Course Solutions And Notes - Chapter15 29
| 09-15-06.doc Path: Penn State >> BIOL >> 230 Fall, 2009 Description: 1 Today\'s questions I II III IV How do we know that DNA is the genetic material? How much DNA is in the genome? How is the sequence of DNA organized in the genome? What is the physical organization of the genome in the cell? 2 Griffith\'s experiment ... Date Added: 2009-06-03 21:12:58 |
| FinalTest3_pdmsort.txt Path: UConn >> VKK >> 06001 Fall, 2009 Description: Creating 262144 Keys Setting RAND_SEED to 1203229069 Creating RUNS Creating RUNS. TOTAL RUNS=64 Starting with N=262144 M=65536 R=4 (STEP=1) GOOD=16384 BAD=0 BAD%=0.000000% (STEP=2) GOOD=16384 BAD=0 BAD%=0.000000% (STEP=3) GOOD=16384 BAD=0 BAD%=0... Date Added: 2009-06-03 21:13:44 |
| G020482-00.ppt Path: Caltech >> G >> 020482 Fall, 2009 Description: Commissioning P Fritschel LIGO NSF review, 23 October 2002 M.I.T. LIGO-G020482-00-D Interferometer Status All 3 interferometers have been operating in power recycled configuration since early 2002 All had comparable sensitivity during S1 LHO 2k... Date Added: 2009-06-03 21:14:48 |
| PS119.lec_8.2006.10.11.doc Path: Concordia Chicago >> ASTRO >> 119 Fall, 2009 Description: Phy Sci 119a Fall 2006 Oct. 11, 2006 Lecture 8 Opening music: Chopin (1810-1849), Valse in C# minor, Op. 64, no. 2 for piano. Performance date, 1847. The piece was performed a few years after Bessell measured the first parallax, Fraunhofer made the f... Date Added: 2009-06-03 21:17:22 |
| PS119.lec_8.2006.10.11.doc Path: Concordia Chicago >> WEB >> 119 Fall, 2009 Description: Phy Sci 119a Fall 2006 Oct. 11, 2006 Lecture 8 Opening music: Chopin (1810-1849), Valse in C# minor, Op. 64, no. 2 for piano. Performance date, 1847. The piece was performed a few years after Bessell measured the first parallax, Fraunhofer made the f... Date Added: 2009-06-03 21:17:22 |
| rtaa200824o2008237.txt Path: Allan Hancock College >> RTAA >> 200824 Fall, 2009 Description: Western Australia Road Traffic Amendment Act 2008 Western Australia Road Traffic Amendment Act 2008 CONTENTS 1. Short title ... Date Added: 2009-06-03 21:17:37 |
| ANOVA.ppt Path: Duke >> STA >> 240 Fall, 2008 Description: ANOVA One Way Analysis of Variance ANOVA Purpose: To assess whether there are differences between means of multiple groups. ANOVA provides evidence. We compare variation among the means of the groups with the variation within groups. Hence the name ... Date Added: 2009-06-03 21:19:18 |
| GEOG302_19.ppt Path: Montana >> GEOG >> 302 Spring, 2008 Description: Panda\'s Thumb: Think, pair, share 10-15 min. 1. In the essay \"Senseless Signs of History\", Gould argues that one can\'t demonstrate evolution with perfection (i.e. \"perfect\" adaptations). Why is this? In \"Double Trouble\" Gould writes about convergent... Date Added: 2009-06-03 21:20:32 |
| LECTURE_C_2_Advanced_Theory_Decomposition.ppt Path: Portland >> CLASS >> 573 Fall, 2009 Description: Orderings and Bounds Parallel FSM Decomposition Prof. K. J. Hintz Department of Electrical and Computer Engineering Lecture 10 Update and modified by Marek Perkowski Orderings on Inclusion Relations Inclusion Relation Reflexive Anti-symmetric T... Date Added: 2009-06-03 21:21:42 |
| G158W09L03_seawater.ppt Path: UCSB >> GEOG >> 158 Fall, 2008 Description: Sea Water Properties Water mass characteristics Salinity, temperature, nutrients, oxygen Key property is seawater density Changes in vertical inhibit mixing Changes in horizontal drive currents See Chapters 1 & 2 of Tomzcak\'s readings What ... Date Added: 2009-06-03 21:21:46 |
| SE-Ethics.ppt Path: USC >> CS >> 510 Fall, 2009 Description: USC C S E University of Southern California Center for Software Engineering Software Engineering Ethics Barry Boehm CS 510, 577 2004 USC-CSE 1 USC C S E University of Southern California Center for Software Engineering Outline Definitio... Date Added: 2009-06-03 21:24:18 |
| T_EX_AVG.txt Path: Michigan State University >> GEO >> 8680 Fall, 2009 Description: DAILY EXTREME AND AVERAGE TEMPERATURES FOR WATERSMEET (1948-80) DATE HI LOW AVG HI LOW AVG HI LOW AVG MAX MAX MAX MIN MIN MIN MEAN MEAN MEAN 01/01 038 000 24 02... Date Added: 2009-06-03 21:25:05 |
| Stat31Midterm2old1.doc Path: UNC >> STOR >> 155 Fall, 2008 Description: Page 1 of 4 Statistics 31, Section 3, Midterm II Tuesday, November 14, 2000 Name: _ Pledge: I have neither given nor received aid on this examination. Signature: __ Instructions: Do not do any actual numerical calculations. Answers in a form that you... Date Added: 2009-06-03 21:26:35 |
| PB265Final.doc Path: UNC >> INLS >> 265 Fall, 2009 Description: Peter Robert Buch INLS265 JaneGreenburg UniversityofNorthCarolina Schoolof Information andLibrary Science May8, 1999 The Resource Description Framework Implications for Internet indexing. Background Today\'s Background Today\'s Resources The Micr... Date Added: 2009-06-03 21:27:40 |
| lect3.ppt Path: UNC >> CS >> 144 Fall, 2009 Description: The University of North Carolina at Chapel Hill COMP 144 Programming Language Concepts Spring 2002 Lecture 3: Lexical Analysis Felix Hernandez-Campos Jan 14 COMP 144 Programming Language Concepts Felix Hernandez-Campos 1 Phases of Compilation COM... Date Added: 2009-06-03 21:28:05 |
| Lecture15.ppt Path: UNC >> COMP >> 790 Fall, 2008 Description: Lecture 15: Protein Sequencing Study Chapter 8.108.15 05/16/09 Comp 590/Comp 79090 Fall 2008 1 From DNA to Proteins DNA sequences \"Program\" that controls living biological systems Sections of DNA (Genes) encode proteins Triplets of nucleoti... Date Added: 2009-06-03 21:28:48 |
| EC-13.ppt Path: USC >> CS >> 577 Fall, 2009 Description: System and Software Requirements Definition (SSRD) and Requirements (review, but more in SSRD II lecture) 1 Requirements Defines the system concept (from OCD) with respect to general technology considerations \"Must\", \"Shall\", \"Will\" instructions ... Date Added: 2009-06-03 21:30:26 |
| Lesson_22_Plan.doc Path: Mercer >> ISE >> 302 Fall, 2009 Description: ISE 302-22 (Fall \'08) Lesson: Queueing Theory I,II & III Objectives: 1. 2. 3. 4. 5. 6. Define and explain fundamental queueing characteristics and conventions. Define queueing performance measures. Explain Little\'s Law. Explain the role of the Expone... Date Added: 2009-06-03 21:31:48 |
| 709lec090312.ppt Path: Maryland >> SOCY >> 709 Fall, 2008 Description: Sociology 709 (Martin) Lecture 7: March 12, 2009 Standard approaches for ordinal explanatory variables Ordinal logit models to treat ordinal outcome variables like ordinal variables. Reading outputs, interpreting intercepts Comparing models Mod... Date Added: 2009-06-03 21:32:47 |
| 323PinkElephant.ppt Path: Penn State >> DHG >> 5005 Fall, 2009 Description: THE PINK ELEPHANT T Conservative Versus Controversial Lindsay Bailor & David Grego A Ed 323 - Fall 2007 Our Space Our Materials Materials. 60 balloons Packing tape Double-stick tape Fishing line Poster board The \'s always tim for fun. re e .or m... Date Added: 2009-06-03 21:33:02 |
| tplta200115o2001271.txt Path: Allan Hancock College >> TPLTA >> 200115 Fall, 2009 Description: Western Australia Tamala Park Land Transfer Act 2001 Western Australia Tamala Park Land Transfer Act 2001 CONTENTS 1. Short title ... Date Added: 2009-06-03 21:33:54 |
| Homework_6.doc Path: Utah >> CV >> 1000 Fall, 2009 Description: DEPARTMENT OF CIVIL AND ENVIRONMENTAL ENGINEERING THE UNIVERSITY OF UTAH CVEEN 1000 Introduction to Civil and Environmental Engineering Spring 2002 A Transportation Problem Introduction Transportation projects are highly visible and are often contr... Date Added: 2009-06-03 21:35:00 |
| info_retrieval.doc Path: Texas >> I >> 331 Fall, 2009 Description: THE \"INFORMATION RETRIEVAL\" (IR) PROBLEM Given what we have accumulated in the cultural record, how does one \"find information\"? Corollary to the \"classic IR problem\": How do we distinguish what we want from the sea of what we don\'t want, espe... Date Added: 2009-06-03 21:35:14 |
| Acknowledgements,Etc.doc Path: Wake Forest >> ETD >> 12162003 Fall, 2009 Description: ACKNOWLEDGEMENTS I would like to give thanks to the members of my committee, Dr. Kathy Kron, Dr. Brian Tague, and Dr. Peter Weigl, for their patience, enthusiasm, and guidance. I am grateful to Dr. E. G. H. Oliver at the Bolus Herbarium in Capetown a... Date Added: 2009-06-03 21:38:24 |
| s15.ppt Path: UNI >> CS >> 161 Fall, 2009 Description: Unit Three Knowledge and Reasoning Let\'s play a game of Wumpus Wumpus World Description A Typical Wumpus World Let\'s play a game of Wumpus Motivating KB Agents Reflex agents keep the world clean, in large part, by dumb luck Searching algorithm... Date Added: 2009-06-03 21:40:18 |
| ClassicProblems.ppt Path: IPFW >> CS >> 472 Winter, 2008 Description: Classic Problems in Concurrency CS 472 Operating Systems Indiana University Purdue University Fort Wayne 1 Classic problems in concurrency We investigate two classic concurrency problems from chapters 5 and 6 Readers/Writers problem Section 5.6,... Date Added: 2009-06-03 21:41:55 |
| PSY100_development09.ppt Path: Toledo >> PSY >> 100 Fall, 2009 Description: Introduction to Psychology Human Development Developmental Psychology The focus of developmental psychology is on how humans develop and change over time Change can occur across the life span of the person Cradle to grave developmental psychology... Date Added: 2009-06-03 21:43:04 |
| bus320d01.txt Path: Sveriges lantbruksuniversitet >> BUS >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: BUS 320-3 D01 LOCATION: SFU TITLE: FINANCIAL ACCT-ASSET SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 38... Date Added: 2009-06-03 21:43:09 |
| EDUC252D03.TXT Path: Sveriges lantbruksuniversitet >> EDUC >> 19993 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: EDUC 252-4 D03 LOCATION: DAW TITLE: REFLECTIVE PRACTICE SECTION TYPE: SEM SEMESTER: 1999-3 ENROL: 12 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown... Date Added: 2009-06-03 21:43:45 |
| sinarski_crocker.ppt Path: UVA >> POWERPOINT >> 345 Fall, 2009 Description: Weather and the Seasons Julie Sinarski Christy Crocker EDLF 345, Section 2 Seasons Spring Summer Fall Winter Spring Warm temperature Rainy and sunny We wear t-shirts and raincoats Animals begin to lose their fur The rain helps plants grow Su... Date Added: 2009-06-03 21:44:05 |
| asmt4.txt Path: Vassar >> CS >> 245 Fall, 2008 Description: CMPU-245, Spring 2009 Asmt. 4 Due: Monday, Feb. 23, 2009 => Be sure to download the asmt2-funcs.txt file so that you can use the TESTER, ASMT-HEADER and PROBLEM-HEADER functions it defines. => Have a look at the file, asmt4-solns-inters.txt, ... Date Added: 2009-06-03 21:45:20 |
| puzzle06.txt Path: Princeton >> CS >> 226 Fall, 2009 Description: 4 0 1 2 3 5 6 7 4 9 10 11 8 13 14 15 12 ... Date Added: 2009-06-03 21:47:47 |
| rtaacova200410o2004575.txt Path: Allan Hancock College >> RTAACOVA >> 200410 Fall, 2009 Description: Western Australia Road Traffic Amendment (Impounding and Confiscation of Vehicles) Act 2004 Western Australia Road Traffic Amendment (Impounding and Confiscation of Vehicles) Act 2004 ... Date Added: 2009-06-03 21:48:08 |
| HealthStatement.doc Path: Iowa State >> NR >> 76683 Fall, 2009 Description: Marion County HORSE HEALTH CARE STATEMENT (Please Print) Name _ Date _ We, the undersigned, certify that these animals have received the vaccinations as listed below. We further certify the information provided below is correct and accurate. Animal ... Date Added: 2009-06-03 21:51:37 |
| 5235fa04contacts.doc Path: N.E. Illinois >> FCS >> 5235 Fall, 2009 Description: Cultural Cuisine Contact Information Michelle Ballard bwlngbabe2@aol.com 708.798.2513 Kristen DiFilippo kernL72@aol.com 217.586.3387 Jennifer Hills Jennylynn921@hotmail.com 217.946.4283 Amy Olson dajeolson@mcshi.com 217.498.8615 Ellen Shike ellenshik... Date Added: 2009-06-03 21:53:07 |
| EO329_08-09.doc Path: East Los Angeles College >> EO >> 329 Fall, 2009 Description: Microprocessor Systems Design (EO329R) s School of Environment and Technology Division of Engineering and Product Design Referred Examinations, January 2009 HONOURS DEGREE COURSE MICROPROCESSOR SYSTEMS DESIGN (EO329R) EXAMINER: C.S. Knight Instruc... Date Added: 2009-06-03 21:53:21 |
| chapter-12-3811-chemical-equilibrium.ppt Path: Clayton >> CHEM >> 3811 Fall, 2009 Description: ANALYTICAL CHEMISTRY CHEM 3811 CHAPTER 12 DR. AUGUSTINE OFORI AGYEMAN Assistant professor of chemistry Department of natural sciences Clayton state university CHAPTER 12 CHEMICAL EQUILIBRIUM CALCULATIONS SOLUBILITY - A measure of how much of a sol... Date Added: 2009-06-03 21:53:57 |
| BMGT496A80226053.doc Path: MD University College >> ASIA >> 2092 Fall, 2009 Description: Syllabus for BMGT 496 - A802 - Business Ethics and Society Instructor: Dr. Kenneth W. Smith Email Address: ksmith@asia.umuc.edu Course Description (Fulfills the civic responsibility requirement.) A study of the relationship of business ethics and soc... Date Added: 2009-06-03 21:54:57 |
| Pictures1.ppt Path: Alaska Anch >> CS >> 109 Fall, 2009 Description: Picture Encoding and Manipulation We perceive light different from how it actually is Color is continuous Visible light is wavelengths between 370 and 730 nm Thats 0.00000037 and 0.00000073 meters But we perceive light with color sensors that p... Date Added: 2009-06-03 21:55:06 |
| jamesd_lab1_presentation.ppt Path: UPenn >> P >> 414 Fall, 2008 Description: DETERM I NI NG TH E L I FETI M E OF M UON DECAY James Dur gin Febr uar y 13, 2009 Physics 521 L ab Par t ner : Jennifer Zhu P + e + + e + - e - + e + Par t icle int er act ions M uons in air Br emsst r ahlung r adiat ion M uons... Date Added: 2009-06-03 21:55:21 |
| 9ECH14.ppt Path: Texas A&M University, Corpus Christi >> FINA >> 3312 Fall, 2008 Description: Power Point Slides for: Financial Institutions, Markets, and Money, 9th Edition Authors: Kidwell, Blackwell, Whidbee M University Copyright 2006 John Wiley... Date Added: 2009-06-03 21:56:22 |
| 9Ech06.ppt Path: Texas A&M University, Corpus Christi >> FINA >> 3312 Fall, 2008 Description: Power Point Slides for: Financial Institutions, Markets, and Money, 9th Edition Authors: Kidwell, Blackwell, Whidbee M University Copyright 2006 John Wiley... Date Added: 2009-06-03 21:56:22 |
| plot4.ps Path: Wisconsin >> PS >> 555 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 18 7 594 785 %Orientation: Portrait %Pages: (atend) %PageOrder: Ascend %DocumentFonts: (atend) %DocumentNeededFonts: (atend) %DocumentData: Clean7Bit %EndComments %BeginDefaults %PageBoundingBox: 18 7 594 785 %PageOrienta... Date Added: 2009-06-03 21:57:56 |
| spec.ps Path: Berkeley >> CS >> 150 Fall, 1996 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: spec.dvi %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o spec.ps spec.dvi %DVIPSParameters: dpi=300, comments remo... Date Added: 2009-06-03 21:58:49 |
| a3.doc Path: Valdosta >> CS >> 4345 Fall, 2008 Description: CS4345 Project 3 Due: 04/11/06 In this project, your job is to create a simulator of an unrealistically simplified memory manager and the hardware memory subsystem that includes nothing but CPU, TLB, and Main Memory. There will be no cache. Ther... Date Added: 2009-06-03 21:59:34 |
| lesson11.ppt Path: University of San Francisco >> CS >> 210 Fall, 2008 Description: The `wait4()\' function Looking at how the various `wait()\' system-calls rely on `wait4()\' in the x86_64 Linux kernel `Waiting\' for a child-process Various standard UNIX library functions may be used by a parent-process to `wait\' for one of its chil... Date Added: 2009-06-03 21:59:50 |
| lesson01.ppt Path: University of San Francisco >> CS >> 210 Fall, 2008 Description: What is Assembly Language? Introduction to the GNU/Linux assembler and linker for Intel Pentium processors High-Level Language Most programming nowdays is done using so-called \"high-level\" languages (such as FORTRAN, BASIC, COBOL, PASCAL, C, C+, JA... Date Added: 2009-06-03 22:00:07 |
| txg90_st.txt Path: Michigan State University >> GEO >> 5650 Fall, 2009 Description: 1951-1980 STATISTICAL SUMMARY FOR MT. CLEMENS DIVISION: SOUTHEAST LOWER TOWN: 02N COUNTY: MACOMB RANGE: 14E LATITUDE: 42d 36m SECTION: 09 ... Date Added: 2009-06-03 22:00:37 |
| Review3kulpa.doc Path: University of Illinois, Urbana Champaign >> CI >> 300 Fall, 2009 Description: Review3kulpa Yes, I enjoyed the cereal box experiments and especially the different resources that improve the time it takes to accomplish. However, the most exciting part of MY morning came at the end when George affirmed our \"project\" by telling us... Date Added: 2009-06-03 22:06:21 |
| 05sep29loops.ppt Path: Cornell >> CS >> 100 Fall, 2008 Description: CS100J September 27, 2003 Loops Repetitive statements, or iterative statements, or loops Start reading chapter 7 on loops. The lectures on the ProgramLive CD can be a big help. \"O! Thou hast damnable iteration and art, indeed, able to corrupt a sai... Date Added: 2009-06-03 22:07:24 |
| itk_279_2005_09_23.ppt Path: Illinois State >> ITK >> 279 Fall, 2008 Description: For Monday Read 7.6-7.7 Chapter 7, exercise 1 for insertion sort, selection sort, and bubble sort. Show the end of each pass through the outer loop of the sort in each case. Program 1 due Sorting Importance of sorting Three basic simple sorts ... Date Added: 2009-06-03 22:08:42 |
| cloned.doc Path: Iowa State >> PUBLIC >> 1229 Fall, 2009 Description: Des Moines Register 12-29-06 Cloned-food ruling is a win for science Like FDA, public should resist scare tactics. REGISTER EDITORIAL BOARD Most Americans don\'t think twice when they chomp into an apple, even though an apple tree begins life as a cut... Date Added: 2009-06-03 22:08:52 |
| cloned.doc Path: Iowa State >> MR >> 1229 Fall, 2009 Description: Des Moines Register 12-29-06 Cloned-food ruling is a win for science Like FDA, public should resist scare tactics. REGISTER EDITORIAL BOARD Most Americans don\'t think twice when they chomp into an apple, even though an apple tree begins life as a cut... Date Added: 2009-06-03 22:08:52 |
| uni.doc Path: Iowa State >> MR >> 0609 Fall, 2009 Description: Des Moines Register 06-04-06 New chief wants UNI to be in national spotlight The president says the school should recruit more out-of-state students. ERIN JORDAN REGISTER IOWA CITY BUREAU Ames, Ia. - Ben Allen says he will work to help the University... Date Added: 2009-06-03 22:09:43 |
| uni.doc Path: Iowa State >> PUBLIC >> 0609 Fall, 2009 Description: Des Moines Register 06-04-06 New chief wants UNI to be in national spotlight The president says the school should recruit more out-of-state students. ERIN JORDAN REGISTER IOWA CITY BUREAU Ames, Ia. - Ben Allen says he will work to help the University... Date Added: 2009-06-03 22:09:43 |
| convicted.doc Path: Iowa State >> MR >> 1208 Fall, 2009 Description: Associated Press 12-01-06 Business Owner Convicted Of Swindling Iowa State DES MOINES, Iowa (AP) - A construction business owner from Ames is convicted of billing Iowa State University for thousands of hours of work that was never done. Thomas Hinder... Date Added: 2009-06-03 22:10:09 |
| sentenced.doc Path: Iowa State >> MR >> 0428 Fall, 2009 Description: KCCI.com, IA 04-26-06 ISU Coach Sentenced Hornbacher Must Get Treatment DES MOINES, Iowa - Iowa State University\'s soccer coach was sentenced Wednesday on her second drunken driving charge. A judge ordered Rebecca Hornbacher to serve seven days of a ... Date Added: 2009-06-03 22:10:14 |
| sentenced.doc Path: Iowa State >> PUBLIC >> 0428 Fall, 2009 Description: KCCI.com, IA 04-26-06 ISU Coach Sentenced Hornbacher Must Get Treatment DES MOINES, Iowa - Iowa State University\'s soccer coach was sentenced Wednesday on her second drunken driving charge. A judge ordered Rebecca Hornbacher to serve seven days of a ... Date Added: 2009-06-03 22:10:14 |
| Function Composition.doc Path: UF >> MAC >> 2311 Fall, 2008 Description: Function Composition I\'ve seen students not know how to properly compose two functions very late into the semester, and this is something you have to be good at to survive in this course. I suspect that many students have trouble because they don\'t h... Date Added: 2009-06-03 22:12:27 |
| lecture02erk_problem.ppt Path: Arizona >> LECTURE >> 101 Fall, 2009 Description: NATS 101 - 06 Lecture 2 Density, Pressure rho\" 3 3 ... Date Added: 2009-06-03 22:12:36 |
| lecture02erk_problem.ppt Path: Arizona >> NATS >> 101 Fall, 2006 Description: NATS 101 - 06 Lecture 2 Density, Pressure rho\" 3 3 ... Date Added: 2009-06-03 22:12:36 |
| 07-MIPSAddressingModes.4p.ps Path: UCSC >> CMPE >> 110 Winter, 2008 Description: %!PS-Adobe-2.0 %DocumentFonts: Helvetica Helvetica-Bold Courier Courier-Bold %Title: stdin %Creator: psnup, Copyright (C) 1994 M. Herbert <rxkmh@minyos.xx.rmit.oz.au> %Revision: $Header: psnup.pro,v 2.2 94/06/14 14:39:29 rxkmh Locked 0%CreationDate: ... Date Added: 2009-06-03 22:12:38 |
| 09-SingleCycleCPU.4p.ps Path: UCSC >> CMPE >> 110 Winter, 2008 Description: %!PS-Adobe-2.0 %DocumentFonts: Helvetica Helvetica-Bold Courier Courier-Bold %Title: stdin %Creator: psnup, Copyright (C) 1994 M. Herbert <rxkmh@minyos.xx.rmit.oz.au> %Revision: $Header: psnup.pro,v 2.2 94/06/14 14:39:29 rxkmh Locked 0%CreationDate: ... Date Added: 2009-06-03 22:12:43 |
| PB265Final.doc Path: UNC >> INLS >> 180 Fall, 2008 Description: Peter Robert Buch INLS265 JaneGreenburg UniversityofNorthCarolina Schoolof Information andLibrary Science May8, 1999 The Resource Description Framework Implications for Internet indexing. Background Today\'s Background Today\'s Resources The Micr... Date Added: 2009-06-03 22:13:06 |
| LEE 504 Group Presentation.ppt Path: Idaho >> AGEC >> 477 Fall, 2008 Description: Natural Re sourceManage e and Laws m nt Overview of key land managing agencies Overview of key natural resource laws Activity for water resources Provide links for agencies and laws Question and answer session Ree Brannon Noel Jensen Sara Robson... Date Added: 2009-06-03 22:13:39 |
| del_f03_c1.txt Path: Stanford >> CPT >> 080214 Fall, 2009 Description: 8152 3 0 1 -0.3125 -0.8125 -586.87866211 -0.06298828 0 1 -0.1875 -0.8125 -587.15972900 -0.27381897 0 1 -0.0625 -0.8125 -587.16290283 -0.05720520 0 1 0.0625 -0.8125 ... Date Added: 2009-06-03 22:14:52 |
| Simulation_procedure.rtf Path: Los Angeles Southwest College >> CSE >> 211 Fall, 2009 Description: SIMULATION Objective: To simulate the given design using ModelSim Simulator. Procedure: 1. Open the Program Navigator. To choose the project which has to be simulated, click on File-> Open Project and choose the project file(*.npl) that has to be sim... Date Added: 2009-06-03 22:15:33 |
| l27.ppt Path: Duke >> CPS >> 100 Fall, 2009 Description: Sorting: From Theory to Practice Why do we study sorting? Because we have to Because sorting is beautiful Example of algorithm analysis in a simple, useful setting There are n sorting algorithms, how many should we study? O(n), O(log n... Date Added: 2009-06-03 22:15:39 |
| cps151Prog8.doc Path: University of Dayton >> CPS >> 151 Fall, 2009 Description: CPS151, Winter 2009 Submission: Program #8 due Wednesday, 3/25/09 (25 points max) Vec151, One More Time last accepted Friday, 3/27/09 (21 points max) Recursive Lists Programs 4 and 5 were designed to demonstrate that underlying implementations of ... Date Added: 2009-06-03 22:16:32 |
| hw4.ps Path: Maryland >> CMSC >> 451 Fall, 2005 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMR17 CMR12 CMR10 CMMI10 CMR7 CMR5 CMMI7 CMSY10 %DocumentPaperSizes: a4 %EndComments %D... Date Added: 2009-06-03 22:17:01 |
| HW4Solution.txt Path: Virginia Tech >> CS >> 2504 Spring, 2006 Description: CS 2504 Spring 2009 HW4 - 1. 4 A: 0110 1101 B: 0100 1010 OR: 0110 1111 2. 10 A: 0110 1101 B: 0100 1010 AND: 0100 1000 3. 10 A: 0110 1101 B: 0100 1010 XOR:... Date Added: 2009-06-03 22:17:06 |
| CA3skl144.xls Path: Penn State >> SKL >> 144 Spring, 2009 Description: Breakdown Machine1( min) 1 2 3 4 5 6 12.1 27.8 18.5 6.5 24.6 33.7 Breakdown Machine2( min) 1 2 3 4 5 6 22.5 15.1 8.2 11.9 7.7 19.4 Breakdown Machine1( min) 1 2 3 4 5 6 12.1 27.8 18.5 6.5 24.6 33.7 Machine 1 6 5 Breakdown 4 3 6 2 5 1 0 5 10 15 ... Date Added: 2009-06-03 22:17:41 |
| met1000-Recycled-project.doc Path: SPSU >> MET >> 1000 Fall, 2009 Description: MET 1000, Dr Simin Nasseri Spring 2009 Recycled Design Project: Creative Design at Minimum Cost Objectives Design a machine, mechanism, tool, or any useful object or device. Plan for building the object by gathering some information about the ma... Date Added: 2009-06-03 22:19:00 |
| AreaData0.txt Path: Virginia Tech >> CS >> 1704 Spring, 2003 Description: Area State FIPS SqrMiles POP90 FEMALE90 MALE90 WHITE90 BLACK90 HISP90 OTHER90 Barbour WV 54001 344.982 15699 8195 7504 15333 148 89 7 Berkeley WV 54003 321.656 59253 29853 29400 56511 2209 399 33 Boone WV 54005 507.403 25870 13297 12573 25590 214 48 ... Date Added: 2009-06-03 22:23:15 |
| CCHEG1810Spring09HomeworkLab11.doc Path: Western Michigan >> CHEG >> 1810 Fall, 2008 Description: CHEG 1810 Spring 2009 Homework #2 Due in Class: March 24 26 Refer to the coffee maker problem we did in Lab 4: http:/homepages.wmich.edu/~parkerp/CHEG1810/Assignments/CHEG1810Spring09Lab4pg1.pdf Prior to class, draw a sketch of the coffee maker, la... Date Added: 2009-06-03 22:23:55 |
| Chapter05.ppt Path: UNC Charlotte >> INFO >> 2130 Fall, 2008 Description: Chapter 5 Input Chapter 5 Objectives Define input List the characteristics of a keyboard Describe different mouse types and how they work Summarize how various pointing devices work Explain how voice recognition works Describe various input devices ... Date Added: 2009-06-03 22:24:26 |
| Evaluation_Plan.doc Path: Old Dominion >> CS >> 410 Fall, 2008 Description: Evaluation Plan How do we know we are done? How do we prove it? ... Date Added: 2009-06-03 22:24:41 |
| ArrayList.ppt Path: UMBC >> CS >> 202 Fall, 1997 Description: CMSC 202 ArrayList Aug 9, 2007 1 What\'s an Array List ? ArrayList is a class in the standard Java libraries that can hold any type of object an object that can grow and shrink while your program is running (unlike arrays, which have a fixed ... Date Added: 2009-06-03 22:27:41 |
| 3.13.txt Path: Puget Sound >> MATH >> 291 Fall, 2009 Description: richards@PowerBook[69] : ls 1.22.hs 2.05.txt 2.26.hs 1.22.txt 2.06.hs 2.26.txt 1.23.hs 2.06.txt 3.10.hs 1.23.txt 2.10.hs 3.10.txt 1.26.hs 2.10.txt 3.12.hs 1.26.txt 2.12.hs 3.12.txt 1.27.hs 2.12.txt 3.2.hs 1.27.txt 2.16.hs 3.2.... Date Added: 2009-06-03 22:27:42 |
| 3.13.txt Path: Puget Sound >> CS >> 291 Fall, 2009 Description: richards@PowerBook[69] : ls 1.22.hs 2.05.txt 2.26.hs 1.22.txt 2.06.hs 2.26.txt 1.23.hs 2.06.txt 3.10.hs 1.23.txt 2.10.hs 3.10.txt 1.26.hs 2.10.txt 3.12.hs 1.26.txt 2.12.hs 3.12.txt 1.27.hs 2.12.txt 3.2.hs 1.27.txt 2.16.hs 3.2.... Date Added: 2009-06-03 22:27:46 |
| L23Review.ppt Path: UMBC >> CS >> 104 Fall, 2009 Description: Final Exam q Final Exam: Thursday Dec 13th, 2001 at 8:30 pm in SS-111, the regular classroom. Final Review Using Variables You may declare variables in C. q The declaration includes the data type you need. q Examples of variable declarations: q i... Date Added: 2009-06-03 22:29:01 |
| Pisa.doc Path: U. Houston >> TAYLORA >> 7656 Fall, 2009 Description: The Leaning Tower Of Pisa Designed As a Bell Tower Took Over 200 Years to Build Houses Seven Bells Each One Represents a Note on the Musical Scale Located in Pisa, Italy - Europe ... Date Added: 2009-06-03 22:32:02 |
| prac2ans.txt Path: Syracuse >> CIS >> 252 Spring, 2008 Description: Sample answers to practice questions - Question 0 =-=-=-=-=-= (a) (Char,Int) -> String (b) [String] (c) [String] (d) [(Char,Int)] -> [String] (e) [Int -> Bool] (f) (Char,Int) -> [String] (g) No type: Composition requires listi... Date Added: 2009-06-03 22:32:38 |
| InterruptibilityConvert(3)(2).ppt Path: UNC >> CS >> 290 Spring, 2002 Description: Determining and Expressing Interruptibility Lavar Askew Interruptibility Interrupt is the temporary stopping of a task to give attention to another task. Interruptibility reflects how likely an interrupt will affect the completion of the user\'s p... Date Added: 2009-06-03 22:33:05 |
| OAS+Gold+Program+Requirement+Package+-+KPITOASG.doc Path: UNC >> READ >> 930951 Fall, 2009 Description: Program Requirement Package PROGRAM: Purpose: KPITOASG Security interface for OAS GOLD Program FLOW: See attached VISO Diagram Attachment 1: Input Example of Passed Data: CHPS JAVA=Y AVER=00000012 STEST=Y HOSP=R40 LOC=pnw1 IP=165.226.228.112 COM... Date Added: 2009-06-03 22:33:54 |
| matrix_Patton.rtf Path: Maryville MO >> SKPWB >> 9467 Fall, 2009 Description: Sharon Patton 9467-Technology to Enhance Learning January 27, 2008 Learning and Technology Matrix Assignment Learning is. Cooperative Active Intentional Technology Digital Camera 7094-1 Image Scanner 6054-1 Presentation Software (Power Point) 6043-1... Date Added: 2009-06-03 22:35:02 |
| section_C2_guide.doc Path: Stevens >> E >> 344 Fall, 2009 Description: Section C2: The Development of Microstructure # C2.1 C2.2 C2.3 C2.4 C2.5 C2.6 Section heading Phases Microscopies to image microstructure Phases and the P-T Phase diagram Binary simple eutectic (IMPORTANT) Binary system with one or more compounds Rel... Date Added: 2009-06-03 22:35:40 |
| sect7_Callisterguide.doc Path: Stevens >> E >> 344 Fall, 2009 Description: Section C2: The Development of Microstructure # C2.1 C2.2 C2.3 C2.4 C2.5 C2.6 Section heading Phases Microscopies to image microstructure Phases and the P-T Phase diagram Binary simple eutectic (IMPORTANT) Binary system with one or more compounds Rel... Date Added: 2009-06-03 22:36:40 |
| apc_section_3.doc Path: Stevens >> E >> 344 Fall, 2009 Description: Assessment Performance Criteria Section 3 Metals and Alloys Students will be able to: 3.1 give examples of at least five different metals used in engineering applications 3.2 sketch an energy-band diagram for a typical metal and use this to explain... Date Added: 2009-06-03 22:37:14 |
| InfoTheory.ppt Path: Wright State >> EE >> 740 Winter, 2008 Description: Lender Waveform Generator PN Generator Xor Z 1 Z 1 Z 1 . Z 1 Xor Sum \"The Gaussian distribution arises in all cases where independent and identically distributed random events are summed up or averaged. This is the context of an important mat... Date Added: 2009-06-03 22:42:44 |
| P3123L07(Color).doc Path: UT Chattanooga >> PSY >> 312 Fall, 2009 Description: Psychology 312 Lab 7 Name_ 3.1.1. The Electromagnetic Spectrum. What type of radiation has the longest wavelength? The smallest? __ _ 3.1.2. Colors for Wavelengths. What wavelength is opposite each of the following in the color circle? a. 495_ 573_... Date Added: 2009-06-03 22:42:51 |
| Final Exam W05 Solutions.doc Path: Michigan >> MATH >> 420 Fall, 2009 Description: ... Date Added: 2009-06-03 22:42:58 |
| lecture26.ppt Path: Arizona >> NATS >> 101 Fall, 2006 Description: NATS 101 Lecture 26 Weather Forecasting 2 Review: Key Concepts There are several types of forecasts Numerical Weather Prediction (NWP) Use computer models to forecast weather -Analysis Phase -Prediction Phase -Post-Processing Phase (today) Humans ... Date Added: 2009-06-03 22:43:59 |
| Activity_07.doc Path: Penn State >> STAT >> 200 Fall, 2008 Description: ACTIVITY 7 Activity 7.1 In each part, indicate, (1) whether the variable is discrete or continuous AND (2) whether it is binomial or not AND (3) if it is binomial, give values for n and p. a. Number of times a \"head\" is flipped in 10 flips of a coin ... Date Added: 2009-06-03 22:44:26 |
| ECE122 Quiz2 Answers.doc Path: UMass (Amherst) >> ECE >> 122 Fall, 2009 Description: ECE 122 Spring 2005 Quiz #2 Name_ Student ID_ Discussion Session (circle one): (1) Wednesday 10:10am 11am (2) Wednesday 11:15am 12:05pm (3) Wednesday 1:25pm-2:15pm (4) Wednesday 2:30pm-3:20pm Q1 Choose the correct answer int i = 1; if (i) System.o... Date Added: 2009-06-03 22:45:35 |
| Presentation1-1.doc Path: CSU LA >> CS >> 490 Fall, 2009 Description: Presentation Outline Description: Data types, Data structures and implementation techniques, File organization (eg. sequential, indexed, multilevel) Data Types* Character: a single byte, capable of holding one character in the local character set. ... Date Added: 2009-06-03 22:47:22 |
| TA3_Sep19.doc Path: Wisconsin >> AAE >> 374 Fall, 2009 Description: Sep. 19 Andrs Moya AAE374 Discussion Section #3 Visual Representation of Distributions & PS1 1. Visual Representation of Distributions see stat.xls Histogram: Graphical display of tabulated frequencies, shown as bars. It shows the number of cases ... Date Added: 2009-06-03 22:47:34 |
| abnormal psychology syllabus.rtf Path: Caltech >> HSS >> 134 Spring, 2009 Description: HPS/PL 134: ABNORMAL PSYCHOLOGY Spring 2005-06, TTh 10.30-12. Baxter 218 murphy@hss.caltech.edu This course provides an survey of issues in contemporary theories of abnormal psychology. The course will have two main concerns. First, we will look a... Date Added: 2009-06-03 22:49:58 |
| soln1.ps Path: Princeton >> CS >> 126 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.55 Copyright 1986, 1994 Radical Eye Software %Title: soln1.dvi %CreationDate: Mon May 13 17:49:12 1996 %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: rdvips soln1.dvi %DVIPSPara... Date Added: 2009-06-03 22:50:32 |
| 08gene.ps Path: Princeton >> CS >> 126 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.55 Copyright 1986, 1994 Radical Eye Software %Title: 08gene.dvi %CreationDate: Mon Apr 15 14:43:42 1996 %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentSuppliedFonts: CMBX10 CMR10 CMTI10 CMTT10 CMSY10 ... Date Added: 2009-06-03 22:50:38 |
| l1.ps Path: Princeton >> CS >> 333 Spring, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.497 Copyright 1986, 1992 Radical Eye Software %Title: l1.dvi %CreationDate: Thu Feb 8 17:10:56 1996 %Pages: 25 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: /usr/local/tex/bin/dvips l1 %... Date Added: 2009-06-03 22:50:42 |
| h3.ps Path: Princeton >> CS >> 423 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: TeX output 1996.02.12:1921 %Creator: DVILASER/PS, ArborText, Inc. %BoundingBox: (atend) %Pages: (atend) %DocumentFonts: (atend) %DocumentMedia: Plain 612 792 75 white {} %EndComments %! % Dvips.pro - included prolog for DviLase... Date Added: 2009-06-03 22:50:49 |
| Kin_Rev.ppt Path: UF >> CHEM >> 4411 Fall, 2009 Description: KRQ1 The first-order reaction A -> Products has a rate of 1.5 M/s when the concentration of A, [A], is 0.75 M. What is the rate constant for the reaction? a) 1.5 M/s b) 2.67 M-1 s-1 c) 2.00 s-1 e) none of these d) 0.5 s KRQ2 The zeroth-order reactio... Date Added: 2009-06-03 22:53:41 |
| Curve Fitting 04.doc Path: Rose-Hulman >> CE >> 311 Spring, 2009 Description: CE 311 CE Computer Applications II Non-linear regression Curve Fitting (con\'t) 1 The basic idea in all curve fitting is to minimize the sum of the squares of the residuals. For non-linear equations, the direct minimization of Sr in either EXCEL (S... Date Added: 2009-06-03 22:53:52 |
| Childs - Life Long Learning.doc Path: Rose-Hulman >> CE >> 489 Fall, 2009 Description: Matt Childs Early Career Educational Plan CE489 Significant changes in the CE profession in the last 10 -20 years Compilation of codes are becoming more common standard code for all subdisciplines Adaptations to codes require stricter complian... Date Added: 2009-06-03 22:54:25 |
| hw4_cover_page.txt Path: BYU Hawaii >> CS >> 1020 Fall, 2009 Description: * * CS 1020 HOMEWORK COVER SHEET * * HOMEWORK #4 * * MY NAME: * WHICH OPTIONAL PARTS I DID: * * * (Only the TA or instructor may fill out the rest.) * * 40 POINTS \"CORRECTNESS\" * - * 10 points: Does the program loop on an individual question until... Date Added: 2009-06-03 22:54:40 |
| hand4.txt Path: Cincinnati >> YR >> 614 Fall, 2009 Description: LINEAR MODELS II HANDOUT #4 DATA MJ129; INPUT T B Y @; CARDS; 1 1 19 1 1 20 1 1 21 1 2 24 1 2 26 1 3 22 1 3 25 1 3 25 2 1 25 2 1 27 2 2 21 2 2 24 ... Date Added: 2009-06-03 22:56:15 |
| inherit_super2.txt Path: Cornell >> CS >> 100 Fall, 2008 Description: class A { public int x; A(int x) { this.x = x; } public int getX_1() { return getX_2(); } public int getX_2() { return x; } } class B extends A { public int x = 3; B(int x) { super(x); } / Can\'t do the following because t... Date Added: 2009-06-03 22:58:01 |
| lecture16.ppt Path: UF >> CLAS >> 4302 Fall, 2009 Description: Objective tests of the auditory system 1. Acoustic immittance measures Static acoustic compliance Tympanometry Acoustic reflex Otoacoustic emissions (OAE) Transientevoked OAE (TEOAE) Distortionproduct OAE (DPOAE) Auditory evoked potentials Ele... Date Added: 2009-06-03 22:59:11 |
| KellerCh5FloodingPart2.ppt Path: N. Arizona >> GLG >> 112 Fall, 2008 Description: Note effect a retention pond has on water flow Temporary storage lessens magnitude of discharge and spreads out impact Channelization Pros Flood and erosion control Better navigation Cons Disturbs ecosystems Plants, animals, feeding/breedin... Date Added: 2009-06-03 22:59:59 |
| Ch. 19-22.ppt Path: Kentucky >> CE >> 599 Fall, 2008 Description: Ch. 19 ADMINISTRATION, LAW, ACCOUNTING Management Information Systems Labor Relations Personnel Administration Purchasing and Materials Management Public Relations Law and Public Affairs Accounting Traffic Corporate Development Real Est... Date Added: 2009-06-03 23:01:07 |
| midterm.txt Path: Binghamton >> CS >> 220 Fall, 2009 Description: CS 220: Computer Systems II: Architecture and Programming Spring 2009 - Section A0 Midterm Exam - 2009/03/18 Name: _ = 1: Circle which of the flags (it can be any number of them) listed under each set of numbers will be set (to 1) after each p... Date Added: 2009-06-03 23:01:22 |
| Notes.doc Path: Boise State >> MATH >> 124 Fall, 2008 Description: Group Theory What is symmetry? Wikipedia Symmetry in common usage generally conveys two primary meanings. The first is an imprecise sense of harmonious or aesthetically-pleasing proportionality and balance; such that it reflects beauty or perfection... Date Added: 2009-06-03 23:01:44 |
| ProblemA2Handout1.doc Path: Carnegie Mellon >> BIO >> 03310 Fall, 2009 Description: ... Date Added: 2009-06-03 23:02:44 |
| Ch.8_Notes_Grad.doc Path: N.C. State >> PA >> 598 Fall, 2008 Description: Spring 2006 Government and Nonprofit Accounting PA 598 Chapter 8 Long-term Obligations I. Why is this information important to financial statement users? GASB Concept # 1 Refer to the key objectives of financial reporting Provide information about... Date Added: 2009-06-03 23:03:05 |
| BazettLect3_2009.ppt Path: Toledo >> BCH >> 445 Fall, 2009 Description: Electron beam-specimen interactions Principle of Electron Energy Loss Spectroscopy (EELS) and Electron Spectroscopic Imaging (ESI) Electron Imaging Spectrometers P and N mapping in a 16-cell mouse embryo P N N-P 400 nm Basic Architecture of the... Date Added: 2009-06-03 23:04:21 |
| PHYS216_Fall2007_Test1_Q.doc Path: NMSU >> PHYS >> 216 Fall, 2009 Description: Q NAME _ PHYS 216 TEST 1 FALL 2007 SHOW ALL YOUR WORK ON THE TEST FORM. IF NEEDED, WRITE ON THE BACK OF THE PAGES OF THE TEST FORM. Coulomb Force exerted by one point charge q1 on another point charge q2 : 1 q1q 2 F1,2 = r1,2 r1,2 = distance betw... Date Added: 2009-06-03 23:04:53 |
| readme.txt Path: Utah >> CS >> 3710 Fall, 2008 Description: The Spartan-3E DDR SDRAM controller design has been hardware verified for the following combination: FPGA PART : xc3s500efg320 Frequency in MHz : 133 Speed grade : -4 HDL : verilog/VHD... Date Added: 2009-06-03 23:05:42 |
| 34-priority-queues.ppt Path: UPenn >> CIT >> 594 Fall, 2009 Description: Priority Queues Priority queue A stack is first in, last out A queue is first in, first out A priority queue is least-first-out The \"smallest\" element is the first one removed (You could also define a largest-first-out priority queue) T... Date Added: 2009-06-03 23:06:12 |
| 15-arrays.ppt Path: UPenn >> CIT >> 591 Fall, 2009 Description: Arrays May 16, 2009 A problem with simple variables One variable holds one value The value may change over time, but at any given time, a variable holds a single value If you want to keep track of many values, you need many variables All ... Date Added: 2009-06-03 23:06:12 |
| chpt1.ppt Path: Bowling Green >> CSC >> 4220 Fall, 2009 Description: C hapte 1 r I ntroduction slides based on material by Jim Kurose and Keith Ross, 1996-2004 With some modifications C pute Ne om r tworking: A Top Down Approach Fe aturing the I nte t, rne 3rd e dition. JimKurose Ke Ross , ith Addison-We y, July 20... Date Added: 2009-06-03 23:06:13 |
| cal.ps Path: UCSD >> CSE >> 101 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: cal.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMR10 CMBX10 CMMI10 CMSY10 CMSY7 CMR7 CMMI7 CMTI10 %+ CMEX10 CMSY5 %EndComments %DVIPSW... Date Added: 2009-06-03 23:08:23 |
| hw4.ps Path: UCSD >> CSE >> 101 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw4.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hw4.dvi -o hw4.ps %DVIPSParame... Date Added: 2009-06-03 23:08:29 |
| application.ps Path: UCSD >> CSE >> 123 Spring, 2002 Description: %!PS-Adobe-2.0 %Creator: dvips 5.55 Copyright 1986, 1994 Radical Eye Software %Title: root.dvi %CreationDate: Wed Dec 4 08:05:18 1996 %Pages: (atend) %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Times-Bold Times-Roman Courier Courier-... Date Added: 2009-06-03 23:08:37 |
| may20.ps Path: UCSD >> CSE >> 101 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: may20.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR17 CMR12 CMBX12 CMBX10 CMR10 CMMI10 CMSY10 CMEX10 %+ CMMI7 CMSY7 MSAM10 CMSY5 CMR7 ... Date Added: 2009-06-03 23:09:01 |
| 0601-mins.doc Path: UCSD >> ARIES >> 0601 Fall, 2008 Description: Memo: Date: Subject: To: From: ARIES-26 Blue font items have been modified or added 28 February 2006 ARIES Project Meeting Minutes, 23 January 2006, University of California, San Diego ARIES Team L. Waganer ARIES Compact Stellarator Waganer Ihli Tur... Date Added: 2009-06-03 23:10:19 |
| Transition_Plan_S06b_T06_v1.3.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Transition Plan (TP) Version 1.3 USC Football Recruitment Database (Team 6) Client Jared Blank USC Football The Team Feasibility Rationale Systems Architecture & UML Modeling Operational Concept and Systems Analysis Life Cycle Plans and Prototypes... Date Added: 2009-06-03 23:11:02 |
| Main.txt Path: CSU Chico >> CSCI >> 111 Fall, 2009 Description: / * / Program name: Main.java / / Name: Glenn Crosby / Date: 14-May-2008 / Class: CSCI 111 / / Note: this class was not written by me but was modified by me as need / to complete lab 6. // / Problem Description (copied directly from the lab assignme... Date Added: 2009-06-03 23:14:16 |
| 04.RadiativeTransfer.ppt Path: Colorado State >> AT >> 606 Fall, 2009 Description: Radiative Transfer and Climate ad hapte 3 in Hartm r ann Re C e e m r Assignm nt 1 dueFriday S pte be 20 Terminology ne r Radianceis e rgy pe unit solid angle usually re rre to in a , fe d give band of wave ngths n le ) Flux (or irradiance is th... Date Added: 2009-06-03 23:17:32 |
| Ch11-balt.ppt Path: Texas San Antonio >> IS >> 3003 Fall, 2008 Description: CHAPTER 11 SYSTEMS DEVELOPMENT McGrawHill/Irwin 2008 The McGrawHill Companies, All Rights Reserved 11-2 DEVLOPING SOFTWARE Software that is built correctly can transform/be adapted as the organization and its business transforms Software that ... Date Added: 2009-06-03 23:17:47 |
| SyllabusTen.doc Path: Caltech >> BEHECON >> 485 Fall, 2009 Description: 10 January 07 Yale Econ 485b Behavioral Economics Tentative Syllabus Prof. Jernej Copic email: jernej.copic@yale.edu office: Room 6, 30 Hilhouse phone: 203 432 6158 REQUIRED TEXTBOOKS: Advances in Behavioral Economics, edited by Colin Camerer, Georg... Date Added: 2009-06-03 23:18:12 |
| CCSOP26ReheatingFoodLeftovers.doc Path: Iowa State >> NR >> 63152 Fall, 2009 Description: Standard Operating Procedure Reheating Food (Leftovers) Policy: All food will be reheated to a temperature reading of 165F for 15 seconds to assure the safety of the food. Procedure: Employees reheating food should: 1. Remove leftover food from the f... Date Added: 2009-06-03 23:20:27 |
| Howardstakeholder2008.doc Path: Iowa State >> C >> 97484 Fall, 2009 Description: Howard County Extension 132 1st Avenue West Cresco, IA 52136 Phone: (563)547-3001 Fax: (563) 547-3012 Email: www.extension.iastate.edu/howard Get inside Extension and discover how we support healthy people, healthy environments, and healthy economies... Date Added: 2009-06-03 23:20:47 |
| scores.txt Path: Iowa State >> ECON >> 1974 Fall, 2009 Description: Date,Visitor,Vistor Score,Home,Home Score,Overtimes 06/01/1974,Denver,14,Jesup,32,0 06/01/1974,Jesup,14,Calmar South Winneshiek,12,0 06/01/1974,Jesup,14,Dunkerton,13,0 06/01/1974,Jesup,16,Fredericksburg,15,0 06/01/1974,Jesup,26,LaPorte City,14,0 06/0... Date Added: 2009-06-03 23:22:35 |
| Ch04.ppt Path: Mississippi State >> CSE >> 3981 Fall, 2009 Description: Chapter 4 Intellectual Property Chapter 4 The slides for this course are based on the course textbook: Quinn, Michael J., Ethics for the Information Age, 3rd ed., Pearson/Addison-Wesley, Boston, 2009. Many of these slides were provided by the publ... Date Added: 2009-06-03 23:23:20 |
| SN23.pdf Path: Bergen CC >> ECON >> 100 Fall, 2009 Description: Section Notes 23, Econ 100A Spring 06 1 Section Notes 23 Covering material from Lecture on April 18th Class Outline 1. Collusion with Constant Marginal Costs 2. Practice Noncooperative Games 1 Collusion with Constant Marginal Costs Problem: (P&... Date Added: 2009-06-03 23:24:20 |
| xx40.ps Path: Minnesota >> A >> 05175 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: dpf96.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSCommandLine: dvips dpf96 %DVIPSParameters: dpi=300, compressed, comments remov... Date Added: 2009-06-03 23:24:53 |
| Handout 1 - Overview of RR1.doc Path: Texas >> PSY >> 418 Fall, 2008 Description: Overview of RR1 3 sections: Title page Introduction Reference Page Title Page - header/page #, running head, title, author, author affiliation - don\'t forget to write out \"running head\" Introduction (4-6 pages, PAST TENSE) 1) State the problem 2) Rev... Date Added: 2009-06-03 23:29:07 |
| MCCP625.87.Leadership.Taft.MHC.doc Path: Springfield >> AA >> 553 Fall, 2009 Description: Springfield College School of Human Services Tampa Bay Campus MCCP 625/87 Leadership: A Lifelong Journey (2 Credits) SUMMER 2009 Instructor: Jeanette Taft , PhD Address: 225 West Busch Blvd. Tampa, FL 33612 Phone number(s): (813) 936-2800 Fax#: (813... Date Added: 2009-06-03 23:29:22 |
| STP226S09_Ch02handout.ppt Path: ASU >> STP >> 226 Fall, 2008 Description: Chapter 2: Organizing Data STP 226: Elements of Statistics Jenifer Boshes Arizona State University 2.1: Variables and Data Variable A variable is a characteristic that varies from one person or thing to another. Example 1: Qualitative Variable A ... Date Added: 2009-06-03 23:29:44 |
| quiz6.txt Path: Binghamton >> CS >> 220 Fall, 2009 Description: CS 220: Computer Systems II: Architecture and Programming Fall 2006 - Section 90 Quiz #6 - 2006/11/14 Name: _ = 1: Circle which one (1) of the following is what \"SIMD\" stands for: a) Simple Instructions Meanings Differ b) Single Instruct... Date Added: 2009-06-03 23:29:45 |
| Ch14&15Solutions.doc Path: CSU Fullerton >> MATH >> 1020 Fall, 2009 Description: Exercise 14.1 1. Given: PV = $1000, n = 6, i = 15% = 1.25% 12 Substitute into formula (10-2) and solve for PMT. 1 - 1.0125 -6 $1000 = PMT 0.0125 PMT = $174.03 Payment number 0 1 2 3 4 5 6 Payment -$174.03 174.03 174.03 174.03 174.03 174.06 To... Date Added: 2009-06-03 23:31:14 |
| BINF7580 Lecture 10 HA.doc Path: UMDNJ >> BINF >> 7580 Fall, 2009 Description: BINF7580 Fulton Shannon Home assignment: 1. Describe any of the Mitochondrial diseases: symptoms, treatments, Clinical and drug trials Ans: Summary A mitochondrion (singular of mitochondria) is part of every cell in the body that contains genetic m... Date Added: 2009-06-03 23:33:26 |
| Tsay_VBnet_TB_07.doc Path: CUNY Baruch >> CS >> 430 Fall, 2009 Description: 59 Chapter 7 Repetition Visual Basic.Net 2/e Multiple Choice 1. The keyword that marks the end of a Do structure is: a) b) c) d) End Do. Loop. For Next. End While B Section Reference: Section 7.1 Answer: 2. Given the structure Do While X > 1000 ... Date Added: 2009-06-03 23:34:31 |
| L23Review.ppt Path: UMBC >> CMSC >> 104 Fall, 2006 Description: Final Exam q Final Exam: Thursday Dec 13th, 2001 at 8:30 pm in SS-111, the regular classroom. Final Review Using Variables You may declare variables in C. q The declaration includes the data type you need. q Examples of variable declarations: q i... Date Added: 2009-06-03 23:34:49 |
| Changing%20Exponential%20Bases.doc Path: Arizona >> MATH >> 109 Fall, 2008 Description: Changing Exponential Bases Math 109 Due: Tuesday March 20th Name:_ In 2001, the in-state tuition at the University of Arizona was $2,344. In 2006, the tuition was up to $4,952. Assuming exponential growth, answer questions 1-3. Let t be the number ... Date Added: 2009-06-03 23:35:42 |
| dreamWeaverSiteCreation.doc Path: Nevada >> BUSINESS >> 360 Fall, 2009 Description: Creating a new site in Dreamweaver Choose create new Dreamweaver site. Name your site. Blank this field out. Click next. Choose this option. Click next. Browse to wherever you want to set up your site. Preferably a USB drive if you\'re working ... Date Added: 2009-06-03 23:37:36 |
| Motion.ppt Path: Nevada >> CS >> 485 Fall, 2009 Description: Motion (Chapter 8) CS485/685 Computer Vision Prof. Bebis Visual Motion Analysis Motion information can be used to infer properties of the 3D world with little a-priori knowledge of it (biologically inspired). In particular, motion information prov... Date Added: 2009-06-03 23:37:40 |
| 04 100ab.xls Path: East Los Angeles College >> UKHR >> 0405 Fall, 2009 Description: Table 100a Projected output from the Housing Corporation\'s Approved Development Programme (ADP) approvals Table 100b Projected output from the Housing Corporation\'s Approved Development Programme (ADP) completions Table 100a Projected output from t... Date Added: 2009-06-03 23:39:42 |
| Pisa.doc Path: UH Clear Lake >> TAYLORA >> 7656 Fall, 2009 Description: The Leaning Tower Of Pisa Designed As a Bell Tower Took Over 200 Years to Build Houses Seven Bells Each One Represents a Note on the Musical Scale Located in Pisa, Italy - Europe ... Date Added: 2009-06-03 23:41:06 |
| Lecture03.ppt Path: Michigan State University >> CSE >> 830 Fall, 2008 Description: Probabilistic (Average-Case) Analysis and Randomized Algorithms Two different but similar analyses Probabilistic analysis of a deterministic algorithm Analysis of a Randomized algorithm Tools from probability theory Indicator variables Lineari... Date Added: 2009-06-03 23:41:23 |
| Rubric.doc Path: Southern Utah >> EDU >> 595 Fall, 2009 Description: Name_ Date_ Class_ Own Your On Biz! Rubric Business Card (20 Points) Points Earned = Start-up Budget (20 Points) Points Earned = Flyer (20 Points) Points Earned = Brochure (20 Points) Points Earned = Power Point Presentation (100 Points) Points Earn... Date Added: 2009-06-03 23:43:40 |
| Marginal_Analysis_Exercise_2009.doc Path: Butler >> EC >> 354 Fall, 2009 Description: EC 354-Marginal Analysis Exercise-Informal Assignment (due Wednesday, January 21st) This example provides numbers that enable us to determine the \"optimal\" amount of exercise to do. The table below shows the Total Benefit and Total Cost of working ou... Date Added: 2009-06-03 23:45:36 |
| REVCH6_pt_1_s08.doc Path: Butler >> EC >> 354 Fall, 2009 Description: EC 354 Intermediate Microeconomics Review Questions for Ch. 6 (part 1) Robert S. Main 1. For each of the accompanying Total Product curves, sketch in the lower panel the corresponding Marginal Product of labor (MPL) and Average Product of labor (AP... Date Added: 2009-06-03 23:45:53 |
| unit2sup.ppt Path: Kentucky >> EE >> 513 Fall, 2008 Description: EE513 Audio Signals and Systems Complex Oscillator Kevin D. Donohue Electrical and Computer Engineering University of Kentucky Oscillator Design Marginally Stable approach: Design a system by placing poles so that a marginally stable system results,... Date Added: 2009-06-03 23:47:05 |
| Hospitals and Nonprofit Behavior.doc Path: Trinity U >> ECON >> 4397 Fall, 2009 Description: Hospitals and the Role of Nonprofit Firms Up to this point we have focused primarily on the demand side of the industry: The demand for health, the role of uncertainty and how it gives rise to the market for insurance, the problems that insurance mar... Date Added: 2009-06-03 23:47:20 |
| Lect12_ 2DKinematics.ppt Path: Georgia Tech >> PHYSICS >> 2211 Fall, 2009 Description: Physics 2211: Lectures 12 q 2-D, 3-D Kinematics and Projectile Motion Independence of x , y and z- components *Georgia Tech track and field example *Football example *Shoot the monkey *Basketball Free Throws Physics 2211 Spring 2005 Lecture 12, Pa... Date Added: 2009-06-03 23:56:59 |
| problem.txt Path: UC Riverside >> CS >> 153 Spring, 2008 Description: This is to implement a shell program that behaves like a subset of bash, the standard Linux shell. And also please refer pages:77-79 of Gary Nutt book. Required features: * cd * Forground and back ground execution of commands. Their names mus... Date Added: 2009-06-03 23:58:09 |
| savitch07.ppt Path: UC Riverside >> CS >> 010 Fall, 2008 Description: Copyright 2003 Pearson Education, Inc. Slide 1 Chapter 7 More Flow of Control Created by David Mann, North Idaho College Copyright 2003 Pearson Education, Inc. Slide 2 Overview Introduction Using Boolean Expressions (7.1) Multiway Branche... Date Added: 2009-06-03 23:58:30 |
| Ass8F03.ps Path: Minnesota >> MATH >> 3283 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: Ass8F03.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips Ass8F03.dvi %DVIPSParamete... Date Added: 2009-06-03 23:58:45 |
| practice591.ppt Path: Penn State >> DGM >> 122 Fall, 2009 Description: Practice Putting the Literature into the Context of Teaching Critical Components P Physical Environment q Description of the building or classroom Old or new Small or large Bright or dark q Size of class, school Social Environment P Class dyn... Date Added: 2009-06-03 23:59:53 |
| practice591.ppt Path: Penn State >> DGM >> 591 Fall, 2009 Description: Practice Putting the Literature into the Context of Teaching Critical Components P Physical Environment q Description of the building or classroom Old or new Small or large Bright or dark q Size of class, school Social Environment P Class dyn... Date Added: 2009-06-03 23:59:53 |
| CH 2 K&K orgcultquestions.doc Path: Oregon State >> BA >> 352 Fall, 2008 Description: Chapter 2 Cultivating Organizational Culture and Ethical Behavior 1. What are the three layers of organizational culture? Be able to give an example of each layer to illustrate your understanding. 2. What are the functions of culture? In other words,... Date Added: 2009-06-04 00:01:23 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 132 Fall, 2009 Description: -/\'^ 48039,32243,793,10971 .ggggj 52829,40606,126,1551 ^4:fv<^ 34923,29197,2221,9044 ^ 45609,30085,2761,2178 iik^ 57927,25134,428,1528 ipi^ 30383,61679,491,2167 j 57596,25753,1523,1197 m 24384,61853,602,604 n 57699,24278,634,353 ... Date Added: 2009-06-04 00:02:12 |
| README.txt Path: Penn State >> CSW >> 4364 Fall, 2009 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Strict/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\"> <head> <title> Changeset 4364 for users/csw14/epidemica/static/README.txt... Date Added: 2009-06-04 00:02:34 |
| energyLmp.xls Path: CSU Northridge >> SED >> 99402 Fall, 2009 Description: Energy changes in chemical reactions. Bonds broken Bond No EnergyTotal CC C=C CH CCl CO C=O CN NN N=N N=N HH HN HO HCl HBr HI ClCl BrBr II O=O 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 347 612 413 346 336 805 286 158 410 945 436 391 464 432 366 298... Date Added: 2009-06-04 00:02:56 |
| ADG - The Living Company.doc Path: Laurentian >> MGT >> 3080 Fall, 2009 Description: The Living Company by Arie De Geus Harvard Business Review (March 1997) In the world of institutions, commercial corporations are newcomers. They have been around for only 500 years a mere blip in the course of human civilization. In that time, as p... Date Added: 2009-06-04 13:13:40 |
| studyquestions_exam2.doc Path: Texas San Antonio >> IS >> 3003 Fall, 2008 Description: STUDY QUESTIONS EXAM 2 IS 3003 Chapter 6: Telecom 1. 2. 3. Should be able to compare and contrast different communication media. Should also be able to discuss the telecom components discussed in class. Distinguish between a network operating system ... Date Added: 2009-06-04 13:13:58 |
| greedy-practice-probs-sols.ps Path: Washington University in St. Louis >> CS >> 441 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: greedy-practice-probs-sols.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o greedy-practice-probs-sols.ps %+ gr... Date Added: 2009-06-04 13:14:15 |
| chap017p.ppt Path: UNC Wilmington >> MKT >> 341 Fall, 2009 Description: 1-1 Chapter 17 Advertising and Public Relations 1-2 cGraw-Hill/Irwin M Copyright 2004 by The McGraw-Hill Companies, Inc. All rights reserved. After studying this chapter you should be able to: Understand the characteristics, functions, and type... Date Added: 2009-06-04 13:16:13 |
| Focus Questions for Group Discussion on Transfer.ppt Path: Uni. Worcester >> CS >> 525 Fall, 2008 Description: Small Group Discussions (More individual involvement) Paper 1: 5 minutes small groups followed by 3 minute report from a randomly selected group and member, followed by ~7 minutes whole class. Paper 2: Same thing but this time with 10 minute for smal... Date Added: 2009-06-04 13:17:35 |
| Tigris.txt Path: Uni. Worcester >> CS >> 525 Fall, 2008 Description: 80542775 <system version=\"2.05 Testing Version \"> Envorement and IP=63.174.82.111 psrb-ppp1-111.tcsn.net email= Mozilla/4.0 (compatible; MSIE 6.0; Windows NT 5.1; DigExt)<what_best_describes_you =Student> <How_much_math_have_you_had =Took algebra y... Date Added: 2009-06-04 13:17:45 |
| lec0108.pptx Path: DePaul >> GAM >> 376 Fall, 2009 Description: Math / Physics 101 GAM 376 Click to edit Master subtitle style Robin Burke Winter 2008 Homework #1 Use my code not Buckland\'s web site Visual Studio Express l see DL\'s comments (col site) Discussion site any course-related topic Begin math / ... Date Added: 2009-06-04 13:17:56 |
| 2005-07-16Court Gutting in Congress.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: July 16, 2005 Court Gutting in Congress Congress is quietly considering whether to destroy one of the pillars of constitutional law: the habeas corpus power of the federal courts to determine whether an indigent defendant has been unjustly sentenc... Date Added: 2009-06-04 13:18:34 |
| 2005Road Maps and Dead Ends.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Road Maps and Dead Ends by Yossi Beilin The New York Times, October 20, 2005 Op-Ed Contributor http:/www.nytimes.com/2005/10/20/opinion/20beilin.html The original timetable of the Middle East \"road map\" the plan given to Israel and the Palesti... Date Added: 2009-06-04 13:18:55 |
| omit.txt Path: Old Dominion >> CS >> 412 Fall, 2009 Description: As a general rule, you can omit the names of parameters if they are obvious or uninteresting. But when you have things like (int, int), the meaning is non-obvious. [Even if I guess that these are a row and column, which comes first?] ... Date Added: 2009-06-04 13:21:46 |
| 4-2.ppt Path: YCP >> MAT >> 171 Fall, 2008 Description: 4.2 Optimization. The student will learn about the optimization of a function in several different settings. 1 Reminder of Facts f is increasing f is decreasing f is constant f is concave up f concave down Inflection point f ` (x) > 0 f ` (x) < 0 f... Date Added: 2009-06-04 13:21:47 |
| Feb15.07.doc Path: Johns Hopkins >> DATA >> 2348 Fall, 2009 Description: OFFICE OF CAREER COUNSELING AND PLACEMENT Virginia Probasco, Admin. Ass\'t ginpro@peabody.jhu.edu Hours, 1 - 5 p.m. 1 E. Mount Vernon Place Room P06, Conservatory Baltimore, MD 21202 (410) 659-8100 x4450 JOB VACANCY BULLETIN NO. 501 www.peabody.jhu.... Date Added: 2009-06-04 13:23:47 |
| hw3.doc Path: ECPI >> CIS >> 150 Fall, 2009 Description: CIS 150 HW #3 WAN Assignment Below is a drawing of a Wide area network of an insurance company. The network consists of the headquarters that supports 4 regional offices. Each regional office supports small insurance offices that are owned by agents ... Date Added: 2009-06-04 13:26:25 |
| ES-CaseStudydirections.doc Path: Johns Hopkins >> DATA >> 3174 Fall, 2009 Description: Empowering Students by Linking Student and Teacher Learning Styles Directions for the Case Study Scenario You will work with your teammates to complete the following case study. This week\'s team facilitator should post the assignment in the team\'s di... Date Added: 2009-06-04 13:26:44 |
| ES-CaseStudydirections.doc Path: Johns Hopkins >> CTE >> 3174 Fall, 2009 Description: Empowering Students by Linking Student and Teacher Learning Styles Directions for the Case Study Scenario You will work with your teammates to complete the following case study. This week\'s team facilitator should post the assignment in the team\'s di... Date Added: 2009-06-04 13:26:44 |
| hw0.ps Path: Duke >> CPS >> 234 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: hw0.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o hw0.ps hw0 %DVIPSParameter... Date Added: 2009-06-04 13:28:07 |
| onetime.txt Path: Duke >> CPS >> 001 Fall, 2009 Description: l i s t e n, m y c h i l d r e n, a n d 12 9 19 20 5 14 13 25 3 8 9 12 4 18 5 14 1 14 4 3 4 19 23 4 16 9 2 12 10 1 17 22 8 25 8 2 8 21 15 13 12 17 9 4 22 1 15 18 10 3... Date Added: 2009-06-04 13:28:10 |
| OAS+Gold+Program+Requirement+Package+-+KPITOASG.doc Path: UNC >> READ >> 910266 Fall, 2009 Description: Program Requirement Package PROGRAM: Purpose: KPITOASG Security interface for OAS GOLD Program FLOW: See attached VISO Diagram Attachment 1: Input Example of Passed Data: CHPS JAVA=Y AVER=00000012 STEST=Y HOSP=R40 LOC=pnw1 IP=165.226.228.112 COM... Date Added: 2009-06-04 13:35:03 |
| alphabet.doc Path: UNC >> FILES >> 210 Fall, 2009 Description: PHIL 210 Lesher Ancient Greek: An Introduction The original language of most of the philosophical texts we will read in this course was Attic Greek, the language spoken andfrom approximately the 7th century for... Date Added: 2009-06-04 13:35:17 |
| kin352d01.txt Path: Sveriges lantbruksuniversitet >> KIN >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: KIN 352-0 D01 LOCATION: SFU TITLE: PRACTICUM II SECTION TYPE: SEC SEMESTER: 1996-3 ENROL: 7 ... Date Added: 2009-06-04 13:36:36 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 18:56:35 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 20:08:25 2008 ( 4310 s elapsed) ... Date Added: 2009-06-04 13:39:51 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 19:01:19 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 20:24:01 2008 ( 4962 s elapsed) ... Date Added: 2009-06-04 13:40:26 |
| guide to christmas exam 2005.doc Path: St. Francis IL >> ECON >> 100 Fall, 2009 Description: Economics 100 Summary of topics and the BIG questions. Chapters covered: 1, 2, 3, 4, 5, 6, 9, 10, 11. The following notes will emphasize the main topics. It is really an opportunity for me to indicate some of the bigger issues and some normative issu... Date Added: 2009-06-04 13:43:00 |
| Ghosh_FIN332_syllabus_Fall_2008.doc Path: CSU Fullerton >> BUSINESS >> 332 Fall, 2009 Description: CALIFORNIA STATE UNIVERSITY, FULLERTON COLLEGE OF BUSINESS AND ECONOMICS Department of Finance Finance 332: Theory of Corporate Finance Fall, 2008 Instructor: Dr. Dipasri Ghosh Phone: (714)-278-4821 Office: SGMH 5183 Fax: Office Hours: Wednesday 5:3... Date Added: 2009-06-04 13:43:07 |
| output.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS10 - local directory - Volume in drive C has no label. Volume Serial Number is 7A81-82A4 Directory of C:\\condor\\execute\\dir_3728 02/13/2008 08:49 PM <DIR> . 02/13/2008 08:49 PM <... Date Added: 2009-06-04 13:43:42 |
| log.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: 000 (59765.000.000) 02/13 19:07:37 Job submitted from host: <128.95.94.28:1092> . 001 (59765.000.000) 02/13 20:43:39 Job executing on host: <172.25.101.177:1056> . 006 (59765.000.000) 02/13 21:03:48 Image size of job updated: 469744 . 006 (59765.000.... Date Added: 2009-06-04 13:44:14 |
| error.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 13 21:44:33 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 13 22:55:48 2008 ( 4275 s elapsed) ... Date Added: 2009-06-04 13:44:46 |
| THESIS PICTURES.doc Path: Buffalo State >> PHY >> 690 Fall, 2009 Description: FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 4 FIGURE 5 ... Date Added: 2009-06-04 13:45:36 |
| Jan25.ppt Path: UNC >> COMP >> 120 Fall, 2008 Description: January 25 Did you get mail from Chun-Fa about assignment grades? Assignment 3 posted due Feb 1. Read 3.1 through 3.4 for next Tuesday 30 January Only 3 more lectures before the first exam coming up February 8. Maxima (was macsyma) is a nice FRE... Date Added: 2009-06-04 13:46:09 |
| lect3.ppt Path: UNC >> COMP >> 144 Fall, 2008 Description: The University of North Carolina at Chapel Hill COMP 144 Programming Language Concepts Spring 2002 Lecture 3: Lexical Analysis Felix Hernandez-Campos Jan 14 COMP 144 Programming Language Concepts Felix Hernandez-Campos 1 Phases of Compilation COM... Date Added: 2009-06-04 13:46:19 |
| 122CH13.PPT Path: CSU Pueblo >> FACULTY >> 122 Fall, 2009 Description: Cha pter 13 Sol uti ons Overview v Sol uti on Pr ocess energy changes, solution formation, chemical reactions Concentr ati on mole fraction, molarity, molality, mass percent, ppm Satur ated Sol uti ons & Sol ubi l i ty Factor s Affecti ng I nt... Date Added: 2009-06-04 13:46:24 |
| F06.010.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F06.010 repeat_region no description available Chr06 137908.143866 tgttggaataaaaatcaactatcatctactaactagtatttacgttacta gtatattatcatatacggtgttagaagatgacgcaaatgatgagaaatag tcatctaaattagtggaagctgaaacgcaaggattgataatgtaatagga tcaatgaatattaacatataaaatgatg... Date Added: 2009-06-04 13:46:39 |
| hw7sol.txt Path: Washington University in St. Louis >> CS >> 455 Fall, 2009 Description: CS 455 - HOMEWORK 7 SOLUTION Page 7-1 - Problem 1 - a) The combine function accepts three parameters: F function to apply to each element of the list L SUM the operation to distribute over the elements of the list L ZERO the value to ... Date Added: 2009-06-04 13:46:40 |
| chapter1.doc Path: SIU Edwardsville >> INDEX >> 563 Fall, 2009 Description: CHAPTER 1 INTRODUCTION TO PL/SQL -PL/SQL is the Oracle\'s procedural language extension to SQL, the non-procedural relational database language. PL/SQL fully integrates modern software engineering features such as data encapsulation, information hidin... Date Added: 2009-06-04 13:46:42 |
| PHYS_2326_022409.ppt Path: Dallas >> PHYS >> 015000 Fall, 2009 Description: Molecular Model of Induced Charge Electronic polarization of nonpolar molecules Total charge Q = qi = 0 But dipole moment d = qi ri may be nonvanishing i i For nonpolar molecules d = 0 in the absence of the applied electric field E but they acqui... Date Added: 2009-06-04 13:47:45 |
| PRO_IVVa_LCO_F05a_T21.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Name: Charles Zhu Project: Team 21 (Rule-based Editor). Overall I think this prototype has met the expectations set out by the team-which is to deliver a non-functional prototype to gather client feedbacks on their vision of the system, and its funct... Date Added: 2009-06-04 13:48:40 |
| IP_IOC2_S05b_T08.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Iteration Plan V 1.5 Iteration Plan Correspondence Document Data Center Team# 8 577b Ian Beckles Sudhir Patel Pritesh Patel Salman Ali Rajrupa Ghosh Dan Ingold Tiffany Kim - IV V IP_IOC2_S05_T08.doc 1 Version Date: 4/23/05 Iterati... Date Added: 2009-06-04 13:49:12 |
| md5sums.txt Path: USC >> PUB >> 20070623 Fall, 2009 Description: 9eb99434b474b3c22e816380f2819c06 changelog.txt e7e2850029b8fcfd61099c75b5bcaebd mit-scheme-20070623-ix86-apple-darwin.tar.gz 958665a6ad7ccaf2ac1504968235d267 mit-scheme-20070623-ix86-gnu-linux.tar.gz 95784f4c63248fa9bd2601c78fb4acca mit-scheme-20... Date Added: 2009-06-04 13:49:41 |
| FSF-2007-chapman.ppt Path: Kansas State >> FOODSAFETY >> 1003 Fall, 2009 Description: Food Safety Forum 2007 Disconnect between food service and public health February 19, 2006 Ben Chapman Brae Surgeoner Tanya MacLaurin University of Guelph bchapman@uoguelph.ca Doug Powell Food Safety Network Kansas State University dpowell@kstate.e... Date Added: 2009-06-04 13:50:40 |
| 1019Lec7.ppt Path: Maple Springs >> CSE >> 1019 Fall, 2009 Description: Math/CSE 1019N: Discrete Mathematics for Computer Science Winter 2007 Suprakash Datta datta@cs.yorku.ca Office: CSEB 3043 Phone: 416-736-2100 ext 77875 Course page: http:/www.cs.yorku.ca/course/1019 05/17/09 1 Analysis of Algorithms Measures of e... Date Added: 2009-06-04 13:50:58 |
| tcss435A_15.ppt Path: Washington >> TCSS >> 435 Fall, 2009 Description: Computer Vision 5/27/2004 TCSS435A Isabelle Bichindaritz 1 Learning Objectives Understand principles of perception in general Understand image formation Understand what is early vision See vision problems in 2D then 3D See an overview of obj... Date Added: 2009-06-04 13:51:21 |
| compiler-message.txt Path: Wilfrid Laurier >> LECT >> 315 Fall, 2009 Description: WillNotCompile.java:21: Exception GreenException must be caught, or it must be declared in the throws clause of this method. public static void f4() { g(); } ^ 1 error ... Date Added: 2009-06-04 13:51:53 |
| hw4.doc Path: Washington >> LING >> 570 Fall, 2008 Description: LING 570: Hw4 Due date: 3pm on Oct 24 For Parts I and II, you need to use the Carmel package and write some scripts as needed. Unlike Part III of Hw3, I am not going to enumerate all the necessary steps in order to complete the tasks. Instead, I will... Date Added: 2009-06-04 13:52:10 |
| equity~1.ppt Path: University of Baltimore >> HOME >> 641 Fall, 2009 Description: Equity Theory (Adams, 1963; Landy, 1989; Beehr, 1996) 1 Equity Theory A version of discrepancy theory of job satisfaction focusing on the discrepancies between what one has on the job and what one thinks is fair - what one should have 2 Equity Th... Date Added: 2009-06-04 13:52:41 |
| wins.ppt Path: University of Baltimore >> HOME >> 650 Fall, 2009 Description: Windows Inter net Name Service WINS It does name resolution (?!) q What is WINS? DNS resolves IP numbers and FQDN q ARP resolves IP numbers and MAC addresses q WINS resolves NetBIOS names and IP numbers (see last class meeting) It is dynamic, as... Date Added: 2009-06-04 13:52:50 |
| soybeanrust.doc Path: Iowa State >> MR >> 0525 Fall, 2009 Description: Stop Soybean Rust News, KS 05-21-07 IA officials find no more soybean rust evidence; feds investigate origin of infected leaf DES MOINES - How and why a single leaf infected with Asian soybean rust was found in Iowa in March are questions that contin... Date Added: 2009-06-04 13:54:09 |
| soybeanrust.doc Path: Iowa State >> PUBLIC >> 0525 Fall, 2009 Description: Stop Soybean Rust News, KS 05-21-07 IA officials find no more soybean rust evidence; feds investigate origin of infected leaf DES MOINES - How and why a single leaf infected with Asian soybean rust was found in Iowa in March are questions that contin... Date Added: 2009-06-04 13:54:09 |
| pork.doc Path: Iowa State >> MR >> 0727 Fall, 2009 Description: Wallace\'s Farmer, IA 07-27-07 Become a Pork Quality Assurance Plus Advisor Compiled By Staff Veterinarians and others in Iowa\'s pork industry have the opportunity to become Pork Quality Assurance Plus Advisors under the National Pork Board\'s PQA Plus... Date Added: 2009-06-04 13:54:24 |
| pork.doc Path: Iowa State >> PUBLIC >> 0727 Fall, 2009 Description: Wallace\'s Farmer, IA 07-27-07 Become a Pork Quality Assurance Plus Advisor Compiled By Staff Veterinarians and others in Iowa\'s pork industry have the opportunity to become Pork Quality Assurance Plus Advisors under the National Pork Board\'s PQA Plus... Date Added: 2009-06-04 13:54:25 |
| 91707.doc Path: Iowa State >> NR >> 63575 Fall, 2009 Description: ISU Extension Tip of the Week September 1721, 2007 Helping Children Succeed in School School Stress Children spend about 1,000 hours per year in school. So, helping children enjoy learning and being successful in school is an important goal. What a... Date Added: 2009-06-04 13:54:55 |
| Requir509.doc Path: Maryville MO >> CSC >> 509 Fall, 2009 Description: REQUIREMENTS DOCUMENT CSC509 Your requirements document shall be a textual document (usually of 7-20 pages) that includes the following information. (The following is taken from the text, \"Software Engineering\', by Ian Sommerville, Addison-Wesley, 1... Date Added: 2009-06-04 13:55:02 |
| prog2.ps Path: UCSD >> CSE >> 160 Fall, 2008 Description: %!PS-Adobe-3.0 %BoundingBox: 54 72 558 720 %Creator: Mozilla (NetScape) HTML->PS %DocumentData: Clean7Bit %Orientation: Portrait %Pages: 4 %PageOrder: Ascend %Title: CSE 160/260 Programming Assignment #2 %EndComments %BeginProlog [ /.notdef /.notdef ... Date Added: 2009-06-04 13:55:25 |
| 6322Normalization.ppt Path: Winston Salem State >> MYWEB >> 6322 Fall, 2009 Description: MIS 6322 Database Design 12.1 Functional Dependencies & Primary Keys Functional Dependency A particular relationship between two attributes. For a given relation, attribute B is functionally dependent on attribute A is, for every valid value o... Date Added: 2009-06-04 13:55:43 |
| 6322Normalization.ppt Path: Winston Salem State >> MIS >> 6322 Fall, 2009 Description: MIS 6322 Database Design 12.1 Functional Dependencies & Primary Keys Functional Dependency A particular relationship between two attributes. For a given relation, attribute B is functionally dependent on attribute A is, for every valid value o... Date Added: 2009-06-04 13:55:43 |
| porn.txt Path: Michigan State University >> FS >> 092796 Fall, 2009 Description: Porn 9-24-96 By PATRICK WILSON Capital News Service LANSING - The Legislature will soon restrict pornography in state prisons, but will change current policies little. Sponsored by Sen. Philip Hoffman, R-Horton, the bill was passed Wedne... Date Added: 2009-06-04 13:56:05 |
| bentley.doc Path: Wayne State University >> AJ >> 3731 Fall, 2009 Description: The 2001 Bentley EXP Speed 8. This new LMGTP heads Bentley\'s return to Le Mans. Tapping into Audi\'s Le Mans experience (Audi owns Bentley), Bentley has constructed a new LMGTP chassis. While the EXP Speed 8 undoubtedly was influenced by Audi\'s 1999 c... Date Added: 2009-06-04 13:57:03 |
| creatingProc2.txt Path: SUNY Plattsburgh >> FACULTY >> 433 Fall, 2009 Description: Creating new processes The only way to create a new UNIX process is to call the routine fork() which makes a complete copy (clone) of the original process including the text and data sections (including the environment and open file-descriptors). The... Date Added: 2009-06-04 13:59:34 |
| A02-Fractional.4p.ps Path: UCSC >> CMPE >> 112 Spring, 2009 Description: %!PS-Adobe-2.0 %DocumentFonts: Helvetica Helvetica-Bold Courier Courier-Bold %Title: stdin %Creator: psnup, Copyright (C) 1994 M. Herbert <rxkmh@minyos.xx.rmit.oz.au> %Revision: $Header: psnup.pro,v 2.2 94/06/14 14:39:29 rxkmh Locked 0%CreationDate: ... Date Added: 2009-06-04 14:01:43 |
| 1973.txt Path: UCCS >> CS >> 591 Fall, 2009 Description: Rule: - Sid: 1973 - Summary: This event is generated when an attempt is made to exploit a buffer overflow vulnerability associated with ProFTP FTP server MKDIR command. - Impact: Remote access. A successful attack may permit the remote execution... Date Added: 2009-06-04 14:02:37 |
| Lecture14.ppt Path: Portland >> CLASS >> 573 Fall, 2009 Description: Some Properties of the 2-D Fourier Transform Translation Distributivity and Scaling Rotation Periodicity and Conjugate Symmetry Separability Convolution and Correlation Translation f x )x j 0 / + yN F - , - ) (, e [2( xM0 / ) u v y p u v ] ( 0v 0 u ... Date Added: 2009-06-04 14:02:51 |
| broadcourseplans.ppt Path: Johns Hopkins >> DATA >> 1590 Fall, 2009 Description: Phase IIb Course Broad Plan and Session Planning Johns Hopkins University Center for Technology in Education 2006 Course Broad Plan The Course Broad Plan contains the details necessary to prepare for instruction. The more time dedicated to outlini... Date Added: 2009-06-04 14:03:02 |
| broadcourseplans.ppt Path: Johns Hopkins >> CTE >> 1590 Fall, 2009 Description: Phase IIb Course Broad Plan and Session Planning Johns Hopkins University Center for Technology in Education 2006 Course Broad Plan The Course Broad Plan contains the details necessary to prepare for instruction. The more time dedicated to outlini... Date Added: 2009-06-04 14:03:02 |
| Maps.txt Path: Temple >> TUA >> 21517 Fall, 2009 Description: theTEXT= <b><font size = \"20\">Maps</font></b> The following links contain maps to the attractions and destinations in this section: <i><a href=\"http:/img136.imageshack.us/img136/2988/independenceparkzz1.jpg\" target=\"blank\"><b>Independence Park</b> ... Date Added: 2009-06-04 14:04:39 |
| Overview.doc Path: WVU >> BADM >> 524 Fall, 2008 Description: BADM524 August 23, 2006 Financial Statement Analysis Project General Overview Fall 06 Everyone in the BADM524 class of 2006 has been hired by Fadali Inc. (the \"Company\"). Fadali is one of the premier manufacturers of widgets, gizmos and big blue f... Date Added: 2009-06-04 14:04:49 |
| Lec3_device.ppt Path: IPFW >> CPET >> 565 Fall, 2009 Description: CPET 565 Mobile Computing Systems Mobile Computing Device & Technologies Lecture 3 Hongli Luo Indiana University-Purdue University Fort Wayne Mobile Computing Device Technologies Mobile Devices Hardware Operating Systems Development Tools ... Date Added: 2009-06-04 14:06:11 |
| lawsuit.txt Path: NYU >> PAGES >> 3307 Fall, 2009 Description: Length.of.service CAP PA.normalized Minority Laid.off 3.17 7 3.33 1 1 4.47 8 3.33 1 1 0.69 11 4.44 1 1 1.52 16 1.11 1 1 7.43 6 13.32 1 1 10.95 7 14.44 1 1 9.53 7 16.68 1 1 6.41 16 9.99 1 1 7.41 15 13.32 0 1 7.00 13 15.56 1 1 1.82 27 3.33 1 1 7.78 11 ... Date Added: 2009-06-04 14:06:22 |
| log2.doc Path: DePaul >> CSC >> 298 Spring, 2009 Description: Jibran Ilyas CSC 298 Jim Janossy DePaul University Weekly Log Log for weeks starting 4/21/03 and 4/28/03 My third week at Morgan Stanley wasn\'t as good as the first two weeks. I was put at Tech support for most of the time. Though, it wasn\'t as bad a... Date Added: 2009-06-04 14:07:06 |
| submit.txt Path: Washington >> V >> 12000 Fall, 2009 Description: executable = allgamma_12229.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-04 14:12:39 |
| problem19_06.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 19.6: b) p V (1.50 10 5 Pa) (0.0600 m 3 0.0900 m 3 ) 4.50 10 3 J. ... Date Added: 2009-06-04 14:12:42 |
| submit.txt Path: Washington >> V >> 12000 Fall, 2009 Description: executable = allgamma_12197.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-04 14:13:12 |
| log.txt Path: Washington >> V >> 10179 Fall, 2009 Description: 000 (43175.000.000) 01/29 07:23:42 Job submitted from host: <128.95.94.28:1098> . 001 (43175.000.000) 01/29 07:33:40 Job executing on host: <172.25.101.183:1063> . 005 (43175.000.000) 01/29 07:41:40 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 14:13:30 |
| error.txt Path: Washington >> V >> 11608 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Jan 30 20:51:28 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 22:01:02 2008 ( 4174 s elapsed) ... Date Added: 2009-06-04 14:15:18 |
| error.txt Path: Washington >> V >> 11500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Jan 30 22:02:47 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 23:17:40 2008 ( 4493 s elapsed) ... Date Added: 2009-06-04 14:15:25 |
| log.txt Path: Washington >> V >> 11577 Fall, 2009 Description: 000 (45077.000.000) 01/30 18:17:40 Job submitted from host: <128.95.94.28:1098> . 001 (45077.000.000) 01/30 20:24:55 Job executing on host: <172.25.101.183:1063> . 010 (45077.000.000) 01/30 20:28:36 Job was suspended. Number of processes actually su... Date Added: 2009-06-04 14:16:11 |
| submit.txt Path: Washington >> V >> 11709 Fall, 2009 Description: executable = allgamma_11709.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:16:18 |
| log.txt Path: Washington >> V >> 11616 Fall, 2009 Description: 000 (45116.000.000) 01/30 18:17:48 Job submitted from host: <128.95.94.28:1098> . 001 (45116.000.000) 01/30 21:04:56 Job executing on host: <172.25.101.51:1055> . 010 (45116.000.000) 01/30 21:07:29 Job was suspended. Number of processes actually sus... Date Added: 2009-06-04 14:16:41 |
| error.txt Path: Washington >> V >> 15311 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 10:42:30 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 11:51:46 2008 ( 4156 s elapsed) ... Date Added: 2009-06-04 14:18:43 |
| log.txt Path: Washington >> V >> 15221 Fall, 2009 Description: 000 (48716.000.000) 02/04 05:07:04 Job submitted from host: <128.95.94.28:1098> . 001 (48716.000.000) 02/04 09:38:55 Job executing on host: <172.25.101.48:1057> . 006 (48716.000.000) 02/04 09:59:03 Image size of job updated: 413248 . 005 (48716.000.0... Date Added: 2009-06-04 14:20:12 |
| output.txt Path: Washington >> V >> 15468 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-B15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2748 02/04/2008 12:51 PM <DIR> . 02/04/2008 12:51 ... Date Added: 2009-06-04 14:20:28 |
| error.txt Path: Washington >> JOBS >> 10097 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 02:50:46 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 03:06:18 2008 ( 932 s elapsed) ... Date Added: 2009-06-04 14:20:52 |
| output.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS1 - local directory - Volume in drive C has no label. Volume Serial Number is 5692-E1E5 Directory of C:\\condor\\execute\\dir_552 02/07/2008 02:28 AM <DIR> . 02/07/2008 02:28 AM <DI... Date Added: 2009-06-04 14:21:00 |
| log.txt Path: Washington >> JOBS >> 10040 Fall, 2009 Description: 000 (51036.000.000) 02/06 08:18:05 Job submitted from host: <128.95.94.28:1098> . 001 (51036.000.000) 02/06 08:20:16 Job executing on host: <172.25.101.67:1067> . 005 (51036.000.000) 02/06 08:36:24 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-04 14:23:21 |
| output.txt Path: Washington >> V >> 15477 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-32WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 3C9A-2CA7 Directory of C:\\condor\\execute\\dir_3384 02/04/2008 12:23 PM <DIR> . 02/04/2008 12:23 ... Date Added: 2009-06-04 14:26:13 |
| log.txt Path: Washington >> V >> 15240 Fall, 2009 Description: 000 (48735.000.000) 02/04 05:07:08 Job submitted from host: <128.95.94.28:1098> . 001 (48735.000.000) 02/04 09:51:20 Job executing on host: <172.25.101.162:1060> . 006 (48735.000.000) 02/04 10:11:29 Image size of job updated: 373968 . 005 (48735.000.... Date Added: 2009-06-04 14:26:36 |
| se280-Prediction Intervals.ppt Path: MSOE >> SE >> 280 Fall, 2009 Description: Prediction Intervals SE-280 Dr. Mark L. Hornick 1 PROBE calculation gives us estimates SE-280 Dr. Mark L. Hornick 2 But just how good are these estimates? Off by 5%, 10%, 50%, 100%, 500%? Does it matter? Do you want to bet: Your weekends? Y... Date Added: 2009-06-04 14:26:53 |
| ps1.doc Path: UPR Mayagüez >> ICOM >> 4015 Fall, 2009 Description: Department of Electrical and Computer Engineering University of Puerto Rico Mayagez ICOM 4015 Advanced Programming Fall 2006 Exam I Practice Exercises and Problem Set 1 DUE: September 14, 2006 In class 1) Create a new Eclipse project titled icom4015... Date Added: 2009-06-04 14:27:39 |
| lec03.ppt Path: UPR Mayagüez >> ICOM >> 4036 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|28 Sep 2004 18:01:52 -0000 vti_extenderversion:SR|5.0.2.6417 vti_backlinkinfo:VX|courses/Spring2004/icom4036/icom4036.htm vti_author:SR|CHURCH\\bvelez vti_modifiedby:SR|BVWS\\bvelez vti_timecreated:TR|19 ... Date Added: 2009-06-04 14:28:10 |
| BN305-Mod1-Part2.txt Path: Colorado State >> PART >> 305 Fall, 2009 Description: <title=\"BN305_Mod1_Part2\"> <!stamp=\"BN305-Mod1-Part2-imp.jar 691231 17:00:00\"> <s=\"Management Functions\"> <t=00:00.0> <!slideid=\"483\"> <video=\"BN305-Mod1-Part2\"> PROFESSOR DENNIS MIDDLEMIST Talk a little bit about this management functions as it i... Date Added: 2009-06-04 14:29:42 |
| CmpE135-OOAD-W01-ws.doc Path: San Jose State >> CMPE >> 135 Fall, 2008 Description: OOAD-W01- Working Sheet CmpE 135 Dr. M.E. Fayad Announcements: None Hardcopies: 1. My teaching philosophy http:/www.engr.sjsu.edu/~fayad/personal/Fayad-TeachF.DOC 2. Syllabus or GreensSheet 3. Lecture #1 - working sheet Lesson Objectives Talk abo... Date Added: 2009-06-04 14:30:17 |
| 09_11.txt Path: Erskine >> PH >> 110 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|10 Sep 2000 04:23:00 -0000 vti_extenderversion:SR|4.0.2.2717 ... Date Added: 2009-06-04 14:30:46 |
| F05 Lessons learned.doc Path: Oregon State >> BA >> 352 Fall, 2008 Description: Lessons Learned Fall 2005 AM Planning Get started early Stick to work plan Remember to stick to work plan even though nothing is due, be sure to continue with research. Make sure you have a balanced team with a distribution of talents (i.e. edi... Date Added: 2009-06-04 14:32:16 |
| klbasis17.txt Path: Utah >> SPIN >> 134 Fall, 2009 Description: Block 17: - 0: 0: 1 1: 1: 1 2: 0: 1 2: 1 3: 1: 1 3: 1 4: 0: 1 2: 1 4: 1 5: 1: 1 3: 1 5: 1 6: 0: 1 2: 1 4: 1 6: 1 7: 1: 1 3: 1 5: 1 7: 1 8: 0: 1 2: 1 4: 1 6: 1 8: 1 9: 1: 1 3: 1 5: 1 7: 1 9: 1 10: 0: 1 2: 1 4: 1 6: 1... Date Added: 2009-06-04 14:34:54 |
| klbasis0.txt Path: Utah >> SPIN >> 121 Fall, 2009 Description: Block 0: - 0: 0: 1 1: 1: 1 2: 0: 1 1: 1 2: 1 3: 0: 1 1: 1 2: 1 3: 1 4: 0: 1 1: 1 2: 1 3: 1 4: 1 5: 0: 1 1: 1 2: 1 3: 1 4: 1 5: 1 6: 0: 1 1: 1 2: 1 3: 1 4: 1 5: 1 6: 1 7: 0: 1 1: 1 2: 1 3: 1 4: 1 5: 1 6: 1 7: 1 ... Date Added: 2009-06-04 14:35:11 |
| output.txt Path: Washington >> V >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-1Z4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2484 12/03/2007 12:05 PM <DIR> . 12/03/2007 12:05 ... Date Added: 2009-06-04 14:35:46 |
| error.txt Path: Washington >> V >> 11213 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 09:20:06 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 10:39:03 2007 ( 4737 s elapsed) ... Date Added: 2009-06-04 14:36:20 |
| output.txt Path: Washington >> V >> 11059 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-9Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2624 12/03/2007 06:54 AM <DIR> . 12/03/2007 06:54 ... Date Added: 2009-06-04 14:36:55 |
| error.txt Path: Washington >> JOBS >> 31327 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 20:46:24 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 21:28:53 2008 ( 2549 s elapsed) ... Date Added: 2009-06-04 14:39:33 |
| error.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 19:13:36 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 20:03:41 2008 ( 3005 s elapsed) ... Date Added: 2009-06-04 14:40:26 |
| log.txt Path: Washington >> JOBS >> 31185 Fall, 2009 Description: 000 (56183.000.000) 02/10 19:08:29 Job submitted from host: <128.95.94.28:1098> . 001 (56183.000.000) 02/10 19:58:38 Job executing on host: <172.25.101.161:1061> . 006 (56183.000.000) 02/10 20:18:46 Image size of job updated: 448712 . 006 (56183.000.... Date Added: 2009-06-04 14:41:37 |
| output.txt Path: Washington >> V >> 11456 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-715QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3712 12/03/2007 12:24 PM <DIR> . 12/03/2007 12:24 ... Date Added: 2009-06-04 14:44:49 |
| submit.txt Path: Washington >> V >> 11375 Fall, 2009 Description: executable = allgamma_11375.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11000-11499/11... Date Added: 2009-06-04 14:45:00 |
| 7 - Population Structure & Life History.ppt Path: University of Illinois, Urbana Champaign >> NRES >> 219 Spring, 2008 Description: Population Structure (Chapter 13 skip p. 259-261) 1. 2. 3. 4. Estimating population size Geographic ranges Dispersal Source-sink dynamics Estimating Population Size Small populations: census: count all individuals Larger populations: census in... Date Added: 2009-06-04 14:46:37 |
| zol415finalstudyquestions.doc Path: Michigan State University >> WEB >> 415 Fall, 2009 Description: ZOL 415, Spring 2009: Final exam study questions. Pg 1 of 1 The final exam will be one essay question from the list of 8, below. I will choose which one, so come prepared to answer all of them. You can prepare however you like. I suggest that ... Date Added: 2009-06-04 14:46:48 |
| P115_HW10_S2009.doc Path: Wisc Eau Claire >> PHYS >> 115 Fall, 2008 Description: Dr. Likkel, Physics 115, UWEC Spring 2009 Physics 115 Homework 10 Cosmology (Chapters (17), 18) 1. The fact that the galaxies farther away are moving away from us the fastest is taken as evidence that A) we are at the center of the universe B) ... Date Added: 2009-06-04 14:47:09 |
| ling361e01.txt Path: Sveriges lantbruksuniversitet >> LING >> 19972 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: LING 361-3 E01 LOCATION: SFU TITLE: LING/LANG TEACH PRAC SECTION TYPE: LEC SEMESTER: 1997-2 ENROL: 34... Date Added: 2009-06-04 14:47:40 |
| Econ 388 CourseOnline Sylabus Fall 2008.doc Path: Western Michigan >> HOMEPAGES >> 388 Fall, 2009 Description: Western Michigan University Department of Economics http:/www.wmich.edu/economics College of Arts & Sciences http:/www.wmich.edu/cas Fall Semester 2008 ECON 388: African Economies Sisay Asefa, Ph.D. Professor, Department of Economics OFFICE: 5455 Fr... Date Added: 2009-06-04 14:48:25 |
| HW3.doc Path: Georgia Tech >> ME >> 6105 Fall, 2008 Description: 1 Homework-3 Wei YE Muhammad SADIQ Khalil GOUIA Task: 1 In our HW2, we had proposed a model of the Solar Water Purifier. This Solar Water Purifier works on the solar energy. It gets water from a reservoir and is transferred to an inlet tank with the ... Date Added: 2009-06-04 14:48:40 |
| PHED 201 Syllabus.doc Path: Samford >> EDU >> 201 Fall, 2009 Description: PHED 201 ELEMENTARY SCHOOL PHYSICAL EDUCATION SAMFORD UNIVERSITY EXERCISE SCIENCE & SPORTS MEDICINE 11:45 12:50 M/W/F Course Description: This course is designed for persons interested in the psychomotor development of the elementary school child. T... Date Added: 2009-06-04 14:49:10 |
| ho02.ps Path: Yale >> CS >> 467 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: ho02.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Helvetica Times-Roman Times-Bold Times-Italic %DocumentPaperSizes: Letter %EndComments... Date Added: 2009-06-04 14:50:09 |
| Lecture9.ppt Path: Covenant School of Nursing >> GHSR >> 5301 Fall, 2009 Description: LONG-TERM CARE Objectives Understand the role and scope of services included in LTC Appreciate who uses LTC and under what circumstances Assess how LTC is organized, integrated, evaluated and reimbursed Be aware of innovative approaches to organi... Date Added: 2009-06-04 14:51:03 |
| hw-3.txt Path: Carnegie Mellon >> CMT >> 721 Fall, 2009 Description: \\documentstyle[12pt]{article} \\begin{document} % macros % %\\documentstyle[12pt]{article} % \ enewcommand{\\thesubsection}{\\arabic{subsection} % 1.2 -> 2 %\\pagestyle{headings} %to fix page # \ ewcounter{examplenumber} \\setcounter{ex... Date Added: 2009-06-04 14:53:06 |
| ps4.ps Path: UC Davis >> CS >> 494 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.83 (MiKTeX 1.20b) Copyright 1998 Radical Eye Software %Title: ps4.dvi %CreationDate: Tue Jul 27 10:56:58 1999 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DV... Date Added: 2009-06-04 14:53:24 |
| wireless.ppt Path: Calvin >> ENGR >> 302 Fall, 2009 Description: Wireless Communications By Kyle Heys Engr 302 Prof Ribeiro Overview i Wave Propagation y Electromagnetic Spectrum y Applications y High Bandwidth Applications y Conclusion y Cellular vs. PCS y GPS Wave Propagation i Waves in three space travel 3... Date Added: 2009-06-04 14:53:51 |
| problem21_32.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 21.32: a) q1 ^ (9 109 N m 2 C 2 ) ( 5.00 10 9 C) E1 j ( 2.813 10 4 N C) ^ j 2 2 40 r1 0.0400 m q2 (9 109 N m 2 C 2 ) (3.00 10 9 C) E2 1.08 10 4 N C 2 2 2 r2 0.0300m (0.0400 m) The angle of E 2 , measured from the x - axis, is 180 tan 1 4.00 cm 3.0... Date Added: 2009-06-04 14:55:43 |
| problem21_66.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 21.66: a) The torque is zero when p is aligned either in the same direction as E or in the opposite directions b) The stable orientation is when p is aligned in the same direction as E c) ... Date Added: 2009-06-04 14:55:46 |
| submit.txt Path: Washington >> V >> 17000 Fall, 2009 Description: executable = allgamma_17148.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs17000-17499/17... Date Added: 2009-06-04 14:58:58 |
| Jeopary Review.ppt Path: Penn State >> NJS >> 5061 Fall, 2009 Description: Choose a category. You will be given the answer. You must give the correct question. Click to begin. Click here for Final Je Famous People 10 Point Things Aren\'t Key Compromise Working Vocabulary 10 Point 10 Point 10 Point Misc. 10 Point 20 Poi... Date Added: 2009-06-04 15:00:35 |
| exam1.ps Path: Washington University in St. Louis >> CS >> 201 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: exam1.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o exam1.ps exam1.dvi %DVIPSParameters: dpi=300, compressed... Date Added: 2009-06-04 15:01:51 |
| CIV1337 - Lecture 4.ppt Path: Toledo >> CIV >> 1337 Fall, 2009 Description: Simulation Programming Continued. Lecture 4 Lecture 4 Topics File I/O (including reading CSV files from Excel) Private Object Attributes Indentifying and Object\'s Class Importing Parts of a Module Type Conversions List Comprehensions Argu... Date Added: 2009-06-04 15:02:09 |
| error.txt Path: Washington >> JOBS >> 30389 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 10:00:14 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 10:42:00 2008 ( 2506 s elapsed) ... Date Added: 2009-06-04 15:02:41 |
| submit.txt Path: Washington >> JOBS >> 30261 Fall, 2009 Description: executable = pass6_30261.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30261... Date Added: 2009-06-04 15:04:09 |
| output.txt Path: Washington >> JOBS >> 30145 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-C05QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3236 02/10/2008 08:34 AM <DIR> . 02/10/2008 08:34 ... Date Added: 2009-06-04 15:04:15 |
| submit.txt Path: Washington >> JOBS >> 30161 Fall, 2009 Description: executable = pass6_30161.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30161... Date Added: 2009-06-04 15:05:38 |
| error.txt Path: Washington >> JOBS >> 30367 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 10:01:20 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 10:44:52 2008 ( 2612 s elapsed) ... Date Added: 2009-06-04 15:06:24 |
| Su06FinalSolutions.xls Path: Georgia Tech >> ISYE >> 2027 Fall, 2008 Description: Xi are IID Normal with mean = 0.77 and variance 2 = 0.08 a. Pr{Xi > 0.8 } = Pr{(Xi )/ > ( = Pr{Z > 0.39 } 1 ( = 0.39 ) =1 0.65 = 0.35 0.8 )/} If Y measures the number of samples out of 6 that have an expression larger than 0.8 , then Y has a bi... Date Added: 2009-06-04 15:07:08 |
| EU 3.ppt Path: BYU >> MANEC >> 358 Fall, 2008 Description: Group 6 European Union Brandon Henrie Lincoln Stevens Brent Andrus Tanner Christensen Adam Belnap Overview Background Current Situation International Aspects Special Problems Future European Union What is the EU? International Union of 25 ... Date Added: 2009-06-04 15:07:32 |
| lecture26S06.ppt Path: University of Illinois, Urbana Champaign >> IB >> 150 Fall, 2008 Description: Lecture 26: The Global Carbon Cycle By the end of this lecture you should be able to. Describe the main pools and fluxes in the global C cycle. Concepts and terms: gigaton Discuss the imbalance in the global C cycle. Concepts and terms: \"missing sink... Date Added: 2009-06-04 15:08:45 |
| SMLmodules.ps Path: East Los Angeles College >> CL >> 0809 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96.1 Copyright 2007 Radical Eye Software %Title: lectures.dvi %CreationDate: Wed Mar 4 16:09:46 2009 %Pages: 48 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 595 842 %DocumentFonts: EURB10 Helvetica ... Date Added: 2009-06-04 15:09:08 |
| ps5.ps Path: NJIT >> CIS >> 750 Spring, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: ps5.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMCSC10 CMR12 CMBX12 CMBX10 CMR10 CMTT10 %EndComments %DVIPSWebPage: (www.radicaleye.com... Date Added: 2009-06-04 15:09:55 |
| chapter1c.ppt Path: UF >> STA >> 6126 Spring, 2008 Description: Introduction (1.1) Data - Information collected by individuals and/or organizations to gain knowledge regarding a field or question of interest. Data Sources: Surveys (Mail, Telephone, Internet) Content Analysis (Newspaper, Magazine, Television... Date Added: 2009-06-04 15:10:10 |
| LEDPeakMaximaRun616.txt Path: Yale >> DEC >> 616 Fall, 2009 Description: Run number 616 tower 1 column 0 row 0 LED max 16.5 mean 16.8425 RMS 0.260265 number of entries 223 rms/mean 0.0154529 tower 2 column 1 row 0 LED max 14.5 mean 14.2072 RMS 0.262301 number of entries 223 rms/mean 0.0184625 tower 3 column 2 row 0 LED ma... Date Added: 2009-06-04 15:10:15 |
| MIPPeakMaximaRun0431part0.txt Path: Yale >> NOV >> 0431 Fall, 2009 Description: Run number 0431part0 Towers which were not necessarily isolated0431part0 tower 1 column 4 row 0 MIP max 4.5 mean 8.52811 RMS 8.37548 number of entries 3030 rms/mean 0.982103 tower 2 column 5 row 0 MIP max 41.5 mean 20.1186 RMS 12.9224 number of entri... Date Added: 2009-06-04 15:10:37 |
| submit.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: executable = pass6_6_80018.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/800... Date Added: 2009-06-04 15:12:41 |
| submit.txt Path: Washington >> JOBS >> 80223 Fall, 2009 Description: executable = pass6_6_80223.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/802... Date Added: 2009-06-04 15:13:20 |
| error.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 20 00:21:22 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 20 01:39:26 2008 ( 4684 s elapsed) ... Date Added: 2009-06-04 15:14:14 |
| PRES-CCLI-080814-v3.ppt Path: Ithaca College >> IC >> 030038 Fall, 2009 Description: Creating a Performance-based Physics program for introductory physics and astronomy classes using the SCALE-UP model of teaching physics Michael Rogers and Luke Keller, Department of Physics, Ithaca College, Ithaca, NY 14850 Funded by: NSF-DUE-05362... Date Added: 2009-06-04 15:18:53 |
| hwk1.ps Path: CSU Channel Islands >> P >> 115 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hwk1.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMBX12 CMR12 CMTI12 CMMI12 CMSY10 CMSY8 CMR8 CMMI8 CMR6 %+ CMEX10 %EndComments %DVIPSWe... Date Added: 2009-06-04 15:19:19 |
| #6 trencher.ppt Path: Minnesota >> ME >> 4054 Fall, 2009 Description: Trench `N Edge Katrina Faucett Peter Gillespie Parmanand Jagnandan Seongtae Kim Nick Schottler Chris Singh Chris Weyandt Customer Requirements The machine is to be self propelled The machine will have automated steering capability The... Date Added: 2009-06-04 15:19:57 |
| 05.gantt.doc Path: Minnesota >> ME >> 4054 Fall, 2009 Description: ... Date Added: 2009-06-04 15:20:05 |
| rfc1945.txt Path: UH Clear Lake >> CSCI >> 5234 Spring, 2008 Description: Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding ... Date Added: 2009-06-04 15:21:11 |
| rfc1945.txt Path: UH Clear Lake >> CSCI >> 5931 Fall, 2008 Description: Network Working Group T. Berners-Lee Request for Comments: 1945 MIT/LCS Category: Informational R. Fielding ... Date Added: 2009-06-04 15:21:15 |
| CMS10115.rtf Path: Allan Hancock College >> CMS >> 1011 Fall, 2009 Description: CMS1011 Television Texts and Institutions Semester 2. 2002 Week 5 Module 5. Narrative and Genre This module introduces three basic ideas about television Its central role in popular culture The central role of narrative within television The di... Date Added: 2009-06-04 15:21:53 |
| 224 Assignment # 5 Solutions s03.doc Path: W. Alabama >> ENVE >> 224 Fall, 2009 Description: ... Date Added: 2009-06-04 15:22:51 |
| 03 GS Genetics overview.ppt Path: Dallas >> MXA >> 049000 Fall, 2009 Description: Genetics Overview 30,000 - 40,000 genes Two copies of each (except XNature or nurture\" problem To what extent our genetic background vs.the external envi... Date Added: 2009-06-04 15:24:31 |
| manual05.ps Path: Duke >> STA >> 216 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: header.dvi %Pages: 59 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -N0 -o manual05.ps header %DVIPSParameters: dpi=600, comp... Date Added: 2009-06-04 15:25:07 |
| Exam1.doc Path: University of Illinois, Urbana Champaign >> CI >> 336 Fall, 2009 Description: M217 - Freshman Advanced Geometry Instructor: Eric Goolish E-Mail: goolish@uiuc.edu Office Phone: (847) 555-5555 Availability: 30 minutes before and after school. Or by Appointment Text Book: Geometry - Houghton Mifflin 2002 Course Webpage: www.highs... Date Added: 2009-06-04 15:26:18 |
| ECE Student Handbook-2008.doc Path: Minnesota >> ECE >> 1001 Fall, 2009 Description: DEPARTMENT OF ELECTRICAL AND COMPUTER ENGINEERING ECE STUDENT HANDBOOK COLLEGE OF SCIENCE & ENGINEERING UNIVERSITY OF MINNESOTA DULUTH FALL 2008 Telephone: 218-726-6147 Fax: 218-726-7267 Email: ece@d.umn.edu www.d.umn.edu/ece/ Individuals who hav... Date Added: 2009-06-04 15:26:23 |
| FRANZIPODDY2009.ppt Path: Allan Hancock College >> ENVS >> 1001 Fall, 2009 Description: Population, Resources and Sustainability Franzi Poldy CSIRO Sustainable Ecosystems ANU 7 April 2009 The challenge growing carbon dioxide emissions what can we do about them? some alternative energy scenarios not predictions not recommendations... Date Added: 2009-06-04 15:27:51 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05102479 Fall, 2009 Description: 05102479... Date Added: 2009-06-04 15:29:10 |
| 1.txt Path: Carnegie Mellon >> TERA >> 31003233 Fall, 2009 Description: 31003233... Date Added: 2009-06-04 15:29:14 |
| error.txt Path: Washington >> V >> 16568 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 10:28:59 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 11:47:27 2008 ( 4708 s elapsed) ... Date Added: 2009-06-04 15:29:32 |
| error.txt Path: Washington >> V >> 16721 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 15:44:01 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 16:57:48 2008 ( 4427 s elapsed) ... Date Added: 2009-06-04 15:31:04 |
| log.txt Path: Washington >> V >> 16927 Fall, 2009 Description: 000 (50422.000.000) 02/05 08:55:48 Job submitted from host: <128.95.94.28:1098> . 001 (50422.000.000) 02/05 20:29:58 Job executing on host: <172.25.101.93:1056> . 006 (50422.000.000) 02/05 20:50:06 Image size of job updated: 455672 . 005 (50422.000.0... Date Added: 2009-06-04 15:31:09 |
| error.txt Path: Washington >> V >> 16942 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 20:41:38 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 21:57:47 2008 ( 4569 s elapsed) ... Date Added: 2009-06-04 15:32:05 |
| output.txt Path: Washington >> V >> 16947 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-1Z4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_544 02/05/2008 08:44 PM <DIR> . 02/05/2008 08:44 P... Date Added: 2009-06-04 15:33:53 |
| AMLE169.ps Path: Allan Hancock College >> CCP >> 169 Fall, 2009 Description: %12345X@PJL JOB @PJL ENTER LANGUAGE=POSTSCRIPT %!PSAdobe3.0 %Title: Microsoft Word summary_final.doc %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 07/20/00 21:41:03 %BoundingBox: 11 13 601 780 %Pages: (atend) %PageOrder: Special %Requirem... Date Added: 2009-06-04 15:35:42 |
| Hirabayashi003.ps Path: Allan Hancock College >> CCP >> 003 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: (Microsoft Word - new_momentum1.doc) %Creator: (Microsoft Word: PSPrinter 8.2.2 J) %CreationDate: (0:32 PM 2000\\224N 5\\214\\216 26\\223\\372 \\213\\340\\227j\\223\\372) %For: (\\221\\345\\213\\264\\214\\244\\213\\206\\216\\272) %Pages: 1 %Docume... Date Added: 2009-06-04 15:36:17 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05102275 Fall, 2009 Description: 05102275... Date Added: 2009-06-04 15:36:42 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05102275 Fall, 2009 Description: 05102275... Date Added: 2009-06-04 15:36:42 |
| counter.txt Path: Capitol College >> CS >> 356 Fall, 2009 Description: 199... Date Added: 2009-06-04 15:37:54 |
| log.txt Path: Washington >> JOBS >> 32422 Fall, 2009 Description: 000 (57420.000.000) 02/10 19:25:10 Job submitted from host: <128.95.94.28:1098> . 001 (57420.000.000) 02/11 03:12:08 Job executing on host: <172.25.101.167:1060> . 006 (57420.000.000) 02/11 03:32:16 Image size of job updated: 449396 . 006 (57420.000.... Date Added: 2009-06-04 15:38:15 |
| output.txt Path: Washington >> JOBS >> 32194 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_416 02/11/2008 01:49 AM <DIR> . 02/11/2008 01:49 A... Date Added: 2009-06-04 15:38:26 |
| error.txt Path: Washington >> JOBS >> 32450 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 03:18:53 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 04:01:00 2008 ( 2527 s elapsed) ... Date Added: 2009-06-04 15:39:30 |
| herd037.txt Path: Iowa State >> ANS >> 352 Fall, 2009 Description: Herd: 37 CALF CROP SUMMARY Herd: 37 Calf Crop: 8 Calf Crop: 8 Est... Date Added: 2009-06-04 15:41:02 |
| log.txt Path: Washington >> JOBS >> 32048 Fall, 2009 Description: 000 (57046.000.000) 02/10 19:23:22 Job submitted from host: <128.95.94.28:1098> . 001 (57046.000.000) 02/11 01:02:36 Job executing on host: <172.25.101.183:1063> . 010 (57046.000.000) 02/11 01:06:16 Job was suspended. Number of processes actually su... Date Added: 2009-06-04 15:41:18 |
| error.txt Path: Washington >> JOBS >> 32333 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 02:36:14 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 03:17:01 2008 ( 2447 s elapsed) ... Date Added: 2009-06-04 15:42:04 |
| submit.txt Path: Washington >> JOBS >> 32087 Fall, 2009 Description: executable = pass6_32087.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs32000-32499/32087... Date Added: 2009-06-04 15:43:05 |
| grades_excel.xls Path: NMSU >> EDLT >> 3683 Fall, 2009 Description: Student Carlos Andrew Marcos Damian Kady Siena Jacob Mayra Julissa Activity 1 Activity 2 Activity 3 Activity 4 Total 25 23 25 25 23 24 25 25 22 23 23 24 25 23 22 20 20 22 21 23 25 25 24 24 19 20 22 21 18 20 21 22 22 23 24 23 0.98 0.97 0.92 0.9 0.86... Date Added: 2009-06-04 15:44:05 |
| WHitney Unit Plan 1.doc Path: NMSU >> ELT >> 36804 Fall, 2009 Description: How long can we go? Thematic Unit Planning Matrix Content Area Thematic Questions Centers Technology Assessment Student Integration and/or Products (References, Rubric Scale or Software and/ Portfolio or Resources) NM Content Standards with Benchmark... Date Added: 2009-06-04 15:44:11 |
| Grades.xls Path: NMSU >> EDLT >> 3684 Fall, 2009 Description: Teacher: Kelley Scott Subject: Special Education Year: 2008 1 2 3 Grading Scale 100-98% A+ 97-93% A 92-90% A5 6 4 Grade B B AA AA AAABB Student Names Abernacki, Raul Canales, Steve Dreay, Elisa Hill, Mary Kilroy, Donna Manches, Aaron Noal, Noah ... Date Added: 2009-06-04 15:44:35 |
| Counting Pets.doc Path: NMSU >> EDLT >> 3684 Fall, 2009 Description: Counting Pets A WebQuest for 2nd Grade (Math) Designed by Shantel Begay bgtel@hotmail.com Introduction | Task | Process | Evaluation | Conclusion | Credits | Teacher Page Introduction Majority of your students will have pets or their neighbors will... Date Added: 2009-06-04 15:44:59 |
| survey_badge(1).xls Path: NMSU >> ELT >> 36801 Fall, 2009 Description: Karen Kaufmann Basic File Mngmnt Excel Data Pix Browsers email Ethical InfoSearch Pres.Skills WP 3 3 3 2 3 2 3 2 2 2 2 Karen Kaufmann Basic managing ProbSolv Tech Intrg. 4 3 2 1 File Mngmnt WP Excel Pres.Skills Data InfoSearch Ethical email ... Date Added: 2009-06-04 15:45:52 |
| ExcelGradeBook.xls Path: NMSU >> EDUC >> 518 Fall, 2009 Description: Gradebook: 3rd 9-weeks Student Name Adams, E Astorga, F Brach, M Bass, E Cortez, J Cobos, D Markks, K Mateos, D Lopez, J Saenz, L Villalobos, V Oral Report PPT Presentation Class Participation Class Assignments 20 25 25 20 13 17 22 19 24 23 21 21 23 ... Date Added: 2009-06-04 15:45:57 |
| 07 - Responsibility.ppt Path: Rose-Hulman >> CS >> 490 Fall, 2009 Description: Patterns Day 13 Responsibility Read chapters 6-11 of Metsker. If you have not given me an electronic copy of your (past) presentation, please do so. No class tomorrow or Monday Reminders Some purposes of patterns Re-use Maintenance Presentation... Date Added: 2009-06-04 15:47:44 |
| FallingBlockRubric.docx Path: Rose-Hulman >> CSSE >> 120 Fall, 2009 Description: CSSE 120-FallingBlock Rub r ic _ Needs Team: Functionality Cr iter ia (weight) Platforms (6) Cont rollable block (7) Loss of life (4) Goodies (5) Running score (2) Additional lives (2) Display score/lives (1) \"How to play\" I nst ructions (1) Playab... Date Added: 2009-06-04 15:47:57 |
| Lesson 3.5.ppt Path: LeTourneau >> MATH >> 1903 Fall, 2009 Description: The Chain Rule Section 3.5 The Chain Rule According to Mrs. Armstrong . \"Pull the chain and the light comes on!\" Introduction Sludge Falls CO2 is changing at rate of 0.02 ppm for each person Population growing at rate of 1000 peopl... Date Added: 2009-06-04 15:50:31 |
| submit.txt Path: Washington >> JOBS >> 11666 Fall, 2009 Description: executable = pass6_11666.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11500-11999/11666... Date Added: 2009-06-04 15:51:08 |
| chprio.doc Path: UMass Lowell >> CS >> 516 Fall, 2009 Description: CHPRIO(2) Xinu Programmer\'s Manual CHPRIO(2) NAME chprio - change the priority of a process SYNOPSIS int chprio(pid,newprio) int pid; int newprio; DESCRIPTION _#C_#h_#p_#r_#i_#o changes the scheduling priority of process _#p_#i_#d to _#n_#e_#w_#p_... Date Added: 2009-06-04 15:52:24 |
| submit.txt Path: Washington >> JOBS >> 11500 Fall, 2009 Description: executable = pass6_11589.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11500-11999/11589... Date Added: 2009-06-04 15:52:47 |
| error.txt Path: Washington >> JOBS >> 11933 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 06:21:35 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 06:33:40 2008 ( 725 s elapsed) ... Date Added: 2009-06-04 15:55:19 |
| test 1 summary.doc Path: Georgia Tech >> ECE >> 4110 Fall, 2008 Description: ECE4110 Test 1 Summary Test 1 is on Thursday February 15, 2007. The exam is open book and open notes. You will want to bring a calculator and all handouts/texts. You are not allowed to bring in any old exams or handwritten copies/notes of old exam pr... Date Added: 2009-06-04 15:55:33 |
| output.txt Path: Washington >> JOBS >> 40467 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-8T51PB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2392 02/11/2008 05:08 PM <DIR> . 02/11/2008 05:08 ... Date Added: 2009-06-04 15:58:35 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 11:15:48 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 12:29:00 2008 ( 4392 s elapsed) ... Date Added: 2009-06-04 15:59:11 |
| submit.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: executable = pass6_40032.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40032... Date Added: 2009-06-04 15:59:41 |
| log.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: 000 (57982.000.000) 02/11 10:27:10 Job submitted from host: <128.95.94.28:1098> . 001 (57982.000.000) 02/11 17:16:20 Job executing on host: <172.25.101.186:1057> . 006 (57982.000.000) 02/11 17:36:28 Image size of job updated: 456012 . 006 (57982.000.... Date Added: 2009-06-04 16:00:46 |
| prodcost.xls Path: Iowa State >> ECON >> 532 Summer, 2008 Description: Sheet1 labor(l) 0 1 2 3 4 5 6 7 8 9 fc 20 20 20 20 20 20 20 20 20 20 output(q) apl = q/l mpl=dq/dl price(P) 0 5 5 5 14 7 9 24 8 10 36 9 12 45 9 9 51 8.5 6 54 7.71 3 54 6.75 0 52 5.78 -2 vc 0 6 12 18 24 30 36 42 48 54 tc 20 26 32 38 44 50 56 62 68 74 ... Date Added: 2009-06-04 16:06:19 |
| rfc3814.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group T. Nadeau Request for Comments: 3814 Cisco Systems, Inc. Category: Standards Track C. Srinivasan ... Date Added: 2009-06-04 16:07:12 |
| rfc981.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group D. L. Mills Request for Comments: 981 M/A-COM Linkabit March 1986 An Experimental ... Date Added: 2009-06-04 16:08:11 |
| rfc993.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group David D. Clark (MIT) Request for Comments: 993 Mark L. Lambert (MIT) Obsoletes: RFC-984 December 1986 PCMAIL: A Distributed... Date Added: 2009-06-04 16:08:12 |
| rfc3791.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group C. Olvera Request for Comments: 3791 Consulintel Category: Informational P. Nesser, II ... Date Added: 2009-06-04 16:08:20 |
| rfc1372.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group C. Hedrick Request for Comments: 1372 Rutgers University Obsoletes: RFC 1080 D. Borman ... Date Added: 2009-06-04 16:08:58 |
| rfc4191.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group R. Draves Request for Comments: 4191 D. Thaler Category: Standards Track Microsoft ... Date Added: 2009-06-04 16:09:33 |
| rfc2717.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group R. Petke Request for Comments: 2717 UUNET Technologies BCP: 35 I. King Category: Best Current Pract... Date Added: 2009-06-04 16:10:07 |
| rfc4060.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group Q. Xie Request for Comments: 4060 D. Pearce Category: Standards Track Motorola ... Date Added: 2009-06-04 16:10:31 |
| rfc806.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group Request for Comments: 806 Proposed Federal Information Processing Standard SPECIFICATION FOR MESSAGE FORMAT FOR COMPUTER BASED MESSAGE SYSTEMS National Bureau of Standards Instit... Date Added: 2009-06-04 16:10:40 |
| rfc875.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: RFC 875 September 1982 M82-51 Gateways, Architectures, and Heffalumps ... Date Added: 2009-06-04 16:10:46 |
| rfc1191.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group J. Mogul Request for Comments: 1191 DECWRL Obsoletes: RFC 1063 S. Deering ... Date Added: 2009-06-04 16:10:59 |
| submit.txt Path: Washington >> V >> 13000 Fall, 2009 Description: executable = allgamma_13321.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs13000-13499/13... Date Added: 2009-06-04 16:18:25 |
| log.txt Path: Washington >> V >> 13140 Fall, 2009 Description: 000 (27785.000.000) 12/04 12:04:47 Job submitted from host: <128.95.94.28:4757> . 001 (27785.000.000) 12/04 14:21:39 Job executing on host: <172.25.101.65:1056> . 006 (27785.000.000) 12/04 14:41:47 Image size of job updated: 469328 . 006 (27785.000.0... Date Added: 2009-06-04 16:18:34 |
| log.txt Path: Washington >> V >> 13000 Fall, 2009 Description: 000 (28001.000.000) 12/04 12:05:29 Job submitted from host: <128.95.94.28:4757> . 001 (28001.000.000) 12/04 17:44:44 Job executing on host: <172.25.101.174:1158> . 006 (28001.000.000) 12/04 18:04:52 Image size of job updated: 454740 . 005 (28001.000.... Date Added: 2009-06-04 16:18:51 |
| final exam 2005.doc Path: Idaho >> AVS >> 305 Fall, 2008 Description: Name _ AVS 305 Final Exam December 13, 2005 1. What is chemical difference between cellulose and amylose? 3 pts 2. Distinguish the difference between homeostasis and homeorhesis. 4 pts 3. True or False. The growth coefficient for fat is greater than... Date Added: 2009-06-04 16:23:12 |
| hair cells stuff.ppt Path: East Los Angeles College >> GM >> 401 Fall, 2009 Description: Inner Hair Cells 1. Nucleus 2. Stereocilia 3. Cuticular plate 4. Radial afferent ending (dendrite of type I neuron) 5. Lateral efferent ending 6. Medial efferent ending 7. Spiral afferent ending (dendrite of type II neuron) Outer Hair Cells 1. Nucle... Date Added: 2009-06-04 16:23:19 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05102322 Fall, 2009 Description: 05102322... Date Added: 2009-06-04 16:24:51 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05102322 Fall, 2009 Description: 05102322... Date Added: 2009-06-04 16:24:52 |
| 00000441.pdf Path: Carnegie Mellon >> TERA >> 31004305 Fall, 2009 Description: ... Date Added: 2009-06-04 16:25:10 |
| 00000441.pdf Path: Carnegie Mellon >> DISK >> 31004305 Fall, 2009 Description: ... Date Added: 2009-06-04 16:25:11 |
| p5bxc2.ps Path: Texas >> P >> 387 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: gnuplot %DocumentFonts: Helvetica %BoundingBox: 50 50 554 770 %Pages: (atend) %EndComments /gnudict 40 dict def gnudict begin /Color false def /Solid false def /gnulinewidth 5.000 def /vshift -46 def /dl {10 mul} def /hpt 31.... Date Added: 2009-06-04 16:27:25 |
| BAA613 Syllabus.doc Path: Mercer >> FACULTY >> 613 Fall, 2009 Description: BAA 613 Ethical Leadership Spring II, 2006 I. Background Carl Joiner, Ph.D.; Office 256 BE Building; Office Hours before and after class and anytime by appointment; Office Phone (678) 547-6438, Home- (770) 451-4344; e-mail, joiner_wc@mercer.edu II.... Date Added: 2009-06-04 16:28:02 |
| Sue student outline Epi.doc Path: Mercer >> FACULTY >> 410 Fall, 2009 Description: Slide 1 EPIDEMIOLOGY from the Greek terms epi = upon, among; demos = people, district; logos = study, word, discourse Epidemiology, \"the study of what is upon the people\" _ _ __ _ _ _ _ Slide 2 What is Epidemiology? The study of how disease is dis... Date Added: 2009-06-04 16:28:09 |
| qryOurTableAsACheckTable.xls Path: VCU >> INFO >> 463 Fall, 2001 Description: Sheet1 vti_encoding:SR|utf8-nl vti_timelastmodified:TR|24 Feb 2003 21:59:54 -0000 vti_extenderversion:SR|4.0.2.7802 vti_filesize:IR|16896 vti_assignedto:SR| vti_approvallevel:SR| vti_backlinkinfo:VX|classes/info463/2001fall/bcp\\ international/bcpi120... Date Added: 2009-06-04 16:28:45 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 16:01:21 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 17:18:14 2008 ( 4613 s elapsed) ... Date Added: 2009-06-04 16:29:13 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 13:34:47 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 14:46:18 2008 ( 4291 s elapsed) ... Date Added: 2009-06-04 16:29:35 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 15:54:39 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 17:15:03 2008 ( 4824 s elapsed) ... Date Added: 2009-06-04 16:30:05 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sat Feb 02 12:52:07 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sat Feb 02 14:05:40 2008 ( 4413 s elapsed) ... Date Added: 2009-06-04 16:30:19 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14297.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:30:35 |
| log.txt Path: Washington >> V >> 14000 Fall, 2009 Description: 000 (47583.000.000) 02/02 08:25:22 Job submitted from host: <128.95.94.28:1098> . 001 (47583.000.000) 02/02 13:26:51 Job executing on host: <172.25.101.41:1057> . 006 (47583.000.000) 02/02 13:47:00 Image size of job updated: 459800 . 005 (47583.000.0... Date Added: 2009-06-04 16:30:41 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14307.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:31:29 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14127.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-04 16:33:12 |
| main1.txt Path: UMBC >> CS >> 202 Fall, 1997 Description: everest% CC main1.C everest% a.out 1 17 1 37 everest% ... Date Added: 2009-06-04 16:34:24 |
| output.txt Path: Washington >> V >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-995QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 5E28-C3DE Directory of C:\\condor\\execute\\dir_4012 01/29/2008 04:52 PM <DIR> . 01/29/2008 04:52 ... Date Added: 2009-06-04 16:35:48 |
| error.txt Path: Washington >> V >> 10078 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Jan 29 11:59:39 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Jan 29 13:13:41 2008 ( 4442 s elapsed) ... Date Added: 2009-06-04 16:36:17 |
| submit.txt Path: Washington >> V >> 10310 Fall, 2009 Description: executable = allgamma_10310.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs10000-10499/10... Date Added: 2009-06-04 16:37:52 |
| submit.txt Path: Washington >> V >> 10148 Fall, 2009 Description: executable = allgamma_10148.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs10000-10499/10... Date Added: 2009-06-04 16:38:27 |
| Homework 3.doc Path: Benjamin Franklin Institute of Technology >> MY >> 4262 Fall, 2009 Description: 4262: Rockets and Mission Analysis Homework #3 Assigned: February 7, 2008 Due: February 21, 2008 Purpose of this homework assignment: 1. Review and apply the basics of thrust chamber model development 2. Explore the implications of electric propuls... Date Added: 2009-06-04 16:38:45 |
| MAE 1202 Lab Hmk 6.doc Path: Benjamin Franklin Institute of Technology >> MY >> 1202 Fall, 2009 Description: MAE 1202: Aerospace Practicum Laboratory Homework #6 Assigned: April 2 or 3, 2009 Due: April 10, 2009 The purpose of this homework assignment is to gain further proficiency using ProEngineer and to create some simple, yet highly instructive, practi... Date Added: 2009-06-04 16:38:45 |
| HWWmunu2j_RecoJets.ps Path: Wisconsin >> PLOTS >> 07302006 Fall, 2009 Description: %!PSAdobe2.0 %Title: HWWmunu2j_RecoJets.ps ( A 4) %Pages: (atend) %Creator: ROOT Version 5.12/00 %CreationDate: Sun Jul 30 16:21:22 2006 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} ... Date Added: 2009-06-04 16:39:44 |
| Textbookexercises.doc Path: UWO >> AS >> 2053 Fall, 2009 Description: Suggested Exercises Make sure you attempt the part A exercises at the very least (chapter 1 only has part A exercises). If you wish to get a deeper understanding of the material, you can attempt the part B exercises. Zima-Brown-Kopp Text Chapter 1 Se... Date Added: 2009-06-04 16:42:21 |
| oct17.xls Path: Wheaton MA >> MATH >> 217 Fall, 2009 Description: South Africa 2004 Election Allocate 200 seats to provinces Province Votes Eastern Cape 2,849,486 Free State 1,321,195 Gauteng 4,650,594 KwaZuluNatal 3,819,864 Limpopo 2,187,912 Mpumalanga 1,442,472 Northern Cape 433,591 North West 1,749,529 ... Date Added: 2009-06-04 16:44:48 |
| 20220240100105_20040219_1016.txt Path: East Los Angeles College >> MAN >> 2022024010 Fall, 2009 Description: # %NewTest # SERIAL NUMBER : 20220240100105 TEST MADE BY : aam LOCATION NAME : Manchester Run number : 1016 TEST_DATE : 19/02/2004 PASSED : YES PROBLEM : NO # %DAQ_INFO # #HOST \"MODTEST\" #VERSION \"3.42\" #DUT \"Endcap_Outer\"... Date Added: 2009-06-04 16:44:48 |
| figure55_k.xls Path: Princeton >> E >> 166 Fall, 2009 Description: ag2sic/ag1sic sig 0.08 0.07 0.07 0.07 0.08 0.07 0.07 0.07 0.08 0.07 0.08 0.07 0.07 0.07 0.07 0.07 0.07 0.07 0.08 0.07 0.07 0.07 0.07 0.07 0.07 0.07 0.07 0.07 0.08 0.07 0.07 0.07 0.07 0.07 0.07 0.06 0.07 0.07 0.07 0.07 0.08 0.08 0.08 0.07 0.08 0.08 0.... Date Added: 2009-06-04 16:45:03 |
| fig49.xls Path: Princeton >> E >> 166 Fall, 2009 Description: prt_asym.eps seq 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 ratio top/bot sigleft/right sig ratio 0.84 0.84 0.84 0.84 0.85 0.85 0.85 0.84 0.84 0.84 0.85 0.85 0.86 0.86 0.86 0.8... Date Added: 2009-06-04 16:45:07 |
| LogTM.pptx Path: Duke >> CPS >> 221 Spring, 2009 Description: LogTM: Logbased Transactional Memory Kevin E. Moore, Jayaram Bobba, Michelle J. Moravan, Click to edit Master subtitle style Mark D. Hill & David A. Wood Presented by: Eduardo Cuervo 5/18/09 Motivation Previous TM systems abort fast, commit sl... Date Added: 2009-06-04 16:45:12 |
| lec16.ppt Path: Harvey Mudd College >> CS >> 154 Spring, 2003 Description: Salamander A serious obstacle course Task: travel around a plastic loop find and transport a metal bearing return through the loop for less than $115 Today Evidence Grids - sonar-based maps a simpler (?) presentation Problem Set #3 due Fri., Ma... Date Added: 2009-06-04 16:45:55 |
| 001108Social climate.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Central Europe Online Daily News - Romanian Presidential Front-Runner Warns of \"Explosive\" Social Climate Fri, Nov 10 Prague 10:01 pm N.Y. 04:01 pm More Countries Russia China Central Europe - Croatia - Czech R... Date Added: 2009-06-04 16:46:05 |
| Fruit Punch Optimization Design Assignment.doc Path: BYU >> STATISTICS >> 532 Fall, 2009 Description: Fruit Punch Optimization Design Assignment For this homework assignment I would like you to analyze the data we collected in class for the Fruit Punch Optimization design. Remember this is a constrained mixture experiment. Fit the Scheffe\'quadratic m... Date Added: 2009-06-04 16:47:34 |
| Pr18.9.xls Path: BYU >> STATISTICS >> 532 Fall, 2009 Description: A 20 30 20 30 20 20 20 30 25 25 25 25 25 B 12.5 12.5 17.5 17.5 15 15 15 15 12.5 17.5 12.5 17.5 16 A Delta B Delta C Delta C 5 5 5 5 4 4 6 6 4 4 6 6 5 -1 -0.67 -0.33 85.386 102.709 75.177 92.500 82.585 82.585 77.501 94.824 97.962 87.071 92.156 82.5... Date Added: 2009-06-04 16:47:36 |
| Inverse_Trig_Graphs.doc Path: Barry >> MAT >> 110 Fall, 2009 Description: Trig and Inverse Trig Functions y = sin x Page 593 and y = sin-1 x y = cos x Page 597 and y = cos -1 x y = tan x Page 599 and y = tan -1 x ... Date Added: 2009-06-04 16:48:13 |
| THE SCIENCE OF LISTENING 2.doc Path: Oregon State >> BA >> 350 Fall, 2008 Description: THE SCIENCE OF LISTENING The transition from consciousness to self-consciousness is one of the profound, crucial moments in human evolution. The transition from consciousness to critical consciousness was another extraordinary moment, marking the app... Date Added: 2009-06-04 16:48:20 |
| 181.ppt Path: Portland >> CS >> 533 Winter, 2008 Description: Soft Timers: Efficient Microsecond Software Timer Support For Network Processing Mohit Aron and Peter Druschel Rice University Presented By Jonathan Walpole 1 Outline Why Soft Timers? What are Soft Timers? Conventional Timers and Associate... Date Added: 2009-06-04 16:48:30 |
| prob5.ps Path: Rochester >> CS >> 247 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: probs5.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -oprobs5.ps probs5.dvi %DVI... Date Added: 2009-06-04 16:49:38 |
| hs12_9do.txt Path: UPenn >> VHM >> 802 Fall, 2009 Description: * do-file for Additional exercise 12.9, VHM 802, Winter 2008 version 10.0 set more off cd \"h:\\vhm\\vhm802\\data_raw\" infix person 1-1 str eye 3-7 str power 9-12 acuity 14-16 using hs12_9.dat, clear encode eye, gen(Eye) encode power, gen(Power) anova ... Date Added: 2009-06-04 16:50:09 |
| LabProb2.txt Path: Trinity U >> CS >> 2322 Fall, 2009 Description: NB. William O. Thornton NB. Lab. Prob. 2 NB. 9/17/07 NB. Explicit def. of sequence computation function foo =: 3 : 0 \'n a b\' =. y seq =. (b-a)%n) * (i. n+1)+a ) NB. Tacit def. of seq. computation func. foo2 =: (1{)-(1{) ... Date Added: 2009-06-04 16:50:29 |
| sp98_homequiz_6.ps Path: Berkeley >> CS >> 152 Spring, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: q6.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o q6.ps q6 %DVIPSParameters: dpi=300, comments removed %DVIPS... Date Added: 2009-06-04 16:51:13 |
| L-19.ps Path: Duke >> CPS >> 130 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: Book.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o Book.ps Book.dvi %DVIPSPar... Date Added: 2009-06-04 16:51:18 |
| log.txt Path: Washington >> JOBS >> 11430 Fall, 2009 Description: 000 (53426.000.000) 02/07 04:23:33 Job submitted from host: <128.95.94.28:1098> . 001 (53426.000.000) 02/07 05:16:50 Job executing on host: <172.25.101.175:1056> . 005 (53426.000.000) 02/07 05:29:30 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 16:51:38 |
| error.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:23:27 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:33:59 2008 ( 632 s elapsed) ... Date Added: 2009-06-04 16:52:30 |
| output.txt Path: Washington >> JOBS >> 11330 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-195QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_708 02/07/2008 05:05 AM <DIR> . 02/07/2008 05:05 A... Date Added: 2009-06-04 16:52:55 |
| output.txt Path: Washington >> JOBS >> 11274 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-50WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3480 02/07/2008 04:58 AM <DIR> . 02/07/2008 04:58 ... Date Added: 2009-06-04 16:53:04 |
| submit.txt Path: Washington >> JOBS >> 11443 Fall, 2009 Description: executable = pass6_11443.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11000-11499/11443... Date Added: 2009-06-04 16:53:27 |
| log.txt Path: Washington >> JOBS >> 11441 Fall, 2009 Description: 000 (53437.000.000) 02/07 04:23:39 Job submitted from host: <128.95.94.28:1098> . 001 (53437.000.000) 02/07 05:17:53 Job executing on host: <172.25.101.161:1061> . 005 (53437.000.000) 02/07 05:30:54 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 16:53:30 |
| g4learnobj.doc Path: IUP >> CH >> 105 Fall, 2009 Description: Learning Objectives: Girard Chapter 4 (JCW: 5/18/09) Chapter 4: The Microscope and Forensic Identification of Hair and Fibers Be sure you can explain the purpose of a microscope in trace evidence analysis. Be sure you can define the concepts: virtu... Date Added: 2009-06-04 16:58:48 |
| csilv102.doc Path: IUP >> CH >> 105 Fall, 2009 Description: Chemistry 105 Activity CSI LV Episode 102: I-15 Murders Name _ 1. Describe what CSI Sara Sidle does on entering the crime scene. (7:20-9:20 min). 2. Continue to summarize the plot as you watch the next segment of this episode. Pay particular atten... Date Added: 2009-06-04 16:58:48 |
| Easterly_Levine_Africa_tragedy.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: ... Date Added: 2009-06-04 16:59:08 |
| b89.xls Path: Berkeley >> ECON >> 161 Fall, 2008 Description: TABLE B89.-Estimated ownership of U.S. Treasury securities, 19912002 [Billions of dollars] Pension funds Held by private inves Federal Total public Reserve and Total Depository U.S. savings debt 1 Government privately held institutions 3 bond... Date Added: 2009-06-04 16:59:21 |
| LCODraft_SSRD_IVVb_LCO_F05a_T10.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: 2970a6fac930f763e737f7acd14374cc2831615f.xls - Areas of Concern Log Project Name: Artifact: Module: MBASE Phase/level: Team 10: Code Generator - Template Based LCODraft SSRD SSRD 1.4 Inception Review # Review Date: Review Time: SSRD 2 10/12/2005... Date Added: 2009-06-04 16:59:59 |
| berk&galvan-apsa07.doc Path: Oregon >> PS >> 607 Fall, 2008 Description: Styles of Creative Syncretism: How the Weak and the Powerful Change Institutions Gerald Berk Dennis Galvan Department of Political Science University of Oregon Draft version. Please contact authors before citing. gberk@uoregon.edu, dgalvan@uoregon.... Date Added: 2009-06-04 17:00:05 |
| lecture 9.ppt Path: San Jose State >> MET >> 163 Fall, 2009 Description: How can we get a vertical profile of the atmosphere? SODAR Sodar: Sound detection and ranging A sodar is an acoustic system to remotely measure wind speed and turbulence characteristics in the lower atmosphere. Sodar systems are like radar (radio de... Date Added: 2009-06-04 17:00:42 |
| 20081022-00z-500.ps Path: San Jose State >> ARCHIVE >> 500 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: %Creator: GEMPAK %EndComments %DocumentsFont:(atend) %Pages:(atend) /M {moveto} def /L {lineto} def /N {newpath} def /LW {setlinewidth} def /A {arc} def /AF {arc fill} def /MS {makefont setfont} def /FF {findfont} def /CF {curr... Date Added: 2009-06-04 17:01:08 |
| z-table.xls Path: Texas A&M >> STAT >> 651 Fall, 2008 Description: z -4.00 -3.90 -3.80 -3.70 -3.60 -3.50 -3.40 -3.30 -3.20 -3.10 -3.00 -2.90 -2.80 -2.70 -2.60 -2.50 -2.40 -2.30 -2.20 -2.10 -2.00 -1.90 -1.80 -1.70 -1.60 -1.50 -1.40 -1.30 -1.20 -1.10 -1.00 -0.90 -0.80 -0.70 -0.60 -0.50 -0.40 -0.30 -0.20 -0.10 0.00 0 ... Date Added: 2009-06-04 17:01:57 |
| mid_spring2001_2up.ps Path: Toledo >> CS >> 324 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.76 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: mid-soln.dvi %CreationDate: Thu Mar 8 07:42:52 2001 %Pages: 4 0 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: PStoPS 1 13 ... Date Added: 2009-06-04 17:02:11 |
| spec_wt.txt Path: Berkeley >> ASTRO >> 00348650 Fall, 2009 Description: # tmin tmax 0.100299 5.35468 [ksec] ;instrument XRT ;exposure 280.77339 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.000000 0... Date Added: 2009-06-04 17:02:44 |
| swb_fit.txt Path: Berkeley >> ASTRO >> 00255445 Fall, 2009 Description: Spectra Extracted from tstart=-3.895 tstop=55.955 (Trigger Time, GPS=852448975.570000, Redshift, z=2.352) Power-Law Model Fit Norm@15keV 1.5892e-02 (1.3947e-02 1.7979e-02) alpha -1.5259 (-1.6302 -1.4223) Energy Fluence (15-350 keV) 2.4964e-06 (2.34... Date Added: 2009-06-04 17:02:57 |
| swb_zprob.txt Path: Berkeley >> ASTRO >> 00299787 Fall, 2009 Description: #z Prob_Amati Prob_Firmani # Using Model PLEXP 0.100000 4.628587e-07 3.397197e-08 0.104713 6.540887e-07 3.398417e-08 0.109648 9.198334e-07 3.399567e-08 0.114815 1.287246e-06 3.400659e-08 0.120226 1.792623e-06 3.401666e-08 0.125893 2.484204e-06 3.4026... Date Added: 2009-06-04 17:03:09 |
| wavdetect.txt Path: Berkeley >> ASTRO >> 00020089 Fall, 2009 Description: Wavdetect Sources with S/N>3: # ra dec err [\"] signif counts steady? -log10(Prob_steady) 0 245.272601 60.613696 1.035 3.4 6.7 1 -1.0 1 245.300708 60.590677 1.065 2.9 5.8 1 -0.1 2 245.260358 60.334523 0.908 2.8 5.7 1 -0.0 3 245.215066 6... Date Added: 2009-06-04 17:03:32 |
| spec_pc.txt Path: Berkeley >> ASTRO >> 00020092 Fall, 2009 Description: # tmin tmax 10.0820 37.374823 [ksec] ;instrument XRT ;exposure 3450.8499 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.00000... Date Added: 2009-06-04 17:04:23 |
| swb15-350lc.txt Path: Berkeley >> ASTRO >> 00315080 Fall, 2009 Description: # t-898251942.440000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -299.440000 0.004537 0.009422 0.009538 0.009436 -0.006704 0.009066 -0.007406 0.010127 -298.440000 0.004879 0.009292 -0.014566 0.00965... Date Added: 2009-06-04 17:04:42 |
| swbz_15-350lc.txt Path: Berkeley >> ASTRO >> 00104298 Fall, 2009 Description: # t-791350527.790000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -1.000000 0.039507 0.073585 -0.061609 0.073617 0.089913 0.055739 0.015927 0.025141 -0.990000 -0.006346 0.068377 -0.048858 0.04635... Date Added: 2009-06-04 17:05:01 |
| swb_zprob.txt Path: Berkeley >> ASTRO >> 00152113 Fall, 2009 Description: #z Prob_Amati Prob_Firmani # Using Model PLEXP 0.100000 2.427472e-06 5.766584e-03 0.104713 3.301697e-06 5.768486e-03 0.109648 4.470026e-06 5.770245e-03 0.114815 6.023804e-06 5.772065e-03 0.120226 8.080112e-06 5.773615e-03 0.125893 1.078817e-05 5.7752... Date Added: 2009-06-04 17:05:02 |
| swb_trig.txt Path: Berkeley >> ASTRO >> 00317662 Fall, 2009 Description: # S/N T1 T2 T90 T50 # Estimated T100 Interval: 0.345 33.405 T90= 24.700 14.0 0.535 21.055 17.860 11.970 ... Date Added: 2009-06-04 17:06:03 |
| spec_pc.txt Path: Berkeley >> ASTRO >> 00335647 Fall, 2009 Description: # tmin tmax 10.0000 439.46480 [ksec] ;instrument XRT ;exposure 55815.805 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.00000... Date Added: 2009-06-04 17:06:10 |
| radvt.txt Path: Berkeley >> ASTRO >> 00020086 Fall, 2009 Description: # t1 t2 dt rad_min rad_max cts err scl bg bg_rat wt 29.194440 35.018798 0.006086 0. 16. 0.00 0.00 0.884888 0.000000 0.000000 1 29.198055 35.810225 1.639768 0. 16. 1.22 ... Date Added: 2009-06-04 17:07:04 |
| swb_timeinfo.txt Path: Berkeley >> ASTRO >> 00286574 Fall, 2009 Description: #file=swbz_15-350lc.txt dt=0.04 tstart=-0.440 tstop=2.480 #t90 dt90 t50 dt50 rt90 drt90 rt50 drt50 rt45 drt45 tav dtav tmax dtmax trise dtrise tfall dtfall cts cts_err pk_rate dpk_rate band 2.760 0.290 1.560 0.439 0.920 ... Date Added: 2009-06-04 17:10:13 |
| swbz_15-350lc.txt Path: Berkeley >> ASTRO >> 00333666 Fall, 2009 Description: # t-909826496.460000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -12.960000 0.006488 0.013548 0.020353 0.013414 -0.000516 0.012963 0.023708 0.014169 -12.520000 -0.002556 0.013997 0.018981 0.01382... Date Added: 2009-06-04 17:10:14 |
| kin142d01.txt Path: Sveriges lantbruksuniversitet >> KIN >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: KIN 142-3 D01 LOCATION: SFU TITLE: INTRO KINESIOLOGY SECTION TYPE: LEC SEMESTER: 1997-1 ENROL: 14... Date Added: 2009-06-04 17:11:06 |
| ced410e01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: CED 410-4 E01 LOCATION: DOW TITLE: STT:FINANCE-CED SECTION TYPE: SEM SEMESTER: 1997-1 ENROL: 17... Date Added: 2009-06-04 17:11:42 |
| psyc250all.txt Path: Sveriges lantbruksuniversitet >> PSYC >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: PSYC 250-3 ALL SECTIONS LOCATION: SFU TITLE: CHILD PSYCHOLOGY SECTION TYPE: LEC SEMESTER: 1997-1 ENROL: 204 ... Date Added: 2009-06-04 17:12:17 |
| submit.txt Path: Washington >> V >> 13000 Fall, 2009 Description: executable = allgamma_13465.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs13000-13499/13... Date Added: 2009-06-04 17:13:42 |
| submit.txt Path: Washington >> V >> 13108 Fall, 2009 Description: executable = allgamma_13108.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs13000-13499/13... Date Added: 2009-06-04 17:14:44 |
| submit.txt Path: Washington >> V >> 13097 Fall, 2009 Description: executable = allgamma_13097.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs13000-13499/13... Date Added: 2009-06-04 17:15:06 |
| submit.txt Path: Washington >> V >> 13070 Fall, 2009 Description: executable = allgamma_13070.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs13000-13499/13... Date Added: 2009-06-04 17:15:49 |
| error.txt Path: Washington >> V >> 13449 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Fri Feb 01 20:12:49 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Fri Feb 01 21:29:54 2008 ( 4625 s elapsed) ... Date Added: 2009-06-04 17:15:49 |
| output.txt Path: Washington >> JOBS >> 70577 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-225QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3508 02/17/2008 02:26 AM <DIR> . 02/17/2008 02:26 ... Date Added: 2009-06-04 17:17:19 |
| 1.txt Path: Carnegie Mellon >> TERA >> 31007027 Fall, 2009 Description: 31007027... Date Added: 2009-06-04 17:23:29 |
| 1.txt Path: Carnegie Mellon >> DISK >> 31007027 Fall, 2009 Description: 31007027... Date Added: 2009-06-04 17:23:29 |
| ling130d01.txt Path: Sveriges lantbruksuniversitet >> LING >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: LING 130-3 D01 LOCATION: SFU TITLE: PRACTICAL PHONETICS SECTION TYPE: LAB SEMESTER: 1998-1 ENROL: 26... Date Added: 2009-06-04 17:24:51 |
| engl368d01.txt Path: Sveriges lantbruksuniversitet >> ENGL >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 368-4 D01 LOCATION: SFU TITLE: STUDIES IN DRAMA SECTION TYPE: LEC SEMESTER: 1998-1 ENROL: 19... Date Added: 2009-06-04 17:25:01 |
| log.txt Path: Washington >> V >> 16000 Fall, 2009 Description: 000 (49724.000.000) 02/05 03:00:27 Job submitted from host: <128.95.94.28:1098> . 001 (49724.000.000) 02/05 04:38:38 Job executing on host: <172.25.101.164:1060> . 006 (49724.000.000) 02/05 04:58:46 Image size of job updated: 403384 . 005 (49724.000.... Date Added: 2009-06-04 17:28:04 |
| error.txt Path: Washington >> V >> 16000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 03:08:15 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 05 04:27:08 2008 ( 4733 s elapsed) ... Date Added: 2009-06-04 17:28:33 |
| output.txt Path: Washington >> V >> 16442 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-50WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1160 02/05/2008 06:57 AM <DIR> . 02/05/2008 06:57 ... Date Added: 2009-06-04 17:28:38 |
| submit.txt Path: Washington >> V >> 16000 Fall, 2009 Description: executable = allgamma_16408.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16000-16499/16... Date Added: 2009-06-04 17:28:52 |
| output.txt Path: Washington >> V >> 16000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-8T51PB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2828 02/05/2008 03:03 AM <DIR> . 02/05/2008 03:03 ... Date Added: 2009-06-04 17:28:57 |
| marc.txt Path: Carnegie Mellon >> TERA >> 31003675 Fall, 2009 Description: 01233nam 22002291 450001001900000008004100019010002200060035002200082043001200104049005300116050001600169092001300185100003600198245011500234260005000349300005600399500004800455505024700503700004400750999008800794999012100882ocm01477069 81111177113... Date Added: 2009-06-04 17:30:03 |
| Chapters_15_17.pptx Path: SIU Edwardsville >> CS >> 111 Fall, 2008 Description: Chapter 15: Networks Data communication networks are set up in two basic configurations. The mesh configuration uses direct, point-to-point connections between each pair of communicating devices. While this approach guarantees a direct connection bet... Date Added: 2009-06-04 17:30:45 |
| Course Syllabus PHSC 334-08.doc Path: Campbell >> PHSC >> 334 Fall, 2009 Description: Pharmaceutical Sciences Course Syllabus Campbell University School of Pharmacy Spring 2008 Course Title: Course Number: Credit Hours: Required/Elective: Prerequisites: None Description: Scientific Literature Seminar I PHSC 334 1 Required This cour... Date Added: 2009-06-04 17:30:46 |
| standing1.txt Path: Wisconsin >> HOMEPAGES >> 1904 Fall, 2009 Description: Division I-A Football Conference Standings as of 12/04/1904 Perfomance Ratings are from David Wilson\'s system Eastern Independent 596 Ave. Rating /-Conference-\\ /-Over-all-\\ Perf W L T Pts Opp W L T... Date Added: 2009-06-04 17:31:15 |
| Handout4.doc Path: UCLA >> ECON >> 102 Fall, 1999 Description: ECON 102. Spring 00. Prof.McDevitt TA Sara Wong Office Hours: Th. 5-7pm. Bunche 2263 HANDOUT #4 TOPICS: - Classical Monetary Theory - Real Business Cycle Theory Part I Multiple Choice. Select the best answer for each question below. 1. Week 5 An in... Date Added: 2009-06-04 17:31:24 |
| asn1.ps Path: Berkeley >> CS >> 164 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: asn1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMR17 CMTI10 CMSY10 CMMI10 CMTT10 CMBX12 %DocumentPaperSizes: Letter %EndComment... Date Added: 2009-06-04 17:31:40 |
| Assignment 10.doc Path: Cornell >> CS >> 381 Fall, 2004 Description: Homework Assignment Number 10 due Friday November 5 7.3.1 c 7.3.4 e 7.3.5 7.4.1 ... Date Added: 2009-06-04 17:31:49 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_240 02/17/2008 09:51 AM <DIR> . 02/17/2008 09:51 A... Date Added: 2009-06-04 17:33:47 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G0WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2856 02/17/2008 09:06 AM <DIR> . 02/17/2008 09:06 ... Date Added: 2009-06-04 17:35:21 |
| output.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-595QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2812 02/17/2008 10:07 AM <DIR> . 02/17/2008 10:07 ... Date Added: 2009-06-04 17:37:34 |
| 1143Exam1Sp00.pdf Path: Troy >> CHM >> 1143 Fall, 2009 Description: First Hour Exam CHM 1143 Spring 2000 200 points total 30 pts 1) Balance the following equations. The first (a) occurs in acidic solution and the second (b) in basic solution. Place the proper coefficients in the blank space in front of each specie... Date Added: 2009-06-04 17:40:18 |
| McA BA 492 W07 grades before optional work for folder.xls Path: Oregon State >> BA >> 492 Fall, 2008 Description: These Are Grades to Date. They do not reflect quizzes that may occur in the coming week. They d ID 498 1631 3666 6564 11599 12211 12799 14239 17694 19222 19277 19454 22540 25144 25509 30394 32176 35418 35558 37499 37937 38354 39908 40004 40310 41061 ... Date Added: 2009-06-04 17:41:42 |
| wi-fi can be lure.ppt Path: Oregon State >> BA >> 495 Fall, 2008 Description: \"Wi-Fi Can Be Lure for Shops, But at a Price\" By Randall Stross New York Times News Service Lauren Gault John Rogers Ian Paul Wi-Fi: The new Air Conditioning The article compares Wi-Fi in restaurants to Air Conditioning in theaters back in the 192... Date Added: 2009-06-04 17:41:50 |
| FinalTWSRubric.doc Path: Weber >> FACULTY >> 3100 Fall, 2009 Description: Final Teacher Work Sample Rubric 4 Unit Information Contextual Factors Disclosure Objectives: Unit Objectives: Each Lesson Design for Instr: Unit Overview Design for Instruction: Group Lesson Design for Instruction: Individual Lessons 3 Include tit... Date Added: 2009-06-04 17:46:00 |
| LCP_IOC1_S09b_T16_V9.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Life Cycle Plan (LCP) Theater Script Online Database Team No 16 Jae Young Bang Gary Lam Shi Heng Guan Young Chan Noh Ka Ho Au Nory Kealii Nishimura Julie Sanchez Non-technical Lead/Builder Tester/Technical Lead Planning and Control Engineer System... Date Added: 2009-06-04 17:46:48 |
| test2.txt Path: Benjamin Franklin Institute of Technology >> CSE >> 1502 Fall, 2009 Description: 31 28 31 30 31 30 31 31 30 31 30 31 ... Date Added: 2009-06-04 17:48:50 |
| Test02.doc Path: University of Dayton >> CPS >> 387 Fall, 2009 Description: CPS387/577 Joseph E. Lang Test #2 April 30, 2007 NAME_ This test is closed notes and closed book. You may not use scratch paper or a calculator on this test. 1. (10 points) The immediate mode instruction, LDI, loads the accumulator with the value sto... Date Added: 2009-06-04 17:50:28 |
| c03p150.txt Path: Eastern Washington University >> CSCD >> 327 Fall, 2009 Description: #include \"ListA.h\" / ADT list operations int main() { List aList; ListItemType dataItem; bool success; aList.insert(1, 20, success); aList.retrieve(1, dataItem, success); }... Date Added: 2009-06-04 17:50:36 |
| Christian_er_1989.pdf Path: Caltech >> ETD >> 05302007 Fall, 2009 Description: ... Date Added: 2009-06-04 17:51:00 |
| feb06.pdf Path: Goucher >> CS >> 102 Fall, 2009 Description: Inside a PC Tom Kelliher, CS 102 Feb. 6, 2006 1 Administrivia Announcements First written quiz on Friday - Review assigned questions and ask for clarifications Wednesday. First online quiz - demo. Assignment Read Chapter 1 Above and Beyond (pp. 4... Date Added: 2009-06-04 17:51:28 |
| ES-CH2.ppt Path: UF >> CAP >> 6685 Spring, 2008 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>29fecc861143840440fbd22310fc47c62074003f.ppt</Key><RequestId>7 ECEAC5E8656DBFA</RequestId><HostId>IpqFuHSitBzd4+JwHNe9gkaISjo... Date Added: 2009-06-04 17:53:01 |
| hw_3sol.doc Path: UNC Pembroke >> MAT >> 3280 Fall, 2008 Description: MAT 3280 - 001 Probability and Statistics I Spring 2009 HW_3 Total Score: 30 Distributed: 03/18/09 Due Monday, 03/30/09, before class time Print your full name and the class code on the first page (upper-right) of your completed homework. Leave at... Date Added: 2009-06-04 17:53:52 |
| sylIntMacro.doc Path: SUNY Albany >> FY >> 554862 Fall, 2009 Description: 2032 2033 University at Albany State University of New York Economics 301: Intermediate Macroeconomics Spring 2009 TTH 10:15AM-11:35AM ES 242 TTH 01:15PM -02:35PM CH 151 Instructor: Professor Fang Yang Office: BA 123E E-mail: fyang@albany.edu Phone... Date Added: 2009-06-04 17:54:27 |
| yeast_glycolysis.txt Path: Kentucky >> EXAMS >> 520 Fall, 2009 Description: YORF NAME GWEIGHT Cell-cycle Alpha-Factor 1 Cell-cycle Alpha-Factor 2 Cell-cycle Alpha-Factor 3 Cell-cycle Alpha-Factor 4 Cell-cycle Alpha-Factor 5 Cell-cycle Alpha-Factor 6 Cell-cycle Alpha-Factor 7 Cell-cycle Alpha-Factor 8 Cell-cycle Alpha-Factor ... Date Added: 2009-06-04 17:55:42 |
| supercomputer021909background.doc Path: University of Louisville >> SUPERCOMPU >> 021909 Fall, 2009 Description: Background FACT SHEET New research computer cluster University of Louisville Belknap campus, Feb. 2009 General information The University of Louisville recently installed a powerful computer cluster that has become Kentucky\'s most powerful academic... Date Added: 2009-06-04 17:57:33 |
| Internet.ppt Path: Charleston Law >> HOME >> 101 Fall, 2009 Description: How the Internet Works Reading for This Week and Next Week Chapter 7 on networks and the World Wide Web Chapter 13, Section 4, on data encryption and information security Chapter 9, Section 9.3.2, on HTML The Internet and the Web The Web is act... Date Added: 2009-06-04 17:59:14 |
| notes2.doc Path: Columbia >> KF >> 2119 Fall, 2009 Description: Topic 2 principles of assessment and intervention. Assistive notes. Slide 1 Exacerbating factors are those which may be contributing to the person\'s difficulties may be precipitating or maintaining the impairment Agnosias prosopagnosia, autopagnos... Date Added: 2009-06-04 18:00:32 |
| AnswersHW6.doc Path: Luther >> M >> 454 Fall, 2009 Description: Math 454 Homework #6 Solutions Spring, 2009 Exercise 3.2.1. (a) Where in the proof of Thm 3.2.3 part (ii) does the assumption of finite get used? Solution: In taking the minimum of the n. Cannot take minimum of an infinite set. (b) Give an example... Date Added: 2009-06-04 18:00:34 |
| softwareevaluationrubric.doc Path: Purdue North Central >> FACULTY >> 271 Fall, 2009 Description: Software Evaluation Rubric Assignment: After reviewing the software you have selected using the rubric below, please write 2-3 paragraphs summarizing the outcomes of the rubric scores (highs and lows), the final score, and some points for recommendin... Date Added: 2009-06-04 18:01:03 |
| hwc1s.doc Path: Kean >> TECH >> 1500 Fall, 2009 Description: Homework Solutions 1. What is the difference between data and signals? Data are entities that convey meaning, while signals are the electric or electromagnetic encoding of data. 2. What are the main advantages of digital signals over analog signals? ... Date Added: 2009-06-04 18:01:27 |
| deme86p.pdf Path: UPenn >> SOC >> 796 Spring, 2009 Description: ... Date Added: 2009-06-04 18:04:26 |
| 00000064.pdf Path: Carnegie Mellon >> DISK >> 05101177 Fall, 2009 Description: ... Date Added: 2009-06-04 18:05:48 |
| 00000075.pdf Path: Carnegie Mellon >> DISK >> 05101177 Fall, 2009 Description: ... Date Added: 2009-06-04 18:05:49 |
| 00000171.pdf Path: Carnegie Mellon >> DISK >> 05101177 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:06 |
| 00000063.pdf Path: Carnegie Mellon >> DISK >> 05101173 Fall, 2009 Description: ... Date Added: 2009-06-04 18:06:57 |
| 00000044.pdf Path: Carnegie Mellon >> DISK >> 05102107 Fall, 2009 Description: ... Date Added: 2009-06-04 18:07:26 |
| 00000007.pdf Path: Carnegie Mellon >> TERA >> 05101975 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:05 |
| 00000007.pdf Path: Carnegie Mellon >> DISK >> 05101975 Fall, 2009 Description: ... Date Added: 2009-06-04 18:08:05 |
| 00000071.pdf Path: Carnegie Mellon >> DISK >> 05101950 Fall, 2009 Description: ... Date Added: 2009-06-04 18:09:36 |
| 00000055.pdf Path: Carnegie Mellon >> DISK >> 05101662 Fall, 2009 Description: ... Date Added: 2009-06-04 18:10:32 |
| 00000116.pdf Path: Carnegie Mellon >> DISK >> 05101576 Fall, 2009 Description: ... Date Added: 2009-06-04 18:11:56 |
| 00000058.pdf Path: Carnegie Mellon >> DISK >> 05101979 Fall, 2009 Description: ... Date Added: 2009-06-04 18:12:40 |
| Applications of Suffix Trees.ppt Path: Utah State >> CS >> 6670 Fall, 2008 Description: Applications of Suffix Trees Charles Yan 2008 1 1. Exact String Matching |P|=n, |T|=m P and T are both known at the same time BoyerMoore, or Suffix trees. O(n+m) T is known and kept fixed. P varies. Suffix trees, O(m) in preprocess, O(n+k) ... Date Added: 2009-06-04 18:14:47 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
