-maturing Barley Early-maturing Durum Late-maturin... Date Added: 2009-02-04 13:53:15 |
| mohave.pdf Path: Arizona >> SGA >> 7 Fall, 2008 Description: Mohave Small Grain Advisory March 7, 2004 Crop Development Planted Dec 15 Early-maturing Barley Late-maturing Barley Early-maturing Durum Late-maturing Durum Planted Jan 15 Early-maturing Barley Late-maturing Barley Early-maturing Durum Late-maturin... Date Added: 2009-02-04 13:53:15 |
| votegov.pdf Path: NYU >> POLITICS >> 8146 Fall, 2008 Description: Why votegov Should Not Predict Public Goods and Private Benefits Clarke and Stone propose Powells (2000) measure of the proportion of the electorate that voted for parties that subsequently joined the governing coalition as a measure of the ratio be... Date Added: 2009-02-06 19:47:14 |
| poster_Bernal_and_Mitsch.pdf Path: Ohio State >> KB >> 1811 Fall, 1925 Description: Estimating carbon sequestration in a Great Lakes coastal wetland using radiometric dating Blanca Bernal and William J. Mitsch Wilma H. Schiermeier Olentangy River Wetland Research Park Natural Resources Graduate Program, The Ohio State University ABS... Date Added: 2009-02-17 22:27:26 |
| poster_Bernal_and_Mitsch.pdf Path: Ohio State >> KB >> 31891 Fall, 2008 Description: Estimating carbon sequestration in a Great Lakes coastal wetland using radiometric dating Blanca Bernal and William J. Mitsch Wilma H. Schiermeier Olentangy River Wetland Research Park Natural Resources Graduate Program, The Ohio State University ABS... Date Added: 2009-02-17 22:27:26 |
| Durgin1995TDAE.pdf Path: Swarthmore >> X >> 12382 Fall, 2008 Description: ... Date Added: 2009-02-11 21:25:32 |
| Solutions_MAT303_exam2.pdf Path: SUNY Stony Brook >> MAT >> 303 Summer, 2008 Description: Name: Recitation: Tu Th ID#: MAT303: Solutions of Midterm II Wednesday, November 16 2005 Problems: Points: 1 2 3 4 Total There are four problems. Do all work on these pages. No Calculators, cell phones or notes may be used. However, a sheet ... Date Added: 2009-01-09 07:17:26 |
| 141-meyer-07spex01 Path: Wisconsin >> MATH >> 141 Fall, 2007 Description: ... Date Added: 2008-08-08 13:02:09 |
| 141-meyer-07spex01.pdf Path: Wisconsin >> MATH >> 141 Fall, 2008 Description: ... Date Added: 2009-02-03 14:24:09 |
| Fay_2003.pdf Path: Berkeley >> PMB >> 290 Fall, 2008 Description: Annu. Rev. Genomics Hum. Genet. 2003. 4:21335 doi: 10.1146/annurev.genom.4.020303.162528 Copyright c 2003 by Annual Reviews. All rights reserved First published online as a Review in Advance on June 4, 2003 SEQUENCE DIVERGENCE, FUNCTIONAL CONSTRAINT... Date Added: 2009-02-18 14:25:46 |
| 655.pdf Path: University of Illinois, Urbana Champaign >> VCM >> 655 Fall, 2008 Description: Course Schedule - Spring 2005 Veterinary Clinical Medicine 655 Special Large Animal Surgery Credit: 1.5 to 2.5 hours. (V C M 355) Lectures on surgical diseases and their diagnosis, treatment, and after care. The food animal laboratory portion is desi... Date Added: 2009-02-02 18:52:08 |
| 051110divide.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Egypt\'s Christian-Muslim divide - Print Version - International Herald Tribune Egypt\'s Christian-Muslim divide Mona Eltahawy International Herald Tribune THURSDAY, NOVEMBER 10, 2005 CAIRO Of the many things one should not mention in polite company in... Date Added: 2009-02-11 19:15:17 |
| Chapter 7 Path: UNC >> BIOL >> 101 Spring, 2008 Description: 7.1 Overview of Energy-Releasing Pathways Anaerobic Reactions do not use free oxygen - many prokaryotes and protists live in places where oxygen is absent; make ATP by fermentation and other anaerobic pathways - many eukaryotic cells still use ferme... Date Added: 2008-05-01 13:46:05 |
| Chapter 3 Notes Path: East Carolina >> ICTN >> 2154 Spring, 2008 Description: Chapter 3 Application Layer Functionality and Protocols Protocols: Define processes on either end of the communication Define the types of messages Define the syntax of messages Define the meaning of any informational fields Define how messages are... Date Added: 2008-04-29 01:53:29 |
| vis2003app2.pdf Path: UC Davis >> CS >> 2003 Fall, 2008 Description: A Visual Exploration Process for the Analysis of Internet Routing Data Soon Tee Teoh Kwan-Liu Ma S. Felix Wu Department of Computer Science University of California, Davis Abstract The Internet pervades many aspects of our lives and is becoming indi... Date Added: 2009-02-06 18:07:54 |
| 112.pdf Path: Arizona >> LAT >> 112 Summer, 2008 Description: STUDIES ON CERTAIN ASPECTS OF THE REPRODUCTIVE BIOLOGY OF MOUTH-BROODING TILAPIA, Oreochromis mossambicus (Peters) FROM ASSAM, INDIA G. Hatikakoty1 and S.P. Biswas2 1 2 Department of Biology, Nazira H.S. & M.P. School, Nazira - 785685, Assam, India ... Date Added: 2009-02-02 16:28:18 |
| 060424elect5.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Socialist victory in Hungary cheers up European left | European Union Elections | Newsletters | About EurActiv | Tour |RSS |Jobs |Yellow Pages Policy Sections Agenda 2004-09EnergyEnlargementEnvironmentFinancial ServicesFuture EUHealth & PharmaInfoSo... Date Added: 2009-02-11 19:30:56 |
| 060424elect5.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Socialist victory in Hungary cheers up European left | European Union Elections | Newsletters | About EurActiv | Tour |RSS |Jobs |Yellow Pages Policy Sections Agenda 2004-09EnergyEnlargementEnvironmentFinancial ServicesFuture EUHealth & PharmaInfoSo... Date Added: 2009-02-11 19:48:53 |
| Friedmans_Feb21.pdf Path: UF >> FIN >> 4504 Summer, 2008 Description: Friedmans, Inc. February 21, 2002 Equity Research McDonald Investments Inc. Basic Report Friedmans, Inc. (FRDM-NASDAQ) UNIQUE BUSINESS MODEL DIFFERENTIATES THIS COMPANY FROM THE PACK SIGNIFICANT POTENTIAL TO EXPAND LOCATIONS AND MARGINS COVERAGE I... Date Added: 2009-01-10 18:29:26 |
| NP10_Chapter07revFinal2.ppt Path: Delaware >> MISY >> 160 Fall, 2008 Description: Chapter 7 The Web and E-mail 7 Chapter Contents Section A: Web Technology Section B: Search Engines Section C: E-commerce Section D: E-mail Section E: Web and E-mail Security Chapter 7: The Web and E-mail 2 7 SECTION Web Technology A Web Basi... Date Added: 2009-01-10 02:44:22 |
| NP10_Chapter07revFinal2.ppt Path: Delaware >> ACCT >> 327 Fall, 2008 Description: Chapter 7 The Web and E-mail 7 Chapter Contents Section A: Web Technology Section B: Search Engines Section C: E-commerce Section D: E-mail Section E: Web and E-mail Security Chapter 7: The Web and E-mail 2 7 SECTION Web Technology A Web Basi... Date Added: 2009-01-10 02:44:22 |
| Cagney_poverty03.pdf Path: Concordia Chicago >> HEALTH >> 2 Fall, 2008 Description: ARTICLE IN PRESS Social Science & Medicine 57 (2003) 843860 Poverty, afuence, and income inequality: neighborhood economic structure and its implications for health Ming Wena,*, Christopher R. Browningb, Kathleen A. Cagneyc Department of Sociology,... Date Added: 2009-02-17 22:50:05 |
| Cagney_poverty03.pdf Path: UChicago >> HEALTH >> 2 Fall, 2008 Description: ARTICLE IN PRESS Social Science & Medicine 57 (2003) 843860 Poverty, afuence, and income inequality: neighborhood economic structure and its implications for health Ming Wena,*, Christopher R. Browningb, Kathleen A. Cagneyc Department of Sociology,... Date Added: 2009-02-17 22:50:05 |
| WaterREU_Flyer1.pdf Path: Texas >> CE >> 374 Fall, 2008 Description: RESEARCH EXPERIENCES FOR UNDERGRADUATES PROGRAM IN WATER RESEARCH AT COLORADO STATE UNIVERSITY Summer 2002 PROGRAM DESCRIPTION The Water Center at Colorado State University is seeking applications for its 2002 NSF Research Experiences for Undergradu... Date Added: 2009-03-19 00:25:32 |
| WaterREU_Flyer1.pdf Path: Caribbean >> CE >> 374 Spring, 2002 Description: RESEARCH EXPERIENCES FOR UNDERGRADUATES PROGRAM IN WATER RESEARCH AT COLORADO STATE UNIVERSITY Summer 2002 PROGRAM DESCRIPTION The Water Center at Colorado State University is seeking applications for its 2002 NSF Research Experiences for Undergradu... Date Added: 2009-03-19 00:25:32 |
| AC 231 The Pacific Path: Michigan >> AMCULT >> 231 Fall, 2005 Description: THE PACIFIC ISLANDS An Introduction AC231 Sex on the Beach Sept. 13, 2005 The Region(s) Modern Nation States and Territories Cultural and Geographic Regions (Map 1) Polynesia Micronesia Melanesia Australia Indonesia (West Papua) Philippines? Seaf... Date Added: 2008-04-17 07:40:29 |
| User%20Centered%20Design%20Process.ppt Path: Rochester >> VERSION >> 19310 Fall, 2009 Description: River Campus Libraries User Centered Design Process Brenda Reeb, Usability David Lindahl, Digital Initiatives Susan Cardinal, Science Libraries How do my ideas get incorporated? Active projects > content group Inactive projects > parking lot T... Date Added: 2009-04-15 22:36:02 |
| 2005MediumGrain1.pdf Path: LSU >> NR >> 19219 Fall, 2008 Description: 2005 LOUISIANA RICE ACREAGE BY VARIETY SURVEY Medium Grains Parish Acadia Allen Avoyelles Beauregard Bossier Caddo Calcasieu Caldwell Cameron Catahoula Concordia East Carroll Evangeline Franklin Iberia Jeff Davis Lafayette Madison Morehouse Natchitoc... Date Added: 2009-02-18 01:32:31 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 170b Fall, 2008 Description: ... Date Added: 2009-01-10 02:26:21 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 20p Fall, 2008 Description: ... Date Added: 2009-01-10 02:26:45 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 162 Fall, 2008 Description: ... Date Added: 2009-01-11 21:56:37 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 161 Fall, 2008 Description: ... Date Added: 2009-01-10 02:25:47 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 196a Spring, 2008 Description: ... Date Added: 2009-01-11 21:57:02 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 165a Fall, 2008 Description: ... Date Added: 2009-01-10 02:26:11 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 171c Fall, 2008 Description: ... Date Added: 2009-01-12 05:56:06 |
| tomasulotriumph.pdf Path: UCSC >> FILM >> 165c Winter, 2008 Description: ... Date Added: 2009-01-10 02:26:16 |
| Dr Prybutok DSCI 5320 Fall 2008.pdf Path: North Texas >> DSCI >> 5320 Fall, 2008 Description: 1 COURSE SYLLABUS (Fall 2008): QUALITY CONTROL - DSCI 5320 CLASS (DAY/TIME): Sect 01- Tuesday 6:30-9:20 PM in CURY211 INSTRUCTOR: Dr. Victor R. Prybutok, Ph.D., CQE, CQA, CMQ/OE OFFICE: 235A E-MAIL: prybutok@unt.edu 940 - 565 - 4767 Tues. and Thurs.... Date Added: 2009-02-03 14:08:58 |
| 2005Quiz2.pdf Path: Charleston Law >> CHEMISTRY >> 112 Fall, 2008 Description: ... Date Added: 2009-02-18 13:31:43 |
| 2005Quiz2.pdf Path: Washington and Lee >> CHEMISTRY >> 112 Fall, 2008 Description: ... Date Added: 2009-02-18 13:31:43 |
| 2393.001.ps Path: Hawaii >> SOEST >> 2393 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207381763.0388276 Float: 2393 Profile: 001 Location: 32.5N 144.8E Date: 06/03... Date Added: 2009-02-17 20:03:28 |
| Jean-Pierre_notes.pdf Path: Rutgers >> 628 >> 472 Fall, 2008 Description: CALCIUM CARBONATE PRODUCTION, DISSOLUTION, AND PRESERVATION Jean-Pierre Gattuso Laboratoire dOcanographie de Villefranche (LOV) CNRS and University of Paris 6 Villefranche-sur-mer and Visiting Research Scientist Rutgers University Outline Introduc... Date Added: 2009-01-11 18:01:55 |
| 6-3 Bob Wilkinson.pdf Path: UCSB >> ENV S >> 3 Spring, 2008 Description: Integrated Planning for Water and Energy Systems Bren School Santa Barbara, CA March 23, 2007 Robert Wilkinson, Ph.D. Director, Water Policy Program Bren School of Environmental Science and Management University of California, Santa Barbara Points... Date Added: 2009-02-02 17:40:55 |
| didion3.pdf Path: UF >> ENC >> 3310 Fall, 2008 Description: Critique on Goodbye To All That by Joan Didion Joan Didion does a good job describing the hustle and bustle of New York in her narrative Goodbye to All That. She begins with a nice little rhyming poem to put the reader in a happy mood. Then, she tur... Date Added: 2009-01-10 18:25:34 |
| didion3.pdf Path: UF >> ENC >> 4260 Fall, 2008 Description: Critique on Goodbye To All That by Joan Didion Joan Didion does a good job describing the hustle and bustle of New York in her narrative Goodbye to All That. She begins with a nice little rhyming poem to put the reader in a happy mood. Then, she tur... Date Added: 2009-01-10 18:26:32 |
| CVEN2121 1P Path: Colorado >> CVEN >> 2121 Summer, 2008 Description: CVEN 2121 Analytical Mechanics I-Statics Homework #1. Assigned Jun 02, 2008, Due Jun 04, 2008 Note: Problems 1-3 are based on material we have already covered. Problem 4 is based on material we will cover on Tuesday (Jun 03). Problem #1: A Fink ro... Date Added: 2008-06-18 09:58:08 |
| Chapter 2 Path: BU >> EC >> 102 Spring, 2008 Description: International trade creates many winners and some losers. Sometimes, a few losers in rich countries try to stop trade that would make winners of workers in very poor countries. The first lesson in international economics is that there are gains from ... Date Added: 2008-04-26 09:19:18 |
| php_assn.pdf Path: Towson >> COSC >> 484 Fall, 2008 Description: COSC 484 Web-based Programming Spring 2006 Assignment 4 PHP Description: Create an automotive web site using dynamic web pages interacting with a relational database and PHP scripts using PHP examples three and four from the sever side processing l... Date Added: 2009-01-09 07:26:56 |
| m 130 section 2.2 powerpoint.ppt Path: Montana >> MATH >> 130 Fall, 2008 Description: Whole Numbers and Numeration Warm-Up: Complete the handout you received when you came in. One student will be chosen randomly to present their solutions! Objectives: SWBAT Compare and contrast three different ways of using whole numbers Order wh... Date Added: 2009-01-09 20:23:35 |
| IEPC-2007-340.pdf Path: Michigan >> PHYSICS >> 340 Fall, 2008 Description: Ground-Based Experiment of Current Collection to Bare Tether in High-Speed Magnetized Plasma IEPC-2007-340 Presented at the 30th International Electric Propulsion Conference, Florence, Italy September 17-20, 2007 Hirokazu Tahara* Osaka Institute of T... Date Added: 2009-02-02 19:40:09 |
| GCH-295-003-S09.pdf Path: George Mason >> GCH >> 295 Fall, 2008 Description: George Mason University Department of Global and Community Health Nutrition for Healthcare Professionals GCH-295 Spring 2009 _ Professor: Office: Office Hours: Mailbox: Meeting time: Location: Course credits: Message phone: Email: Carol Stiller, MS, ... Date Added: 2009-04-16 01:27:09 |
| Stat 511 HW 4 S04.pdf Path: Iowa State >> STAT >> 511 Fall, 2008 Description: Stat 511 HW#4 Spring 2004 (Not to be Collected) 1. In the context of Problems 3 and 4 of HW #1, use R matrix calculations to do the following in the (non-full-rank) Gauss-Markov normal linear model. a) Find 90% two-sided confidence limits for . b) F... Date Added: 2009-01-09 02:12:54 |
| 020507USFarms.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: IHT Article Print Page Copyright 2002 The International Herald Tribune | www.iht.com Who really pays to help U.S. farmers? Paul Blustein The Washington Post Monday, May 6, 2002 Subsidies undercut the world\'s poor WASHINGTON Of all the problems that ... Date Added: 2009-02-11 18:05:17 |
| systems and order Path: Texas >> ARC >> 308 Spring, 2007 Description: systems and order Austin city plan, Edwin waller, 1839 Savannah city plan, james Oglethorpe, 1733 Central beheer offices, apledoorn, Holland, herman Hertzberg, 1974 Sarabhai residence, ahedabad, India, le Corbusier, 1952 Kimball art museum, fort wort... Date Added: 2009-02-24 11:43:22 |
| key-final-06.pdf Path: UF >> PHA >> 5127 Fall, 2008 Description: Name: _ UFID#: _ PHA 5127 Final Exam Fall 2006 On my honor, I have neither given nor received unauthorized aid in doing this assignment. Name Please transfer the answers onto the bubble sheet. The question number refers to the number on the bubble... Date Added: 2009-01-10 18:19:07 |
| m553f.pdf Path: Purdue >> MA >> 553 Fall, 2008 Description: Math 553 Final Exam December 13 2007 W. Heinzer 1. (16 pts) (a) List representatives for each conjugacy class in the symmetric group S4 and state the number of elements in each conjugacy class. (b) List representatives for each conjugacy class i... Date Added: 2009-01-11 17:54:50 |
| 060120water.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Terraviva EUROPE Friday, 20 January 2006 DEVELOPMENT: NGOS AGAINST WATER PRIVATISATION PLANS by Stefania Bianchi BRUSSELS (IPS) - An alliance of development groups is challenging the European Union and developed countries over their plans to promote... Date Added: 2009-02-11 18:52:43 |
| 060120water.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Terraviva EUROPE Friday, 20 January 2006 DEVELOPMENT: NGOS AGAINST WATER PRIVATISATION PLANS by Stefania Bianchi BRUSSELS (IPS) - An alliance of development groups is challenging the European Union and developed countries over their plans to promote... Date Added: 2009-02-11 19:12:23 |
| 3-02-07 AnterogradeHO Path: Rutgers >> PSYCH >> 340 Spring, 2007 Description: Cognition: Anterograde Amnesia March 2, 2007 Two Types of Amnesia Retrograde Amnesia Impairment of memory for events before the injury. Impairment of memory for events after an injury. That is, an impairment in learning. Anterograde Amnesia... Date Added: 2008-04-02 21:39:28 |
| TheChabad.pdf Path: SCAD >> DSCOTT >> 22 Fall, 2009 Description: Terumah 5761 (2001) Who Needs Nudniks? Half the world are givers, and half the world are takers. The Old Man on the Island \"Remember, Reb Ze\'ev,\" were the Baal Shem Tov\'s parting words to his disciple. \"one must know how to properly answer a questi... Date Added: 2009-04-15 21:54:06 |
| Chapter 8 Handout Problems Path: North Texas >> ACCT >> 2020 Spring, 2008 Description: ... Date Added: 2008-04-15 20:11:00 |
| project2.pdf Path: N.C. State >> MA >> 574 Fall, 2008 Description: Math 797V Project 2 Due: February 28, 2008 Problem 1. In this problem, you will use Euler-Bernoulli beam equations to model the transverse vibrations of a beam excited by a voltage spike to a PZT patch. Data will consist of displacement measurements ... Date Added: 2009-01-09 04:44:43 |
| project2.pdf Path: N.C. State >> MA >> 797v Fall, 2008 Description: Math 797V Project 2 Due: February 28, 2008 Problem 1. In this problem, you will use Euler-Bernoulli beam equations to model the transverse vibrations of a beam excited by a voltage spike to a PZT patch. Data will consist of displacement measurements ... Date Added: 2009-01-09 04:44:50 |
| project2.pdf Path: N.C. State >> MA >> 797 Fall, 2008 Description: Math 797V Project 2 Due: February 28, 2008 Problem 1. In this problem, you will use Euler-Bernoulli beam equations to model the transverse vibrations of a beam excited by a voltage spike to a PZT patch. Data will consist of displacement measurements ... Date Added: 2009-02-04 14:46:35 |
| yoursearch.pdf Path: Concordia Chicago >> SEARCHING >> 1 Fall, 2009 Description: Web Institute for Teachers http:/webinstituteforteachers.org Conducting your search Searching the Web WIT 2001 Homeroom Module By: Rowena Namoca Conducting your Search Your search strategy should always begin by asking yourself - \"What do I want ... Date Added: 2009-04-15 22:01:22 |
| HST 370 Quiz 3 Path: Cal Poly Pomona >> HIST >> 370 Winter, 2008 Description: In terms of their work force, American farmers and ranchers a. continued to use Indian laborers to work their lands b. hired Chinese immigrants d. relied on black workers The Big Four included all of the following except a. Leland Stanford b. Collis... Date Added: 2008-03-11 19:17:26 |
| Practice Questions - Linear Programming - Solutions Path: USC >> BUAD >> 311 Spring, 2008 Description: Practice Questions Linear programming 1. A steel manufacturer produces metal sheet in standard size of: width 11ft and length 11ft. After the production, the plant can cut the sheet into the sizes a customer may want. For example, it can cut a sheet... Date Added: 2008-02-29 00:26:21 |
| Lecture2-Transport-2up.pdf Path: Berkeley >> EE >> 105 Fall, 2009 Description: EE105 - Fall 2005 Microelectronic Devices and Circuits Lecture 2 Transport in Semiconductors Announcements Web site is up: http:/www-inst.eecs.berkeley.edu/~ee105 Homework has been posted, due Tuesday, September 6, at 5pm (drop box in Cory) 2 1 ... Date Added: 2009-04-16 01:58:46 |
| nursing.pdf Path: CSU Fresno >> GME >> 193 Fall, 2008 Description: Nursing College of Health and Human Services Department of Nursing Michael F. Russler, Chair Carol Rayner, Administrative Support Coordinator McLane Hall, Room 190 559.278.2041 www.csufresno.edu/nursing/ B.S. in Nursing M.S. in Nursing Options: Cli... Date Added: 2009-01-10 02:47:41 |
| nursing.pdf Path: CSU Fresno >> PLANT >> 194 Fall, 2008 Description: Nursing College of Health and Human Services Department of Nursing Michael F. Russler, Chair Carol Rayner, Administrative Support Coordinator McLane Hall, Room 190 559.278.2041 www.csufresno.edu/nursing/ B.S. in Nursing M.S. in Nursing Options: Cli... Date Added: 2009-01-10 02:47:41 |
| lecture-13-2-tom.ppt Path: Arizona >> MIS >> 04 Fall, 2009 Description: Intro to Machine Learning 18.118.3 Intro Forms of Learning What is learning? Learning element alters performance element so it makes better decisions Learning Element Learning element design affected by Components Which components are ... Date Added: 2009-04-15 22:59:56 |
| lecture-13-2-tom.ppt Path: Arizona >> MIS >> 440 Fall, 2009 Description: Intro to Machine Learning 18.118.3 Intro Forms of Learning What is learning? Learning element alters performance element so it makes better decisions Learning Element Learning element design affected by Components Which components are ... Date Added: 2009-04-15 22:59:56 |
| 21b_Final_F02 Path: Harvard >> MATH >> 21B Fall, 2002 Description: Name: _ Math 21b Final Exam Tuesday, January 14th, 2002 Please circle your section: Tom Judson Katherine Visnjic (CA) MWF 9-10 Andy Engelward Jakub Topp (CA) MWF 10-11 Andy Engelward Erin Aylward (CA) MWF 11-12 Question 1 2 3 4 5 6 7 8 9 10 Total P... Date Added: 2008-01-23 16:41:27 |
| Economics Path: LSU >> ECON >> 2030 Spring, 2009 Description: Economics and Market Forces What happens in society can be seen as a reaction to, and interaction of, economic forces, social forces, and historical forces. Social, cultural, and political forces influence market forces. Political and social forces o... Date Added: 2009-02-12 22:26:16 |
| bor8.pdf Path: LSU >> BGTPLAN >> 8 Fall, 2008 Description: Board of Regents Form BOR-8 Auxiliary Enterprise Operations Married Student Housing 2006-07 Institution: Louisiana State University Married Student Housing 2007-08 Cafeterias 2006-07 Revenues Expenditures Salaries Other Compensation Related Benefit... Date Added: 2009-02-06 19:38:25 |
| The ultimate goal of the educational system is to shift to the individual the burden of pursuing his Path: Cornell >> ADMISSIONS >> 101 Spring, 2008 Description: \"The person who really thinks learns quite as much from his failures as from his successes.\" -John Dewey For the past few summers my friend and I have started small profitable businesses using the internet. Our first endeavor we named the Auracast Co... Date Added: 2008-02-12 05:17:28 |
| gradsc1.doc Path: N. Illinois >> MGMT >> 217 Fall, 2008 Description: Grading Scale For Exam 1 79 and above = A 78-65 =B 64.52 =C 51.38 =D 37 and below = F ... Date Added: 2009-01-09 05:18:32 |
| puk9.doc Path: Sierra >> BIOSCI >> 4 Fall, 2008 Description: Physiological unknown #9 Fall 2005 CGCAGGCCTAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGAT TCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATA ACGTCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGG GATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTG... Date Added: 2009-01-11 21:00:15 |
| puk9.doc Path: Sierra >> BIOSCI >> 1 Fall, 2008 Description: Physiological unknown #9 Fall 2005 CGCAGGCCTAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGAT TCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATA ACGTCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGG GATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTG... Date Added: 2009-01-11 21:00:15 |
| puk9.doc Path: Sierra >> BIOSCI >> 2 Fall, 2008 Description: Physiological unknown #9 Fall 2005 CGCAGGCCTAACACATGCAAGTCGAGCGGATGAAGGGAGCTTGCTCCTGGAT TCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATA ACGTCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGG GATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTG... Date Added: 2009-01-11 21:00:15 |
| 399.pdf Path: University of Illinois, Urbana Champaign >> ANTH >> 399 Spring, 2008 Description: Course Schedule - Spring 2009 Anthropology 399 Special Topics credit: 1 to 3 hours. Topics are given on a one-time only, experimental basis. Faculty offer special topics in their areas of expertise that provide an opportunity for undergraduates to be... Date Added: 2009-02-02 18:09:04 |
| lecture20.pdf Path: Michigan State University >> PHY >> 481 Fall, 2008 Description: PHY481: Electromagnetism Solving Laplaces equation via Separation of Variables 1) Cartesian coordinates 2) Spherical coordinates 3) Cylindrical coordinates Examples Lecture 20 Carl Bromberg - Prof. of Physics Cartesian coordinates Determine na... Date Added: 2009-01-09 02:54:34 |
| Ch14-15 Vocab Path: UPenn >> HIST >> 020 Fall, 2008 Description: Federico Nusymowicz 10/31/06 Period 4 Reform in Early 19th Century America ID Second Great Awakening: the Great Revival was the second great religious revival in United States history and consisted of several kinds of activity, distinguished by local... Date Added: 2008-06-25 13:34:16 |
| BayDistComp00.pdf Path: College of the San Mateo >> BCST >> 220 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ARCH >> 210 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> BCST >> 230 Spring, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ARCH >> 220 Spring, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ADAP >> 100 Spring, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> BCST >> 240 Spring, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ARCH >> 230 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ADAP >> 110 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ARCH >> 666 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ADAP >> 130 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> BCST >> 210 Spring, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| BayDistComp00.pdf Path: College of the San Mateo >> ADAP >> 140 Fall, 2008 Description: GREATER S. F. BAY AREA COMMUNITY COLLEGE DISTRICTS ASSOCIATE DEGREE & CERTIFICATE COMPLETION RATES 1997 - 2000 45% 40% Statewide Average 32.7% 41.3% 39.9% 39.8% 39.6% 36.5% 35.7% 35.2% 34.2% 31.7% 29.2% 24.80% 24.6% 17.3% 42.6% Completion Rates % ... Date Added: 2009-01-09 15:19:52 |
| japan 2.ppt Path: Syracuse >> ANT >> 611 Fall, 2008 Description: Video: Aging in Japan Wednesday, September 27, 2000 Being distributed: Study questions for next week s Topic questions for section on Japan s Point of clarification: the ofuro bath Japanese tradition of relaxing in the bathtub s Careful, thorough w... Date Added: 2009-01-09 07:20:22 |
| japan 2.ppt Path: Syracuse >> ANT >> 612 Fall, 2008 Description: Video: Aging in Japan Wednesday, September 27, 2000 Being distributed: Study questions for next week s Topic questions for section on Japan s Point of clarification: the ofuro bath Japanese tradition of relaxing in the bathtub s Careful, thorough w... Date Added: 2009-01-09 07:20:22 |
| 115_4-22-08.pdf Path: Berkeley >> ECON >> 115 Spring, 2008 Description: Do I have to take the final? ! ! ! ! The final is obligatory. If you miss it, you will get a zero, and your grade is affected compensurately. (If you are hospitalized, dealing with the emergency illness of a family member, etc., we will find a w... Date Added: 2009-01-09 19:25:00 |
| ExamAnsFall06.pdf Path: UNLV >> LAW >> 06 Fall, 2008 Description: Grading Key: Civil Procedure, Fall 2006 BAGS # _ Question 1 (36 points total, 3 points each) Raw score _ Final score _ (a) _ True. Based on what we know so far this class action has a decent shot of meeting the prerequisites of R. 23(a) (numerosity... Date Added: 2009-02-06 19:37:09 |
| 2008_06_05_12_30_21 Path: UCSD >> BIBC >> 103 Fall, 2008 Description: ... Date Added: 2008-10-20 23:33:52 |
| Chp. 14 - A Macroeconomic Theory of the Open Economy Path: Purdue >> ECON >> 252 Fall, 2007 Description: Chp. 14 - A Macroeconomic Theory of the Open Economy Net Capital Outflow is the link between the market for loanable funds and the foreign currency exchange market. o NCO is part of the demand for loanable funds o NCO is also the source of the supp... Date Added: 2008-04-07 15:31:05 |
| EDUC 2130.doc Path: Kennesaw >> EDUC >> 2130 Fall, 2008 Description: KENNESAW STATE UNIVERSITY UNDERGRADUATE PROPOSAL Change in Existing Course Existing Course Prefix/Number/Title _EDUC 2130 Exploring Teaching and Learning_ Department _PTEU_ Degree Title (if applicable) __ Proposed Effective Date _Fall 08_ Please ind... Date Added: 2009-02-02 21:37:33 |
| project.doc Path: SIU Edwardsville >> IME >> 458 Fall, 2008 Description: IME 458 Class Project (Fall 08 100 points) Students will combine as a team to design a research project to compare the use of the PlayStation III, Nintendo, and X-Box game products. Programs that will run on all products will be the media for evalua... Date Added: 2009-01-09 07:11:54 |
| project.doc Path: SIU Edwardsville >> IME >> 477 Spring, 2008 Description: IME 458 Class Project (Fall 08 100 points) Students will combine as a team to design a research project to compare the use of the PlayStation III, Nintendo, and X-Box game products. Programs that will run on all products will be the media for evalua... Date Added: 2009-01-09 07:11:54 |
| HuaTang.txt Path: Harvard >> CS >> 50 Fall, 2009 Description: /* * proposal.txt - Hua Tang * This is the proposal for my final project. * Id: proposa2.txt,v 1.1 1995/12/02 18:35:37 huatang Exp huatang **/ Abstract This project aims to construct a tool to study population genetics. The program takes the... Date Added: 2009-04-16 00:18:26 |
| HuaTang.txt Path: Harvard >> CS >> 95 Fall, 2009 Description: /* * proposal.txt - Hua Tang * This is the proposal for my final project. * Id: proposa2.txt,v 1.1 1995/12/02 18:35:37 huatang Exp huatang **/ Abstract This project aims to construct a tool to study population genetics. The program takes the... Date Added: 2009-04-16 00:18:26 |
| Lesson05b.pdf Path: University of Dayton >> UNIT >> 01 Fall, 2009 Description: COALITION FOR NONPROFIT HEALTH CARE 1301 K STREET, N.W. SUITE 900 EAST WASHINGTON, D.C. 20005 (202) 408-7170 WWW.CNHC.ORG RESEARCH, EDUCATION, ADVOCACY Nonprofit Healthcare-Under Scrutiny or Under Siege? Attorneys General and labor unions have ... Date Added: 2009-04-16 00:08:15 |
| photo_album.pdf Path: Centre >> NSC >> 140 Fall, 2008 Description: NSC 140: Extra-credit Assignment The assignment is to create an album of your own photographs that are relevant to environmental geology. You may use your own camera (digital or film) or purchase a single-use 35 mm camera. The album should contain at... Date Added: 2009-02-11 22:09:29 |
| Bio 201 F08 True lect 16 v2r Path: SUNY Stony Brook >> BIO >> 201 Fall, 2008 Description: Reproduction in Chondrichthyes - internal fertilization Varying reproductive strategies in different species Oviparous = eggs w/yolk Viviparous = live young, placenta Ovoviviparous = no placenta, eggs held inside and eventually hatch inside female re... Date Added: 2009-04-14 23:55:46 |
| Supplement.pdf Path: Berkeley >> EE >> 225 Spring, 2003 Description: EE 225A DIGITAL SIGNAL PROCESSING SUPPLEMENTARY MATERIAL 1 EE 225a Digital Signal Processing Supplementary Material 1. Allpass Sequences A sequence h a ( n ) is said to be allpass if it has a DTFT that satisfies Ha ( e ) = 1 . Note that this is t... Date Added: 2009-02-17 18:05:46 |
| Supplement.pdf Path: Berkeley >> EECS >> 225 Spring, 2003 Description: EE 225A DIGITAL SIGNAL PROCESSING SUPPLEMENTARY MATERIAL 1 EE 225a Digital Signal Processing Supplementary Material 1. Allpass Sequences A sequence h a ( n ) is said to be allpass if it has a DTFT that satisfies Ha ( e ) = 1 . Note that this is t... Date Added: 2009-02-17 18:05:46 |
| Final B Path: Wisconsin >> SPANISH >> 204 Fall, 2006 Description: ESPAOL 204 EXAMEN FINAL (1) 16 de mayo del 2002 I. VOCABULARIO. Escoger la frase de la segunda columna que mejor se relacione con cada palabra de la primera columna. (15) 1. _ plagiar 2. _ el espa 3. _ la pena de muerte 4. _ proscribir 5. _ infringi... Date Added: 2008-04-29 19:04:35 |
| apollonius.pdf Path: UConn >> MATH >> 2720w Fall, 2008 Description: Appollonius of Perga, ca. 250-175 BCE Apollonius was primarily an astronomer but he wrote extensively about the geometry of circles and the conic sections. He was the author of Conic Sections, in 8 books, with 400 theorems. So he followed in the trad... Date Added: 2009-01-10 02:39:22 |
| h10 Path: Colorado College >> EC >> 207 Spring, 2008 Description: The Colorado College Department of Economics and Business Block 7 Econ 207 HW 10. 1. A monopolist can produce at constant marginal and average costs of AC=MC=5. The firm has a market demand curve given by Q = 53 P. (a) Derive the monopolist\'s margin... Date Added: 2008-04-19 11:42:03 |
| Chapter 10 Reading Quiz Path: Stevens >> PEP >> 111 Fall, 2007 Description: MasteringPhysics: Assignment Print View Reading Quiz 10.1 Part A Energy is a physical quantity with properties somewhat similar to what other quantity? ANSWER: Money Heat A liquid Work Momentum Reading Quiz 10.2 Part A Hooke\'s law describes the for... Date Added: 2008-04-08 12:00:06 |
| article12_2004.pdf Path: Arizona >> CALS >> 2004 Fall, 2008 Description: Virus Calves in Detecting a o reduce economic losses from a livestock virus you need to know how the disease is spreading, and which animals are carrying it. Research underway at the University of Arizona Veterinary Diagnostic Laboratory (AzVDL), ... Date Added: 2009-02-06 20:22:37 |
| article12_2004.pdf Path: Arizona >> AG >> 2004 Fall, 2008 Description: Virus Calves in Detecting a o reduce economic losses from a livestock virus you need to know how the disease is spreading, and which animals are carrying it. Research underway at the University of Arizona Veterinary Diagnostic Laboratory (AzVDL), ... Date Added: 2009-02-04 13:44:47 |
| article12_2004.pdf Path: Arizona >> CALS >> 12 Fall, 2007 Description: Virus Calves in Detecting a o reduce economic losses from a livestock virus you need to know how the disease is spreading, and which animals are carrying it. Research underway at the University of Arizona Veterinary Diagnostic Laboratory (AzVDL), ... Date Added: 2009-02-06 20:22:37 |
| 040813unempl.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Some 20 pct of young Czechs without job - press esk novinySportovn novinyFinann novinyPrask novinyNerisProtextTKZpravodajsk server TKadvertisement: Prague hotels - hotel search - last minute offers16.8. 2004 Z DOMOVAGrossova vldaZE SVTAEKONOMIKASPORT... Date Added: 2009-02-11 19:06:55 |
| HW2.pdf Path: S.F. State >> ONLINE >> 690 Fall, 2008 Description: ... Date Added: 2009-02-06 19:42:07 |
| cal53.pdf Path: Arkansas Tech >> MATH >> 2914 Fall, 2008 Description: Arkansas Tech University MATH 2914: Calculus I Dr. Marcel B. Finan 34 Interpretations of the Denite Integral We start this section by showing that the denite integral of a rate of change gives the total change of the function. We dene the total ch... Date Added: 2009-02-17 23:40:21 |
| prefred_specification.pdf Path: UChicago >> FOZZIE >> 1 Fall, 2008 Description: ... Date Added: 2009-02-17 22:52:37 |
| prefred_specification.pdf Path: Concordia Chicago >> FOZZIE >> 1 Fall, 2008 Description: ... Date Added: 2009-02-17 22:52:37 |
| chapter.6.quiz Path: Lehigh >> SSP >> 001 Spring, 2007 Description: 1. The sociological definition of deviance stresses: a. the social context in which deviance occurs. b. the personality types related to deviance. c. the individual who is deviant. d. the behavior defined as deviant. 2. Emile Durkheim argued that: a.... Date Added: 2008-02-26 21:18:37 |
| Book1 Path: Fisher >> INTRO COMP >> cs101 Spring, 2008 Description: Campus Clothiers Semiannnual Projected Gross Margin, Expenses, and Operating Income fe br ua ry ja nu ar y m ar ch Sales Cost of Goods Sold Gross Margin Expenses Bonus Commission Marketing Research and Development Support, General, and Administrative... Date Added: 2008-04-28 06:32:28 |
| 1974.Phys Rev.Anastassakis.Resonance Raman scattering under (111) uniaxial stress in the region of t Path: Maryland >> PHYS >> 111 Fall, 2008 Description: ... Date Added: 2009-02-03 13:59:00 |
| websoln.pdf Path: Wisconsin Milwaukee >> M >> 111 Fall, 2009 Description: Solution to online example Thursday, November 06, 2008 12:39 PM Lectures Page 1 Lectures Page 2 ... Date Added: 2009-04-15 22:20:43 |
| CPSY433-Jackson-Bailey-1082.pdf Path: Loyola Chicago >> WWW >> 1 Fall, 2008 Description: LOYOLA UNIVERSITY CHICAGO 433-001 Multicultural Counseling Spring Semester 2008 Class meets: Tuesdays 4:15pm - 6:45 pm (January 15, 2008 April 9, 2008) Location: 602 Lewis Towers Instructor: Christina Jackson-Bailey, Ph.D. Email: cjacksonbailey@luc.... Date Added: 2009-02-11 21:00:41 |
| CPSY433-Jackson-Bailey-1082.pdf Path: Loyola Chicago >> WWW1 >> 1 Fall, 2008 Description: LOYOLA UNIVERSITY CHICAGO 433-001 Multicultural Counseling Spring Semester 2008 Class meets: Tuesdays 4:15pm - 6:45 pm (January 15, 2008 April 9, 2008) Location: 602 Lewis Towers Instructor: Christina Jackson-Bailey, Ph.D. Email: cjacksonbailey@luc.... Date Added: 2009-02-11 21:00:41 |
| 14_Nidhi_HPCA11_WS6.ppt Path: Rice >> LACSI >> 11 Fall, 2008 Description: Performance Monitoring on Pentium 4* Processor Nidhi nidhi.nidhi@intel.com IA 32 Performance Architect *Pentium is a trademark or registered trademark of Intel Corporation or its subsidiaries in the United States and other countries Outline Pent... Date Added: 2009-02-06 20:18:36 |
| 14_Nidhi_HPCA11_WS6.ppt Path: Rice >> LACSI >> 6 Fall, 2008 Description: Performance Monitoring on Pentium 4* Processor Nidhi nidhi.nidhi@intel.com IA 32 Performance Architect *Pentium is a trademark or registered trademark of Intel Corporation or its subsidiaries in the United States and other countries Outline Pent... Date Added: 2009-02-06 20:18:36 |
| bae.pdf Path: Martin Luther >> T >> 1 Fall, 2008 Description: ... Date Added: 2009-02-18 13:47:06 |
| bae.pdf Path: Washington State >> T >> 1 Fall, 2008 Description: ... Date Added: 2009-02-18 13:47:06 |
| naderi.pdf Path: Berkeley >> STAT >> 110 Fall, 2008 Description: Wildre Chances and Probabilistic Risk Assessment D. R. Brillinger1 , H. K. Preisler2 and H. M. Naderi1 Statistics Department1 University of California Berkeley, CA, 94720-3860 Pacic Southwest Research Station2 USDA Forest Service Albany, CA, 94710 Ke... Date Added: 2009-02-18 14:19:58 |
| naderi.pdf Path: Berkeley >> STATISTICS >> 110 Fall, 2008 Description: Wildre Chances and Probabilistic Risk Assessment D. R. Brillinger1 , H. K. Preisler2 and H. M. Naderi1 Statistics Department1 University of California Berkeley, CA, 94720-3860 Pacic Southwest Research Station2 USDA Forest Service Albany, CA, 94710 Ke... Date Added: 2009-02-18 14:24:42 |
| ART 114F.doc Path: Fullerton College >> ART >> 114F Fall, 2008 Description: ART 114F - Art History- Impressionism to the Present (3) Upon successful completion of this course the student will be able to: 1. 2. 3. 4. Identify common themes and purposes that underlie the art of all cultures. Identify styles of selected masterw... Date Added: 2009-02-02 14:20:59 |
| Lebanon Timeline.doc Path: Mary Baldwin >> ACADEMIC >> 128 Fall, 2008 Description: U.S. in Lebanon, 1982-84 June 3, 1982, P.L.O. gunmen shot Israeli Ambassador to the U.K., Shlomo Argov Israeli Defense Forces invaded Lebanon on June 6 and defeat P.L.O. by late June. PLO agreed to withdraw entirely from Lebanon on August 19, 1982... Date Added: 2009-02-11 21:43:50 |
| cinti.ppt Path: Ohio State >> WS >> 6 Fall, 2002 Description: HIV/AIDS-2004 Sandro Cinti, M.D. Advances in antiretroviral therapy 1) 2) 3) 4) 5) Epidemiology: scope of the problem Antiretrovirals: Whats available now Complications of antiretroviral therapy When and what antiretrovirals to start Selected cases... Date Added: 2009-02-17 22:28:18 |
| Absorption Spectroscopy Graph Path: Arizona >> CHEM >> 104A Fall, 2007 Description: 1.39E-06 2.74E-06 4.27E-06 0.511 5.57E-06 0.23 0.13 0.68 Absorbance 0.7 0.65 0.6 0.55 0.5 0.45 0.4 0.35 0.3 0.25 0.2 0.15 0.1 1.00E-06 2.00E-06 Row 2 3.00E-06 4.00E-06 5.00E-06 6.00E-06 Row 1 Row 4 Concentration ... Date Added: 2008-09-22 16:52:24 |
| IOE265HW1 Path: Michigan >> IOE >> 265 Winter, 2007 Description: IOE 265 W2007 HW #1 solutions Due: Mon Jan 22 at 9:00 AM (beginning of lecture) Please include your name, UM ID and lab section time in your written homework assignment. The assignment is worth 10 points. You may work with other students to discuss p... Date Added: 2008-03-07 09:18:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 351 Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> MUSIC >> 257 Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 652r Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> FLANG >> 201r Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 384r Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> MUSIC >> 351 Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 655r Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:47 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> FLANG >> 202r Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 387 Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 187 Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> HFL >> 380 Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 419a Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:58 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 215r Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> MUSIC >> 251 Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 462 Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 419b Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:58 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 285 Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> MUSIC >> 256 Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-09 18:55:57 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> TMA >> 565r Fall, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Acting_All_Dec._Materials08.pdf Path: BYU >> FLANG >> 102r Winter, 2008 Description: Acting Pre-Major Declaration (Major and Minor Degrees) Introduction The Acting Pre-Major is open enrollment for any student interested in being accepted into the BFA Acting Program or Music Dance Theatre. In order to track progress and to provide ap... Date Added: 2009-01-11 04:55:46 |
| Math 1307 ---3.1 Examples.pdf Path: Southern Methodist >> MATH >> 1307 Fall, 2008 Description: Math 1307-004 Finite Math _ Sec. 3.1 Terms: Simple Interest, Principal ( P), Interest, Interest rate ( r ); Amount Simple Interest (A) I=Prt ; A=P(1+rt) Formula: Examples: 1. $5000 is loaned for 10 months at 10% annual rate. How much is earned? 2... Date Added: 2009-01-09 10:29:48 |
| Lesbib.doc Path: North Texas >> CECS >> 6220 Fall, 2008 Description: Les M. Lunce Annotated Bibliography for CECS 6220, Spring 2005 Learners With Special Needs: Assistive & Adaptive Technologies Amberg, Elizabeth. (2000, February). Software - Focus on Special Needs. T.H.E. Journal Software/Courseware. Retrieved Octob... Date Added: 2009-02-03 14:08:35 |
| Lect13.ppt Path: NHMCCD >> PHYS >> 1404 Spring, 2008 Description: Forces & Magnetic Dipoles x B F F = AI = B U = B . Today. Application of equation for trajectory of charged particle in a constant magnetic field: Mass Spectrometer Magnetic Force on a current-carrying wire Current Loops Magnetic ... Date Added: 2009-01-11 16:28:55 |
| Lect13.ppt Path: NHMCCD >> PHYS >> 2425 Fall, 2008 Description: Forces & Magnetic Dipoles x B F F = AI = B U = B . Today. Application of equation for trajectory of charged particle in a constant magnetic field: Mass Spectrometer Magnetic Force on a current-carrying wire Current Loops Magnetic ... Date Added: 2009-01-11 16:28:56 |
| Lect13.ppt Path: NHMCCD >> PHYS >> 2426 Summer, 2008 Description: Forces & Magnetic Dipoles x B F F = AI = B U = B . Today. Application of equation for trajectory of charged particle in a constant magnetic field: Mass Spectrometer Magnetic Force on a current-carrying wire Current Loops Magnetic ... Date Added: 2009-01-12 03:32:54 |
| midterm1sol.pdf Path: SUNY Stony Brook >> PHY >> 251 Fall, 2008 Description: ... Date Added: 2009-01-11 18:20:41 |
| GEOL1122Exam22008.pdf Path: UGA >> GLY >> 1122 Fall, 2008 Description: ... Date Added: 2009-02-06 19:41:00 |
| 11635651725701.pdf Path: UPenn >> PLC >> 31 Fall, 2009 Description: Processing presupposition: verifying vs. falsifying sentences with only A long-standing debate about the meaning of sentences like \'Only A are B\' has to do with the nature of the inference that \'A are B\' (for Horn 1969, Geurts & van der Sandt 2004 i... Date Added: 2009-04-15 21:33:38 |
| Chapter 8 - Input-Output.doc Path: Tarleton >> C S >> 230 Fall, 2008 Description: Input and Output Chapter 7: Input/Output Java I/O 1 -1 Rev. 3.1 Input and Output Contents Objectives.4 Section 1: Introduction..5 Java I/O.6 InputStreamReader..7 BufferedReader.8 Reading an Integer..9 BufferedWriter.10 File Streams..11 StreamTo... Date Added: 2009-01-09 07:24:25 |
| expos paper 3 Path: Rutgers >> ENGLISH >> 101 Spring, 2008 Description: Constantine Simantiras 101: LG FD #3 Due Thursday, March 6 Finding Out for Yourself God is a word that strikes many thoughts in a single conversation. It is a strong topic that has well more than two sides. The word God is more than just a word. Go... Date Added: 2008-04-04 13:24:16 |
| interpolation.pdf Path: CA Merced >> CSE >> 185 Fall, 2008 Description: ... Date Added: 2009-01-10 01:37:02 |
| interpolation.pdf Path: CA Merced >> CSE >> 276 Fall, 2008 Description: ... Date Added: 2009-01-10 01:37:02 |
| interpolation.pdf Path: CA Merced >> CSE >> 286 Spring, 2008 Description: ... Date Added: 2009-01-10 01:37:02 |
| practicefinal.266..pdf Path: Purdue >> MA >> 266 Fall, 2008 Description: MA 266 FINAL EXAM INSTRUCTIONS May 2, 2005 NAME INSTRUCTOR 1. You must use a #2 pencil on the marksense sheet (answer sheet). 2. If the cover of your question booklet is GREEN, write 01 in the TEST/QUIZ NUMBER boxes and blacken in the appropriate sp... Date Added: 2009-02-02 15:45:17 |
| an2304b.txt Path: Michigan >> LIB >> 230402 Fall, 2002 Description: Federal Depository Library Program ADMINISTRATIVE NOTES Newsletter of the Federal Depository Library Program [ PDF version ] [ Back Issues ] -March 15, 2002 GP 3.16/3-2:23/04 (Vol. 23, no. 04) - New Chief of Receiving and Verification Section C... Date Added: 2009-02-11 21:15:43 |
| 1739.083.ps Path: Hawaii >> SOEST >> 1739 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207373155.0388276 Float: 1739 Profile: 083 Location: 37.8N 147.5E Date: 08/05... Date Added: 2009-02-17 19:57:05 |
| stats 363 HW 8-5 Path: Creighton >> MTH >> 1363 Spring, 2008 Description: Section 8.5 Exercise 8.23. The 90% con dence interval for x 1:645 p . n is given by (a) If n = 125, x = 0:84, and s2 = 0:086, then p 0:086 = 0:084 0:043 or 0:084 1:645 p 125 (b) If n = 50, x = 21:9, and s2 = 3:44, then p 3:44 21:9 1:645 p = 21:9 0:4... Date Added: 2008-04-20 13:34:11 |
| 8emulsionsbw.pdf Path: Auburn >> ANSC >> 4310 Fall, 2008 Description: Auburn University - Animal Sciences Assign: Ch. 9 & 10 in Processed Meats ANSC 4700 Meat Processing Emulsified Sausage Auburn University - Animal Sciences Auburn University - Animal Sciences Introduction Emulsion - a mixture of two immiscible li... Date Added: 2009-01-09 18:20:28 |
| 8emulsionsbw.pdf Path: Auburn >> ANSC >> 4700 Fall, 2008 Description: Auburn University - Animal Sciences Assign: Ch. 9 & 10 in Processed Meats ANSC 4700 Meat Processing Emulsified Sausage Auburn University - Animal Sciences Auburn University - Animal Sciences Introduction Emulsion - a mixture of two immiscible li... Date Added: 2009-01-09 18:20:39 |
| Assn #1 Path: Mt. SAC >> ENGL >> 1A Fall, 2008 Description: Michelle Lutz ENGL 1A MW 945AM-1155AM Beyond \"The Eye\" Edgar Allen Poe writes of such dark and eerie tales in which one would obviously assume the narrators insanity. He clearly wants his readers to understand the uncanny and mystery in his stories... Date Added: 2008-04-16 14:10:10 |
| stat5411_2008_assign_3_answers.pdf Path: Minnesota >> STAT >> 5411 Fall, 2008 Description: Stat 5411 Fall 2008 Assignment 3 Answers BC 9/19 Source Variety Error Corrected Total DF 2 9 11 Sum of Squares 0.22785000 0.09455000 0.32240000 Mean Square 0.11392500 0.01050556 F Value 10.84 Pr > F 0.0040 BC 9/22 5.0 2.66 20 21 df =85 60 in ta... Date Added: 2009-02-17 20:58:46 |
| McConnellSSChina Path: Ohio State >> ECON >> 508 Winter, 2006 Description: Social Security Reform in Transitional China OConnell 1 Social Security Reform in Transitional China Protection against the insecurities associated with old age and employment disability have long been an integral part of government activities. Yet... Date Added: 2008-07-17 15:40:30 |
| 311Exam_III.doc Path: Montana >> CHEM >> 312 Spring, 2008 Description: Exam III Chemistry 311 Name_ Please do not open the exam until told to do so. You will have 1 hour and 5 minutes to complete the test. Please promptly hand in your test when time is called. 1. The two enatiomers of a chiral compound generally show ... Date Added: 2009-01-09 04:19:18 |
| parssim1.pdf Path: Texas >> ICES >> 1 Fall, 2008 Description: Users Guide to Parssim1: The Parallel Subsurface Simulator, Single Phase Version: Parssim1 v. 2.1 May 1998 (Minor updates to February 21, 2006) Todd Arbogast Code Management: The Center for Subsurface Modeling Mary F. Wheeler, director, Steven Bryan... Date Added: 2009-02-11 22:35:56 |
| GEN ST 349 NURS 445 long.pdf Path: Washington >> ART >> 445 Fall, 2008 Description: spring Site: 2005 GEN ST/NURS 45th Street Clinic 349A/455B A Ensign Address: 1629 N 45th St. Location: Students will be doing their service at the clinic. Seattle WA 98103-6701 URL http:/www.psnhc.org/page/62/clini c_medical Overview: Missio... Date Added: 2009-02-02 20:30:51 |
| Final.pdf Path: UCSD >> COGS >> 17 Fall, 2008 Description: Posted Grades PID A05887809 A06199981 A06578705 A06708510 A06758198 A06888133 A06955961 A06991355 A07019013 A07049738 A07242451 A07263608 A07299165 A07305698 A07308707 A07341279 A07629772 A07649574 A07754340 A07883644 A07920263 A08166401 A08169238 A0... Date Added: 2009-01-11 21:33:59 |
| Final.pdf Path: UCSD >> COGS >> 99 Fall, 2008 Description: Posted Grades PID A05887809 A06199981 A06578705 A06708510 A06758198 A06888133 A06955961 A06991355 A07019013 A07049738 A07242451 A07263608 A07299165 A07305698 A07308707 A07341279 A07629772 A07649574 A07754340 A07883644 A07920263 A08166401 A08169238 A0... Date Added: 2009-01-11 21:33:59 |
| l210.pdf Path: Texas >> BOTANY >> 210 Fall, 2008 Description: . Cellulose II: 463-474, 2004. , . 2004 Kluwer Academic Publishers. Printed in Ihe Nelherlands. 463 Formation of nematic ordered cellulose and chitin Tetsuo Kondo I ,\"\', Wakako Kasai l and R. Malcolm Brown, Jr. l IGraduate School of Bioresources a... Date Added: 2009-02-11 22:43:06 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 626a Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 200 Spring, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:12 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 660s Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 461s Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:12 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDST >> 490 Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 490 Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDST >> 590 Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 490s Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDST >> 591d Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| EDPS301A Peer Mentor Training.pdf Path: Purdue >> EDPS >> 620c Fall, 2008 Description: SYLLABUS FOR EDPS 301A PEER MENTOR TRAINING SPRING 2004 Tuesday/Thursday 10:30am-11:45am HORIZONS Mission Statement The mission of the HORIZONS Student Support Program is to retain and graduate its participants at the highest possible rate with the h... Date Added: 2009-01-11 19:25:13 |
| 02 Energy Path: SUNY Stony Brook >> CHE >> 132 Spring, 2008 Description: Available Seats in Sections of CHE 132 Sec R29 R05 R30 R12 R18 R25 R21 R32 R22 R24 R26 R27 Day Tue Tue Tue Tue Tue Tue Thu Thu Thu Thu Thu Thu Start Time 08:20 AM 09:50 AM 09:50 AM 12:50 PM 02:20 PM 03:50 PM 08:20 AM 09:50 AM 02:20 PM 02:20 PM 03:50 ... Date Added: 2008-06-29 13:47:39 |
| 050712labor.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: seeurope.net : View StorySEEUROPE Google HOMENEWS TODAYNEWSLETTERABOUT USCONTACTSAD INFOTOP 100 INVESTMENT GUIDE COUNTRY RATINGS EVENTS CALENDAR SEE COUNTRIES SEE HOLIDAYS USEFUL LINKS DISCUSSION BOARD SIGHT SEEING GREECE: Labor Reform Talks Reach... Date Added: 2009-02-11 19:47:28 |
| 050407galbraith.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Economist.com | Articles by Subject | J.K. Galbraith Articles by subject: Topics: Economics BOOKS J.K. Galbraith Unconventional wisdom Apr 7th 2005 From The Economist print edition WHATEVER you may think of his ideas, John Kenneth Galbraith has le... Date Added: 2009-02-11 18:21:09 |
| EcologicalExperiments.pdf Path: Texas Tech >> PHIL >> 3302 Fall, 2008 Description: ... Date Added: 2009-02-03 13:35:38 |
| lecture26gc-2.pdf Path: Berkeley >> CS >> 164 Fall, 2008 Description: Automatic Memory Management Lecture 26 Prof. Necula CS 164 Lecture 26 1 Lecture Outine Why Automatic Memory Management? Garbage Collection Three Techniques Mark and Sweep Stop and Copy Reference Counting Prof. Necula CS 164 Lecture 26 2 1... Date Added: 2009-04-16 01:57:55 |
| LabReview08.ppt Path: Arkansas >> CSES >> 1203 Fall, 2008 Description: Lab Practicum Review What does iodine test for? What are adventitious roots? Why does fresh potato cause bubbling when in peroxide? Can you identify a X.S. of a leaf, stem or root under the microscope? What are simple or compound leaves? Can you iden... Date Added: 2009-01-09 19:11:54 |
| MATH 226 - 9.10.2007 Path: Bucknell >> MATH >> 226 Fall, 2007 Description: MATH 226 September 10, 2007 Numerical Summaries o Summary of location Sample Median 0.5 quantile; Q(.5); very center of the data range Sample Mean sum of all numbers divided by number of numbers x-bar = sigma(x, 1n)/n Sample Mode most often o... Date Added: 2008-04-07 12:58:22 |
| Socrates Path: University of Maine >> HON >> 111 Fall, 2007 Description: Zach Garcia Honors 111 Plato\'s the republic The Republic This was one of the more interesting books that we have read this year. I did not know much about Socrates or about what his life was like. But this book shed some light on what he was all abou... Date Added: 2008-04-07 16:48:19 |
| dp119499.pdf Path: Wisconsin >> IRP >> 1999 Fall, 2008 Description: Institute for Research on Poverty Discussion Paper no. 1194-99 The Earned Income Tax Credit and the Labor Supply of Married Couples Nada Eissa University of California, Berkeley and NBER E-mail: eissa@econ.berkeley.edu Hilary Williamson Hoynes Univ... Date Added: 2009-02-11 16:32:49 |
| Hsc70-CHIP.pdf Path: UNC >> BIOL >> 324 Fall, 2008 Description: The Hsc70 co-chaperone CHIP targets immature CFTR for proteasomal degradation Nature Cell Biology, 3 :100-105 Present by Liang Protein quality control is a posttranslational process, and is essential for functional cell activity. Accumulation of mis... Date Added: 2009-02-03 14:02:35 |
| article1 Path: Xavier >> PSYCH >> 101 Spring, 2008 Description: Psych 101 Prof. Rowekamp Vision and Color Contrast Vision is dependent on not only the eye, but also the brain. Incoming light hits the retina and the information works its way back through the rods and cones. It then goes through the bipolar cell la... Date Added: 2008-05-05 08:57:36 |
| Sep8_2008.pdf Path: Bemidji State >> CHEM >> 1211 Fall, 2009 Description: 9/8/2008 Periodic Table 1A 1 H 3 Li 11 Na 19 K 37 Rb 55 Cs 87 Fr 4 Be 12 Mg 20 Ca 38 Sr 56 Ba 88 Ra 3B 21 Sc 39 Y 57 La 89 Ac 4B 22 Ti 40 Zr 72 Hf 104 Rf 5B 23 V 41 Nb 73 Ta 105 Db 6B 24 Cr 42 Mo 74 W 106 Sg 7B 25 Mn 43 Tc 75 Re 107 Bh 8B 26 Fe 44 R... Date Added: 2009-04-15 22:20:59 |
| testAndQuizScoresSoFar030b.txt Path: UNI >> 240 >> 030 Spring, 2008 Description: -Q1Pts -10 10 9.5 10 10 9.5 10 7.5 10 10 6.5 8 6.5 9 6 4.5 7.5 9 -Q1Pts -6 6.5 6 8.5 6.5 7 4.5 6.5 6 7 1 6 4 -Q1Pts - - - -Q2Pts Q3Pts Qpoints TPts QTPts Rank - - -18 9.5 140 100 240 1 NTBPM 16.5 11 142 96 237 2 HQQGH 18 11.5 145 91 237 3 VVPZX 17 1... Date Added: 2009-02-02 20:00:15 |
| PracticeQ_solns.pdf Path: Penn State >> MATH >> 141b Spring, 2008 Description: ... Date Added: 2009-01-09 06:18:23 |
| EcologyTest2Studying Path: CSU Fresno >> BIOSC >> 130 Spring, 2008 Description: LECTURE 7 POPULATION DISTRIBUTIONS AND ABUNDANCE * What factors typically limit species distribution? - Environment - No species can tolerate the full range of the earth\'s environments - Adapted to a particular environment.climate may influence dire... Date Added: 2008-04-03 21:48:58 |
| 336syllabus.pdf Path: George Mason >> PCOOPER >> 6 Fall, 2009 Description: CHEMISTRY336 PHYSICALCHEMISTRYLABORATORYI Instructor: OfficeHrs: Instructor: OfficeHrs: Text: Dr.PaulCooper; M Rm.335,STI; Email:pcooper6@gmu.edu Ph.(703)9932403 Email:kapettigrew@gmail.com Dr.KatherinePettigrew;Rm.326A,STI M&W11AM12PM... Date Added: 2009-04-16 01:28:39 |
| Ch03 Path: Purdue >> ECON >> 251 Spring, 2008 Description: CHAPTER 3 Demand and Supply After studying this chapter you will be able to Describe a competitive market and think about a price as an opportunity cost Explain the influences on demand Explain the influences on supply Explain how demand and suppl... Date Added: 2008-04-01 18:03:31 |
| W07midterm.doc Path: UCSB >> INT >> 20 Winter, 2008 Description: CPE 103 Midterm B Winter 2007 Name_ 1) Write the recurrence equation for each of the following processes. The unit of work is a multiply. Dont solve the equations, just write them down. (4 pts each) a) testMethod( int n ) { int num = 1; result = 1... Date Added: 2009-02-02 17:34:02 |
| lesson18.ppt Path: University of San Francisco >> CS >> 686 Fall, 2008 Description: Utilizing NIC\'s enhancements A look at how driver software needs to change when using newer features of our hardware `theory\' versus `practice\' The engineering designs one encounters in computer hardware components can be observed to undergo an `ev... Date Added: 2009-04-15 20:32:57 |
| debtcrisis6.pdf Path: S.F. State >> ONLINE >> 620 Fall, 2008 Description: Econ 620 Handout # 6 Dr. King Debt and Currency Crises Balance of Payments Crises and Capital Flight. The Balance of Payments and the Money Supply Credit (1) Exports of Goods and services (3) Private export of assets (capital inflow) (5) Foreign CB... Date Added: 2009-02-17 19:05:13 |
| 09-1107 Path: Berkeley >> SOC >> 124 Fall, 2007 Description: Soc 124 09/1107 Human Capital >combination of individ, cult and struct based theory >attribs of the theory -investment of the individ in his/her future by developing tech skills that will be used to sell oneself in the labor market (look behind a res... Date Added: 2008-04-01 19:44:24 |
| Object Space Normal Mapping Tutorial.pdf Path: UF >> CAP >> 5705 Fall, 2008 Description: Object Space Normal Mapping Tutorial http:/www.3dkingdoms.com/tutorial.htm go to Tutorials Page | go to 3DKingdoms.com Object Space Normal Mapping with Skeletal Animation Tutorial by Jonathan Kreuzer (All 3D models by Josh Hess) www.3dkingdoms.com... Date Added: 2009-02-02 17:50:03 |
| Table of Contents for portfolio Path: SUNY Oswego >> EDU >> 200 Fall, 2007 Description: Table of Contents Section One Position Papers Section Two PowerPoint Presentation Section Three Journal Reflections Section Four Final Reflection Section Five Rubrics ... Date Added: 2008-04-07 10:21:22 |
| CLOs.pdf Path: Michigan State University >> ME >> 410 Fall, 2008 Description: Heat Transfer Course Learning Objectives 1. 2. 3. Students understand and are able to use the conduction, convection and radiation rate equations Students are able to use the conservation of energy to solve problems Students are able to solve one-dim... Date Added: 2009-01-09 02:51:40 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 2201 Fall, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 1102 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 2202 Fall, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 1103 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 2204 Fall, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 1105 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 2206 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:47 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 1106 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 1100 Fall, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 2207 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:47 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 2200 Fall, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| thea_1151.doc Path: Fairmont State >> PHTA >> 1101 Spring, 2008 Description: Course Outcomes-Suggested Template Updated 2/7/08 Course number and title: 1151 Text Analysis Submission date: 3/5/08 Submitted by: John O\'Connor Course: THEA 1151 Text Analysis Instructor (name/email): John OConnor/joconnor@fairmontstate.edu Date: ... Date Added: 2009-01-10 18:13:46 |
| li_Tang.ppt Path: BYU >> P MGT >> 652 Winter, 2008 Description: A Probabilistic Model for Classification of Multiple-Record Web Documents June Tang Yiu-Kai Ng Overview Probabilistic Model Bayes decision theory Document and query representations Ranking-function construction Multivariant Statistical Anal... Date Added: 2009-01-11 04:53:08 |
| 550_schedule_summary.pdf Path: Washington >> POL S >> 550 Winter, 2008 Description: ENVIR 550/BBUS 550 Spring 2003 University of Washington Hund & Laverty Schedule of class sessions The following table presents an overview. Please refer to the detail below. Week 1 2 Date Apr 1 Apr 3 Apr 8 Apr 10 3 Apr 15 Apr 17 4 5 6 Apr 22 Apr ... Date Added: 2009-02-02 20:36:23 |
| webj-468m castaneda.pdf Path: USC >> JOUR >> 468m Fall, 2008 Description: THE AMERICAN PRESS AND ISSUES OF SEXUAL DIVERSITY (J-468m) Fall 2007 Laura Castaeda COURSE OBJECTIVE: The movement for gay rights is one of the most hotly contested issues of the last 30 years. The 1990s saw an explosion of news coverage, talk show... Date Added: 2009-02-02 20:12:58 |
| AATP_Policy.doc Path: Pasco-Hernando Community College >> MCB >> 2010l Fall, 2008 Description: MANATEE COMMUNITY COLLEGE ACADEMIC AFFAIRS TESTING POLICY Enrollment Services, through the Assessment/Testing Centers on each campus, offers an extensive program of group and individual testing designed to meet the needs of students. The Assessment/T... Date Added: 2009-01-09 06:04:48 |
| AATP_Policy.doc Path: Pasco-Hernando Community College >> PEM >> 1132 Fall, 2008 Description: MANATEE COMMUNITY COLLEGE ACADEMIC AFFAIRS TESTING POLICY Enrollment Services, through the Assessment/Testing Centers on each campus, offers an extensive program of group and individual testing designed to meet the needs of students. The Assessment/T... Date Added: 2009-01-09 06:07:11 |
| AATP_Policy.doc Path: Pasco-Hernando Community College >> PHY >> 2049c Spring, 2008 Description: MANATEE COMMUNITY COLLEGE ACADEMIC AFFAIRS TESTING POLICY Enrollment Services, through the Assessment/Testing Centers on each campus, offers an extensive program of group and individual testing designed to meet the needs of students. The Assessment/T... Date Added: 2009-01-09 15:17:07 |
| mid_term12-07-06-solution Path: UCLA >> MAE >> 105A Fall, 2006 Description: ... Date Added: 2009-04-11 00:32:03 |
| sec050701.pdf Path: Texas >> SEC >> 050701 Fall, 2008 Description: 1250 DOCUMENTS OF THE GENERAL FACULTY SECRETARY\'S REPORT May 7, 2001 I. II. COMMENTS None. MEMORIAL RESOLUTION COMMITTEES APPOINTED BY THE PRESIDENT. On April 19, 2001, President Faulkner appointed the following committee to prepare a memorial reso... Date Added: 2009-02-17 18:14:17 |
| sec050701.pdf Path: Caribbean >> SEC >> 050701 Fall, 2008 Description: 1250 DOCUMENTS OF THE GENERAL FACULTY SECRETARY\'S REPORT May 7, 2001 I. II. COMMENTS None. MEMORIAL RESOLUTION COMMITTEES APPOINTED BY THE PRESIDENT. On April 19, 2001, President Faulkner appointed the following committee to prepare a memorial reso... Date Added: 2009-02-17 18:14:17 |
| Chapter 6 Path: UGA >> ACCT >> 2101 Spring, 2008 Description: 6 CHAPTER Reporting and Analyzing Cash and Internal Controls Purpose of Internal Control Policies and procedures managers use to: 1. Protect assets. 2. Ensure reliable accounting. 3. Promote efficient operations. 4. Urge adherence to company polici... Date Added: 2008-04-08 08:33:10 |
| 12 - Student Outline Population, Immigration and Urbanization Path: Evansville >> SOC >> 105 Fall, 2007 Description: The Dynamic Population Demography It is the scientific study of the size, growth and composition and distribution of human population, and how these factor change over time. Although the study of demography involves mathematics and statistics. The... Date Added: 2008-04-07 14:32:46 |
| 5733 syllabus sp07.pdf Path: Oklahoma >> ECON >> 5733 Fall, 2008 Description: ... Date Added: 2009-02-02 20:02:57 |
| Econ-671-Syllabus.pdf Path: Michigan >> LAW >> 671 Fall, 2008 Description: Economics 671: Econometric Analysis I Department of Economics, University of Michigan, Fall 2008 1 Description This is the rst course in the two-course block that forms the basic required sequence in Econometrics for all doctoral students in Economi... Date Added: 2009-02-02 19:36:25 |
| NOTES_BIO_27_091003 Path: USC >> BISC >> 120Lg Fall, 2005 Description: Prokaryote Diversity First organisms on Earth. Biomass of bacteria at least 10x of all eukaryotes. Thrive in extreme environments. Great diversity: 5000 species described. 400k-4million estimated. Not only disease causing organisms Benign, intestinal... Date Added: 2007-10-16 20:07:36 |
| 14-NewNamedSpaces.pdf Path: Iowa State >> MIS >> 440x Fall, 2008 Description: DEVELO PM ENT College Dedicates Three New Named Spaces D R . C H A R L E S B . H A N D Y G R A D U AT E PROGRAMS OFFICE Today we honor Dr. Charles Handy, a man whose dedication and perseverance helped build business education at ISU. LABH HIRA Th... Date Added: 2009-01-09 02:08:32 |
| 14-NewNamedSpaces.pdf Path: Iowa State >> SCM >> 524x Fall, 2008 Description: DEVELO PM ENT College Dedicates Three New Named Spaces D R . C H A R L E S B . H A N D Y G R A D U AT E PROGRAMS OFFICE Today we honor Dr. Charles Handy, a man whose dedication and perseverance helped build business education at ISU. LABH HIRA Th... Date Added: 2009-01-09 02:08:32 |
| RavizzaZachos.pdf Path: UF >> GLY >> 5736 Fall, 2008 Description: 6.20 Records of Cenozoic Ocean Chemistry G. E. Ravizza University of Hawaii, Manoa, HI, USA and J. C. Zachos University of California, Santa Cruz, CA, USA 6.20.1 INTRODUCTION 6.20.2 CENOZOIC DEEP-SEA STABLE ISOTOPE RECORD 6.20.2.1 Oxygen Isotopes and... Date Added: 2009-01-10 18:33:11 |
| 2-27-06 Hist105 Path: Texas A&M >> HIST >> 105 Spring, 2006 Description: Review o Era of Good Feelings through the mid 1820s o Americans have a sense of common purpous, especially in matters of economic goals. o Economic Trinity becomes accepted policy Protective tariffs, rechartering the Bank of US, federal... Date Added: 2008-10-27 00:21:32 |
| Required_Criminal_Records_Check.pdf Path: Malone >> MEDIA >> 163 Fall, 2009 Description: Counselor, Social Worker Fax 614-728-7790 http:/cswmft.ohio.gov & cswmft.info@cswb.state.oh.us CRIMINAL RECORDS CHECK REQUIRED FOR INITIA... Date Added: 2009-04-15 21:42:47 |
| pls 293 campaign.doc Path: Michigan State University >> AT >> 293 Fall, 2008 Description: Michael Wolf PLS 392 4/19/06 Political Campaign Johnny Patriot Candidate Platform: County Commissioner: Ensuring a better future by improving the world around us today Goals: aesthetically improve the Ingham county area; create better police communit... Date Added: 2009-02-02 14:50:28 |
| Corvidae_06.pdf Path: NMSU >> BIOLOGY-WE >> 5 Fall, 2008 Description: Proc. R. Soc. B (2006) 273, 11171125 doi:10.1098/rspb.2005.3431 Published online 14 February 2006 Out of Gondwanaland; the evolutionary history of cooperative breeding and social behaviour among crows, magpies, jays and allies Jan Ekman1,2,* and Per... Date Added: 2009-02-06 20:58:10 |
| physicspostlab2 Path: Vermont >> PHYS >> 22 Spring, 2008 Description: Question 1 (5 points) Select the word on the right that best fits the blank in each sentence below. (Please note! wrong matches will subtract from correct ones). Preview columns: 1. Electric field lines always cross _to equipotential lines. 2. Equipo... Date Added: 2008-04-17 20:54:10 |
| MUS 332.3.pdf Path: UNC Greensboro >> MUS >> 332 Fall, 2008 Description: MUS 332.01 History of Western Music II (3:3) CLASS MEETINGS: M-W-F 10:00-10:50, 223 SoM OFFICE HOURS: T 2:30-3:30, W 8:30-9:30, and by appointment Prof. Anne Parks 242 School of Music a_parks2@uncg.edu Music 332, History of Western Music II, is the... Date Added: 2009-02-02 19:56:48 |
| Biologych10 Path: UNC >> BIOL >> 101 Spring, 2008 Description: 10.1 Mendel\'s Insight into Inheritance Patterns Contrary to once trusted \"blending\" theory, only the frequency of each version of a trait among individuals of a population may persist/change over time Before Darwin\'s theory, a monk, Gregor Mendel, ha... Date Added: 2008-04-01 01:35:07 |
| 13.59 Path: Cal Poly >> PHYS >> 141 Spring, 2008 Description: ... Date Added: 2008-04-10 15:19:21 |
| Governtment chapter notes Path: Texas >> GOV >> 310L Spring, 2008 Description: Book Notes Chapter 7 Book Notes The Media The Alien and Sedition Acts were enacted by the Federalists in an attempt to silence the Republican press. Types of Media o Broadcast media o Print media Rely on leading newspapers to set their agenda. It ... Date Added: 2008-09-01 14:35:07 |
| 060205cyanide.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: CorpWatch BULGARIA: Bulgarians Protest Use of Cyanide Leaching by Michael Werbowski, World Press February 5th, 2006 The cyanide \"leakage\" that killed tons of fish in the Czech river Labe (Elbe) recently has re-focused public attention throughout cent... Date Added: 2009-02-11 18:45:43 |
| 060205cyanide.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: CorpWatch BULGARIA: Bulgarians Protest Use of Cyanide Leaching by Michael Werbowski, World Press February 5th, 2006 The cyanide \"leakage\" that killed tons of fish in the Czech river Labe (Elbe) recently has re-focused public attention throughout cent... Date Added: 2009-02-11 19:55:35 |
| 530-03_opening.ppt Path: Rutgers >> 610 >> 530 Fall, 2008 Description: PRINCIPLES OF SEARCHING 17:610:530 (01) Tefko Saracevic SCILS, Rm. 306 (732)932-7500/Ext. 8222 tefko@scils.rutgers.edu Tefko Saracevic, Rutgers University 1 Communication x Course web site: http:/www.scils.rutgers.edu/~tefko/Courses posted wil... Date Added: 2009-02-02 15:52:06 |
| 15-seq.pdf Path: San Diego State >> LING >> 795 Fall, 2008 Description: Parameter estimation For a trigram model: P(wn2, wn1, wn ) P(wn |wn2, wn1) = P(wn2, wn1) So, we need to estimate the marginal bigram and trigram probabilities. If we want to estimate the parameter vector from a training corpus c, then nd: = arg... Date Added: 2009-01-10 00:08:21 |
| 15-seq.pdf Path: San Diego State >> ART >> 696 Fall, 2008 Description: Parameter estimation For a trigram model: P(wn2, wn1, wn ) P(wn |wn2, wn1) = P(wn2, wn1) So, we need to estimate the marginal bigram and trigram probabilities. If we want to estimate the parameter vector from a training corpus c, then nd: = arg... Date Added: 2009-01-10 17:27:56 |
| 15-seq.pdf Path: San Diego State >> LING >> 681 Fall, 2008 Description: Parameter estimation For a trigram model: P(wn2, wn1, wn ) P(wn |wn2, wn1) = P(wn2, wn1) So, we need to estimate the marginal bigram and trigram probabilities. If we want to estimate the parameter vector from a training corpus c, then nd: = arg... Date Added: 2009-01-10 17:27:56 |
| 15-seq.pdf Path: San Diego State >> LING >> 696 Fall, 2008 Description: Parameter estimation For a trigram model: P(wn2, wn1, wn ) P(wn |wn2, wn1) = P(wn2, wn1) So, we need to estimate the marginal bigram and trigram probabilities. If we want to estimate the parameter vector from a training corpus c, then nd: = arg... Date Added: 2009-01-10 17:27:56 |
| 15-seq.pdf Path: San Diego State >> LING >> 571 Fall, 2008 Description: Parameter estimation For a trigram model: P(wn2, wn1, wn ) P(wn |wn2, wn1) = P(wn2, wn1) So, we need to estimate the marginal bigram and trigram probabilities. If we want to estimate the parameter vector from a training corpus c, then nd: = arg... Date Added: 2009-01-10 00:08:21 |
| vita.pdf Path: Virginia Tech >> LIB >> 110798 Fall, 2008 Description: VITA Michelle Lynn Glaze was born in Alexandria, Virginia on June 17, 1974. Being brought up as a military brat she attended public schools in Missouri, Virginia, Georgia, Minnesota, and New Mexico. After her family returned to Virginia, she attende... Date Added: 2009-02-18 00:51:11 |
| h2-solutions.pdf Path: N.C. State >> CSC >> 450 Fall, 2008 Description: CSC 750 Service-Oriented Computing H2 1/10/2007 Solution and Grading Key 1. (8 points) Identify all of the following statements that are true about extended transaction models A. An extended transaction must have a vital subtransaction B. A vital ... Date Added: 2009-01-12 03:49:16 |
| h2-solutions.pdf Path: N.C. State >> CSC >> 750 Spring, 2008 Description: CSC 750 Service-Oriented Computing H2 1/10/2007 Solution and Grading Key 1. (8 points) Identify all of the following statements that are true about extended transaction models A. An extended transaction must have a vital subtransaction B. A vital ... Date Added: 2009-01-12 03:49:16 |
| 021030rescue.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / World / Asia-Pacific Thursday Oct 31 2002. All times are London time. Subscribe to FT.com Username Password Subscribe now To explore our exclusive features take a tour Home Global| UK | US World US UK Europe Asia-Pacific Middle East & Afr... Date Added: 2009-02-11 18:20:04 |
| fire7.pdf Path: Iowa State >> ARTGR >> 573 Fall, 2008 Description: GENERIC RISK ASSESSMENT 3.6 FIGHTING FIRES - USING POSITIVE PRESSURE VENTILATION SCOPE This document examines the hazards, risks and controls that relate to the use of Positive Pressure Ventilation (PPV) during operational incidents. PPV can be achie... Date Added: 2009-01-09 08:02:30 |
| fire7.pdf Path: Iowa State >> ARTGR >> 591 Fall, 2008 Description: GENERIC RISK ASSESSMENT 3.6 FIGHTING FIRES - USING POSITIVE PRESSURE VENTILATION SCOPE This document examines the hazards, risks and controls that relate to the use of Positive Pressure Ventilation (PPV) during operational incidents. PPV can be achie... Date Added: 2009-01-09 08:02:31 |
| prob12.pdf Path: Duke >> STA >> 104 Summer, 2008 Description: Mathematics 149S Fall 1997 Problem Set 12 Todays problems come from The Wohascum County Problem Book. 1. Suppose 64 points in the plane are positioned so that 2001, but no more, distinct lines can be drawn through pairs of points. Prove that at leas... Date Added: 2009-01-10 02:55:15 |
| prob12.pdf Path: Duke >> STA >> 135 Spring, 2008 Description: Mathematics 149S Fall 1997 Problem Set 12 Todays problems come from The Wohascum County Problem Book. 1. Suppose 64 points in the plane are positioned so that 2001, but no more, distinct lines can be drawn through pairs of points. Prove that at leas... Date Added: 2009-01-10 02:55:15 |
| prob12.pdf Path: Duke >> STA >> 253 Fall, 2008 Description: Mathematics 149S Fall 1997 Problem Set 12 Todays problems come from The Wohascum County Problem Book. 1. Suppose 64 points in the plane are positioned so that 2001, but no more, distinct lines can be drawn through pairs of points. Prove that at leas... Date Added: 2009-01-11 22:15:22 |
| FMS 483 Fall 08.doc Path: ASU >> FMS >> 483 Fall, 2008 Description: FMS 483: TECHNO-ENTERTAINMENT CONVERGENCES Fall 2008 Tu/Th 10:30 11:45am, LL648C Profes sor: Office : Hours : Mailb ox: Email: Victoria Meng LL 643D Tu/Th 12-1pm or by appointment FMS department main office Victoria.meng@asu.edu Please refer to t... Date Added: 2009-02-02 21:17:41 |
| capenexamIIv3.doc Path: East Carolina >> OMGT >> 6683 Fall, 2008 Description: ... Date Added: 2009-01-12 14:56:29 |
| encrypted.txt Path: Western Washington >> CSCI >> 211 Fall, 2008 Description: INGVZKX 1 RUUSOTMY. IGRR SK OYNSGKR. YUSK EKGXY GMU-TKBKX SOTJ NUC RUTM VXKIOYKRE-NGBOTM ROZZRK UX TU SUTKE OT SE VAXYK, GTJ TUZNOTM VGXZOIARGX ZU OTZKXKYZ SK UT YNUXK, O ZNUAMNZ O CUARJ YGOR GHUAZ G ROZZRK GTJ YKK ZNK CGZKXE VGXZ UL ZNK CUXRJ. OZ OY... Date Added: 2009-02-02 21:06:45 |
| 2008-05-26-672.pdf Path: Oregon State >> NR >> 405 Fall, 2008 Description: acueEllerq PuEIS,tu.trv leu\'opocold&c@col \'zr?a3au O Sn, ?l,(rpBD[ueurBz \'rplllsd?I o a^ $e ur^ -er?o?p nunqu!,r8 Dlleg rrq II,{ \'Io[ rAIq nq el^oqspuu?l -ap J?p)I ?ullrf 0861ueur -!er eurseuryo -f?seul Sruruuqelrur ?uoue^ {Blue \'J?A JPI -eug uruuelr... Date Added: 2009-01-11 19:11:32 |
| 2008-05-26-672.pdf Path: Oregon State >> NR >> 499 Fall, 2008 Description: acueEllerq PuEIS,tu.trv leu\'opocold&c@col \'zr?a3au O Sn, ?l,(rpBD[ueurBz \'rplllsd?I o a^ $e ur^ -er?o?p nunqu!,r8 Dlleg rrq II,{ \'Io[ rAIq nq el^oqspuu?l -ap J?p)I ?ullrf 0861ueur -!er eurseuryo -f?seul Sruruuqelrur ?uoue^ {Blue \'J?A JPI -eug uruuelr... Date Added: 2009-01-11 19:11:32 |
| 2008-05-26-672.pdf Path: Oregon State >> ECE >> 483 Spring, 2008 Description: acueEllerq PuEIS,tu.trv leu\'opocold&c@col \'zr?a3au O Sn, ?l,(rpBD[ueurBz \'rplllsd?I o a^ $e ur^ -er?o?p nunqu!,r8 Dlleg rrq II,{ \'Io[ rAIq nq el^oqspuu?l -ap J?p)I ?ullrf 0861ueur -!er eurseuryo -f?seul Sruruuqelrur ?uoue^ {Blue \'J?A JPI -eug uruuelr... Date Added: 2009-01-11 19:11:32 |
| 2008-05-26-672.pdf Path: Oregon State >> TA >> 401 Fall, 2008 Description: acueEllerq PuEIS,tu.trv leu\'opocold&c@col \'zr?a3au O Sn, ?l,(rpBD[ueurBz \'rplllsd?I o a^ $e ur^ -er?o?p nunqu!,r8 Dlleg rrq II,{ \'Io[ rAIq nq el^oqspuu?l -ap J?p)I ?ullrf 0861ueur -!er eurseuryo -f?seul Sruruuqelrur ?uoue^ {Blue \'J?A JPI -eug uruuelr... Date Added: 2009-01-11 19:11:32 |
| 10894.pdf Path: USC >> MARSHALL >> 055 Fall, 2008 Description: Presentation to Marshall School of Business Students Federal Reserve Bank of San Francisco February 14, 2008 I. What is Community Development? Broad definition: Process/activities designed to create conditions of economic and social prosperity for... Date Added: 2009-02-18 02:01:19 |
| EX A-3.xlsx Path: Olympic College >> CMPTR >> 150 Spring, 2008 Description: Property Address Price Bedrooms Bathrooms Total ... Date Added: 2009-01-09 05:56:14 |
| EX A-3 Path: JCCC >> CIS >> 124 Spring, 2008 Description: Property Address Price Bedrooms Bathrooms Total ... Date Added: 2008-05-14 13:49:32 |
| Gutierrez - SPAN 304.doc Path: Ole Miss >> SPAN >> 304 Fall, 2008 Description: UniversityofMississippi DepartmentofModernLanguages Spring2008 Spanish304CroftSection Professor: Dr.JohnR.Gutirrez E211ABondurantHall johng@olemiss.edu 1:003:00TuesdaysandThursdays oranyothertimebyappointment. 9157717or9157298 OfficeHours: Office... Date Added: 2009-02-02 19:47:01 |
| EPS 625 PHX - Spring 2006.doc Path: N. Arizona >> EPS >> 625 Fall, 2008 Description: College of Education VISION STATEMENT We develop educational leaders who create tomorrows opportunities. MISSION STATEMENT Our mission is to prepare professionals to serve and lead education and human services organizations. DEPARTMENT OF EDUCATION... Date Added: 2009-02-02 15:12:27 |
| Lesson Plan for v-cell.doc Path: ND State >> BIOL >> 600 Fall, 2008 Description: LESSON PLAN FOR DAY ONE OBJECTIVES FOR STUDENTS: Students will understand that different things are specialized in their function and are interdependent upon each other. ( 12.1.1 , 12.1.5) Students will use the process of inquiry to solve problems... Date Added: 2009-02-02 15:10:22 |
| p130.pdf Path: SUNY Stony Brook >> PHY >> 501 Fall, 2008 Description: ... Date Added: 2009-01-11 19:45:48 |
| J Phys Chem B 2006 110 11665.pdf Path: Berkeley >> NE STUD >> 110 Fall, 2008 Description: J. Phys. Chem. B 2006, 110, 11665-11676 11665 An In Situ Al K-Edge XAS Investigation of the Local Environment of H+- and Cu+-Exchanged USY and ZSM-5 Zeolites Ian J. Drake, Yihua Zhang, Mary K. Gilles, C. N. Teris Liu, Ponnusamy Nachimuthu,|, Rupert... Date Added: 2009-02-02 17:01:48 |
| Lec 06, H atom, Orbitals, Energy Levels, Chem 4A F08, Pines.pdf Path: Berkeley >> CHEM >> 4a Fall, 2008 Description: Chem 4A F2008 Lecture 06: H-Atom Orbitals Energy Levels Particle in a Box -h2 d2 +V = E 2m dx2 nx n(x) = _ sin( L ) (x) 2 sin( L L 9/10/2008 22 En = n h 2 8mL (x)2 ~ Probability Excited States Ground State 2008 A. Pines M. Kubinec (x) + + + L... Date Added: 2009-01-09 19:20:36 |
| class1 Path: Texas A&M >> CHEM >> 107 Spring, 2008 Description: Class #1 Atoms M University Qatar Chemistry Molecules All matter is composed of atoms. Two or more atoms... Date Added: 2008-03-29 17:38:20 |
| Chapter-10.pdf Path: RIT >> RITDML >> 1850 Fall, 1993 Description: American Families in Crisis Teenage Pregnancy Why Teenage Pregnancy Occurs .5 Statistics on Teenage Pregnancy.6 How Will Becoming a Teenage Mother Affect the Girl ?..7 How Will Becoming a Teenage Father Affect the Boy ?.8 Options Available to Pregna... Date Added: 2009-02-11 17:16:01 |
| Chapter-10.pdf Path: RIT >> RITDML >> 927 Fall, 2008 Description: American Families in Crisis Teenage Pregnancy Why Teenage Pregnancy Occurs .5 Statistics on Teenage Pregnancy.6 How Will Becoming a Teenage Mother Affect the Girl ?..7 How Will Becoming a Teenage Father Affect the Boy ?.8 Options Available to Pregna... Date Added: 2009-02-11 17:16:01 |
| 2007__Exam_3_with_key Path: Michigan State University >> ANS >> 313 Fall, 2007 Description: ANS 313 Exam 3, October 17, 2007 Name: _ Labgroup: _ (100 points; 2 points/question) Complete scantron for all answers. You may keep this for your records. True/False 1. T F Much of the requirement for leucine could be met by feeding its respective k... Date Added: 2008-03-19 02:58:37 |
| HIS 102H Lsn 7 Socialism and Global Depression.ppt Path: Southern Miss. >> ART >> 102 Fall, 2008 Description: Part 1: Socialism Part 2: Global Depression Theme: The relationship between the economy and society Lesson 7 Part 1: Socialism Lesson 7 Putting It All Together Enlightenment Capitalism Steam powered machines More incentive, more capability, more d... Date Added: 2009-02-02 20:15:56 |
| Microscope.doc Path: NHMCCD >> BIOL >> 1407 Spring, 2008 Description: WORD LIST ARM BACILLUS BASE CAPSULE CENTER COARSE ADJUSTMENT COCCUS COMPOUND CONDENSER DARK FIELD DOWN ELECTRON ENDOSPORES FIELD OF VIEW FINE ADJUSTMENT FLAGELLUM FORTY FORTY FOUR HIGH POWER IMMERSION OIL IRIS DIAPHRAGM LENS PAPER LIGHT LOW POWER MEC... Date Added: 2009-01-09 15:14:06 |
| OrganizerPages.pdf Path: Kent State >> ANTH >> 18210 Fall, 2008 Description: Vista 3.0 for Instructors/Designers Organize Your Course Materials with Organizer Pages Overview: In order to keep your Home Page uncluttered, you can create additional pages called Organizer Pages. An Organizer Page is simply a folder into which oth... Date Added: 2009-01-09 02:26:04 |
| Problem set 7 Solutions Path: UCSB >> CHEM >> 2B Winter, 2007 Description: Problem set 7 Solutions ... Date Added: 2008-08-06 11:58:55 |
| az13593b2.pdf Path: Arizona >> AZ >> 1359 Fall, 2008 Description: Interactive Effects of Salinity and Primo on the Growth of Kentucky Bluegrass 1 M. Pessarakli1, K.B. Marcum2, D.M. Kopec1, and Y.L. Qian3 University of Arizona, 2Texas A&M University, 3Colorado State University Abstract Kentucky bluegrass (Poa prat... Date Added: 2009-04-15 23:06:37 |
| Equation Sheet_Test 2 Path: Clemson >> PHYS >> 208 Spring, 2008 Description: FORMULA SHEET (TEST NO.2) 1) 4 6) = 2) 5) 7) 3) 8) : 9) 10) 11) 12) 13) 14) 16) 17) 18) 19) 21) 22) ... Date Added: 2008-04-21 10:45:29 |
| Rolling_objects.doc Path: Alabama >> PH >> 125 Fall, 2008 Description: Rolling Objects In this exercise you will compare the rolling speeds of several round objects down an incline. Preliminary questions 1. Two solid spheres have the same radius but have different masses. If they are simultaneously released from rest at... Date Added: 2009-01-09 07:29:14 |
| lifesci3_1_syl081.pdf Path: UCLA >> EE BIOL >> 133 Fall, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:34 |
| lifesci3_1_syl081.pdf Path: UCLA >> LIFESCI >> 4 Fall, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:33 |
| lifesci3_1_syl081.pdf Path: UCLA >> LIFESCI >> 1 Fall, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:33 |
| lifesci3_1_syl081.pdf Path: UCLA >> PHY SCI >> 13 Summer, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:34 |
| lifesci3_1_syl081.pdf Path: UCLA >> LIFESCI >> 192a Fall, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:33 |
| lifesci3_1_syl081.pdf Path: UCLA >> PHY SCI >> 133 Summer, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:34 |
| lifesci3_1_syl081.pdf Path: UCLA >> LIFESCI >> 192b Summer, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:33 |
| lifesci3_1_syl081.pdf Path: UCLA >> PHY SCI >> 153 Summer, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:34 |
| lifesci3_1_syl081.pdf Path: UCLA >> LIFESCI >> 2 Fall, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:33 |
| lifesci3_1_syl081.pdf Path: UCLA >> PHY SCI >> 166 Summer, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:34 |
| lifesci3_1_syl081.pdf Path: UCLA >> LIFESCI >> 3 Fall, 2008 Description: Life Sciences 3: Introduction to Molecular Biology UCLA Summer Session A - June 23, 2008 to August 1, 2008 Lectures: M/W/F 9:00-10:50am Location: FRANZ 1178 LS3 Instructor Information: Angel P. Tabancay, Jr., Ph.D. Office Hours: M 8-9am and W 8-9... Date Added: 2009-01-11 20:29:33 |
| an184r.txt Path: Michigan >> LIB >> 180497 Fall, 1997 Description: ADMINISTRATIVE NOTES Newsletter of the Federal Depository Library Program Vol. 18, no. 04 GP 3.16/3-2:18/04 February 28, 1997 MICHAEL F. DIMARIO PUBLIC PRINTER PREPARED STATEMENT BEFORE THE SUBCOMMITTEE ON LEGISLATIVE APPROPRIATIONS COMMITTEE ON A... Date Added: 2009-02-11 21:21:57 |
| A_Quiz12(Fa07) Path: MATC Madison >> ASTRO >> 107 Spring, 2008 Description: SURVEY OF ASTRONOMY 806243 Quiz Score: /10 = _% Name: _ Section: _ ASTRONOMY 806-243 QUIZ 12 _ 1. This planet is the smallest of the terrestrial planets. It has a very old cratered surface, a weak magnetic field, and tidally locked rotation. a) Mer... Date Added: 2008-05-03 03:22:20 |
| AUTO 069.pdf Path: San Bernardino Valley College >> AUTO >> 069 Spring, 2008 Description: San Bernardino Valley college Curriculum Approved: November 17, 2003 Last Updated: September 2003 I. CATALOG DESCRIPTION: A. Department Information: Division: Technical Department: Automotive Course ID: AUTO 069 Course Title: Engine Performance - Fue... Date Added: 2009-02-02 16:00:56 |
| syllabus.doc Path: SUNY Fredonia >> CSIT >> 205 Spring, 2009 Description: CSIT 205-01 SYLLABUS (2007 Summer) COURSE: TEXTBOOKS: Visual Basic II (CSIT 205, 3 credit hours) (Web-based course/ANGEL) Starting Out with Visual Basic 2005 3rd Edition (copyright 2007) by Gaddis & Irvine Addison-Wesley Beifang Yi Office: Fenton H... Date Added: 2009-04-15 19:55:20 |
| san2p2.pdf Path: Colorado State >> CIVE >> 724 Spring, 2008 Description: Water for the World Technical Note No. SAN. 2.P.2 Estimating how much sewage or washwater will flow from a home, communal latrine, or public building 1s an essential part of planning and designing sewage or washwater disposal systems. Making this es... Date Added: 2009-01-09 07:50:30 |
| Ch_4.pdf Path: Virginia Tech >> LIB >> 07272003 Fall, 2008 Description: FIGURE 1 Adoration of the Magi Pieter Brueghel the Younger http:/www.abcgallery.com/B/bruegel/pieter1.html 94 Chapter 4 THREE CASE STUDIES CONTEXTUALIZED IN A SERVICE-LEARNING CLASS The Tapestry of the Study Tapestry a hand-woven fabric of plain... Date Added: 2009-02-18 00:52:29 |
| chapter 7 questions Path: Wisc Stout >> APRL >> 202 Spring, 2008 Description: Jenny Lipke Chapter 7 Questions 1, 2 1. Explain the relationship of fabric quality to garment quality. a. Fabric provides a foundation for quality. Fabrics interacts with other components of the garment to affect overall quality. Fabric quality is m... Date Added: 2008-04-23 09:00:23 |
| ESS 3 notes Path: UCSB >> ECON >> 109 Winter, 2008 Description: Micro Minerals Most problematic minerals: calcium (macro) and iron (micro Micro= less than 100 mg needed a day IRON Hemoglobin- is a protein molecule that has four irons in the red blood cells that binds oxygen and moves it around Myoglobin: is a pro... Date Added: 2008-06-08 20:48:01 |
| MP_kfw5_a_200709.pdf Path: Duke >> LAW >> 399 Spring, 2008 Description: Natural Resource Management at South Topsail Beach, NC by Katherine F. Wright August 2007 Advisor: Dr. Patrick Halpin Masters project submitted in partial fulfillment of the requirements for the Master of Environmental Management degree in the Nicho... Date Added: 2009-02-02 14:07:55 |
| LiteracyCoachPP-041.pdf Path: Kent State >> CTTE >> 45377 Summer, 2008 Description: Every Child A Graduate The Literacy Coach A Key to Improving Teaching and Learning in Secondary Schools The Literacy Coach A Key to Improving Teaching and Learning in Secondary Schools Elizabeth G. Sturtevant A L L I A N C E F O R E X C E L L E N... Date Added: 2009-01-09 15:13:58 |
| LiteracyCoachPP-041.pdf Path: Kent State >> CTTE >> 46015 Summer, 2008 Description: Every Child A Graduate The Literacy Coach A Key to Improving Teaching and Learning in Secondary Schools The Literacy Coach A Key to Improving Teaching and Learning in Secondary Schools Elizabeth G. Sturtevant A L L I A N C E F O R E X C E L L E N... Date Added: 2009-01-09 15:13:58 |
| LiteracyCoachPP-041.pdf Path: Kent State >> CTTE >> 55377 Summer, 2008 Description: Every Child A Graduate The Literacy Coach A Key to Improving Teaching and Learning in Secondary Schools The Literacy Coach A Key to Improving Teaching and Learning in Secondary Schools Elizabeth G. Sturtevant A L L I A N C E F O R E X C E L L E N... Date Added: 2009-01-09 15:13:59 |
| hw4.txt Path: Wisconsin >> E C E >> 331 Fall, 2008 Description: Homework 4 (due Thu - 2/19) Chp 2: 24,26,27,28,48,54,60,61,64 ... Date Added: 2009-02-03 14:29:01 |
| abstract1.pdf Path: Minnesota >> IMA >> 1 Fall, 2008 Description: Cantellis Lemma and the Estimation of Transaction Costs Andrew Mullhaupt, S.A.C. Capital Management There is a great variety of mathematics that has found its way into the world of nance. Without a doubt a great deal of this work occurs at hedge fund... Date Added: 2009-02-17 20:30:37 |
| Bells.ppt Path: Berkeley >> CS >> 284 Fall, 2008 Description: BELLS Bells can have many different shapes Some examples from around the world How to capture these shapes ? In a parameterized form, so that we can morph between them? Start with simple symmetrical shape Use Rotational Symmetry Start with ... Date Added: 2009-02-18 14:18:03 |
| OR-040018.pdf Path: Washington State >> PNN >> 04 Fall, 2008 Description: ALIETTE WDG brand Fungicide For Use on Hops for Downy Mildew Control Bayer CropScience LP P.O. Box 12014, 2 T.W. Alexander Drive Research Triangle Park, NC 27709 (919) 549-2000 EPA Reg. No. 264-516 EPA SLN. No. OR-040018 24(c) Supplemental Label FOR... Date Added: 2009-02-18 02:27:40 |
| OR-040018.pdf Path: Martin Luther >> PNN >> 04 Fall, 2008 Description: ALIETTE WDG brand Fungicide For Use on Hops for Downy Mildew Control Bayer CropScience LP P.O. Box 12014, 2 T.W. Alexander Drive Research Triangle Park, NC 27709 (919) 549-2000 EPA Reg. No. 264-516 EPA SLN. No. OR-040018 24(c) Supplemental Label FOR... Date Added: 2009-02-18 02:27:40 |
| OR-040018.pdf Path: Washington State >> TRICITY >> 04 Fall, 2008 Description: ALIETTE WDG brand Fungicide For Use on Hops for Downy Mildew Control Bayer CropScience LP P.O. Box 12014, 2 T.W. Alexander Drive Research Triangle Park, NC 27709 (919) 549-2000 EPA Reg. No. 264-516 EPA SLN. No. OR-040018 24(c) Supplemental Label FOR... Date Added: 2009-02-18 02:28:08 |
| OR-040018.pdf Path: Martin Luther >> TRICITY >> 04 Fall, 2008 Description: ALIETTE WDG brand Fungicide For Use on Hops for Downy Mildew Control Bayer CropScience LP P.O. Box 12014, 2 T.W. Alexander Drive Research Triangle Park, NC 27709 (919) 549-2000 EPA Reg. No. 264-516 EPA SLN. No. OR-040018 24(c) Supplemental Label FOR... Date Added: 2009-02-18 02:28:08 |
| hw1.ps Path: Berkeley >> MATH >> 113 Fall, 2000 Description: ... Date Added: 2009-02-18 14:12:07 |
| PPal1.doc Path: FSU >> NEURO >> 1 Fall, 2008 Description: Unnatural amino acid mutagenesis in mapping ion channel function Darren L Beene_, Dennis A Dougherty_ and Henry A Lester Current Opinion in Neurobiology 2003, 13:264270 Excellent resource for seeing the various uses for mutagenesis using unnatural am... Date Added: 2009-02-17 19:07:41 |
| PPal1.doc Path: S.F. State >> NEURO >> 1 Fall, 2008 Description: Unnatural amino acid mutagenesis in mapping ion channel function Darren L Beene_, Dennis A Dougherty_ and Henry A Lester Current Opinion in Neurobiology 2003, 13:264270 Excellent resource for seeing the various uses for mutagenesis using unnatural am... Date Added: 2009-02-17 19:07:41 |
| 611.Q1417.doc Path: New Hampshire >> ADMN >> 611 Fall, 2008 Description: David Klotz ADMN 611 12/11/06 Take Home Quiz 1) Leadership and power are closely related but separate things. Leaders and followers must have some similar goals in order to be effective while in order to have power, one needs only to possess what o... Date Added: 2009-02-03 14:01:14 |
| yr1_3best-practices.pdf Path: Alaska Anch >> ELDERS >> 1 Fall, 2008 Description: National Resource Center for American Indian, Alaska Native, and Native Hawaiian Elders Establishing Best Practices for Alaska Native Elders Prepared by Bernard Segal, Ph.D. Stacy L. Smith, MFA (Editor) Cheryl Easley, Ph.D. Dean, College of Health a... Date Added: 2009-02-18 14:26:50 |
| 1.24 Path: Michigan State University >> ISS >> 210 Winter, 2007 Description: 1/24 PROCESS OF OBEDIENCE (obedience: external authority; commitment, internal authority) *a morale-existent in everything Antecedent conditions (distant) Family o socialization in context of structures of authority 4 CONDITIONS o Active- requires so... Date Added: 2008-03-19 08:19:14 |
| MARK 7375-lecture 2.ppt Path: U. Houston >> MARK >> 7375 Fall, 2008 Description: Competitor Identification/ Mkt Definition Prerequisite for analyzing competition: - identifying your competitors - defining your market Competitor Identification Identifying competitors by identifying substitutes Substitutes are products whose c... Date Added: 2009-02-03 13:45:48 |
| 16018_Study Guide Questions for Final Exam Path: Full Sail >> SP >> 0710 Spring, 2008 Description: Study Guide Questions for Final Exam Chapter 10 (1) What is empathy? (2) What is our weakest communication skill? (3) What are the five steps of listening? (4) What are common barriers to empathy? (5) What are advantages of empathetic listening? (6) ... Date Added: 2008-04-08 11:42:29 |
| Law 3800, Final Grade Sheet, F08.doc Path: Western Michigan >> LAW >> 3800 Fall, 2008 Description: Final Grade Sheet Law 3800 T. Edmonds Fall 2008 Total of 1st and 2nd quiz, Midterm exam, and Final Exam* Final Point Total* 756 - 846 702 - 755 648 - 701 606 - 647 546 - 605 510 - 545 426 - 509 0 - 425 Grade A BA B CB C DC D E Percentage Range* 89 1... Date Added: 2009-02-03 14:38:31 |
| mathCharFunct-07 Path: Berkeley >> ARE >> 211 Fall, 2007 Description: ARE211, Fall 2007 CHARFUNCT: TUE, NOV 6, 2007 PRINTED: DECEMBER 14, 2007 (LEC# 20) Contents 5. Characteristics of Functions. 5.1. 5.2. 5.3. 5.4. 5.5. Surjective, Injective and Bijective functions Homotheticity Homogeneity and Euler\'s theorem Monoton... Date Added: 2008-08-01 11:34:15 |
| Molecular Lecture - 2.28.08.pdf Path: Texas Tech >> ACCT >> 5320 Fall, 2008 Description: Online Senior Assessment (OSA) An announcement of the OSA will be released this week to seniors through their Texas Tech e-mail address. A follow up e-mail will provide the same students the OSA link. There are four OSA versions covering most of the... Date Added: 2009-02-03 13:32:58 |
| 37-beeper-searching.ppt Path: UPenn >> CIT >> 594 Fall, 2009 Description: Searching in BeeperHunt (Mostly minor variations on old slides) Apr 10, 2009 Shortest path? In the BeeperHunt assignment, there are two beepers at all times Your robot has to choose which beeper to go after This may or may not be the closest ... Date Added: 2009-04-15 20:42:51 |
| Bergen extinction Path: Berkeley >> ARE >> 262 Spring, 2008 Description: Extinction of fish stocks Peter Berck Professor University of California, Berkeley Visiting Professor, Ume Universitet Marine Resource Destruction We take it as given that policy should avoid causing very low populations of marine organisms. Th... Date Added: 2008-08-01 11:53:39 |
| Bergen extinction.ppt Path: Berkeley >> POL SCI >> 261 Spring, 2008 Description: Extinction of fish stocks Peter Berck Professor University of California, Berkeley Visiting Professor, Ume Universitet Marine Resource Destruction We take it as given that policy should avoid causing very low populations of marine organisms. Th... Date Added: 2009-02-02 17:06:02 |
| GBe5dplw.pdf Path: Minnesota >> WWW1 >> 5 Fall, 2008 Description: ... Date Added: 2009-02-17 21:20:38 |
| tsl306 Path: Rhode Island >> PHYS >> 204 Spring, 2008 Description: RLC Parallel Circuit (1) Applied alternating voltage: E = Emax cos t Resulting alternating current: I = Imax cos(t - ) Goals: Find Imax , for given Emax , . Find currents IR , IL , IC through devices. ~ R IR A A I Junction rule: I = IR + IL ... Date Added: 2008-04-30 10:33:49 |
| TCA-cycle.pdf Path: UCLA >> CHEM >> 89 Fall, 2008 Description: ... Date Added: 2009-01-11 20:32:21 |
| 29topic_6_f07 Path: CUNY Brooklyn >> BIO >> 29 Spring, 2008 Description: Topic 6 Plant Cell Walls? Plant Cell Walls Primary Cell Wall Middle Lamella Secondary Cell Wall Secondary Metabolites Functions of Cell Walls Provide tensil strength and plasticity Tubes for long distance transport Prevention of water loss Prot... Date Added: 2008-04-08 21:44:05 |
| May_7_2fC_B100_00_02m.pdf Path: UPenn >> ASDBLR >> 02 Fall, 2009 Description: ASDBLR00 vs 02 at Shaper Out Beta=100 50m 40m Voltages (lin) 30m 20m 10m 0 0 20n 40n Time (lin) (TIME) 60n 80n 100n ASDBLR00 vs 02 at Track Disc Input Beta=100 15m Voltages (lin) 10m 5m 0 0 20n 40n Time (lin) (TIME) 60n 80n 100n... Date Added: 2009-04-15 21:15:06 |
| 1738.019.ps Path: Hawaii >> SOEST >> 1738 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207372630.0388276 Float: 1738 Profile: 019 Location: 35.4N 143.7E Date: 09/20... Date Added: 2009-02-17 19:56:02 |
| DissertationPDfinal.doc.pdf Path: Virginia Tech >> LIB >> 04242002 Fall, 2008 Description: SPINAL CORD GENE EXPRESSION CHANGES IN THE CHICKEN (GALLUS GALLUS) MODEL OF PHENYL SALIGENIN PHOSPHATE INDUCED DELAYED NEUROTOXICITY By Jonathan Fox Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in p... Date Added: 2009-02-18 01:11:23 |
| tg913.txt Path: Lehigh >> DMD >> 1 Fall, 2008 Description: Subject: Re: question and book review Date: Fri, 13 Sep 2002 14:18:44 -0400 From: Tom Goodwillie <tomg@math.brown.edu> > >My problem is: let $f,g : X\\to Y$ be two maps of $I$-diagrams >such that $f_i$ is homotopic to $g_i$ for $i\\in I$. >Is it true t... Date Added: 2009-02-17 23:13:46 |
| notesec110908.doc Path: CSU Northridge >> LR S >> 100f Fall, 2008 Description: Lecture of Friday, September 08, 2000 Note taker: Friedrich von Ploetz -Topics: Isoquant Lines Isocost Lines Scale Expansion Path I. Isoquants (greek: same quantity) - An isoquant is a curve that shows all the combinations of inputs that will prod... Date Added: 2009-01-09 07:41:06 |
| lecture10 Path: Cornell >> CS >> 2042 Fall, 2008 Description: More Handy Shell Features Control Flow and Loops Functions Lecture 10: More Bash Scripting CS2042 - UNIX Tools October 22, 2008 Lecture 10: Scripting, cont. More Handy Shell Features Control Flow and Loops Functions Arithmetic Arrays Lecture O... Date Added: 2009-01-23 23:08:23 |
| midterm_solution371_2003 Path: Concordia Canada >> ENGR >> 371 Spring, 2003 Description: ... Date Added: 2008-10-21 14:53:28 |
| cps250HW2.doc Path: University of Dayton >> CPS >> 250 Fall, 2009 Description: CPS250, Homework #2, Due Tuesday, Feb. 3, 2009 (beginning of class) Answer the exercises below from your textbook. Please answer the questions in the space provided, and circle your final answer. Name: _ Pages 138-139: #20b (Use box below for final a... Date Added: 2009-04-16 00:07:10 |
| colourmap.pdf Path: Emporia >> LI >> 861 Spring, 2008 Description: Tube Map Chesham Amersham 9 1 Chalfont Wealdstone North Harrow Harrowon-the-Hill 3 Watford Junction Watford High Street Bushey Carpenders Park Edgware Burnt Oak Watfo... Date Added: 2009-01-10 02:59:11 |
| syl103.pdf Path: Arizona >> INDV >> 103 Fall, 2008 Description: 3 X $ R y r 7 ( # w QF 8$FQb z7$h zwg Fe w rrw 8 z 7 8 \'1878 F31 g8 r R7 #1 7 Tq#z $83r#b yb zn$#167n3w8 F#Fd #r g # T F rfr\"8F\"7$\"d$#t66 } Qzgr$zTr81gTzwhFzzTFhg$7F1#67(Q#w7T8g7` ... Date Added: 2009-01-12 04:58:09 |
| ACC HW5-1 Path: CUNY Lehman >> ACC >> 201 Fall, 2006 Description: June1 Purchased 160 books on an account for $5 each from Ex Libris Publishers (D merchandise inventory and C accounts payable), FOB destination (seller pays), terms 2/10 n/30 to all of its customers. The appropriate party also made a cash payment of ... Date Added: 2008-04-17 20:26:42 |
| Chapter6-helmy-4.ppt Path: UF >> CEN >> 4500c Fall, 2008 Description: Chapter 6 Wireless and Mobile Networks Computer Networking: A Top Down Approach 4th edition. Jim Kurose, Keith Ross Addison-Wesley, July 2007. 6: Wireless and Mobile Networks 6-1 Chapter 6: Wireless and Mobile Networks Background: # wireless (mo... Date Added: 2009-01-10 03:40:12 |
| bc.xls Path: Washington State >> ECONS >> 513 Fall, 2008 Description: age 30 50 47 49 52 29 49 27 47 59 35 26 41 60 45 58 33 47 35 62 36 29 41 53 59 43 41 60 27 52 53 52 34 28 48 39 57 29 48 29 63 33 35 31 55 39 smoking 1 0 0 1 1 0 1 1 0 0 0 0 1 1 0 0 0 1 0 1 1 1 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 1 0 dietfa... Date Added: 2009-02-18 02:24:22 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
