Course Solutions And Notes - transl04 2c
| WAG.ppt Path: Binghamton >> CS >> 495 Fall, 2009 Description: The Watson Adventure Game 2004 CS-495 Fall 2003 Experimented with Client Server version Static Pictures of parts of the building NSEW navigation Panoramic 3-views of building intersection Confused user Good attempt but abandoned Spring 2004 ... Date Added: 2009-06-03 15:08:34 |
| 12-5-media-server.ppt Path: Wayne State University >> ECE >> 7995 Fall, 2009 Description: Hierarchical Caching and Prefetching for Continuous Media Servers with Smart Disks By:Amandeep Singh Parth Kushwaha Index: Introduction Media Servers Proposed Algorithms Sweep and Prefetch(S&P) Gradual Prefetching Grouped Periodic Multigrou... Date Added: 2009-06-03 15:09:35 |
| 222popq1.txt Path: MNSU >> CHM >> 224 Fall, 2009 Description: Pop Question No. 1. If you make a solution of 10e-3 M HCl, the pH is 3. If you make a solution of 10e-5 M HCl, the pH is 5. Since HCl is a strong acid, the [H+] is equal to the [HCl]. What is the pH of a solution of HCl that has been diluted to a... Date Added: 2009-06-03 15:10:34 |
| BA301_intro.ppt Path: Fort Lewis >> BA >> 301 Fall, 2009 Description: BA301 Management Management and Organization Behavior\" is a study of the principles, practices, and processes of administration: the organization of a system the behavior of people in the orga... Date Added: 2009-06-03 15:11:11 |
| reliable-transfer-2.ppt Path: Rutgers >> CS >> 352 Spring, 2006 Description: Chapter 3: Transport Layer Our goals: understand principles behind transport layer services: r learn about transport layer protocols in the Internet: r r r r multiplexing/demultipl exing reliable data transfer flow control congestion control r... Date Added: 2009-06-03 15:11:31 |
| Elegansnotes.doc Path: SUNY Buffalo >> BCH >> 512 Fall, 2009 Description: Paper for the discussion : Parry DH, Xu J, Ruvkun G. A whole-genome RNAi Screen for C. elegans miRNA pathway genes. Curr Biol. 2007 Dec 4;17(23):2013-22. You will need Figure 1A from supplemental data. Questions for the discussion: 1) What are the ma... Date Added: 2009-06-03 15:12:45 |
| coursescz.PPT Path: SUNY Buffalo >> PSY >> 222 Fall, 2009 Description: Predictors of Course in Schizophrenia People with schizophrenia will have a worse course if: they had poor premorbid functioning they have primarily negative symptoms they have critical family members (high EE) they experience negative life event... Date Added: 2009-06-03 15:13:19 |
| SQLInsertShip.txt Path: Millersville >> CS >> 466 Fall, 2009 Description: insert into ship values (\'A45B678\', \'Elzer\'s Escape\', 2000, 2005, \'passenger\'); insert into ship values (\'B222C43\', \'Adam\'s Apple\', 4300, 1999, \'passenger\'); insert into ship values (\'C425A33\', \'Chuck\'s Charger\', 12400, 2001, \'cargo\'); insert into sh... Date Added: 2009-06-03 15:14:31 |
| 5e_chap06.ppt Path: DePaul >> DGRANT >> 340 Fall, 2009 Description: Chapter 6 SYSTEMS DEVELOPMENT Phases, Tools, and Techniques McGraw-Hill/Irwin 2005 The McGraw-Hill Companies, All rights reserved OPENING CASE STUDY Developing Enter the Matrix It took over four years to develop Enter the Matrix videogame based o... Date Added: 2009-06-03 15:14:48 |
| ex1.doc Path: DePaul >> SE >> 430 Fall, 2009 Description: Exercise 1 : One-Minute Microwave This is a team exercise to give the student some experience with CRC card modeling. Your assignment: Read the following problem charter, requirements, and use cases. You will use them as the basis for building a CR... Date Added: 2009-06-03 15:14:56 |
| richest.txt Path: DePaul >> CSC >> 239 Fall, 2009 Description: 1 William Gates III 48 46.6 United States \" United States , WA , Medina\"2 Warren Buffett 73 42.9 United States \"United States , NE , Omaha\"3 Karl Albrecht 84 23 Germany \"Germany , Donaueschingen\"4 Prince Alwaleed Bin Talal Alsaud 47 21.5 Saudi... Date Added: 2009-06-03 15:15:07 |
| Task2-INME4031.doc Path: UPR Mayagüez >> INME >> 4031 Fall, 2009 Description: University of Puerto Rico Mayagez Campus Department of Mechanical Engineering INME 4031 - LABORATORY I Spring 2004 TASK 2: Stress-Strain Measurement Objective: The purpose of this task is to determine the modulus of elasticity of a given cantilever b... Date Added: 2009-06-03 15:15:24 |
| Testing.ppt Path: DePaul >> SE >> 682 Fall, 2009 Description: A Review of Software Testing - P. David Coward What is Testing? Does software match requirements? - Specs might not be correct Testing attempts to assess how well tasks have been performed Expected output vs. output from test Two types of Testing T... Date Added: 2009-06-03 15:15:49 |
| 0226DNS.ppt Path: St. Thomas >> C >> 370 Fall, 2009 Description: CISC 370 - Class Today Recap Circuit/Message/Packet Switching Internet Architecture DNS and distributed processing More Wireshark Tracking sequence numbers 05/14/09 R. Smith - University of St Thomas - Minnesota 1 Recap TCP/UDP/IP Relati... Date Added: 2009-06-03 15:19:43 |
| 0226DNS.ppt Path: St. Thomas >> CISC >> 370 Fall, 2009 Description: CISC 370 - Class Today Recap Circuit/Message/Packet Switching Internet Architecture DNS and distributed processing More Wireshark Tracking sequence numbers 05/14/09 R. Smith - University of St Thomas - Minnesota 1 Recap TCP/UDP/IP Relati... Date Added: 2009-06-03 15:19:44 |
| res1203.doc Path: RIT >> CLS >> 8343 Fall, 2009 Description: Cynthia Scigaj Local Address cls8343@rit.edu 71 Rutgers St Rochester, NY 14607 (585) 764-9801 Email Permanent Address 11462 Broadway Alden, NY 14004 (716) 937-6501 Objective To put skills and education to use in ... Date Added: 2009-06-03 15:20:28 |
| l7.txt Path: RIT >> SE >> 420 Fall, 2009 Description: SE 420 - Formal Methods - Winter 2008 Lab 7 Purpose: Practice simple Z schemas. 1. Type the definitions of the vending machine from the quiz: a) State schema for vending machine b) Initialization... Date Added: 2009-06-03 15:21:41 |
| Set01a-Equilibrium.doc Path: Michigan >> PS >> 441 Fall, 2009 Description: Econ 441 Problem Set 1 - Answers Alan Deardorff International Equilibrium Page 1 of 5 Problem Set 1 - Answers International Equilibrium 1. a. Explain how it is possible for a production function to have the property of constant or increasing return... Date Added: 2009-06-03 15:21:52 |
| GraphicsF.txt Path: Sanford-Brown Institute >> CS >> 190 Fall, 2009 Description: /Bernard Peng /bpeng #ifndef _SIMSGRAPHICS_ #define _SIMSGRAPHICS_ /building types, these will be defined by logic class Building; class Road; class Character; class SimsGraphics { public: SimsGraphics(); ~SimsGraphics(); /GUI calls, this ta... Date Added: 2009-06-03 15:22:56 |
| colin2.txt Path: Sanford-Brown Institute >> CS >> 190 Fall, 2009 Description: Copy into your editor, fill in the blanks, and place in directory /pro/web/web/courses/cs190/2007/handins/1-26/LOGIN2.txt. Replace LOGIN with your CS login. Note the 2 there so that you don\'t overwrite the first handin! Come up with at least 3 pot... Date Added: 2009-06-03 15:22:58 |
| GraphicsF.txt Path: Sanford-Brown Institute >> CS >> 2002 Fall, 2009 Description: /Bernard Peng /bpeng #ifndef _SIMSGRAPHICS_ #define _SIMSGRAPHICS_ /building types, these will be defined by logic class Building; class Road; class Character; class SimsGraphics { public: SimsGraphics(); ~SimsGraphics(); /GUI calls, this ta... Date Added: 2009-06-03 15:23:38 |
| sampleOutput3.txt Path: Michigan >> EECS >> 498 Fall, 2008 Description: Script started on Thu 11 Jan 2008 06:01:17 PM EST [ 1 ] proj1 -: ./morgana1 Welcome to the Let\'s Make A Deal simulator! To start, please enter a random sequence seed. Enter integer from 0 to 9999: 10000 Invalid input! Please try again! Enter integer... Date Added: 2009-06-03 15:24:31 |
| syn00e.ww.txt Path: Wisconsin >> ENGR >> 749 Fall, 2009 Description: CORRECTED ACCELEROGRAM 24514-C0284-94017.02 CHAN 8: 0 DEG FROM UNCORRECTED ACCELEROGRAM DATA PROCESSED: 04/19/94, CDMG QN94A514 NORTHRIDGE EARTHQUAKE JANUARY... Date Added: 2009-06-03 15:27:05 |
| 6.ReliabilityandValidity.ppt Path: Wisconsin >> J >> 658 Fall, 2009 Description: Reliability and Validity Criteria of Measurement Quality How do we judge the relative success (or failure) in measuring various concepts? design Reliability consistency of measurement Validity confidence in measures and Reliability and... Date Added: 2009-06-03 15:27:14 |
| critique02.doc Path: Oregon State >> OC >> 560 Fall, 2008 Description: Jed Roberts Article Review 5/14/2009 Lamy, F., Kaisser, J., Ninnemann, U., Hebbeln, D., Arz, H. W., and Stoner, J. 2004. Antarctic Timing of Surface Water Changes off Chile and Patagonian Ice Sheet Response. Science. 304: 1959-62. Summary Lamy et ... Date Added: 2009-06-03 15:28:38 |
| 722-10-2-2000.ppt Path: RIT >> EECC >> 722 Fall, 2009 Description: What is Configurable Computing? Spatially-programmed connection of processing elements Customizing computation to a particular application by changing hardware functionality on the fly. \"Hardware\" customized to specifics of problem. Direct map of ... Date Added: 2009-06-03 15:29:49 |
| SWW3FINE-BIO_WCMP0001-FNM_20071224T1200_20071224T1200_20071226T1200_00t_Z.txt Path: LSU >> WW >> 677251 Fall, 2009 Description: WAVEWATCH III 20071224 120000 -72.00 -63.00 91 40.00 46.00 61 .t 0.0100 s 1 2 (1X,32I4) -999 -999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999-999 -999... Date Added: 2009-06-03 15:31:56 |
| oc_20071203.doc Path: UC Davis >> SS >> 0708 Fall, 2009 Description: NAME _ 20071203 (OPENER) Solve of x (hint: use factoring and zero product property): x2 + x = 20 Graph: y = x2 + x 20 (CLOSER) Solve for x (hint: use your calculator: CALC zero) x2 2x = 4 Why do we use different techniq... Date Added: 2009-06-03 15:33:24 |
| 01-Lect__7.doc Path: UC Davis >> VEN >> 0507 Fall, 2009 Description: Lecture #7 Making Table Wines Part III Well, are we really going to start to put all of these winery operations together and make wine? Well, no-not yet. Professor Meredith has a few more operations to discuss, and then we can put them together. S... Date Added: 2009-06-03 15:33:45 |
| 01-Lect__7.doc Path: UC Davis >> LOG >> 0507 Fall, 2009 Description: Lecture #7 Making Table Wines Part III Well, are we really going to start to put all of these winery operations together and make wine? Well, no-not yet. Professor Meredith has a few more operations to discuss, and then we can put them together. S... Date Added: 2009-06-03 15:33:45 |
| 01-Lect__7.doc Path: UC Davis >> ATT >> 0507 Fall, 2009 Description: Lecture #7 Making Table Wines Part III Well, are we really going to start to put all of these winery operations together and make wine? Well, no-not yet. Professor Meredith has a few more operations to discuss, and then we can put them together. S... Date Added: 2009-06-03 15:33:45 |
| intro.doc Path: Bucknell >> CS >> 208 Fall, 2009 Description: \\chapter{Introduction} \\section{SWI-Prolog} \\label{sec:intro} \\label{sec:swiprolog} SWI-Prolog started back in 1986 with the requirement for a Prolog that could handle recursive interaction with the C-language: Prolog calling C and C calling Prolog... Date Added: 2009-06-03 15:35:50 |
| ECE543-Final-Grade_1.doc Path: Rutgers >> ECE >> 543 Fall, 2009 Description: RUID (Last 4-digits) 6966 5099 1767 2572 9017 3675 6032 2591 462 1430 1538 4233 1435 7134 2057 6538 6443 9788 7280 7322 3682 9733 5236 8941 8649 9927 9252 3330 1131 343 2908 8630 9846 1144 4164 Final 75 66 70 59 58 36 60 67 48 34 46 82 77 72 50 57 5... Date Added: 2009-06-03 15:36:44 |
| Hypervisor.PPT Path: Acton School of Business >> GW >> 4314 Fall, 2009 Description: IBM Research Hypervisors Orran Krieger 2005 IBM Corporation http:/www.research.ibm.com/hypervisor Hypervisors will be pervasive for commercial systems Server consolidation. Incremental upgradeability of HW and SW. Testing for new deployments... Date Added: 2009-06-03 15:38:21 |
| project_1.doc Path: Wisconsin >> ENGR >> 311 Fall, 2009 Description: CEE 311 HYDROSCIENCE SPRING 2007 PROJECT I Due March 6, 2007 1. Consider a pond with the following characteristics: The only factors contributing to the water budget are direct rainfall on, and evaporation from, the pond; surface runoff from t... Date Added: 2009-06-03 15:38:36 |
| 635-522combinedoutline1.doc Path: Wisconsin >> ENGR >> 522 Fall, 2009 Description: CEE 522 Hazardous Waste Management (3 Credits, 3 Design Credits) Lecturer: Jim K. Park Lecture Hours EH 3359, 09:30 am - 10:45 am, TR Office Hours EH 3230, 11:00 am - 12 pm T and 11:00 am 2:30 pm Th OUTLINE Week 1 2 Topic Regulations, Introduction t... Date Added: 2009-06-03 15:38:38 |
| chap25.ppt Path: Kentucky >> STA >> 200 Fall, 2008 Description: Inference about a Population Mean STA200 Chapter 25 Sampling Distribution of Lack x of bias in random sampling The mean of a number of observations is less variable than individual observations\' The distribution of a mean of a number of observ... Date Added: 2009-06-03 15:40:06 |
| Lecture05_IterationINKED.ppt Path: Georgia Tech >> CS >> 1371 Fall, 2008 Description: CS1371 Computing for Engineers Lecture 11 Iteration Iteration The Concept Repeat a block of code any desired number of times Have a variable that changes value each time the code is repeated Typically called the index variable Constructs to all... Date Added: 2009-06-03 15:40:25 |
| 2510T2b.doc Path: Georgia Tech >> CMPE >> 2510 Fall, 2009 Description: Score:_ Name: _ CmpE 251 0 Computer Architec ture Test II March 1, 199 6 Place all answers in the blanks provided. 1. (5 points ) Convert 151.37 5, a decimal nu m be r, to IEEE 32 bit floating point format. IEEE He... Date Added: 2009-06-03 15:41:08 |
| LORE-QueryOptimization.ppt Path: Michigan >> EECS >> 684 Fall, 2008 Description: Query Optimization for Semistructured Data Jason McHug, Jennifer Widom Stanford University - Rajendra S. Thapa .Road Map Lore System Query Execution Engine Statistic and cost model Performance Results Lore Data Model - OEM Data Guide Path Expres... Date Added: 2009-06-03 15:41:30 |
| crit.revanwr.doc Path: Wisconsin >> ENGR >> 497 Fall, 2009 Description: 9/29/99 EPD 497 Reviewer\'s name Review of \" The Coastal Plain of the Arctic National Wildlife Refuge: Oil or Wilderness? \" This report discusses the vital subject of U.S. environmental protection as it moves into the 21st century. The author has focu... Date Added: 2009-06-03 15:42:09 |
| CDD65.txt Path: Michigan State University >> GEO >> 2846 Fall, 2009 Description: FLINT WSO AP DIVISION: 10 STATION #2846 ... Date Added: 2009-06-03 15:44:29 |
| mprec_ssprec_105_s08.txt Path: Berkeley >> C >> 105 Fall, 2009 Description: \"101\",\"1\" \"111\",\"2\" \"112\",\"3\" \"121\",\"4\" \"123\",\"5\" \"211\",\"6\" \"212\",\"UNASSIGN\" \"217\",\"7\" \"301\",\"8\" \"311\",\"10\" \"321\",\"11\" \"401\",\"12\" \"411\",\"13\" \"412\",\"UNASSIGN\" \"421\",\"14\" \"431\",\"UNASSIGN\" \"442\",\"15\" \"501\",\"16\" \"511\",\"18\" \"531\",\"19\" \"541\",\"20\" \"551\",\"21... Date Added: 2009-06-03 15:45:21 |
| project13_final_paper.doc Path: University of Illinois, Urbana Champaign >> ECE >> 445 Spring, 2008 Description: CORDLESS PHONE PAGING DEVICE by Charlinda Catchings and Chrissy Hart ECE 345 Shao Hsia May 1, 2000 Project Number 13 ii Abstract This paper covers the development of a cordless telephone paging device. The designed paging device is intended to displ... Date Added: 2009-06-03 15:47:31 |
| ch_05.ppt Path: Cal Poly >> CSC >> 101 Fall, 2009 Description: Reference . and Misc Other Topics Clark Savage Turner, J.D., Ph.D. csturner@csc.calpoly.edu 756-6133 Some lecture slides have been adapted from those developed 1 by John Lewis and William Loftus to accompany 1 Java Software Solutions: Foundations of... Date Added: 2009-06-03 15:49:41 |
| IBOT_Lockdown1.ppt Path: Washington University in St. Louis >> BME >> 401 Fall, 2009 Description: IBOT Lockdown Group: JV All-stars IBOT Lockdown Group Members: Bart Phillips, Andrew Miller, and Adam Dashe Mentor: Dr. David Gray The IBOT Inventor: Dean Kamen Stair-walker Stand up Need An automatic automobile lock down system for the IBOT... Date Added: 2009-06-03 15:49:58 |
| type.txt Path: UCSB >> LESSON >> 109 Fall, 2009 Description: # of Type \"S 1, R1\" \"S1, R2\" \"S2, R1\" BV 24 8 8 8 BV 18 8 8 8 BV 12 8 8 8 Supplier 5 6 6 ... Date Added: 2009-06-03 15:50:48 |
| B2_Pancheri.ppt Path: UC Riverside >> ISMD >> 0731 Fall, 2009 Description: Total cross-sections and Bloch-Nordsieck Gluon Resummation ISMD2004, Sonoma State University Giulia Pancheri INFN Frascati In collaboration with A. de Roeck, R.M. Godbole, A. Grau and Y.N. Srivastava JHEP 0306:061,2003 Phys.Rev.D60:114020,1999 05/1... Date Added: 2009-06-03 15:53:25 |
| newwinterunit03.doc Path: UC Riverside >> MATH >> 302 Winter, 2008 Description: III. DOCUMENT PREPARATION USING TEX One way of avoiding problems with examinations and other documents is to prepare them in a careful and reliable manner. The mathematical typesetting program TEX is an extremely powerful tool for creating scientific... Date Added: 2009-06-03 15:53:58 |
| clippingexample.ppt Path: USC >> CSCI >> 571 Summer, 2008 Description: Clipping in three browsers Opera 5 I.E. 6 Netscape 7 ... Date Added: 2009-06-03 15:54:03 |
| ec-07a.ppt Path: USC >> CSCI >> 577 Fall, 2009 Description: Distributed Assessment of Risk Tool (DART) Jesal Bhuta jesal@usc.edu Outline DART Objectives Applying DART in CSCI 577: DART Process DART Demonstration 2 Spatial Distribution Architect - Leavy Client Health Science Campus Tester OHE 122 Ris... Date Added: 2009-06-03 15:54:50 |
| lab2.doc Path: USC >> ENGR >> 479 Fall, 2009 Description: LAB 2 Goal: To design MOS SINGLE STAGE CIRCUITS a) Common Source Amplifier of voltage gain 40, b) Common Source Amplifier c) Simple Common Gate Amplifier and Find the 3 dB cut off frequency for all the three. COMMON SOURCE AMPLIFIER +10 V RL =... Date Added: 2009-06-03 15:55:27 |
| OCD_LCO_F05a_T09_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Operational Concept Description (OCD) J2EE Based Session Management Framework Extension Team 9 Team Members Nishant Bajaj Project Manager Deepti Agarwal Concept Engineer Gaurav Bhatnagar Prototype Developer Saurabh Mahajan System Architect Sup... Date Added: 2009-06-03 15:56:40 |
| resultquad.txt Path: UMKC >> CS >> 352 Fall, 2009 Description: SIVAGAMI VENKATACHALAM OUTPUT FILE RESULT FILE (ResultQuad.TXT) Quadratic Load factor when the search is performed 0.10014 42959 Not found after 0 probes 35609 Not found after 0 probes ... Date Added: 2009-06-03 15:58:56 |
| summary.txt Path: Michigan State University >> CSE >> 470 Fall, 2009 Description: % % This document is for the Group Meeting Summary. The Summary should % be distributed to each member (and other invitees) and to the TA % following the meeting (hopefully the day after) so that each member % will have a clear understanding of the ... Date Added: 2009-06-03 16:00:49 |
| aqmlists02.doc Path: UNC >> SOCI >> 709 Fall, 2008 Description: ADVANCED QUANTITATIVE METHODS READING LIST Jan 2002 Advanced Methods Committee: $ Ken Bollen bollen@unc.edu $ Guang Guo gguo@email.unc.edu $ Franois Nielsen (Chair) francois_nielsen@unc.edu OUTLINE 1. 2. 3. 4. 5. 6. 7. LINEAR REGRESSION LO... Date Added: 2009-06-03 16:02:39 |
| VARIABLES.txt Path: UNC >> GEOG >> 1990 Fall, 2009 Description: The following variable names and labels define the attributes attached to the STATE and MUNICIPIO coverages: STCODE - state key according to the map LON - longitude of state or municipio center point LAT - latitude ... Date Added: 2009-06-03 16:02:58 |
| seth_leonard_1.txt Path: UNC >> GEOG >> 491 Fall, 2008 Description: ID,INFO 1,first name 2,last name 3,major 4,phone# 5,email 6,hometown 7,state 8,favorite book 9,favorite local restaurant ... Date Added: 2009-06-03 16:02:58 |
| jordan-termfreq.txt Path: UNC >> INLS >> 172 Fall, 2008 Description: the 30 to 13 and 13 in 11 a 10 jordan 9 chicago 8 that 7 of 7 s 6 norris 5 no 4 it 4 his 4 he 4 you 3 who 3 was 3 television 3 season 3 said 3 people 3 not 3 nba 3 from 3 for 3 city 3 at 3 as 3 2 with 2 will 2 wednesday 2 washington 2 today 2 this 2... Date Added: 2009-06-03 16:03:22 |
| mapwtrar.txt Path: UNC >> GEOG >> 591 Fall, 2008 Description: Identification_Information: Citation: Citation_Information: Originator: North Carolina Floodplain Mapping Program, North Carolina Division of Emergency Management Publication_Date: 20070216 Title: MapWtrAr (Water Area), Onslow... Date Added: 2009-06-03 16:03:31 |
| 1932.doc Path: UVA >> MA >> 1932 Spring, 2009 Description: January 1932 Politics and Society Reconstruction Finance Corporation established by the Hoover administration as an attempt to restart the economy Oliver Wendell Holmes resigns from the Supreme Court Albany: FDR enters presidential race Scien... Date Added: 2009-06-03 16:07:58 |
| lab03.doc Path: Pittsburgh >> CS >> 0110 Fall, 2008 Description: CS 0110 Lab 3: Microsoft PowerPoint 2007 1. Creating a new Microsoft PowerPoint 2007 presentation a. Open Microsoft PowerPoint 2007 using the Start menu (Start > All Programs > Microsoft Office > Microsoft Office PowerPoint 2007). b. In the Office b... Date Added: 2009-06-03 16:09:53 |
| sheep--2.txt Path: CSU Fresno >> MP >> 3 Fall, 2009 Description: I Like A Sheep chorus: Sheep, sheep, I like a sheep; I\'ve never had anything quite like a sheep. Well, I\'ve done it all and I\'ve sunk pretty deep, But nothing compares to the pleasures of sheep. Some people say that a cow is just fine, While other f... Date Added: 2009-06-03 16:12:22 |
| 12451.ppt Path: Pittsburgh >> SUPER >> 7 Fall, 2009 Description: Financing, Access, Quality and Outcomes in Primary Health Care: The case of the Republic of Kazakhstan Mr. Aikan Akanov, Director of the Healthy Lifestyle Promotion Centre VII CARK MCH Forum Almaty, Kazakhstan 5 - 7 November 2003 Agenda Overview of... Date Added: 2009-06-03 16:15:51 |
| 19921.ppt Path: Pittsburgh >> SUPER >> 7 Fall, 2009 Description: SALMONELLA INFECTION Abdelaziz Elamin, MD, PhD, FRCPCH College of Medicine Sultan Qaboos University INTRODUCTION Discovered in 1880 & named after Daniel Salmon, the pathologist who first isolated the organism from porcine intestine. Salmonella is a ... Date Added: 2009-06-03 16:18:48 |
| INLS2513F.doc Path: UNC >> INLS >> 251 Fall, 2008 Description: Georgetown University 1.This is definitely how its done in the LCNAF (LCNAF record no. 90002553), but here\'s my possible explanation as to why. Tell me if I\'m at all on the right track: This is an interesting situation because a meeting name is hiera... Date Added: 2009-06-03 16:19:42 |
| wf930243.txt Path: MO St. Louis >> WOFACT >> 92 Fall, 2009 Description: CIA WORLD FACTBOOK 1992 via the Libraries of the Univ. of Missouri-St. Louis Match 244 DB Rec# - 72,957 Dataset-WOFACT Source :CENTRAL INTELLIGENCE AGENCY Source key :CI Program :WORLD FACTBOOK Program key :CI WOFACT Upd... Date Added: 2009-06-03 16:20:56 |
| assignment3.doc Path: E. Illinois >> CLS >> 435 Fall, 2009 Description: Assignment 3 Part 1 (12 points) CLS 435 The following reactions were obtained by testing red blood cells from a donor unit with antisera: Anti-D: Anti-C: Anti-E: Anti-c: Anti-e: 1. 2. 3. 4. 5. 6. + + 0 0 + What Rh antigens does the donor possess? ... Date Added: 2009-06-03 16:21:27 |
| 041202profile.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: BBC NEWS | Europe | Country profiles | Country profile: Bosnia-Hercegovina Country profile: Bosnia-Hercegovina The Republic of Bosnia-Hercegovina is still struggling to recover from three years of bloody inter-ethnic war during 1992-95. Around 25... Date Added: 2009-06-03 16:21:45 |
| Switches.ppt Path: W. Kentucky >> CIT >> 384 Spring, 2009 Description: CIT 384: Network Administration Switches CIT 384: Network Administration Slide #1 Topics 1. TCP/IP Architecture 2. OSI Reference Model 3. Cisco certification overview CIT 384: Network Administration Slide #2 Switching at Data Link Layer Applica... Date Added: 2009-06-03 16:22:25 |
| 2510T2b.doc Path: Alabama Huntsville >> CPE >> 431 Fall, 2009 Description: Score:_ Name: _ CmpE 251 0 Computer Architec ture Test II March 1, 199 6 Place all answers in the blanks provided. 1. (5 points ) Convert 151.37 5, a decimal nu m be r, to IEEE 32 bit floating point format. IEEE He... Date Added: 2009-06-03 16:23:23 |
| IPT2004_Phase2_Team1_Teamwork_Poster.ppt Path: Alabama Huntsville >> IPT >> 2004 Fall, 2009 Description: LS: common goal innovative design members have knowledge as a well-integrated, ed team pursuing a op a creative, e that all team TEAM MEMBERS: Barry Heflin Desiree Delane David Wilks Brad Seal Geraldine Gaeta Lee Foster Josh Suggs Ernesto K... Date Added: 2009-06-03 16:23:29 |
| SENPUPDATE.ppt Path: Bradley >> PROJ >> 201 Fall, 2009 Description: SENIOR PROJECT By: Ricardo V. Gonzalez Advisor: V. Prasad. Data Mover Method: in VLSI using LEDIT package Testing being done in LogicWorks and pspice. OBJECTIVE The main objective is to build a Data Mover with testable features to transfer data ... Date Added: 2009-06-03 16:24:02 |
| SENPUPDATE.ppt Path: Bradley >> CEGT >> 201 Fall, 2009 Description: SENIOR PROJECT By: Ricardo V. Gonzalez Advisor: V. Prasad. Data Mover Method: in VLSI using LEDIT package Testing being done in LogicWorks and pspice. OBJECTIVE The main objective is to build a Data Mover with testable features to transfer data ... Date Added: 2009-06-03 16:24:02 |
| Methods2.ppt Path: Concordia OR >> CSC >> 250 Fall, 2009 Description: Methods 2. 1. Review. 2. Parameter passing mechanisms. 3. Choosing the right mechanism. 4. Adding methods. 1. Review. l A. For user-defined methods in C#, we need: l (1) a method declaration-where? l (2) a method call-where? l B. What is meant by \"t... Date Added: 2009-06-03 16:24:35 |
| design_outline.txt Path: Truman State >> MDM >> 162 Fall, 2009 Description: :Class Responsibilities: as of July 20, 2005 Please e-mail mdm162@truman.edu for changes to this document. This is not by any means a complete listing of all the classes this game will require. This is simply an outline of some of the major players.... Date Added: 2009-06-03 16:26:37 |
| cs654-f06-15.ppt Path: Binghamton >> CS >> 654 Fall, 2009 Description: Distributed Systems: Synchronization CS 654 Lecture 15 November 6, 2006 C+/C Source Code Organization Why break code up into multiple files? Ease of finding things? Compilation speed. Only need to recompile part of the app. Separate compilatio... Date Added: 2009-06-03 16:28:26 |
| 14Johnon.ppt Path: Keystone >> BIOLOGY >> 101 Fall, 2009 Description: Essentials of the Living World Second Edition George B. Johnson Jonathan B. Losos Chapter 14 The New Biology Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 14.1 Genomics Genomics is a field that compare... Date Added: 2009-06-03 16:28:45 |
| mistakes.doc Path: San Diego State >> BUS >> 418 Spring, 2009 Description: Mistakes, Problems, and Cautions MISTAKES Legging In Mistakes Most common mistake is to leg into a spread from an unprofitable outright position, in effect, locking in a loss by spreading. Creating the spread merely increases transaction costs. The b... Date Added: 2009-06-03 16:29:06 |
| linux.doc Path: Widener >> CSCI >> 151 Fall, 2009 Description: Basic LINUX/UNIX Commands Working with Files and Directories in LINUX The LINUX/UNIX file system is organized as a hierarchy of directories starting from a single directory called root which is represented by a / (slash). A directory is a place ... Date Added: 2009-06-03 16:29:14 |
| RecordableOpticalDiscs.doc Path: Wayne State University >> CASF >> 03 Fall, 2009 Description: Recordable CDs and DVDs Floppy diskettes and hard drives use magnetic fields to record data, and are consequently called magnetic media. CDs and DVDs use optical methods (reflective and non-reflective areas) and are called optical media. Magnetic med... Date Added: 2009-06-03 16:29:53 |
| VirtualFieldTrip.ppt Path: SUNY Cortland >> RAKITA >> 22 Fall, 2009 Description: Virtual Field Trip to Auschwitz/Birkenau Miss. Rakita 6th Grade Social Studies Theme The Virtual Field Trip I have created fits under the National Council for the Social Studies Standards lll and lV. In the early grades, young learners draw upon i... Date Added: 2009-06-03 16:30:07 |
| OC03F_pair_0.2mbin.txt Path: Rutgers >> LATTE >> 03 Fall, 2009 Description: depth a412 a440 a488 a510 a532 a555 a650 a676 a715 1.00000 1.27219 1.06477 0.68646 0.55993 0.45616 0.34763 0.19256 0.32904 0.00000 1.20000 1.27334 1.06955 0.68883 0.56017 0.45713 0.34921 0.19357 0.33284 0.00000 1.40000 1.27704 ... Date Added: 2009-06-03 16:32:25 |
| manning.doc Path: NMSU >> CE >> 151 Fall, 2009 Description: CE 151 Spring 2009 Manning\'s Equation Assigned Friday, February 6, 2009 Due Friday, February 13, 2009, 8:30 AM Work this assignment in a spreadsheet, and hand in neatly formatted, well-organized printouts of your spreadsheet work. Be sure that your ... Date Added: 2009-06-03 16:34:10 |
| trace.doc Path: St. Thomas >> QMCS >> 370 Fall, 2009 Description: Tracing Assignment Find a computer and do the following. 1) From any computer with a rich set of internet software, use traceroute to see how many internet hops there is to stthomas.edu (140.209.1.5) or if you are inside St. Thomas try a distant loca... Date Added: 2009-06-03 16:34:30 |
| Lecture-20-Geology-4501.ppt Path: Minnesota >> GEO >> 4501 Fall, 2008 Description: Geology 4501 Lecture 20 Plate tectonics Geology 4501 Lecture 20 Plate tectonics Example of Global Positioning System allowing to determine the (x,y,z,t) space time locations of targets placed in networks on plates. Geology 4501 Lecture 20 Pl... Date Added: 2009-06-03 16:37:00 |
| HIST_1110-FC6_Fall_08.doc Path: U. Memphis >> CAS >> 2 Fall, 2009 Description: The University of Memphis HIST 1110 WORLD CIVILIZATIONS I Sections 003, FC6, and FCB Fall 2008 MWF 10:20-11:15 / Mitchell 200 https:/umdrive.memphis.edu/dlaumann/public/H1110(F08).home.html Dr. Dennis Laumann office hours: W 2:30-4:30 and F 11:30-12:... Date Added: 2009-06-03 16:37:30 |
| bilaws.doc Path: N. Arizona >> EGR >> 486 Fall, 2009 Description: SOLAR PV ELECTRIC COMMUTER VEHICLE Team Statutes TEAM MEMBERS Dave Dufek Bobby Olsen Justin Smith Elliot Rector Krystle Rubino Table of Contents a.TEAM STRUCTURE AND ORGANIZATION 3 1.1.1Director of Sponsor Management and Leadership..3 1.2.1Directo... Date Added: 2009-06-03 16:39:01 |
| bilaws.doc Path: N. Arizona >> D >> 486 Fall, 2009 Description: SOLAR PV ELECTRIC COMMUTER VEHICLE Team Statutes TEAM MEMBERS Dave Dufek Bobby Olsen Justin Smith Elliot Rector Krystle Rubino Table of Contents a.TEAM STRUCTURE AND ORGANIZATION 3 1.1.1Director of Sponsor Management and Leadership..3 1.2.1Directo... Date Added: 2009-06-03 16:39:01 |
| hod.doc Path: N. Arizona >> MAT >> 368 Spring, 2008 Description: Hours of Daylight The length of day of a given point on earth varies with the time of year. Also on any given day, different places have different amounts of daylight. This is caused by the tilt of the earth which is 23.55 from a perpendicular to the... Date Added: 2009-06-03 16:39:09 |
| Lecture20Mar10.ppt Path: N. Arizona >> BIO >> 4262006 Fall, 2009 Description: I. Photorespiration II. CO2 concentrating mechanisms variation on the \"C3\" photosynthetic metabolism. Plant of the day, Zea mays (Poaceae) How does the photosynthetic response to light compare in corn and beans? Corn vs. bean Corn has: 1... Date Added: 2009-06-03 16:39:12 |
| jrh_fits.txt Path: Caltech >> P >> 60 Fall, 2009 Description: TIME INFO Utc Lst Julian date Year (UT) Day of year (UT) Month (UT) Day of month (UT) Apparent equinox Sunset, sunrise TARGET OBJECT INFO Object name (if available) Equinox of coordinates RA, Dec coordinates Proper motion Non-sidereal rates Refer... Date Added: 2009-06-03 16:40:24 |
| Kuai_QBOf.doc Path: Caltech >> AGU >> 2007 Fall, 2009 Description: Influence of the solar cycle on the Quasi-Biennial Oscillation period Le Kuai1, Run-Lie Shia1, Xun Jiang2, Ka-Kit Tung3, Yuk L. Yung1 1 Division of Geological and Planetary Sciences, California Institute of Technology, Pasadena, CA 91125 2 Jet Propul... Date Added: 2009-06-03 16:40:52 |
| G030178-00.ppt Path: Caltech >> G >> 030178 Fall, 2009 Description: GEO Online Detector Characterization System R. Balasubramanian Cardiff University LSC March 2003 LIGOG03017800Z GEO Online Detector Characterization System The basic purpose of the online detector characterization system is to monitor and char... Date Added: 2009-06-03 16:41:39 |
| T050073-01.doc Path: Caltech >> T >> 050073 Fall, 2009 Description: LASER INTERFEROMETER GRAVITATIONAL WAVE OBSERVATORY LIGO- T050073-01 ADVANCED LIGO May 11, 2005 Advanced LIGO Lower Quad Suspension Installation Fixture arm Design Review Ken Mailand Distribution of this document: LIGO Science Collaboration This ... Date Added: 2009-06-03 16:41:52 |
| G050022-00.ppt Path: Caltech >> G >> 050022 Fall, 2009 Description: Toward the Advanced LIGO optical configuration investigated in 40meter prototype Aspen winter conference Jan. 19, 2005 O. Miyakawa, Caltech and the 40m collaboration LIGO- G05002200R Aspen winter conference, January 2005 1 Caltech 40 meter protot... Date Added: 2009-06-03 16:42:11 |
| p30118940612.txt Path: Auburn >> DIGDATA >> 1894 Fall, 2009 Description: 301 It is important that my department in Collage, should be supplied with suitable apparatus for Class instruction. The need of this is apparent, and my department is behind other scientific departments in this respect. The Board at its meeting las... Date Added: 2009-06-03 16:44:27 |
| lapcod2002-lekien-oma.ppt Path: Caltech >> LAPCOD >> 2002 Fall, 2009 Description: Open Boundary Modal Analysis (OMA): Interpolation, Extrapolation and Filtering of High Frequency Radar Data LAPCOD, December 13th 2002 Franois Lekien Control and Dynamical Systems California Institute of Technology Collaborators: Randy Bank, Jerry Ma... Date Added: 2009-06-03 16:44:38 |
| G020431-00.ppt Path: Caltech >> G >> 020431 Fall, 2009 Description: E7 Sensitivities for LIGO Interferometers LHO2k: full configuration; LHO4k & LLO4k : recombined configuration, no power recycling Plaser = 0.020 W Comments go here LIGO - DCC NUMBER REQD Meeting title goes here LIGO Laboratory or LSC Institution... Date Added: 2009-06-03 16:44:57 |
| Chapter1.ppt Path: Iowa State >> ECON >> 353 Fall, 2008 Description: Why Study Financial Markets? 1. Excess funds = > Shortage of funds 2. Promoting economic efficiency, productive use of funds Markets: Bond (IOU\'s), Stock (ownership claim), FOREX (currencies) Why Study Banking and Financial Institutions? (banks, ins... Date Added: 2009-06-03 16:45:44 |
| lab9simulation.txt Path: Iowa State >> STAT >> 601 Fall, 2008 Description: normintests<-function(dat1,dat2,alp,screen=F){ #compute normal theory interval estimates #at level (1-alp)100% using models for #two groups having normal distributions #and either equal or unequal variances # #data objects dat1 and dat2 are ass... Date Added: 2009-06-03 16:45:46 |
| Chapter8NEWNotes.ppt Path: Iowa State >> ECON >> 101 Fall, 2008 Description: Chapter 8: Impacts of Output Decisions on ShortRun Costs, Revenues, and Profits for Competitive Firms Key Topics 1. Cost concepts a. b. c. d. e. Cash and Non Cash Variable and Fixed Total: TFC, TVC, TC Average: AFC, AVC, ATC, AVC & AP Marginal: MC... Date Added: 2009-06-03 16:46:49 |
| lect14.ppt Path: Iowa State >> CPRE >> 210 Fall, 2009 Description: Design of Complex vending Machine Inputs: q (quarter), d (dime) and n (nickel) Input can be two bit coded input or three bit not coded input Two bit coded: 00 no coin, 01 nickel, 10 dime, and 11 quarter Three bit not coded: 001 nickel, 010 dime, ... Date Added: 2009-06-03 16:47:12 |
| L-5.ppt Path: Idaho State >> PHYSICS >> 112 Fall, 2009 Description: PHYSICS 112 Lecture 5 Review Lecture 4 Light sources Law of reflection Law of refraction Total internal reflection By Dr. Valeriia Starovoitova 2 5.1. Color Why do objects have color? Objects appear to have color since they are able t... Date Added: 2009-06-03 16:49:47 |
| Jorge_presentation.ppt Path: IUPUI >> AOM >> 2006 Fall, 2009 Description: Innovation Success: An Empirical Study of Software Development Projects in the Context of the Open Source Paradigm Jorge Colazo, Ph.D. Candidate Dissertation Proposal Committee: Prof. Kevin B. Hendricks Operations Management (Chair) Prof. Larry J. Me... Date Added: 2009-06-03 16:50:11 |
| 12--DRUGREP-comprehensive.ppt Path: UVA >> MODULE >> 12 Fall, 2009 Description: Separating the Wheat from the Chaff Obtaining Useful Information from Pharmaceutical Representatives Based on: Shaughnessy AF, Slawson DC, Bennett JH. Separating the wheat from the chaff: identifying fallacies in pharmaceutical promotion. J Gen Inter... Date Added: 2009-06-03 16:51:00 |
| lecture27.PPT Path: UVA >> LECTURE >> 27 Fall, 2009 Description: CS 551 / 645: Introductory Computer Graphics David Luebke cs551@cs.virginia.edu http:/www.cs.virginia.edu/~cs551 David Luebke 05/15/09 Administrivia q Assignment 6 notes Correction to lookat() explanation Clipping in 3-D versus homogeneous coor... Date Added: 2009-06-03 16:51:11 |
| chap3sec1.ppt Path: UVA >> CS >> 202 Fall, 2008 Description: Section 3.1: Proof Strategy Now that we have a fair amount of experience with proofs, we will start to prove more difficult theorems. Our experience so far has been with theorems that require us only to apply the definitions and fit them together to ... Date Added: 2009-06-03 16:51:27 |
| lecture15.ppt Path: UVA >> CS >> 200 Fall, 2009 Description: Class 15: Golden Ages and Astrophysics CS200: Computer Science University of Virginia Computer Science David Evans http:/www.cs.virginia.edu/evans Science\'s Endless Golden Age 21 February 2003 CS 200 Spring 2003 2 Astrophysics \"If you\'re goin... Date Added: 2009-06-03 16:51:39 |
| collabdiscussion.doc Path: Maryville MO >> RLBP >> 6 Fall, 2009 Description: Collaborative Projects and Community To prepare for this forum, please review the article from Learning Unit 1, \"Establishing Ground Rules for Groups.\" As we explore many online activities during this course, you will recognize an important feature o... Date Added: 2009-06-03 16:51:52 |
| wcwilliams.txt Path: UVA >> HYPER >> 2 Fall, 2009 Description: William Carlos Williams: http:/eir.library.utoronto.ca/rpo/display/poet359.htmlBlizzard Blizzard Snow: years of anger following hours that float idly down - the blizzard drifts its weight deeper and deeper for three days or sixty years, eh... Date Added: 2009-06-03 16:52:06 |
| 1-intro-ooHiLev.ppt Path: BU >> CS >> 113 Fall, 2009 Description: CS112 Intro to CS II with C+ Introduction Problems and Programs Program helps articulate structure of Problem, and maybe even solve it \"Model the World\" Hence \"objects\" Functional spec Design spec How 05/15/09 Gene Itkis; cs112 2 What Your world ... Date Added: 2009-06-03 16:53:27 |
| Newton_Raphson_Example.doc Path: Georgia Tech >> ME >> 2016 Fall, 2008 Description: % Newton Raphson Example % ME2016, Dr. Ferri % func = @(x) log(x.^2) - 0.7; % fprime = @(x) 2./x; % lines used to form anonymous function from m-file n = 2; b = 0.7; func = @(x) test_function(x,n,b); fprime = @(x) deriv_test_function(x,n,b); x=0.5:0.... Date Added: 2009-06-03 16:58:49 |
| schedule.txt Path: Georgia Tech >> CS >> 2000 Fall, 2009 Description: = Below is a preliminary day-by-day class schedule and associated reading assignments. All reading assignments are from MIND by Paul Thagard, MIT Press. Additional reading assignments may be posted later. = Week Date Topic Readings - 1 Jan.... Date Added: 2009-06-03 16:58:50 |
| schedule.txt Path: Georgia Tech >> CS >> 3790 Fall, 2008 Description: = Below is a preliminary day-by-day class schedule and associated reading assignments. All reading assignments are from MIND by Paul Thagard, MIT Press. Additional reading assignments may be posted later. = Week Date Topic Readings - 1 Jan.... Date Added: 2009-06-03 16:58:51 |
| Head.Method.ppt Path: Georgia Tech >> AE >> 3021 Fall, 2008 Description: Head\'s Method for Modeling Turbulent Boundary Layers Bertin & Smith: Page 147 L. Sankar November 22, 2004 Governing Equations Von Karman Integral Momentum Equation Cf d 1 due + (2 + H ) = dx ue dx 2 H : Shape Factor wall C f = Skin Friction Coeffi... Date Added: 2009-06-03 16:59:00 |
| Wyrwas-midterm.ppt Path: Georgia Tech >> CS >> 2001 Fall, 2009 Description: Monte Carlo Simulation of (CsI)nCs+ Clusters Rich Wyrwas Jefferson Wu Dr. Matthew Wolf Dr. Robert Whetten Problem Krckeberg,S.,et.al, Phys Rev.Lett., 2000, 85, 4494. Electron Diffraction of Small Clusters (CsI)nCs+ N= 30-39 Give similar diffracti... Date Added: 2009-06-03 16:59:50 |
| Wyrwas-midterm.ppt Path: Georgia Tech >> CS >> 6230 Fall, 2008 Description: Monte Carlo Simulation of (CsI)nCs+ Clusters Rich Wyrwas Jefferson Wu Dr. Matthew Wolf Dr. Robert Whetten Problem Krckeberg,S.,et.al, Phys Rev.Lett., 2000, 85, 4494. Electron Diffraction of Small Clusters (CsI)nCs+ N= 30-39 Give similar diffracti... Date Added: 2009-06-03 16:59:51 |
| Singh.ppt Path: UGA >> BCMB >> 8010 Fall, 2008 Description: Prostaglandin H2 synthase-1 (E.C. Number 1.14.99.1) Arunima Singh Introduction Integral membrane protein, located primarily in endoplasmic reticulum. Catalyses the first committed reaction of prostaglandin synthesis. Two isoforms. PGHS-1 is con... Date Added: 2009-06-03 17:00:38 |
| Class-5.ppt Path: UGA >> CS >> 1302 Fall, 2007 Description: Classes and Objects CSCI-1302 Remember. We covered reference types in the last few lectures. Objects, Strings, and Arrays are reference types. Now, we will be narrowing our focus on Objects, Classes, and Object-oriented programming. Object Orien... Date Added: 2009-06-03 17:01:05 |
| KFP2D2.doc Path: Middlebury >> FYSE >> 1144 Fall, 2009 Description: Kaitlyn Fallon Jane Austen and Film Mrs. Bertolini September 29, 2006 Novel to Film: Sensibly Dramatic Adaptation Throughout Jane Austen\'s novel, Sense and Sensibility, the reader comes to understand the lifestyle and expectations of the Regency peri... Date Added: 2009-06-03 17:02:48 |
| romberg.txt Path: Laurentian >> MC >> 3416 Fall, 2009 Description: # - # romberg.txt # Romberg integration # # ARGUMENTS # f function to integrate # x0 lower integration limit # x1 upper integration limit # tolerance convergence tolerance of diagonal elements # n max... Date Added: 2009-06-03 17:04:38 |
| Item_Analysis.ppt Path: Maple Springs >> PSYCH >> 3090 Fall, 2009 Description: Item Analysis Purpose of Item Analysis Evaluates the quality of each item Rationale: the quality of items determines the quality of test (i.e., reliability & validity) May suggest ways of improving the measurement of a test Can help with underst... Date Added: 2009-06-03 17:06:06 |
| Essay331507.doc Path: Maple Springs >> ARTS >> 3315 Fall, 2009 Description: AS/HUMA 3315 3.0 (Winter 2007) Black Literatures and Cultures in Canada Essay (25%) The Assignment With detailed reference to at least three sources used in the course (including films) and two external academic sources, discuss one of the following ... Date Added: 2009-06-03 17:07:26 |
| week9ans.doc Path: East Los Angeles College >> BEE >> 205 Fall, 2009 Description: Exercise Answers Chapter 9 Exercise Answers 1. Change the setup in the Sample sheet of MonteCarlo.xls to simulate the freethrow shooting behavior of Shaquille O\'Neal, who shoots 50% from the free-throw line. Using the MCSim add-in (See section 9.5), ... Date Added: 2009-06-03 17:07:34 |
| 1-19-09 Path: Allegheny >> ECON >> 200 Spring, 2009 Description: Microeconomics Class Notes 1/19/09 When taking partial derivatives, if you take the partial derivative (of a specific, single variable), you simply treat all other variables as though they are constants. So in an equation for utility: U = 2x^2 +... Date Added: 2009-06-03 17:45:06 |
| Chap002.ppt Path: Cuyamaca College >> COMP >> 3513 Fall, 2009 Description: SYSTEMS ANALYSIS AND DESIGN METHODS 6th Edition Whitten Bentley Dittman C H A P T E R 2 Irwin/McGrawHill INFORMATION SYSTEM BUILDING BLOCKS Copyright 2004 The McGrawHill Companies. All Rights reserved SYSTEMS ANALYSIS AND DESIGN METHODS 6th Ed... Date Added: 2009-06-03 19:22:06 |
| 2webpage.doc Path: Cuyamaca College >> SOCI >> 3153 Fall, 2009 Description: Sociology 3153 Introduction to Survey Research Winter 2002-2003 Handout #2 Professor: Jan Marontate BAC 311 Survey Research Methods Web Site Checklist The web site you create for your Survey Research homepage should summarize the work you do for ea... Date Added: 2009-06-03 19:33:08 |
| E+S_Feb_2002.doc Path: Contra Costa College >> COEN >> 312 Fall, 2009 Description: DIGITAL DESIGN COEN 312 Answer All Questions. Time Allowed 1 hr. 10min. Lecturer Dr. A. J. Al-Khalili Midterm exam. Feb 14th, 2002 Sample A Question 1 (Use Boolean Algebra for Question 1) 1.a Simplify to obtain minimum SOP (3 marks) F(A, B, C, D) =... Date Added: 2009-06-03 19:41:30 |
| jan_15.ppt Path: Maple Springs >> SOCI >> 3690 Fall, 2009 Description: Making Canadian Families I OUTLINE The family and the nation Nationalism and racism interconnections Making white families/Making Canada white Transforming `family\'/Challenging the state Next assignment Conservative Govt\'s \"Child Care Choice ... Date Added: 2009-06-03 19:50:23 |
| mpeg4-SA.ppt Path: McGill >> MUMT >> 611 Fall, 2009 Description: MPEG-4 John Lazzaro John Wawrzynek June 18, 2001 Modified by Francois Thibault January 20, 2003 Further modified by Ichiro Fujinaga January 20, 2005 CS Division University of California at Berkeley www.cs.berkeley.edu/~johnw MPEG 4 Standard Finaliz... Date Added: 2009-06-03 19:52:04 |
| mpeg4-SA.ppt Path: McGill >> MPEG >> 611 Fall, 2009 Description: MPEG-4 John Lazzaro John Wawrzynek June 18, 2001 Modified by Francois Thibault January 20, 2003 Further modified by Ichiro Fujinaga January 20, 2005 CS Division University of California at Berkeley www.cs.berkeley.edu/~johnw MPEG 4 Standard Finaliz... Date Added: 2009-06-03 19:52:04 |
| MT-W08_solution.doc Path: McGill >> OMMGCR >> 472 Fall, 2009 Description: Question 1 a) 1) F 2) T 3) T 4) T 5) F 6) F 7) F 8) F 9) T 10) F 11) F 12) T b) 1) D 2) C 3) B 4) A 5) C 6) D 7) B 8) B 9) A 10) D 11) B 12) D Question 2 I. Variety: Continuous, Repetitive, Batch, Job shop Volume: Job shop, Batch, Repetitive, Conti... Date Added: 2009-06-03 19:52:52 |
| Chapter5.ppt Path: UMBC >> COMP >> 112 Fall, 2009 Description: Section 5 A Brief History of the Computer \"Ninety percent of everything is crud\" Sturgeon\'s Law Theodore Sturgeon 1 Prehistory 16121614 John Napier first used the printed decimal point and invented logarithms as a way to simplify difficult ma... Date Added: 2009-06-03 19:53:25 |
| ass1.txt Path: Maple Springs >> MATH >> 6911 Fall, 2009 Description: MATH6911 - NUMERICAL METHODS IN FINANCE Assignment 1. Choose ANY 5 problems (out of 10) from Practice Problem Set 1. (http:/www.math.yorku.ca/~hhuang/math6911/problem1.pdf). Due: 5:20pm, Oct 10, 2007. ... Date Added: 2009-06-03 19:56:51 |
| ppt17.ppt Path: Laurentian >> MGT >> 200603 Fall, 2009 Description: INTERMEDIATE ACCOUNTING Seventh Canadian Edition KIESO, WEYGANDT, WARFIELD, YOUNG, WIECEK Prepared by: Gabriela H. Schneider, CMA Northern Alberta Institute of Technology CHAPTER 17 Complex Financial Instruments Learning Objectives 1. Describe th... Date Added: 2009-06-03 20:00:54 |
| w2d1.txt Path: Laurentian >> CS >> 1000 Fall, 2009 Description: Week 2 Day 1 Information technology: collection of tools to support manipulation of information. - computers (a) - TV/radio? (b) - books? (c) All three manipulate information. However, we generally think about (a) when talking about IT. Co... Date Added: 2009-06-03 20:02:05 |
| MacroChap07.ppt Path: Laurentian >> ECON >> 200803 Fall, 2009 Description: Chapter 7: Growth, Productivity, and Wealth in the Long Run Prepared by: Kevin Richter, Douglas College Charlene Richter, British Columbia Institute of Technology 2006 McGrawHill Ryerson Limited. All rights reserved. 1 General Observations abou... Date Added: 2009-06-03 20:03:25 |
| o-socpol-org.doc Path: Laurentian >> ANTH >> 200103 Fall, 2009 Description: Sociopolitical organization (In Womack ch.4 pp. 85-97) Political anthropology is the cross-cultural study of political systems. Cross-culturally there is a range of effectiveness and complexity in political systems from informal ones with temporary l... Date Added: 2009-06-03 20:03:59 |
| 1_1team_NEWZEALAND.doc Path: Laurentian >> MGT >> 4220 Fall, 2009 Description: MGT4220A, International Marketing Team Project New Zealand 1. Jessica Lindskog 2. Marc Menzies 3. Karli Eckart 4. Jesse Sacha 5. Isamu Sam Yamato Congratulations! You are the citizens of New Zealand. Each of you will assume a \"title\" in your country... Date Added: 2009-06-03 20:05:24 |
| jdbc_and_ssh.txt Path: Virgin Islands >> CSC >> 370 Fall, 2009 Description: JAR File - To compile and run JAVA programs using JDBC you need the following jar file: /opt/oracle/jar/classes12.jar If you are working at your home computer, transfer that file to your computer, and then set your JAVA IDE to consider that file. ... Date Added: 2009-06-03 20:06:58 |
| PR1_REV3.doc Path: Virgin Islands >> ECE >> 499 Fall, 2009 Description: Progress Report #1 Digital Input Power-Meter In partial fulfillment of ELEC 499A at the University of Victoria Prepared for: Dr. W. D. Little NxtPhase Corporation Prepared by: Darrin Marr 9511318 Marcie Webb 9805367 Brad Zarikoff 9800578 1. Projec... Date Added: 2009-06-03 20:07:08 |
| Lecturenotes22and24.09.2008.doc Path: Virgin Islands >> LAW >> 374 Fall, 2009 Description: Lecture notes: EU legislation and the legislative process September 22 and 24, 2008 Background reading (optional but recommended): 1. \"Process and Players\" (link from syllabus). Note that Part 1.1.2 is out of date. We will not cover in this course 1.... Date Added: 2009-06-03 20:08:00 |
| exam2007forreview.doc Path: Virgin Islands >> LAW >> 322 Fall, 2009 Description: this is last year\'s exam for review purposes only Family Law 322 Exam Preparation Class December 2, 2008 The Fact Pattern Darius and Maia met at Simon Fraser University in Vancouver in the fall of 1991. She was 28 and he was 21. Darius was an undergr... Date Added: 2009-06-03 20:08:07 |
| formal.ppt Path: East Los Angeles College >> CS >> 223 Fall, 2009 Description: Formal Methods and Testing Goal: software reliability Use software engineering methodologies to develop the code. Use formal methods during code development What are formal methods? Techniques for analyzing systems, based on some ma... Date Added: 2009-06-03 20:08:33 |
| UM.ppt Path: East Los Angeles College >> CS >> 411 Fall, 2009 Description: UM Dr. Alexandra I. Cristea http:/www.dcs.warwick.ac.uk/~acristea/ Read read chapters \'The Adaptive Web\' : Generic User Modeling Systems, User Models for Adaptive Hypermedia and Adaptive Educational Systems User Profiles for Personalized Informa... Date Added: 2009-06-03 20:08:42 |
| toyMCPull_fp0Fix_R1R2G_DDBFFix.txt Path: Virgin Islands >> TOYMCRUN >> 1234 Fall, 2009 Description: strt plotting FCN=24.1549 FROM MIGRAD STATUS=CONVERGED 64 CALLS 65 TOTAL EDM=1.63976e-09 STRATEGY= 1 ERROR MATRIX ACCURATE EXT PARAMETER STEP FIRST NO. ... Date Added: 2009-06-03 20:09:37 |
| family.ppt Path: Laurentian >> MGT >> 200303 Fall, 2009 Description: Family or Household Decision Making Types of Households/Families Why is it Important for Marketers to know about Families and Households? 1. impart lifestyle and consumption values to their members 2. influential in consumption decisions 3. make ... Date Added: 2009-06-03 20:10:02 |
| lec4.2.ppt Path: W. Alabama >> CHE >> 720 Fall, 2009 Description: DESIGN PROJECT INPUT INFORMATION Reactions & reaction conditions Desired Production Rate Marketing studies, limitations of largest unit Product purity/ price vs purity tradeoffs Market considerations, customer specs Raw materials/ price vs puri... Date Added: 2009-06-03 20:12:56 |
| Color.ppt Path: W. Alabama >> SYDE >> 777 Fall, 2009 Description: Causes of color The sensation of color is caused by the brain. Some ways to get this sensation include: Pressure on the eyelids Dreaming, hallucinations, etc. Light could be produced in different amounts at different wavelengths (compare the sun... Date Added: 2009-06-03 20:13:25 |
| lecture11.ppt Path: W. Alabama >> BIOL >> 240 Fall, 2009 Description: Lecture 11 11.13 The Formation of Hfr Strains and Chromosome Mobilization 11.14 Complementation 11.16 Mobile DNA: Transposable Elements 11.1 Genetic Map of the Escherichia coli Chromosome transfer of plasmid DNA by conjugation: conjugation contact... Date Added: 2009-06-03 20:13:27 |
| Logit_Regr_MS.doc Path: W. Alabama >> CIV >> 640 Fall, 2009 Description: Civ E 640: URBAN TRANSPORT PLANNING Calibrating Binary Logit Mode-Split Models Using Logistic Regression in SPSS Get Started With SPSS What is SPSS? SPSS is a comprehensive and flexible statistical analysis and data management system. SPSS can take ... Date Added: 2009-06-03 20:13:50 |
| peso_mines.doc Path: W. Alabama >> AFM >> 231 Fall, 2009 Description: 1Moot Court for Accounting 231: Peso Silver Mines1 In the action the appellant claimed a declaration that the shares in Cross Bow Mines Limited, hereinafter referred to as \"Cross Bow\", Mayo Silver mines Limited, hereinafter referred to as \"Mayo\", and... Date Added: 2009-06-03 20:14:21 |
| ise_useful_websites.doc Path: East Los Angeles College >> ES >> 3770 Fall, 2009 Description: Extracting rules http:/www.informatik.uni-stuttgart.de/ifi/ps/reengineering/ On-Line lecture notes: ISE on-line lecture notes: Here at Warwick for Intelligent Systems Engineering, ES377: http:/www.eng.warwick.ac.uk/staff/elh/es3770/ Foundations of AI... Date Added: 2009-06-03 20:14:57 |
| water.txt Path: W. Alabama >> STAT >> 332 Fall, 2009 Description: house x y 1 14.96 4.09 2 17.02 5.74 3 13.56 3.92 4 12.27 4.01 5 17.3 5.93 6 15.39 4.77 7 18.38 6.25 8 14.87 3.94 9 14.25 5.15 10 15.94 4.99 11 17.55 5.64 12 18.73 5.32 13 15.02 3.94 14 15.71 5.16 15 14.06 4.71 16 12.3 4.04 17 17.03 5.54 18 13.87 4.25... Date Added: 2009-06-03 20:15:44 |
| lecture_notes_-_incomparable_world_90.1_for_web_site.doc Path: East Los Angeles College >> AM >> 203 Fall, 2009 Description: Dr. Lynne Macedo Spring Term 2009 Issue 90.1 University of Warwick AM 203 CARIBBEAN LITERATURE Page 1 of 9 Incomparable World Lecture Notes Today\'s lecture is, as I am sure you are all well aware, the penultimate one for this term, and we are ther... Date Added: 2009-06-03 20:16:33 |
| H356_o.sas.txt Path: McGill >> ENQ >> 10194 Fall, 2009 Description: FILE PUT @ 1 AM68_RNO Z06. @ ... Date Added: 2009-06-03 20:17:04 |
| otitis.txt Path: Université du Québec à Montréal >> MAT >> 3880 Fall, 2009 Description: \'The Heritability of Otitis Media, A Twin and Triplet Study\' (Casselbrant et al), JAMA. 1999;282:2125-2130 http:/jama.ama-assn.org/ notes from JH I have taken the data from the second data file she sent me and put it as a plain ascii file, with n... Date Added: 2009-06-03 20:17:56 |
| startVertexDetect_wb_20040520.ppt Path: Laurentian >> PHYS >> 000148 Fall, 2009 Description: Start and Vertex Detector W. Boeglin, A.Klein Current Design: 3300 scintillating fibers 1mm diameter 3 double layers (1 axial, 2 stereo) cylindrical geometry spherical cap for forward coverage estimated position resolution < 1mm Scintillator ar... Date Added: 2009-06-03 20:19:33 |
| lecnew18.ppt Path: Toledo >> CSC >> 321 Fall, 2009 Description: CSC321 Lecture 18: Hopfield nets and simulated annealing Geoffrey Hinton Hopfield Nets A Hopfield net is composed of binary threshold units with recurrent connections between them. Recurrent networks of non-linear units are generally very hard to ... Date Added: 2009-06-03 20:20:22 |
| 17-bibliog.doc Path: Virgin Islands >> LAW >> 370 Fall, 2009 Description: A SHORT BIBLIOGRAPHY OF COMPARATIVE LAW This bibliography is compiled from the contributions to this book, and is to that extent limited: it does not purport to be comprehensive. However, the reader will find here most of the works in comparative law... Date Added: 2009-06-03 20:21:02 |
| cours304.ppt Path: Université du Québec à Montréal >> PHI >> 0200 Fall, 2009 Description: La persuasion et l\'influence http:/ruccs.rutgers.edu/ArchiveFolder/research%20Group/Publications/ra www.unites.uqam.ca/philo/cours/PHI0200/ Plan des prochaines semaines Cours 1: Quelques erreurs de raisonnement: le constat pessimiste Cours 2... Date Added: 2009-06-03 20:21:27 |
| ExosShellScripts.txt Path: Neumont >> IFT >> 1215 Fall, 2009 Description: -=[ Auteur: lia, plonky at gmail dot com ]=- Introduction Le shell est un outil fondamental dans les systmes Unix. Il sert principalement d\'interface entre l\'utilisateur et le systme d\'expl... Date Added: 2009-06-03 20:22:18 |
| centipede.ppt Path: UWI Mona >> CH >> 4904 Fall, 2009 Description: Centipede Date Sales facts Store Product Brand Promotion The product hierarchy has been split into 2 dimensions. To have the same information as a prior design, the fact table has 1 more FK. Breaking a dimension into several dimensions is easily ... Date Added: 2009-06-03 20:26:03 |
| jula117.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: EVIDENCE [Recorded by Electronic Apparatus] Tuesday, May 2, 1995 .0933 [Image] [English] The Chair: Order. We are continuing our examination of Bill C-68, An Act respecting firearms and other weapons. This morning we have a panel of witnesses co... Date Added: 2009-06-03 20:26:15 |
| math309d01.txt Path: Sveriges lantbruksuniversitet >> MATH >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: MATH 309-3 D01 LOCATION: SFU TITLE: CONT. OPTIMIZATION SECTION TYPE: LEC SEMESTER: 1998-1 ENROL: 28... Date Added: 2009-06-03 20:27:13 |
| v02n411.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From owner-cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Sat May 23 13:22:57 1998 Date: Sat, 23 May 1998 13:06:07 -0600 From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca... Date Added: 2009-06-03 20:27:42 |
| v02n411.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From owner-cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Sat May 23 13:22:57 1998 Date: Sat, 23 May 1998 13:06:07 -0600 From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca... Date Added: 2009-06-03 20:27:42 |
| jdbc_and_ssh.txt Path: Virgin Islands >> CSC >> 200901 Fall, 2009 Description: JAR File - To compile and run JAVA programs using JDBC you need the following jar file: /opt/oracle/jar/classes12.jar If you are working at your home computer, transfer that file to your computer, and then set your JAVA IDE to consider that file. ... Date Added: 2009-06-03 20:28:34 |
| CH07.ppt Path: Laurentian >> MGT >> 3360 Fall, 2009 Description: Chapter Seven Manufacturing and Service Technologies Thomson Learning 2004 71 Core Transformation Process for a Manufacturing Company ENVIRONMENT Organization Raw Material Inputs Materials Handling Milling Core Work Processes Product or Ser... Date Added: 2009-06-03 20:29:43 |
| v03.n392.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From - Tue Jun 20 16:51:44 2000 Received: from broadway.sfn.saskatoon.sk.ca (broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id GAA22103; Tue, 20 Jun 2000 06:48:34 -0600 (CST) Received: (from majordomo@loc... Date Added: 2009-06-03 20:30:10 |
| v04-n399.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca on behalf of Cdn-Firearms Digest [owner-cdn-firearms-digest@sfn.saskatoon.sk.ca] Sent: Thursday, 20 December, 2001 18:23 To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Di... Date Added: 2009-06-03 20:30:47 |
| authexamples.ppt Path: Virgin Islands >> CSC >> 370 Fall, 2009 Description: Authorization Examples A Company You are the DBA for the VeryFine Toy Company and create a relation called Employees with fields ename, dept, and salary. For authorization reasons, you also define views EmployeeNames (with ename as the only attribut... Date Added: 2009-06-03 20:30:49 |
| 5Comments6_7.doc Path: UWI Mona >> CS >> 60564 Fall, 2009 Description: Comments from Vic Ho Maintaining of Secured Owner-Controlled Clinical Data\" Who is going to issue the smart card to the clients? How the doctors are going to access the records? How the user is going to update the... Date Added: 2009-06-03 20:31:18 |
| Syll3821.doc Path: Laurentian >> MGT >> 200801 Fall, 2009 Description: UNIVERSITY OF LETHBRIDGE FACULTY OF MANAGEMENT Mgt 3821 - Visual Programming Applications (using Visual Basic .NET) Term: Instructor: Spring 2008 Brian Dobing, Room E424, 329-2492, brian.dobing@uleth.ca Class Web Page: http:/classes.uleth.ca/200801/m... Date Added: 2009-06-03 20:31:31 |
| Class5.ppt Path: Laurentian >> MGT >> 200102 Fall, 2009 Description: Process Strategy and Capacity Planning 17 July 2001 Introduction What: Making process and capacity decisions Where: Produce goods and services Why: Long term effects on company Process Focus Complete jobs on demand Low vol... Date Added: 2009-06-03 20:32:35 |
| v02n363.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From owner-cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Mon Apr 27 12:54:38 1998 Date: Mon, 27 Apr 1998 12:40:12 -0600 From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca... Date Added: 2009-06-03 20:33:24 |
| v03.n308.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: Date: Sat, 18 Mar 2000 19:59:09 -0600 Message-Id: <200003190159.TAA04426@broadway.sfn.saskatoon.sk.ca> X-Authentication-Warning: broadway.sfn.saskatoon.sk.ca: majordomo set sender to owner-cdn-firearms-digest@sfn.saskatoon.sk.ca using -f From: owner-... Date Added: 2009-06-03 20:34:26 |
| ECON483D01.TXT Path: Sveriges lantbruksuniversitet >> ECON >> 20021 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ECON 483-3 D01 LOCATION: SFU TITLE: ST-URBAN ECONOMICS SECTION TYPE: SEM SEMESTER: 2002-1 ENROL: 22 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown ... Date Added: 2009-06-03 20:34:36 |
| adab2005178.txt Path: Allan Hancock College >> ADAB >> 2005178 Fall, 2009 Description: Western Australia ANZAC Day Amendment Bill 2005 CONTENTS Part 1 - Preliminary 1. Short title 2 2. Commencement ... Date Added: 2009-06-03 20:34:53 |
| hlouocsfcaamab2008949.txt Path: Allan Hancock College >> HLOUOCSFCA >> 2008949 Fall, 2009 Description: Queensland Health Legislation (Restriction on Use of Cosmetic Surgery for Children and Another Measure) Amendment Bill 2008 Queensland Health Legislation (Restriction on Use of Cosmetic Surgery fo... Date Added: 2009-06-03 20:35:05 |
| page.txt Path: Allan Hancock College >> BP >> 250 Fall, 2009 Description: <wysiwyg page >33008AD8-D1B7-4739-A27F-FB64353077D1<p>tammy</p><p>assignment1</p><p></p><p><a class=\"media mediafile mf_ai\" title=\"bp250:08s2:elective:fish_tricks:team:duangkamol_ngamkron:assignment1.ai\" href=\"/lib/exe/fetch.php?id=cache=cache&a... Date Added: 2009-06-03 20:37:04 |
| Sathiakumar-Swamidos.doc Path: Allan Hancock College >> ELEC >> 4707 Fall, 2009 Description: Student Projects by Dr. Sathiakumar for Semester 2, 2008 [SSK1] Tracking maximum power from Solar panel to interface to the power grid (Hardware/software project) (No of student 1) There has been a strong move through out the world to utilize cleaner... Date Added: 2009-06-03 20:37:24 |
| Bjornl-Simulation.ppt Path: Allan Hancock College >> INFO >> 4990 Fall, 2009 Description: Investigating a theoretical model Bjorn Landfeldt University of Sydney Bjrn Landfeldt School of Information Technologies We\'ll look at: We have a theory and a model How do we check the accuracy of our model? Methodology Things to consider Bjrn... Date Added: 2009-06-03 20:37:32 |
| APNDIXC.DOC Path: Allan Hancock College >> WIN >> 12141 Fall, 2009 Description: ? Appendix C-Solutions to selected questions and sample exam solutions Appendix C-Solutions to selected questions and sample exam solutions Contents page Appendix C-Solutions to selected questions and sample exam solutions ..3 Week 2 Activities qu... Date Added: 2009-06-03 20:38:00 |
| aea1953144.txt Path: Allan Hancock College >> AEA >> 1953144 Fall, 2009 Description: [pic] Atomic Energy Act 1953 Act No. 31 of 1953 as amended This compilation was prepared on 8 July 2008 taking into account amendments up to Act No. 73 of 2008 The text of any of those amendments not in force on that date is appended in the Note... Date Added: 2009-06-03 20:42:34 |
| cta1991228.txt Path: Allan Hancock College >> CTA >> 1991228 Fall, 2009 Description: COURTS (CASE TRANSFER) ACT 1991 No. 43 of 1991 Version incorporating amendments as at 17 December 2008 Courts (Case Transfer) Act 1991 - TABLE OF PROVISIONS Section Page PART 1-PRELIMINARY 1. Purposes 2. Commencement 3. Definitions 4. Dele... Date Added: 2009-06-03 20:43:05 |
| waclaplb2008553.txt Path: Allan Hancock College >> WACLAPLB >> 2008553 Fall, 2009 Description: [Page Break] New South Wales Western and Crown Lands Amendment (Special Purpose Leases) Bill 2008 Contents Page 1 Name of A... Date Added: 2009-06-03 20:44:10 |
| ccjab2006344.txt Path: Allan Hancock College >> CCJAB >> 2006344 Fall, 2009 Description: Queensland Criminal Code (Double Jeopardy) Amendment Bill 2006 Queensland Criminal Code (Double Jeopardy) Amendment Bill 2006 Contents ... Date Added: 2009-06-03 20:44:24 |
| ffab2003240.txt Path: Allan Hancock College >> FFAB >> 2003240 Fall, 2009 Description: Passed by both Houses New South Wales Funeral Funds Amendment Bill 2003 Contents Page 1 N... Date Added: 2009-06-03 20:44:53 |
| 800161.ppt Path: Allan Hancock College >> EDU >> 1461 Fall, 2009 Description: EDU 2462 Biophysical Foundations of Human Movement 1 Relevant Staff Craig Daly Lecturer Room G335 Ph: 4631 2338 Email: dalyc@usq.edu.au Tony Rossi Lecturer Room G334 Ph: 4631 2337 Email: rossi@usq.edu.au Dave Robinson Lecturer Wide Ba... Date Added: 2009-06-03 20:45:01 |
| IntroSendmail.doc Path: Allan Hancock College >> CITP >> 0040 Fall, 2009 Description: Linux Style: sendmail: Introduction and Configuration Posted on Thursday, November 29, 2001 by Eric Jorn Seneca Source: http:/www.linuxjournal.com/article.php?sid=5507 A guide for those of you configuring your first e-mail server. With the growth of ... Date Added: 2009-06-03 20:46:29 |
| roea1962183.txt Path: Allan Hancock College >> ROEA >> 1962183 Fall, 2009 Description: Queensland RECORDING OF EVIDENCE ACT 1962 Reprinted as in force on 21 January 1997 (includes amendments up to Act No. 37 of 1996) Reprint No. 1A This reprint is prepared by the Office of the Queensland Parliamentary C... Date Added: 2009-06-03 20:47:07 |
| CS_Software_Evaluation_Sheet.doc Path: Allan Hancock College >> CITP >> 0042 Fall, 2009 Description: Software Evaluation Sheet Type of software Where did you locate the software? Where can you get support for this program? Your Evaluation Help/support Install/uninstall process What does this program do? How effectively does the program do what i... Date Added: 2009-06-03 20:47:31 |
| Chapter_2_ID2e_slides_ke.ppt Path: Allan Hancock College >> WEEK >> 12036 Fall, 2009 Description: Chapter 2: Understanding and conceptualizing interaction Adapted by Kathy Egea for cois10236 Recap design methodology HCI facilitates usability goals and user experiences through designing interactions to make work effective, efficient and... Date Added: 2009-06-03 20:48:49 |
| Chapter_2_ID2e_slides_ke.ppt Path: Allan Hancock College >> COIS >> 12036 Fall, 2009 Description: Chapter 2: Understanding and conceptualizing interaction Adapted by Kathy Egea for cois10236 Recap design methodology HCI facilitates usability goals and user experiences through designing interactions to make work effective, efficient and... Date Added: 2009-06-03 20:48:50 |
| ANU%20Hall%20and%20College%20Fee%20Summary%202009%20v%204.pdf?branch=main&language=default Path: Allan Hancock College >> PART >> 1674 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>2c97355b507c5cb0be40c2c316990a34c6996f4a.pdf%3Fbranch %3D</Key><RequestId>8B7FF797FE369CDD</RequestId><HostId>Zvj94Yh2An8tGeQ... Date Added: 2009-06-03 20:50:40 |
| tmb1998429.txt Path: Allan Hancock College >> TMB >> 1998429 Fall, 2009 Description: PARLIAMENT OF VICTORIA Trade Measurement (Administration) (Amendment) Act 1998 Act No. TABLE OF PROVISIONS Clause ... Date Added: 2009-06-03 20:51:46 |
| Filter_Housing_Temp.txt Path: Allan Hancock College >> PHYSICS >> 002 Fall, 2009 Description: Time Time In Secs Filter Housing Temp 2009_04_19 09:28:02 3322978082 25.8857 2009_04_19 09:28:04 3322978084 25.8405 2009_04_19 09:29:07 3322978147 25.7952 2009_04_19 09:30:10 3322978210 25.9763 2009_04_19 09:31:13 3322978273 25.8857 2009_04_19 09:32:... Date Added: 2009-06-03 20:52:02 |
| L9-InSAR&lidar.ppt Path: Texas San Antonio >> EES >> 5053 Fall, 2008 Description: InSAR and LIDAR Lecture 9 Nov 17, 2008 1. Interferometric Synthetic Aperture Radar (InSAR) Is a process whereby radar images of the same location on the ground are recorded by Two antennas of one platform separated by a few meters (single pass... Date Added: 2009-06-03 20:52:57 |
| FMCh10.ppt Path: Laurentian >> MGT >> 200901 Fall, 2009 Description: Calculating the Variance Covariance matrix MGT 4850 Spring 2009 University of Lethbridge Efficient Portfolios Efficient frontier Black (1972) convex combination of any two efficient portfolios, e.g. if we have two efficient portfolios we can fin... Date Added: 2009-06-03 20:54:03 |
| C270.doc Path: Wisc Whitewater >> C >> 270 Fall, 2009 Description: C270: Changing the order of FAQ categories. Changing the order of the FAQ Category will allow you to move FAQ Categories around. Fig 1 - Changing the Order of FAQ Categories Fig 2 - Click on FAQ Fig 3 - Click on admin Fig 4 Change the order numb... Date Added: 2009-06-03 20:55:32 |
| C270.doc Path: Wisc Whitewater >> D >> 270 Fall, 2009 Description: C270: Changing the order of FAQ categories. Changing the order of the FAQ Category will allow you to move FAQ Categories around. Fig 1 - Changing the Order of FAQ Categories Fig 2 - Click on FAQ Fig 3 - Click on admin Fig 4 Change the order numb... Date Added: 2009-06-03 20:55:32 |
| 102805_rprim.doc Path: UNC >> EC >> 434 Fall, 2009 Description: 10/28/05 Class Notes Rob Prim Econ 159 American Institutionalists cont. Thorstein Veblen John Commons John Commons Public goods: non-rival and non-exclusive Tax or subsidy to promote or discourage externalities. Negative externality: over produc... Date Added: 2009-06-03 20:55:49 |
| SED525FLFrenchLessonPlan.doc Path: CSU Northridge >> SEE >> 18618 Fall, 2009 Description: Adriana Tufenkjian SED525 Elementary French Grade level: 9th grade Textbook: Deux Mondes Chapter 1: Ma famille et moi Section: 1.5 La vie de famille: Page 54 Lesson plan on `er\' verbs Time allocated : 3 sessions Material : DVD player video clips + ... Date Added: 2009-06-03 20:56:32 |
| PublicMoneyforSportsStadiums.doc Path: Western Kentucky University >> ECON >> 420 Fall, 2008 Description: Public Money for Sports Stadiums Can\'t Be Justified Daily Policy Digest State Local Spending From 1953 to the present, more than $20 billion in public money has been lavished on construction of sports stadiums in the U.S. Tha... Date Added: 2009-06-03 20:57:53 |
| CARD_PICTIVE.ppt Path: East Los Angeles College >> CE >> 53502 Fall, 2009 Description: 1 Staffordshire UNIVERSITY School of Computing CARD (Collaborative Analysis of Requirements & Design ) Slide: 1 Prototyping 2 Staffordshire UNIVERSITY School of Computing CARD Overview Invented at Bellcore by M. Muller (1992) High level of abs... Date Added: 2009-06-03 20:59:33 |
| dbsum.txt Path: East Los Angeles College >> J >> 1141 Fall, 2009 Description: J1141-6545 0.394 116.048 175.279 -65.7553 295.791 -3.8632 1.374 1 parkes /net/hp88/psrwww/pub/data/epndb/J1141-6545/klm+00_1374.epn <TR> <TD align=\"right\">J1141-6545 |</TD> <TD align=\"right\"> 1.374 GHz</TD> <TD align=\"right\">| <a href=ht... Date Added: 2009-06-03 21:04:49 |
| ATTU19F8.doc?OpenElement Path: East Los Angeles College >> PHIL >> 212 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>2c8c185dd5213dd48a5f6864c0fbe2fdfcec2aec.doc %3FOpenEleme</Key><RequestId>868881CC2F76CC47</RequestId><HostId>p+BiJIJBjuZTTKz... Date Added: 2009-06-03 21:05:03 |
| athensform.doc Path: East Los Angeles College >> KX >> 07771 Fall, 2009 Description: Application for an Athens username All students are automatically allocated an Athens username and password. Unfortunately we cannot look your password up, however we can reset it and send the details back to you. Please read the following details a... Date Added: 2009-06-03 21:05:10 |
| 20220380200214_20050329_1045.txt Path: East Los Angeles College >> PHYSICS >> 2022038020 Fall, 2009 Description: # %NewTest # SERIAL NUMBER : 20220380200214 TEST MADE BY : drb LOCATION NAME : Oxford Run number : 1045 TEST_DATE : 29/03/2005 PASSED : YES PROBLEM : NO # %DAQ_INFO # #HOST \"PPXP281\" #VERSION \"3.43\" #DUT \"Barrel_Module\" #T... Date Added: 2009-06-03 21:05:58 |
| geog2750_13.doc Path: East Los Angeles College >> GEOG >> 2750 Fall, 2009 Description: GEOG2750 Earth Observation and GIS of the Physical Environment Dr Steve Carver School of Geography University of Leeds 13. Error and uncertainty Lecture outline: - Introduction - Error and uncertainty: terminology, types and sources - Why is it imp... Date Added: 2009-06-03 21:06:21 |
| 0901.txt Path: Virginia Tech >> CS >> 4804 Fall, 2003 Description: Sep 01, 2003 - - Recap basic search algorithms - BFS and UCS - More search algorithms: Depth First Search (DFS) - uses a stack in place of a queue - primary advantage is its space complexity - problems: does not provide optimal solution - more... Date Added: 2009-06-03 21:07:04 |
| fe100_06-07.doc Path: East Los Angeles College >> FE >> 100 Fall, 2009 Description: SCHOOL OF ENGINEERING Foundation Degree Electrical/Electronic/Mechanical Engineering FIRST YEAR 2006 / 2007 FE100 - ENGINEERING MATHEMATICS Examiner: Mark Thompson Attempt ALL EIGHT questions in SECTION A This section carries 40% of the total mark ... Date Added: 2009-06-03 21:07:13 |
| move_act_list.txt Path: East Los Angeles College >> COM >> 1080 Fall, 2009 Description: move from ?r1 to ?r2 ... Date Added: 2009-06-03 21:08:21 |
| Class19_Kemp_labor.ppt Path: Washington >> SIS >> 150 Winter, 2008 Description: The New Labor Migration in Israel General Portrait of the Phenomenon How many? How prominent? Where do they work? Where do they come from? What is their status (with/without permits) Flows of foreign workers to Israel 2001-2007 250,000 200,00... Date Added: 2009-06-03 21:10:29 |
| CommEdModels.ppt Path: Washington >> NUTR >> 536 Winter, 2008 Description: Communication & Educational Models Communication Process of sending and receiving messages s Transmission requires a mutual understanding between communicator and listener. s Education s systematic instruction, schooling or training Learning Chan... Date Added: 2009-06-03 21:11:10 |
| 19340212.TXT Path: Penn State >> BUB >> 1934 Fall, 2009 Description: Sheet1 STATE COLLEGE, PENNSYLVANIA DAILY WEATHER SUMMARY - Latest Complete Day [Midnight - Midnight LT] -02/12/34 High Temperature Low Temperature Mean Temperature Rain or Liquid Equivalent Snow and/or Ice Pellets Snow Depth 36 Rank (1=Warmest, 39=... Date Added: 2009-06-03 21:13:16 |
| study.doc Path: Iowa State >> MR >> 0728 Fall, 2009 Description: GameSpot 07-26-06 Study: Game violence has desensitizing effect Iowa State researchers find that a violent gaming session can reduce physiological response to footage of real-life violence in the short term. Playing violent games can desensitize peop... Date Added: 2009-06-03 21:15:37 |
| study.doc Path: Iowa State >> PUBLIC >> 0728 Fall, 2009 Description: GameSpot 07-26-06 Study: Game violence has desensitizing effect Iowa State researchers find that a violent gaming session can reduce physiological response to footage of real-life violence in the short term. Playing violent games can desensitize peop... Date Added: 2009-06-03 21:15:37 |
| tax.doc Path: Iowa State >> MR >> 0210 Fall, 2009 Description: Des Moines Register 02/06/06 Pro: Boost tax to cut smoking, save healthcare costs, lives By JOSEPH MURPHY SPECIAL TO THE REGISTER As a student in the state of Iowa, I support an increase in the tobacco tax, and I am not the only one. Many students a... Date Added: 2009-06-03 21:15:45 |
| tax.doc Path: Iowa State >> PUBLIC >> 0210 Fall, 2009 Description: Des Moines Register 02/06/06 Pro: Boost tax to cut smoking, save healthcare costs, lives By JOSEPH MURPHY SPECIAL TO THE REGISTER As a student in the state of Iowa, I support an increase in the tobacco tax, and I am not the only one. Many students a... Date Added: 2009-06-03 21:15:45 |
| email.txt Path: Iowa State >> AGRON >> 060413 Fall, 2009 Description: From: Adam Ciha Subject: Hills FD Still frames from tornado These images were taken from a video of the Tornado as it hit Wal-mart/Hwy 1 area of Iowa City the other night. They\'re not the best b/c they\'re from a video. It was taped by a Hills Firef... Date Added: 2009-06-03 21:16:08 |
| breed085.txt Path: Iowa State >> ANS >> 352 Fall, 2009 Description: Herd: 85 CALF CROP SUMMARY Herd: 85 Calf Crop: 1 Calf Crop: 1 Old Bulls 1 2 4 5 Young B... Date Added: 2009-06-03 21:16:25 |
| ECON250D01.TXT Path: Sveriges lantbruksuniversitet >> ECON >> 20001 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ECON 250-3 D01 LOCATION: SFU TITLE: ECON.DEVELOPMENT A SECTION TYPE: LEC SEMESTER: 2000-1 ENROL: 84 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown ... Date Added: 2009-06-03 21:16:32 |
| 1.kahlili.doc Path: Maryville MO >> PT >> 415 Fall, 2009 Description: PT 8390 CM II - PBL Case - Mrs. Tannaz Kahlili Part 1, Mrs. Tannaz Kahlili A 76 y/o female brought to the ER by her daughter and her 73 y/o husband. Patient walked with the substantial help of her daughter, and was unable to use her left arm. The on... Date Added: 2009-06-03 21:16:32 |
| EE542_452_class13.ppt Path: Boise State >> EE >> 552 Fall, 2009 Description: EE 552/452, Spring, 2007 Wireless Communications (and Networks) Zhu Han Department of Electrical and Computer Engineering Class 13 Feb. 19th, 2007 Outline Modulation Basics Amplitude Modulation Frequency Modulation EE451/551 Slides on the web ... Date Added: 2009-06-03 21:17:00 |
| EE542_452_class13.ppt Path: Boise State >> EE >> 452 Fall, 2009 Description: EE 552/452, Spring, 2007 Wireless Communications (and Networks) Zhu Han Department of Electrical and Computer Engineering Class 13 Feb. 19th, 2007 Outline Modulation Basics Amplitude Modulation Frequency Modulation EE451/551 Slides on the web ... Date Added: 2009-06-03 21:17:00 |
| MOD10_AW.TXT Path: Pittsburgh >> ENGR >> 0112 Fall, 2008 Description: The AWT Component Library 10 Course Map The JDK offers many components from which GUIs an be built. This module examines these AWT Components, and covers non-component AWT classes such as Color and Font, as well as GUI printing. Relevance 3 Present t... Date Added: 2009-06-03 21:17:32 |
| demo-partition.ppt Path: Duke >> CPS >> 001 Fall, 2009 Description: Partitioning in Quicksort s How do we partition the array efficiently? choose partition element to be rightmost element scan from right for smaller element scan from left for larger element exchange repeat until pointers cross QUICKSORTISCOOL ... Date Added: 2009-06-03 21:17:48 |
| lect03.ppt Path: Duke >> CPS >> 001 Fall, 2009 Description: Today\'s topics q q q Binary Numbers Brookshear 1.11.6 Slides from Prof. Marti Hearst of UC Berkeley SIMS Upcoming Networks Interactive Introduction to Graph Theory http:/www.utm.edu/cgi-bin/caldwell/tutor/departments/math/graph/intro Problem ... Date Added: 2009-06-03 21:19:07 |
| ex11-59.txt Path: Duke >> CH >> 113 Spring, 2009 Description: \"Cure Time 1\" \"Adhesive type\" \"Adhesive factor\" \"Cure Time\" 72.7 \"Copper\" 1 1 80 \"Copper\" 1 1 77.8 \"Copper\" 2 1 75.3 \"Copper\" 2 1 77.3 \"Copper\" 3 1 76.5 \"Copper\" 3 1 74.7 \"Nickel\" 1 1 77.4 \"Nickel\" 1 1 79.3 \"Nickel\" 2 1 77.8 \"Nickel\" 2 1 77.2 \"Nickel... Date Added: 2009-06-03 21:19:23 |
| test1s07soln.txt Path: Duke >> CPS >> 006 Fall, 2009 Description: Solution to Test 1 CompSci 6 Spring 2007 Problem 1 - Part A A. String B. int pos, int pos2 C. Brodhead, Richard D. C D E, A E. It builds a new string that is everything after the second blank, followed by a comma, followed by the original firs... Date Added: 2009-06-03 21:20:06 |
| c-5750_county_codes.doc Path: UCSB >> C >> 5750 Fall, 2009 Description: C-5750 COUNTY CODE LISTING: The indexes to this multi-county flight are separated by county, and are filed under C5750 by the three letter USDA county codes as listed below. PLEASE NOTE: Some county coverage will cross county boundaries. For example:... Date Added: 2009-06-03 21:20:45 |
| cs164lec10.ppt Path: UC Riverside >> CS >> 164 Fall, 2008 Description: CS 164: Computer N etwor ks Sl i de Set 10 - I nter networ ki ng (Conti nued) Routi ng I n thi s set . H ow a r e l i nk-sta te a l gor i thms i mpl emented i n pr a cti ce ? OSPF M obi l e I P - Secti on 4.3 - Gl oba l I nter net -Subnetti ng, C... Date Added: 2009-06-03 21:22:27 |
| 02-03-03agenda.doc Path: Rose-Hulman >> CS >> 414 Fall, 2009 Description: Software Engineering I, Team 8 Union Hospital Linear Accelerator Project Project Meeting, February 2, 2003 Agenda 1. Review Agenda [1 min] Review and modify this agenda Choose someone to run the next meeting Choose someone to take minutes 2. Outst... Date Added: 2009-06-03 21:27:17 |
| GorskiKevin_WR_08_20030203.doc Path: Rose-Hulman >> CS >> 414 Fall, 2009 Description: Individual Weekly Report Form Kevin Gorski Time Period: 01/28/03 - 02/03/03 The information given on this form represents my work on the project and is true to the best of my knowledge. Tasks completed: Updates to Print Shop Work Order form. Age... Date Added: 2009-06-03 21:27:18 |
| FEDintro.doc Path: NJIT >> FED >> 101 Fall, 2009 Description: FED for Chemical Engineering Spring 2009 R. Barat Introduction Welcome to the FED course for the Otto York Chemical Engineering Department for Spring 2009. The objectives of this course are: To provide a first engineering design, construction, ... Date Added: 2009-06-03 21:32:05 |
| hw0.old.doc Path: Youngstown >> CIS >> 3701 Fall, 2008 Description: CSCI 3701: Advanced Object-Oriented Programming Assignment 0: Using the Java SDK and the NetBeans IDE The purpose of this exercise is to introduce you to using the Java SDK (Software Development Kit) on your home PC. There is nothing to turn in or to... Date Added: 2009-06-03 21:32:13 |
| 3120SIMPLECHOWS07.doc Path: N.E. Illinois >> FCS >> 3120 Fall, 2009 Description: SIMPLE CARBOHYDRATES WORKSHEET Recipe A 2 c granulated sugar c whole milk c whipping cream 1 T light corn syrup 1 T butter or... Date Added: 2009-06-03 21:32:25 |
| GS390levelone.doc Path: CSU Bakersfield >> GS >> 390 Fall, 2009 Description: Region 8 (Kern, San Luis Obispo, Santa Barbara, Ventura Counties) Technology Certification Program Proficiency Checklist Level One: Basic Proficiency Objective: To ensure educators are able to: Communicate and collaborate electronically Plan, desi... Date Added: 2009-06-03 21:33:07 |
| ANDERSON.txt Path: UMKC >> CS >> 101 Fall, 2009 Description: Class lists for DAVID ANDERSON CS471 CAROL ADAMS LEWIS AGUILAR ANNE ARNOLD LEO BARBER JEROME BENSON VERNON BL... Date Added: 2009-06-03 21:33:22 |
| sampleanwsersfortextselection1.doc Path: Purdue >> ENGLISH >> 492 Fall, 2009 Description: Name:_Sample Student_ Date:_ Use your personal experiences to answer the following questions. Try to answer the questions as honestly as you can. This assignment will be collected and graded based on your participation. You won\'t be sharing your indi... Date Added: 2009-06-03 21:33:48 |
| AppliedAnalysisCompSyll.txt Path: UMBC >> M >> 611 Fall, 2009 Description: Comprehensive Examination Syllabus for Applied Analysis (Math 611) (1) Normed linear spaces, subspaces, finite dimensional normed linear spaces. (2) Bounded linear transformations, The principle of uniform boundedness, open mapping ... Date Added: 2009-06-03 21:34:09 |
| manpgp.txt Path: UMBC >> CS >> 202 Fall, 1997 Description: PGP(1) UNIX System V (PGP Version 2.6) PGP(1) NAME pgp - Pretty Good Privacy encryption system SYNOPSIS pgp [options] pgpfile pgp -e [options] file user . DESCRIPTION PGP (Pretty Good Privacy) is a publ... Date Added: 2009-06-03 21:34:44 |
| Lab6F08.doc Path: Arizona >> GEO >> 101 Fall, 2009 Description: Lab 6 Jurjevich GEOG 101 PHYSICAL GEOGRAPHY: Weather and Climate Fall 2008 Name_ 1. What is the definition of an air mass and what two factors distinguish air masses from one another? 2. What are the letters used my meteorologists for classi... Date Added: 2009-06-03 21:35:18 |
| hw3.doc Path: North Texas >> CSE >> 1030 Fall, 2009 Description: CSCE 1030 Homework 3 Due: Thurs, Mar 5 at the Start of class Crossing the River: Five people must cross this scary suspension bridge. There are some rules: The bridge will support at most 2 people at a time Each person or group of two must ha... Date Added: 2009-06-03 21:36:56 |
| protein.ppt Path: Wake Forest >> CHM >> 765 Fall, 2009 Description: Protein Structure two-fold symmetry (point group C2) alpha helix domains hemerythrin antiparallel beta sheets alpha/beta barrel open twisted alpha/beta domain ... Date Added: 2009-06-03 21:38:25 |
| WBBJ_new_4_log.txt Path: Michigan State University >> D >> 2105 Fall, 2009 Description: Warning: parameter fixed_couplings not found setting it to default value T A PDF is used, so alpha_s(MZ) is going to be modified Old value of alpha_s from param_card: 0.118 New value of alpha_s from PDF cteq6l1: 0.13 ** * ... Date Added: 2009-06-03 21:39:27 |
| WBBJ_new_4_log.txt Path: Michigan State University >> P >> 2105 Fall, 2009 Description: Warning: parameter fixed_couplings not found setting it to default value T A PDF is used, so alpha_s(MZ) is going to be modified Old value of alpha_s from param_card: 0.118 New value of alpha_s from PDF cteq6l1: 0.13 ** * ... Date Added: 2009-06-03 21:39:27 |
| lecture1.ppt Path: Stanford >> CS >> 262 Fall, 2009 Description: Welcome to CS262: Computational Genomics Instructor: Serafim Batzoglou TA: Eugene Fratkin Tuesday Genomics Basic concepts and scientific questions... Date Added: 2009-06-03 21:39:55 |
| lab06_checkoff.doc Path: UNI >> CS >> 061 Fall, 2009 Description: Name: _ Lab section (circle one) Lecture section (circle one) 70 1 71 2 C. S. 1 Lab 6 Instructions Before attempting to complete this sheet, please read the directions on the class website. Complete the questions and signatures on this sheet and... Date Added: 2009-06-03 21:40:09 |
| SM-2(LiHun)-simple.doc Path: Washington >> CHINESE >> 203 Fall, 2009 Description: Homework for SM-2 o I. Answer the following questions with the pattern given: mV 1. x \' S @7 m 4. A ~ + V \' c mV 5. E + II. Translate the following into Chinese: 1. Because they are influenced by t... Date Added: 2009-06-03 21:40:46 |
| ECE4371_class22.ppt Path: U. Houston >> ECE >> 4371 Fall, 2008 Description: ECE 4371/4117, Fall, 2008 Introduction to Telecommunication Engineering/Telecommunication Laboratory Zhu Han Department of Electrical and Computer Engineering Class 22 Nov. 13th, 2008 Outline Review Hamming Code Cyclic Code x x x CRC BCH RS ... Date Added: 2009-06-03 21:41:09 |
| fitted-par_f07_c1.txt Path: Stanford >> CPT >> 080619 Fall, 2009 Description: 0 8152 13 7 8.441890e-05 444 0.0000e+00 8.6270e-05 -4.8483e-05 0.0000e+00 -4.1674e-04 -4.1420e-05 0.0000e+00 -1.6844e-05 -2.7120e-04 0.0000e+00 0.0000e+00 -2.7663e-04 0.0000e+00 0.0000e+00 0.0000e+00 0.0000e+00... Date Added: 2009-06-03 21:41:42 |
| Section_3_1_Narrated.ppt Path: UNL >> MATH >> 101 Fall, 2008 Description: Section 3.1 Quadratic Functions Section 3.1 Objectives Analyze graphs of quadratic functions. Write quadratic functions in standard form and use the results to sketch graphs of functions. Use quadratic functions to model and solve real-life probl... Date Added: 2009-06-03 21:42:08 |
| quizAppendB.doc Path: UNL >> CSE >> 230 Fall, 2009 Description: CSE 230: Computer Organization Quiz 1 Name: _ 1) Consider the Boolean function given by the following table: A 0 0 0 0 1 1 1 1 B 0 0 1 1 0 0 1 1 C 0 1 0 1 0 1 0 1 X 1 0 1 0 0 1 1 1 a) Give a logic expression (any legitimate form). b) Give the sum ... Date Added: 2009-06-03 21:42:15 |
| F08.048.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F08.048 repeat_region no description available Chr08 complement(543609.549636) tgttggaataaaaatccactatcgtctatcaactaatagttatattatca atatattatcatatacggtgttaagatgatgacataagttatgagaagct gtcatcgaggttagaggaagctgaagtgcaaggattgataatgtaatagg ataatgaaacatataa... Date Added: 2009-06-03 21:42:25 |
| Foucault.ppt Path: Southwestern >> ANT >> 3520301 Fall, 2009 Description: Foucault: Discourse, Power and the Subject Broader Social & Political Context, Biography 1926-1984 France Taught and visited US (berkeley) The postmodern moment Things fall apart Student and other movements of late 1960s Nuclear crises (cuban m... Date Added: 2009-06-03 21:44:32 |
| tenure.doc Path: Iowa State >> MR >> 1207 Fall, 2009 Description: Des Moines Register 12-01-07 Intelligent design theory influenced ISU tenure vote By LISA ROSSI REGISTER AMES BUREAU December 1, 2007 Ames, Ia. - Iowa State University professor Guillermo Gonzalez\'s support of the theory of intelligent design damag... Date Added: 2009-06-03 21:46:03 |
| tenure.doc Path: Iowa State >> PUBLIC >> 1207 Fall, 2009 Description: Des Moines Register 12-01-07 Intelligent design theory influenced ISU tenure vote By LISA ROSSI REGISTER AMES BUREAU December 1, 2007 Ames, Ia. - Iowa State University professor Guillermo Gonzalez\'s support of the theory of intelligent design damag... Date Added: 2009-06-03 21:46:03 |
| ex3_fa05.doc Path: UF >> STA >> 6126 Spring, 2008 Description: STA 6126 Exam 3 Fall 2005 PRINT Name _ 1. Interchanging the rows (levels of the independent variable) in a contingency table will: a) b) c) d) Effect the chi-square statistic, but not the numbers of concordant/discordant pairs Effect the numbers of... Date Added: 2009-06-03 21:46:51 |
| p09519000611.txt Path: Auburn >> DIGDATA >> 1900 Fall, 2009 Description: 95 Moved by Mr. Terry, That the request of the Committee of the Alumni Association be granted. Carried. Mr. G. O. Dickey appeared before the Board as Chairman of the Committee of the Alumni Association and read the resolutions referred to above, sett... Date Added: 2009-06-03 21:47:09 |
| ERRATA.TXT Path: UCLA >> CACHE >> 5001 Fall, 2009 Description: Sheet1 PDS_VERSION_ID = PDS3 RECORD_TYPE = STREAM OBJECT = TEXT PUBLICATION_DATE = 2007-02-28 NOTE = \"ERRATA.TXT reflects any known deficiencies with files contained on volume GOMW_5001.\" END_OBJECT = TEXT END ERRATA This file contains a list of all ... Date Added: 2009-06-03 21:47:45 |
| activity_sheet_02.doc Path: N.C. State >> AEE >> 226 Fall, 2008 Description: AEE 226 Activity Sheet 02 Activity A: Open the file index.html from the www directory of the K drive: Add information about yourself in the top right cell. Delete the strutting wolf image and insert the bell tower instead (you might need to get t... Date Added: 2009-06-03 21:50:17 |
| 32.MMHardware.ppt Path: University of Illinois, Urbana Champaign >> CS >> 241 Spring, 2008 Description: CS 241 Fall 2006 System Programming Paging Hardware S:Ch 8.1 [333351] Roy H Campbell 05/16/09 CS241 2006 RHC and YZ, All Rights Reserved 1 Administration LMP2 Available start early New Self-Assessment Lecture Quiz coming ... Date Added: 2009-06-03 21:52:45 |
| hbpCh6.ppt Path: CSU Fullerton >> MGT >> 339 Fall, 2009 Description: Chapter 6 Strategic Management PowerPoint slides by R. Dennis Middlemist Colorado State University Competitive Advantage The objective of strategic management is to determine, create and maintain competitive advantages. Competitive advantage ter... Date Added: 2009-06-03 21:54:30 |
| Phys5350-26.ppt Path: Utah State >> PHYS >> 5350 Spring, 2008 Description: Euler Predictor-Corrector Method Let\'s estimate yn+1 using the Euler method and calculate an estimate for y\'n+1 from it. 1. Step: 2. Step: y n +1 = y n + y n \' Dx y\'n +1 = f (x n +1, y n +1 ) y n \'+ y\'n +1 y n +1 = y n + h 2 Predictor Step 3. Ste... Date Added: 2009-06-03 21:54:39 |
| 060205capitalism.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Stabroek NewsNewspaper Software newspaper publication newspaper publishing CPSG hosting Monday, February 6, 2006 Home Classifieds - General - Real Estate - Employment... Date Added: 2009-06-03 21:56:14 |
| 060205capitalism.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Stabroek NewsNewspaper Software newspaper publication newspaper publishing CPSG hosting Monday, February 6, 2006 Home Classifieds - General - Real Estate - Employment... Date Added: 2009-06-03 21:56:16 |
| HW1_Sol.doc Path: Pittsburgh >> SIS >> 2825 Fall, 2009 Description: Telcom 2825 Information Systems and Network Infrastructure Protection Homework 1, Spring 2009 more important than other critical infrastructures? Information Technology and Telecommunications are considered one of the most important infrastructures b... Date Added: 2009-06-03 21:57:34 |
| 11-FPGAsa.ppt Path: Berkeley >> CS >> 150 Fall, 1996 Description: Implementation Strategies ROMbased Design Example: BCD to Excess 3 Serial Converter BCD 0000 0001 0010 0011 0100 0101 0110 0111 1000 1001 Excess 3 Code 0011 0100 0101 0110 0111 1000 1001 1010 1011 1100 Conversion Process Bits are presented in bit se... Date Added: 2009-06-03 21:58:59 |
| 3TaxaNoMCN71QClasses.txt Path: SHSU >> LDG >> 005 Fall, 2009 Description: Class 0: q001, q010, q100, q111 Class 1: q000 Class 2: q011 Class 3: q101 Class 4: q110 ... Date Added: 2009-06-03 22:01:04 |
| Lecture28.ppt Path: California State University, Monterey Bay >> CS >> 341 Fall, 2009 Description: Homework Reading None (Finish all previous reading assignments) Machine Projects Turn in MP5 today Labs Finish lab reports by deadline posted in lab 1 Exam #2 Returned today Solution posted I have your grades up to date on my laptop, see... Date Added: 2009-06-03 22:01:36 |
| iowaranks.doc Path: Iowa State >> MR >> 0914 Fall, 2009 Description: Waterloo Cedar Falls Courier, IA 09-13-07 Iowa ranks high in home ownership By DAN GEARINO, Courier Des Moines Bureau DES MOINES - New census figures show Iowa remains a place where most people own their own homes, most parents are in the work force ... Date Added: 2009-06-03 22:02:12 |
| iowaranks.doc Path: Iowa State >> PUBLIC >> 0914 Fall, 2009 Description: Waterloo Cedar Falls Courier, IA 09-13-07 Iowa ranks high in home ownership By DAN GEARINO, Courier Des Moines Bureau DES MOINES - New census figures show Iowa remains a place where most people own their own homes, most parents are in the work force ... Date Added: 2009-06-03 22:02:12 |
| Pre-Professional Curriculum - 084.doc Path: UCCS >> MJRSHEET >> 084 Fall, 2009 Description: PROGRAM REQUIREMENTS - BACHELOR OF SCIENCE IN HEALTH CARE SCIENCE Pre-Professional Option General Education Course Requirements ENGL 131 II (Complete Competency Exam after ENGL 141) Humanities Electives (twosee LAS list... Date Added: 2009-06-03 22:03:17 |
| civl2201_2009_laboratory_materials_template.doc Path: Allan Hancock College >> CIVL >> 2201 Fall, 2009 Description: School of Civil Engineering Tests to Examine the Material Properties of Steel and Concrete Report from Laboratory Demonstrations on ? March 2009 as part of the unit of study CIVL2201 Structural Mechanics Your name Student Number Date of Report Abst... Date Added: 2009-06-03 22:05:00 |
| a07_content.doc Path: Bowling Green >> A >> 264 Fall, 2009 Description: ASSIGNMENT #7: CONTENT DESIGNER DUE: March 17, 2009 VALUE: 30 points Your name: _Katie Thomas_ kktc264 q_ TCOM 264 Kling Spring 2009 Page 1 of 3 The role of the Content Designer is to utilize collected research materials, media, interviews, etc. t... Date Added: 2009-06-03 22:08:36 |
| itk_279_2005_10_26.ppt Path: Illinois State >> ITK >> 279 Fall, 2008 Description: For Friday Read 9.5 Homework: Chapter 9, exercises 5 and 7 Program 3 due Exam 2 will be 1 week from Friday Program 3 Any questions? Paper 2 Any questions? Weighted Graphs Dykstra\'s algorithm A greedy algorithm A form of best-first searc... Date Added: 2009-06-03 22:08:43 |
| plantspecialist.doc Path: Iowa State >> MR >> 0317 Fall, 2009 Description: Mason City Globe Gazette 03/09/06 Plant specialist warns of rust disease By PAUL DELGER, Of The Globe Gazette KANAWHA - An Iowa State University plant pathologist encouraged North Iowa farmers Thursday to remain diligent in tracking potential Asian s... Date Added: 2009-06-03 22:09:04 |
| plantspecialist.doc Path: Iowa State >> PUBLIC >> 0317 Fall, 2009 Description: Mason City Globe Gazette 03/09/06 Plant specialist warns of rust disease By PAUL DELGER, Of The Globe Gazette KANAWHA - An Iowa State University plant pathologist encouraged North Iowa farmers Thursday to remain diligent in tracking potential Asian s... Date Added: 2009-06-03 22:09:04 |
| fakespace.doc Path: Iowa State >> MR >> 0519 Fall, 2009 Description: Marshalltown Times Republican, IA 05-121-06 Fakespace teams up with ISU By RYAN BRINKS Marshalltown-based Fakespace Systems, Inc. is helping Iowa State University create the most realistic virtual reality room in the world. More than $4 million in eq... Date Added: 2009-06-03 22:09:49 |
| fakespace.doc Path: Iowa State >> PUBLIC >> 0519 Fall, 2009 Description: Marshalltown Times Republican, IA 05-121-06 Fakespace teams up with ISU By RYAN BRINKS Marshalltown-based Fakespace Systems, Inc. is helping Iowa State University create the most realistic virtual reality room in the world. More than $4 million in eq... Date Added: 2009-06-03 22:09:49 |
| isustudy.doc Path: Iowa State >> MR >> 0728 Fall, 2009 Description: KCCI.com, IA 07-24-06 ISU Study Shows Link Between Behavior, Violent Video Games Researchers Say Teens Are More Desensitized To Violence AMES, Iowa - Iowa State University researchers said video games still have a big impact on how teenagers react to... Date Added: 2009-06-03 22:11:11 |
| isustudy.doc Path: Iowa State >> PUBLIC >> 0728 Fall, 2009 Description: KCCI.com, IA 07-24-06 ISU Study Shows Link Between Behavior, Violent Video Games Researchers Say Teens Are More Desensitized To Violence AMES, Iowa - Iowa State University researchers said video games still have a big impact on how teenagers react to... Date Added: 2009-06-03 22:11:11 |
| H6.rtf Path: IUPUI >> M >> 163 Fall, 2009 Description: Last Name _ H6 (due 5/23) Section 2.5 41 45 Section 2.6 1 3 7 11 13 15 17 21 25 Section 3.1 1 3 5 Your Score ID_ ... Date Added: 2009-06-03 22:11:31 |
| Notes030311.doc Path: Southern Oregon >> AME >> 3523 Fall, 2009 Description: METHOD #3 K-METHOD k1 = I xy I x I y - I xy Iy I x I y - I xy Ix I x I y - I xy 2 2 2 = - 21.33 = -0.01775 in-4 (81.18)(153.6) - (-21.33) 2 153.6 = 0.01279 in-4 (81.18)(153.6) - (-21.33) 2 81.18 = 0.006757 in-4 (81.18)(153.6) - (-21.33) 2 k2 = =... Date Added: 2009-06-03 22:13:34 |
| Mock_Final.rtf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: Mock Final Exam, Fall 1999 Definitions-one sentence on each (1/5 of exam) 1. What is the rate of inflation? 2. Why is real GDP per worker a better index of economic well-being than real GDP? 3. Why is the stock market an important leading indicator?... Date Added: 2009-06-03 22:13:56 |
| lin_dark_1012591.txt Path: Stanford >> CPT >> 080214 Fall, 2009 Description: Linearity analysis for FSN=1012591-1012678 Front camera: Rate: 541.29620DN/s Intercept: 897.33485DN Intercept: -1.6577520s Side camera: Rate: 534.93256DN/s Intercept: 861.28407DN Intercept: -1.6100797s ... Date Added: 2009-06-03 22:14:10 |
| del_f11_c0.txt Path: Stanford >> CPT >> 080619 Fall, 2009 Description: 8152 11 0 1 -0.3125 -0.8125 -583.40075684 0.34037781 0 1 -0.1875 -0.8125 -583.50915527 0.48898315 0 1 -0.0625 -0.8125 -583.50726318 0.60633850 0 1 0.0625 -0.8125 ... Date Added: 2009-06-03 22:14:59 |
| Actions0.txt Path: Virginia Tech >> CS >> 1704 Spring, 2003 Description: save lcis00 dump del 54109 del 24047 del 54107 del 54105 del 51840 del 51830 del 24045 del 54103 del 54101 del 51820 del 54099 del 24043 del 34041 del 51810 del 54097 del 34039 del 54095 del 54093 del 54091 del 24041 del 34037 del 54089 del 51800 de... Date Added: 2009-06-03 22:18:48 |
| example243.txt Path: IUP >> CH >> 355 Fall, 2009 Description: static GLintPoint corners[3]; static int numCorners = 0; if(button = GLUT_LEFT_BUTTON corner[numCorners].y = screenHeight - y; / flip y coordinate if(+numCorners = 3) { Sierpinski(corners); ... Date Added: 2009-06-03 22:18:52 |
| 709lec09do.doc Path: Maryland >> SOCY >> 709 Fall, 2008 Description: Socy 709 code on loglinear modeling * quick example of the Doll and Peto study input agecat smoker deaths person_y 1 1 32 52375 2 1 104 43144 3 1 206 28406 4 1 186 12477 5 1 102 5215 1 0 2 18788 2 0 12 10661 3 0 28 5682 4 0 28 2557 5 0 31 1431 end ge... Date Added: 2009-06-03 22:19:17 |
| sockets_in_a_nutshell.doc Path: North-West Uni. >> CS >> 340 Fall, 2009 Description: CS 340 Sockets In A Nutshell Winter05 Sockets In A Nutshell The Berkeley socket interface provides a common interface to mechanisms by which processes running on the same or on different machines can communicate. Because of its generality (the Lin... Date Added: 2009-06-03 22:21:53 |
| Fterm.ps Path: UPenn >> CIS >> 670 Spring, 2003 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: fterm.dvi %CreationDate: Tue Oct 08 12:01:14 2002 %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR10 CMBX10 CMSY10 CMMI10 CMR7 CMSY7 ... Date Added: 2009-06-03 22:23:08 |
| cs221-notes6.ps Path: Stanford >> CS >> 221 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: cs221-notes6.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMR17 CMBX12 CMR12 CMMI12 CMSY10 CMMI8 CMR8 CMR7 CMR10 %+ CMEX10 CMSY8 CMR6 CM... Date Added: 2009-06-03 22:23:43 |
| David Citron.doc Path: East Los Angeles College >> SOCS >> 314 Fall, 2009 Description: Report on David Citron\'s visit on 20 May 2005 David Citron, advisor to the United States embassy in London highlighted a `schizophrenia\' in the American mindset which penetrates to the highest levels of the government. A... Date Added: 2009-06-03 22:23:51 |
| 243_lab5_Applets.txt Path: Wisc Platteville >> CS >> 243 Fall, 2009 Description: CS/SE 2430 - Lab 5 - Applets 1. Start up NetBeans and create Lab5 on your J drive: - File/New Project - General Category, Java Application - For Project Name: Lab5 - For Project Location: J:\\ - Uncheck \"Set Main as Project\"... Date Added: 2009-06-03 22:24:19 |
| wrapup.txt Path: Grinnell >> CS >> 195 Spring, 2003 Description: CSC195, Class 56: Wrapup Overview: * Apologies * The subject matter of the course * Final comments Notes: * I don\'t really expect that anyone will read this eboard, but habit is a powerful thing. * We meet at Dari Barn today. * I\'ll miss you all... Date Added: 2009-06-03 22:25:01 |
| UNCC-IESLecture08 - ADC.ppt Path: UNC Charlotte >> ECGR >> 4101 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|12 Mar 2007 13:03:56 -0000 vti_extenderversion:SR|12.0.0.6211 vti_author:SR|MOSAIC\\jmconrad vti_modifiedby:SR|CONRADUNCCLAPTO\\Robot vti_timecreated:TR|27 Sep 2004 13:03:11 -0000 vti_title:SR|Embedded Sy... Date Added: 2009-06-03 22:25:22 |
| Readme.txt Path: UNC Charlotte >> ECGR >> 4101 Spring, 2008 Description: - PROJECT GENERATOR - PROJECT NAME : Flash_Suspend PROJECT DIRECTORY : C:\\MTOOL\\SKP16C26\\Sample_Code\\CPU_RW\\Flash_Suspend CPU SERIES : M16C/20 CPU TYPE : Other TOOLCHAIN NAME : Renesas M16C Standard Toolchain TOOLCHAIN VERSION : 5.2.0.0 GENERATION FI... Date Added: 2009-06-03 22:25:34 |
| ProjectProposal.doc Path: CSU San Marcos >> CS >> 697 Fall, 2009 Description: Geoff (Gong Fu) Marshall Te Yung (Stan) Chiang William (Wei Li) Kemper Primary Objective: Develop a three dimensional acyclic graph layout algorithm with the following constraints: Total volume of laid out graph is minimized. Total number of inte... Date Added: 2009-06-03 22:26:25 |
| lecture17-clustering.ppt Path: UMBC >> CS >> 676 Spring, 2007 Description: Introduction to Information Retrieval Lecture 17 Clustering Today\'s Topic: Clustering Document clustering Motivations Document representations Success criteria Partitional Hierarchical Clustering algorithms What is clustering? Cluster... Date Added: 2009-06-03 22:28:43 |
| L07VariablesInC.ppt Path: UMBC >> CS >> 104 Fall, 2009 Description: Variables in C Topics Naming Variables Declaring Variables Using Variables The Assignment Statement Reading Sections 2.3 - 2.4 UMBC CMSC 104, Section 0801 - Fall 2002 What Are Variables in C? Variables in C have the same meaning as variable... Date Added: 2009-06-03 22:28:57 |
| Article_Scoring_Rubric.doc Path: Murray State KY >> PSY >> 304 Fall, 2009 Description: PSY 304: Demonstration Activity #9 (Research Article) Criteria (1 pt. for each ; 0 pts. for each X) Formatted with section headings (Hypothesis, Method, etc.) Reference for source provided in correct APA style Relevant cognitive concept(s) identified... Date Added: 2009-06-03 22:30:53 |
| relchart.doc Path: Murray State KY >> PSY >> 570 Fall, 2009 Description: Sources of Internal and External Invalidity in Two Preexperimental and Three True Experimental Designs Sources of External Invalidity Selection -o Confounding of Pretest and X NA Confounding of Selection and X ? ? Sources of Internal Invalidity His... Date Added: 2009-06-03 22:30:54 |
| Reflection Electronic Portfolio.doc Path: U. Houston >> SCHATZKES >> 3242 Fall, 2009 Description: Sheila Schatzke Reflection Electronic Portfolio An electronic portfolio can be used for a variety of purposes. Wikipeda defines electronic portfolios as, \"There are three main types: developmental, reflective and representational. A developmental e... Date Added: 2009-06-03 22:31:10 |
| hwk036.ps Path: N.C. State >> ST >> 430 Fall, 2008 Description: %!PS-Adobe-3.0 %Title: hwk036.wxp %Creator: PScript5.dll Version 5.2 %CreationDate: 10/2/2003 15:1:28 %For: monahan %BoundingBox: (atend) %Pages: (atend) %Orientation: Portrait %PageOrder: Ascend %DocumentNeededResources: (atend) %DocumentSuppliedRes... Date Added: 2009-06-03 22:32:42 |
| Tryptone.txt Path: MTSU >> STAT >> 6020 Fall, 2008 Description: NAME: The Tryptone Task TYPE: Designed experiment SIZE: 30 observations, 9 variables DESCRIPTIVE ABSTRACT: Bacteria are cultured in medical laboratories to identify them so patients can be treated correctly. The tryptone dataset contains measu... Date Added: 2009-06-03 22:35:01 |
| patton_tech_team_plan.rtf Path: Maryville MO >> SKPWB >> 7366 Fall, 2009 Description: Sharon Patton Technology Support Team Plan Technology Support Team Plan Description of School Number of students: 381 (K-12) Number of faculty and staff: 70 Number/name of buildings (include grade levels housed in building): 1 Summersville Elementa... Date Added: 2009-06-03 22:35:03 |
| Chap007436.ppt Path: MTSU >> EF >> 4360 Fall, 2009 Description: Chapter Seven Asset-Liability Management: Determining and Measuring Interest Rates and Controlling Interest-Sensitive and Duration Gaps McGraw-Hill/Irwin 2008 The McGraw-Hill Companies, All Rights Reserved Asset-Liability Management The Purpose of... Date Added: 2009-06-03 22:35:17 |
| 6e.doc Path: Stevens >> E >> 344 Fall, 2009 Description: An 18-8 stainless steel is characterized by the following mechanical properties: y = 120 ksi; T = 180 ksi; elongation to failure = 12%; E = 12,000 ksi Using these four properties as guides, sketch a well-labeled stress-strain diagram for this mater... Date Added: 2009-06-03 22:36:14 |
| PH235_Rotational_Inertia_WS.doc Path: Rose-Hulman >> PH >> 235 Fall, 2009 Description: 1 PH 235 Moment of inertia review worksheet Name_ Box # _ The text p. 378 says torque about an axis is rFt, where r is the distance from the axis to the force, and Ft is the tangential component of the force. a) Use this (as the text does on p. 38... Date Added: 2009-06-03 22:36:55 |
| 2-CompOrg.ppt Path: Charleston Law >> CS >> 210 Fall, 2009 Description: Computer Science 210 Computer Organization Introduction to Computer Organization Text Figures: COPYRIGHT 1998 MORGAN KAUFMANN PUBLISHERS, INC. ALL RIGHTS RESERVED Computer Components The abstract view of a computer is commonly divided into five ba... Date Added: 2009-06-03 22:43:19 |
| language_and_terms.ppt Path: Laurentian >> ED >> 3602 Fall, 2009 Description: Language and Terms A quick overview Changing over time What was once acceptable terminology in the field is now considered deplorable language. EG Idiot / Imbecile Mentally Retarded Not Normal Handicapped Disabled Student with Sp... Date Added: 2009-06-03 22:43:25 |
| Notes16-1.doc Path: CSU LA >> CS >> 312 Fall, 2009 Description: Mark W. Berry CS 312 Lecture-Notes for 03/04/03 Review: Comparison Sort Definition: Any sort algorithm using comparisons between keys, and nothing else about the keys, to arrange items in a predetermined order. An alternative is a restricted univers... Date Added: 2009-06-03 22:46:37 |
| Notes6-1.doc Path: CSU LA >> CS >> 320 Fall, 2009 Description: Lecture notes: Monday 7/14/03 CS320 Server Side Internet Programming Summer 2003 Professor Jeffrey Miller State TCP is a stateful protocol. HTTP is stateless. It doesn\'t maintain state. Four Ways to Maintain State 1) 2) 3) 4) URL Rewriting Hidden Fo... Date Added: 2009-06-03 22:47:09 |
| call-by-name.txt Path: University of Iowa >> CS >> 185 Fall, 2009 Description: CS 185, Call-By-Name Functional Programming Last time: eager functional programming with references. Example: we can implement recursive functions using references: let fib = (let fib = mkref 0 in let Fib = lambda n. if n <= 1 then 1 ... Date Added: 2009-06-03 22:47:40 |
| commands.txt Path: California State University, Monterey Bay >> CS >> 110 Fall, 2009 Description: # test WISE type courses exit ... Date Added: 2009-06-03 22:52:41 |
| train.txt Path: Michigan State University >> ECE >> 482 Fall, 2009 Description: Initializing Task Info Starting OSSimIN1: 1 SimIN1: 1 TrainSpeed[0] = 255TrainSpeed[1] = 255SimIN1: 1 SimIN1: 1 TrainSpeed[1] = 255TrainSpeed[0] = 255SimIN1: 1 SimIN1: 1 TrainSpeed[0] = 255TrainSpeed[1] = 255SimIN1: 1 SimIN1: 1 TrainSpeed[1] ... Date Added: 2009-06-03 22:53:38 |
| Final Presentation Country Estates.ppt Path: Rose-Hulman >> CE >> 489 Fall, 2009 Description: Country Estates Final Report PARAGON Project Team Mike Reeves Project Manager Cole Marr Project Engineer Bryce Beckstrom Project Engineer Amanda Sheehe Project Editor Project Description Design Requirements Project Approach W... Date Added: 2009-06-03 22:54:23 |
| comm_skills_nov_05_part_2.doc Path: East Los Angeles College >> MD >> 901 Fall, 2009 Description: Masters Programme Module: Communication Skills: Educational Methods and Effective Clinical Practice (part 2) Wednesday 23rd Friday 25th November 2005 Room A.042 - Medical School Building Warwick Medical School Building, Gibbet Hill Campus University... Date Added: 2009-06-03 22:54:52 |
| answer06.ps Path: Allan Hancock College >> COMP >> 284 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: answer06.dvi %Pages: 9 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMBX12 CMTI12 CMR12 CMSY10 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (ww... Date Added: 2009-06-03 22:55:17 |
| hand15.txt Path: Cincinnati >> YR >> 615 Fall, 2009 Description: LINEAR MODELS III HANDOUT #15 Thanks to Misty Hein for help. DATA CHENG; DO SUBJ=1 TO 30; SS=4*RANNOR(0); DO TIME=1 TO 6; ST=2*RANNOR(0); T=TIM... Date Added: 2009-06-03 22:56:13 |
| hand15.txt Path: Cincinnati >> LM >> 615 Fall, 2009 Description: LINEAR MODELS III HANDOUT #15 Thanks to Misty Hein for help. DATA CHENG; DO SUBJ=1 TO 30; SS=4*RANNOR(0); DO TIME=1 TO 6; ST=2*RANNOR(0); T=TIM... Date Added: 2009-06-03 22:56:13 |
| hand13.txt Path: Cincinnati >> STAT >> 572 Fall, 2009 Description: SURVIVAL ANALYSIS HANDOUT #13 Fit 2 2-parameter Weibull distributions to the data (drug=0/1) DATA HMOHIV; INPUT ID @13 ENTDATE DATE7. @23 ENDDATE DATE7. TIME AGE DRUG... Date Added: 2009-06-03 22:56:52 |
| hand9.txt Path: Cincinnati >> STAT >> 534 Fall, 2009 Description: HANDOUT #9 THE OUTPUT DELIVERY SYSTEM The ODS is a new version 8 method for delivering output. It allows one to create SAS data sets out of every piece in the output window. ... Date Added: 2009-06-03 22:57:19 |
| Chapter7-AnalyzingConsumerMarketsBuyerBehavior.doc Path: FGCU >> MAR >> 6815 Fall, 2009 Description: Chapter 7 Analyzing Consumer Markets and Buyer Behavior Learning Objectives After reading this chapter students should: Understand the major factors influencing consumer behavior Know and recognize the types of buying decision behavior Understand ... Date Added: 2009-06-03 22:57:34 |
| eoc.4.txt Path: UF >> CEN >> 5035 Fall, 2008 Description: Chapter 4 Exercises 4.5 What is the critical distinction between a MILE- STONE and a DELIVERABLE? A (user) DELIVERABLE is a project result that is ... Date Added: 2009-06-03 22:58:29 |
| chap15.ppt Path: MSOE >> MS >> 342 Fall, 2009 Description: Chapter 15 Motivating Organizational Members Pamela S. Lewis Stephen H. Goodman Patricia M. Fandt Slides Prepared by Bruce R. Barringer University of Central Florida 2001 South-Western College Publishing Motivation Defined The forces and expenditure... Date Added: 2009-06-03 22:59:36 |
| Review - Consolidations.ppt Path: Idaho >> ACCT >> 592 Spring, 2008 Description: Created Subsidiaries Purpose of Setting Up Separate Corporations Subsidiary vs. Branch Limiting Legal Liability Exposure Federal income taxes Patent & Copyright Protection Meet foreign country local ownership rules Create a perception of separatene... Date Added: 2009-06-03 23:00:25 |
| lec1.rtf Path: N.C. State >> ENGR >> 517 Fall, 2009 Description: Objectorienteddesign:discoveringobjectswithCRCcards.1 ReedPhillips,PresidentofKnowledgeSystemsCorporation introducesthetape. Question:HowdoIdistributetheresponsibilityacross collaboratingobjectssothattogethertheysolvemyproblem? Objectsdecomposeprobl... Date Added: 2009-06-03 23:00:38 |
| 340Clastics.ppt Path: Wisc Green Bay >> EARTHSC >> 340 Fall, 2009 Description: Clastic Sedimentary Rocks Derived from the Mechanical Breakup and Redeposition of Older Rocks Clastic Rocks Classified by: Grain Size Grain Composition Texture Sediment Sizes and Clastic Rock Types Rock Type Shale Siltstone Sandstone Sediment Cl... Date Added: 2009-06-03 23:00:49 |
| Lecture 17 notes .doc Path: Purdue >> STAT >> 301 Fall, 2008 Description: Lecture 17 notes for Friday October 24, 2008 Chapter 14 Continued: Width of a confidence interval depends on (1) confidence level and (2) sample size. Width increases when the confidence level is increased. Width decreases when the sample size is i... Date Added: 2009-06-03 23:02:16 |
| ch9.ppt Path: CSU Dominguez Hills >> CSC >> 311 Spring, 2008 Description: Chapter 9: Maps and Dictionaries Objectives: Map ADT Hash tables Dictionary ADT Hash functions and hash code Compression functions and collisions Listbased Dictionary Hash table Dictionary Ordered search tables and binary search Skip l... Date Added: 2009-06-03 23:05:26 |
| Icebreakers and Name Games.doc Path: N.E. Illinois >> EIU >> 1111 Fall, 2009 Description: Icebreakers and Name Games Two Truths and a Lie The group members must pick three facts about themselves (characteristics, significant events, accomplishments, etc.) to share with the group. Two characteristics must be true, while the third one is... Date Added: 2009-06-03 23:05:35 |
| read_timingsheet_0.xls Path: Utah >> CS >> 3710 Fall, 2008 Description: Sheet1 Uncertainity parameter Value Uncertainity before DQS Uncertainity after DQS Tclock 7518.80 clock period Tmemory_dll_duty_cycle_dist 375.94 375.94 375.94 Duty cycle distortion from m Tdata_period 3383.46 Data period is half the Memory uncertan... Date Added: 2009-06-03 23:05:43 |
| hw3soln.ps Path: UCSD >> CSE >> 230 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: hw3soln.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Courier Times-Italic %DocumentPaperSizes: Letter %EndCom... Date Added: 2009-06-03 23:08:25 |
| hw3sol.ps Path: UCSD >> CSE >> 105 Fall, 2001 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: main.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMR10 CMBX12 CMR12 CMMI10 CMR8 CMTT10 CMSY10 %+ CMSY8 CMMI8 CMTI10 %EndComments... Date Added: 2009-06-03 23:08:28 |
| 440.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sun Nov 16 20:02:37 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.4 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:12:19 |
| 76.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Mon Sep 8 20:10:47 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:13:01 |
| 50.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sun Sep 7 07:52:41 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:13:17 |
| APDW4.ppt Path: UGA >> FORS >> 5770 Fall, 2008 Description: Applied Population Dynamics Week 4 Lecture Notes: Data Collection and Sampling SCI ENCE AND M ANAGEM ENT Using models to make predictions and to inform management decisions Using data to evaluate outcomes and to improve model predictions SCI ENC... Date Added: 2009-06-03 23:14:49 |
| sg1.doc Path: W. Kentucky >> CSC >> 364 Fall, 2009 Description: CSC 364 Study Guide for Midterm 1 Exam Date: Thursday, September 21 or Tuesday, September 26 The actual exam date will be announced at least 1 week prior to the exam Material for the exam will come from chapters 4-5, 7-8, 10 as follows. When you are ... Date Added: 2009-06-03 23:17:13 |
| Acct6270-001.doc Path: UNC Charlotte >> ACCT >> 6270 Spring, 2008 Description: ADVANCED FINANCIAL ACCOUNTING II Acct 6270-001 Spring 2009 Dr. Suzanne K. Sevin Office: Friday 262B Office Phone: 704-687-7612 Office Hours: Monday, 9:00am 11:00am; Tuesday Thursday, 5:30pm 6:30pm E-Mail: ssevin@uncc.edu... Date Added: 2009-06-03 23:18:07 |
| 97q06.doc Path: Drake >> ECON >> 173 Fall, 2009 Description: Intermediate Microeconomic Analysis (Econ 173) Drake University, Spring 1997 William M. Boal Signature: Printed name: ID number: QUIZ #6: February 25, 1997 INSTRUCTIONS: This quiz is closed-book, closed-notes, but calculators are permitted. Only an... Date Added: 2009-06-03 23:18:14 |
| detailed_log.txt Path: Southern Oregon >> CASA >> 400 Fall, 2009 Description: 2008-04-06 03:48:05 CDT - BEGIN (Anl, 2008-04-06.08:40Z, casa400, casa_anal) 2008-04-06 03:48:09 CDT - Processing background grids for hours 0 - 0 [Using 20080406_06Z NAM12 run] 2008-04-06 03:48:39 CDT - Processing data for 7 radars: KSAO KRSP KLWE K... Date Added: 2009-06-03 23:18:39 |
| boardregents.doc Path: Iowa State >> MR >> 0803 Fall, 2009 Description: Iowa City Press Citizen, IA 08-02-07 Board tables naming discussion By Brian Morelli Iowa City Press-Citizen CEDAR FALLS - The Iowa state Board of Regents set aside a portion of a policy manual update that could affect the Wellmark-University of Iowa... Date Added: 2009-06-03 23:20:51 |
| boardregents.doc Path: Iowa State >> PUBLIC >> 0803 Fall, 2009 Description: Iowa City Press Citizen, IA 08-02-07 Board tables naming discussion By Brian Morelli Iowa City Press-Citizen CEDAR FALLS - The Iowa state Board of Regents set aside a portion of a policy manual update that could affect the Wellmark-University of Iowa... Date Added: 2009-06-03 23:20:51 |
| phy284spr08syl.doc Path: Illinois State >> PHY >> 284 Spring, 2008 Description: PHY 284 - Quantum Mechanics I - Spring 2008 Instructor: Dr. Epaminondas Rosa, Jr. office: MLT 312 B, phone: 438-5193 email: erosa@ilstu.edu web: www.phy.ilstu.edu/~erosa/phy284.html Lectures: MWF from 10:00 a.m. to 10:50 a.m., MLT 215. Office hours: ... Date Added: 2009-06-03 23:21:35 |
| financial.doc Path: Iowa State >> MR >> 0504 Fall, 2009 Description: Des Moines Register, IA 04-29-08 Does the industry still need financial assistance? And should the money go to out-of-state investors? By PAULA LAVIGNE REGISTER STAFF WRITER Companies controlled by investors outside the state are the top recipients o... Date Added: 2009-06-03 23:21:50 |
| financial.doc Path: Iowa State >> PUBLIC >> 0504 Fall, 2009 Description: Des Moines Register, IA 04-29-08 Does the industry still need financial assistance? And should the money go to out-of-state investors? By PAULA LAVIGNE REGISTER STAFF WRITER Companies controlled by investors outside the state are the top recipients o... Date Added: 2009-06-03 23:21:50 |
| PVNRT_2_00.DOC Path: Frostburg >> P >> 263 Fall, 2009 Description: Name_ Partners_ _ Further Analysis of Gas Law Results Please enter the values of room temperature and atmospheric pressure here, and write your equation in the form which has mgas in a term that\'s separate from the term with mbottle. Room temperatur... Date Added: 2009-06-03 23:22:44 |
| smusylsum.03.doc Path: SMU - Cox School of Business >> FINA >> 6222 Fall, 2008 Description: Finance 6027 Summer 2003 Professor Harvey Rosenblum SMU Office: 106 Fincher Preliminary Syllabus Financial Markets and Monetary Policy Wed., 6:30-9:30 pm McGuire 353 FRB Phone: 214-922-5055 FAX 972-248-1119 E-mail: harvey.rosenblum@dal.frb.org harve... Date Added: 2009-06-03 23:23:11 |
| SN20.pdf Path: Bergen CC >> ECON >> 100 Fall, 2009 Description: Section Notes 20, Econ 100A Spring 06 1 Section Notes 20 Covering material from Lecture on March 23rd Class Outline 1. Advertising 2. Factor Markets Finish Problems from last section notes. 1 Advertising As was discussed in lecture, when a rm s... Date Added: 2009-06-03 23:24:20 |
| eboard.56.txt Path: Grinnell >> CS >> 195 Spring, 2003 Description: CSC195, Class 56: Wrapup Overview: * Apologies * The subject matter of the course * Final comments Notes: * I don\'t really expect that anyone will read this eboard, but habit is a powerful thing. * We meet at Dari Barn today. * I\'ll miss you all... Date Added: 2009-06-03 23:27:28 |
| 8Hick study.ppt Path: Texas >> PSY >> 387 Fall, 2008 Description: Some Psychological Applications of IT Hick (1952) Choic e RT 1 2 bits 3 ... Date Added: 2009-06-03 23:28:50 |
| Chi-Square Examples 1-2 Answers.doc Path: Texas >> PSY >> 418 Fall, 2008 Description: SPSS Worksheet: Chi-Square EXAMPLE 1: A researcher is interested in factors that are involved in course selection. A sample of 50 students is asked, \"Which of the following factors is most important to you when selecting a course?\" Students must choo... Date Added: 2009-06-03 23:29:00 |
| week12-f07.ppt Path: ASU >> CSE >> 471 Fall, 2008 Description: 11/5 Bayes Nets project due Prolog project assigned Today: FOPC-Resolution Thm Proving; Situation CalculusLeading to planning 1.small ( x) pet ( x) aptPet ( x) 2.dog ( x) pet ( x) 3.cat ( x) pet ( x) 4.elephant ( x) pet ( x) 5.skunk ( x) small... Date Added: 2009-06-03 23:30:29 |
| Syl_2007s.doc Path: ASU >> MAT >> 170 Fall, 2009 Description: MAT 170 Instructor: Dr. Anmin Zhu SLN : 28638 Telephone: (480) 965-6437 MAT170 URL: http:/math.asu.edu/fym/Courses/mat170/mat170.html Topic Calendar Week 1/16-1/19 1/22-1/26 1/29-2/2 2/5-2/9 2/12-2/16 2/19-2/23 2/26-3/2 3/5-3/9 3/12-3/16 3/19-3/23 3/... Date Added: 2009-06-03 23:31:01 |
| Lecture1_3.ppt Path: UMDNJ >> BINF >> 5311 Fall, 2009 Description: BINF5311 Object Programming in Java Shankar Srinivasan Module 1, Topic 3 Advanced Java language features The keywords this and super Abstract classes and interfaces Methods for handling strings in Java Wrapper classes The Java class li... Date Added: 2009-06-03 23:33:30 |
| RandomNumbers.vb.txt Path: DePaul >> IT >> 236 Fall, 2009 Description: \' Project RandomNumbers \' Show how to use the Next and NextDouble methods of the Random class \' to generate random numbers. Imports System.Console Public Module Module1 Public Sub Main() Dim r As New Random Dim n As Integer ... Date Added: 2009-06-03 23:36:45 |
| 06_linklist.txt Path: Nevada >> CS >> 302 Fall, 2008 Description: / / CS 308 program 6_linklist.cpp - Written by D.C. Williams for 2/8/05 class / / Program to create and access a dynamically allocated singly linked list / to hold inventory data. / #include <iostream> #include <cstdio> using namespace std; cons... Date Added: 2009-06-03 23:38:15 |
| finalpaper.doc Path: Michigan State University >> ECE >> 482 Fall, 2009 Description: Satellite Tracking System Design Team 2 EXECUTIVE SUMMARY The S.T.A.R.S. (Satellite Tracking for Amateur Radio System) design team has developed a portable and easy to use satellite tracking system. The prototype was developed for Dr. Shanblatt with... Date Added: 2009-06-03 23:39:24 |
| Reflection Electronic Portfolio.doc Path: UH Clear Lake >> SCHATZKES >> 3242 Fall, 2009 Description: Sheila Schatzke Reflection Electronic Portfolio An electronic portfolio can be used for a variety of purposes. Wikipeda defines electronic portfolios as, \"There are three main types: developmental, reflective and representational. A developmental e... Date Added: 2009-06-03 23:40:44 |
| 2sampcase.doc Path: Chester >> ECO >> 502 Fall, 2009 Description: Memorandum To: Terry Statlove From: Ms. Nostat Date: 5/17/2009 Re: Tennis Racquet Price Changes Thank you for your response to my last memo. I was disappointed that the evidence regarding the substandard material was inconclusive. I have decided ... Date Added: 2009-06-03 23:42:13 |
| Final%20Presentation%20Country%20Estates.ppt Path: Rose-Hulman >> CE >> 489 Fall, 2009 Description: Country Estates Final Report PARAGON Project Team Mike Reeves Project Manager Cole Marr Project Engineer Bryce Beckstrom Project Engineer Amanda Sheehe Project Editor Project Description Design Requirements Project Approach W... Date Added: 2009-06-03 23:42:47 |
| Week14.doc Path: Allegheny >> C >> 112 Fall, 2009 Description: Week 14 Solutions, p 1 Chem. 112 S09 Dr. Guldan Chemistry 112 Week 14 Solutions: 11.51 (a)The solubility equilibrium is AgBr(s) Ag + (aq) + Br - (aq). [Ag + ] = [Br - ] = 8.8 -7 mol -1 = S = solubility 10 L K sp = [Ag + ][Br - ] = (8.8 10-7 ) (8... Date Added: 2009-06-03 23:44:16 |
| Knuth-Morris-Pratt.ppt Path: Michigan State University >> CSE >> 960 Fall, 2008 Description: Knuth-Morris-Pratt Algorithm left to right scan like the nave algorithm one main improvement on a mismatch, calculate maximum possible shift to the right for the pattern Basic Idea Definition For each position i in pattern P, define spi(P) to b... Date Added: 2009-06-03 23:46:12 |
| 011206emergency.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: IHT Article Print Page Copyright 2001 The International Herald Tribune | www.iht.com Argentina Raids Pension Funds Compiled by Our Staff From Dispatches AP, Reuters Friday, Dece... Date Added: 2009-06-03 23:47:09 |
| HCAD 5220 Homework 4.doc Path: Trinity U >> HCAD >> 5320 Fall, 2009 Description: HCAD 5220 Fall 2008 Ed Schumacher Homework 4 1. At BigCounty Community Hospital the administrator has implemented multiple innovations to attempt to reduce overall length of stay in the public hospital. You have been asked to assess if these efforts... Date Added: 2009-06-03 23:47:29 |
| attacking.ps Path: UVA >> CS >> 551 Fall, 2008 Description: #%-12345X@PJL JOB @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: http:/dlib.computer.org/so/boo %Creator: AdobePS5.dll Version 5.1.2 %CreationDate: 10/26/2000 8:49:26 %BoundingBox: (atend) %Pages: (atend) %Orientatio... Date Added: 2009-06-03 23:48:18 |
| 582h7.ps Path: University of Illinois, Urbana Champaign >> MATH >> 582 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: ttemp.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMB10 CMR10 CMBX10 CMTI10 CMMI10 CMR7 CMMI7 CMSY10 %+ Millennial-BlackboardBold %Docu... Date Added: 2009-06-03 23:56:28 |
| r-eg-04.txt Path: Washington University in St. Louis >> MA >> 322 Fall, 2009 Description: Example R programs and commands 4. Combinations and permutations # All lines preceded by the \"#\" character are my comments. # All lines preceded by the \">\" character are my input. # All other lines are the R program output. # Coun... Date Added: 2009-06-03 23:57:15 |
| quiz_question_answers.doc Path: Arizona >> NATS >> 101 Fall, 2006 Description: Answers to the Quiz Questions Practice Quiz 1. Winter, carbon monoxide 2. Converging, rise 3. Water vapor (H2O) and carbon dioxide (CO2) 4. a. photochemical reactions & d. reactions involving ozone 5. Acidic, ammonia 6. Secondary, summer, afternoon 7... Date Added: 2009-06-03 23:57:53 |
| lab3.doc Path: UC Riverside >> CS >> 010 Fall, 2008 Description: CS 10 - Lab 3 In this lab you will learn some basic concepts about programming and write a short program that uses arithmetic operations. The TA will go over the following topics. Be sure you understand these topics, ask questions if necessary. They ... Date Added: 2009-06-03 23:58:25 |
| decision.ppt Path: Penn State >> M >> 330 Fall, 2009 Description: Consumer Behavior Decision making Types of Purchase Behavior and the Consumer Decision Making Process Consumer Behavior Decision making Outline Types of purchase decisions Need arousal Information acquisition (types of search, determinants of s... Date Added: 2009-06-03 23:58:55 |
| p1d.ps Path: St. Vincent >> PH >> 111 Fall, 2001 Description: ... Date Added: 2009-06-03 23:58:56 |
| AmericaFirstrevised.ppt Path: UCSB >> GEOG >> 135 Fall, 2009 Description: America Land of Free Home of Brave Don\'t Mess With Texas Quick Facts for America 295,734,134 People (July 2005 estimate) .92% Population Growth Rate 2.08 Children per Women 77.71 Years of Average Life Expectancy $40,100 per Capita GDP 4.4%... Date Added: 2009-06-04 00:00:51 |
| Ch21 Path: Seneca >> BUSINESS >> LAW380 Fall, 2008 Description: CHAPTER 21 TERMINATING THE EMPLOYMENT RELATIONSHIP Objectives After studying this chapter, you should have an understanding of: how the employment relationship ends the differences among dismissals for just cause, dismissals with notice, constructi... Date Added: 2009-06-04 09:44:55 |
| module 2 Path: Seneca >> BUSINESS >> AIT 803 Spring, 2009 Description: Module 2: Business process modelling the human side Preview Improving organizational performance and increasing customer satisfaction to achieve competitive advantage are the stated objectives of many organizations today, and for some longstanding o... Date Added: 2009-06-04 10:17:12 |
| crim313e01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: CRIM 313-3 E01 LOCATION: SFU TITLE: SPECIFIC TYPES-CRIME SECTION TYPE: SEM SEMESTER: 1997-1 ENROL: 25... Date Added: 2009-06-04 13:13:22 |
| out4040401.txt Path: Mt. Holyoke >> SPT >> 130 Fall, 2009 Description: * Analysis of file x4040401 * melanterite spt130 120K - Melanterite Cloutis SPT 130 120K - NCHAN FLCHN 512 521.7 Calibration coefficients CAL0 and CAL1: -3.8910618 0.0155935 Fitted spectrum has filename: fs... Date Added: 2009-06-04 13:13:52 |
| PHONE LOG RECORDER-AIRLIE GARDENS.doc Path: UNC Wilmington >> MKT >> 341 Fall, 2009 Description: PHONE LOG: AIRLIE GARDENS NAME_ TEAM_ CLASS: 9:00 OR 10:00 (circle your class above) ACTION CODES: NA no answer CB/NA call back/no answer R refused CB/R call back refused C completed CB/C call back/completed LAST NAME, FIRST NAME DATE/TIME AC... Date Added: 2009-06-04 13:15:53 |
| 2006-02-21Disparate Conservative Assessments of Bush.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: February 21, 2006 Books of The Times | \'Rebel in Chief\' and \'Impostor\' Disparate Conservative Assessments of Bush By MICHIKO KAKUTANI The portraits of President George W. Bush served up by these two new books could not be more at odds. Both authors ... Date Added: 2009-06-04 13:18:46 |
| 2006-09-03Opium Harvest at Record Level in Afghanistan.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: September 3, 2006 Opium Harvest at Record Level in Afghanistan By CARLOTTA GALL KABUL, Afghanistan, Sept. 2 Afghanistans opium harvest this year has reached the highest levels ever recorded, showing an increase of almost 50 percent from last... Date Added: 2009-06-04 13:19:39 |
| 2004-11-07The Term Ahead- Bush Prepares for Changes in Programs and Cabinet.txt Path: Western Kentucky University >> TXT >> 323 Fall, 2009 Description: The Term Ahead: Bush Prepares for Changes in Programs and Cabinet November 7, 2004 By RICHARD W. STEVENSON WASHINGTON, Nov. 6 - President Bush\'s aides are preparing the groundwork to move ahead with his plans to overhaul the tax code and Social S... Date Added: 2009-06-04 13:19:47 |
| peer1_solutions.doc Path: Ohio State >> STAT >> 135 Winter, 2008 Description: Solutions to Peer Review for Exam 1 Group A In March of last year, the postmaster for a medium-sized city of 100,000 people wanted to plan for the expected crowds filing their tax returns at the last minute. To do this, she decided to estimate the pe... Date Added: 2009-06-04 13:20:34 |
| Cpr-08.ppt Path: Arizona >> FILES >> 21792 Fall, 2009 Description: Elective in CPR Instruction Sam Keim, MD Emergency Medicine University of Arizona College of Medicine Why should we care? 700,000 cardiac arrests per year 250,000 die Survival to hospital discharge neurologically intact 3 - 8% Substantial vari... Date Added: 2009-06-04 13:21:19 |
| m_3411438_ne_11_1_20070609.txt Path: Arizona >> ARID >> 34114 Fall, 2009 Description: Metadata: Identification_Information: Citation: Citation_Information: Originator: USDA-FSA-APFO Aerial Photography Field Office Publication_Date: 20080109 Title: NAIP Digital Ortho Photo Image Geospatial_Da... Date Added: 2009-06-04 13:21:22 |
| grp6_wk9.ppt Path: UCSD >> ECE >> 191 Fall, 2004 Description: ECE 191: Group 6 Wk9 Physical Activity Meter Mentor: Paul Blair, Ph.D Group: Joshua Ramos Joseph Sabet Tommy Truong Sponsored by: Calit2 1 Agenda Gantt Chart Tasks performed Summary Plans for next week 2 Gantt Chart Jan 2009 Feb 2009 1/25 2/1... Date Added: 2009-06-04 13:21:58 |
| grp3_wk2.ppt Path: UCSD >> ECE >> 191 Fall, 2004 Description: Team 3 Mentors : SPIRIT Dr. Farhad Tadayon, Ken Loomis CEAM Prof. Sia NematNasser UCSD Mr. Jon Isaacs Team members: Channa Bou Chris Beltran Soheil Banisadr Formed after Boeing Commercial Airlines sold thei... Date Added: 2009-06-04 13:21:58 |
| 3512.ps Path: Neumont >> IFT >> 3512 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: R:/BOULO/COURS/IFT3512/3512.dvi %CreationDate: Mon Mar 22 15:58:50 2004 %Pages: 26 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMBX10 CMR10 CMMI7 CMSY... Date Added: 2009-06-04 13:23:12 |
| ch09.ppt Path: La Salle >> TEACH >> 230 Fall, 2009 Description: Microsoft Visual Basic 2005: Reloaded Second Edition Chapter 9 Structures and Sequential Access Files Objectives After studying this chapter, you should be able to: Create a structure Declare and manipulate a structure variable Create an array o... Date Added: 2009-06-04 13:23:26 |
| 02-Event_Proposal_Form.doc Path: UC Davis >> LOG >> 0509 Fall, 2009 Description: International 2005 University of California, Davis Education Week International Education Week November 14-18, 2005 EVENT PROPOSAL FORM (Please submit to Parvin Damania by July 15th , if possible) Contact Name: Department/Organization Event Title... Date Added: 2009-06-04 13:24:36 |
| 02-Event_Proposal_Form.doc Path: UC Davis >> ATT >> 0509 Fall, 2009 Description: International 2005 University of California, Davis Education Week International Education Week November 14-18, 2005 EVENT PROPOSAL FORM (Please submit to Parvin Damania by July 15th , if possible) Contact Name: Department/Organization Event Title... Date Added: 2009-06-04 13:24:36 |
| lec21.doc Path: UNC Asheville >> CSCI >> 333 Fall, 2009 Description: CSCI 333: TSP The Problem The Traveling Sales Person problem is an optimization problem: find the shortest route through a set of cities visiting each city only once. The set of cities is represented as a graph and the roads between them as edges.... Date Added: 2009-06-04 13:26:05 |
| superconductors-1.ppt Path: Washington >> COURSES >> 576 Fall, 2009 Description: www.physics.ku.edu http:/qt.tn.tudelft.nl/research/fluxqubit/qubit_rabi.jpg http:/www-drecam.cea.fr/ Heike Kamerlingh Onnes Superconductivity in Hg 1911 1933 1957 1962 1997 1998 1999 2000 2002 2006 Bardeen, Cooper, Schrieffer Theory of Superconduc... Date Added: 2009-06-04 13:27:20 |
| squeeze.ps Path: Columbia >> WW >> 2040 Fall, 2009 Description: %!PS-Adobe-2.0 %Copyright: Copyright (c) 1993 ATT, All Rights Reserved ... Date Added: 2009-06-04 13:27:55 |
| hw4.ps Path: Duke >> CPS >> 296 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o hw4.ps hw4 %DVIPSParameters... Date Added: 2009-06-04 13:28:13 |
| JS-Personnel+Technician-June,+\'07.doc Path: UNC >> READ >> 4826950 Fall, 2009 Description: PERSONNEL TECHNICIAN General Statement of Duties Performs varied paraprofessional personnel technician, assistant and department reception duties. Distinguishing Features of the Class An employee in this classis responsible for assisting employees an... Date Added: 2009-06-04 13:34:55 |
| ANU%20Hall%20and%20College%20Fee%20Summary%202009%20v%204.pdf?branch=main&language=default Path: Allan Hancock College >> PART >> 1674 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>2c97355b507c5cb0be40c2c316990a34c6996f4a.pdf%3Fbranch %3D</Key><RequestId>8B7FF797FE369CDD</RequestId><HostId>Zvj94Yh2An8tGeQ... Date Added: 2009-06-04 13:35:02 |
| Session14_Completely_Randomized_Factorial_Designs.ppt Path: Idaho >> WEBPAGES >> 507 Fall, 2009 Description: Completely Randomized Factorial Design With Two Factors Assumptions: In addition to the assumptions that we already talked about this design assumes: 1) Two or more factors, each factor having two or more levels. 1) All levels of each factor are inve... Date Added: 2009-06-04 13:36:20 |
| ling110d01.txt Path: Sveriges lantbruksuniversitet >> LING >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: LING 110-3 D01 LOCATION: SFU TITLE: THE WONDER OF WORDS SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 22... Date Added: 2009-06-04 13:37:02 |
| ch1.ppt Path: UNC Charlotte >> SIS >> 5160 Fall, 2009 Description: Introduction to Database Systems Chpt 1 Instructor: Xintao Wu Database Management Systems Ramakrishnan Gehrke 2 History y 60s ... Date Added: 2009-06-04 13:37:47 |
| 10AM-SSI-2.doc Path: Oregon State >> GEO >> 300 Winter, 2008 Description: 10 AM Recitation Students Painting the Inside of the Student Sustainability Center For the OSU Student Sustainability Initiative Saturday, April 11, 12PM 4PM Contact Person: Matt Jager (SSI Activities Coordinator) matthew.j.jager@gmail.com Location:... Date Added: 2009-06-04 13:37:56 |
| output.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-6W4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3432 02/17/2008 06:36 PM <DIR> . 02/17/2008 06:36 ... Date Added: 2009-06-04 13:38:19 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 20:19:00 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 21:36:36 2008 ( 4656 s elapsed) ... Date Added: 2009-06-04 13:40:14 |
| PowerGenerationDistribution.ppt Path: RMCAD >> EEE >> 381 Winter, 2009 Description: EEE381B Aerospace Systems & Avionics Power generation and distribution Refs: -Mulukutla S. Sarma, Introduction to Electrical Engineering , Oxford University Press, 2001 -AgustaWestland report N. EU91L501A rev 5, EH101 CSH Electrical Load Analysis I... Date Added: 2009-06-04 13:42:11 |
| finalstdgd2005.doc Path: St. Francis IL >> ECON >> 100 Fall, 2009 Description: ECONOMICS 100.13 STUDY GUIDE FINAL EXAMINATION 2005 Note that 1/3 of the final examination will be multiple choice questions drawn from the text book test bank. The study guide and the web site multiple choice questions will give you practice with si... Date Added: 2009-06-04 13:43:03 |
| 622initialthoughts.rtf Path: Buffalo State >> PHY >> 622 Summer, 2003 Description: Thoughts from initial meeting regarding PHY622 5June03 @BSC: Marie Plumb, Dan M and Dewayne Beery. Documents are they develop are available at <http:/physicsed.buffalostate.edu/courses/03/summer/PHY622/> Suggestions, corrections, different ideas are ... Date Added: 2009-06-04 13:45:28 |
| Projectile Motion Lab.doc Path: Buffalo State >> PHY >> 690 Fall, 2009 Description: Projectile Motion Lab v 1.1 Name _ Date _ Purpose The purpose of this lab is to explore Projectile motion. In particular the relationship between the horizontal and vertical motions of objects launched horizontally from different heights. In this ... Date Added: 2009-06-04 13:45:34 |
| syllabus.doc Path: Princeton >> FILES >> 300 Fall, 2009 Description: Fall 2006 Moby-Dick Unbound 1 Objectives An introduction to literary analysis and research, using Melville\'s Moby-Dick (1851). We examine its religious, philosophical, and aesthetic riddles while exploring critical essays and learning to use onlin... Date Added: 2009-06-04 13:46:58 |
| Sexual_Orientation.rtf Path: CSU San Marcos >> PSYC >> 352 Fall, 2009 Description: Chapter Ten Sexual Orientations 276 SEXUAL ORIENTATION A Continuum of Sexual Orientations Terminology lesbian) * * gay males lesbian females homosexual orientation: attraction to same sex partner (aka gay or bisexual orientation: attraction to bo... Date Added: 2009-06-04 13:48:04 |
| wmst-101 syllabus.doc Path: CSU San Marcos >> WMST >> 101 Fall, 2009 Description: WMST 101-Introduction to Women\'s Studies, Fall 2003 Section 5-Tues. & Thurs. 11:30-12:45 (CRN 41565) University Hall 100 This course is based on class discussion and student participation and is taught by a team of students and faculty. Teaching Tea... Date Added: 2009-06-04 13:48:11 |
| ATPR_OCP_F08a_T11_V1.1.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Acceptance Test Procedure and Results (ATPR) Version 1.1 Acceptance Test Procedure and Results (ATPR) Team # 11 Web-based Service for TPC Foundation Brijen Ved Kevin Sanghavi Natasha Julka Sheena Singh Prathima Naidu Ankitsinh Rana Ely Lerner Pat... Date Added: 2009-06-04 13:49:30 |
| 326.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sun Oct 26 18:32:39 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-04 13:49:31 |
| DS212_03.ppt Path: S.F. State >> ONLINE >> 212 Fall, 2008 Description: Chapter 3: Displaying and Describing Categorical Data The three rules of data analysis won\'t be difficult to remember: 1. Make a picture-things may be revealed that are not obvious in the raw data. These will be things to think about. 2. Make a pic... Date Added: 2009-06-04 13:50:11 |
| 06-03.ppt Path: Washington >> FACULTY >> 481 Spring, 2009 Description: 06/03 Administrative Discussion questions on Counterhack available Schedule Tuesday legal aspects of security and privacy Thursday software and network attacks (1/2) general discussion (1/2) discussion questions due on e-reserve material fr... Date Added: 2009-06-04 13:50:33 |
| student_chap8.ppt Path: Washington >> FACULTY >> 142 Winter, 2009 Description: Chapter 8 Applications of Aqueous Equilibria Chapter 8: Applications of Aqueous Equilibria 8.1 Solutions of Acids or Bases Containing a Common Ion 8.2 Buffered Solutions 8.3 Exact Treatment of Buffered Solutions 8.4 Buffer Capacity 8.5 Titrations an... Date Added: 2009-06-04 13:50:51 |
| ex2.ps Path: Maple Springs >> CSE >> 6117 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMBX12 CMSY8 CMMI12 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f ... Date Added: 2009-06-04 13:51:21 |
| asymptotic.doc Path: UCSC >> CMPS >> 101 Spring, 2008 Description: CMPS 101 Algorithms and Abstract Data Types Summer 2006 Asymptotic Growth of Functions We introduce several types of asymptotic notation which are used to compare the relative performance and efficiency of algorithms. As we\'ve seen in comparing Inse... Date Added: 2009-06-04 13:51:29 |
| syllabus.ppt Path: NJIT >> CS >> 505 Fall, 2009 Description: Welcome to Lab 505 1, Lab instructor: Yanzhi Bai yb8@njit.edu http:/web.njit.edu/~yb8/ office hour: half an hour after the lab, GITC 4402, or by appointment, or by email too. 2, all work move to `eclipse\' 3, lab work is due at end of the each lab. Ho... Date Added: 2009-06-04 13:54:12 |
| section01.doc Path: SUNY IT >> CSC >> 555 Fall, 2009 Description: Some architecture scenarios. 1. You want to set up your e-commerce unit. How big should it be? What kind of architecture do you propose? Clients Servers Internet In other words, how many servers (HTTP, Applications, DB, .)? Should the server pool ... Date Added: 2009-06-04 13:55:37 |
| syllabus.doc Path: MSOE >> MYWEB >> 100 Fall, 2009 Description: EE-100 Introduction to Electrical Engineering 8/21/08 Prof: Office: Phone: Email: Dr. Mossbrucker Dr. Reyer S-342 S-345A 414-277-7418 414-277-7347 mossbruc@msoe.edu reyer@msoe.edu Dr. Williams (Prog Dir) S-339 414-277-7420 williams@msoe.edu Dr. Wrate... Date Added: 2009-06-04 13:58:02 |
| moviemaker_tutorial.doc Path: U. Houston >> CUIN >> 3112 Fall, 2008 Description: Instructions for Editing a Movie with Windows Movie Maker 1. Connect to or insert into the computer the storage device containing the movie/video files to be edited. (This may be a diskette, flash drive/memory stick, CD, camera or camcorder with a US... Date Added: 2009-06-04 13:58:54 |
| G04.338.075.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >G04.338.075 Chr04 contig 338 bases 524914.528174 CTATACGCTTCAAATGGATCGTGTTTACTGCTTCGCTCCAAATCGTTTTC CGAATTGTGCGCTCTCTGAGTTTTGAAATAGCGCCTCTTTCCACACTTGT AAAGTTCAGCACCTATCCAGAATGCAATTGTGAATGCAATGGCGAGACCC CATTCAGCACCAATTGGTTTATGCAAAAACACTTTATCATTAATAA... Date Added: 2009-06-04 14:00:53 |
| Simulation_3.doc Path: Ohio State >> EE >> 743 Fall, 2009 Description: Simulation #3 (ECE743/Spring 2009) 1. Problem 1: Consider a permanent magnet dc motor. The rotor is initially at stall with TL = 0 and Bm = 6.04 10-6 N m s. the armature is stepped from zero to 6 V while the change in T L is zero. The motor is rated... Date Added: 2009-06-04 14:00:56 |
| c115c1208.ppt Path: Christian Brothers >> CHEM >> 115 Fall, 2009 Description: Chapter 12 Solutions Dr. S. M. Condren Solution Solutions, in chemistry, homogeneous mixtures of two or more substances. Dr. S. M. Condren Solute The substance that is present in smallest quantity is said to be dissolved and is called the solute.... Date Added: 2009-06-04 14:01:52 |
| Chapter_10.ppt Path: Wake Forest >> PHYSICS >> 113 Fall, 2009 Description: Chapter 10:Rotation of a rigid object about a fixed axis Reading assignment: Chapter 10.1 to10.4, 10.5 (know concept of moment of inertia, don\'t worry about integral calculation), 10.6 to 10.8 Homework: (due Thursday, April, 06) Problems: CQ1, CQ5, ... Date Added: 2009-06-04 14:02:46 |
| Exercise10.doc Path: Mississippi State >> ECE >> 3714 Fall, 2009 Description: Datasheet for Lab #10: Basic Memory Devices Revision: 3_30_09 SR Latch (NOR) 1. Draw a symbol for an SR latch (NOR Implementation) 2. Draw a schematic for an SR latch (NOR Implementation) 3. Write the state table for an SR latch (NOR Implementatio... Date Added: 2009-06-04 14:03:38 |
| s26.ppt Path: UNI >> CS >> 161 Fall, 2009 Description: Artificial Neural Networks Biological Inspiration Brain vs. Computers The Perceptron Multilayer networks Some Applications ICS611 1 Biological inspiration Animals are able to react adaptively to changes in their external and internal environment, ... Date Added: 2009-06-04 14:04:10 |
| emailSep14th2.txt Path: UNI >> CS >> 080 Fall, 2009 Description: From jacobson@math-cs.cns.uni.edu Fri Sep 14 19:10:59 2001 Date: Fri, 14 Sep 2001 17:41:52 -0500 (CDT) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-080-01@uni.edu, 810-080-02@uni.edu Subject: HW #1 and HW #2 averages. Hi 080 students, ... Date Added: 2009-06-04 14:04:14 |
| slides13.ppt Path: UF >> CIS >> 4301 Fall, 2008 Description: Information and Database Systems I Spring 2009 February 24, 2009 Announcements Assignment 2 Due Thursday. Quiz 3 on Thursday March 5th SQL, up to what we cover today CIS4301 - Spring 2009 SQL Full Relation Operations So far we\'ve worked with... Date Added: 2009-06-04 14:05:29 |
| Greenreaction.doc Path: Uni. Westminster >> BGH >> 0605 Fall, 2009 Description: Hines 1 Brandon Hines Econ 253 Dick Chapman September 11, 2007 Increase of Green for Carmakers at Frankfurt According to \"Green fleets, fat profits on display at Frankfurt show,\" from Rueters writer Erik Kirschbaum, the international car market sale... Date Added: 2009-06-04 14:07:43 |
| Syllabus.doc Path: La Verne >> ECBU >> 511 Fall, 2009 Description: University of La Verne School of Business and Global Studies Management Support Systems EcBu 511 Instructor and Class Information Name: Dr. Yehia Mortagy `Ben\' Office: Landis 211 Phone: (909) 593-3511 ext 4556 E-mail: mortagyy@ulv.edu Class Schedule:... Date Added: 2009-06-04 14:07:44 |
| lr.ps Path: Princeton >> COS >> 320 Spring, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: lect.dvi %Pages: 27 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 596 842 %DocumentFonts: Times-Bold Times-Roman Times-Italic Courier %EndComments %DVIP... Date Added: 2009-06-04 14:09:45 |
| submit.txt Path: Washington >> V >> 15027 Fall, 2009 Description: executable = allgamma_15027.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-06-04 14:10:53 |
| submit.txt Path: Washington >> V >> 16731 Fall, 2009 Description: executable = allgamma_16731.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 14:10:58 |
| submit.txt Path: Washington >> V >> 11513 Fall, 2009 Description: executable = allgamma_11513.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:12:18 |
| log.txt Path: Washington >> V >> 12500 Fall, 2009 Description: 000 (46297.000.000) 01/31 19:17:25 Job submitted from host: <128.95.94.28:1098> . 001 (46297.000.000) 01/31 22:41:41 Job executing on host: <172.25.101.45:1057> . 006 (46297.000.000) 01/31 23:01:49 Image size of job updated: 381268 . 005 (46297.000.0... Date Added: 2009-06-04 14:14:08 |
| problem26_35.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 26.35: RC VQ I V Q I Q Q t t ... Date Added: 2009-06-04 14:14:59 |
| error.txt Path: Washington >> V >> 11929 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Jan 31 00:19:27 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Jan 31 01:38:08 2008 ( 4721 s elapsed) ... Date Added: 2009-06-04 14:15:47 |
| error.txt Path: Washington >> V >> 11500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Jan 30 21:47:30 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 23:02:17 2008 ( 4487 s elapsed) ... Date Added: 2009-06-04 14:16:14 |
| submit.txt Path: Washington >> V >> 11618 Fall, 2009 Description: executable = allgamma_11618.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:17:24 |
| log.txt Path: Washington >> V >> 15369 Fall, 2009 Description: 000 (48864.000.000) 02/04 05:07:36 Job submitted from host: <128.95.94.28:1098> . 001 (48864.000.000) 02/04 11:14:42 Job executing on host: <172.25.101.183:1063> . 010 (48864.000.000) 02/04 11:17:40 Job was suspended. Number of processes actually su... Date Added: 2009-06-04 14:19:19 |
| submit.txt Path: Washington >> V >> 15094 Fall, 2009 Description: executable = allgamma_15094.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-06-04 14:19:27 |
| Trans Fatty Acids.ppt Path: Laurentian >> BCHM >> 2300 Fall, 2009 Description: Trans Fatty Acids The King and I (Hans-aka Jeff, and Elvis aka Will) So what\'s the big deal? In 1995 trans fatty acids make up an estimated 4-12% of the average American\'s dietary fat intake (Roach et al 2004). That\'s 2-4% of total energy input, o... Date Added: 2009-06-04 14:19:37 |
| log.txt Path: Washington >> V >> 15214 Fall, 2009 Description: 000 (48709.000.000) 02/04 05:07:03 Job submitted from host: <128.95.94.28:1098> . 001 (48709.000.000) 02/04 09:37:27 Job executing on host: <172.25.101.176:1056> . 006 (48709.000.000) 02/04 09:57:35 Image size of job updated: 465292 . 006 (48709.000.... Date Added: 2009-06-04 14:19:57 |
| output.txt Path: Washington >> V >> 15260 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-645QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3732 02/04/2008 10:16 AM <DIR> . 02/04/2008 10:16 ... Date Added: 2009-06-04 14:20:22 |
| output.txt Path: Washington >> V >> 15444 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-205QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2376 02/04/2008 11:59 AM <DIR> . 02/04/2008 11:59 ... Date Added: 2009-06-04 14:20:25 |
| submit.txt Path: Washington >> JOBS >> 10080 Fall, 2009 Description: executable = pass6_10080.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10000-10499/10080... Date Added: 2009-06-04 14:20:47 |
| output.txt Path: Washington >> JOBS >> 10328 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-F2WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1068 02/07/2008 02:59 AM <DIR> . 02/07/2008 02:59 ... Date Added: 2009-06-04 14:22:59 |
| output.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5ZVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3608 02/07/2008 02:27 AM <DIR> . 02/07/2008 02:27 ... Date Added: 2009-06-04 14:24:20 |
| submit.txt Path: Washington >> JOBS >> 10364 Fall, 2009 Description: executable = pass6_10364.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10000-10499/10364... Date Added: 2009-06-04 14:25:47 |
| ICOM4015-lec05-f06.ppt Path: UPR Mayagüez >> ICOM >> 4015 Fall, 2009 Description: Decisions Advanced Programming ICOM 4015 Lecture 5 Reading: Java Concepts Chapter 6 Fall 2006 Slides adapted from Java Concepts companion slides 1 Lecture Goals To be able to implement decisions using if statements To understand how to group state... Date Added: 2009-06-04 14:27:19 |
| prontuario.doc Path: UPR Mayagüez >> ICOM >> 4036 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|03 Oct 2003 14:17:34 -0000 vti_extenderversion:SR|5.0.2.4330 vti_title:SR|Department of Electrical and Computer Engineering vti_backlinkinfo:VX|courses/spring2002/inel4206/inel4206.htm courses/Fall2003/... Date Added: 2009-06-04 14:27:28 |
| lec07.ppt Path: UPR Mayagüez >> INEL >> 4206 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|10 Apr 2002 13:08:22 -0000 vti_extenderversion:SR|5.0.2.3409 vti_title:SR|Intel Pentium Register Set vti_backlinkinfo:VX|courses/spring2002/inel4206/inel4206.htm vti_syncwith_ece.uprm.edu\\:21/public_htm... Date Added: 2009-06-04 14:27:44 |
| veto_0.40mip_veto_rib_B.ps Path: Stanford >> EXP >> 061001 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: vetoOut/veto_0.40mip_veto_rib_B.ps: rib_B %Creator: ROOT Version 5.10/00 %CreationDate: Mon Oct 9 11:15:03 2006 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} de... Date Added: 2009-06-04 14:28:56 |
| syllabus.doc Path: Colorado State >> ACT >> 205 Fall, 2008 Description: ACT205 Fundamentals of Accounting Fall 2008 Dr. William Mister Rockwell Hall 246 Office Phone: 970 491-6256 Email: William.Mister@colostate.edu Dr. Melanie Middlemist Rockwell Hall 235 Office Phone 970 491-7441 Email mmiddlem@lamar.colostate.edu R... Date Added: 2009-06-04 14:29:38 |
| Blood Vessels2007.ppt Path: Erskine >> BG >> 101 Fall, 2009 Description: Blood Vessels Types of vessels Arteries and arterioles Capillaries Carry blood away from heart Connect arterial system to venous system Site of exchange of substances Return blood from periphery to heart Veins and venules Arter... Date Added: 2009-06-04 14:30:22 |
| 02 - Loops & 3D.doc Path: Syracuse >> PHY >> 307 Fall, 2008 Description: PHY307, Science and Computers I Lab #2, September 5, 2002 (due by end of lab period) and HWK #3 (due September 10, 11:30AM) Loops and 3D objects Summary of what you will do: The goal is to for you to gain more practice at Python by writing loops to ... Date Added: 2009-06-04 14:31:47 |
| Winter 06 Lecture 1 introduction updated.ppt Path: Oregon State >> BA >> 321 Fall, 2008 Description: BA 321 Agenda for Lecture 1 Course administration Introduction to cost accounting Break Entrance exam BA 321 Administration Syllabus Course Requirements Course Materials and Resources How to Succeed BA 321 Course Requirements Fina l Ex a m... Date Added: 2009-06-04 14:32:01 |
| test3.ps Path: Kentucky >> MA >> 113 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: t3.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o t3.ps t3 %DVIPSParameters: dpi=300, comments removed %DVIPS... Date Added: 2009-06-04 14:32:45 |
| kllist4.txt Path: Utah >> SPIN >> 152 Fall, 2009 Description: Block: 4 Size: 45 - Printing 5 polynomials . Maximum Degree: 3 -> q^3 Maximum Coefficient: 1 -> 1 - 0 1 q q^2 q^3 ... Date Added: 2009-06-04 14:34:43 |
| rbasis21.txt Path: Utah >> SPIN >> 134 Fall, 2009 Description: Block 21: - 0: 0: 1 1: 1: 1 2: 0: q-1 2: 1 3: 1: q-1 3: 1 4: 0: q-1 4: 1 5: 1: q-1 5: 1 6: 0: q-1 6: 1 7: 1: q-1 7: 1 8: 0: q^2-2q+1 2: q-1 6: q-1 8: 1 9: 1: q^2-2q+1 3: q-1 7: q-1 9: 1 10: 0: q^2-2q+1 4: q-1 6: q-1 10: 1 1... Date Added: 2009-06-04 14:34:55 |
| rlist31.txt Path: Utah >> SPIN >> 134 Fall, 2009 Description: Block: 31 Size: 77 - Printing 33 polynomials . Maximum Degree: 11 -> q^11-2q^10+q^9 Maximum Coefficient: 2 -> q^2-2q+1 - 0 1 q-1 -q+1 q^2-q q^2-2q+1 -q^2+2q-1 q^3-q^2 -q^2+q -q^3+2q^2-q q^3-2q^2+q q^4-2q^3+q^2 q^4-q^3 -q^3+q^2 -q^4+2q^3-q^2 q^5-q^... Date Added: 2009-06-04 14:34:59 |
| submit.txt Path: Washington >> JOBS >> 31496 Fall, 2009 Description: executable = pass6_31496.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31000-31499/31496... Date Added: 2009-06-04 14:38:56 |
| output.txt Path: Washington >> V >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-685QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1948 12/03/2007 11:44 AM <DIR> . 12/03/2007 11:44 ... Date Added: 2009-06-04 14:42:54 |
| output.txt Path: Washington >> V >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-535QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2476 12/03/2007 12:54 PM <DIR> . 12/03/2007 12:54 ... Date Added: 2009-06-04 14:45:42 |
| Lecture 2_Natural selection and genetic variation.ppt Path: Idaho >> WEBPAGES >> 548 Fall, 2009 Description: Genetic Variation and Natural Selection Outline A quick refresher on natural selection, genetic variation, and adaptation Definitions Types of phenotypic variation Natural selection and adaptation single genes - Quantifying genetic variation - ... Date Added: 2009-06-04 14:45:53 |
| black.rtf Path: SUNY Albany >> PAD >> 504 Fall, 2008 Description: ~ lint (L4e I I z@c@c @ R@uft I @(. @ka) Using the Internet to Support K-12 Education in Black River, Vermont Marianne Gordimer grew up in your hometown, Black River Vermont, and her mother still lives there. Marianne is a senior Vice President in... Date Added: 2009-06-04 14:46:31 |
| Fertilizer Lab 1-3-06.ppt Path: University of Illinois, Urbana Champaign >> HORT >> 105 Spring, 2008 Description: Objectives To understand the importance of fertilizers and pH To distinguish fertilizer types To calculate fertilizer rates for their home gardens Apply fertility concepts to a vegetable experiment Soil Fertility and Fertilizers What is a f... Date Added: 2009-06-04 14:46:35 |
| diophantus.ps Path: Berkeley >> CS >> 191 Spring, 2005 Description: %!PS-Adobe-3.0 %Pages: (atend) %BoundingBox: 0 0 540 770 %HiResBoundingBox: 0.000000 0.000000 539.400000 769.900000 %. %Creator: GNU Ghostscript 707 (pswrite) %CreationDate: 2004/09/08 12:15:04 %DocumentData: Clean7Bit %LanguageLevel: 2 %EndComments ... Date Added: 2009-06-04 14:46:54 |
| 5desk.txt Path: Pittsburgh >> CS >> 1501 Fall, 2006 Description: A a Aachen Aalborg aardvark Aarhus Aaron AB Ab abaci aback abacus Abadan abaft abalone abandon abandoned abandonedly abandonment abase abasement abash abashed abashedly abashment abate abatement abattoir abbacy abbe abbess abbey abbot Abbott abbrevia... Date Added: 2009-06-04 14:47:05 |
| edpr416f04.txt Path: Sveriges lantbruksuniversitet >> EDUC >> 19972 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: EDPR 416-4 F04 LOCATION: OFF TITLE: EDUCATIONAL PRACTICE SECTION TYPE: SEC SEMESTER: 1997-2 ENROL: 7 ... Date Added: 2009-06-04 14:47:36 |
| tipping_point_megan.ppt Path: Purdue >> OLS >> 386 Fall, 2008 Description: The Tipping Point Written By: Malcolm Gladwell The Tipping Point Is: The moment of critical mass The dramatic moment in an epidemic when everything changes at once Things tip because of the dramatic efforts of a select few In order to c... Date Added: 2009-06-04 14:48:51 |
| StudentDriverCertification.doc Path: Centre >> EDU >> 343 Fall, 2009 Description: CENTRE COLLEGE DRIVER CERTIFICATION For drivers of college-owned or leased vehicles or personal vehicles on college-related business. By my signature below, I certify that: 1. I have a valid driver\'s license (copy attached). 2. I have not accumulated... Date Added: 2009-06-04 14:49:49 |
| assignment1assessment.doc Path: Allan Hancock College >> CS >> 3000 Fall, 2009 Description: ISYS3000 Information Systems Management _ ISYS3000 Assessment for assignment 1 Section Part A Excel. 4 Completeness of answers Clarity of explanations Quality of written expression Part B 1a 1b 1c 1d 2a 2b 2c 2d 3a 3b 3c 3d 4 5 6 Good 3 Satisfact... Date Added: 2009-06-04 14:50:41 |
| Pulling Your Dars.doc Path: ASU >> FMS >> 394 Spring, 2008 Description: How to Pull Your D.A.R.S Report 1. Visit my.asu.edu 2. Login to your \"My ASU\" 3. My ASU will open with two tabs on the far right; one labeled \"My Info\" the other labeled \"My Stuff\" 4. If not already open, please click the \"My Info\" tab (circled belo... Date Added: 2009-06-04 14:50:45 |
| showcase.doc Path: Iowa State >> PUBLIC >> 1116 Fall, 2009 Description: Wallace\'s Farmer, IA 11-15-07 Modern Marvels to Showcase Future of Corn Compiled By Staff The History Channel program \"Modern Marvels\" is exploring the topic of corn and will feature several Iowa State University experts in a broadcast on Monday, Nov... Date Added: 2009-06-04 14:51:20 |
| cs211_26_4.ps Path: UWO >> CS >> 211 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - cs211_26 %Creator: Windows NT 4.0 %CreationDate: 10:40 3/26/2002 %Pages: (atend) %BoundingBox: 9 15 784 596 %LanguageLevel: 1 %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend) %EndComments % %... Date Added: 2009-06-04 14:51:35 |
| cs457_11.ps Path: UWO >> CS >> 457 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 45 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where {... Date Added: 2009-06-04 14:52:08 |
| exam1 reviewChapter 2.doc Path: UCF >> MAR >> 4803 Fall, 2008 Description: Exam 1 Review Videos: Garfield, Blairwitch Project, Southwest Airlines Chapter 1-Strategic Planning and Marketing Management Organizational growth strategies p. 11 The mission statement Criteria for setting marketing objectives Strategic plan what it... Date Added: 2009-06-04 14:54:45 |
| problem21_92.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 21.92: a) f ( x) a 0 f ( x) : a a f ( x)dx 0 a f ( x)dx a a a 0 f ( x)dx a a 0 f ( x)d ( x) a 0 f ( x)dx. Now replace x with y : a 0 f ( x)dx 0 f ( y )d ( y ) f ( x)dx 2 f ( x)dx. g ( x) : a a b) g ( x) a 0 g ( x)dx 0 a g ( x)dx a... Date Added: 2009-06-04 14:55:49 |
| output.txt Path: Washington >> V >> 17000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-2W4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1272 02/06/2008 01:16 AM <DIR> . 02/06/2008 01:16 ... Date Added: 2009-06-04 14:56:18 |
| log.txt Path: Washington >> V >> 17000 Fall, 2009 Description: 000 (50562.000.000) 02/05 23:53:12 Job submitted from host: <128.95.94.28:1098> . 001 (50562.000.000) 02/05 23:53:51 Job executing on host: <172.25.101.181:1056> . 006 (50562.000.000) 02/06 00:13:59 Image size of job updated: 462764 . 006 (50562.000.... Date Added: 2009-06-04 14:57:26 |
| lab2.ps Path: Washington University in St. Louis >> CS >> 241 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: lab2.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o lab2.ps lab2.dvi %DVIPSParameters: dpi=300, compressed, c... Date Added: 2009-06-04 15:01:34 |
| submit.txt Path: Washington >> JOBS >> 30218 Fall, 2009 Description: executable = pass6_30218.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30218... Date Added: 2009-06-04 15:04:05 |
| log.txt Path: Washington >> JOBS >> 30347 Fall, 2009 Description: 000 (55344.000.000) 02/10 07:49:24 Job submitted from host: <128.95.94.28:1098> . 001 (55344.000.000) 02/10 09:27:02 Job executing on host: <172.25.101.162:1060> . 006 (55344.000.000) 02/10 09:47:11 Image size of job updated: 352204 . 005 (55344.000.... Date Added: 2009-06-04 15:04:35 |
| error.txt Path: Washington >> JOBS >> 30475 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 10:12:10 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 10:54:57 2008 ( 2567 s elapsed) ... Date Added: 2009-06-04 15:04:45 |
| submit.txt Path: Washington >> JOBS >> 30182 Fall, 2009 Description: executable = pass6_30182.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30182... Date Added: 2009-06-04 15:05:18 |
| DLE Ch.9-Strat. Implementation-Controls, Culture & Governance.ppt Path: UNC Wilmington >> MGT >> 455 Fall, 2009 Description: Strategy Implementation Controls, Organizational Culture, and Corporate Governance UNCWCSB MGT455 Spring 2009 Based on DL&E, Ch. 9 and other sources Prof. Carlos L. Rodriguez Outline Strategy implementation and Strategic Control Systems Inform... Date Added: 2009-06-04 15:07:06 |
| 3104Fa07Test2Solutions.xls Path: Georgia Tech >> ISYE >> 3104 Fall, 2008 Description: a. Produce in period 8 for periods 8, 9, and 10 (40 + 20 + 30 = 90 units) Produce in period 4 for periods 4, 5, 6, and 7 (50 + 50 + 10 + 20 = 130 units) Produce in period 1 for periods 1, 2, and 3 (20 + 50 + 10 = 80 units) b. Produce in period 7 for ... Date Added: 2009-06-04 15:07:08 |
| Intro.ps Path: UCSD >> CSE >> 240 Spring, 2001 Description: %!PS-Adobe-3.0 %Title: (L1 Intro) %Creator: (Microsoft PowerPoint: PSPrinter 8.3.1) %CreationDate: (2:21 AM Tuesday, September 29, 1998) %For: () %Pages: 28 %DocumentFonts: Times-Roman Times-Italic Times-Bold MonotypeSorts Helvetica-Bold Helvetica-Bo... Date Added: 2009-06-04 15:11:43 |
| error.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 19 20:48:24 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 19 22:07:07 2008 ( 4723 s elapsed) ... Date Added: 2009-06-04 15:12:24 |
| output.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3652 02/19/2008 09:17 PM <DIR> . 02/19/2008 09:17 ... Date Added: 2009-06-04 15:13:04 |
| output.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-G15QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2376 02/19/2008 10:35 PM <DIR> . 02/19/2008 10:35 ... Date Added: 2009-06-04 15:13:12 |
| submit.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: executable = pass6_6_80443.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80000-80499/804... Date Added: 2009-06-04 15:14:12 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
