Course Solutions And Notes - Fish part II 29
| 2213-Hale-S2009.pdf Path: Southern Oregon >> CAS >> 2213 Fall, 2009 Description: ... Date Added: 2009-06-13 05:30:53 |
| CprE308.Lab1.F03.pdf Path: Iowa State >> ECE >> 308 Fall, 2009 Description: CprE 308 Laboratory 1: Introduction to Linux Department of Electrical and Computer Engineering Iowa State University Fall 2003 \"Experience is not what happens to you; it is what you do with what happens to you.\" - Aldous Huxley Submission: There is ... Date Added: 2009-06-13 05:33:11 |
| like.rtf Path: Rutgers >> ITI >> 400 Fall, 2009 Description: LIKE I think the topics that we cover are interesting, and it is easy to stay focused and attentive when real world examples play a role in each topic. Groups for discussions. Not a lot of hw / busy work. Teacher is clear and easy to understand. Book... Date Added: 2009-06-13 05:33:29 |
| Excel lab3.pdf Path: Washington >> ME >> 395 Fall, 2009 Description: ME395 Introduction to Mechanical Design Fall 2006 Economics Lab: Spreadsheets in Design and Economic Analysis Problem Statement A spreadsheet is a powerful and prevalent mathematical tool that can be used throughout the design process. For example,... Date Added: 2009-06-13 05:34:12 |
| Student Interview 1.doc Path: Penn State >> IVC >> 101 Fall, 2009 Description: Psychosocial Theory Running head: PSYCHOSOCIAL THEORY 1 The Application of Psychosocial Theories through Student Interviews Ivan V. Ceballos The Pennsylvania State University Psychosocial Theory The Application of Psychosocial Theories through Stu... Date Added: 2009-06-13 05:36:01 |
| more-HMMs.pdf Path: Wisconsin >> BMI >> 576 Fall, 2009 Description: Learning and Prediction Tasks learning Given: a model, a set of training sequences Do: find model parameters that explain the training sequences with relatively high probability (goal is to find a model that generalizes well to sequences we haven\'t ... Date Added: 2009-06-13 05:36:33 |
| cs2200pres07_Pipelining.ppt Path: Georgia Tech >> CS >> 2200 Fall, 2008 Description: CS 2200 Presentation 7 Pipelining Concluded Question Help Sessions will be the Tuesday of the week that each project is due. What time of day would you prefer 1. 5 p.m. 2. 6 p.m. Pipeline M X 1 P C ADD ADD Instr Mem BEQ DP R F SE A M X ALU ... Date Added: 2009-06-13 05:37:53 |
| ast425.pdf Path: Toledo >> AST >> 425 Fall, 2009 Description: AST 425: Research Topics in Astronomy and Astrophysics 2003-2004 Instructor: Prof. Chris Matzner Office: 1301 McLennan Labs Phone: 416-978-2172 email: matzner@astro.utoronto.ca This is a course of directed research. Students will identify and conctac... Date Added: 2009-06-13 05:39:28 |
| Reflection 15.pdf Path: Uni. Westminster >> KSS >> 0130 Fall, 2009 Description: Standard 15: Teacher candidates will demonstrate how to learn about other cultures and language patterns. What: As part of my Family and Community class, I researched and presented on the Japanese Culture. This Japanese Culture report incorporated m... Date Added: 2009-06-13 05:41:00 |
| hw8.doc Path: Washington >> DN >> 315 Fall, 2009 Description: Psych 315, Spring 2009 Homework 8 due Thurs 5/28 *NOTE: Assignments are posted ahead of time to allow students flexibility in when they complete them. Note, however, that these assignments may be revised slightly; any revisions will be announced in c... Date Added: 2009-06-13 05:41:38 |
| ep_nfl_dat.txt Path: Berkeley >> ASTRO >> 00302506 Fall, 2009 Description: # Ep dEp lprob lNiso dlNiso 49.644 0.041 -1.05e-04 7.701 0.293 49.684 0.042 1.61e-04 7.701 0.292 49.730 0.049 4.28e-04 7.701 0.292 49.782 0.056 7.03e-04 7.701 0.292 49.841 0.064 9.08e-04 7.651 0.285 49.910 0.073 1.16e-03 7.651 0.285 49.988 0.084 1.39... Date Added: 2009-06-13 05:41:55 |
| pssolutions3.pdf Path: Kentucky >> MA >> 575 Fall, 2008 Description: ... Date Added: 2009-06-13 05:42:57 |
| Jorge Monica FInal OPIM207.doc Path: UConn >> OPIM >> 207 Spring, 2008 Description: Monica Mora Jorge Torres Opim 207 Professor Dowding Business Plan Artesanias Latino Americanas 1.0 Business Summary Artesanias Latino Americanas is a small company based in Connecticut. The company specializes in the importation of Central and South... Date Added: 2009-06-13 05:43:05 |
| Stern_Nov07.pdf Path: Colorado >> ASTR >> 4800 Fall, 2008 Description: SMD Major Activities: Next 12 months Dr. Alan Stern Associate Administrator OUR FOUR CORE OBJECTIVES To Get More Science Done With the Budget We Have. To Ensure the Vision for Space Exploration Succeeds. To Promote U.S. Leadership Across All of SMD... Date Added: 2009-06-13 05:43:32 |
| HeartburnAndReflux handout.pdf Path: UF >> PHA >> 5941 Fall, 2009 Description: Leading Health Care In The 21st Century Heartburn and Reflux H eartburn and reflux occurs when stomach acid flows back into the esophagus. The backflow of stomach acid is caused when the muscle at the base of the esophagus (lower esophageal Sphincte... Date Added: 2009-06-13 05:44:16 |
| proposal.pdf Path: Berkeley >> CS >> 261 Fall, 2008 Description: Security Analysis of Multipath Routing for Internet Igor Ganichev October 15, 2007 Multipath routing proposals try to provide multiple routes between nodes on the Internet. Dierent proposals address dierent sets of problems such as increasing the re... Date Added: 2009-06-13 05:46:13 |
| hardness.txt Path: Berkeley >> ASTRO >> 00287260 Fall, 2009 Description: # t1 t2 hardness error 0.11930000 0.12288400 0.49362720 0.19908950 0.12288400 0.12860500 0.69569341 0.14698107 0.12860500 0.12917500 1.0000000 0.0000000 0.12917500 0.13205500... Date Added: 2009-06-13 05:46:29 |
| pigwtsBayesModelRS.txt Path: Allan Hancock College >> WEB >> 902 Fall, 2009 Description: model { for(i in 1:nObs) { mu[i] <- beta0 + UV[idnum[i],1] + (beta1 + UV[idnum[i],2])*nweeks[i] weight[i] ~ dnorm(mu[i],tauEps) } for (j in 1:2) { UVmean[j] <- 0 } for (iSubj in 1:nSubj) { UV[i... Date Added: 2009-06-13 05:47:17 |
| quiz8solns.pdf Path: Utah >> MATH >> 2270 Summer, 2008 Description: Math 2270 Quiz 8 This is a take home quiz. You are allowed to use any book, computer program, or other reference material that you would like, but you are not allowed to consult any person but the instructor about these problems. This includes your c... Date Added: 2009-06-13 05:47:37 |
| uaspts.pdf Path: Ball State >> WEB >> 150 Fall, 2009 Description: Decision Points - Version 4 4/11/01 Decision Point 1 Professional Significance Identification with Professional Education Type of Evaluation Formative and Summative Requirements * Complete introductory course with C or better * Demonstrate knowl... Date Added: 2009-06-13 05:48:18 |
| 10-PipelinedCPU.4p.pdf Path: UCSC >> CMPE >> 110 Winter, 2008 Description: Wed Dec 8 20:25:42 PST 2004 Wed Dec 8 20:25:42 PST 2004 11111111111111111 00000000000000000 11111111111111111 00000000000000000 111 000 111 000 <> <> Page 3 Page 1 ... Date Added: 2009-06-13 05:49:20 |
| Main_the_Case_of_Cent_East_Europe_-_Loc_Gov_the_Driv_of_Growth_-_Chp_2.pdf Path: East Los Angeles College >> EB >> 902 Fall, 2009 Description: ... Date Added: 2009-06-13 05:50:13 |
| syslec1.doc Path: East Los Angeles College >> C >> 215 Fall, 2009 Description: B Eng ESCE and ESIE - Part 2 Signals, Circuits and Systems This part of the subject of Signals, Circuits and Systems is based on the approach of mathematically modelling practical gubbinses such as filters, amplifiers, motors, controllers and the lik... Date Added: 2009-06-13 05:50:24 |
| midterm_98.pdf Path: University of Iowa >> C >> 010350 Fall, 2009 Description: Rhetoric 10:001:064 YOUR MIDTERM GRADE 14 October 1998 Please review the earlier handout More About Grades. That whole sheet is relevant, though I repeat just one sentence here: A midterm grade is not a promise, a threat, or a prediction. I have no... Date Added: 2009-06-13 05:50:43 |
| KS_advocacy ad rubric.pdf Path: University of Iowa >> C >> 010350 Fall, 2009 Description: Time Accelerated Rhetoric 10:003, Fall 2005 Major Speech #1 Advocacy Ad Analysis _ Thoughtful rhetorical analysis of the advocacy ad Position_ Purpose_ Occasion_ Audience_ Appeals_ Specific examples to support your claims Text_ Visuals_ Layout_ Eff... Date Added: 2009-06-13 05:50:45 |
| multiplexing.ps Path: George Mason >> CS >> 455 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.76a Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: multiplexing.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR7 LCIRCLEW10 CMBX12 CMR10 CMSY10 CMMI10 CMBX10 %+ Helveti... Date Added: 2009-06-13 05:50:53 |
| 4up.pdf Path: UNL >> CSE >> 978 Fall, 2009 Description: Introduction CSCE 990 Lecture 4: Statistical Learning Theory In Chapter 3, we discussed the need for restricting the class of functions F we choose from when minimizing Remp[f ] Stephen D. Scott January 26, 2006 Most gures c 2002 MIT Press, B... Date Added: 2009-06-13 05:55:50 |
| 7:bag-boost-4up.pdf Path: UNL >> CSE >> 478 Fall, 2009 Description: CSCE 478/878 Lecture 7: Combining Classifiers: Weighted Majority, Boosting, and Bagging Outline Combining classifiers to improve performance Combining arbitrary classifiers: Weighted Majority algorithm Stephen D. Scott (Adapted from Tom Mitchell... Date Added: 2009-06-13 05:55:53 |
| cs8430_asg_2.txt Path: Kennesaw >> CS >> 8430 Fall, 2008 Description: CS8430 Fall 2004 Assignment No. 2 (Due September 10, 2004) For the system selected in assignment No.1. 1. Decscribe the class relationships for the classes identified; indicate the category of relationship (horizontal, or vertical). 2. Construct... Date Added: 2009-06-13 05:56:34 |
| homework5.ps Path: Texas >> CS >> 336 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86d Copyright 1999 Radical Eye Software %Title: homework5.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips homework5 %DVIPSParamet... Date Added: 2009-06-13 05:56:40 |
| slac-pub-3607.pdf Path: Stanford >> PUBS >> 3500 Fall, 2009 Description: SLAC - PUB March 1985 (4 - 3607 COUPLED VIBRATIONAL MODES OF THE SLC ARC MAGNET AND SUPPORT SYSTEM W. T. WENG AND A. W. CAAO t Stanford Linear Accelerator Center Stanford University, Stanford, Cali/ornia, 84805 1. INTRODUCTION The magnet support sy... Date Added: 2009-06-13 05:57:56 |
| SemainePlate.doc Path: NSULA >> COURS >> 11930 Fall, 2009 Description: Chronique du 21 mars 2002 Que puis-je vous dire d\'autre? Rien ne bouge. Le S&P500 tait il y aune semaine 1153.04 et aujourd\'hui, on le retrouve 1153.59. Heureusement, il y a nos trois portefeuilles Marketocracy. Ils ne bougent pas beaucoup eux non... Date Added: 2009-06-13 05:58:15 |
| calc_lab_notes.pdf Path: Ill. Chicago >> CHEM >> 114 Fall, 2008 Description: ... Date Added: 2009-06-13 05:58:39 |
| 02-recursion.pdf Path: University of Illinois, Urbana Champaign >> CS >> 573 Spring, 2008 Description: Algorithms Lecture 2: Recursion Our life is frittered away by detail. Simplify, simplify. Henry David Thoreau Everyone who enjoys thinks that the principal thing to the tree is the fruit, but in point of fact the principal thing to it is the seed. ... Date Added: 2009-06-13 05:59:55 |
| Group Counseling Progress Assessment 7.doc Path: Penn State >> MUH >> 164 Fall, 2009 Description: CN ED 404 Moran He Group Counseling Progress Assessment Session 7, November 20, 2006 Group 7 1 What happened Today we had the last session of our group experience. Katie and Terry co-led this session. Terry first asked Jon about the homework she as... Date Added: 2009-06-13 06:00:26 |
| ENV E.pdf Path: San Diego State >> ES >> 0506 Fall, 2009 Description: Environmental Engineering In the College of Engineering OFFICE: Engineering 424 TELEPHONE: 619-594-6071 E-MAIL: environmental@engineering.sdsu.edu Faculty Emeritus: Stratton Chair: Supernak The Blasker Chair in Environmental Engineering: Gurol The Wi... Date Added: 2009-06-13 06:01:21 |
| TE.pdf Path: San Diego State >> IVC >> 0607 Fall, 2009 Description: Teacher Education TEACHER EDUCATION CREDENTIALS AND PROGRAMS Note: Courses designated by an underscore are offered on the Imperial Valley Campus. Most courses are available at the San Diego campus. Faculty Emeritus: Baldwin, Medeiros, Merino, Rodne... Date Added: 2009-06-13 06:01:35 |
| Lanza and Nair 2009.pdf Path: UMass (Amherst) >> KIN >> 585 Spring, 2008 Description: Muscle mitochondrial changes with aging and exercise14 Ian R Lanza and K Sreekumaran Nair ABSTRACT Aging has been reported to be accompanied by reduced mitochondrial function and insulin sensitivity. Whether these deleterious effects result from chro... Date Added: 2009-06-13 06:02:48 |
| igini.pdf Path: NYU >> ATM >> 262 Fall, 2009 Description: IG: a new approach to pricing portfolio credit derivatives Mark Joshi and Alan Stacey Isaac Newton Institute 25th Feb 2005 Slide 2 Portfolio credit derivatives In recent years, products with pay-offs depending on credit events from multiple refer... Date Added: 2009-06-13 06:03:15 |
| hw3.pdf Path: Stanford >> STAT >> 315 Fall, 2009 Description: Statistics 315a Homework 3, due Friday February 28, 2003. 1. B-splines. This question is longer than usual, but includes a lot of text to teach you about B-splines. These are a recursively defined bases for splines of order M with knots at 1 , . . . ... Date Added: 2009-06-13 06:04:12 |
| MICR 410 lab internet resources.doc Path: CSU LA >> MICRO >> 410 Fall, 2009 Description: WBC Maturation: University of Virginia Pathology http:/www.med-ed.virginia.edu/courses/path/innes/index.cfm Click on Normal Hematopoiesis The Crookston Collection http:/www.thecrookstoncollection.com/ Click on Processes- Granulopoiesis Hematograph... Date Added: 2009-06-13 06:04:26 |
| BP-Lab.xls Path: N.E. Illinois >> UX >> 5700 Fall, 2009 Description: Subject Gender A F E F G F H F J F L F M F B M C M D M F M I M K M N M AVE ALL T-test SBP pre and post DBP pre and post Corr GripPeak SBP GripPeak DBP SBP 97 120 116 94 98 101 100 143 134 134 117 123 126 126 116.4 DBP 54 79 78 60 64 75 70 96 86 69 ... Date Added: 2009-06-13 06:05:18 |
| quiz1sp2000.rtf Path: Temple >> ACCT >> 511 Fall, 2009 Description: ACCOUNTING 511-FOX SBMTEMPLE UNIVERSITY SPRING 2000-DR. E. PRESS-QUIZ Chapters 2 & 3 Name:_ 1. (Write the letter of the correct answer to the left of the problem.) When reporting a cumulative effect of a change in accounting principle, current disclo... Date Added: 2009-06-13 06:05:30 |
| myo2.63.pdf Path: Portland >> EAS >> 361 Fall, 2008 Description: ... Date Added: 2009-06-13 06:05:32 |
| C4300L3.4u.ps Path: Allan Hancock College >> COMP >> 4300 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: C4300L3.dvi %Pages: 6 0 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 596 842 %DocumentFonts: CMSS17 CMTI12 CMBX12 CMR12 CMSY10 CMMI12 CMR17 CMEX10 %En... Date Added: 2009-06-13 06:08:30 |
| L03_Decision_Trees.ppt Path: Minnesota >> CS >> 8751 Fall, 2009 Description: Decision Trees Decision tree representation ID3 learning algorithm Entropy, Information gain Overfitting CS 8751 ML KDD Decision Trees 2 A De... Date Added: 2009-06-13 06:09:39 |
| up1990.xls Path: Yale >> RP >> 269 Fall, 2009 Description: STATE UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADESH UTTARPRADE... Date Added: 2009-06-13 06:10:41 |
| orrissa.xls Path: Yale >> RP >> 269 Fall, 2009 Description: District Balasore Bolangir Cuttack Dhen Kanal Ganjam Keonjhar Koraput Kalahandi Mayurbhanj Puri Phulbani Sambalpur Sundergarh Total Population ( \' 000s ) Cases&others API (%) P.v. 2095 12543 1301 5764 4282 8553 1400 7269 2512 15875 985 10822 2110 24... Date Added: 2009-06-13 06:10:45 |
| MicroDrive Summary of FIN Ratios.doc Path: University of Illinois, Urbana Champaign >> FIN >> 453 Fall, 2009 Description: MicroDrive Inc.: Summary of Financial Ratios (Millions of Dollars)3 Industry Average 4.2x 2.1x Ratio Liquidity Current Quick, or acid, test Asset Management Inventory Turnover Days Sales Outstanding (DSO) Fixed Assets Turnover Total assets turnover ... Date Added: 2009-06-13 06:10:49 |
| 3dANOVA.ps Path: Air Force Academy >> GES >> 125 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: anova.dvi %Pages: 59 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips anova %DVIPSParameters: dpi=600, compressed, comments remo... Date Added: 2009-06-13 06:12:42 |
| syllabus_1101_MWF_FALL_08.pdf Path: UGA >> ENGLISH >> 200808 Fall, 2009 Description: TEACHERS SAMPLE ENGL1101 SYLLABUS Fall 2008 (7/9/08) MONDAY/WEDNESDAY/FRIDAY Required Course Materials: Motives for Writing, 5th ed., Miller (MW) The St. Martin\'s Handbook, 6th ed., Lunsford (SMH) First-year Composition Guide at UGA, 2008-09 ed. Goal... Date Added: 2009-06-13 06:13:04 |
| ex3ans.pdf Path: Idaho >> SGHCHEM >> 101 Fall, 2009 Description: 101: Exam #3 Version A 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. c a d e d a b e b d b a a c d e e b d c e b d c b Version B 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 2... Date Added: 2009-06-13 06:13:12 |
| class16.ppt Path: University of Hawaii - Hilo >> BIL >> 301 Fall, 2009 Description: CHEMISTRY 161 Chapter 5 www.chem.hawaii.edu/Bil301/welcome.html REVISION Boyle\'s Law p 1/V Gay-Lussac\'s Law VT Avogadro\'s Law nV 1. IDEAL GAS EQUATION (1) p 1/V (2) V T (3) n V VTn/p V 1/p VT Vn p V = const n T p V = const n T pV=R... Date Added: 2009-06-13 06:13:23 |
| SyllabusSummer2009.doc Path: N.C. State >> CSC >> 226 Fall, 2008 Description: COURSE SYLLABUS Discrete Mathematics for Computer Scientists CSC 226, Section 051, Summer 2009 Preq: CSC 116 and MA 141 CSC,CSU,CPE,CPU majors only Meets: Instructor: Office: Hours: TWH 3:20-4:35 PM, EB2 1226 Dr. Robert Rodman 2314 EB2 TWH 2:00 3:10... Date Added: 2009-06-13 06:13:36 |
| 00247110.pdf Path: BYU >> CS >> 470 Fall, 2009 Description: ... Date Added: 2009-06-13 06:15:52 |
| 127APracticeTest1Fall08.doc Path: Arizona >> CS >> 127 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|23 Sep 2008 23:44:20 -0000 vti_title:SR|Practice Final vti_author:SR|mercer vti_modifiedby:SR|mercer vti_timecreated:TR|23 Sep 2008 20:44:49 -0000 vti_backlinkinfo:VX| vti_extenderversion:SR|4.0.2.8912 ... Date Added: 2009-06-13 06:18:54 |
| Xilinx State Machine Encoding.pdf Path: RIT >> P >> 07202 Fall, 2009 Description: Implementing State Machines in LCA Devices Application Note BY PETER ALFKE AND BERNIE NEW XAPP 027.001 Summary This Application Note discusses various approaches that are available for implementing state machines in LCA devices. In particular, th... Date Added: 2009-06-13 06:20:48 |
| 10281homework8.pdf Path: Pittsburgh >> MATH >> 081 Fall, 2009 Description: Q S Q T) 3 7#5421 0 )(\' t }qxnm mp nxyusyrowzx{vtsx{mx{ss9onmvxyuPw}qvtx{}opvz{ w m { w u w t zp { w z ~pz m u w e fd5 w z~p u lzp u mp m w u uP}xw... Date Added: 2009-06-13 06:21:08 |
| 525 syllabus final 09.doc Path: CSU LA >> HSINGH >> 525 Fall, 2009 Description: CALIFORNIA STATE UNIVERSITY, LOS ANGELES COLLEGE OF HEALTH AND HUMAN SERVICES School of Kinesiology and Nutritional Science NTRS 525 Advanced Topics in Food Science and Technology SCHEDULE: Time Lecture: FA 248 Wed 6:10-10:00 Room INSTRUCTOR: Name:... Date Added: 2009-06-13 06:21:19 |
| Probiotics and Prebiotics.pdf Path: CSU LA >> HSINGH >> 467 Fall, 2009 Description: Probiotics and Prebiotics NTRS 467 Dr. Harmit Singh Winter 06 Probiotics Foods believed to be good for health that are produced by or that contain live microorganisms. New metabolism are discovered More useful functions are discovered More micro... Date Added: 2009-06-13 06:21:21 |
| Mixer_Project.pdf Path: Iowa State >> EE >> 507 Fall, 2009 Description: EE 507: VLSI Communication Circuits Spring 2009 DESIGN PROJECT 2 A CMOS DOWNCONVERSION MIXER DUE DATE: APRIL 7, 2009 Project Description: For this project you will design, analyze, and simulate a downconversion mixer in the same 0.13m CMOS process... Date Added: 2009-06-13 06:22:12 |
| hw4.pdf Path: Utah >> MATH >> 5750 Fall, 2008 Description: MATH 5750/6880 OPTIMIZATION HOMEWORK 4 Due: Mon Dec 1st 2008 1. Problem 16.21 (Nocedal and Wright p495). This asks you to redo the derivation of the interior point method for convex quadratic programming (16.6 pp 480482) so that equality constraints ... Date Added: 2009-06-13 06:23:20 |
| solutions1.pdf Path: ECCD >> STAT >> 2655 Fall, 2009 Description: Solutions to Assignments 1 and 2 and supplemental problems STAT 2655 Antal A. Jrai a October 17, 2005 A word of advice (before you read on): You will benefit most from reading the solution of a problem if you have honestly tried to do it yourself, an... Date Added: 2009-06-13 06:24:19 |
| arc.doc Path: MIT >> I >> 386 Fall, 2009 Description: #PCE version 4#C# man_module#name#space#id_table#modified# current_idO#I#xN# class/arcN# referenceC# hash_table#refer#sizeO#I#xN#bothI#sN# V.arc.sizeC#man_variable_card# # identifier#module# last_modified#name#summary#description#see_also#inherit#def... Date Added: 2009-06-13 06:24:21 |
| 110_05s_x3_equations.doc Path: Towson >> CHEM >> 110 Fall, 2008 Description: CHEM 110.001Summer 2005 QUIZ #3 Equation Sheet R = 8.3145 J K-1 mol-1 = 1.987 cal K-1 mol-1 = 0.082057 L atm K-1 mol-1 1 cal = 4.184 J 1 atm = 760 torr = 101,325 Pa 1 L atm = 101.3 J 1 bar = 100,000 Pa 1 mm Hg => 1 torr .. Total heat capacity : Mol... Date Added: 2009-06-13 06:24:35 |
| sample unit plan for pattern.doc Path: U. Houston >> CUIN >> 4297 Fall, 2008 Description: Unit Sample for Pattern Unit Overview CurriculumFraming Questions Essential Question How do patterns help you learn and remember? What are repeating and growing patterns? How can patterns be identified? Unit Questions How do repeating and gro... Date Added: 2009-06-13 06:25:48 |
| ch02.docx Path: Valdosta >> CS >> 1301 Fall, 2008 Description: Chapter 2 Elementa ry P rogramming Sections Pages Review Questions Programming Exercises 2.1-2.16 26-59 1-11, 13-17, 20-22, 25, 27, 30-32 2,4,6,12,14,16,18 Terminology algorithm, identifier, variable & naming convention, statement, expression, decl... Date Added: 2009-06-13 06:25:53 |
| eSim.pdf Path: UMBC >> CMSC >> 411 Spring, 2008 Description: esim: A Structural Design Language and Simulator for Computer Architecture Education Ethan Miller1,2 elm@acm.org 1 Jon Squire1 squire@csee.umbc.edu Computer Science & Electrical Engineering Dept., University of Maryland, Baltimore County 2Departmen... Date Added: 2009-06-13 06:26:29 |
| aareadme.txt Path: Washington University in St. Louis >> MEXMRS >> 0870 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM ... Date Added: 2009-06-13 06:26:41 |
| lecture8.pdf Path: Laurentian >> ANTH >> 3010 Fall, 2009 Description: Participant observation Sequence of topics: bias/subjectivity, neutrality, objectivity fieldnotes participant observation (epistemology, continuum) Bias a predisposition or prejudice (statistics) a systematic distortion of a statistical result d... Date Added: 2009-06-13 06:27:50 |
| slac-pub-3379.pdf Path: Stanford >> PUBS >> 3250 Fall, 2009 Description: SLAC-PUB3379 July 1984 IT@) A MEASUREMENT OF THE AVERAGE B KADRoN LIFETIME* D. E. Klem, R. Dubois, C. C. Young, W. B. Atwood, P. H. Baillon,\' B. C. Barish, G. R. Bonneaud,b A. Courau, G. J. Donaldson,c M. M. Duro, E. E. Elsen, S. G. Gao,d Y. Z. ... Date Added: 2009-06-13 06:28:02 |
| Inclusion IQ.pdf Path: Idaho >> FCS >> 469 Fall, 2008 Description: ... Date Added: 2009-06-13 06:28:55 |
| spr_04c.pdf Path: Troy >> MTH >> 2201 Fall, 2009 Description: MTH 2201 (2 pm) Test #2 Spring, 2004 Pat Rossi Name Instructions. Show clearly how you arrive at your answers. 1. An excursion boat with a capacity of 1600 people runs a charter trip for a group of 1000 people at $25.00 per person (i.e., the company... Date Added: 2009-06-13 06:28:58 |
| PFS08_h1w.xls Path: UMass (Amherst) >> PUBP >> 606 Fall, 2009 Description: Use a 2-D Plot the following utility functions in X1, X2 and explain how they differ. Plot three indifference curves for total utility of 1, 2 and 3 1 2 3 U = ln(X1) + ln(X2) U = AX1X2 U = AX1X21- Additive natural log Square root Cobb-Douglas Additi... Date Added: 2009-06-13 06:32:12 |
| James Lamberti Training - Blagging.doc Path: St. Johns >> JLAMB >> 819 Fall, 2009 Description: Blagging Cell Phone Training Part 1 \"Theory\" 1. GDS Business Model for Success a. 50% = getting Suspect to pick up the phone b. 50% = getting Suspect to listen What is the initial goal when making the first call with a new lead? a. Obtaining th... Date Added: 2009-06-13 06:32:39 |
| tour.doc Path: Trinity U >> CS >> 1300 Fall, 2009 Description: Tour Assignment (Note: all homework assignments are due before the beginning of the next class. No late work will be accepted.) 1. Copy the folder 4tour from the class folder to your shared folder on \\tucc-tiger\\groups\\ComputerSkills\\Semmes\\students.... Date Added: 2009-06-13 06:34:58 |
| Samples 2--2001.pdf Path: Minnesota >> CHEM >> 5361 Fall, 2008 Description: The cysteine-modified glycoside shown below has some protecting groups (R) attached to it. What are those protecting groups? RO O H N H S O OR AcO AcO O OAc ppm 7.0 6.0 1 5.0 4.0 3.0 2.0 1.0 H NMR, 250 MHz, DMSO-d6 3.2 3.1 1 3.0 2.9... Date Added: 2009-06-13 06:35:25 |
| ExamKey2005.pdf Path: Oregon State >> BI >> 212 Winter, 2008 Description: Key First Midterm Exam BI 212 - 2005 1. C 2. D 3. C 4. E 5. D 6. E 7. B 8. D 9. E 10. C 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. E E E E B E B D D C 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. C D A E A D A E A A 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. A... Date Added: 2009-06-13 06:36:32 |
| 11a Value Creation.doc Path: CSU Long Beach >> SMIN >> 492 Fall, 2009 Description: MKTG 492 Professor Sam Min Lecture 11a Customer Value Creation (Kano Method) Customer Value Creation 1 Five Types of Product Features (Kano Method) Everything you want. Nothing you don\'t need. Presenting Mac mini. With a powerful G4 processor, g... Date Added: 2009-06-13 06:36:59 |
| 2005 final exam.pdf Path: Harvard >> GENETICS >> 201 Fall, 2009 Description: Name_ Genetics 201 Final exam December 20, 2005 PUT YOUR NAME ON EVERY PAGE. THERE ARE FOUR MULTI-PART QUESTIONS ON THIS EXAM. EACH QUESTION IS WORTH A DIFFERENT TOTAL NUMBER OF POINTS. THE POINT VALUE FOR EACH PART IS INDICATED. QUESTION 1 2 3 4 T... Date Added: 2009-06-13 06:39:47 |
| Lecture14.ppt Path: UF >> CLAS >> 3032 Fall, 2009 Description: Acoustic reflex Protective function Due to muscle contraction in response to intense sound Threshold of reflex: Around 80 dB SL (sensation level). Reflex results in attenuation of loud sounds by about 10 30 dB More effective at low frequencies (... Date Added: 2009-06-13 06:40:10 |
| lecture18.ps Path: Cornell >> CS >> 611 Fall, 2001 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.78 Copyright 1998 Radical Eye Software (www.radicaleye.com) %Title: lecture18.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMSS12 CMR12 CMMI12 CMR10 CMSY10 CMMI10 CMMI7 CMSY7 %+ CMR7 %... Date Added: 2009-06-13 06:43:05 |
| Sp2005.midterm.pdf Path: Carnegie Mellon >> CS >> 15212 Fall, 2009 Description: Computer Science 15212: Midterm Examination February 17, 2005 Name Name: Andrew ID: Recitation Section: Instructions Write your name, Andrew id, and recitation section in the space provided at the top of this page, and write your name at the top o... Date Added: 2009-06-13 06:43:20 |
| Lecture-13-Geology-4501.ppt Path: Minnesota >> GEO >> 4501 Fall, 2008 Description: Baker,Matthew P Dally,Jason D Dillman,Amanda Marie Foss,Jason R Frederick,Kristin Elise French,Daniel P Hashim,Mohd Faris Heck,Jessica Mae Johnson,Eric Leo Johnson,Katie Jane Kania,Jonathan Kennedy,Nathan Ryan Kolawole,Olufemi Ayodele Lee,Caroline L ... Date Added: 2009-06-13 06:44:38 |
| IE486_L16.ppt Path: Purdue >> IE >> 486 Fall, 2008 Description: IE 486 Work Analysis Review for exam 2 Lab 3 can be turned in today or tomorrow for full credit. Lab 4 will be introduced tomorrow. R... Date Added: 2009-06-13 06:45:26 |
| l9.pdf Path: Acton School of Business >> MATH >> 102 Fall, 2008 Description: Calculus 102- Lecture 9 (Jeff)Dajiang Liu June 20, 2005 Now we are going to discuss a special type of functions. Inverse trigonometric function. You might have already seen them, they are like y = arcsin x, etc. It is the inverse function of y = sin ... Date Added: 2009-06-13 06:48:01 |
| e376as1.pdf Path: Sveriges lantbruksuniversitet >> E >> 376 Fall, 2009 Description: M K G F A B O e894a1j q1 T(K) peak lamb K um 5800 0.4995 2000 1.4485 3500 0.8277 5000 0.5794 6000 0.4828 7500 0.3863 10000 0.2897 30000 0.0966 Colour Green NIR(Red) NIR(Red) Yellow Green Violet/UV UV(Violet) DUV(Violet) E(peak) 8.413E+13 4.102E+11... Date Added: 2009-06-13 06:48:54 |
| q5.pdf Path: ECCD >> PS >> 3909 Fall, 2009 Description: ... Date Added: 2009-06-13 06:49:12 |
| S[1].I.ch14part2.doc Path: JMU >> BIO >> 270 Spring, 2008 Description: LECTURE NOTES/BOOK KEY CONCEPTS AND TERMS CHECKLIST (*L.N.=information can be found in your lecture notes) Chapter 14, part II Renal Physiology 3. Regulation of Blood Composition 1) Regulation of electrolytes and solutes a. Na regulating mechanisms R... Date Added: 2009-06-13 06:49:50 |
| S[1].I.ch14partII.doc Path: JMU >> BIO >> 270 Spring, 2008 Description: LECTURE NOTES/BOOK KEY CONCEPTS AND TERMS CHECKLIST (*L.N.=information can be found in your lecture notes) Chapter 14, part II Renal Physiology 3. Regulation of Blood Composition 1) Regulation of electrolytes and solutes a. Na regulating mechanisms R... Date Added: 2009-06-13 06:49:50 |
| SIpracticetest2.doc Path: JMU >> BIO >> 270 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|22 Mar 2005 14:01:13 -0000 vti_extenderversion:SR|5.0.2.4803 vti_backlinkinfo:VX|si/bio270handounts_sp05.htm ... Date Added: 2009-06-13 06:49:51 |
| 1205_worksheet3.doc Path: Virginia Tech >> WORKSHEET >> 1205 Fall, 2009 Description: W8BNMSWD#:#;}W1205_worksheet3.doc# #1205_worksheet3.doc# #< #Jimmy Arnold <arnold@calvin.math.vt.edu>, Worksheet 3# # ##z #$ #$#\'#9#9#1205_worksheet3.doc#W8BNMSWD#W8BNMSWD# # #,+-?#*.-.*s#\'#Z<7={yqT#$#[Q.,R#s? gYJII#H#.#Z@2 ,# ,# s/# # ... Date Added: 2009-06-13 06:50:44 |
| hwk1key.pdf Path: UCLA >> STAT >> 110 Spring, 2002 Description: Solution for Homework 1 Problem 8: a. Number observations equal 2 x 2 x 2 = 8. b. This could be called an analytic study because the data would be collected on an existing process. There is no sampling frame. Problem 18: a. The following histogram wa... Date Added: 2009-06-13 06:52:15 |
| CH342 Spring2009syllabus.pdf Path: Alabama >> CH >> 342 Fall, 2008 Description: CH 342 Physical Chemistry II Tentative Lecture/Exam Schedule SPRING 2009 Week 1 Weekday Date Chapter Week 10 Date Mar. 10 Mar. 12 Chapter 6 7 Thursday Jan. 8 Intro 2 Tuesday Thursday Jan. 13 Jan. 15 1 1 11 Mar. 17 Mar. 19 No class ... Date Added: 2009-06-13 06:52:24 |
| greenwave.ps Path: NMT >> PHYS >> 514 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: greenwave.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMR10 CMMI10 CMSY7 CMSY10 CMR7 CMBX7 CMSY5 %+ CMEX10 CMMI7 CMTI10 CMMI5 %En... Date Added: 2009-06-13 06:53:35 |
| ch10_part1.pdf Path: Creighton >> ATS >> 533 Fall, 2009 Description: Chapter10 TropicalandSouthernHemisphereClimates Contrastsbetweentropicsandextratropics(middlela;tudes) Li>lechangeinincidentsolarangleovertheyear Diurnaltemperaturevaria;onisgreaterthantheannualvaria;on Theatmosphereisbarotropic(thecounterparttob... Date Added: 2009-06-13 06:54:14 |
| MAT241examI.pdf Path: Pima CC >> MAT >> 241 Summer, 2008 Description: ... Date Added: 2009-06-13 06:54:29 |
| PHY122ExIV.pdf Path: Pima CC >> PHY >> 122 Fall, 2008 Description: ... Date Added: 2009-06-13 06:54:35 |
| learningToOrderSchapire.pdf Path: Neumont >> IFT >> 3390 Fall, 2009 Description: a ( ( 7 ( 7 8 1 7 ( 8 7 X Y 1 a a 7 7 ( 2Gy\"IG00y\"0033uG)h0)S!3!w)2\"2@ $ E E E p V E ( 8 V H E gI171)IcB@I)1S)g5Qg@a)fbPfy1bIdbD1PfQ)S5aIDg11g71y)SgaI)1S52 W Y 9 4 E R ( 8 F H 9 2 ( E W 8 4 Y 4 H E A H W 2... Date Added: 2009-06-13 06:55:14 |
| quiz5raw.pdf Path: Indiana State >> CARBON >> 105 Fall, 2009 Description: Name _ Quiz 5 (Chem 105) PV = nRT 1. 2. 3. 4. R = 0.08206 L atm/mol K October 12, 2007 1 atm = 14.7 psi Standard temperature and pressure (STP) are _ and _. How many mmHg are there in a standard atmosphere (1 atm)? _ How many mmHg are there in 1 tor... Date Added: 2009-06-13 06:55:48 |
| 20041025 Monday ling 100 lecture.doc Path: Berkeley >> LING >> 100 Fall, 2009 Description: 1 of 1 29537d7a85c0e1ff19ff8f68a3bf8b5502aac891.doc 20041025 Monday ling 100 lecture kind ness es root + suffic (affix) derivational A-> N \"the quality of being A\" + infelction expresses plural meaning A inflectional - changes o neither category o no... Date Added: 2009-06-13 06:56:41 |
| environment_5.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: NV I R O N M E N T E ... Date Added: 2009-06-13 06:59:52 |
| flower030.txt Path: UNI >> FACULTY >> 030 Fall, 2009 Description: Date: Mon, 14 Feb 2000 13:39:56 -0600 (CST) Hi Visual Basic students, Guess what happens if the (Name) property of your Timer control is set to the default NAME Timer1 but the SUB you typed in -... Date Added: 2009-06-13 07:00:20 |
| YER098W.t2k.str2-logo.pdf Path: UCSC >> YER >> 098 Fall, 2009 Description: YER098W.t2k STR2 5 4 3 2 1 CC 1 Z S A CC ZSTTZSCTH A Z A Y C S T H C CSSCTCTHHHHHHHHHHHHHH S S T C S H S H Y S H Z Z T H H C X XXXXXXXXXCTQ XXX XXXXX X XXXXXXXXXXXXXXXXXXXXHXXXXXX X Z A T Z S C H C C H T Y C G H H Y H H H A AHC Z H TT S 10 CBYCC... Date Added: 2009-06-13 07:01:57 |
| YER088C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YER >> 088 Fall, 2009 Description: YER088C.t2k EBGHSTL 3 2 1 C X CE E X C E S EEECCSGGCCCCGGCT C CT CCCCSETSSGEEESSSS S C XXXXTXXHXTXXXEHXX X C X C TT 10 T TT X X E X G S G E H CCCCC S E T X X SSTTG X C C T T S T T C T S GSSSSEEEETSTCCCCTHHCSTTS C S G C T S S E E B C C S S ... Date Added: 2009-06-13 07:02:01 |
| YDR037W.t2k.str2-logo.pdf Path: UCSC >> YDR >> 037 Fall, 2009 Description: YDR037W.t2k STR2 6 5 4 3 2 1 C C C S H H H C H H H H H C H T X X X X X X XXXXX A H 1 10 20 30 40 H 6 5 4 3 2 1 H H HHHH 51 T T C C T C C T C T C C C C C C C C T C C T C T T C C X X X X X X X X X X X X X X X X X HHHHHHHHHH X HHH X X X HHH... Date Added: 2009-06-13 07:04:21 |
| YGR035W-A.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YGR >> 035 Fall, 2009 Description: YGR035W-A.t2k EBGHTL 3 2 1 C X CHH H C T X X HHHHHHHHH 10 E E E H E E X X X X X X X XXXX H H H H X X X X TCC T EHCETCTETT C C H T E T H X X X EE X H CCXXXXXXX H H G C T T H C H C X X X X X X X X X X C C T H TG H HH X X T TT X X T T ... Date Added: 2009-06-13 07:05:25 |
| YGR032W.t2k.alpha-logo.pdf Path: UCSC >> YGR >> 032 Fall, 2009 Description: 3 2 1 HHHH X X S B E S S HHH C HHHH BBE E HH HH I C I A I I IIIIXXXXXXXXXXXXXXXIXSIIIXXXXIII X X 351 360 370 380 390 S E H S E H E 3 2 1 H S H B E B H S H D S B A B E B I XXXXXX H H H H G C F H XX H HIHH I S X X H I G G S X X X X... Date Added: 2009-06-13 07:05:40 |
| YML057W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YML >> 057 Fall, 2009 Description: YML057W.t2k DSSP-EHL2 2 1 CC 1 HHXXXE H H C C C C H H C C C C C H C H C H C C C C X X X X X X X 10 20 30 40 H 2 1 C X T H T E H T 51 60 70 80 90 H 2 1 H T E E T H T 2 1 H T E S E T H HHHHHHHH CCC C C C X X X X X X X X... Date Added: 2009-06-13 07:09:44 |
| YER173W.t2k.alpha-logo.pdf Path: UCSC >> YER >> 173 Fall, 2009 Description: YER173W.t2k ALPHA 3 2 1 H E I C E BHG S A B E EE SH XXXXXXXXXXXXXXAXXXXXHXXX X X B E E B H C S I H H T B EI A S B E E T H B D H S C I H S H B E H H X X X X H HS IHB E E B H I I H I H A E BB CC E XXXXXX X X H H H X X X H H XXIIXH... Date Added: 2009-06-13 07:10:10 |
| YML007W.t2k.w0.5-logo.pdf Path: UCSC >> YML >> 007 Fall, 2009 Description: YML007W.t2k w0.5 5 4 3 2 1 M L A P D S E S S SS S S GT S P S K S XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX S S P P P T I S S S P V V E V G G Q T T A A D S S L G A Q N P S G N S S V S A A G A P P A P S G G T N D S G S H G G R P A R V... Date Added: 2009-06-13 07:10:35 |
| YOL078W.t2k.w0.5-logo.pdf Path: UCSC >> YOL >> 078 Fall, 2009 Description: YL M F L V I XXXXXXXXXXXXXXXXXXXXXXXXXX N E DGV L I LLPELE I I V V I V PPV L I FM DLLENY Y E V I I V F L S S S K S S A XX I I L LL G G E E XXXXXXXXXXXXXXXXXXXXXX LG I V M M L L V V R R V I I N K Q K K I V N N V Q A 51 60 70 80... Date Added: 2009-06-13 07:11:04 |
| YDL010W.t2k.str2-logo.pdf Path: UCSC >> YDL >> 010 Fall, 2009 Description: YDL010W.t2k STR2 4 3 2 1 CCC Y S S Y Z M S Y M Y S T S C E Y Z C Z Z M H Y T S Y Z Z H M Y C T C M M Y Y Q H Y A S S S G Z H H Q YMEHHCECYCH Z T T C M T S H H S H C Z H H H E E C Y S M S H C G S H X X X X X X X X X X X X X X X X XX X X X X X X X X ... Date Added: 2009-06-13 07:11:40 |
| YER177W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YER >> 177 Fall, 2009 Description: YER177W.t2k EBGHSTL 3 2 1 C X 1 10 20 30 40 H 3 2 1 T H HHHHT T T XXXXCXX HC S S C H H H X X X HCC TT HEEEHH HEHHHXXXXXXXXTTHHHXX T T S S X X X X X X HHHHHH 70 H T C C X X C X X HHH C T X 51 60 80 90 T 3 2 1 H T H H T X... Date Added: 2009-06-13 07:11:59 |
| 06-Notes.pdf Path: Duke >> CPS >> 130 Fall, 2009 Description: Note Title 5/25/2005 ... Date Added: 2009-06-13 07:13:14 |
| 2005_exam_02.pdf Path: Kent State >> MATH >> 19002 Spring, 2008 Description: MATH 19002 SPRING 2005 EXAM 2 100 minutes 1 1. Solve for a: K = 1 + a2 2. Solve using Cramer\'s Rule. Give answers to two decimal places. 2.5T1 + 3T2 = 0 5.7T1 - 1.3T2 = 6 7. Solve using Cramer\'s Rule. Give answers to two decimal places. 3I1 + 2... Date Added: 2009-06-13 07:13:33 |
| YML007C-A.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YML >> 007 Fall, 2009 Description: YML007C-A.t2k EBGHSTL 3 2 1 C X 1 10 20 E H H 30 CEEEEE C HHHH E HXXX E HHH X XXXX X MV HFI FIALRSMR FMRRLVRNLQYLLL P I T SS L L FI H H H H H C H X X X X X X X X C X HHH HHHHHHH T T X X X X X X X H X X X H C H H C H X X T H X X X ... Date Added: 2009-06-13 07:15:55 |
| lab1i.pdf Path: Stanford >> STAT >> 208 Fall, 2009 Description: Computing Lab Section #1 1. Setting Things Up. Make a course directory. elaine20:~> mkdir s208 elaine20:~> cd s208 Make a le called standnorm.m with the following lines: function out=standnorm(n) out=randn(1,n); If you are working on a leland machin... Date Added: 2009-06-13 07:17:14 |
| grb00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090124 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09012412_upa.wxp Date: 1200Z 24 JAN 09 Searching for KGRB. Searching the city database file for: KGRB . Date:1200Z 24 JAN 09 Station: KGRB... Date Added: 2009-06-13 07:17:33 |
| eval_form_10.doc Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: Date Due:_ Date Completed: _ CprE 211 Lab Evaluation Form Lab 10 Lab Partners _ _ Lab Section _ Completed _ _ _ Description Prelab None Lab Demonstration Channel 0 works (3 pts) Channel 1 works (3 pts) Channel 2 works (3 pts) Channel 3 works (... Date Added: 2009-06-13 07:19:43 |
| outline.pdf Path: RPI >> IH >> 4600 Fall, 2009 Description: ... Date Added: 2009-06-13 07:21:04 |
| CTnoise.pdf Path: Michigan >> NERS >> 580 Fall, 2008 Description: Radiology Research Henry Ford Health System Internal Document Title: Date: Authors: Noise Propogation in Microtomography Vers-01: April 1999 Vers-02: 15 October 2002 M. Flynn, A. Seifert, S. Browde I. Introduction For computed tomography (CT) syst... Date Added: 2009-06-13 07:30:17 |
| flower030.txt Path: UNI >> CNS >> 030 Fall, 2009 Description: Date: Mon, 14 Feb 2000 13:39:56 -0600 (CST) Hi Visual Basic students, Guess what happens if the (Name) property of your Timer control is set to the default NAME Timer1 but the SUB you typed in -... Date Added: 2009-06-13 07:30:37 |
| krugII.ppt Path: Cal Poly Pomona >> CIS >> 421 Fall, 2009 Description: Things You Need to Get Right Krug II Life vs. Web Krug p. 52 & 56 Searching is difficult because you have no sense of scale, direction or location Navigation helps to build confidence, tells us what is available, helps us learn to use the sit... Date Added: 2009-06-13 07:33:58 |
| YOL065C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YOL >> 065 Fall, 2009 Description: YOL065C.t2k CB_BURIAL_14_7 3 2 1 AAAAB FGFGGGFF BB B GF FFF CDCDFF CDCDAXCEE D X X B X CED DE X X D D X X X X X X X X X G E E A A A EE A BBAAB C B C B B B B B B F C D D EEGDCDDDCCCDCCCCCCXXCXXXX D D X XXXXDDDXDXXDXX A A A G AA AA BB B X A ... Date Added: 2009-06-13 07:34:38 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 527 Fall, 2009 Description: . 13859:23213:101:78 24184:38373:101:98 23141:50118:127:78 21412:18713:127:78 24260:27200:101:78 18259:33024:101:78 26346:45459:127:78 22506:50118:76:78 24845:45459:127:78 20446:13383:101:78 27032:12692:127:78 21107:13383:127:78 30466:32372:101:98 13... Date Added: 2009-06-13 07:42:30 |
| chaos.xls Path: Texas >> ACE >> 375 Fall, 2009 Description: 5 11.88 26.16 48.29 62.43 58.64 60.63 59.67 60.16 59.92 60.04 59.98 60.01 59.99 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60.2 60.15 60.1 60.05 60 59.95 59.9 59.85 59.8 59.75 Column A 0 5 10 15 20 25 5 14.2 35.95 67.92 64.27 67.74 64.47... Date Added: 2009-06-13 07:52:28 |
| f00-e3-sol-9-10.pdf Path: Los Angeles Southwest College >> MATH >> 142 Fall, 2009 Description: 5 bS- 9. Find the third Taylor polynomial I 4(!)} -= O ~ ( P3(X) for f(x) = In(x + I: about a 0. ()CJ~ ~()(f() :f\'(.!\'[ -:. ~ \'\"fYol i (D/ : -I {( (0) =- \'2- -c ~fl )\'( f:!(I<);0:\'f(o ) i {Yo) X 11!1 2- ~l- + ~ \'3! :x~ rp;~ ~~V... Date Added: 2009-06-13 07:55:36 |
| YBR054W.t2k.str2-logo.pdf Path: UCSC >> YBR >> 054 Fall, 2009 Description: YBR054W.t2k STR2 2 1 CCHHH HXXX HC X X X X 1 10 20 30 40 H 2 1 T H Z T S H HH 51 X XXXX H H H C Z Z Y S XX CC SZ YZ CTTSCCCHHH Y AA T S X T Z SX C X A Q M S G Z Y G A C Z X X X A H C XXXXXXXXX HHH 60 70 80 90 T 2 1 XXXX... Date Added: 2009-06-13 08:24:02 |
| YBR082C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YBR >> 082 Fall, 2009 Description: YBR082C.t2k CB_BURIAL_14_7 3 2 1 AAAAA C X C BCB BBBCBCXBA A A D D D C C D X X X X X D E C B DB D D D B C D C D D A D C D C DDDCCA C D D C D E A C B B B B B F C B F C E CCEDCDEGDGEBCXDCDCDXCE C B D D D A D D C D E E A C E E E F G D C D D X X XDX... Date Added: 2009-06-13 08:24:02 |
| YBR058C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YBR >> 058 Fall, 2009 Description: YBR058C.t2k EBGHSTL 3 2 1 C X C E E C S T T T T T G C E H H S CC H XXXXXXXXXTTXXXXXXCXTXX X X X X T C HH HHHHHHHHHHHHHH 10 20 H C H H E X X X X X E C T X X C CSSC C S TT T H S C H C C E HHHHEEXXTTTTCC T T E H H C H C C S X X X X X X X X ... Date Added: 2009-06-13 08:25:06 |
| The Mac Farlane Plot70.pdf Path: Paul Smith's College >> SHARE >> 111506 Fall, 2009 Description: ... Date Added: 2009-06-13 08:33:06 |
| 003303_1.pdf Path: Pittsburgh >> AEI >> 4874 Fall, 2009 Description: ... Date Added: 2009-06-13 08:39:12 |
| cs427-21 Path: UIllinois >> CS >> 427 Fall, 2007 Description: Future Homework Review work of another project Pair with someone on your project Swap reviews with a pair from a different project (TAs will assign) Meet once to review their work Meet once to review your own work CS427 21-1 To be reviewed: ... Date Added: 2009-06-14 09:53:02 |
| a_bro_1535.pdf Path: Hamline >> SAVE >> 110207 Fall, 2009 Description: EROMHAM, BEDFORDSHIRE Sir John Dyve, wife Isabel, mother Elisabeth M.S. I (Sir Thomas Widville, wives Elizabeth E\" series St. Oven A bro 1535 eng.1 Effigies of Sir John Dyve, 1535, in armor, with his mother Elizabeth, daughter... Date Added: 2009-06-14 22:46:27 |
| Goudy, F.W_COLOR.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: B B GG GG G G BB G G Type Family of B B GG GG G G BB G G JJ JJ JJ Goudy Catalogue Goudy Modern Goudy Modern Italic Goudy Old Style Goudy Sans Goudy Italic Goudy Lombardic Capitals Goudy Handtooled Goudy, Frederic W. \"The alphabet, and Element... Date Added: 2009-06-14 22:50:47 |
| CS1_241_P4_tight comp_ouye.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: applications for ryuusei athletic wear 1. exterior sign 2. sneaker 3. jersey 241_graphic design I_jeff ouye ... Date Added: 2009-06-14 22:50:56 |
| YGR255C.t2k.w0.5-logo.pdf Path: UCSC >> YGR >> 255 Fall, 2009 Description: YGR255C.t2k w0.5 6 5 4 3 2 1 10 20 30 40 E 6 5 4 3 2 1 L E H T X X A 51 60 70 80 90 T 6 5 4 3 2 1 D E P K A T E H T T E H T H L I V F A L L R XXXX R Q T 6 5 4 3 2 1 E K E T E E H T 6 5 4 3 2 1 T E T S E T S E ... Date Added: 2009-06-14 22:51:38 |
| YGR295C.t2k.w0.5-logo.pdf Path: UCSC >> YGR >> 295 Fall, 2009 Description: YGR295C.t2k w0.5 6 5 4 3 2 1 P XX S I TF L E KNV I S I E S L XXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXX E D A E N T D K K V E D D V T E I S L K L Q I K E I S NV L S A A K L S X LP D F T V F M Y Q L I CYAV K L H L F V A L R F A S... Date Added: 2009-06-14 22:51:54 |
| YGR258C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YGR >> 258 Fall, 2009 Description: YGR258C.t2k CB_BURIAL_14_7 3 2 1 A B X D BE DD C C D D C CCE C E D C E E D CDCCBDCDCFACACCCBCCCAFAACD E A F D D X X X B F B A E C EB C G A D D D D D D D D X X X X X X X X X X X X X X ABBAA B ABB B BBEBBDE A A X X X X X X DDDXFE D C X FFF GF... Date Added: 2009-06-14 22:51:54 |
| 12.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: 241 : Sample 1 2 3 1 2 1 1. 2. 3. 4. 2 1 21 4 2 1 2 1 4 2 1 2 1 1 2 3 1 2 1 2 3 1 2 1 2 1 4 2 1 2 1 4 2 1 2 1 1 2 3 1 2 1 2 3 1 2 1 2 3 1 2 1 241_Graphic Design I : Term : Your Name ... Date Added: 2009-06-14 22:52:39 |
| WebDesign.pdf Path: Laurentian >> CLASSES >> 200401 Fall, 2009 Description: ... Date Added: 2009-06-14 23:11:40 |
| email080day4Example.txt Path: UNI >> FACULTY >> 080 Fall, 2009 Description: Date: Wednesday, 03 Sep 2003 12:55:13 From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-080-01@uni.edu, 810-080-03@uni.edu Subject: Exercise #16, page 31. Solution. Hi discrete students, In the 11 a.m. Wednesday class, the... Date Added: 2009-06-14 23:17:57 |
| emailSep7th0F2001.txt Path: UNI >> FACULTY >> 080 Fall, 2009 Description: Date: Fri, 07 Sep 2001 10:48:02 -0500 (CDT) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-080-01@uni.edu, 810-080-02@uni.edu Subject: HW solutions on web page this afternoon. Hi Discrete students, I will hand back homewo... Date Added: 2009-06-14 23:18:01 |
| hw2Sept2000.txt Path: UNI >> FACULTY >> 080 Fall, 2009 Description: In Exercises 27-29, you are travelling in a certain country where every inhabitant is either 1. a truthteller who always tells the truth, or 2. a liar who always lies. ... Date Added: 2009-06-14 23:18:04 |
| HW18.pdf Path: Toledo >> HW >> 0203 Fall, 2009 Description: Dror Bar-Natan: Classes: 2002-03: Math 157 - Analysis I: Homework Assignment 18 Assigned Tuesday February 4; not to be submitted. web version: http:/www.math.toronto.edu/~drorbn/classes/0203/157AnalysisI/HW18/HW18.html Required reading Reread the h... Date Added: 2009-06-14 23:22:26 |
| 281_µØ»y»y®ðµü±Ð¾Ç±´°Q.pdf Path: S.F. State >> ONLINE >> 899 Fall, 2008 Description: (context)(utterance) (1) a. b. c. never (2) a. 13-16 b. 10-5-25 c. 8-4-62 never1(a)(b-c) (3) a. / b.* / c.* / (4) a.* b.* c.* 1 - 281 - (5a) (5) a. b.* c. (2b-c) (6a)(7b) (6) a... Date Added: 2009-06-14 23:32:45 |
| PHP_Array.ppt Path: Oregon State >> CS >> 540 Fall, 2008 Description: An indexed array is similar to the one provided by a conventional programming language. An element of an associative array can be accessed by a keyword. It is like a dictionary or map. An array element can be of any type. It can be an integer, ... Date Added: 2009-06-14 23:33:11 |
| Test_Solution.pdf Path: Purdue >> MA >> 170 Fall, 2008 Description: ... Date Added: 2009-06-14 23:33:17 |
| final_inclass_060508.pdf Path: Berkeley >> EEP >> 162 Spring, 2009 Description: EEP 162 Final Exam May 15, 2006 Instructions: (i) You will have 3 hours to work on this exam, until 3:30. (ii) In answering the following questions, take time to think about your answer before you begin writing. Points will be awarded both on the con... Date Added: 2009-06-14 23:33:26 |
| chapter15.ppt Path: NMSU >> PPT >> 460 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>2965b87fd8a7b2834200cf08cf692037ca628173.ppt</Key><RequestId>D A558810254CDD25</RequestId><HostId>SAUBhXdxpSlxkniWuR7WiWYyTLt... Date Added: 2009-06-14 23:33:32 |
| Lec-03-ppt.ppt Path: Purdue >> BME >> 595 Summer, 2008 Description: 1. 2. 3. 4. 5. 6. Pass out Class Outline Pass out 1st Paper Pass out \"how to read a scientific paper\" History of Biosensors Different Device Types Device Design Criteria Defining events in the history of biosensor development 1916 1922 1956 1962 19... Date Added: 2009-06-14 23:35:23 |
| DaoustStatsHmwk.pdf Path: Los Angeles Southwest College >> STAT >> 708 Fall, 2009 Description: Robert Daoust STAT708-ENVIRONMETRICS Timeseries Homework Question 1 Part A) A random walk can be generated by the equation: Zt=ti=0ai=zt-1+at Hence, a random walk generated by such an equation would not be stationary because it is TIME-DEPENDENT. E... Date Added: 2009-06-14 23:36:50 |
| guidelines.pdf Path: University of Iowa >> CS >> 196 Fall, 2009 Description: Guidelines for the Term Papers First Draft due: Nov 18th Final paper due: Dec 15th 1. Your rst draft should be 2-3 pages long. It should contain a fairly detailed overview of your nal draft. I will grade it quickly and give you feedback. Your nal dr... Date Added: 2009-06-14 23:36:54 |
| 2304-w09.syl.pdf Path: CSU Mont. Bay >> MCS >> 2304 Fall, 2009 Description: MATH 2304-01 Calculus III Winter 2009 MWF 12:001:10 p.m. Robinson Hall 119 Instructor: William R. Nico Office: RO 239 Phone: (510)885-3386 E-mail: william.nico@csueastbay.edu (On the mcs system just \"nico\" will work.) Web: www.mcs.csueastbay.edu/~nic... Date Added: 2009-06-14 23:37:51 |
| 11a Value Creation.doc Path: CSU Long Beach >> SMIN >> 661 Fall, 2009 Description: MKTG 492 Professor Sam Min Lecture 11a Customer Value Creation (Kano Method) Customer Value Creation 1 Five Types of Product Features (Kano Method) Everything you want. Nothing you don\'t need. Presenting Mac mini. With a powerful G4 processor, g... Date Added: 2009-06-14 23:38:43 |
| call_for_participation_amia_2006.txt Path: SUNY Albany >> OU >> 372553 Fall, 2009 Description: i2b2 Workshop on Natural Language Challenges in Clinical Data Fall Symposium of American Medical Informatics Association November 10, 2006 Washington, DC i2b2.org/NLP Call for Participation Within the framework of i2b2 (Informatics... Date Added: 2009-06-14 23:38:49 |
| Tooltips.docx Path: Michigan >> IOE >> 373 Fall, 2008 Description: Tooltips Tooltips are a nice and easy way to make a user interface more friendly. They are little windows which display a message whenever the mouse \"hovers\" over a control (no click required). Create a new project, and add a TrackBar and a few other... Date Added: 2009-06-14 23:38:53 |
| CHAP10.ppt Path: CSU San Marcos >> CS >> 637 Fall, 2009 Description: Stallings, Wireless Communications Networks, Second Edition, 2005 Pearson... Date Added: 2009-06-14 23:39:46 |
| adaptq.pdf Path: Utah >> MATH >> 5620 Spring, 2008 Description: Adaptive Quadrature* In this note, we take a fresh view of adaptive quadrature that will illustrate most of the key ingredients of Variable Step Variable Order (VSVO) methods for solving IVPs of ODEs. One missing ingredient is the variable order. How... Date Added: 2009-06-14 23:46:57 |
| ch09.pdf Path: GA Southern >> CS >> 215 Fall, 2009 Description: Graphics and Applets Chapter 9 Fundamentals of Programming Graphics and Applets 2001 Richard L. Halterman 1 Need a Reason? Graphical computer games are much more attractive than text-based games Graphics permit WYSIWYG wordprocessors a... Date Added: 2009-06-15 00:06:04 |
| eudoxus.pdf Path: Texas A&M >> MATH >> 629 Fall, 2008 Description: Eudoxus of Cnidus1 Eudoxus (c. 400 BCE), son of Aeschines, is ranked among the greatest of the ancient mathematicians, surpassed perhaps only by Archimedes | but more on Archimedes later. The few facts known concerning his life are derived substantia... Date Added: 2009-06-15 00:07:33 |
| slides11.ppt Path: Duke >> CPS >> 100 Fall, 2009 Description: Graphs, the Internet, and Everything http:/www.caida.org/ CPS100 11.1 Airline routes CPS100 11.2 Word ladder CPS100 11.3 Graphs: Structures and Algorithms q Howdopacketsofbits/informationgetroutedontheinternet Messagedividedintopacketsoncli... Date Added: 2009-06-15 00:22:23 |
| Inversion.doc Path: E. Kentucky >> ITTC >> 690 Fall, 2009 Description: Sort-based Inversion Requires 2 sets of temporary files. Creates Sorted dictionary file. Pass 1 create large temporary file, one entry per term per document Requires a memory data structure per document to count frequency per term. Each entry stores... Date Added: 2009-06-15 00:27:04 |
| ExerciseQuestions1.doc Path: UH Clear Lake >> ISAM >> 3033 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|02 Dec 2006 20:54:32 -0000 vti_extenderversion:SR|6.0.2.5516 vti_author:SR|UHCL\\gercek vti_modifiedby:SR|UHCL\\gercek vti_timecreated:TR|02 Dec 2006 20:54:32 -0000 vti_cacheddtm:TX|02 Dec 2006 20:54:32 -... Date Added: 2009-06-15 00:28:15 |
| Living Company Article.doc Path: Laurentian >> MGT >> 200603 Fall, 2009 Description: The Living Company by Arie De Geus Harvard Business Review (March 1997) In the world of institutions, commercial corporations are newcomers. They have been around for only 500 years a mere blip in the course of human civilization. In that time, as p... Date Added: 2009-06-15 00:42:03 |
| Main_the_Case_of_Cent_East_Europe_-_Loc_Gov_the_Driv_of_Growth_-_Chp_2.pdf Path: East Los Angeles College >> EB >> 901 Fall, 2009 Description: ... Date Added: 2009-06-15 00:47:48 |
| final.pdf Path: ASU >> TEACH >> 272 Fall, 2009 Description: MAT 272 Final Exam Instructor: John Quigg December 13, 2003 Name: No books, notes or calculators of any kind are permitted on the test. Do not use your own scratch paper. Write each solution in the space provided, not on scratch paper. If you... Date Added: 2009-06-15 00:53:05 |
| multicalc.pdf Path: ASU >> TEACH >> 272 Fall, 2009 Description: jrjjrj01jn y tk VV h oVV ViV V Uo RVVV o~t khi V eU ryr~UU thWiUUU rVUU r~U UU ty hk V THGPHGE ISRQI@FD Wsf1w1segff c1wdb aRff` ce1t`b fg1dY}r~ XtU d f q i X ggwfru1o$y XtU rufByxupegd y 1gd Fgf xgq tda$1ff1 sByypd degd C&tk XttUU y X d ... Date Added: 2009-06-15 00:53:19 |
| sequence.pdf Path: ASU >> TEACH >> 371 Fall, 2009 Description: SEQUENCES JOHN QUIGG Exercise 1. Let (xn ) be a convergent sequence in R, and put x = lim xn . Dene a new sequence (k ) by k 1 k = xn . k n=1 Prove that k x. Hint: Break the sum into two parts, one of which has a xed number of terms, and the other ... Date Added: 2009-06-15 00:53:33 |
| The Living Company Article.doc Path: Laurentian >> MGT >> 200603 Fall, 2009 Description: The Living Company by Arie De Geus Harvard Business Review (March 1997) In the world of institutions, commercial corporations are newcomers. They have been around for only 500 years a mere blip in the course of human civilization. In that time, as p... Date Added: 2009-06-15 01:08:50 |
| p339-balakrishnanA.pdf Path: Texas >> CS >> 378 Fall, 2008 Description: Accountable Internet Protocol (AIP) David G. Andersen1 , Hari Balakrishnan2 , Nick Feamster3 , Teemu Koponen4 , Daekyeong Moon5 , and Scott Shenker5 1 Carnegie Mellon University, 2 MIT, 3 Georgia Tech, 4 ICSI & HIIT, 5 University of California, Berk... Date Added: 2009-06-15 01:09:58 |
| aislides-4up.pdf Path: Duke >> X >> 108 Fall, 2009 Description: Why Study Games? Many human activities can be modeled as games Negotiations Bidding TCP/IP Military confrontations Pursuit/Evasion Games CPS 170 Ron Parr Games are used to train the mind Human game-playing, animal play-fighting Why Are Gam... Date Added: 2009-06-15 01:12:06 |
| TM #5 - The Living Company.doc Path: Laurentian >> MGT >> 200801 Fall, 2009 Description: The Living Company by Arie De Geus Harvard Business Review (March 1997) In the world of institutions, commercial corporations are newcomers. They have been around for only 500 years a mere blip in the course of human civilization. In that time, as p... Date Added: 2009-06-15 01:24:04 |
| morph_w-title.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: Ky cs eo l fa ... Date Added: 2009-06-15 01:24:18 |
| Personality.pdf Path: North Texas >> GEOG >> 4800 Fall, 2008 Description: PersonalityTypesExercise Goals Toidentifyyourpersonalitytype. Toevaluatetheaccuracyofthepersonalitytype. Toassesshowyourpersonalitytypecaninfluenceyourwork. Tousethepersonalitytraitstodevelopstrategiesforminimizinggroupconflict. Exercise 1. Tak... Date Added: 2009-06-15 01:31:07 |
| CHAPTER01 Path: UT Arlington >> MAE >> 3311 Summer, 2006 Description: Chapter 1 INTRODUCTION AND BASIC CONCEPTS E very science has a unique vocabulary associated with it, and thermodynamics is no exception. Precise definition of basic concepts forms a sound foundation for the development of a science and prevents pos... Date Added: 2009-06-15 02:05:25 |
| YPL230W.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YPL >> 230 Fall, 2009 Description: YPL230W.t2k CB_BURIAL_14_7 3 2 1 AAAAAABBAA B BB BB C D C D D D D X X X X X X X X 1 10 20 30 40 A 3 2 1 AB D D X X B A A B D A B D B E B D A B B D A B BCDAAA C A CCC B B ADBA C AA B A B C A DB BB A CE CC C XDDDCDXCCXDCDDCCCCCDCDC ... Date Added: 2009-06-15 02:16:09 |
| owens.pdf Path: Cal Poly >> CSC >> 530 Fall, 2009 Description: From Structures and Functors to Modules and Units Scott Owens Matthew Flatt University of Utah {sowens,mflatt}@cs.utah.edu Abstract Component programming techniques encourage abstraction and reuse through external linking. Some parts of a program, h... Date Added: 2009-06-15 02:17:05 |
| environment_5.pdf Path: San Diego State >> ART >> 342 Fall, 2008 Description: NV I R O N M E N T E ... Date Added: 2009-06-15 02:21:28 |
| Goudy, F.W_COLOR.pdf Path: San Diego State >> ART >> 242 Fall, 2008 Description: B B GG GG G G BB G G Type Family of B B GG GG G G BB G G JJ JJ JJ Goudy Catalogue Goudy Modern Goudy Modern Italic Goudy Old Style Goudy Sans Goudy Italic Goudy Lombardic Capitals Goudy Handtooled Goudy, Frederic W. \"The alphabet, and Element... Date Added: 2009-06-15 02:51:38 |
| MODULE8p.pdf Path: East Los Angeles College >> CL >> 0708 Fall, 2009 Description: MODULE 8p - Applets - Trials B The applet to be developed in this series of trials is called AppletB. The first version is a simple modification of AppletA but should be saved in AppletB.java import java.applet.Applet; import java.awt.Graphics; impo... Date Added: 2009-06-15 02:55:04 |
| pollack1999.pdf Path: Stanford >> CBIO >> 241 Fall, 2009 Description: 1999 Nature America Inc. http:/genetics.nature.com letter Genome-wide analysis of DNA copy-number changes using cDNA microarrays Jonathan R. Pollack1, Charles M. Perou2, Ash A. Alizadeh3, Michael B. Eisen2, Alexander Pergamenschikov2, Cheryl F. W... Date Added: 2009-06-15 03:04:49 |
| worksheet9.pdf Path: Colorado >> AMATH >> 2460 Fall, 2009 Description: Solving Systems of Dierential Equations Patrick Young November 6, 2006 Contents 1 Eigenvalues and Eigenvectors 2 Finding Eigenvalues 3 Finding Eigenvectors 4 Finding Eigenvalues Quickly 5 Finding Eigenvectors Quickly 6 Homework 1 1 2 2 3 3 1 Eigen... Date Added: 2009-06-15 03:43:43 |
| Lecture 9 given Sp 09 Path: Texas >> CH 310N >> 53185 Spring, 2009 Description: Lecture 9 Organic Chemistry II for Prehealth Professionals Chemistry 310N Unique number: 53185 Tu,Th 12:302:00 pm, Welch 2.224 Professor: Jonathan Sessler, Ph.D. sessler@mail.utexas.edu Note: Office Hours will end at 3:10 pm today and Tuesday;... Date Added: 2009-06-15 15:48:16 |
| 310NHWSet1ques Path: Texas >> CH310N >> 53185 Spring, 2009 Description: Homework Problem Set 1 Iverson CH310N Due Wednesday, January 28 NAME (Print): _ SIGNATURE: _ Chemistry 310N Dr. Brent Iverson 1st Homework January 23, 2009 Please print the first three letters of your last name in the three boxes Homework Probl... Date Added: 2009-06-15 16:15:21 |
| www-St-Takla-org___Jesus-Christ-Pantokrator-25 Path: Kent Uni. >> RBIO >> RBIO1234 Winter, 2007 Description: ... Date Added: 2009-06-15 18:29:46 |
| hc_071005_test.ps Path: CSU Channel Islands >> E >> 835 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hc_071005_test.dvi %Pages: 19 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hc_071005_test %DV... Date Added: 2009-06-16 13:37:35 |
| tj.1000m.2006080706.txt Path: U. Houston >> SERVER >> 2006080706 Fall, 2009 Description: 2 REAL 6 8 6 18 0 REAL 6 8 6 18 0 12BACKWARDOMEGA 6 8 7 6 29.696 -95.499 1000.0 6 8 7 6 29.670 -95.129 1000.0 6 8 7 6 30.039 -94.075 10... Date Added: 2009-06-16 13:45:25 |
| tj.500m.2009040212.txt Path: U. Houston >> SERVER >> 2009040212 Fall, 2009 Description: 2 REAL 9 4 2 0 0 REAL 9 4 2 0 0 12BACKWARDOMEGA 9 4 2 12 29.696 -95.499 500.0 9 4 2 12 29.670 -95.129 500.0 9 4 2 12 30.039 -94.075 5... Date Added: 2009-06-16 13:46:01 |
| tj.1500m.2009043000.txt Path: U. Houston >> SERVER >> 2009043000 Fall, 2009 Description: 2 REAL 9 4 29 12 0 REAL 9 4 29 12 0 12BACKWARDOMEGA 9 4 30 0 29.696 -95.499 1500.0 9 4 30 0 29.670 -95.129 1500.0 9 4 30 0 30.039 -94.075 15... Date Added: 2009-06-16 13:46:06 |
| tj.1000m.2009041218.txt Path: U. Houston >> SERVER >> 2009041218 Fall, 2009 Description: 2 REAL 9 4 12 18 18 REAL 9 4 12 18 18 12FORWARD OMEGA 9 4 12 18 29.696 -95.499 1000.0 9 4 12 18 29.670 -95.129 1000.0 9 4 12 18 30.039 -94.075 10... Date Added: 2009-06-16 13:46:20 |
| 36 Thermoelectric.pdf Path: Brookdale >> MECH >> 4810 Fall, 2009 Description: 4/6/09 Energy Conversion Systems MECH 4810 Group #8 History Theory Applications Conclusions Problems Questions Energy Conversion Systems MECH 4810 Group #8 1 4/6/09 History Theory Applications Conclusions Problems Questions 17701831 Es... Date Added: 2009-06-16 13:46:20 |
| Requirement 12.doc Path: Oregon State >> CS >> 589 Fall, 2008 Description: Requirement #: 12 Requirement Type: 11a Event/Use Case #: Description: Use should be able to configure the look and feel of the product to match there environment. Rationale: Tasktracer is a peripheral program designed to increase productivity. Being... Date Added: 2009-06-16 13:48:27 |
| PDF_DDT.pdf Path: Virginia Tech >> PUBS >> 456 Fall, 2009 Description: Degree-Day Tables 155 Table 26. Degree Day Table for Codling Moth, Based on 50 F Minimum and 88F Maximum Thresholdsa a Degree days determined using a sine wave function [Baskerville and Emin (1969) Ecology 50: 514-517]. To convert Fahrenheit degree... Date Added: 2009-06-16 13:49:19 |
| tj.1500m.2009051906.txt Path: U. Houston >> SERVER >> 2009051906 Fall, 2009 Description: 2 REAL 9 5 18 18 0 REAL 9 5 18 18 0 12BACKWARDOMEGA 9 5 19 6 29.696 -95.499 1500.0 9 5 19 6 29.670 -95.129 1500.0 9 5 19 6 30.039 -94.075 15... Date Added: 2009-06-16 13:49:37 |
| 802-11-addresses.pdf Path: W. Alabama >> CS >> 456 Fall, 2009 Description: ... Date Added: 2009-06-16 13:50:38 |
| bwlec10.pdf Path: University of Illinois, Urbana Champaign >> CS >> 475 Fall, 2008 Description: Context Free Languages 178 Parenthesis Matching Given an arithmetic expression. Check if the parentheses are matched. Note: The language is not regular. Ignoring the numbers and variables in the expression, a correct expression corresponds to some... Date Added: 2009-06-16 13:51:27 |
| 4169-2009-sem1-str5-nine.ppt Path: Allan Hancock College >> LAW >> 4169 Fall, 2009 Description: Equity 406 Lecture 9 ESTOPPEL (cont) Proprietary estoppel a different approach? Giumelli v Giumelli .son was promised a part of the parents rural property if he stayed and did not accept a job elsewhere son remained property later denied estoppe... Date Added: 2009-06-16 13:53:19 |
| log.txt Path: Washington >> V >> 22000 Fall, 2009 Description: 000 (34400.000.000) 12/24 09:31:52 Job submitted from host: <128.95.94.28:1084> . 001 (34400.000.000) 12/24 18:09:02 Job executing on host: <172.25.101.163:1058> . 006 (34400.000.000) 12/24 18:29:11 Image size of job updated: 455016 . 005 (34400.000.... Date Added: 2009-06-16 13:53:37 |
| submit.txt Path: Washington >> V >> 22000 Fall, 2009 Description: executable = allgamma_22424.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs22000-22499/... Date Added: 2009-06-16 13:56:29 |
| output.txt Path: Washington >> V >> 22000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-135QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is F8FE-2FC1 Directory of C:\\condor\\execute\\dir_3560 12/24/2007 03:51 PM <DIR> . 12/24/2007 03:51 ... Date Added: 2009-06-16 13:58:33 |
| YDR182W-A.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YDR >> 182 Fall, 2009 Description: YDR182W-A.t2k DSSP-EHL2 2 1 X CCEECCCCCECCCE C C C C E X X H H H H X X X 10 20 30 40 E 2 1 S E T S E H T E CCC X C C E H E X X X X X H H H H H H H H H X X C C ECCCCCCCCE C EE EEEEEE C 60 S 51 KK EHL GKLLVPLV LYQI T E 50 1 C ... Date Added: 2009-06-16 13:58:53 |
| mouse.ps Path: University of Illinois, Urbana Champaign >> ECE >> 359 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: (Using Simulink) %Version: 1 2 %Creator: (FrameMaker 5.1.2P1d) %CreationDate: (D:19981229090008) %DocumentData: Clean7Bit %BoundingBox: 27 71 584 719 %Pages: 3 %DocumentProcessColors: (atend) %DocumentSuppliedResources: %+ font... Date Added: 2009-06-16 14:00:20 |
| YJL225W-A.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YJL >> 225 Fall, 2009 Description: YJL225W-A.t2k EBGHSTL 3 2 1 CC X 1 10 20 30 40 H 3 2 1 T H T E H H H H X X X 51 60 70 80 90 E 3 2 1 T C E S E E S C T C H C S E T H T T E X X X X X X X X XHHXHHHHHHHECCSXX X X X X X X X X X X X X X T H E CC TTC C SSS C SCT C... Date Added: 2009-06-16 14:00:59 |
| shelton_draft.rtf Path: San Diego State >> PROJECT >> 344 Fall, 2009 Description: Discussion of CSS vs. Tables When the internet was brought to home computers across the globe, designing for it became an issue-functionality, usability, among other things, are now a focus when building a website. Before, it was simply an informatio... Date Added: 2009-06-16 14:03:06 |
| Week 4 Hobbes Foundations.pdf Path: East Los Angeles College >> GV >> 201 Fall, 2009 Description: ... Date Added: 2009-06-16 14:03:42 |
| AWER_3820_final_spring04.doc Path: Utah State >> AWER >> 3820 Fall, 2009 Description: NAME AWER 3820 final. April 27, 2004. . 1. Describe the three orbital cycles that make up the Milankovitch Cycles. How can they affect global climate? (ten points) 2. Based on the readings in Wally Broekers book, fill in these blanks. (two points ... Date Added: 2009-06-16 14:09:26 |
| uA749ckt.pdf Path: Georgia Tech >> ECE >> 4435 Fall, 2008 Description: ... Date Added: 2009-06-16 14:55:36 |
| output.txt Path: Washington >> V >> 1029 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-2ZVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3612 06/02/2007 07:35 AM <DIR> . 06/02/2007 07:35 ... Date Added: 2009-06-16 15:19:59 |
| Allison Sciullo.doc Path: Penn State >> ALS >> 5408 Fall, 2009 Description: Allison Sciullo ... Date Added: 2009-06-16 16:34:40 |
| source_info.txt Path: Washington >> V >> 2023 Fall, 2009 Description: Source ID Source Name counts 1000 Giommi_BLLacs_000 74 1001 Giommi_BLLacs_001 39 1002 Giommi_BLLacs_002 19 1004 Giommi_BLLacs_004 23 ... Date Added: 2009-06-16 16:35:39 |
| 26896-8.txt Path: UNC >> DOCS >> 26896 Fall, 2009 Description: Project Gutenberg\'s Notes and Queries, Number 76, April 12, 1851, by Various This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Proje... Date Added: 2009-06-16 16:42:54 |
| 25974-8.txt Path: UNC >> DOCS >> 25974 Fall, 2009 Description: The Project Gutenberg eBook, God\'s Plan with Men, by T. T. (Thomas Theodore) Martin This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of t... Date Added: 2009-06-16 16:49:37 |
| 25397-0.txt Path: UNC >> DOCS >> 25397 Fall, 2009 Description: The Project Gutenberg EBook of Lun Heng, by Chong Wang This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg License i... Date Added: 2009-06-16 16:54:26 |
| Assignment_1.pdf Path: Texas A&M >> AMESP >> 325 Fall, 2009 Description: 09-06-02 ELEN-325 Assignment #1 Due: 09-13-02, 12:20 A.M. Homeworks will not be received after the due. Instructor: Dr. Jose Silva-Martinez PROBLEMS: 1.11, 1.17, 1.19, 1.20, AND 1.22 ... Date Added: 2009-06-16 17:04:48 |
| 2298_2.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: source: Designing a Super Peer Network by Beverly Yang et al Idea: -This paper presents the concept of super peer network with an extensive simulation results of the same. -A super peer is a node in a system that is a mixture of a pure and hybrid ... Date Added: 2009-06-16 17:38:12 |
| 9266_1.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper #2 Title: Anonymous Usage of Location-Based Services through Spatial and Temporal Cloaking Problem Statement Location based services face the problem of privacy risks. One way to deal with it is to provide anonymity. Anonymity can provide a g... Date Added: 2009-06-16 17:39:20 |
| schwartzintro1996.pdf Path: Sveriges lantbruksuniversitet >> CMNS >> 487 Fall, 2009 Description: ... Date Added: 2009-06-16 17:41:43 |
| Final_Exam.pdf Path: Colorado >> PHIL >> 4360 Fall, 2008 Description: Final Exam Topics in Mind and Language Due: Monday, May 12, 4 pm, by email to me. You must get email confirmation from me that Ive received your exam. Answer any 5 of the following questions. Type your answers. 1. What is Kripkes modal argument? Disc... Date Added: 2009-06-16 17:42:15 |
| AME30362_ICE07_f08.pdf Path: Oakland University >> AME >> 30362 Fall, 2009 Description: ICE#7 AME30362 DETAIL DESIGN Name: 11/25/2008 Write the two most relevant responsibilities for each team member in a concurrent engineering environment. Team Member Sales & Marketing Responsibility Industrial Design Design Engineering Industri... Date Added: 2009-06-16 17:43:15 |
| day 15 - 0225.ppt Path: Oregon State >> BA >> 341 Fall, 2009 Description: Chapter 18/19 Corporate Bonds / Government Bonds Bonds Our goal in this chapter is to understand the basic types and features of corporate bonds and government bonds (Federal, state and local). 18-2 Corporate Bond Basics A Corporate bond is a ... Date Added: 2009-06-16 17:43:26 |
| Histidine phosphorylation.pdf Path: Iowa State >> BBMB >> 645 Spring, 2008 Description: Mechanisms of Receptor activation EGF Histidine Kinases and Two Component Systems FGF Growth hormone TGF BMP Insulin, IGF erythropoietin Sebald and Mueller 2003 Trends Biochem Sci. 28 518-21 Topics Histidine phosphorylation Two component systems... Date Added: 2009-06-16 17:43:31 |
| hw9-H251-ans.pdf Path: Oregon >> H >> 251 Fall, 2009 Description: H w 0opm t$\"% q f tH zi ~j krpf d$9p1 g m w s ! s q ig ) ( ) ) # # ! # 7 ! ) @ e ) s g m w s ga`2$`0AC31 q hf oH i aFpm rpf Q5 R q ig H q t hf q t hf Ye... Date Added: 2009-06-16 17:44:24 |
| 04-Kestrel2.4p.pdf Path: UCSC >> CMPE >> 220 Fall, 2008 Description: Fri Dec 1 16:23:56 PST 2006 Fri Dec 1 16:23:56 PST 2006 <> <> ... Date Added: 2009-06-16 17:44:33 |
| lectslides 2007-06-11 (FDI overview).ppt Path: Penn State >> ASM >> 412 Fall, 2009 Description: Multinationals and Foreign Direct Investment An Overview A legal entity created under the laws of a state, consisting of a person or group of people (shareholders) What\'s so special about a corporation? What\'s a corporation? Legally, a corpo... Date Added: 2009-06-16 17:46:12 |
| Lecture10.pdf Path: UVA >> MATH >> 552 Spring, 2008 Description: ... Date Added: 2009-06-16 17:47:22 |
| AMarx.pdf Path: Portland >> GEOG >> 475 Fall, 2008 Description: Network Junction, Whats Your Function Adam Marx GEOG 575 Network Datasets vs. Geometric Networks Bidirectional flow Junctions associated with turn tables to model restrictions Used to model transportation networks Directed flow Junctions alone ... Date Added: 2009-06-16 17:49:42 |
| KC0015.pdf Path: UMKC >> IKC >> 0015 Fall, 2009 Description: March 10, 1984 REVISED June 27, 2005 WESTERN HISTORICAL MANUSCRIPT COLLECTION KANSAS CITY KC 0015 Dix Teachenor (1892-1961) Papers 1911 - 1935 21 folders MICROFILM PROVENANCE: This gift was received from the UMKC General Library as accession 0024... Date Added: 2009-06-16 17:51:38 |
| output.txt Path: Washington >> V >> 11500 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS1 - local directory - Volume in drive C has no label. Volume Serial Number is 5692-E1E5 Directory of C:\\condor\\execute\\dir_3104 12/03/2007 02:51 PM <DIR> . 12/03/2007 02:51 PM <D... Date Added: 2009-06-16 17:52:28 |
| submit.txt Path: Washington >> V >> 11632 Fall, 2009 Description: executable = allgamma_11632.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11500-11999/11... Date Added: 2009-06-16 17:52:57 |
| output.txt Path: Washington >> V >> 11500 Fall, 2009 Description: = running on = COMPUTERNAME=IOLANI - local directory - Volume in drive C has no label. Volume Serial Number is 04CD-062E Directory of C:\\Condor\\execute\\dir_472 12/03/2007 03:36 PM <DIR> . 12/03/2007 03:36 PM <DIR... Date Added: 2009-06-16 17:53:01 |
| error.txt Path: Washington >> V >> 11500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 15:44:18 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 16:50:30 2007 ( 3972 s elapsed) ... Date Added: 2009-06-16 17:53:29 |
| submit.txt Path: Washington >> V >> 11666 Fall, 2009 Description: executable = allgamma_11666.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11500-11999/11... Date Added: 2009-06-16 17:54:34 |
| LEC02.pdf Path: Texas A&M >> AGECON >> 652 Fall, 2009 Description: THE RICARDIAN MODEL PRODUCTION POSSIBILITIES WHEAT (mil. bu.) CORN (mil. bu.) US EU 250 200 1250 600 YIELDS (Productivity of Land) WHEAT ( bu/acre) CORN ( bu/acre) US EU 25 20 125 60 LAND USE COEFFICIENTS WHEAT (acres/bu) CORN (acre/bu) U... Date Added: 2009-06-16 17:54:44 |
| certificate.ppt Path: U. Houston >> CUIN >> 3111 Fall, 2008 Description: KindergartenDiploma CONGRATULATIONS! TrinityMartinez Youhavecompletedkindergartenat[childsschool] andareawardedthisdiplomainrecognitionofyouraccomplishments. Signature Date ... Date Added: 2009-06-16 17:56:29 |
| HW5s.pdf Path: Michigan State University >> ECE >> 313 Fall, 2008 Description: ... Date Added: 2009-06-16 17:56:42 |
| P232-Quiz13Info.pdf Path: Redlands >> PHYS >> 232 Fall, 2009 Description: Information for the Quiz on Ch. 13 Fundamental Concepts Equations you must know: (1) Electric field of a point charge (2) Relationship between electric field and electric force Other fundamental concepts: The Superposition Principle Retardation Speci... Date Added: 2009-06-16 17:56:49 |
| psy321_project_list2.pdf Path: CSU Northridge >> PSY >> 321 Fall, 2009 Description: PSY 321 Spring 2006 No. 1 Names Maya Watanabe Keila Mejia Sharon Roh Rachel Romo Ruth Vasquez Crystal Huscher Sheena Garrett Payman Raoofi Leah Brunk Matthew Romero Diana Escobedo Jessica Pruitt Reneau Trinidad Xochitl Ortega Oscar Magdaleno Michael ... Date Added: 2009-06-16 17:57:52 |
| week3_dead_time-level.xls Path: UT Chattanooga >> ENGR >> 329 Fall, 2009 Description: Time(sec) Input Value(%) Output(cm-H20) 0 20 0.88 0.01 20 0.18 0.02 20 0 0.03 20 0 0.04 20 0 0.05 20 0 0.06 20 0 0.07 20 0 0.08 20 0 0.09 20 0 0.1 20 0 0.11 20 0 0.12 20 0 0.13 20 0 0.14 20 0 0.15 20 0 0.16 20 0 0.17 20 0 0.18 20 0 0.19 20 0 0.2 20 0... Date Added: 2009-06-16 17:58:14 |
| RunProgram2b.doc Path: Chester >> CSC >> 142 Fall, 2009 Description: -jGRASP exec: java Assign2B enter one of the following commands: A >to print average test score F >to print a students score and grade M >to print the max score and student with that score L >to print all students (names scores and grades -from G... Date Added: 2009-06-16 17:59:47 |
| HWK Topics 12 -13 S2008.doc Path: SUNY Fredonia >> MA >> 200 Fall, 2009 Description: Name_ _1) a) b) c) d) e) _2) a) b) c) d) e) _3) a) b) c) d) e) _4) a) b) c) d) _5) What is a placebo? an experimental treatment a control treatment a parameter A lurking/confounding variable a statistic StatisticsHWK to be turned in for Chapters 12 ... Date Added: 2009-06-16 18:01:19 |
| spec_pc_bg.txt Path: Berkeley >> ASTRO >> 00295779 Fall, 2009 Description: # tmin tmax 0.0742110 92.7457 [ksec] ;instrument XRT ;exposure 35725.734 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.000000 0... Date Added: 2009-06-16 18:01:30 |
| eel4747_lab_exam_I_fall07.doc Path: FIU >> EEL >> 4747 Fall, 2009 Description: EEL 4747C Microcomputers - II Lab Exam I Name of the student: _ Panther ID: _ Date: 12th October 2007. You cannot use laptops, any sort of supporting material during the exam. Total Exam time 1Hr. 1. Write a program to move boe-bot forward for 3 s... Date Added: 2009-06-16 18:01:52 |
| Kikuchi(2003)J_ Biochem_133,263.pdf Path: E. Kentucky >> BIOL >> 750 Fall, 2009 Description: J. Biochem. 133, 263270 (2003) DOI: 10.1093/jb/mvg036 RNA Aptamers Targeted to Domain II of Hepatitis C Virus IRES That Bind to Its Apical Loop Region Kunio Kikuchi1,2, Takuya Umehara1,2, Kotaro Fukuda1, Joonsung Hwang1, Atsushi Kuno2, Tsunemi Haseg... Date Added: 2009-06-16 18:02:37 |
| l20.pdf Path: Sveriges lantbruksuniversitet >> CS >> 710 Fall, 2009 Description: CMPT 710 - Complexity Theory: Lecture 20 Valentine Kabanets November 15, 2007 1 MA AM Theorem 1. MA AM Proof. Let L MA be arbitrary. Let R(x, y, z) be a polytime relation for L, as in the denition of MA. By the previous section (on error reduct... Date Added: 2009-06-16 18:04:33 |
| Solution Combinations.xls Path: RIT >> P >> 08456 Fall, 2009 Description: Design Solution Matrix Option 1 Housing Cylindrical enclosure, draw latch w/ o-ring, size adjustable Ball pivot style, C-ring w/ o-ring Cylindrical enclosure, threaded end caps P08456 Mounting Hinge design, allowing 2 axis of motion Multiple ball jo... Date Added: 2009-06-16 18:07:04 |
| how you sense.pdf Path: Wisc Stevens Point >> JHUBB >> 452 Fall, 2009 Description: How You See When you look at something you are actually seeing beams of light bouncing off of the object and into your eyes. The light rays enter the eye through the cornea, which is a thick, transparent protective layer on the surface of your eye. T... Date Added: 2009-06-16 18:09:53 |
| Rationale.pdf Path: Wisc Stevens Point >> JHUBB >> 452 Fall, 2009 Description: Rationale Most students use transportation every day, and yet they rarely take time to think about it. Students do not usually appreciate and reflect on how they are getting to school and around town every day. Especially important, they do not thin... Date Added: 2009-06-16 18:09:58 |
| July 21st.ppt Path: Oregon State >> BA >> 516 Fall, 2009 Description: Dove: Redefining Beauty Copyright Houghton Mifflin Company. All rights reserved. 1|2 \"True Colors\" Commercial Super Bowl XL, February 5th, 2006- Dove debuts its True Colors commercial. This was the first ever Super Bowl ad that was primarily tar... Date Added: 2009-06-16 18:10:25 |
| q8sol.nb.pdf Path: Hudson VCC >> MATH >> 121 Fall, 2009 Description: Math 121 B Quiz # 8 Solutions 1) The easier order of integration is dx dy: m 4 4 y 0 4 y x2 y2 x y. In the order dy dx, it is necessary to split the region into two subregions: m 0 4 x2 2 0 x2 y2 y x 4 4 x 0 0 x2 y2 y x 2) The integral we... Date Added: 2009-06-16 18:11:29 |
| note08_fa07.ppt Path: Oklahoma State >> CS >> 2351 Fall, 2008 Description: CS2351 Unix Programming Lecture #8 Command Substitution So far, we have seen two ways of getting values into variables by assignment statements var=\"hello there\" by the user supplying them as command line arguments var=$1 In sh, csh, and ksh,... Date Added: 2009-06-16 18:11:46 |
| pcrCam_ptet_CFP_t7_r.txt Path: Illinois Tech >> IPRO >> 302 Fall, 2009 Description: CTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTC ATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGA GATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTC CAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACC CTAATC... Date Added: 2009-06-16 18:11:53 |
| hw5.ps Path: Caltech >> CDS >> 201 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86d Copyright 1999 Radical Eye Software %Title: hw5_2001.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMBX12 CMBX10 CMR10 CMMI10 MSBM10 CMR8 CMSY10 %+ CMMI8 CMEX10 CMSY8 CMCSC10 ... Date Added: 2009-06-16 18:14:32 |
| ph115bpp119th127.pdf Path: UCSB >> PH >> 115 Fall, 2009 Description: ... Date Added: 2009-06-16 18:16:15 |
| submit.txt Path: Washington >> V >> 26500 Fall, 2009 Description: executable = allgamma_26588.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5p8\\jobs26500-26999/... Date Added: 2009-06-16 18:19:58 |
| output.txt Path: Washington >> V >> 26500 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS8 - local directory - Volume in drive C has no label. Volume Serial Number is B020-E7D5 Directory of C:\\condor\\execute\\dir_516 12/26/2007 10:01 AM <DIR> . 12/26/2007 10:01 AM <DI... Date Added: 2009-06-16 18:21:11 |
| hw8_sols.ps Path: Texas >> PHY >> 389 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw8.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMR17 CMR12 CMBX12 CMTT12 CMMI12 MSBM10 CMSY10 CMMI8 %+ CMR8 CMSY8 CMEX10 CMR6 %Documen... Date Added: 2009-06-16 18:29:54 |
| lasso.pdf Path: Toledo >> CSC >> 2515 Fall, 2009 Description: 6Pd~qpSS(iWdyi~PitSqp5P}i~SEiTSPvPdhq( Stq EE6PqddqdY hPWPP2tWSqSPSqWptiS Tu P hPi dtdSdhbhd~qpSytdiithPiWSYi~Sit6yxPiWPi5PPxWvSxPT$pidYtxPiY ... Date Added: 2009-06-16 18:30:16 |
| Lec18_bohrmodel.ppt Path: Colorado >> PHYS >> 2170 Fall, 2008 Description: Bohr model of the atom Announcements: Problem solving sessions M3-5 and T3-5. Niels Bohr 1885 1965 http:/www.colorado.edu/physics/phys2170/ Physics 2170 Spring 2009 1 Summary of atomic energy levels 1) Electrons in atoms only found in specifi... Date Added: 2009-06-16 18:30:46 |
| A0272mi1_2_dem.txt Path: Washington University in St. Louis >> MER >> 0272 Fall, 2009 Description: The file A272_MI_1_at_Tetl_2dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0288562 2) Add -7.35833 The x & y scales are 0.030 mm / pixel. Maximum value for DEM,... Date Added: 2009-06-16 18:33:19 |
| 3.indIO.ps Path: Sveriges lantbruksuniversitet >> CS >> 760 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @ @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - 3.indIO %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 06/12/01 12:15:09 %BoundingBox: 14 13 581 829 %Pages: (atend) %PageO... Date Added: 2009-06-16 18:33:58 |
| lab_6_floodfreq.pdf Path: Santa Clara >> CENG >> 140 Fall, 2009 Description: Santa Clara University Department of Civil Engineering CENG 140 Water Resources Engineering Spring 2006 Flood Frequency Analysis Lab From the class web site download the spreadsheet guadalupe_peak_flow.xls which accompanies this assignment. This sp... Date Added: 2009-06-16 18:34:19 |
| inspiration.doc Path: N. Georgia >> KNHALL >> 3081 Fall, 2009 Description: Krystina Hall Inspiration Activity For my activity, my students are learning about rocks and minerals (3rd grade). So we will make a web about how to identify them and some differences. The middle will be labeled \"Earth\" because that is what rocks an... Date Added: 2009-06-16 18:40:23 |
| M&Ms Student Handout.doc Path: Purdue >> STAT >> 301 Fall, 2008 Description: Student Handout for MMs 1. Counts: Brown Plain Peanut Total 2 Yellow 3 Red 5 Blue 0 Orange 8 Green 4 Total 22 Overall total number of plain and peanut M&Ms counted: ... Date Added: 2009-06-16 18:40:27 |
| ch7notes.1.pdf Path: New Mexico >> PHYS >> 552 Fall, 2009 Description: ... Date Added: 2009-06-16 18:41:15 |
| need.pdf Path: Texas A&M >> MATH >> 647 Fall, 2008 Description: International Journal of Food Microbiology 64 (2001) 247260 www.elsevier.nl / locate / ijfoodmicro On the need for another type of predictive model in structured foods E.J. Dens, J.F. Van Impe* BioTeC-Bioprocess Technology and Control, Department of... Date Added: 2009-06-16 18:41:19 |
| Hw5_Sol_101A.pdf Path: UCLA >> C >> 101 Fall, 2009 Description: ... Date Added: 2009-06-16 18:42:22 |
| Group 6 Homework ch14.doc Path: VMI >> CH >> 132 Fall, 2009 Description: Group 6 Homework ch.14 2) What kind of reaction powers the sun? - Nuclear fusion reactions power the sun. 3) What was the principle fuel used in the United States before 1800? - The principle fuel used in the U.S before 1800 was the burning of wood.... Date Added: 2009-06-16 18:43:20 |
| typographyresults.xls Path: MNSU >> ENG >> 4682008 Fall, 2009 Description: Font#1:Baskerville 1(notatall) Count Cheap 44.4%(4) Cold 37.5%(3) Confident 0.0%(0) Dignified 12.5%(1) Elegant 55.6%(5) Feminine 50.0%(4) Formal 0.0%(0) Friendly 11.1%(1) Inviting 10.0%(1) 66.7%(6) Loud Masculine 37.5%(3) Playful 75.0%(6) Pretentiou... Date Added: 2009-06-16 18:44:50 |
| bus886out.doc Path: S.F. State >> BUS >> 886 Fall, 2008 Description: Spring 2003 AMBA-Cohort 3 BUS886: STATISTCS AND OPERATIONS ANALYSIS A. A. Elimam College of Business - San Francisco State University Professor: Dr. Abdelghani A. Elimam Office: BUS342 e-mail address: aelimam@sfsu.edu Phone: 415-338-2214(O) 925-94... Date Added: 2009-06-16 18:45:47 |
| 106_3_6_09.doc Path: Haverford >> PHYS >> 106 Fall, 2008 Description: ... Date Added: 2009-06-16 18:46:27 |
| T0327.t06.bys-logo.pdf Path: UCSC >> T >> 0327 Fall, 2009 Description: T0327.t06 bys 5 4 3 2 1 H X 1 10 20 30 40 H 5 4 3 2 1 T G E P H G P T E H G T P G Y E EE PP P PYHHEH G D C XXXXXXXX H H 51 60 70 80 90 H G P 5 4 3 2 1 G H E H S H P H G H P P X X G P 101 HH 100 HHHHHHHHHHHHHH YS DDR P... Date Added: 2009-06-16 18:47:09 |
| T0386.t04.n_sep-logo.pdf Path: UCSC >> T >> 0386 Fall, 2009 Description: T0386.t04 n_sep 6 5 4 3 2 1 D X 1 10 20 30 40 D 6 5 4 3 2 1 H D A D G H D H HHHHHHH G X X X HD GG BH X D D I D X X X X X 51 60 70 80 90 D 6 5 4 3 2 1 H D A D A D A D A D X A D 6 5 4 3 2 1 A D A D H D H D G D H HHHH... Date Added: 2009-06-16 18:49:36 |
| ComputerAssignment4.xls Path: Auburn >> FINC >> 3630 Summer, 2008 Description: FINC 3630 Computer Assignment 4 Email to Dr. Yost with the subject: FINC 3630 Computer Assignment #4 Due: Monday, June 22nd (emailed to Dr. Yost before Noon) *All work must be YOUR OWN. You may not share spreadsheets!* Modified Mini Case Chapter 13: ... Date Added: 2009-06-16 18:53:11 |
| b6m-423.pdf Path: Texas El Paso >> BIO >> 0608 Fall, 2009 Description: Bell Hall 100 747-5536 The University of Texas at El Paso El Paso, Texas 79968-0509 College of Science Bachelor of Science Degree Plan Microbiology - Psychology Minor (120/37) Name Major: Microbiology Department Chair: Dr. Robert Kirken Address Mi... Date Added: 2009-06-16 18:53:20 |
| group16firstdraft.doc Path: UCSD >> MAE >> 156 Fall, 2008 Description: Charpy Impact Tester Sponsor: Professor Marc Meyers Elissa Clemson, Damian Morales, Amanda Muller, & Andrew White MAE 156B- Fundamental Principles of Mechanical Design II University of California- San Diego Professor Jayson June 7, 2007 1 Abstrac... Date Added: 2009-06-16 18:54:52 |
| planthormones102.pdf Path: Bryn Mawr >> BIO >> 102 Fall, 2009 Description: ... Date Added: 2009-06-16 18:58:20 |
| M135HmkF03.pdf Path: CSU Chico >> M >> 135 Fall, 2009 Description: Math 135 Linear Algebra Homework Fall 2003 Text: Gil Strang Introduction to Linear Algebra 2nd Ed., Wellesley-Cambridge Press Homework is assigned for each week and will be due Friday of that same week. Only the bold underlined problems should be tu... Date Added: 2009-06-16 18:58:49 |
| GEM 09 NaturalPath.pdf Path: Stanford >> MSANDE >> 271 Fall, 2009 Description: Overview: NaturalPath Media, a three year old company based in San Francisco, is the largest online network for sustainable, healthy, and conscious lifestyles. NaturalPath Media delivers custom and targeted marketing campaigns through our network of ... Date Added: 2009-06-16 19:01:06 |
| modl.txt Path: Berkeley >> ASTRO >> 00151905 Fall, 2009 Description: chi^2/nu= 50.661984 / 52 The fit is rejectable at 47.338095 % Confidence 39.3650 43.8050 364.66259 43.8050 47.5050 405.41476 47.5050 49.7250 430.51070 49.7250 52.315... Date Added: 2009-06-16 19:02:26 |
| Enterprise Collaboration (6).ppt Path: Siena >> CSIS >> 114 Fall, 2009 Description: Enterprise Collaboration Systems Also Crossfunctional Systems include: crosses different functional business areas (accounting, finance, inventory management, human resources, etc.) Instant Messaging to Video Conferencing Lotus Notes (I... Date Added: 2009-06-16 19:02:35 |
| saf.ps Path: University of Illinois, Urbana Champaign >> MATH >> 0136 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.58 Copyright 1986, 1994 Radical Eye Software %Title: D:\\TEXWORK\\Saf\\SAF.dvi %CreationDate: Wed Sep 09 13:04:54 1998 %Pages: 34 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSCommandLine: C:\\tex\\EMTEX\\... Date Added: 2009-06-16 19:02:57 |
| handout.ps Path: Toledo >> CSC >> 363 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: handout.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -t letter handout.dvi -o h... Date Added: 2009-06-16 19:03:03 |
| Phys132 - Spring 2007 - HW7.pdf Path: Delaware State >> PHYS >> 132 Fall, 2009 Description: Phys 132 - Fund Phys 2 - Homework 7 Due Mon, Feb 12, 2007 Name: _ 1. How many electrons flow through a battery that delivers a current of 3.0 A for 12 s? a) 4 b) 36 c) 4.8 1015 d) 6.4 1018 e) 2.2 1020 2. The potential difference across the ends ... Date Added: 2009-06-16 19:04:20 |
| B8 ..pdf Path: Minnesota >> SMITH >> 097 Fall, 2009 Description: B 8. COMMUNITY DEVELOPMENT: ROSEVILLE EXAMPLE Over the years most people in this country became congregated in big metropolitan areas and numerous smaller cities & towns with fewer living on farms. These urban areas typically grew with too little rat... Date Added: 2009-06-16 19:05:07 |
| f05_wk03.ppt Path: NJIT >> PH >> 111 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>29eb03edf6b435dda2d0955931a64aaae529f61d.ppt</Key><RequestId>3 BE1AA68E43CBDD7</RequestId><HostId>v5BQOA+76QvYjOBqo/CulhI2gIz... Date Added: 2009-06-16 19:05:36 |
| wk08.ppt Path: NJIT >> PH >> 111 Fall, 2009 Description: Chapter 8: Potential Energy and Conservation of Energy Introduction Potential Energy and Conservation of Energy Conservative Forces Gravitational and Elastic Potential Energy Conservation of (Mechanical) Energy Potential Energy Curve External Forces... Date Added: 2009-06-16 19:05:38 |
| quiz6sol.pdf Path: Rutgers >> CS >> 101 Fall, 2009 Description: CS 101: Quiz #6, March 11, 2009, SOLUTION 1. Write a method called random100 that returns a random integer in the range of 1 to 100 inclusive. Solution: public int random100(){ return (int)(Math.random()*100) + 1; } ... Date Added: 2009-06-16 19:09:22 |
| Shlyakhtenko.ps Path: SUNY Albany >> V >> 177 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.58 Copyright 1986, 1994 Radical Eye Software %Title: Shlyakhtenko.hdvi %CreationDate: Mon Apr 28 21:45:19 1997 %Pages: 40 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -Papple -z S... Date Added: 2009-06-16 19:09:50 |
| Have we overcome the Challenges associated with.pdf Path: UNLV >> ECG >> 702 Fall, 2008 Description: Have we overcome the Challenges associated with SoC and Multi-Core Testing? Sankaran Menon Intel Corporation Abstract The advent of System-on-Chip (SoC) technology and integration of multiple cores on a single die has created a wide spectrum of new o... Date Added: 2009-06-16 19:12:27 |
| set9.ps Path: Michigan State University >> PHY >> 851 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.82 Copyright 1998 Radical Eye Software %Title: set9.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips set9 -o %DVIPSParameters: dpi... Date Added: 2009-06-16 19:13:09 |
| chap5.ps Path: Acton School of Business >> CAAM >> 378 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: book1.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR17 CMR12 CMBX12 CMSL12 CMMI12 CMTI12 CMR8 CMSY10 %+ CMMI8 CMEX10 CMSY8 CMMI6 CMR6 ... Date Added: 2009-06-16 19:13:23 |
| 99a0771_1.pdf Path: Wisconsin >> LAW >> 518 Fall, 2009 Description: 1999 2000 LEGISLATURE LRBa0771/1 PJK:jlg:km ASSEMBLY AMENDMENT 2, TO ASSEMBLY SUBSTITUTE AMENDMENT 1, TO 1999 ASSEMBLY BILL 518 October 25, 1999 Offered by Representative UNDERHEIM. 1 2 3 4 5 6 7 8 9 10 11 At the locations indicated, amend the... Date Added: 2009-06-16 19:15:54 |
| 99a0769_1.pdf Path: Wisconsin >> LAW >> 518 Fall, 2009 Description: 1999 2000 LEGISLATURE LRBa0769/1 RPN&PJK:wlj:km ASSEMBLY AMENDMENT 7, TO ASSEMBLY SUBSTITUTE AMENDMENT 1, TO 1999 ASSEMBLY BILL 518 October 26, 1999 Offered by Representative WASSERMAN. 1 2 3 4 5 6 7 8 9 10 11 12 At the locations indicated, am... Date Added: 2009-06-16 19:15:57 |
| chap8.pdf Path: Wyoming >> CS >> 4780 Fall, 2009 Description: 8 Libraries Every language comes with collections of programs that are reusable by the programmer, called libraries. The quality and diversity of these programs are often some of the criteria one uses to assess the ease of use of a language. You coul... Date Added: 2009-06-16 19:17:59 |
| Texaco.pdf Path: Johns Hopkins >> MTS >> 252 Fall, 2009 Description: ... Date Added: 2009-06-16 19:18:49 |
| Carbon_short version_05.ppt Path: Hudson VCC >> FOR >> 272 Fall, 2009 Description: Managing for Forest Carbon Storage Inter-governmental Panel on Climate Change Kyoto Protocol Reduce greenhouse gas emissions (CO2 and methane) to 5% below 1990 levels by 2008 Forestry: Can offset emissions by sequestering carbon Only applies to... Date Added: 2009-06-16 19:19:27 |
| Spinward_Marches.pdf Path: Columbia >> MBK >> 2109 Fall, 2009 Description: \"Imagination will often carry us to worlds that never were. But without it we go nowhere.\" - Carl Sagan MK 531 Remote Survey Data: Spinward Marches TRAVELLER Science-Fiction Adventure in the Far Future TableofContents ABOUT THE REMOTE SURVEY In... Date Added: 2009-06-16 19:22:01 |
| Endothelial activation.pdf Path: MIT >> HST >> 527 Fall, 2009 Description: Available online http:/arthritis-research.com/content/4/S3/S109 Supplement Review Endothelial activation: intracellular signaling pathways Jordan S Pober Yale University School of Medicine, Boyer Center for Molecular Medicine, New Haven, CT, USA C... Date Added: 2009-06-16 19:23:14 |
| acetC5_gpa770.pdf Path: Stetson >> GPA >> 770 Fall, 2009 Description: CONTENU DU COURS ISE EN CONTEXTE ONCEPTS LOGICIELS PROGRAMMATION EN ASSEMBLEUR ET EN ONCEPTS ATRIELS COMPOSANTS D UN MICROCONTRLEUR INTRA FINAL Universit du Qubec cole de technologie suprieure GPA770: Microlectronique applique ric Granger C.... Date Added: 2009-06-16 19:23:21 |
| portersm07final Path: UT Dallas >> BUSINESS >> 4444 Spring, 2009 Description: CHAPTER 7 Investments and Receivables OVERVIEW OF EXERCISES, PROBLEMS, AND CASES Learning Outcomes Exercises Estimated Time in Minutes Level 1. Show that you understand the accounting and disclosure of various types of investments companies make. 2.... Date Added: 2009-06-16 19:24:48 |
| idec_require.txt Path: UMass (Amherst) >> ECE >> 659 Fall, 2009 Description: bdpol 0 cwe 0 zwe 0 fwe 0 wwe 0 ... Date Added: 2009-06-16 19:26:31 |
| BQM FINAL EXAM.xls Path: Uni. Westminster >> AKS >> 0605 Fall, 2009 Description: Gender: 1=Female Age 0 0 0 0 1 0 1 1 1 0 0 0 0 0 0 0 0 0 1 1 1 0 0 0 0 0 0 1 1 1 0 1 0 1 1 0 0 0 0 1 0 0 0 0 1 1 1 0 0 0 0 0 57 57 47 36 30 38 47 36 45 42 46 56 63 51 50 52 59 46 44 40 46 59 49 48 32 40 41 45 35 32 35 32 34 53 44 29 63 57 53 53 48 4... Date Added: 2009-06-16 19:27:57 |
| cell_secretions.pdf Path: OKCU >> BIOL >> 3403 Fall, 2009 Description: BIOL 3403 Feb. 23, 2001 Cell Secretions Reading: pp. 273-282 and the following Scientific American article: -Welsh and Smith, \"Cystic fibrosis.\" Scientific American, Dec. 1995 -available online at http:/www.people.virginia.edu/~rjh9u/cfsciam.html Rev... Date Added: 2009-06-16 19:28:37 |
| social.rtf Path: Wisconsin >> EDPSYCH >> 301 Fall, 2009 Description: Social Constructivist Perspectives on Teaching & Learning n n Research context of social constructivism Mechanisms accounting for learning n n n Analyses of social constructivism n n n Sociocognitive conflict theory of Piaget Sociocultural theory... Date Added: 2009-06-16 19:30:23 |
| r-solution9.pdf Path: GCSU >> MATH >> 1261 Fall, 2008 Description: Math 1261: Calculus I Reading Quiz 9 Solutions Name: Brown 1. (2 pts) Give an example of a function f that has a local minimum at 0, but whose derivative is never 0. Solution. f (x) = |x| 2. (2 pts) Use calculus to nd the exact absolute maximum a... Date Added: 2009-06-16 19:31:54 |
| Catullus7.pdf Path: Haverford >> LAT >> 101 Fall, 2009 Description: INTRODUCTION TO LATIN Catullus 7 Meter: hendecasyllabic [Phalaecean]: x x uu u u x Quaeris, quot mihi basiationes tuae, Lesbia, sint satis superque. quam magnus numerus Libyssae harenae lasarpiciferis iacet Cyrenis oraclum Iovis inter aestuosi ... Date Added: 2009-06-16 19:33:47 |
| worldpop.xls Path: CofC >> EVSS >> 650 Fall, 2008 Description: rank Country 0 World 1 China 2 India 3 United States of America 4 Indonesia 5 Brazil 6 Pakistan 7 Bangladesh 8 Russia 9 Nigeria 10 Japan 11 Mexico 12 Philippines 13 Vietnam 14 Germany 15 Egypt 16 Ethiopia 17 Turkey 18 Congo, Dem. Rep. of the 19 Iran ... Date Added: 2009-06-16 19:37:13 |
| Sorting.ppt Path: Eastern Washington University >> CSCD >> 326 Fall, 2009 Description: CSCD 326 Data Structures I Sorting 1 Quicksort Overview Arecursivesortingalgorithmwhichdivides anarrayintotwosmallerpartitions. Allsmallelementsinonepartitionandlarge elementsinanother Callsitselfrecursivelywitheachpartitiona divideandconqueralgori... Date Added: 2009-06-16 19:42:43 |
| BenchKth.txt Path: Eastern Washington University >> CSCD >> 326 Fall, 2009 Description: public class BenchKth { static java.util.Random generator = new java.util.Random(); static java.util.Scanner console = new java.util.Scanner(System.in); /* * Driving main to exercise the quick sort algorithms */ public static void main ( ... Date Added: 2009-06-16 19:42:45 |
| Steps for Finding a Junction Diode Circuit Transfer Functi….pdf Path: E. Kentucky >> ITTC >> 312 Fall, 2009 Description: 9/24/2004 Steps for Finding a Junction Diode Circuit Transfer Function.doc 1/9 Steps for Finding a Junction Diode Circuit Transfer Function Determining the transfer function of a junction diode circuit is in many ways very similar to the analysis ... Date Added: 2009-06-16 19:43:35 |
| ass12.pdf Path: UWO >> MATH >> 302 Spring, 2008 Description: Mathematics 302A, 2005 Assignment 12, due at class time, Friday, November 11 Read the handout to determine the complete statement of the classification theorem for finite abelian groups. 1. Find, up to isomorphism, all finite abelian groups of order ... Date Added: 2009-06-16 19:52:36 |
| nrinv_CA2003_aut_120403.ida.txt Path: UC Riverside >> BASE >> 308 Fall, 2009 Description: #IDA #TYPE Area Source Emission Inventory #COUNTRY US #YEAR 2003 #DESC CA only, Extracted from WRAP2003, see below (MO 06/14/05) #DESC WRAP States 2003 NONROAD Emissions version 2 (no shipping) #DESC Moved aircraft and locomotive SCC\'s (2285002005 22... Date Added: 2009-06-16 19:53:03 |
| Rubric for Debate.pdf Path: Wisc Stevens Point >> PHURT >> 042 Fall, 2009 Description: Rubric for Debate Category Respect for team members 4 Students listen to each other while talking. Students wait for others to finish and act in a very professional and respectful way. Information is supported and always cited. Information is clearly... Date Added: 2009-06-16 19:55:06 |
| Notes10.pdf Path: UCSD >> MATH >> 140 Fall, 1998 Description: Math 140a, Winter 2007 Notes and suggested reading for Week 10 . Reading from Rudin for Week 10: p. 8993 (up to connectedness) Notes: Sections 4.2.2 and 9.3.2 in Strichartz will be useful! 1 ... Date Added: 2009-06-16 19:57:08 |
| 06.ppt Path: NSULA >> IFT >> 17584 Fall, 2009 Description: IFT-17584 Semaine 06 Programmation systme @Pierre Marchand et Martin Dubois, 2002 1 Plan de la rencontre Retour sur la semaine prcdente Programmation SIMD Programmation SIMD2 Mmoire virtuelle @Pierre Marchand et Martin Dubois, 2002 2 Retou... Date Added: 2009-06-16 19:57:40 |
| slides1718bw.pdf Path: UVA >> ECON >> 419 Fall, 2008 Description: Introduction General Electric and Honeywell proposed to merge in 2000 GE supplies jet engines for commercial aircraft Honeywell produced various electrical and other control systems for jet aircraft Deal was approved in the US But was blocked by... Date Added: 2009-06-16 19:59:35 |
| WS48.pdf Path: Webster FL >> EDTC >> 5560 Fall, 2009 Description: WS 4.8 molecule Molecular Geometry Lewis structure e- regions on central atom egeometry molecular geometry P or NP polarity CH2 S H2 O 2 NF3 CCl4 . O3 . . O-O=O . . SO2 H3 O + HF ... Date Added: 2009-06-16 20:01:47 |
| davis-131a-second-mid-term2[1].pdf Path: UC Davis >> STA >> 131 Fall, 2008 Description: Prof. P. Hall Stat 131A Midterm II Spring 2008 Name: Answer ALL of the following questions. Show all your work. Partial credit can only be given if your thoughts can be followed. 1. (a) (8 points) Let A and B denote two events, both subsets of th... Date Added: 2009-06-16 20:08:31 |
| index.pdf Path: Temple >> C >> 073 Fall, 2009 Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Spring 2007 Course Syllabus Course: Mathematics C073.007. Course Title: Math CO73 College Algebra. Time: TR 10:10-12:00. Place: AC 00007. Instructor: Isaak Pesenson. Inst... Date Added: 2009-06-16 20:09:15 |
| Energy intensities.xls Path: University of Illinois, Urbana Champaign >> UP >> 446 Spring, 2008 Description: CATEGORIES Highly Aggregated Categories Average Energy Intensity (all categories) Average Intensity of Direct Energy Average Intensity of Indirect Energy Average Intensity of Sprawl-related Energy Average Intensity of Non-sprawl BLS Expenditure Categ... Date Added: 2009-06-16 20:12:33 |
| evaluation.rtf Path: Allegheny >> FS >> 101 Fall, 1931 Description: Individual Participation Description FS 101 Teaching and Learning Please complete this form for each member of your group, including yourself. Responses should be typeset using this form as a base. Responses are due at the beginning of the class pe... Date Added: 2009-06-16 20:18:58 |
| CS 540A Spring 08go Orientation.doc Path: Stevens >> CS >> 540 Fall, 2009 Description: CS 540 Spring 2008 CS 540: Fundamentals of Quantitative Software Engineering (Issue 1/08) CS 540A Fundamentals of QSE I Call #: Instructor: Ogden, G. D. 11221 Credits: 3.00 - 3.00 Session: Normal Academic Term 01/16/2008-05/12/2008 Enrollment Cap: 0... Date Added: 2009-06-16 20:19:19 |
| Presentation4.ppt Path: RIT >> TEAM >> 730 Fall, 2009 Description: Programming Languages in Distributed Systems Team CAR Chris Dunnigan Andre Joseph Rasika Joshi Agenda Review of Project Statement Accomplishments Software Developed Demonstrations Investigation Results Future Work X10 MC# ... Date Added: 2009-06-16 20:19:51 |
| Environmental Correlates of Physical Activity.ppt Path: Texas A&M >> KINE >> 304 Fall, 2008 Description: Environmental Correlates of Physical Activity Information adapted from: Carron, A. V., Hausenblas, H. A., & Estabrooks, P. A. (2003). The psychology of physical activity. New York: McGraw Hill. Fundamentals Delayed gratification Experimental r... Date Added: 2009-06-16 20:19:57 |
| lab6_drgs.doc Path: University of Alaska Fairbanks >> NRM >> 338 Fall, 2009 Description: NRM338 Fall 2004 Lab#6 Page#1 Digital Raster Graphics: Scanned Maps In this lab, you will learn how to: Use the Image Analysis extension and Spatial Analyst extension to: clip away white space outside map collars mosaic together your Fairbanks D... Date Added: 2009-06-16 20:20:37 |
| system_ucf1.txt Path: New Mexico >> ECE >> 344 Fall, 2009 Description: # # This system.ucf file is generated by Base System Builder based on the # settings in the selected Xilinx Board Definition file. Please add other # user constraints to this file based on customer design specifications. # Net sys_clk_pin LOC=AE14; ... Date Added: 2009-06-16 20:21:39 |
| cordicvhdl.txt Path: New Mexico >> ECE >> 438 Fall, 2008 Description: library IEEE; use IEEE.STD_LOGIC_1164.all; use IEEE.STD_LOGIC_UNSIGNED.all; entity CORDIC is port ( SYS_CLK_H : in STD_LOGIC; SYS_RST_H : in STD_LOGIC; IN_VALUE : in STD_LOGIC_VECTOR ( 15 downto 0 ); IN_VALID : in STD_LOGIC; ... Date Added: 2009-06-16 20:21:46 |
| cordicdemo.txt Path: New Mexico >> ECE >> 438 Fall, 2008 Description: library IEEE; use IEEE.STD_LOGIC_1164.all; use IEEE.STD_LOGIC_UNSIGNED.all; entity CORDIC is port ( SYS_CLK_H : in STD_LOGIC; SYS_RST_H : in STD_LOGIC; IN_VALUE : in STD_LOGIC_VECTOR ( 15 downto 0 ); IN_VALID : in STD_LOGIC; ... Date Added: 2009-06-16 20:21:46 |
| cordic.txt Path: New Mexico >> ECE >> 443 Fall, 2008 Description: library IEEE; use IEEE.STD_LOGIC_1164.all; use IEEE.STD_LOGIC_UNSIGNED.all; entity CORDIC is port ( SYS_CLK_H : in STD_LOGIC; SYS_RST_H : in STD_LOGIC; IN_VALUE : in STD_LOGIC_VECTOR ( 15 downto 0 ); IN_VALID : in STD_LOGIC; ... Date Added: 2009-06-16 20:21:59 |
| tb_std.txt Path: New Mexico >> ECE >> 443 Fall, 2008 Description: library IEEE; use IEEE.STD_LOGIC_1164.all; use IEEE.STD_LOGIC_TEXTIO.all; use STD.TEXTIO.all; entity TBSTD is end entity TBSTD; architecture TBSTD of TBSTD is component STD_LOGIC_VERSION is port ( SYS_RST_H : in STD_LOGIC; SYS_CLK_H : ... Date Added: 2009-06-16 20:22:01 |
| nand2.txt Path: New Mexico >> ECE >> 443 Fall, 2008 Description: library IEEE; use IEEE.STD_LOGIC_1164.all; entity NAND2 is generic ( DLY : TIME := 3 ns ); port ( A : in STD_LOGIC; B : in STD_LOGIC; F : out STD_LOGIC ); end entity NAND2; architecture EQUATION of NAND2 is begin F <= ... Date Added: 2009-06-16 20:22:14 |
| MT3_4.pdf Path: CSU Northridge >> M >> 24771 Fall, 2009 Description: Math 102 1. For f(x) = x2 + 2x 5, ) TEST CHAPTERS 3 Comments find Fall 2006 10 f(x+h) f(x) = h = = = f(x+h) f(x) ) and simplify completely. h NOTE: *f(x+h) is NOT f(x)+h ! (x+h)2 + 2(x+h) 5 - ( x2 + 2x 5 ) f(x+h) is NOT f(x)... Date Added: 2009-06-16 20:27:05 |
| slides13.pdf Path: Washington University in St. Louis >> ECON >> 402 Fall, 2009 Description: Class 13 Econ 402 James Morley Class 13 Outline More on the Natural Rate of Unemployment Job Flows and the NRU in Excel Estimating the NRU and its Sources (King and Morley, 2007) Shapiro-Stiglitz Model of Efciency Wages Policy and the Natural Rate ... Date Added: 2009-06-16 20:28:10 |
| User Task List.doc Path: Clayton >> CSU >> 11170 Fall, 2009 Description: User Task List Create a frameset with two columns Ensure that every page is set up to display in the display frame of the frame set. All the images should be put in an images folder. Insure that all links and images have proper reference links. ... Date Added: 2009-06-16 20:28:28 |
| Field Experience Eval.pdf Path: Wisc Stevens Point >> MLEGN >> 632 Fall, 2009 Description: ... Date Added: 2009-06-16 20:31:38 |
| AdaptaiveReflection.pdf Path: Wisc Stevens Point >> MLEGN >> 632 Fall, 2009 Description: Adaptive Reflection As a future teacher, I will be responsible for incorporating students with disabilities into my general education classroom. As a result, I think it is important to understand the laws that are specific to educating students with ... Date Added: 2009-06-16 20:31:39 |
| jewelrysales.doc Path: UMKC >> BDS >> 545 Fall, 2008 Description: 1992 01 803. 1992 02 1030. 1992 03 922. 1992 04 977. 1992 05 1182. 1992 06 1104. 1992 07 1046. 1992 08 1100. 1992 09 1043. 1992 10 1132. 1992 11 1376. 1992 12 3469. 1993 01 802. 1993 02 1002. 1993 03 902. 1993 04 1007. 1993 05 1246. 1993 06 1270. 199... Date Added: 2009-06-16 20:33:43 |
| Ch05MID01b.doc Path: UMKC >> BDS >> 545 Fall, 2008 Description: Why is it important to deseasonalize a time series before fitting a trend of the time series? 5.4 Deseasonalization of a time series is essential before fitting a trend line because it is necessary to identify the movements in trend over time. In oth... Date Added: 2009-06-16 20:34:06 |
| notes_Chapter_03_Large.pdf Path: Washington >> CHEM >> 142 Fall, 2008 Description: Chapter 3 - Stoichiometry 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 Atomic Masses The Mole Molar Mass Percent Composition of Compounds Determining the Formula of a Compound Chemical Equations Balancing Chemical equations Stoichiometric Calculations: Amounts of... Date Added: 2009-06-16 20:34:37 |
| worksheet28.pdf Path: Kentucky >> MA >> 113 Fall, 2008 Description: MA 113.016 MathExcel Worksheet 28 November 9, 2005 4 3 1. Compute i=1 5 j=1 (i + j) . 2. Evaluate i=1 i f (wi )x if f (x) = 3x, wi = 5 , n and x = 1 . 5 3. Find the number n such that i=1 i = 78. 4. Find the limits: n (a) lim n i=1 n 3... Date Added: 2009-06-16 20:34:57 |
| lect18_design_for_low_power.ppt Path: Mississippi State >> ECE >> 4263 Fall, 2009 Description: Introduction to CMOS VLSI Design Lecture 18: Design for Low Power David Harris Harvey Mudd College Spring 2004 Outline Power and Energy Dynamic Power Static Power Low Power Design 18: Design for Low Power CMOS VLSI Design Slide 2 Power and... Date Added: 2009-06-16 20:35:05 |
| R113713_SSU_0209_equipment list.xls Path: Maryland >> R >> 113713 Fall, 2009 Description: College of Behavioral and Social Sciences Office of Academic Computing Services Lefrak Lab A/V System Overhaul Rooms 0214, 0225, 0229, 0231 University of Maryland, College Park RFQR113713_SSU_0209 LOCATION: BLDG ROOM DATES: START END Stamp Student U... Date Added: 2009-06-16 20:38:04 |
| PankoCh7.ppt Path: CSU Sacramento >> MIS >> 214 Fall, 2009 Description: Small Ethernet LANs Chapter 7 Copyright 2001 Prentice Hall Revision 2: July 2001 Ethernet s 2 The Most Popular LAN Technology Carries perhaps 80% of all LAN traffic Created at the Xerox Palo Alto Research Center (PARC) Initially standardized by D... Date Added: 2009-06-16 20:38:52 |
| Inet-Ch10.ppt Path: CSU Sacramento >> MIS >> 140 Fall, 2009 Description: Chapter 10 Network Security Networking in the Internet Age by Alan Dennis 1 Copyright 2002 John Wiley Sons, Inc. All rights reserved. Reproduction or translation of this work beyond that named in Secti... Date Added: 2009-06-16 20:38:58 |
| prob3_6.pdf Path: UVA >> PHYS >> 521 Fall, 2008 Description: ... Date Added: 2009-06-16 20:44:24 |
| new.doc Path: Virginia Tech >> CS >> 4984 Fall, 2008 Description: 298 F.3d 1290 63 U.S.P.Q.2d 1843 (Cite as: 298 F.3d 1290) Page 1 United States Court of Appeals, Federal Circuit. NEW RAILHEAD MANUFACTURING, L.L.C., Plaintiff-Appellant, v. VERMEER MANUFACTURING COMPANY and Earth Tool Company, L.L.C., DefendantsAp... Date Added: 2009-06-16 20:44:51 |
| solutions_final_2007.pdf Path: UVA >> PHYS >> 521 Fall, 2008 Description: ... Date Added: 2009-06-16 20:45:11 |
| mar_08_04.pdf Path: Wisconsin >> CHEM >> 562 Fall, 2008 Description: ... Date Added: 2009-06-16 20:46:20 |
| Bio1100Ch10W.ppt Path: N.E. Illinois >> BIO >> 1100 Fall, 2009 Description: CHAPTER 10 PHOTOSYNTHESIS 1. Plants and other _ are the producers of the biosphere Photosynthesis nourishes almost all of the living world directly or indirectly. _ produce their organic molecules from _ and other __ raw materials are the ultima... Date Added: 2009-06-16 20:48:06 |
| Ass#10.pdf Path: Hudson VCC >> MATH >> 019 Fall, 2009 Description: Assignment 10 (1 Point) Chapter 5 Name_ Directions: Read each question carefully and answer as clearly as possible. DUE DATE: End of Class on December 11, 2008 Fall 2008 Math 19 Come to class on Thursday December 11, 2008. ... Date Added: 2009-06-16 20:51:20 |
| lab10_f03.doc Path: Michigan >> ED >> 793 Fall, 2009 Description: ED 793 LAB #10 Multiple Regression: Determining how well a model fits the data and how well each independent variable in the model predicts the dependent variable. MULTIPLE REGRESSION Assumptions: 1. Independence Scores for any subject are indepen... Date Added: 2009-06-16 20:53:04 |
| 04-out.txt Path: Hudson VCC >> FOR >> 121 Fall, 2009 Description: MATRIX OF RELATIVE IMPORTANCE VALUES COMMUNITY SPECIES 1 2 3 4 5 6 7 8 9 ... Date Added: 2009-06-16 20:55:01 |
| HealthSci.PT835.2.25.03.pdf Path: Kentucky >> USC >> 40203 Fall, 2009 Description: UNIVERSITY OF KENTUCKY Office of the Chancellor Albert B. Chandler Medical Center AJ01 Kentucky Clinic Lexington, KY 40536-0284 (859) 323-5126 Fax: (859) 323-1918 February 28, 2003 www.uky.edu Jeffrey B. Dembo, D.D.S., Chair University Senate Coun... Date Added: 2009-06-16 20:55:58 |
| hw1.ps Path: W. Alabama >> CO >> 781 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw1.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hw1.dvi -o %DVIPSParameters: d... Date Added: 2009-06-16 20:58:04 |
| Reference.doc Path: SMU - Cox School of Business >> ENGR >> 8381 Spring, 2009 Description: Links: http:/svmlight.joachims.org/ http:/www.research.microsoft.com/%7Ejplatt/ Books: 1. \"Support Vector Machines\" by Cristianini and Shawe-Taylor (Strongly recommended for SVM) 2. \"Nonlinear Programming\", 2nd Edition, by Berksekas 3. \"The Mathemati... Date Added: 2009-06-16 20:58:58 |
| NLP4.3.pdf Path: SMU - Cox School of Business >> ENGR >> 8381 Spring, 2009 Description: ... Date Added: 2009-06-16 20:59:00 |
| Turning Points.doc Path: Penn State >> JBG >> 165 Fall, 2009 Description: Turning Points When I stepped on the campus of Wittenberg University as a New Student, I was fully confident that I would get my degree in History and Secondary Education. Becoming a high school teacher felt like such an admirable and fulfilling care... Date Added: 2009-06-16 20:59:46 |
| t9sol.pdf Path: Allan Hancock College >> COMP >> 4403 Fall, 2009 Description: COMP4403/7402 Compilers & Interpreters (2009/1) Sample Solution to Tutorial Exercise 9 School of Information Technology and Electrical Engineering, University of Queensland May 18, 2009 For these questions assume the classes SymTab and Type have been... Date Added: 2009-06-16 21:03:37 |
| Jan 24 07 lecture.pdf Path: UCLA >> CHEM >> 171 Fall, 2008 Description: ... Date Added: 2009-06-16 21:03:53 |
| FRWS6400_Lec6_StochasticExpoGrowth.xls Path: Oregon State >> FRWS >> 6400 Fall, 2009 Description: Demographic Stochasticity in Birth Process Only discuss convergence problems N0 10 b 0.11 How to model demographic stochasticity Number born Pr(B=b) Pr(B<=b) critbinom 0 0.312 0.312 0 1 0.385 0.697 1 2 0.214 0.912 2 3 0.071 0.982 3 4 0.015 0.997 4 5 ... Date Added: 2009-06-16 21:05:36 |
| sn1998bw_1998_06_24.ps Path: Southern Oregon >> D >> 1990 Fall, 2009 Description: ... Date Added: 2009-06-16 21:06:15 |
| jan14.ppt Path: Iowa State >> ECE >> 308 Fall, 2009 Description: Review of Previous Class Two definitions of an operating system Provides easy interface to hardware Resource manager 1 Does this belong in the OS? Device driver (program which controls a hardware device) Text editor Compiler Web browser She... Date Added: 2009-06-16 21:08:23 |
| Quiz11.pdf Path: Michigan >> ECE >> 460 Fall, 2009 Description: ... Date Added: 2009-06-16 21:10:00 |
| 0273685988_sol_ch07-app8.xls Path: FIU >> EIN >> 5359 Fall, 2008 Description: a. Sustainable Growth Rate: Shareholders\' equity Sales Target ratios: Assets to sales Net profit margin Debt to equity Earnings retention SGR = 18.69% $40,000,000 $150,000,000 0.40 0.07 0.50 0.60 b. Sustainable Growth Rate: Shareholders\' equity Sale... Date Added: 2009-06-16 21:10:57 |
| j101deshoo.pdf Path: Western Washington >> J >> 101 Fall, 2009 Description: JAPN 101 Lesson 8 4. Constructions that Require the Dictionary Form 4.1. Different Short forms Affirmative Non-past 1. Dictionary form3 [L8] write Past 3. form [L10] wrote Negative 2. form [L9] do not write 4. form didnt write (L10) 4.2. Dicti... Date Added: 2009-06-16 21:15:31 |
| NSLP Community Nutrition.pdf Path: Iowa State >> FSHN >> 463 Fall, 2009 Description: 10/20/2008 USDA Child Nutrition Programs National School Lunch Program Provides nutritionally balanced lunches to children each school day in more than 101,000 public and nonprofit private schools and residential institutions to 30.5 million studen... Date Added: 2009-06-16 21:16:18 |
| Acids [Compatibility Mode].pdf Path: Laurentian >> CHEM >> 200803 Fall, 2009 Description: Chemical Reactions and Reaction Mechanisms Reaction Mechanisms An elementary process. describes on a microscopic particle basis, what is occuring during a chemical reaction reaction. H N C H Molecularity. H C Cl N C H C H H Cl The molecularity of an... Date Added: 2009-06-16 21:16:31 |
| T5-EX-E9D.xls Path: Oregon >> CIT >> 281 Fall, 2008 Description: ABC Company Birth Date Employment Date 2-Feb-70 3-Aug-06 Ned Terrain ... Date Added: 2009-06-16 21:16:59 |
| lab6_f01.pdf Path: UF >> MIL >> 3701 Fall, 2009 Description: University of Florida Department of Electrical & Computer Engineering EEL 3701- Fall 2001 Revision 0 Drs. Gugel and Schwartz Professors in ECE 16-Oct-01-8:13 AM Page 1/1 LAB 6: Traffic-Light Controllers, an Example State Machine OBJECTIVES To des... Date Added: 2009-06-16 21:18:59 |
| PuppetReview.pdf Path: Wisc Stevens Point >> AZEID >> 365 Fall, 2009 Description: Puppet Review Need: A puppet (don\'t need to know ventriloquism to use one) Goal: Have the students tell the puppet what they have been learning in a subject. Procedure: I first start by introducing the puppet and saying that the puppet has h... Date Added: 2009-06-16 21:21:13 |
| Prototypes and categories 2.ppt Path: Acton School of Business >> SEMANTICS >> 315 Fall, 2009 Description: Polysemy How many senses does a word have? Last time. We considered some problems the prototype theory had. The first one was to connect the notion of `central member\' of a lexical category to the concept of a basic level term Rosch... Date Added: 2009-06-16 21:24:54 |
| sta.pdf Path: VCU >> PDFS >> 20033 Fall, 2009 Description: VCU Schedule of Classes 71 Division of Student Affairs Cooperative Education COOP 298 COOP EDUCATIONAL EXPERIENCE (0) 11415 001 MELTON, C MTWRF FEE REQUIRED - SEE FEE TABLE IN FRONT OF BOOK PERMISSION OF INSTRUCTOR REQUIRED CONTACT DEPT. ABOUT ROOM... Date Added: 2009-06-16 21:25:15 |
| Exam 2.doc Path: Christendom >> ACCT >> 420 Fall, 2009 Description: Dominican University Department of Accounting Accounting 420 Mr. Pollastrini Exam II Fall, 2007 Problem I II III IV Total Possible Points 60 10 10 _20 100 Name_ _Solution_ Actual Points I. The Black Company is a merchandiser that carries on much o... Date Added: 2009-06-16 21:25:37 |
| grades07.xls Path: Uni. Westminster >> ACC >> 1105 Fall, 2009 Description: GRADES FOR SPRING 2007 Marketing points possible points earned 100 1 15 15 2 15 12 3 20 20 4 15 15 5 22 22 6 30 30 7 20 17 Short Quizzes 50 1 10 9 2 10 10 3 10 7 4 10 7 5 10 8 6 10 9 Midterm 100 79 Indv. Marketing project 100 73 Final 100 90 497 423 ... Date Added: 2009-06-16 21:25:42 |
| assignmentsList.xlsx Path: Benjamin Franklin Institute of Technology >> BUS >> 1601 Fall, 2009 Description: exercise Office2007 keyword 1 Basics submit to due date 1/25/2008 file DDB versions flyer.htm 2 Word 1 1/25/2008 3 Word 2 4 5 6 7 resume.do BUS1601 c folder exercise3. htm Web folder create BUS1601 BUS1601 ... Date Added: 2009-06-16 21:27:11 |
| finalexamAS 05.xls Path: Washington >> PBAF >> 527 Fall, 2009 Description: c Teaching Institute Teachers Teacher Characteristics Had supervised student teaching of 10 or more weeks Had supervised student teaching of 1 or more weeks Has Master\'s or BA in Education Has BA from competitive College (based on college rankings) ... Date Added: 2009-06-16 21:27:20 |
| YDL171C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YDL >> 171 Fall, 2009 Description: EEE X X X EESC EC TSES S C CXCCECCCSHX G G X X TTT X 451 460 470 480 490 T 3 2 1 C H X X E H T H H H C H C C H H C C H S C H H C T T HTTT C H T S S T T T S G S T S S G X X X X X X X X X XXXXXXXXXXXXXX C HH HHHHHHHHTTC H S H 501 510... Date Added: 2009-06-16 21:27:32 |
| ecs150_S2009_L004.ppt Path: UC Davis >> ECS >> 150 Fall, 2008 Description: U CDavi s, ecs150 Fal l 2007 : Operating System ecs150 Spr i ng 2009 #4: M emor y M anagement (chapter 5) Dr. S. Felix Wu Computer Science Department University of California, Davis http:/www.cs.ucdavis.edu/~wu/ sfelixwu@gmail.com 05/21/2009 ecs150... Date Added: 2009-06-16 21:32:11 |
| Wrapper.doc Path: Virginia Tech >> CS >> 2704 Summer, 2002 Description: CS 2704 Homework Assignment 2 Fall 1999 The code outlined below shows how a class named Wrapper implements its Apply() method by using an association with an object of a class Inner: class Inner { private: / private data public: / other member func... Date Added: 2009-06-16 21:32:36 |
| Folate.ppt Path: Wesleyan >> BIOL >> 514 Spring, 2009 Description: Campbell RK Pediatrics 2001 Oct;108(4):1048-50 The unnecessary epidemic of folic acid-preventable spina bifida and anencephaly. Rydlewicz A, Simpson JA, Taylor RJ, Bond CM, Golden MH. QJM 2002 Jan;95(1):27-35 The effect of folic acid supplementation... Date Added: 2009-06-16 21:33:15 |
| 00-ClassIntro.4p.pdf Path: UCSC >> CMPE >> 220 Fall, 2008 Description: Thu Nov 20 19:02:19 PST 2008 Thu Nov 20 19:02:19 PST 2008 <> <> ... Date Added: 2009-06-16 21:33:18 |
| 04-Kestrel2.1p.pdf Path: UCSC >> CMPE >> 220 Fall, 2008 Description: ... Date Added: 2009-06-16 21:33:19 |
| Discussion5Solns.pdf Path: Berkeley >> MEC >> 124 Fall, 2009 Description: -P\'. bhr^L g= Cr\" +g)^* Ct -diJalrz F.Tg,-n^)\'t \' n, , f! =e =o = {t* = 6t,/L @) .t) Uvpqf-L ! rrao1ac ?,r\"* s/,.q,- C i- o, $o-sirr-) f*-x.: A, Q =-Q 2 Q 4, n\'. F=f, Lur,\"+q4o*nJ rlt oi ?) Or : sz: Ez = t: 2- 3 / Tz*L-tt Ft - nC , fa - ... Date Added: 2009-06-16 21:34:15 |
| Lect 1.pdf Path: Toledo >> BIO >> 403 Fall, 2009 Description: Course organization Lectures: Tuesday 3-5 Course organization Intranet Webpage Lectures Course information Readings Announcements Sample questions Tutorials: Tuesday 5-6 Office hours: Wed 11-12, Or by appointment Course organization ... Date Added: 2009-06-16 21:34:58 |
| lec5_handout.doc Path: Wisc La Crosse >> AST >> 362 Fall, 2009 Description: S07 AST 362 SPECTRAL LINES (cont\'d) Lecture 5 1 Spectral Line Formation: Kutner 3-4, Zeilik 8-2 (D) Excitation: Radiative or Collisional De-Excitation: Radiative (spontaneous or stimulated) or Collisional Which lines you see (and how strong the... Date Added: 2009-06-16 21:35:31 |
| Chapter 5 - Energy.ppt Path: MSU Billings >> CHEM >> 115 Fall, 2009 Description: Chemistry, The Central Science, 11th edition Theodore L. Brown; H. Eugene LeMay, Jr.; and Bruce E. Bursten Chapter 5 Thermochemistry John D. Bookstaver St. Charles Community College Cottleville, MO Thermochemistry 2009, Prentice-Hall, Inc. Energy... Date Added: 2009-06-16 21:36:23 |
| Bitwise Operators.doc Path: SUNY Buffalo >> EE >> 324 Fall, 2009 Description: Bitwise operators. bitand - Bit-wise AND. bitcmp - Complement bits. bitor - Bit-wise OR. bitmax - Maximum floating point integer. bitxor - Bit-wise XOR. bitset - Set bit. bitget - Get bit. bitshift - Bit-wise shift. ... Date Added: 2009-06-16 21:39:03 |
| Math166HW6.pdf Path: Iowa State >> MATH >> 166 Fall, 2008 Description: Math 166: Homework #6 Due on Thursday, 6-15-06 Show your work! If no work is shown, no credit will be given. Section 10.1: #2, 8, 10, 22, 28 Section 10.2: #1, 6, 7, 8 Section 10.3: #2, 4, 12, 21 Problem #1: Evaluate the following integral: f (x)dx,... Date Added: 2009-06-16 21:39:36 |
| introdiffequ8pages.pdf Path: Wellesley >> CS >> 249 Fall, 2009 Description: Chapter 1, Introduction Extract from Introduction to Scientic Computing with Dierential Equation Models Lennart Edsberg, KOD, KTH, SE-100 44 Stockholm There is probably no exaggeration to say that dierential equations are the most common and importan... Date Added: 2009-06-16 21:39:55 |
| 450MS_ACCESS_ LAB1.doc Path: SIU Edwardsville >> INDEX >> 450 Fall, 2009 Description: Dr. Bordoloi MICROSOFT ACCESS LAB 1 Introduction A database is a collection of data that is stored electronically. The person who owns the database needs to manage this data, i.e., retrieve data upon request, delete data that is not needed, add new d... Date Added: 2009-06-16 21:40:36 |
| 05apr14exceptions.ppt Path: Cornell >> CS >> 100 Fall, 2008 Description: CS100J 14 April 2005 Exceptions in Java. Read Chapter 10. This material will not be tested Review session Sunday in Olin 155, 1PM-3PM. Do not miss class or lab on Tuesday. We will start on Matlab in class, and the lab will introduce you to its use o... Date Added: 2009-06-16 21:41:34 |
| lect14.txt Path: Cornell >> CS >> 410 Fall, 2009 Description: CS410, Summer 1998 Lecture 14 Outline Dan Grossman Goals: * Reviewing the Prelim * Amortized Analysis * The prelim results are just fine! Sample solution is on the web site. We went over all the questions in class. There is not point in re... Date Added: 2009-06-16 21:41:44 |
| Pre02c_CASTNET_Statistics.txt Path: UC Riverside >> PAH >> 308 Fall, 2009 Description: AllSite_AllDay HNO3g SO2g P_NH4 P_SO4 P_NO3 Total_NO3 P_mNO3_mSO4 P_NH4_ratio P_NO3_ratio Fraction_Bias(%) 13.61577 39.197... Date Added: 2009-06-16 21:42:40 |
| risk.pdf Path: Illinois State >> FIL >> 341 Fall, 2008 Description: Modeling Risk Up to this point in the semester, we have run models as if we knew what would happen. For instance, we have projected sales, when we are certain that those figures are wrong. The problem with projections is that we know they are wrong. ... Date Added: 2009-06-16 21:43:55 |
| WACC0903.xls Path: Illinois State >> FIL >> 341 Fall, 2008 Description: Interest (kd) Capital Debt Outstanding Weights Weight*Rate Revolving Loan 5.57% 60,558,687 0.58 0.03 Term Loan 40,000,000 0.39 0.04 11.50% Real Estate Loan 8.275% 2,986,345 0.03 0 103,545,032 Overall kd = Tax Rate = After-tax kd = 7.939% 30.00% 5.557... Date Added: 2009-06-16 21:43:56 |
| Book1.xlsx Path: Uni. Westminster >> SWF >> 1212 Fall, 2009 Description: Typeof waste Agricultur e Mineral industries (mining and milling waste) Industrial (nonhaza rdous) Municipal (domestic ) Utility Hazardou s Lowlevel radioactiv e Million tons 2,340 Percent 52 Milliontons 1,620 36 Agriculture 225 5 4% 2% 1% 5% 52... Date Added: 2009-06-16 21:46:01 |
| Chapter 11.pdf Path: North Texas >> CECS >> 0111 Spring, 2009 Description: powerplug oe -v Lvs Ee y d W L o y vs B d oe y r or s d B ey o y vr d L E o - vr s Ee B e- yo v booklovers b oe pCS3 d A o h ts oo Ph shapeexperiment ... Date Added: 2009-06-16 21:46:51 |
| exfinalmup1short.ps Path: UPenn >> MATH >> 114 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: exfinalmup1short.dvi %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMTI12 CMSY10 CMR9 CMMI12 CMR8 CMEX10 %+ CMMI8 CMR6 CMSY8 CMC... Date Added: 2009-06-16 21:47:35 |
| NOTES FOR WEEK 7 Sp09.doc Path: UCSC >> CMPE >> 080 Fall, 2009 Description: CMPE 80E NOTES FOR WEEK 7 Spring 09 We ended last week\'s notes with a few more ideas drawn from CHPTS 3 Instrumantalization\" refers to the process of taking ideas as instruments a... Date Added: 2009-06-16 21:48:02 |
| Power Plug-1.pdf Path: North Texas >> CECS >> 3220001 Spring, 2009 Description: ... Date Added: 2009-06-16 21:48:11 |
| Kieso18.doc Path: WVU >> ACCT >> 311 Fall, 2008 Description: ACCT311 Long-Term Contracts Page 1 of 4 Income Recognition and Measurement of Net Assets Revenue Recognition (Chapter 2) Any item is recognized (recorded) when it: Meets the definition of the item and Is reliably measurable In addition, revenue is... Date Added: 2009-06-16 21:51:10 |
| lab05.pdf Path: UPR Mayagüez >> INEL >> 3115 Fall, 2009 Description: Universidad de Puerto Rico en Mayaguez Electrical and Computer Engineering Department High Tech Tools and Toys Lab Laboratory 5: DSP - Digital Signal Processing OBJECTIVES - Familiarize the students with Digital Signal Processing using software tool... Date Added: 2009-06-16 21:53:50 |
| e_e.pdf Path: San Diego State >> ES >> 0809 Fall, 2009 Description: Electrical Engineering In the College of Engineering OFFICE: Engineering 426 TELEPHONE: 619-594-5718 E-MAIL: ee@engineering.sdsu.edu http:/electrical.sdsu.edu The undergraduate degree in Electrical Engineering is accredited by the American Board for ... Date Added: 2009-06-16 21:58:39 |
| lecture_2_stoddard.ppt Path: Washington >> BIOC >> 530 Fall, 2008 Description: B-DNA 5\' - C G A T C G ` - 3\' 5\' - G C T A G C ` - 3\' Specificity = Low (1 in 4096) ; Fidelity = High 5\' - A X C X A C X T W X C G X T W C Y X - 3\' 3\' - T X G X T G X A Y X G C X A Y G W X - 5\' `X\'=any base pair, `Y/W\'=any pyrimidine/purine Specifi... Date Added: 2009-06-16 21:58:46 |
| AA.pdf Path: San Diego State >> ES >> 9900 Fall, 2009 Description: Academic Advising Mission and Purpose Research has indicated that a strong academic advising system is an essential ingredient of undergraduate student success in higher education. A shared responsibility between adviser and student, academic advisin... Date Added: 2009-06-16 21:58:50 |
| cs110_s09_02_class.doc Path: NJIT >> MK >> 110 Fall, 2009 Description: CIS110 PRACTICE 02 CLASSES Define a class named Counter. It has one integer attribute named count. The constructor assigns the default value of 0 to count. Implement the following methods: getCount setCount incCount decCount toString /returns the val... Date Added: 2009-06-16 22:01:04 |
| hw2.ps Path: Stanford >> STAT >> 315 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: hw2.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR10 CMSY10 CMMI10 CMMI8 CMR8 CMTT10 %EndComments %DVIPSWebPage: (www.radicaley... Date Added: 2009-06-16 22:01:48 |
| hair.docx Path: Uni. Westminster >> BLR >> 1121 Fall, 2009 Description: ... Date Added: 2009-06-16 22:03:22 |
| MATLAB Lecture 2 Handout symbolic.doc Path: Benjamin Franklin Institute of Technology >> MY >> 1202 Fall, 2009 Description: Aerospace Practicum Introduction to MATLAB Lecture #2 In-Class Practice Exercises Complete these problems if you finish all of the in-class demonstrations before the laboratory is over. If you do not get to these in class, take a look at them during ... Date Added: 2009-06-16 22:03:38 |
| hw1.pdf Path: SUNY Stony Brook >> AMS >> 527 Fall, 2008 Description: AMS 527, Spring 2009, Homework 1 65 points. Due: Monday 02/09. Electronic submission of homework assignments is strongly encouraged for the computer problems. For A the written part, you are encouraged (but not required) to typeset using L TEX or LYX... Date Added: 2009-06-16 22:04:56 |
| Code of Conduct.doc Path: SUNY Albany >> PM >> 157 Fall, 2009 Description: The Forum Code of Conduct Developed the The Forum Team Part ESC Our Vision, Values, and Mission Vision ?: 1) 2) 1 ?. ?. ? ?. ? ?. This Style-the Block Quotation-can be used for quotes, notes or paragraphs of special interest. To use the Bloc... Date Added: 2009-06-16 22:07:05 |
| slac-pub-6857.pdf Path: Stanford >> PUBS >> 6750 Fall, 2009 Description: Digital I/Q Demodulator* SLAC-PUB-95-6857 C. Ziomek and P. Corredoura Stanford Linear Accelerator Center, Stanford, CA 94309, USA Abstract I/Q demodulation is a common and useful RF signal processing technique used in charged-particle accelerators.... Date Added: 2009-06-16 22:09:24 |
| MAHARASHTRA.xls Path: Yale >> RP >> 269 Fall, 2009 Description: STATE MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHARASHTRA MAHA... Date Added: 2009-06-16 22:12:17 |
| andhrapradesh2001.xls Path: Yale >> RP >> 269 Fall, 2009 Description: STATE ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDHRA PRADESH ANDH... Date Added: 2009-06-16 22:12:25 |
| up1998.xls Path: Yale >> RP >> 269 Fall, 2009 Description: STATE UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT PRADESH UTTAT ... Date Added: 2009-06-16 22:13:07 |
| Assessing Investment Alternatives.doc Path: University of Illinois, Urbana Champaign >> FIN >> 453 Fall, 2009 Description: Assessing Investment Alternatives Your name is Inspector Cleaseau, and your boss, Chief Detective Officer Dreyfus, has asked you to evaluate and rank nine capital investment projects. The underlying, marginal, after-tax operating, nominal, free cash ... Date Added: 2009-06-16 22:13:23 |
| s2.ps Path: Old Dominion >> CS >> 381 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: s2.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips s2 %DVIPSParameters: dpi=600, comm... Date Added: 2009-06-16 22:13:56 |
| slac-pub-1989.pdf Path: Stanford >> PUBS >> 1750 Fall, 2009 Description: SLAC-PUB-1989 August 1977 cm) (2+1)-DIMENSIONAL ABELIAN LATTICE GAUGE THEORY* h Bela1 E, Baaquie Stanford Linear Accelerator Center Stanford University, Stanford, California 94305 ABSTRACT A modified form of the Wilson action is studied for the Ab... Date Added: 2009-06-16 22:16:18 |
| L7.pdf Path: Delaware >> ELEG >> 305 Fall, 2008 Description: ELEG305: Digital Signal Processing Lecture 7: Frequency Domain Analysis of LTI Systems Kenneth E. Barner Department of Electrical and Computer Engineering University of Delaware Fall 2008 K. E. Barner (Univ. of Delaware) ELEG305: Digital Signal P... Date Added: 2009-06-16 22:16:27 |
| CV Huaiyu Wang.doc Path: Penn State >> HZW >> 101 Fall, 2009 Description: Huaiyu Wang u Department of Philosophy 240 Sparks Building The Pennsylvania State University University Park, PA 16802-5201 USA Cell: 814.441.4023 Fax: 814.865.0119 hzw101@psu.edu, wdhyana@gmail.com Area of Specialization Contemporary Continenta... Date Added: 2009-06-16 22:17:55 |
| Hw4.txt Path: N.C. State >> CSC >> 651 Fall, 2009 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Transitional/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\" lang=\"en-US\" xml:lang=\"en-US\"> <head> <title>Login Required</title> <link rev=\"made\" hr... Date Added: 2009-06-16 22:18:46 |
| 10amFeb23.pdf Path: Lock Haven >> CHEM >> 121 Fall, 2009 Description: Today:MoreChapter14:EquilibriumConstantsandQ WebAssign:Nonewassignment,lastassignmentdue2/26 Lab:BeginningonTuesday(sec02)QualitativeAnalysisof Ionswhichbeginsonpage83. Friday:Quiz6 1 2 3 4 5 6 ... Date Added: 2009-06-16 22:18:59 |
| act22_F06.pdf Path: Kentucky >> MA >> 109 Fall, 2008 Description: MA109, Activity 22: Review (Sections 2.2+2.4+6.1+6.2) Objective: Date: To prepare for Midterm 2, make sure that you can solve the types of problems listed in Activities 21 and 22. At least one sample problem is listed by each type of problem. The s... Date Added: 2009-06-16 22:22:54 |
| 18a_Creating EMS.pdf Path: LSU >> EXST >> 7015 Fall, 2008 Description: Rules for creating EMS Statistical Techniques II EXST7015 Expected Mean Squares (EMS) Expected Mean Squares (EMS) for the Completely Random Design 1) Initially treat all effects as if they were random. Represent each source with a 2, and an appropr... Date Added: 2009-06-16 22:23:25 |
| 9.pdf Path: Missouri S&T >> EE >> 265 Fall, 2009 Description: 0 1) In homework 8, you found the Fourier Transform of 5 0 3 7 3 7 , probably by using FT tables and theorems (at least that\'s the way I did it). Now do it using the basic equation. (If you used the basic equation in homework 8, then do it us... Date Added: 2009-06-16 22:25:16 |
| hughes.pdf Path: Temple >> BA >> 323 Fall, 2009 Description: Annu. Rev. Nucl. Part. Sci. 1999. 49:30339 Copyright c 1999 by Annual Reviews. All rights reserved SPIN STRUCTURE FUNCTIONS E. W. Hughes California Institute of Technology, Pasadena, California 91125; e-mail: Emlyn@slac.stanford.edu R. Voss CERN, ... Date Added: 2009-06-16 22:25:52 |
| Part4AngAtoms.doc Path: UNE >> CH >> 327 Fall, 2009 Description: Atoms, Just Atoms Question 1 What are the spherical harmonics? What do they have to do with the electronic structures of atoms? Sketch the following spherical harmonic: (using the correct definitions of and . Y0,0(, ) Y1,0(, ) Y1,1(, ) Y1,-1(, ) Que... Date Added: 2009-06-16 22:26:06 |
| 104lec11W09.pdf Path: UMBC >> BIOL >> 104 Fall, 2009 Description: Lecture 11: Pathogenesis of Infectious Disease: The Microbes Fight Back! Text p. 124-132 Lecture Outline: I. Host Factors a. General Health and nutritional status b. Immune status c. Health of immune system d. Presence of normal microbiota Microbe Fa... Date Added: 2009-06-16 22:27:42 |
| CH141 Practice Exam 3 2003.pdf Path: Colby >> CH >> 141 Fall, 2009 Description: 1. Which form of electromagnetic radiation has the longest wavelengths? _ A. _ B. _ C. _ D. _ E. gamma rays microwaves radio waves infrared radiation x-rays From the following list of observations, choose the one that most clearly supports the foll... Date Added: 2009-06-16 22:31:49 |
| prob_ex1.ps Path: University of Iowa >> M >> 170 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: prob_set.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o prob_set.ps prob_set.dvi %DVIPSParameters: dpi=600, c... Date Added: 2009-06-16 22:37:07 |
| constraint.doc Path: MIT >> I >> 386 Fall, 2009 Description: #PCE version 4#C# man_module#name#space#id_table#modified# current_idO#I#xN#class/constraintN# referenceC# hash_table#refer#sizeO#I#xaI#sN#V.constraint.fromC#man _variable_card# # identifier#module# last_modified#name#summary#description#see_also#inh... Date Added: 2009-06-16 22:37:41 |
| parbox.doc Path: MIT >> I >> 386 Fall, 2009 Description: #PCE version 4#C# man_module#name#space#id_table#modified# current_idO#I#xN# class/parboxN# referenceC# hash_table#refer#sizeO#I#xN#bothI# sN#V.parbox.auto_cropC#man_variable_card## # identifier#module# last_modified#name#summary#description#see_al... Date Added: 2009-06-16 22:37:46 |
| PolarGraphs.pdf Path: LSU >> MATH >> 1023 Fall, 2008 Description: ... Date Added: 2009-06-16 22:38:38 |
| SolverHelp.doc Path: Johns Hopkins >> MTS >> 251 Fall, 2009 Description: SOLVER HELP FILE Hypothetical Problem (Six Flags) You have a six flags where you have three kinds of areas area for park rides (R), area for food (F) and area for shops (S). Management wants to know how to best utilize the area. And they have constr... Date Added: 2009-06-16 22:39:23 |
| hm101_14.pdf Path: St. Francis IL >> CHEM >> 101 Fall, 2009 Description: CHEM 101 Homework Assignment #14 Fall 2007 You don\'t have to hand in this problem set. You are encouraged to practice these problems before the exam. Solutions are already posted on the web page. 1. There are three different dichlorobenzenes, C6... Date Added: 2009-06-16 22:40:05 |
| 3390 FINAL EXAM SPRING 2009 section A.doc Path: Laurentian >> MGT >> 200901 Fall, 2009 Description: University of Lethbridge, Faculty of Management, Spring Semester 2009 Canadian Trade Unions (Mgt. 3390A) FINAL EXAM THE EXAM TAKES PLACE IN ROOM D631 ON MONDAY APRIL 27 FROM 2 P.M. TILL 5 P.M. THIS REPRESENTS 30% OF YOUR COURSE GRADE. IF YOUR MARK EX... Date Added: 2009-06-16 22:40:52 |
| 108.ppt Path: Virginia Tech >> ESM >> 4084 Fall, 2008 Description: AOE/ESM 4084 Engineering Design Optimization Lecture # 8 Optimum Design Concepts Zafer Grdal Virginia Tech 06/08/09 GLOBAL OPTIMALITY Convex Sets Let P and P2 be any two points in a set S. The set is 1 convex if the entire line segment between ... Date Added: 2009-06-16 22:41:01 |
| aareadme.txt Path: Washington University in St. Louis >> MEXMRS >> 1022 Fall, 2009 Description: PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM ... Date Added: 2009-06-16 22:41:57 |
| slac-pub-3382.pdf Path: Stanford >> PUBS >> 3250 Fall, 2009 Description: SLAC -PUB ~July -1984 (T/E) - 3382 EVOLUTION BOUND FIELD EQUATION AND RELATIVISTIC FOR SCALAR STATE WAVE FUNCTIONS MODELS IN FOUR AND SIX DIMENSIONS* STANLEY J. BRODSKY, CHUENG-RYONG JI AND MIKOLAJ SAWICKI+ Stanford Stanford Linear Ac... Date Added: 2009-06-16 22:44:23 |
| final96.ps Path: University of Illinois, Urbana Champaign >> CS >> 421 Spring, 2008 Description: %!PSAdobe3.0 %Title: Microsoft Word Final Exam.d %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 05/04/96 01:26:04 %BoundingBox: 13 13 600 780 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (atend) %DocumentSupp... Date Added: 2009-06-16 22:49:03 |
| degniproj.pdf Path: Gordon MA >> MATH >> 0203 Fall, 2009 Description: RSA and Public Key Cryptography Math 112 Possible Project If you want to use this project, you should still talk to me and go over it, to discuss exactly which parts you would concentrate on. The advantage of this one is that it is already in a nice ... Date Added: 2009-06-16 22:50:17 |
| syl.doc Path: El Paso CC >> SPOT >> 120 Fall, 2009 Description: CIS120 Syllabus - Fall, 2007 Course Number : CRN: Course Title: Instructors: Instructor Phone: Instructor Email: Instructor Office Hours: Credit Hours: CIS120 Computer Concepts I 4 CAS 133 or BA131, WR 90 and MTH 65 This class is NOT a computer ... Date Added: 2009-06-16 22:51:38 |
| AM465fAss1_sol.doc Path: UWO >> AM >> 465 Fall, 2009 Description: AM465f: Assignment 1. Solution 1. s = s0 + v0 * t + 0.5 * g * t * t; G = 4 * PI * PI * pow(a, 3)/ (P * P *(m1 + m2); FV = PV * pow(1 + INT / 100), YRS); c = sqrt(pow(a, 2) + pow(b, 2) - 2 * a * b * cos(gamma); 2. dm = m (= (1 + v/c) / = (1 - v/c) - ... Date Added: 2009-06-16 22:51:55 |
| 0822-leader-rrtrynewtack.pdf Path: Virginia Tech >> PUBS >> 1922 Fall, 2009 Description: Milwaukee Leader: Railroads Try New Tack [Aug. 22, 1922] 1 Railroads Try New Tack in Laying Wreck Blame Unsigned news report in the Milwaukee Leader, v. 11, no. 218 (Aug. 22, 1922), pg. 1. CHICAGO - Worried by the recurrence of railroad wrecks adm... Date Added: 2009-06-16 22:52:05 |
| topic04.pdf Path: UWO >> AM >> 050 Fall, 2009 Description: ... Date Added: 2009-06-16 22:52:10 |
| hw4-sols.ps Path: UCSC >> CMPS >> 132 Fall, 2008 Description: %!PS-Adobe-3.0 %Pages: (atend) %BoundingBox: 84 49 541 717 %HiResBoundingBox: 84.000000 49.100000 540.600000 717.000000 %. %Creator: AFPL Ghostscript 650 (pswrite) %CreationDate: 2007/02/01 09:13:46 %DocumentData: Clean7Bit %LanguageLevel: 2 %EndComm... Date Added: 2009-06-16 22:52:35 |
| cse791syl.ps Path: Syracuse >> CSE >> 791 Spring, 2008 Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - CSE791-syl %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 09/13/99 09:42:46 %BoundingBox: 13 13 599 780 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (atend) %DocumentSupplied... Date Added: 2009-06-16 22:54:17 |
| solved01.pdf Path: Laurentian >> MATH >> 2865 Fall, 2009 Description: ... Date Added: 2009-06-16 22:54:45 |
| Biodome-Arctic and Anta#67E.txt Path: Université du Québec à Montréal >> K >> 22635 Fall, 2009 Description: <body bgcolor=lime><p align=center><body text=red> The Arctic and Antarctic<p><br> <img width=150 height=118 src=\"PENGUIN.GIF\" align=right> \"The Polar world is mine to rule and nobody can and will stop me ! No one I say ! The Penguin rules !<br>... Date Added: 2009-06-16 22:55:27 |
| 6C.pdf Path: Carnegie Mellon >> CS >> 103 Fall, 2009 Description: The Limits of Computation Universal Computers (Turing Machines) 6C 15-103 Principles of Computation, Carnegie Mellon QATAR - Stehlik/Cortina 1 Alan Turing 1912-1954 Consider by many to be one of the founding fathers of computer science. Developed... Date Added: 2009-06-16 22:57:04 |
| en_4629.txt Path: Benjamin Franklin Institute of Technology >> ECE >> 5527 Fall, 2009 Description: 192.71 193.17 A: Hello. 193.49 194.04 B: yeah. 193.97 196.51 A: yeah how is &Bubby? What happened with that test? 197.18 200.42 B: %um she\'s not getting the results for a couple of days. 200.94 204.29 A: She\'s not getting oh uh-huh %uh ... Date Added: 2009-06-16 22:58:17 |
| morec.pdf Path: Princeton >> CS >> 126 Fall, 2008 Description: September 19, 1996 10:09 AM Lecture 3. More About C Programming languages have their lingo Programming language Types Constants Variables Expressions Statements Functions are `categories\' of values are values of basic types name locations that hol... Date Added: 2009-06-16 23:01:43 |
| EXAMPLE STEP BY STEP LESSON PROCEDUREBY NATALIESPRING2004.pdf Path: Minnesota >> ELED >> 1010 Fall, 2009 Description: (EXAMPLE STEP BY STEP LESSON PROCEDURE) (BY NATALIE, Sec. 002) My Procedures For This Lesson Outline the Procedures you will use during the lesson Legend to Outline: BOLD text = Speaking Parts ( ( ) = INSTRUCTOR NOTES FOR HOW TO DO TEACHING PROCEDU... Date Added: 2009-06-16 23:03:12 |
| Figure 2 Mouse and Chicken Expression and Enhancers.doc Path: Texas >> JLV >> 1212 Fall, 2009 Description: 90 A B C Tumpel et. al, Developmental Biology, 246, 2002. Figure 2. Diagrammatic summary of Hox gene expression in the hindbrain and pharyngeal arches of mouse and chicken and the associated regulatory elements. ... Date Added: 2009-06-16 23:03:21 |
| tetracycline, macrolides and chloramphenicol.pdf Path: Ill. Chicago >> HANDOUTS >> 331 Fall, 2009 Description: Macrolides Erythromycin Clarithromycin Azithromycin Roxithromycin Dirithromycin Ketolides Non-antibiotic Tacrolimus (also FK-506 or Fujimycin) NCH3 azithromycin OCH3 clatrithromycin Erythromycin 1 I. Mechanism Binds 50S and inhibit transferases ... Date Added: 2009-06-16 23:03:56 |
| geo ppoint assess.pdf Path: U. Houston >> CUIN >> 3113 Fall, 2008 Description: ... Date Added: 2009-06-16 23:04:23 |
| SASStudentUse.pdf Path: Uni. Worcester >> MA >> 2611 Fall, 2008 Description: WPI/SAS Agreement - Student Use Agreement In exchange for granting me, as a registered student, the right to possess and use a copy of SAS Institute software (\"Software\") on my personal computer or workstation, I agree that: 1. The Software is the c... Date Added: 2009-06-16 23:07:48 |
| L3 spec development.ppt Path: Dallas >> EE >> 6306 Fall, 2008 Description: ASIC Design Lecture 4 Specification Development Understanding the application Specification development I/Os Signals Working modes Pin description Typical connection Parameter definition Specification definition of project MSDSP Specific... Date Added: 2009-06-16 23:09:47 |
| EasyWinWin_IVV_LCO_F05a_T11.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Armen Donigian IV Mantis should not be identified as tools. They are applications t... Date Added: 2009-06-16 23:09:57 |
| antimicrobial drugs.ppt Path: MO Western >> BIO >> 251 Fall, 2009 Description: ... Date Added: 2009-06-16 23:12:29 |
| lecture03.ppt Path: Stanford >> CS >> 157 Fall, 2009 Description: Computational Logic Lecture 3 Truth Table Method and Propositional Proofs Michael Genesereth Autumn 2006 Deduction In deduction, the conclusion is true whenever the premises are true. Premise: p Conclusion: (p q) Premise: p Non-Conclusion: (p q)... Date Added: 2009-06-16 23:13:03 |
| WaterBalance2.ppt Path: Allegheny >> BIO >> 220 Fall, 2008 Description: ... Date Added: 2009-06-16 23:13:03 |
| PLCY 175 Course Outline Fall 2003.pdf Path: UNC >> PLCY >> 175 Fall, 2008 Description: PUBLIC POLICY ANALYSIS 175 Quantitative Analysis in Public Policy Fall 2003 Instructor: Ashu Handa Course meeting time and location: T, TH, 11:00-12:15, Wilson LG 304 Computer labs: 9/16, 9/23, 10/9, 11/6, 11/13, 11/25 Manning 01 Office: 219-A Aberne... Date Added: 2009-06-16 23:13:21 |
| phy3050atomicstructure.ppt Path: N.E. Illinois >> PHY >> 3050 Fall, 2009 Description: Atomic Structure Elements q Only about 118 diffe nt e m nts m up all them rials we re le e ake ate know Only 88 of the arefound in nature se There aining e m nts arem in laboratorie and aretoo m le e ade s unstable(radioactive to occur in nature... Date Added: 2009-06-16 23:14:15 |
| probset8_soln.pdf Path: Wisconsin >> CHEM >> 341 Fall, 2008 Description: ... Date Added: 2009-06-16 23:14:56 |
| usersguide.pdf Path: Rosalind Franklin University of Medicine & Science >> PF >> 310 Fall, 2009 Description: A Division of Cisco Systems, Inc. 2.4 GHz Wireless-G 802.11g Broadband Router WIRELESS Model No. User Guide WRT54G Wireless-G Broadband Router Copyright and Trademarks Specifications are subject to change without notice. Linksys is a register... Date Added: 2009-06-16 23:15:52 |
| maincpp.txt Path: DePaul >> DAY >> 309 Fall, 2009 Description: / Project PersonMap, File main.cpp / Show how to use the STL map data structure. / Disable map warning number 4786 peculiar to / Microsoft implementation. #pragma warning(disable: 4786) #include <iostream> #include <string> #include <map> #include ... Date Added: 2009-06-16 23:22:22 |
| HW20.pdf Path: Idaho >> ENGR >> 210 Fall, 2008 Description: ... Date Added: 2009-06-16 23:23:14 |
| npc.pdf Path: UCSB >> CS >> 130 Fall, 2009 Description: ... Date Added: 2009-06-16 23:23:50 |
| PHY221set3.pdf Path: Pima CC >> PHY >> 221 Fall, 2008 Description: ... Date Added: 2009-06-16 23:28:14 |
| CalcII8.3.pdf Path: Pima CC >> MAT >> 231 Fall, 2008 Description: ... Date Added: 2009-06-16 23:28:31 |
| PE 105 Defending PE.pdf Path: Wisc Stevens Point >> CCHRI >> 402 Fall, 2009 Description: #11219402 Supporting the role of physical education According to dictionary.com physical education is the training in the development of and care for the human body; stresses athletics; includes hygiene. Physical education teaches life long skills a... Date Added: 2009-06-16 23:28:40 |
| oldmidterm2.ps Path: North-West Uni. >> CS >> 311 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: exam1.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Helvetica Helvetica-Bold Helvetica-Oblique %+ Helvetica-BoldOblique Times-Roman Times-... Date Added: 2009-06-16 23:32:54 |
| wpasgmt.txt Path: CSU Stanislaus >> CS >> 4000 Fall, 2009 Description: CS 4000 Summer 2000 Word Processing Assignments1. (Due 5:30 pm June 20) Using a word processor, write a paper according to the following procedure and format.Part I A. Picture in your mind a person you have strong feelings for. The subject may be so... Date Added: 2009-06-16 23:34:12 |
| TBCE Lecture One 2009.pdf Path: East Los Angeles College >> C >> 1021 Fall, 2009 Description: Topics in biological and cultural evolution Lecture one Evolutionary Psychology: A United Field? Dr. Julie Coultas What we will cover in the four lectures Evolutionary Psychology: A United Field? Emotions Cognitive Sex Differences Cultural Evolution... Date Added: 2009-06-16 23:36:11 |
| Practice Problems.pdf Path: UF >> STA >> 6166 Summer, 2008 Description: Practice Problems (Do not turn in) Chapter 1: 1,2,5,6 Chapter 2: 1,2,4,5,6,7,8 Chapter 3: 1,6,8,10,11,12,17,19,22,23,25,27,28,29,31 Chapter 4: 1,3,12,15,16,18,19,21,22,26,27,28,33,34,41,43,44, 46,47,48,53,54,55,57,58 Chapter 5: 2,3,4,5,7,9,11,12,13,1... Date Added: 2009-06-16 23:36:56 |
| Notes - 03.31.09.pdf Path: UNC Charlotte >> ECGR >> 3181 Fall, 2008 Description: Notes - 03.31.09 Tuesday, March 31, 2009 9:01 AM ECGR3181-Spr2009 Page 1 ECGR3181-Spr2009 Page 2 ... Date Added: 2009-06-16 23:39:08 |
| NC_pntLocs.xlsx Path: UNC >> GEOG >> 801 Fall, 2008 Description: EO_ID E_UTM N_UTM 11834.000000 732677.20972500000 3756368.85225000000 2457.000000 761663.85302900000 3758427.30371000000 2457.000000 762076.08074500000 3758545.76535000000 2457.000000 763024.86678700000 3758582.75604000000 2457.000000 762621.72296300... Date Added: 2009-06-16 23:39:52 |
| Exercise_5_key_revised for 2010.doc Path: Washington >> FISH >> 454 Fall, 2008 Description: (10 POINTS) COMPARTMENT MODELS ANSWER WORKSHEET 1A. Repeat the calculations above to solve for the steady state P-concentration (C*) but include an additional input, Inp, as a source of water to lake that affects water volume. (1) dV (t ) = I d + I n... Date Added: 2009-06-16 23:41:37 |
| softwarelicense.pdf Path: Georgia Tech >> GTG >> 396 Fall, 2009 Description: Max Groves CS4001B 27 June 2007 Software License Summary 1) Adobe Reader EULA last updated 3-30-2007 from Adobe 2) Use is unlimited until updating to a newer version, where a new license is adopted. Cost is free. 3) Rights: For general use Permits us... Date Added: 2009-06-16 23:42:30 |
| Compute and Storage Clouds Using Wide Area.pdf Path: Wayne State University >> DU >> 7600 Fall, 2009 Description: Compute and Storage Clouds Using Wide Area High Performance Networks Robert L. Grossman Yunhong Gu Michael Sabala Wanzhi Zhang National Center for Data Mining University of Illinois at Chicago January 31, 2008 Revised July 16, 2008 Abstract We descri... Date Added: 2009-06-16 23:43:54 |
| math281hw_original.doc Path: Black Hills >> MATH >> 281 Fall, 2009 Description: Math 281 Introduction to Statistics Fall 2005 - Tentative Schedule and Suggested Homework Week Date # 1 Week of Aug. 30th Section/Problems Go over syllabus Section 1.2: Types of Data #1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 23 Section 1.3: Critical Thinki... Date Added: 2009-06-16 23:44:50 |
| exam2_f03.pdf Path: Black Hills >> MATH >> 123 Fall, 2009 Description: Calculus I - Exam 2 - Fall 2003 Name_ Calulators may not be used on any portion of this exam. Questions 1 - 9 are multiple choice. You will receive seven points for each correct response. Question 10 is short answer (fill in the blank). You will re... Date Added: 2009-06-16 23:44:53 |
| resumebiology.pdf Path: Lehigh >> RER >> 205 Spring, 2009 Description: RAJIKA EMILY REED, MPH 1701 North 19th Street Allentown, Pennsylvania 18104 OBJECTIVE: EDUCATION: To teach Biology at the secondary level. Graduate Studies: Lehigh University, Fall 2005 - Present Masters Degree in Secondary Education, Biology Certifi... Date Added: 2009-06-16 23:46:12 |
| 300 06 fa week 7 day 1.doc Path: UCCS >> BIO >> 300 Fall, 2009 Description: BIOL 300 Fall 2006: Class Notes Outline Week 7 Day 1 Introduction to Statistics Continued, Plus Correlations Thought for the Day: \"People will tolerate honest mistakes, but if you violate their trust you will find it very difficult to ever regain t... Date Added: 2009-06-16 23:48:40 |
| 7065889Referances.txt Path: East Los Angeles College >> BROOKESW >> 07065889 Fall, 2009 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Transitional/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\"> <head> <meta content=\"text/html; charset=ISO-8859-1\" http-equiv=\"content-type\" /> <... Date Added: 2009-06-16 23:48:43 |
| 7065889Code.txt Path: East Los Angeles College >> BROOKESW >> 07065889 Fall, 2009 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Transitional/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\"> <head> <meta content=\"text/html; charset=ISO-8859-1\" http-equiv=\"content-type\" /> <... Date Added: 2009-06-16 23:48:44 |
| TomSelsley.doc Path: Berkeley >> IS >> 247 Fall, 2000 Description: Pre Focus Group Questionnaire This should take about five to ten minutes. This Pre Focus Group Questionnaire will help us to frame the discussion Monday night according to the groups\' travel experiences and preferences. Please answer the questions... Date Added: 2009-06-16 23:49:12 |
| MadeUpTask.doc Path: Berkeley >> IS >> 247 Fall, 2000 Description: MadeUpTask 11/18/00 Produced by Sacha Pearson, Kim Garrett, and Jennifer English Now that you are familiar with the content of the database, please make up your own task similar to the tasks you saw above. Please state your task below. Then try to ... Date Added: 2009-06-16 23:49:37 |
| mandelbaum-The Inadequacy of American Power.doc Path: Gettysburg >> P >> 344 Spring, 2009 Description: Title: Authors: Source: The Inadequacy of American Power. Mandelbaum, Michael Foreign Affairs; Sep/Oct2002, Vol. 81 Issue 5, p61, 14p Abstract: The fact of American supremacy tends to polarize opinion. The chief obstacle to an expansive American in... Date Added: 2009-06-16 23:49:56 |
| grb00z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20081209 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/08120912_upa.wxp Date: 1200Z 9 DEC 08 Searching for KGRB. Searching the city database file for: KGRB . Date:1200Z 9 DEC 08 Station: KGRB... Date Added: 2009-06-16 23:51:22 |
| LEC04_460.doc Path: Washington >> GEOG >> 460 Fall, 2008 Description: Lecture 4 Levels of Measurement Learning Objectives: 4.1 Why bother with understanding levels of measurement? 4.2 What are the levels of measurement provided by Stevens (1946) 4.3 Describe the levels of measurement presented by Chrisman (2002). Why d... Date Added: 2009-06-16 23:52:24 |
| c07_rockcycle_03.pdf Path: UVA >> EVSC >> 101 Spring, 2008 Description: Rocks and the Rock Cycle Rocks = any naturally formed, nonliving, firm coherent aggregate mass of mineral matter OR an assemblage of minerals bound together Minerals = inorganic natural compound having a specific chemical formula and possessing a cr... Date Added: 2009-06-16 23:52:54 |
| NUTR600_2007_Lecture_2.ppt Path: Washington >> GH >> 555 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|31 Mar 2008 18:19:03 -0000 vti_extenderversion:SR|12.0.0.6211 vti_author:SR|WMDC-LAPTOP\\littlebluewizard vti_modifiedby:SR|WMDC-LAPTOP\\littlebluewizard vti_timecreated:TR|31 Mar 2008 18:19:03 -0000 vti_... Date Added: 2009-06-16 23:54:09 |
| ch0.ps Path: UF >> ECE >> 6503 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: ch0.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Italic Times-Bold CMSY10 Courier %EndComments %DVIPSWebPage: (www.radi... Date Added: 2009-06-16 23:55:22 |
| B0880FtGraham_dem.txt Path: Washington University in St. Louis >> MER >> 0880 Fall, 2009 Description: The file B880_FortGrahamdem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0253991 2) Add -6.47676 The x & y scales are 0.030 mm / pixel. Maximum value for DEM, cor... Date Added: 2009-06-16 23:55:43 |
| B0067eifel_dem.txt Path: Washington University in St. Louis >> MER >> 0067 Fall, 2009 Description: The file B067_Eifel_dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0128343 2) Add -3.27275 The x & y scales are 0.030 mm / pixel. Maximum value for DEM, corresp... Date Added: 2009-06-16 23:55:43 |
| Example 2 - TV Production.xls Path: CSU Fullerton >> ISDS >> 361 Fall, 2009 Description: TV Production Standard 1600 60 0.2 0.1 0.05 Flat 1066.67 90 0.2 0.3 0.08 Plasma 0 100 0.4 0.4 0.15 Total 192000 533.33 480 160 <= <= <= 600 480 160 TV\'s Per Week Profit Production Assembly Inspectiion 125 Microsoft Excel 10.0 Answer Report Workshe... Date Added: 2009-06-16 23:56:50 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
