Course Solutions And Notes - koehler-questionnaire 2c
| GGRFSecondOpinion.pdf Path: Duke >> POLSCI >> 233 Fall, 2008 Description: Lets Get a Second Opinion: International Institutions and American Public Support for War Joseph M. Grieco Christopher Gelpi Jason Reifler Peter D. Feaver August 2007 For comments on earlier drafts, we thank Carol Atkinson, Marco Cesa, Michael Cox... Date Added: 2009-01-10 02:54:27 |
| GGRFSecondOpinion.pdf Path: Duke >> POLSCI >> 309 Fall, 2008 Description: Lets Get a Second Opinion: International Institutions and American Public Support for War Joseph M. Grieco Christopher Gelpi Jason Reifler Peter D. Feaver August 2007 For comments on earlier drafts, we thank Carol Atkinson, Marco Cesa, Michael Cox... Date Added: 2009-01-10 02:54:32 |
| GGRFSecondOpinion.pdf Path: Duke >> GS >> 310a Fall, 2008 Description: Lets Get a Second Opinion: International Institutions and American Public Support for War Joseph M. Grieco Christopher Gelpi Jason Reifler Peter D. Feaver August 2007 For comments on earlier drafts, we thank Carol Atkinson, Marco Cesa, Michael Cox... Date Added: 2009-01-10 18:13:08 |
| Midterm Paper #2 Path: Ithaca College >> SOCI >> 21400 Spring, 2008 Description: Cheri Berger Definitions of Normality Midterm paper- with discussed extension 2. The standards of normality set by the communities, in which the law-abiding citizens reside, make it possible to point out issues of deviance where forth people can be r... Date Added: 2008-05-25 22:06:57 |
| CNS221_7.ppt Path: Caltech >> BI >> 187 Fall, 2008 Description: CNS 221 - Spring 2006 Lecture 7 (2006-Apr-18) Wolfgang Einhuser Treyer Stability of fixed points For a fixed point to be stable, the real part of both eigenvalues of the matrix J fp = must be negative. Hence (whiteboa... Date Added: 2009-01-11 20:35:08 |
| CH105 Lecture 11 Stoichiometry Path: Skidmore >> CHEM >> 105 Fall, 2008 Description: ... Date Added: 2008-04-07 09:11:38 |
| 2_28_08 Path: St. Joseph CT >> PSYC >> 245 Spring, 2008 Description: www.dhsthepromise.com jeff soilder who committed suicide at 23 after war ... Date Added: 2008-04-07 09:59:20 |
| DATE05-Hung.pdf Path: Penn State >> CSE >> 578 Fall, 2008 Description: Thermal-Aware Task Allocation and Scheduling for Embedded Systems W-L. Hung, Y. Xie, N. Vijaykrishnan, M. Kandemir, and M. J. Irwin The Pennsylvania State University, University Park, PA 16802, USA {whung,yuanxie,vijay,kandemir,mji@cse.psu.edu} Abstr... Date Added: 2009-01-09 09:40:49 |
| DATE05-Hung.pdf Path: Penn State >> CSE >> 598c Fall, 2008 Description: Thermal-Aware Task Allocation and Scheduling for Embedded Systems W-L. Hung, Y. Xie, N. Vijaykrishnan, M. Kandemir, and M. J. Irwin The Pennsylvania State University, University Park, PA 16802, USA {whung,yuanxie,vijay,kandemir,mji@cse.psu.edu} Abstr... Date Added: 2009-01-09 09:40:49 |
| 06-inverse Path: Harvard >> MATH >> 21b Spring, 2004 Description: 10/8/2003, THE INVERSE HOMEWORK: Section 2.3: 10,20,30,40*,42*, Section 2.4: 14,28,40*,72* Math 21b, O. Knill DIAGONAL: 2 0 A= 0 3 REFLECTION: cos(2) sin(2) A= sin(2) - cos(2) A-1 = 1/2 0 0 1/3 cos(2) sin(2) sin(2) - cos(2) A-1 = A = INVERTIBLE... Date Added: 2008-04-06 23:46:25 |
| 2230-f05.pdf Path: Pittsburgh >> PSY >> 2230 Fall, 2008 Description: Department of Psychology University of Pittsburgh Syllabus for PSY 2230 Clinical Assessment I Fall Term 2004 Instructor: Andrew Koffmann, Ph.D. Clinical Psychology Center 412-624-2077 koffmann@pitt.edu Patricia A. Matestic, M.S. Clinical Psychology... Date Added: 2009-02-02 20:08:29 |
| ackerberg2.pdf Path: Maryland >> ECON >> 664 Fall, 2008 Description: _ih|t?}c wi@h?}c @?_ L?t 4ih LUi ? , Tihi?Ui BLL_ @h!i|tG ? ,4ThU@* , @4?@|L? #@?i* Nw @?_ U!ihMih}W ,+ @hU 2.c 2ff2 Devwudfw Wklv sdshu hpslulfdoo| dqdo|}hv glhuhqw hhfwv ri dgyhuwlvlqj lq d qrq0gxudeoh/ h{shulhqfh jrrg pdunhw1 D g|qdplf ohduqlq... Date Added: 2009-02-06 19:30:29 |
| 315-08-Q4A.pdf Path: Rutgers >> 694 >> 484 Spring, 2008 Description: Name_Section (day) _ 1) Name the organism that is the source of the cDNA clones that you are sequencing. (one point) Caenorhabditis brenneri 2) How are the DNA chains separated for DNA sequence analysis? (one point) Chains are electrophoresed on a g... Date Added: 2009-01-11 18:05:29 |
| 315-08-Q4A.pdf Path: Rutgers >> 090 >> 311 Fall, 2008 Description: Name_Section (day) _ 1) Name the organism that is the source of the cDNA clones that you are sequencing. (one point) Caenorhabditis brenneri 2) How are the DNA chains separated for DNA sequence analysis? (one point) Chains are electrophoresed on a g... Date Added: 2009-01-12 04:11:48 |
| 315-08-Q4A.pdf Path: Rutgers >> MBB >> 315 Fall, 2008 Description: Name_Section (day) _ 1) Name the organism that is the source of the cDNA clones that you are sequencing. (one point) Caenorhabditis brenneri 2) How are the DNA chains separated for DNA sequence analysis? (one point) Chains are electrophoresed on a g... Date Added: 2009-02-04 14:53:01 |
| Exam2review.ppt Path: Siena >> CSIS >> 114 Fall, 2009 Description: Exam 2 Sample Questions Coordinating in-bound and out-bound logistics is most likely a function of a a) b) c) d) SCM System Accounting System CRM System Marketing System Inventory control and inventory management is most likely a function of a a) b... Date Added: 2009-04-15 19:34:23 |
| ECE130A-Quiz2sample.pdf Path: UCSB >> ECE >> 130a Fall, 2008 Description: Name: ECE 130A: Signal Analysis and Processing Fall 2008 Prof. Michael Liebling TAs: Jingning Han, Kumar Viswanatha Electrical & Computer Engineering Dept. University of California, Santa Barbara Sample Quiz 2 Instructions: Write your rst and last n... Date Added: 2009-01-10 02:12:17 |
| ECE130A-Quiz2sample.pdf Path: UCSB >> ECE >> 1a Fall, 2008 Description: Name: ECE 130A: Signal Analysis and Processing Fall 2008 Prof. Michael Liebling TAs: Jingning Han, Kumar Viswanatha Electrical & Computer Engineering Dept. University of California, Santa Barbara Sample Quiz 2 Instructions: Write your rst and last n... Date Added: 2009-01-10 02:12:17 |
| ECE130A-Quiz2sample.pdf Path: UCSB >> ECE >> 2c Fall, 2008 Description: Name: ECE 130A: Signal Analysis and Processing Fall 2008 Prof. Michael Liebling TAs: Jingning Han, Kumar Viswanatha Electrical & Computer Engineering Dept. University of California, Santa Barbara Sample Quiz 2 Instructions: Write your rst and last n... Date Added: 2009-01-10 02:12:17 |
| ECE130A-Quiz2sample.pdf Path: UCSB >> ECE >> 594q Winter, 2008 Description: Name: ECE 130A: Signal Analysis and Processing Fall 2008 Prof. Michael Liebling TAs: Jingning Han, Kumar Viswanatha Electrical & Computer Engineering Dept. University of California, Santa Barbara Sample Quiz 2 Instructions: Write your rst and last n... Date Added: 2009-01-10 02:15:50 |
| STS 200 Final Paper Path: Penn State >> STS >> 200 Spring, 2008 Description: STS 200 Sec.001 Medical Anthropology: Bioethics and Mental Health The area of medical anthropology I want to focus on is bioethics. According to dictionary.com, bioethics is defined as \"a field of study concerned with the ethics and philosophical imp... Date Added: 2008-05-16 19:03:42 |
| LinearAlgSyllabus.pdf Path: N. Arizona >> MAT >> 316 Fall, 2008 Description: UNIVERSITY OF NORTHERN ARIZONA MAT 316, FALL 2008 Introduction to Linear Algebra Lectures: Lecturer: Oce Hours: Oce: Email: Phone: MWF, 1:50-2:40 pm, in ADM 162 Dr. Brent Pohlmann M 1:00 - 1:50, W 1:00 - 1:50, 2:40 - 3:40, T, TH 10:50 -11:50 ADM 216 ... Date Added: 2009-01-11 20:44:57 |
| Q3-zans Path: Virginia Tech >> MATH >> 1206 Spring, 2008 Description: ... Date Added: 2008-04-01 15:45:06 |
| 2380.162.ps Path: Hawaii >> SOEST >> 2380 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207377991.0388276 Float: 2380 Profile: 162 Location: 40.0N 157.7E Date: 09/22... Date Added: 2009-02-17 20:17:27 |
| MLP_Notes2004.pdf Path: UCSD >> ECE >> 173 Fall, 2008 Description: Spring Quarter 2004 UCSD ECE173 To train our network we use gradient descent. The ideal update rule would be (u, v)new = (u, v) (u,v) F(S) where F(S) = 1 Multilayer Perceptrons April 13, 2004 N N y(k) y (k) 2 and is a small positive number. (Rek... Date Added: 2009-01-10 01:59:32 |
| finalprogram.pdf Path: George Mason >> I >> 2000 Fall, 2009 Description: 32nd Symposium on the Interface: Computing Science and Statistics Modeling the Earths Systems: Physical to Infrastructural April 5-8, 2000 Monteleone Hotel New Orleans, Louisiana SPONSORED BY HOSTED BY The Interface Foundation of North America Los A... Date Added: 2009-04-16 01:14:29 |
| 101-Lab3-Yeast_Streakouts.pdf Path: Rutgers >> MBB >> 101 Fall, 2008 Description: Lab 3 Yeast Streakouts Lab #3 Yeast Streak Outs In last weeks lab you plated the mutagenized yeast cultures on selective media (SD-leu, trp) to select for mutants in the Hst1:Sir2 chimera protein that would fail to silence transcription of the hml:T... Date Added: 2009-02-04 14:53:41 |
| BIO 102 Picture Books list.doc Path: E. Kentucky >> BIO >> 102 Fall, 2008 Description: Title I took a walk Gorilla doctors: saving endangered great apes My bodyworks: songs about your bones, muscles, heart, and more! Stone Girl, Bone Girl Fossil Girl Prehistoric Actual Size When bugs were big, plants were strange, and tetrapods stalked... Date Added: 2009-02-02 14:10:47 |
| Chem Fiesta Fixed Path: Case Western >> CHEM >> 105 Spring, 2009 Description: Dimensional Analysis and Stoichiometry Dimensional Analysis Problems If you have 456g of glucose C6H12O6 how many atoms of oxygen would you have? If you have 3.48 x 1023 molecules of iodine how many milligrams do you have? Stoichiometry Problems If... Date Added: 2009-03-01 15:44:32 |
| ch531-ch1.pdf Path: Alabama >> CH >> 435 Fall, 2008 Description: Rules of QMOT Chapter 1 1. 2. 3. 4. 5. 6. 7. Consider valence orbitals only Form completely delocalized MOs as linear combinations of s and p AOs MOs must be either symmetric or antisymmetric with respect to the molecular symmetry operations Compose ... Date Added: 2009-01-10 01:09:12 |
| international.pdf Path: Rider >> ENG >> 316 Fall, 2008 Description: Rider University International Student Supplement PART I: DIRECTIONS FOR COMPLETING THE CERTIFICATION OF FINANCES According to the United States Department of Homeland Security regulations, Rider University is required to obtain certification that ap... Date Added: 2009-01-11 19:26:31 |
| 070917borg.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: The Nordic Option - New York Times September 17, 2007 Op-Ed Columnist The Nordic Option By ROGER COHEN Stockholm Think Sweden and what comes to mind is probably not a youthful finance minister, with his long dark hair in a ponytail and a gold ring t... Date Added: 2009-02-11 19:53:14 |
| fall08-20.pdf Path: UC Davis >> POL >> 193 Fall, 2008 Description: From: To: CC: Subject: Sara Lombardo \"Sara Lombardo\"; \"Joaquin Feliciano\"; \"Sandra Rodriguez\"; Washington Fall Program Internship #20 - Conference on Asian Pacific American Leadership with USDA Agricul. Research Service Labs Monday, July 21, 2008 10... Date Added: 2009-01-10 01:31:05 |
| fall08-20.pdf Path: UC Davis >> HIS >> 192 Winter, 2008 Description: From: To: CC: Subject: Sara Lombardo \"Sara Lombardo\"; \"Joaquin Feliciano\"; \"Sandra Rodriguez\"; Washington Fall Program Internship #20 - Conference on Asian Pacific American Leadership with USDA Agricul. Research Service Labs Monday, July 21, 2008 10... Date Added: 2009-01-10 01:31:05 |
| Bergman-minmodel05.pdf Path: Washington >> LAW A >> 591 Fall, 2008 Description: Insulin Sensitivity: Methods HORMONE RESEARCH Horm Res 2005;64(suppl 3):815 DOI: 10.1159/000089312 Published online: January 20, 2006 Minimal Model: Perspective from 2005 Richard N. Bergman University of Southern California, Los Angeles, Calif., ... Date Added: 2009-02-02 20:29:03 |
| Class9-Phonons.ppt Path: UCSD >> PHYS >> 211a Fall, 2008 Description: PHONONS NEUTRONS LIGHT P. 139 Table 5.1 ... Date Added: 2009-01-12 05:44:43 |
| SwineCropInformationSheet Path: Penn State >> AN SC >> 418 Fall, 2006 Description: Crop Information Sheet Soil Tes t Planned Fertilizer (starter or other fertilizers to be applied regardless of manure applications) 150 lbs/ac 10-10-10 starter Typical Manure Application Season Field Number Crop Group Acres Expected Yield Fiel... Date Added: 2008-07-23 10:29:02 |
| lecture16.pdf Path: UPenn >> STAT >> 101 Fall, 2008 Description: Stat101 Spring 2005 Lecture 16 Stat101 p.1 Topics Admin A simulation game Volatility drag Central limit theorem Stat101 p.2 Admin Assignment 4 is due TUESDAY March 22 Question 5 typo: should read f (y) = c(y 2 10y + 25) See website... Date Added: 2009-04-15 20:50:28 |
| mitosis and meiosis homework Path: N.C. State >> BIO >> 183 Spring, 2008 Description: Due in class: 3-13-08 Concept Check: Mitosis & Meiosis: Name:_ Lab Section:_ I. Mitosis An organism has a total of six chromosomes in its diploid state. Show how one of this organism\'s somatic cells would look after Interphase Show how mitosis woul... Date Added: 2008-05-22 16:31:43 |
| pp103-107.pdf Path: Kent State >> FR >> 13202 Fall, 2008 Description: Electronic Transactions on Numerical Analysis. Volume 24, pp. 103-107, 2006. Copyright 2006, Kent State University. ISSN 1068-9613. Kent State University etna@mcs.kent.edu ETNA WEIERSTRASS THEOREM IN WEIGHTED SOBOLEV SPACES WITH DERIVATIVES: ANNO... Date Added: 2009-01-10 17:12:03 |
| pp103-107.pdf Path: Kent State >> FR >> 23201 Fall, 2008 Description: Electronic Transactions on Numerical Analysis. Volume 24, pp. 103-107, 2006. Copyright 2006, Kent State University. ISSN 1068-9613. Kent State University etna@mcs.kent.edu ETNA WEIERSTRASS THEOREM IN WEIGHTED SOBOLEV SPACES WITH DERIVATIVES: ANNO... Date Added: 2009-01-10 17:12:03 |
| 031120interv.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: WSJ.com - Kazakhstan\'s Nazarbayev Speaks on Terrorism, Oil November 20, 2003 8:29 p.m. EST WORLD NEWS LEAVING THE SOVIETS BEHIND Kazakhstan Makes a Comeback1 Kazakhstan Balancing Act Gives China a Key Oil Role2 Kazakhstan\'s Nazarbayev Speaks on ... Date Added: 2009-02-11 19:26:28 |
| NISTLec.doc Path: Iowa State >> STAT >> 480 Fall, 2008 Description: NIST Software Reliability Error types in numerical computation: 1) Binary representation & finite precision a. Ex: Base 10 Base 2 i. Reality: 0.1 0.00011001100110011 ii. Computer: Truncates to 0.00011001100110011 iii. Computer sees 0.1 as 0.0999999... Date Added: 2009-01-10 17:10:30 |
| gloverVAH Path: Towson >> EMF >> 461 Spring, 2008 Description: EMF 461 \"Video Activist Handbook\" Response \"The Video Activist Handbook\", by Thomas Harding read like a long set of instructions for the entry level video activist. I thought that Harding spent too many pages writing about equipment and techniques th... Date Added: 2008-05-04 06:37:01 |
| komunyakka_wright_wnotes.doc Path: N. Illinois >> ECON >> 595 Fall, 2008 Description: Nicholas J. Valenti 26 November 2002 ENGL 595 The Horror, The Horror: Dehumanization Through War and Racism in Dien Cai Dau and Native Son In Anne Petrys The Street, Boots Smiths greatest fear is losing his life in a foreign, white peoples war. Boots... Date Added: 2009-02-02 15:13:02 |
| midtermsolutions-w03.pdf Path: UC Davis >> ECS >> 170 Fall, 2008 Description: ECS 170 - Intro to Artificial Intelligence Suggested Solutions Mid-term Examination (100 points) Open textbook and open notes only Show your work clearly Winter 2003 Problem 1. (15 points) Consider the so-called Cryptarithmetic problem shown below. ... Date Added: 2009-01-11 21:24:54 |
| GEB 1011.doc Path: Pasco-Hernando Community College >> GEB >> 1011 Fall, 2008 Description: CHIPOLA COLLEGE COURSE SYLLABUS COURSE TITLE: INTRODUCTION TO BUSINESS COURSE NUMBER: GEB 1011 COURSE DESCRIPTION: A survey course designed to acquaint the student with the terminology, organization, and function of the American business system. To... Date Added: 2009-02-02 15:25:49 |
| 214.pdf Path: WVU >> ART >> 214 Fall, 2008 Description: A cross-national investigation of competitive factors affecting the United States wood furniture industry Paul M. Smith Cynthia D. West Abstract Few wood products industries in the United States have felt the competitive pressures from the globaliza... Date Added: 2009-02-03 14:39:32 |
| KINE 5328 NeuroMuscular Syllabus.pdf Path: UT Arlington >> KINE >> 5328 Fall, 2008 Description: KINE 5328 Neuromuscular Physiology of Exercise Spring, 2006 Syllabus Professor: Office: Phone: Email: Office Hours: Location & Time: Dr. Mark D. Ricard 230 ACT, Exercise Science Research Laboratories (ESRL) (817) 272-0764 ricard@uta.edu By Appointmen... Date Added: 2009-02-03 14:11:20 |
| 2373.010.ps Path: Hawaii >> SOEST >> 2373 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207375932.0388276 Float: 2373 Profile: 010 Location: 32.5N 146.2E Date: 07/16... Date Added: 2009-02-17 19:57:07 |
| syllabus.doc Path: Michigan State University >> ME >> 461 Fall, 2008 Description: Department of Mechanical Engineering MICHIGAN STATE UNIVERSITY ME 461: Mechanical Vibrations Summer 2002 Instructor Mr. Brian J. Olson Phone: 432-1085 Office: 2565 EB Email: olsonbr1@egr.msu.edu Teaching Assistants Pete Schmitz Phone: 432-1085 Off... Date Added: 2009-01-09 02:51:55 |
| Frasi 2 Path: UPenn >> ITAL >> 205-301 Fall, 2008 Description: Federico Nusymowicz P.1 Orazioni Il sinistro Antipurgatorio aveva un bagliore rosseggiante grazie alla fiamma eterna del centro del mondo. I dannati strepitavano mentre Dante, stupefatto e petrificato, osservava atterrito. Ti ammonisco: se seppellisc... Date Added: 2008-06-26 00:32:16 |
| phonics_presentation.ppt Path: SFASU >> BIO >> 512 Fall, 2008 Description: Phonics: The Building Blocks of Early Reading Presenter: Dr. Susan Smith Workshop Outcomes Develop a deeper understanding of the concepts of the English spelling system Become familiar with using explicit, systematic instruction Understand the dev... Date Added: 2009-01-11 18:21:15 |
| phonics_presentation.ppt Path: SFASU >> BIO >> 571 Spring, 2008 Description: Phonics: The Building Blocks of Early Reading Presenter: Dr. Susan Smith Workshop Outcomes Develop a deeper understanding of the concepts of the English spelling system Become familiar with using explicit, systematic instruction Understand the dev... Date Added: 2009-01-11 18:21:16 |
| phonics_presentation.ppt Path: SFASU >> ELE >> 578 Summer, 2008 Description: Phonics: The Building Blocks of Early Reading Presenter: Dr. Susan Smith Workshop Outcomes Develop a deeper understanding of the concepts of the English spelling system Become familiar with using explicit, systematic instruction Understand the dev... Date Added: 2009-01-11 18:21:16 |
| phonics_presentation.ppt Path: SFASU >> SED >> 578 Summer, 2008 Description: Phonics: The Building Blocks of Early Reading Presenter: Dr. Susan Smith Workshop Outcomes Develop a deeper understanding of the concepts of the English spelling system Become familiar with using explicit, systematic instruction Understand the dev... Date Added: 2009-01-11 18:21:16 |
| HLDVT00.pdf Path: UCSD >> ESDAT >> 00 Fall, 2008 Description: Interface based Hardware/Software Validation of a System-on-Chip Debashis Panigrahi, Clark N. Taylor and Sujit Dey Department of Electrical and Computer Engineering University of California, San Diego fdpani, cntaylor, deyg@ece.ucsd.edu Abstract The ... Date Added: 2009-02-17 18:23:06 |
| RentData.txt Path: Berkeley >> E >> 141 Fall, 2008 Description: 230 245 190 203 450 280 310 185 218 185 340 230 245 200 125 300 350 100 280 175 310 450 160 285 255 340 300 880 800 450 630 480 2 2 1 4 3 2 2 2 2 1 2 2 1 2 1 3 2 1 2 2 2 3 2 1 2 4 2 6 5 3 6 3 2 2 1 2 2 2 2 1 2 1 2 2 1 2 1 3 2 1 2 1 2 2 1 1 2 2 2 6 ... Date Added: 2009-02-17 17:37:24 |
| notes13.pdf Path: SUNY Stony Brook >> PHY >> 505 Fall, 2008 Description: ... Date Added: 2009-01-11 18:20:50 |
| 060831elect.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Djukanovic, allies likely to form 1st gov\'t in independent Montenegro Yahoo! My Yahoo! Mail News Home - Help News HomeTop StoriesWorldAsia PacificBusinessTechnologyEntertainmentSportsPhotos - News by Country - Indonesia Malaysia Philippines Singapor... Date Added: 2009-02-11 19:03:08 |
| 060831elect.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Djukanovic, allies likely to form 1st gov\'t in independent Montenegro Yahoo! My Yahoo! Mail News Home - Help News HomeTop StoriesWorldAsia PacificBusinessTechnologyEntertainmentSportsPhotos - News by Country - Indonesia Malaysia Philippines Singapor... Date Added: 2009-02-11 19:11:09 |
| 18_11.pdf Path: Wisconsin >> ZOOLOGY >> 430 Fall, 2008 Description: ... Date Added: 2009-02-04 14:14:36 |
| Sp04PHY108Ex3Solns Path: SUNY Buffalo >> PHYSICS >> 108 Spring, 2008 Description: ... Date Added: 2008-04-14 00:21:01 |
| Brown Cipollo Scott.pdf Path: Penn State >> C E >> 361 Fall, 2008 Description: Optimal Low-Thrust Rendezvous using a Hybrid Evolutionary Strategy Christopher J. Scott Denise L. Brown Dept. of Aerospace Engineering Pennsylvania State University University Park, PA 16802 Peter M. Cipollo Abstract This paper develops a hybrid ... Date Added: 2009-01-11 17:41:30 |
| Brown Cipollo Scott.pdf Path: Penn State >> C E >> 555 Fall, 2008 Description: Optimal Low-Thrust Rendezvous using a Hybrid Evolutionary Strategy Christopher J. Scott Denise L. Brown Dept. of Aerospace Engineering Pennsylvania State University University Park, PA 16802 Peter M. Cipollo Abstract This paper develops a hybrid ... Date Added: 2009-01-11 17:41:31 |
| Brown Cipollo Scott.pdf Path: Penn State >> C E >> 563 Spring, 2008 Description: Optimal Low-Thrust Rendezvous using a Hybrid Evolutionary Strategy Christopher J. Scott Denise L. Brown Dept. of Aerospace Engineering Pennsylvania State University University Park, PA 16802 Peter M. Cipollo Abstract This paper develops a hybrid ... Date Added: 2009-01-11 17:41:31 |
| Brown Cipollo Scott.pdf Path: Penn State >> C E >> 360 Fall, 2008 Description: Optimal Low-Thrust Rendezvous using a Hybrid Evolutionary Strategy Christopher J. Scott Denise L. Brown Dept. of Aerospace Engineering Pennsylvania State University University Park, PA 16802 Peter M. Cipollo Abstract This paper develops a hybrid ... Date Added: 2009-01-11 17:41:13 |
| ICS153-Syllabus.pdf Path: UC Irvine >> EEE >> 36425 Winter, 2004 Description: ICS 153 Computer Networks Lichun Bao School of Info. & Comp. Sciences University of California, Irvine Course Overview Course Description Introductory course on computer networks and their protocols. This course will provide students with a thoroug... Date Added: 2009-02-06 18:49:36 |
| Nov_24.pdf Path: Minnesota >> MATH >> 1151 Fall, 2008 Description: 12.1 continued - more fun with sequences Monday, November 24, 2008 12:23 PM Suppose we wanted to add up the first n terms of a sequence. Summation notation: New Section 1 Page 1 New Section 1 Page 2 New Section 1 Page 3 A sequence is arithmetic ... Date Added: 2009-02-17 20:31:04 |
| Safety_Field_Telephone_List _Oct 2007_.pdf Path: New Hampshire >> T >> 2 Fall, 2008 Description: FHWA Safety Field Staff Telephone Listing Revised October 2007 ALABAMA ALASKA FLETCHER, Al (HDA-AK) Al.Fletcher@dot.gov 709 W. Ninth Street, Room 851 Juneau, AK 99802-1648 : 907-586-7245 : 907-586-7420 (FAX) SCHMITZ, Matthew (HDA-CA) Matthew.Schmi... Date Added: 2009-02-18 02:10:07 |
| US-Mex(2005).ppt Path: Texas >> CE >> 397 Fall, 2008 Description: Border 2012: U.S.-Mexico Environmental Program David Trujillo Sonia Uribe CE 397 Transboundary Water Resources November 1, 2005 Environmental and Water Resources Engineering University of Texas at Austin Background La Paz Agreement 1983 Border Env... Date Added: 2009-02-17 18:10:19 |
| US-Mex(2005).ppt Path: Caribbean >> CE >> 397 Fall, 2008 Description: Border 2012: U.S.-Mexico Environmental Program David Trujillo Sonia Uribe CE 397 Transboundary Water Resources November 1, 2005 Environmental and Water Resources Engineering University of Texas at Austin Background La Paz Agreement 1983 Border Env... Date Added: 2009-02-17 18:10:19 |
| TR_96-60.pdf Path: Maryland >> TOMOS >> 5832 Fall, 2008 Description: TECHNICAL RESEARCH REPORT Managing File Subsystem Data Streams for Databases on Networked Systems by S. Gupta, J.S. Baras, S. Kelley, N. Roussopoulos CSHCN T.R. 96-13 (ISR T.R. 96-60) The Center for Satellite and Hybrid Communication Networks is a... Date Added: 2009-02-06 19:34:01 |
| TR_96-60.pdf Path: Maryland >> TOMOS >> 1903 Fall, 1920 Description: TECHNICAL RESEARCH REPORT Managing File Subsystem Data Streams for Databases on Networked Systems by S. Gupta, J.S. Baras, S. Kelley, N. Roussopoulos CSHCN T.R. 96-13 (ISR T.R. 96-60) The Center for Satellite and Hybrid Communication Networks is a... Date Added: 2009-02-06 19:34:01 |
| TR_96-60.pdf Path: Maryland >> LIB >> 5832 Fall, 2008 Description: TECHNICAL RESEARCH REPORT Managing File Subsystem Data Streams for Databases on Networked Systems by S. Gupta, J.S. Baras, S. Kelley, N. Roussopoulos CSHCN T.R. 96-13 (ISR T.R. 96-60) The Center for Satellite and Hybrid Communication Networks is a... Date Added: 2009-02-06 19:18:00 |
| TR_96-60.pdf Path: Maryland >> LIB >> 1903 Fall, 1920 Description: TECHNICAL RESEARCH REPORT Managing File Subsystem Data Streams for Databases on Networked Systems by S. Gupta, J.S. Baras, S. Kelley, N. Roussopoulos CSHCN T.R. 96-13 (ISR T.R. 96-60) The Center for Satellite and Hybrid Communication Networks is a... Date Added: 2009-02-06 19:18:00 |
| MARS 1010 Gases-Nutrients Path: UGA >> MARS >> 1010L Fall, 2007 Description: MARS 1010: Gases/Nutrients Most Abundant dissolved gases in seawater: Nitrogen: relatively inactive biologically 11/2/2007 11:27:00 AM Oxygen: Very active biologically (photosynthesis and respiration) but it is not very soluble Carbon Dioxide: very... Date Added: 2008-03-20 08:07:58 |
| MCAG 4203 spring 2002 final exam.doc Path: Oklahoma State >> MCAG >> 4203 Fall, 2008 Description: MCAG 4203 Final Examination Spring 2002 May 8, 2002 2:30 PM Ag. Hall 306 100 points Time Allowed: 1 hour 50 minutes (6) 1. Name _ A golf course fairway is 1000 feet long by 90 feet wide and is irrigated as a single zone (in one set). If the daily wa... Date Added: 2009-02-02 21:42:43 |
| sept15nptf.ppt Path: UPenn >> SEPT >> 15 Fall, 2009 Description: NETWORKPLANNINGTASK FORCE 1 STRATEGYSESSIONSEPTEMBER15,2008 3YEARSECURITYDISCUSSION NPTFMeetingdates 2 February18Operationalreview(Completed) April21Securitystrategysession(Completed) July21Updates&planningdiscussions(Completed) August11Strat... Date Added: 2009-04-15 20:50:20 |
| RR12 Path: Texas >> RHE >> 309S Fall, 2007 Description: Levi 1 Rachel Levi Lacey Donohue RHE 309S November 13, 2007 RR # 12: Devil\'s Highway Conclusion: The United States government as well as the Border Patrol is investing extensive amounts of money into securing the border along with the finances necess... Date Added: 2008-03-18 23:25:44 |
| _BYLAW_CHANGE_10_2_-_FAC_APPROVE_CURR_CHANGES.pdf Path: UC Riverside >> MATH >> 008b Fall, 2008 Description: COMMITTEE ON RULES & JURISDICTION REPORT TO THE RIVERSIDE DIVISION May 30, 2006 To be adopted: Proposed Changes to Bylaw 10.2 PRESENT: 10. Procedures for Approval of New Undergraduate Curricula and Changes in Undergraduate Curricula (En 28 May 81) 10... Date Added: 2009-01-11 21:27:46 |
| _BYLAW_CHANGE_10_2_-_FAC_APPROVE_CURR_CHANGES.pdf Path: UC Riverside >> MATH >> 009a Fall, 2008 Description: COMMITTEE ON RULES & JURISDICTION REPORT TO THE RIVERSIDE DIVISION May 30, 2006 To be adopted: Proposed Changes to Bylaw 10.2 PRESENT: 10. Procedures for Approval of New Undergraduate Curricula and Changes in Undergraduate Curricula (En 28 May 81) 10... Date Added: 2009-01-11 21:27:46 |
| ART 201 Sec 2 Beckner.doc Path: Illinois State >> ART >> 201 Fall, 2008 Description: METCALF LABORATORY SCHOOL OBSERVATIONS FALL 2008 ART 201 SECTION 2 Beckner OBSERVATION: Students will observe K-8 Art classes for a total of 6 hours at Metcalf. ASSIGNMENT: See table below. REMEMBER TO FOLLOW THE EXACT DATES AND TIMES LISTED! *PAY C... Date Added: 2009-02-02 14:27:16 |
| Econ 207 - Fall 2006 - Lab 11.pdf Path: Iowa State >> ECON >> 207 Spring, 2008 Description: ECONOMICS 207 FALL 2006 LAB 11 Problem 1. Find all rst and second order partial derivatives with respect to x, y, and z. (i) f (x; y; z) = exyz Date: 8 November 2006. 1 2 ECONOMICS 207 FALL 2006 LAB 11 (ii) f (x; y; z) = ax3 b yz ECONOMICS 207... Date Added: 2009-02-02 14:38:18 |
| MAhluwalia.pdf Path: UMBC >> CS >> 07 Fall, 2008 Description: Preserving Privacy in Supply Chain Management: a Challenge for Next Generation Data Mining1 Madhu Ahluwalia, Zhiyuan Chen, Aryya Gangopadhyay2, Zhiling Guo {madhu.is, zhchen, gangopad, zgou}@umbc.edu Abstract In this paper we identify a major area of... Date Added: 2009-02-17 23:56:14 |
| STRESS.rtf Path: N. Georgia >> PSYC >> 3070 Spring, 2008 Description: STRESS the emotional response to stimuli that tax or exceed our ability to cope Causes of organizational stress: 1) Occupational demands lots of decisions constant attentional demands unpleasant physical conditions 2) Conflict 3) Role ambiguity 4) Ov... Date Added: 2009-01-09 05:25:42 |
| STRESS.rtf Path: N. Georgia >> PSYC >> 3080 Fall, 2008 Description: STRESS the emotional response to stimuli that tax or exceed our ability to cope Causes of organizational stress: 1) Occupational demands lots of decisions constant attentional demands unpleasant physical conditions 2) Conflict 3) Role ambiguity 4) Ov... Date Added: 2009-01-09 05:25:47 |
| STRESS.rtf Path: N. Georgia >> PSYC >> 4900 Fall, 2008 Description: STRESS the emotional response to stimuli that tax or exceed our ability to cope Causes of organizational stress: 1) Occupational demands lots of decisions constant attentional demands unpleasant physical conditions 2) Conflict 3) Role ambiguity 4) Ov... Date Added: 2009-01-11 17:11:14 |
| AgreementSTA02052007 .pdf Path: Hartwick >> X >> 272 Fall, 2008 Description: AGREEMENT FOR STUDENT TECHNOLOGY ASSISTANTS As an STA (Student Technology Assistant) employed by Technology Services I understand that I am considered an employee of the College. I also understand that I am required to abide by the rules set forth in... Date Added: 2009-02-11 21:33:29 |
| cfallcabbage2001.pdf Path: Arizona >> AG >> 2001 Fall, 2008 Description: Table 8A. Income and Cash Operating Summary; Fall Cabbage, 2001 COUNTY: Maricopa CROP: Cabbage AREA: Salt River Project Item FARM: Maricopa Veg ACRES: 1.0 YIELD: 746.0 Ct / Acre Unit WATER SOURCE: Salt River Project IRRIGATION SYSTEM: Flood Furrow PR... Date Added: 2009-02-06 20:27:27 |
| cfallcabbage2001.pdf Path: Arizona >> CALS >> 2001 Fall, 2008 Description: Table 8A. Income and Cash Operating Summary; Fall Cabbage, 2001 COUNTY: Maricopa CROP: Cabbage AREA: Salt River Project Item FARM: Maricopa Veg ACRES: 1.0 YIELD: 746.0 Ct / Acre Unit WATER SOURCE: Salt River Project IRRIGATION SYSTEM: Flood Furrow PR... Date Added: 2009-02-06 20:28:59 |
| Midterm1Key-2008.pdf Path: UCSB >> EEMB >> 130 Spring, 2008 Description: Name: EEMB 130- Population Genetics Midterm #1 Short Answer: In the space below, provide a brief (one/two sentence) answer to each of the following questions (5 points each). You may find it helpful to look at the associated equations when formulatin... Date Added: 2009-01-11 21:52:59 |
| finalSol06 Path: Cornell >> ECE >> 3150 Fall, 2007 Description: ECE 315 Final Exam Solution Fall 2006 Name: _ Student net ID: _ When you are asked to explain a question briefly, use only 1-3 short sentences. Any wrong information you put down can be subject to point deduction, whether it is relevant to the que... Date Added: 2008-02-02 21:58:38 |
| homework1_solution Path: Iowa State >> CPR E >> 211 Spring, 2003 Description: Assigned: 1/13/05 Due: 1/25/05 CprE 211 Spring 2005 Homework 1 Solution Last Name First Name Section _ _ _ Remember, these homework exercises not only give you practice with course concepts, but also represent the types of questions you will be ... Date Added: 2008-04-02 21:48:58 |
| Exam II Key Path: Texas >> CHEM >> 310N Spring, 2008 Description: Chem. 310N, Spring 2008 Professor Krische Midterm Exam II Average = 50 Grading Scale 90-100 = A+ 80-89 = A 70-79 = A65-69 = B+ 60-64 = B 55-59 = B50-54 = C+ 45-49 = C 40-44 = C37-39 = D+ 33-36 = D 30-32 = D0-29 = F Name: Problem 1. (16 points) 2. ... Date Added: 2008-04-09 13:08:34 |
| 512-06w.pdf Path: Washington >> ENVIR >> 512 Fall, 2008 Description: ... Date Added: 2009-02-02 20:37:12 |
| newness Path: Cornell >> AEM >> 2400 Fall, 2008 Description: Newness in a product -if a new product is functionally different, it is new -legal terms: new can be used up to 6 months after regular distribution -Organizations perspective -consumers perspective ... Date Added: 2008-10-21 22:53:02 |
| FLLP-FLBmailer.pdf Path: N.C. State >> CES >> 2007 Fall, 2008 Description: Speakers David Halley is a NC Registered Forester and SAF Certied Forester with True North Forest Management Services in Holly Springs, NC. He is a forestry and wildlife graduate of Virginia Tech. He spent fourteen years as a Service Forester, Distri... Date Added: 2009-02-04 14:45:14 |
| problems3-sol Path: RIT >> ELE >> 101 Spring, 2008 Description: Homework 3 University Astronomy University Astronomy 1017-301 Homework Assignment 3 Instructor: Dr Andrew Robinson Due Date: 4pm Thursday, 12 October 2006. To tackle some of the following problems you will need to do some research, using either th... Date Added: 2008-04-19 18:43:09 |
| 5200_L37.pdf Path: Mich Tech >> EE >> 5200 Fall, 2008 Description: ... Date Added: 2009-01-09 03:07:45 |
| HW2_27 Path: Moravian >> CHEM >> 114 Spring, 2008 Description: Homework due 2/27 Indicate whether aqueous solutions of the following salts would be acidic, basic, or neutral. For solutions that are not neutral indicate which ion is causing the solution to be acidic or basic LiC2H3O2 - Basic - comes from the stro... Date Added: 2008-04-03 05:47:46 |
| asl-675.pdf Path: Iowa State >> ECON >> 675 Fall, 2008 Description: Iowa State University Management/Economics Economic Impact of a Ban on the Use of Over-the-Counter Antibiotics in U.S. Swine Rations Dermot J. Hayes, professor, Helen H. Jensen, professor, Iowa State University; Lennart Backstrom, professor, Univer... Date Added: 2009-02-02 14:38:33 |
| essay 6 Path: Cornell >> ILRIC >> 4330 Spring, 2008 Description: In late 2005, SEIU organized 5,000 low-wage janitors in Houston, in a breakthrough case of union success in the South. Last month, these same janitors won a four-week-long strike for higher pay and guaranteed working hours. How do these victories rel... Date Added: 2008-05-19 09:46:16 |
| Modern Cont Path: Colorado >> ENGL >> 3060 Spring, 2007 Description: Christina Persiani English 3060- Spring 2008 Term Paper #1 The Completion of a Novel Since the time I was little, I have seen many different conversions of novels into movies. From the Little Mermaid to the new thriller Atonement, I have seen the cha... Date Added: 2008-03-31 15:05:27 |
| exam3-key.pdf Path: Purdue >> IE >> 230 Fall, 2008 Description: IE 230 Seat # _ Closed book and notes. 60 minutes. Cover page and four pages of exam. No calculators. (1 pt.) Name _ < KEY > _ This test covers through Chapter 5 of Montgomery and Runger, third edition. The random vector (X 1, X 2, . . . , Xk ) h... Date Added: 2009-01-12 14:37:12 |
| exam3-key.pdf Path: Purdue >> I E >> 230 Fall, 2008 Description: IE 230 Seat # _ Closed book and notes. 60 minutes. Cover page and four pages of exam. No calculators. (1 pt.) Name _ < KEY > _ This test covers through Chapter 5 of Montgomery and Runger, third edition. The random vector (X 1, X 2, . . . , Xk ) h... Date Added: 2009-01-12 14:37:12 |
| multicast.ppt Path: Columbia >> COMS >> 6181 Fall, 2009 Description: Multicast Henning Schulzrinne Dept. of Computer Science Columbia University Fall 2003 Overview IP multicast service models any source, source-specific multicast, Multicast protocol components address assignment local group management intr... Date Added: 2009-03-19 00:01:10 |
| multicast.ppt Path: Columbia >> CS >> 6181 Fall, 2008 Description: Multicast Henning Schulzrinne Dept. of Computer Science Columbia University Fall 2003 Overview IP multicast service models any source, source-specific multicast, Multicast protocol components address assignment local group management intr... Date Added: 2009-03-19 00:01:10 |
| area-03.pdf Path: UPenn >> COLING >> 03 Fall, 2009 Description: TOPICS Computational Lexicons Slaven Bilac, Timothy Baldwin, Hozumi Tanaka: Bringing the Dictionary to the User: The FOKS System Helmut Horacek: Varying Cardinality in Metonymic Extensions to Nouns Dekang Lin, Patrick Pantel: Concept Discovery fr... Date Added: 2009-04-15 21:15:34 |
| area-03.pdf Path: UPenn >> COLING >> 2002 Fall, 2009 Description: TOPICS Computational Lexicons Slaven Bilac, Timothy Baldwin, Hozumi Tanaka: Bringing the Dictionary to the User: The FOKS System Helmut Horacek: Varying Cardinality in Metonymic Extensions to Nouns Dekang Lin, Patrick Pantel: Concept Discovery fr... Date Added: 2009-04-15 21:15:34 |
| final.pdf Path: Pittsburgh >> MATH >> 2500 Fall, 2008 Description: Math 2500 Final Exam, Fall 2005 Instructions. There are four problems. You should solve all four problems, and turn your solutions in to me by 5:00pm on Friday December 16, 2005. Any results that were proved either in class or in chapters 1 through 1... Date Added: 2009-02-02 20:07:05 |
| 1624manual.pdf Path: Minnesota >> WIKI >> 500 Fall, 2008 Description: Table of Contents Introduction. 1 Layout of the Acquisitions Module.. 2 Budgets . 5 INTRODUCTION..5 FINDING A BUDGET .5 CREATING A NEW BUDGET ..9 New Button and Duplicate Button .9 BUDGET INFORMATION FORM ..10 Modifying an Existing Budget .15 Transac... Date Added: 2009-02-17 20:43:25 |
| lec21.pdf Path: Cornell >> ORIE >> 630 Fall, 2008 Description: Mathematical Programming Lecture 21 OR 630 Fall 2005 November 08, 2005 Notes by Ilya Alexandrovich Sheynzon Dantzig-Wolfe Decomposition (continued) min (P ) cT x1 + . + cT xk 1 k A01 x1 + . + A0k xk = b0 A11 x1 = b1 . Akk xk = bk x1 0, ., xk 0. m... Date Added: 2009-02-17 22:06:07 |
| lec21.pdf Path: Cornell >> OR >> 630 Fall, 2008 Description: Mathematical Programming Lecture 21 OR 630 Fall 2005 November 08, 2005 Notes by Ilya Alexandrovich Sheynzon Dantzig-Wolfe Decomposition (continued) min (P ) cT x1 + . + cT xk 1 k A01 x1 + . + A0k xk = b0 A11 x1 = b1 . Akk xk = bk x1 0, ., xk 0. m... Date Added: 2009-02-17 22:06:07 |
| Midterm2Checklist.pdf Path: Michigan >> WWW-PERSON >> 217 Fall, 2008 Description: MATH 217 Section 2 Midterm 2 Checklist Winter 2007 Chapter 2: Sections 2.8-29, Chapter 3: Sections 3.1-3.3, Chapter 4: Sections 4.1-4.7 I.1 Subspaces of Rn (Fundamentals) 1. Concepts: subspace, span, basis, dimension, coordinates, ColA, NulA. 2. Find... Date Added: 2009-02-11 21:21:24 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 105 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 340 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 353 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 106 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 350 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> CS >> 228 Winter, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 150 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 484 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 250 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> CS >> 422 Winter, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 211 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> CS >> 446 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 310 Winter, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 240 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 090 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:41 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 312 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 09:17:14 |
| ma100_culp.pdf Path: N. Michigan >> MA >> 265 Fall, 2008 Description: MA 100 Intermediate Algebra Prerequisite: AT LEAST a C in MA090 or satisfactory Placement Test score. Required materials: Ken Culp Text: Understanding Intermediate Algebra (Fifth Ed.), Lewis Hirsch & Arthur Goodman (Brooks/Cole). A scientific or gr... Date Added: 2009-01-09 15:21:42 |
| POLS401-JudPhilAssignment.doc Path: Tarleton >> POLS >> 304 Fall, 2008 Description: POLS 401 Judicial Philosophy Assignment A. Set forth your philosophy of how judges should decide difficult cases. This should take a paragraph or two. It should be clear from your explanation exactly what a judge should do with the text of the law/Co... Date Added: 2009-01-11 21:08:10 |
| WooLam92b.pdf Path: Texas >> CS >> 92 Fall, 2008 Description: ... Date Added: 2009-02-11 22:40:59 |
| hw6_sol Path: Syracuse >> PHY >> 102 Spring, 2008 Description: ... Date Added: 2008-05-18 23:17:14 |
| Hinsley.pdf Path: UF >> ANT >> 3390 Fall, 2008 Description: ... Date Added: 2009-01-10 03:38:12 |
| review2sol Path: Princeton >> COS >> 340 Fall, 2007 Description: Computer Science 340 Reasoning about Computation Review Session 2 Friday, January 11, 2008 Problem 1 Recall the cow grazing problem from Homework 5. The cow is on a path that leads to food, but the cow doesn\'t know what direction the food lies in. Th... Date Added: 2008-01-29 15:48:12 |
| lab1 Path: Tufts >> PHYSICS >> 11 Spring, 2008 Description: Interval VS. Distance Between Dots 12 10 Distance between dots in cm Series1 8 Series2 Series3 Series4 6 100 g 200 g 300 g 400 g 4 2 0 0 2 4 6 8 10 12 14 16 18 20 Interval Number 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 2.6 2.8 3.3 3... Date Added: 2008-04-28 22:48:04 |
| Chapter 04.pdf Path: BYU >> C S >> 124 Fall, 2008 Description: Chapter 4 The von Neumann Model ECEn/CS 124 Chapter 4 1 Digital Logic Hierarchy 2to4 FA LC-3 D Mem Now Begins Software ECEn/CS 124 Chapter 4 2 1 The Von Neumann Computer Memory MAR MDR INPUT * Keyboard * Mouse * Scanner * Card reader * Disk... Date Added: 2009-01-10 17:02:07 |
| Handout 15.pdf Path: East Carolina >> OMGT >> 6683 Fall, 2008 Description: Handout 15 Project group Each group member must initial his/her name next to the line provided. A signature indicates that the person has read the syllabus and understands and accepts the terms of the group project. Once chosen, the project leader w... Date Added: 2009-01-11 22:15:33 |
| DTreesAndOverfitting-9-13-05.pdf Path: Berkeley >> COMPSCI >> 294 Spring, 2008 Description: Machine Learning, Decision Trees, Overfitting Recommended reading: Mitchell, Chapter 3 Machine Learning 10-701 Tom M. Mitchell Center for Automated Learning and Discovery Carnegie Mellon University September 13, 2005 Machine Learning: Study of algo... Date Added: 2009-01-09 19:21:34 |
| H07.pdf Path: Alabama >> CS >> 470 Fall, 2008 Description: Problem set number 7 CS470 Spring 2005 due date April 4, 2005, 4:00pm Exercise 7.1 [worth 30 points] Design an algorithm for maximizing the cost of matrix chain multiplication. In particular prove: (1) the structure of optimal solution using the cut ... Date Added: 2009-01-09 07:29:08 |
| H07.pdf Path: Alabama >> IE >> 470 Fall, 2008 Description: Problem set number 7 CS470 Spring 2005 due date April 4, 2005, 4:00pm Exercise 7.1 [worth 30 points] Design an algorithm for maximizing the cost of matrix chain multiplication. In particular prove: (1) the structure of optimal solution using the cut ... Date Added: 2009-01-09 15:40:09 |
| HW5.pdf Path: UCLA >> MATH >> 270c Fall, 2008 Description: Math 270C: Assignment 5 Due Wednesday, February 22, 2006 (late homework accepted) Note: Monday, February 20, there is no class due to national holiday. [1] Assume that the n n, symmetric, positive denite matrix A has the eigenvalues i , i = 1, ., n,... Date Added: 2009-01-09 19:49:17 |
| brouha.pdf Path: Penn State >> BIOE >> 553 Fall, 2008 Description: ... Date Added: 2009-01-11 17:32:32 |
| brouha.pdf Path: Penn State >> I E >> 553 Fall, 2008 Description: ... Date Added: 2009-01-11 17:32:32 |
| Skeletal System Path: RIT >> SCI >> Human Bio Winter, 2007 Description: Skeletal System Lab 8 Function of the Bones Support Movement Protection Storage of Minerals Formation of Blood Cells that Make up Bones Osteoblasts are responsible for mineralization of the osteoid matrix. Osteocytes Osteoclast Osteoblast ... Date Added: 2008-04-17 16:50:36 |
| backlash.doc Path: Illinois State >> KNR >> 171 Spring, 2008 Description: Title: # of players: Ages: Equipment: How to play: Backlash Unlimited (even amount works better) 6+ 4 balloons or balls Evenly divide the group into two teams for this outdoor relay race. Once the teams are set, have each player pair up with another... Date Added: 2009-01-09 01:40:50 |
| 121-8.pdf Path: Ball State >> CS >> 121 Fall, 2008 Description: 3/31/2008 Linked Lists Same methods as ArrayList interface List extends Collection class LinkedListed implements List class ArrayList implements List Performance tradeoff ArrayList access element at numbered position insert or remove element a... Date Added: 2009-01-09 23:40:18 |
| Illinois11.doc Path: Cornell >> EDI >> 11 Fall, 2008 Description: Maintaining Communication Thomas: So tell us a little bit about how you maintained your communication between, if you will, their staff at the Human Services Center and your staff, because I know its kind of a third facet, if you will, of the advance... Date Added: 2009-02-17 22:12:26 |
| C88-1029.pdf Path: UPenn >> C >> 88 Fall, 2009 Description: Morphology and cross dependencies In the synthesis of personal pronouns in Romance languages Laurence DANLOS and Fiagametta NAMER LADL, Universit6 de Paris 7 2, Place Jussieu 75251 Paris Cedex 05, France Abstract This paper describes some of the pr... Date Added: 2009-04-15 21:44:11 |
| 0003body.pdf Path: Minnesota >> DIGITAL >> 002 Fall, 2008 Description: CIVIL SERVICE COMMISSION COMMISSIONEBS HARRY B. MITCHELL, President; LUCILLE FOSTER MCMILLIN, and LEONARD D. WHITE OFFICERS LAWSON A. MOYER, Chief Examiner; KENNETH C. VIPOND, Assistant Chief Examiner and Budget Officer; J. H. WEISS, Assistant Chief... Date Added: 2009-02-17 20:57:07 |
| 530977.pdf Path: Tufts >> OCW >> 530977 Fall, 1946 Description: Tufts OpenCourseWare Veterinary Public Health 2007 Tufts University 1. Veterinary Public Health 2. Overview OCW: Population Health (J. Lindenmayer) Page - 1 Tufts OpenCourseWare Veterinary Public Health 2007 Tufts University 3. The Great... Date Added: 2009-02-04 14:23:04 |
| 030707FDI.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Warsaw Business Journal Last updated: 10th July 2003 Banking Politics Industry Telecom Lifestyle Other News This week\'s WBJ Editorial Viewpoint Investor Eye Outside the office Movie Guide Restaurant Guide Goin... Date Added: 2009-02-11 20:29:22 |
| thesis2.pdf Path: Virginia Tech >> LIB >> 52797 Fall, 2008 Description: Chapter 1 Introduction Aging can be defined as the process by which organisms proceed through a physical deterioration of the body. Elderly individuals are the fastest growing segment of the population. In 1900, about 3.1 million persons, or roughly ... Date Added: 2009-02-18 01:18:07 |
| 7.001_EEO_Affirmative_Action.pdf Path: FAU >> CHAPTER >> 7 Fall, 2008 Description: Florida Atlantic University Regulation 7.001 Equal Employment Opportunity - Affirmative Action. (1) The following policy for the State University System was adopted by the Board of Regents on December 8, 1974: The State University System believes in ... Date Added: 2009-02-17 16:06:10 |
| 7.001_EEO_Affirmative_Action.pdf Path: FAU >> WISE >> 7 Fall, 2008 Description: Florida Atlantic University Regulation 7.001 Equal Employment Opportunity - Affirmative Action. (1) The following policy for the State University System was adopted by the Board of Regents on December 8, 1974: The State University System believes in ... Date Added: 2009-02-17 16:06:24 |
| prose1.pdf Path: Delaware >> EDUC >> 391 Fall, 2008 Description: ... Date Added: 2009-01-10 03:34:45 |
| 050911borrow.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: The Chinese, Too, May Be Worth Copying - New York Times September 11, 2005 The Chinese, Too, May Be Worth Copying By WILLIAM J. HOLSTEIN THE American economy is more open than Western Europe\'s, and may be better able to respond to challenges from Ch... Date Added: 2009-02-11 17:38:16 |
| quiz_answers_Quiz2_answers Path: Washington >> CHEM >> 239 Spring, 2006 Description: ... Date Added: 2008-06-30 13:36:30 |
| DJ.pdf Path: TAMU Commerce >> ENG >> 102 Fall, 2008 Description: The Logistics of Keeping a Dialogue Journal Whats a Dialogue Journal? According to Ann Berthoff, the researcher who developed this assignment (something she calls a dialectical notebook), Here is how it works: the dialectical notebook is a doubleentr... Date Added: 2009-01-09 15:34:07 |
| OH_MIN_JNL_v05_i02_999.pdf Path: Ohio State >> KB >> 1811 Fall, 1925 Description: 46 THE OHIO MINING JOURNAL. THE COAL TRADE JOURNAL. Published Every Wednesday. \'The Only Paper in the United States Entirely Devoted to the Interests of the Coal Trade, ESTABLISHED APRIL 21ST, 18G9. FREDERICK E. SAWARD, Editor and Proprietor. PUB... Date Added: 2009-02-17 22:31:35 |
| OH_MIN_JNL_v05_i02_999.pdf Path: Ohio State >> KB >> 32291 Fall, 2008 Description: 46 THE OHIO MINING JOURNAL. THE COAL TRADE JOURNAL. Published Every Wednesday. \'The Only Paper in the United States Entirely Devoted to the Interests of the Coal Trade, ESTABLISHED APRIL 21ST, 18G9. FREDERICK E. SAWARD, Editor and Proprietor. PUB... Date Added: 2009-02-17 22:31:35 |
| robot_control_architectures.pdf Path: CUNY Baruch >> CC >> 30 Fall, 2009 Description: Robot Control Architecture Sense-Plan-Act This consists of three linear steps. 1. Sense the environment. 2. Plan what to do next by building a world model through sensory input. Consider all goals both short term and long term. 3. Execute the plan th... Date Added: 2009-04-15 23:58:32 |
| 04_the_history_of_life_on_earth.pdf Path: Pasco-Hernando Community College >> BSC >> 1010l Fall, 2008 Description: THE HISTORY OF LIFE ON EARTH LOST WORLDS The Earth is ever changing. Antarctica was once a tropical paradise and the western United States was a shallow sea. Naturally occurring processes cause these changes over time. 25.1 CONDITIONS ON EARLY EART... Date Added: 2009-01-11 17:27:43 |
| 04_the_history_of_life_on_earth.pdf Path: Pasco-Hernando Community College >> BSC >> 1086l Fall, 2008 Description: THE HISTORY OF LIFE ON EARTH LOST WORLDS The Earth is ever changing. Antarctica was once a tropical paradise and the western United States was a shallow sea. Naturally occurring processes cause these changes over time. 25.1 CONDITIONS ON EARLY EART... Date Added: 2009-01-11 17:28:01 |
| 04_the_history_of_life_on_earth.pdf Path: Pasco-Hernando Community College >> BSC >> 1011l Fall, 2008 Description: THE HISTORY OF LIFE ON EARTH LOST WORLDS The Earth is ever changing. Antarctica was once a tropical paradise and the western United States was a shallow sea. Naturally occurring processes cause these changes over time. 25.1 CONDITIONS ON EARLY EART... Date Added: 2009-01-12 04:01:54 |
| 04_the_history_of_life_on_earth.pdf Path: Pasco-Hernando Community College >> BSC >> 1085l Spring, 2008 Description: THE HISTORY OF LIFE ON EARTH LOST WORLDS The Earth is ever changing. Antarctica was once a tropical paradise and the western United States was a shallow sea. Naturally occurring processes cause these changes over time. 25.1 CONDITIONS ON EARLY EART... Date Added: 2009-01-12 04:01:59 |
| stuChapter 7-Music.ppt Path: UCF >> MAR >> 4715 Fall, 2008 Description: Chapter 7-Musical Ride Nicole Howatt Musical Roots To What? From What? Quick Snapshot of Music Development Aspiring singer/songwriter writes few hot songs for a hot genre They form a band or work solo and build a loyal fan base at mus... Date Added: 2009-01-10 18:09:47 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> HOS >> 1014 Fall, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-10 18:35:42 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> HOS >> 3020 Fall, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-11 22:52:26 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> FRC >> 1010 Spring, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-10 18:30:45 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> HOS >> 4304 Fall, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-11 22:52:45 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> FRC >> 3212 Fall, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-10 18:31:33 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> VEC >> 2100 Fall, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-10 18:34:36 |
| Brazilian Journal of Plant Physiology.pdf Path: UF >> VEC >> 3221c Fall, 2008 Description: HEAT TREATMENT AND ACC OXIDASE IN MANGOES R E S E A R C H A R T I C145 LE Heat treatment effects on ACC oxidase activity of Keitt mangoes Renar Joo Bender1*, Eduardo Seibert1, Jeffrey K. Brecht2 1Departamento de Horticultura e Silvicultura, Faculda... Date Added: 2009-01-10 18:34:36 |
| vc44_tapper_grid.ppt Path: Illinois Tech >> MICE >> 44 Fall, 2008 Description: G4MICE GRID production Alex Tapper Test/demo of European Data Grid software IST 2003 Workshop in Milan October 2nd, 3rd and 4th Testing from September 30th Will use G4MICE GRID resources 30-40 computers Could generate >30M events? Sci... Date Added: 2009-02-17 23:23:08 |
| Schedule2.pdf Path: Texas Tech >> ARCH >> 5604 Fall, 2008 Description: Schedule Week 1: Oct 11, 2008 1. 2. 3. Complete Site Analysis (parking, transportation, high-lines, sight lines.etc) Begin working out Program for building (Spaces) Begin Laying out the floorplans according to the program Week 2: Oct 17, 2008 1. Ma... Date Added: 2009-04-15 20:16:02 |
| 05022myths.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / Comment funds dataIndustriesLexComment & anal... Date Added: 2009-02-11 17:38:56 |
| ANT324L last paper Path: Texas >> ANT >> 324L Fall, 2007 Description: ANT324L Dec 1 An Indigenous Death Pact Beginning with the fall of the last great indigenous empires of the Aztecs and the Mayans, the Mexican Federal Government has continuously oppressed, or blatantly ignored, indigenous peoples throughout the coun... Date Added: 2008-03-25 08:02:04 |
| ANT324L last paper Path: Texas >> ANT >> 324L Fall, 2007 Description: ANT324L Dec 1 An Indigenous Death Pact Beginning with the fall of the last great indigenous empires of the Aztecs and the Mayans, the Mexican Federal Government has continuously oppressed, or blatantly ignored, indigenous peoples throughout the coun... Date Added: 2008-03-25 09:06:45 |
| bstree1.ppt Path: Maryland >> ENEE >> 698 Fall, 2008 Description: GREEDY FUNCTION APPROXIMATION: BOOSTING and ADDITIVE TREE Presented By: Jie Shao 11/19/2003 University of Maryland, ENEE 698A Roadmap Detour: introduction of boosting Boosting Trees Numerical Optimization Right-sized Trees for Boosting 11/... Date Added: 2009-02-18 00:29:43 |
| DeloriaDeathAndReligion Path: Ohio State >> COMP STD >> 367 Spring, 2008 Description: - b/l ! M, - r l - I I \':\' ;1?\' g!;tE ;jljS iiiiliii;EiliE !;:;*!:iEtIgF IiiiiiiigFsilE : != I E : E i g ;si[;5 i f g E ! $ 3 l iF r c ) : c $ As a - ? 2 ^ 9 ;!F!fiFiF3i iSig;E;i;Ef ?;Ze EEE i 9ffgiais; Fi*:3Fifff:i;Eiii; lE ; g F ... Date Added: 2008-04-19 14:40:51 |
| Microsoft PowerPoint - Knight Ch 6 - dynamics I notes Path: Clemson >> PHYSICS >> 122 Spring, 2008 Description: Dynamics I - Chapter 6 Bodies in Equilibrium (a = 0) STRATEGY: 1. Diagram and givens converted to standard units 2. Draw free body diagram, identifying the _ direction 3. Resolve forces into x and y components 4. Use equations of equilibrium Hints o... Date Added: 2008-04-17 19:07:56 |
| panopticism Path: Binghamton >> ENG >> 117D Spring, 2008 Description: Foucault begins his story by describing the seventeenth century plaque. He tells how houses were closed off, there was separation, inspection, and how things were quarantined. From this, concepts of power and discipline were created. Since that time,... Date Added: 2008-03-11 19:12:58 |
| J1_ground_bounce.pdf Path: UC Irvine >> J >> 1 Fall, 2008 Description: Ground Bounce in Digital VLSI Circuits Payam Heydari, Member, IEEE, Massoud Pedram, Fellow, IEEE Abstract- This paper is concerned with the analysis and optimization of the ground bounce in digital CMOS circuits. First, an analytical method for calcu... Date Added: 2009-02-06 19:00:15 |
| 2dmotion.ppt Path: Valparaiso >> PHYSICS >> 151 Fall, 2008 Description: Remember: Problems worthy of attack Prove their worth by hitting back -Piet Hein Learning physics involves resistance training! II. 2-D (and 3-D) Motion A. Definition and Properties of Vectors B. Position, Velocity and Acceleration Vectors C. 2-D Mo... Date Added: 2009-02-06 20:21:22 |
| 050216energy.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Energy Central News DATAMONITOR: Meeting Kyoto objectives will be costly for energy users London, Feb 16, 2005 - M2 PRESSWIRE Recent research from independent market analyst Datamonitor* (DTM.L) reveals that meeting Europe`s growing electricity deman... Date Added: 2009-02-11 17:42:34 |
| 010827economy.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Hungarian business news from Budapest Business Journal Article Page Fri., August 31, 2001 Home This Week\'s BBJ Real Estate Listings Story Arch... Date Added: 2009-02-11 20:07:54 |
| MAM.doc Path: Duke >> FINANCE >> 453 Fall, 2008 Description: YIELD CURVE AND STOCK RETURN Midas Asset Management OBJECTIVE The yield curve is used to capture the overall movement of interest rates and has been a great predictor of future economic events. Securities with longer maturity\'s usually have a higher ... Date Added: 2009-01-10 02:54:44 |
| test2rev.pdf Path: SUNY Stony Brook >> MAP >> 103 Fall, 2008 Description: MAP 103 Spring 2008 Exam 2 Review Information Test format: There are 9 questions, a few with multiple parts. Each question or part of a question is worth 6 or 7 points apiece, for a total of 105 points. 100 points will be considered a perfect score.... Date Added: 2009-01-09 07:17:13 |
| pl942000.xls Path: Missouri (Mizzou) >> MCDC >> 2000 Fall, 2008 Description: Table 1. Population for Missouri Counties, Municipalities, and Legislative Districts: 1990 and 2000 Area Missouri Counties (115)* Adair Andrew Atchison Audrain Barry Barton Bates Benton Bollinger Boone Buchanan Butler Caldwell Callaway Camden Cape Gi... Date Added: 2009-02-17 22:46:21 |
| 2-2 Path: Texas >> CMS >> 315M Spring, 2006 Description: Rumors I. Types of Rumors A. \"Bogies\" (Negative) reflect feared or anxiety provoking outcomes (Dread rumors) Things that scare us. Designed to crate fear in people. Most common type of rumors. (75%) B. \"Wedge drivers\" intended to divide group loy... Date Added: 2008-04-16 22:32:10 |
| wd02_Rice.doc Path: Delaware >> CISC >> 101 Fall, 2008 Description: Making Sushi Rice Great sushi starts with the rice. If you master this process all you need to add is really good fish. The trick involves fanning the rice as it cools to help evaporate the moisture. The end result should be sticky rice with a glossy... Date Added: 2009-01-12 06:12:56 |
| 3081.pdf Path: Ohio State >> EDU P&L >> 802 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> CON SCI >> 300 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> MUSIC >> 769 Summer, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> GERMAN >> 703 Winter, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> CON SCI >> 701 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> NURSING >> 694 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> GERMAN >> 993 Spring, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> EDU P&L >> 732 Summer, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> NURSING >> 713 Spring, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> OHIOLINE >> 3000 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-02-17 22:37:40 |
| 3081.pdf Path: Ohio State >> EDU P&L >> 756 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> NURSING >> 715 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> EDU P&L >> 768 Fall, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> NURSING >> 745 Winter, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 3081.pdf Path: Ohio State >> MUSIC >> 745 Spring, 2008 Description: FactSheet Extension Powdery Mildew on Turfgrass Joseph W. Rimelspach Department of Plant Pathology Michael J. Boehm Department of Plant Pathology HYG-3081-96 Plant Pathology, 2021 Coffey Road, Columbus, OH 43210-1087 P owdery mildew fungi are fou... Date Added: 2009-01-11 22:27:00 |
| 06-07 Syllabus 101.doc Path: Spokane Falls Community College >> HLTH >> 101 Fall, 2008 Description: Profesor: Ferdinand Vlez Espaol 101 Oficina: 4-132B Horas de consulta: Mon. Thu 11:00-11:20 & 12:30-1:00 Other times by appointment Telfono: 533-3948 Correo electrnico: ferdinandv@spokanefalls.edu Class Website http:/faculty.spokanefalls.edu/AutoW... Date Added: 2009-02-02 16:15:05 |
| honors section requirements and how to write a question Path: UCLA >> PHIL >> 156 Spring, 2008 Description: Philosophy 156-Spring 2007 Honors section An honors section (189) will be offered for any interested student. Students can earn an additional unit on a P/NP basis only. I will not give a grade for honors section work, so do not sign up for the graded... Date Added: 2008-05-04 13:18:19 |
| lecture_10_1 Path: Cornell >> PAM >> 2100 Fall, 2008 Description: Inference for regression Simple linear regression IPS chapter 10.1 2006 W.H. Freeman and Company Objectives (IPS chapter 10.1) Inference for simple linear regression Simple linear regression model Confidence interval for regression parameters S... Date Added: 2009-01-09 17:20:34 |
| 050202consumer.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: RUSSIA PROFILE.org Thursday, February 3, 2005 February 2, 2005 Researchers give a portrait of Russian consumer Noviye Izvestia [From RIA Novosti\'s digest of the Russian press] The analytical company Data Direct yesterday presented a portrait of the ... Date Added: 2009-02-11 19:56:59 |
| MKA2021.doc Path: Pasco-Hernando Community College >> AST >> 1002 Spring, 2008 Description: PERSONAL SELLING MKA 2021 CATALOG DESCRIPTION MKA 2021 Personal Selling (3)(A.A.S./A.S.). Three hours per week. This course focuses on the fundamentals underlying the modern idea of the role of personal selling in society; the requirements to prepar... Date Added: 2009-01-09 06:03:16 |
| MKA2021.doc Path: Pasco-Hernando Community College >> PHY >> 2048c Fall, 2008 Description: PERSONAL SELLING MKA 2021 CATALOG DESCRIPTION MKA 2021 Personal Selling (3)(A.A.S./A.S.). Three hours per week. This course focuses on the fundamentals underlying the modern idea of the role of personal selling in society; the requirements to prepar... Date Added: 2009-01-09 06:07:39 |
| MKA2021.doc Path: Pasco-Hernando Community College >> CHM >> 2210c Fall, 2008 Description: PERSONAL SELLING MKA 2021 CATALOG DESCRIPTION MKA 2021 Personal Selling (3)(A.A.S./A.S.). Three hours per week. This course focuses on the fundamentals underlying the modern idea of the role of personal selling in society; the requirements to prepar... Date Added: 2009-01-12 04:02:35 |
| hw03.pdf Path: UF >> PHY >> 6645 Fall, 2008 Description: PHY 6645 Fall 2003 Homework 3 Due by 5 p.m. on Friday, September 19. No credit will be available for homework submitted after 5 p.m. on Monday, September 22. Answer all questions. Please write neatly and include your name on the front page of your a... Date Added: 2009-01-10 18:21:17 |
| BIOL121.schedule.pdf Path: UPenn >> BIO >> 121 Fall, 2007 Description: Biology 121: Professors Lampson (L), Rea (R) and Guest Research Lecturers (G) LECTURE SCHEDULE DATE LECTURE Introduction and Basic Principles 5-Sep (R) Course organization; chemistry of life 7-Sep (R) Chemistry of life 10-Sep (L) Life is cellular; pr... Date Added: 2009-02-06 17:38:39 |
| CRJ 125.doc Path: Palo Verde College >> ART >> 125 Fall, 2008 Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 4/25/07 Board Approval: 5/22/07 P al o V er d e C o l l eg e 1. Course Information. Course Initiator: William Smith Subject Area and Course Numb... Date Added: 2009-01-09 06:02:05 |
| CRJ 125.doc Path: Palo Verde College >> CRJ >> 125 Fall, 2008 Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 4/25/07 Board Approval: 5/22/07 P al o V er d e C o l l eg e 1. Course Information. Course Initiator: William Smith Subject Area and Course Numb... Date Added: 2009-02-02 15:23:24 |
| CRJ 125.doc Path: Palo Verde College >> ART >> 105 Fall, 2008 Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 4/25/07 Board Approval: 5/22/07 P al o V er d e C o l l eg e 1. Course Information. Course Initiator: William Smith Subject Area and Course Numb... Date Added: 2009-01-09 06:02:05 |
| arrayproject.doc Path: WPUNJ >> CS >> 230 Fall, 2008 Description: Array project: Do either (a) or (b) Due April 26,2007 (a)Fern Problem write a function void amultpb( double a[2][2],double x[2], double b[2]) which replaces x with ax+b for x and b have 2 components. . Use the formula x[0]= a[0][0]*x[0]+a[0][1]*x[1]... Date Added: 2009-02-17 23:38:40 |
| 061007wheat.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / Companies / Consumer industries - Pressure grows on Australias Wheat BoardSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.comCOMPANIES Consumer industriesSubscription pageClosePressure grows on Australias Wheat... Date Added: 2009-02-11 19:26:08 |
| 061007wheat.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / Companies / Consumer industries - Pressure grows on Australias Wheat BoardSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.comCOMPANIES Consumer industriesSubscription pageClosePressure grows on Australias Wheat... Date Added: 2009-02-11 19:46:34 |
| syl_f07.pdf Path: UF >> EEL >> 5840 Fall, 2008 Description: EEL-5840 : Elements of Machine Intelligence FALL SEMESTER 2007 2007 Catalog Data: Textbook: Reference: Elements of Machine Intelligence (3) Prereq: Senior Standing. Engineering and hardware concepts pertaining to the design of intelligent computer sy... Date Added: 2009-02-02 17:50:57 |
| WS 321, From Mystics to Feminists, Marta Vicente.doc Path: Kansas >> ORGN >> 321 Fall, 2008 Description: 1 From Mystics to Feminists: Women\'s History in Europe 1600 to the Present WS/HIST 321 Spring 2006, T & R 11:00-12:15 120 Snow Hall Prof. M. Vicente GTA: Emily Lowrance-Floyd Vicentes office: 213-G Bailey Berninis Ecstasy of Saint Lowrance-Floyds off... Date Added: 2009-02-02 19:23:47 |
| 16-Daemons Path: Lehigh >> CSE >> 265 Spring, 2008 Description: CSE 265: System and Network Administration Daemons init cron and atd inetd and xinetd Kernel daemons File service daemons Internet daemons Time synchronization daemons Booting and configuration daemons FTP and WWW proxy servers CSE 265: S... Date Added: 2008-08-06 18:18:44 |
| 16-Daemons Path: Lehigh >> CSE >> 265 Spring, 2008 Description: CSE 265: System and Network Administration Daemons init cron and atd inetd and xinetd Kernel daemons File service daemons Internet daemons Time synchronization daemons Booting and configuration daemons FTP and WWW proxy servers CSE 265: S... Date Added: 2008-08-06 18:18:44 |
| C82-2024.pdf Path: UPenn >> C >> 82 Fall, 2009 Description: A CONTRASTIVE ANALYSIS OF THE USE OF DEFINITE ARTICLES IN ENGLISHSCIENTIFIC TEXTS AND IN ENGLISH LITERATURE Janlne Gallals-Hamonno Fac. des Lettres et Sciences Humalnes, Universlt~ de Metz, Ile du Saulcy, 57000 Metz, France This paper is a contin... Date Added: 2009-04-15 20:42:02 |
| Answers_to_final_sample_questions_08 Path: Cornell >> PAM >> 2100 Fall, 2008 Description: PAM 2100 INSTRUCTOR: SALAM ABDUS SAMPLE FINAL QUESTIONS In total, there will be 10 problems and 15 multiple choice questions in the final. Out of the 10 problems, at least 6 problems will be from the material covered after the second prelim, and at m... Date Added: 2009-01-09 17:16:05 |
| CS310 comp science s05 Stewart quiz 3-4 Path: UCSD >> CS >> 310 Spring, 2005 Description: ... Date Added: 2008-02-15 16:13:49 |
| lec05f08.pdf Path: George Mason >> BINF >> 731 Fall, 2008 Description: Secondary Structure: Computational Problems BINF 731 Protein Structure Analysis Iosif Vaisman 2007 Secondary structure characterization Secondary structure assignment Secondary structure prediction Protein structure classification Structural class... Date Added: 2009-04-16 01:26:57 |
| refer.pdf Path: Virginia Tech >> LIB >> 080999 Fall, 2008 Description: REFERENCES ABAQUS, 1998, Hibbitt, Karlsson, and Sorensen, Inc., 100 Medway St., Providence, Rhode Island. ASTM D 3039, Standard Test Method for Tensile Properties of Polymer Matrix Composite Materials, 1994 Annual Book of ASTM Standards, Philadelphi... Date Added: 2009-02-18 01:09:38 |
| lecture2.pdf Path: UCLA >> STAT >> 202 Fall, 2008 Description: Today We will look at the Unix operating system, the philosophy underlying its design and some basic tools Lecture 2: The pipeline We will use as our case study the last week of traffic across the departments website www.stat.ucla.edu You will h... Date Added: 2009-02-17 17:23:43 |
| Librarians_Report_3-8-2002.pdf Path: GA Southern >> SPAN >> 2002 Fall, 2008 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 Faculty Senate Librarians Report March 8, 2002 A summary of business conducted by Fac... Date Added: 2009-02-02 21:32:41 |
| Lecture11-2008.pdf Path: UC Davis >> EAD >> 115 Fall, 2008 Description: EAD 115 Numerical Solution of Engineering and Scientific Problems David M. Rocke Department of Applied Science Numerical Integration Some functions of known form can be integrated analytically Others require numerical estimates because the form of... Date Added: 2009-01-09 19:34:24 |
| 060724land.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Aljazeera.Net - Forty million Chinese farmers lose land Advanced Search Homepage News Economy Culture Sci-Tech Special Reports Weather Polls Your feedback Contact Us About Aljazeera Code of Ethics Services Frequencies Arab World Global News Market ... Date Added: 2009-02-11 17:34:49 |
| 060724land.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Aljazeera.Net - Forty million Chinese farmers lose land Advanced Search Homepage News Economy Culture Sci-Tech Special Reports Weather Polls Your feedback Contact Us About Aljazeera Code of Ethics Services Frequencies Arab World Global News Market ... Date Added: 2009-02-11 18:11:31 |
| Lecture02.4up.pdf Path: Wisconsin >> CS >> 538 Fall, 2008 Description: Continuations provide a novel way to suspend and reexecute computations. 2. ML (Meta Language) Typed exceptions are provided. Abstract data types, with constructors, are included. 3. Prolog (Programming in Logic) Strong, compile-time type checking.... Date Added: 2009-02-04 14:18:46 |
| pd129.txt Path: Lehigh >> DMD >> 1 Fall, 2008 Description: Subject: Question on homeomorphism Date: Mon, 28 Jan 2002 20:56:43 +0530 From: \"Priyavrat C. Deshpande\" <pdeshpande@ip.eth.net> To: \"Tpopology List\" <dmd1@lehigh.edu> Can following situation happen ? X and Y are 2 topological spaces which are not hom... Date Added: 2009-02-17 23:13:27 |
| AM05-09.pdf Path: Embry-Riddle FL/AZ >> AM >> 05 Fall, 2008 Description: DOT/FAA/AM-05/9 Office of Aerospace Medicine Washington, DC 20591 Interpretation of Carboxyhemoglobin and Cyanide Concentrations in Relation to Aviation Accidents Dennis V. Canfield Arvind K. Chaturvedi Kurt M. Dubowski Civil Aerospace Medical Insti... Date Added: 2009-02-06 19:56:37 |
| Summer2007LectureSyllabus.pdf Path: UF >> ENY >> 3005 Fall, 2008 Description: WELCOME TO ENY 3005/5006 PRINCIPLES OF ENTOMOLOGY and GRADUATE SURVEY OF ENTOMOLOGY Distance Course Summer 2007 Instructors: Dr. Pete Coon Office: 3212, ENY building Phone: 392-1901 ext. 178 E-mail: petec@ifas.ufl.edu Frank Wessels Office: 3223, ENY ... Date Added: 2009-01-11 22:47:40 |
| TR-00-07.pdf Path: Virginia Tech >> CS >> 00000563 Fall, 2008 Description: Parallel Global Aircraft Conguration Design Space Exploration CHUCK A. BAKER, LAYNE T. WATSON, BERNARD GROSSMAN, WILLIAM H. MASON Multidisciplinary Analysis and Design (MAD) Center for Advanced Vehicles Virginia Polytechnic Institute and State Univer... Date Added: 2009-02-18 00:45:22 |
| word_f06_02.doc Path: Sierra >> BIOSCI >> 1 Fall, 2008 Description: PUK2 #2 Combined sequence with ends edited and overlap removed: AGGARGGCCTACACATGCAAGTCGAGCGGTAACAGATAAGAAGCTTGCTTCTT TTGCTGACGAGCGCCGgACGGGTGAGTAATGCCTGGGAATATACCCTGATGTG GgGGATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAG AGGGGGACCTTCGGGCCTCTCGC... Date Added: 2009-01-12 14:46:09 |
| word_f06_02.doc Path: Sierra >> BIOSCI >> 2 Fall, 2008 Description: PUK2 #2 Combined sequence with ends edited and overlap removed: AGGARGGCCTACACATGCAAGTCGAGCGGTAACAGATAAGAAGCTTGCTTCTT TTGCTGACGAGCGCCGgACGGGTGAGTAATGCCTGGGAATATACCCTGATGTG GgGGATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAG AGGGGGACCTTCGGGCCTCTCGC... Date Added: 2009-01-12 14:46:09 |
| word_f06_02.doc Path: Sierra >> BIOSCI >> 4 Fall, 2008 Description: PUK2 #2 Combined sequence with ends edited and overlap removed: AGGARGGCCTACACATGCAAGTCGAGCGGTAACAGATAAGAAGCTTGCTTCTT TTGCTGACGAGCGCCGgACGGGTGAGTAATGCCTGGGAATATACCCTGATGTG GgGGATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAG AGGGGGACCTTCGGGCCTCTCGC... Date Added: 2009-01-12 14:46:09 |
| parker.pdf Path: Arizona >> SGA >> 23 Fall, 2008 Description: Parker Small Grain Advisory March 23, 2008 Growth Stage Planted Jan 1 Early barley Late barley Durum Planted Feb 1 Early barley Late barley Durum 1-leaf 3-leaf 5-leaf 1-node Flag lf visible Boot Flower Milk Soft Mature Harvest dough H = stage in 2 w... Date Added: 2009-02-04 13:47:42 |
| parker.pdf Path: Arizona >> SGA >> 2008 Fall, 2008 Description: Parker Small Grain Advisory March 23, 2008 Growth Stage Planted Jan 1 Early barley Late barley Durum Planted Feb 1 Early barley Late barley Durum 1-leaf 3-leaf 5-leaf 1-node Flag lf visible Boot Flower Milk Soft Mature Harvest dough H = stage in 2 w... Date Added: 2009-02-04 13:47:42 |
| 19.pdf Path: LSU >> BIOLOGY >> 2 Fall, 2007 Description: Marine Pollution Bullet#r, Vol. 34, No. 4, pp. 269 275, 1997 Pergamon PII: S0025-326X(97)00129-4 ~\': 1997 Elsevier Science Ltd All rights reserved. Printed in Great Britain 0025 326X/97 $17.00 + 0.(X) Effects of Suspended, DieselContaminated Sedim... Date Added: 2009-02-06 18:51:34 |
| 06chapter_1.pdf Path: Virginia Tech >> LIB >> 080999 Fall, 2008 Description: CHAPTER 1 RATIONALE AND OBJECTIVE As the new millennium dawns, major new demands are required of the materials we use. Aromatic polyimides are a class of high performance polymers that have excellent thermal, electrical and mechanical properties. T... Date Added: 2009-02-18 00:52:37 |
| 296Quiz1.pdf Path: Syracuse >> MAT >> 296 Fall, 2008 Description: Name : MAT 296 Quiz 1 Show all work to receive full credit. 1. (2 pts.) Find the area of the region bounded by y = x3 x, y = 3x. 2. (3 pts) Consider the solid obtained by rotating the region bounded by y = x, y = x about the line x = 2. Sketch a t... Date Added: 2009-01-09 07:20:37 |
| Terms-and-Issues.pdf Path: W. Carolina >> ENGL >> 251 Fall, 2008 Description: ENGL 251 Gastle Exam 1 Study Guide Part I: Objective Answer (20 of 25 for 2 points each). Quiz-type questions (some taken directly from your quizzes) concerning comprehension of material you have read and information discussed in class. Example: Wha... Date Added: 2009-02-02 21:03:35 |
| Assembly Exploded Title Page (1) Path: Drexel >> MEM >> 201 Summer, 2005 Description: ... Date Added: 2008-04-20 22:08:29 |
| mt2_bl5_ans Path: Colorado College >> EC >> 151 Spring, 2008 Description: The Colorado College Department of Economics and Business Block 5: Principles of Microeconomics Block 5 Econ 151 Midterm # 2 answers 1) (a) (i) Average cost is the total cost per unit of output, while the marginal cost is the change in total cost for... Date Added: 2008-04-19 11:31:27 |
| w3.ppt Path: UCSD >> MAE >> 156 Fall, 2008 Description: The Hydraulic Turbine Design Sponsored by Edwards A Hill James Ho Bong Chung Fabiola Camacho Ramon Orlando Paz Kenny Nguyen Material Behavior Analysis Accomplished: Implement the Matlab program for the blade and shaft: - calculate the shear stres... Date Added: 2009-02-18 01:36:22 |
| an2007c.txt Path: Michigan >> LIB >> 200799 Fall, 1999 Description: ADMINISTRATIVE NOTES Newsletter of the Federal Depository Library Program -April 15, 1999 GP 3.16/3-2:20/07 (Vol. 20, no. 07) - SPECIAL OFFER AVAILABLE TO DEPOSITORIES [The following notice was sent to all depository libraries.] A Special Offer will... Date Added: 2009-02-11 21:16:40 |
| 20040830.txt Path: University of Dayton >> CPS >> 150 Fall, 2009 Description: Aug 30, 2004 (and intro lecture to Aug 31 lab) - - Course webapge, http:/academic.udayton.edu/SaverioPerugini/courses/cps150/ - see course calendar, includes - lectures summaries - homeworks - HW1 is now posted! - reading assignments (to b... Date Added: 2009-04-16 00:06:21 |
| florescuesta.pdf Path: IPFW >> SOC >> S450 Spring, 2008 Description: Publicado en Hispania (la norteamericana, no la espaola), 59 (1976), 95455. This review is a predecessor of my article On Editing Don Quixote, published in Cervantes 3.1 (1983): 334 and 160 (http:/www2.h-net.msu.edu/~cervantes/ csa/bcsas83.htm). Acco... Date Added: 2009-01-09 01:55:51 |
| 050304IncDist.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Beijing tries to face unrest over wealth gap: printer friendly version Beijing tries to face unrest over wealth gap By Joseph Kahn The New York Times Friday, March 4, 2005 BEIJIN... Date Added: 2009-02-11 17:27:58 |
| redblack.pg8.ps Path: UMBC >> GL >> 341 Fall, 1999 Description: Black Red Case 1 V L P S R Rotate V P L Dont care Extra Black S R Recolor P V L R S Then go to one of the other cases. Case 2 V L Case 3 V L Case ... Date Added: 2009-02-17 23:07:22 |
| HW2 Solutions.doc Path: Southern Methodist >> EE >> 8390 Fall, 2008 Description: ... Date Added: 2009-01-09 07:13:30 |
| sicknessuntodeath Path: BC >> PL >> 070 Spring, 2008 Description: SICKNESS UNTO DEATH Context Nothing in Kierkegaard\'s life (1813-1855) suggested he would enjoy posthumous fame. A peculiar man, often surly and unpleasant, possibly somewhat hunchbacked, Kierkegaard divided his time between wandering the streets of C... Date Added: 2008-05-11 13:40:26 |
| 8.2 Path: Georgia Tech >> AE >> 2020 Summer, 2007 Description: ... Date Added: 2008-04-07 12:49:37 |
| c0833.pdf Path: Martin Luther >> C >> 0833 Fall, 2008 Description: GARDEN RECORD Add this sheet to your regular 4-H Record Book. Keep all your records in one book. C0833 VEGETABLE 4-H CONTAINER GARDEN PLAN FOR FLOWER Project enrollment number Total square feet in garden NAME Garden Design: Draw a map of your ga... Date Added: 2009-02-18 13:42:08 |
| c0833.pdf Path: Washington State >> C >> 0833 Fall, 2008 Description: GARDEN RECORD Add this sheet to your regular 4-H Record Book. Keep all your records in one book. C0833 VEGETABLE 4-H CONTAINER GARDEN PLAN FOR FLOWER Project enrollment number Total square feet in garden NAME Garden Design: Draw a map of your ga... Date Added: 2009-02-18 13:42:08 |
| lecture1.ppt Path: FIU >> PAD >> 3003 Fall, 2008 Description: Public Administration PAD 3003 What is public administration? Administrator as implementer: PA may be defined as all processes, organizations and individuals associated with carrying out laws and other rules adopted or issued by legislatures, e... Date Added: 2009-02-02 21:26:17 |
| EE303_022307.pdf Path: Maryland >> EE >> 303 Spring, 2006 Description: ... Date Added: 2009-02-06 19:17:14 |
| TR 80-362.pdf Path: Purdue >> SA >> 362 Fall, 2008 Description: ... Date Added: 2009-02-02 15:50:08 |
| outline.doc Path: St. Norbert >> CS >> 225 Fall, 2009 Description: Binary Data Storage and Manipulation: Demonstrating Physical Representation and Implementation Tentative Detailed Outline of Research and Website Content Adam DeNoble Chris Kratz John Moss Ted Trisco CS-225 Group Project Fall 2004 1. Historical dev... Date Added: 2009-04-15 22:33:54 |
| Daniel Ellsberg Path: Yale >> PHIL >> 430 Fall, 2008 Description: ... Date Added: 2008-04-21 06:52:10 |
| Daniel Ellsberg Path: Yale >> ARCH >> 430 Fall, 2008 Description: ... Date Added: 2008-04-21 06:45:32 |
| ECON200Chw3.pdf Path: UCSD >> ECON >> 200c Spring, 2008 Description: Homework 3 Troy Kravitz April 25, 2007 Problem 16 Exercise 8 in the lecture notes: prove that there is no PSNE in the asymmetric linear Bertrand game, and explain why the PSNE existence theorem for innite games does not apply. Suppose (s1 , s2 ) is ... Date Added: 2009-02-02 17:29:41 |
| 050224priv.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: TCA - English Language Newspaper in Central Asia Afghanistan Kazakhstan Kyrgyzstan Uzbekistan Tajikistan Turkmenistan AFGHANISTAN KAZAKHSTAN KYRGYZSTAN TAJIKISTAN TURKMENISTAN UZBEKISTAN CENTRAL ASIA news Catalog Statistic Search Subscribe F.A.Q Cou... Date Added: 2009-02-11 18:40:17 |
| Group 12 Plant List.pdf Path: Purdue >> HORT >> 217 Fall, 2008 Description: Group 12 Evergreen Shrubs Abelia x grandiflora Buxus microphylla Buxus (Sheridan hybrids) Chamaecyparis pisifera Juniperus chinensis Juniperus horizontalis Juniperus procumbens Juniperus sabina Juniperus virginiana Leucotho fontanesiana Mahonia aqui... Date Added: 2009-02-11 22:14:11 |
| albrecht.pdf Path: Concordia Chicago >> DARKENERGY >> 2001 Fall, 2009 Description: Distinguishing between dark Title energy models: Big issues & SNAPpy details Andreas Albrecht UC Davis COSMOLOGICAL PROBES OF DARK ENERGY Chicago December 2001 Outline Big Issues 1. Not just another parameter 2. Challenges for theorists 3. What are ... Date Added: 2009-04-15 22:00:23 |
| The many layers of shakespeare Path: Colorado >> ENGL >> 3563 Fall, 2007 Description: 6 December 2007 Professor Mike Preston ENG 3563 The Many Layers of Shakespeare Peter Saccio, a scholar of Shakespeare and professor at Dartmouth College deems the collection of plays Romeo and Juliet and A Midsummer Nights Dream as part of the period... Date Added: 2009-03-18 13:09:33 |
| 2391.112.ps Path: Hawaii >> SOEST >> 2391 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207381262.0388276 Float: 2391 Profile: 112 Location: 32.2N 166.5E Date: 12/17... Date Added: 2009-02-17 20:10:40 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 620 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 596 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 525 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 680 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 625 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 601 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 590 Spring, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 690 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 660 Summer, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 606 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 591 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 697 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:08 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 664 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 610 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 594 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 737 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:08 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 670 Summer, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 612 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 595 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 738 Spring, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:08 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 324 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| EPS611_MasterSyllabi_2005.doc Path: N. Arizona >> EPS >> 671 Fall, 2008 Description: 1 Instructions for Instructors Teaching EPS Courses Attached is the master syllabus for the course that you have been assigned to teach. There are a few items that you should be aware of when using the master syllabus as a model for the course you wi... Date Added: 2009-01-09 05:15:07 |
| 462.generic.syllabus.pdf Path: Sonoma >> ENGL >> 462 Fall, 2008 Description: EDMS 462 TEACHING READING AND LANGUAGE ARTS IN THE ELEMENTARY SCHOOL Sonoma State University Department of Literacy and Elementary Education Philosophy The goal of this course is to prepare credential students to teach reading and language arts at t... Date Added: 2009-02-02 16:11:12 |
| Lecture%203%20Gains%20from%20Trade Path: University of Illinois, Urbana Champaign >> ACE >> 455 Spring, 2009 Description: ACE 455: International Trade in Food and Agriculture Lecture 3: Comparative Advantage and Gains from Trade Prof. Madhu Khanna Dept. of Agricultural and Consumer Economics University of Illinois, Urbana- Champaign Constant Cost PPF At every point o... Date Added: 2009-03-25 08:22:33 |
| chen_bbeak_lesson.pdf Path: Purdue >> BIOL >> 595e Spring, 2008 Description: Birds, Beaks, and Natural SelectionA Simulation Objective Students will learn about the role of mutations in natural selection and evolution. Time This lesson was designed for two to three 50-minute periods. Materials Teaching Evolution Case Studie... Date Added: 2009-01-09 20:41:46 |
| Paola_Sed_2000.pdf Path: UF >> GLY >> 5558c Spring, 2008 Description: Sedimentology (2000) 47 (Suppl. 1), 121178 Quantitative models of sedimentary basin lling CHRIS PAOLA Department of Geology & Geophysics and St. Anthony Falls Laboratory, University of Minnesota, Minneapolis, MN 55455, USA (E-mail: cpaola@tc.umn.edu... Date Added: 2009-01-10 18:33:10 |
| 644.pdf Path: Minnesota >> IMA >> 90 Fall, 2008 Description: ... Date Added: 2009-02-17 21:09:41 |
| chapter1.key Path: Michigan State University >> PHY >> 231C Spring, 2006 Description: PHYSICS 231 INTRODUCTORY PHYSICS I www.pa.msu.edu/courses/phy231 Course Information Scott Pratt prattsc@msu.edu (517) 355-9200, ext. 2016 Office Hours: Monday, 9-10:30 AM in 1248 BPS http:/www.pa.msu.edu/courses/phy231 1 2 Succeeding in Physics... Date Added: 2008-07-25 16:04:11 |
| maffettresume.pdf Path: South Carolina Aiken >> MAFFETT >> 703 Fall, 2009 Description: Sheryl Price Maffett 291 Palmetto Forge Road Saluda, SC 29138 (864) 445-0241 maffett@earthlink.net OBJECTIVE: To acquire a fulfilling position where I can use my skills and talents to become part of a productive professional team in a positive work e... Date Added: 2009-04-15 22:01:53 |
| OH_MIN_JNL_v05_i02_017.pdf Path: Ohio State >> KB >> 1811 Fall, 1925 Description: THE OHIO MINING JOURNAL. 17 MINE FURNACE VENTILATION. BY JOHN BA1LLIE. I present this paper on Mine Furnace Ventilation with some hesitation, for I have no doubt that most of the members of this Institute are better qualified to handle the subject... Date Added: 2009-02-17 22:31:32 |
| OH_MIN_JNL_v05_i02_017.pdf Path: Ohio State >> KB >> 32291 Fall, 2008 Description: THE OHIO MINING JOURNAL. 17 MINE FURNACE VENTILATION. BY JOHN BA1LLIE. I present this paper on Mine Furnace Ventilation with some hesitation, for I have no doubt that most of the members of this Institute are better qualified to handle the subject... Date Added: 2009-02-17 22:31:32 |
| HUMSV 183.doc Path: San Bernardino Valley College >> HUMSV >> 183 Fall, 2008 Description: HUMSV 183 ALCOHOL/DRUG COUNSELING I 1) Students will identify and discuss the critical skills and issues involved in becoming a professional counselor, as assessed by exams, term projects, and written assignments. 2) Students will demonstrate screen... Date Added: 2009-02-02 15:59:59 |
| new-course-mgmt-435-services-mktg.doc Path: Purdue >> IT >> 435 Fall, 2008 Description: Curriculum Proposal Items in red are filled in by School/Senate This form may be filled out online. Only grey boxes will accept text and will expand as you fill them in. A second page will be generated automatically if needed. Department: MHRM Autho... Date Added: 2009-02-02 15:43:33 |
| Software.doc Path: UCLA >> EDUC >> 255c Spring, 2008 Description: Software relevant for intervention studies SEM software AMOS EQS (1) (1) (2) (1) (2) (3) (2) (3) (4) (3) (4) (5) (4) (5) (6) (5) (6) (7) (6) (7) (8) Total = (8) Total = (7) (8) Total = LISREL Multilevel software HLM MlwiN (1) (1) (2) (2) (3) (3) (... Date Added: 2009-01-10 01:35:21 |
| kdd.pdf Path: George Mason >> INFS >> 795 Fall, 2008 Description: Generating English Summaries of Time Series Data Using the Gricean Maxims Somayajulu G. Sripada and Ehud Reiter and Jim Hunter and Jin Yu Dept. of Computing Science University of Aberdeen Aberdeen, Scotland, U.K. +44 (0) 1224 272295 {ssripada,ereite... Date Added: 2009-01-10 17:04:01 |
| prelab10 Path: Ohio State >> CSE >> 200 Spring, 2008 Description: CSE 200 Spring 2008 CSE200 Pre-Lab Session 10: Web Page Design Purpose: 5 Points The purpose of this lab is to give you an opportunity to create and publish a web page of your own, learning some of the basic web page components and what it means t... Date Added: 2008-04-17 02:02:42 |
| 480a_041_e2s.pdf Path: Arizona >> CHEM >> 044 Fall, 2009 Description: ... Date Added: 2009-04-15 23:26:38 |
| inducedemf.pdf Path: IUPUI >> PHYS >> 251 Fall, 2008 Description: IUPUI PHYS 251 LAB Page 1 of 6 INDUCED EMF OBJECTIVE To obtain a qualitative understanding of Faradays Law of Electromagnetic Induction and Lenzs Law of Induced Current by constructing a simple transformer. EQUIPMENT Two identical coils, laminated ... Date Added: 2009-02-02 14:33:31 |
| hw3.pdf Path: Washington >> POL S >> 542 Spring, 2008 Description: ATM S 542 Frierson HW #3 (due 5-16-08) 1) Use the linearized shallow water QG equations in the presence of a mean flow U for this problem. a. First calculate the speed of the mean flow that will create stationary Rossby waves for a given (k,l). Appr... Date Added: 2009-02-02 20:36:23 |
| Quiz3 Path: UC Davis >> PHY >> 7B Winter, 2008 Description: Physics 7B-A/B 2/6/08 Codes: grading use only Quiz # 3 DL sec: Name: last, first 1.)Twocontainersareconnectedbyatube ofinteriorcrosssectionarea1.210-4m2 (B) (A) andlength8.0cmshown.Thecontaineron water... Date Added: 2008-07-31 18:48:33 |
| L1502.pdf Path: Washington State >> TR >> 502 Fall, 2008 Description: 6.450 Introduction to Digital Communication MIT, Fall 2002 November 4, 2002 Lecture 15: Gaussian noise, covariance and spectral density 1 Review A set of rvs, (Z1 , . . . Zk ) are zero mean jointly Gaussian if they are all linear combinations of... Date Added: 2009-02-18 13:49:14 |
| L1502.pdf Path: Martin Luther >> TR >> 502 Fall, 2008 Description: 6.450 Introduction to Digital Communication MIT, Fall 2002 November 4, 2002 Lecture 15: Gaussian noise, covariance and spectral density 1 Review A set of rvs, (Z1 , . . . Zk ) are zero mean jointly Gaussian if they are all linear combinations of... Date Added: 2009-02-18 13:49:14 |
| AC 101 Fall 2007 Ch 3 Path: Quinnipiac >> AC >> AC101 Spring, 2008 Description: Hughes Ayers Hoskin John Wiley & Sons, Inc. 2004 The Accounting Process Chapter Three Prepared by: Sarita Sheth Santa Monica College Why study accounting? Investors want to make decisions based on good information. Financial Statements are a comp... Date Added: 2008-09-30 23:01:11 |
| Lecture_25_SlideHandouts.pdf Path: Kansas >> EECS >> 841 Fall, 2008 Description: #,?.2-.@$A.5@13? !\"#$%)*+,-./$0121)3 4/153$6)-.-7 8599$:;% <.=-,/.$>:G5+-./$\';J\'J$ #-./.)( 8)/2F-G$H$6)3=.I$\"G5+-./$\'J #=G5/2-.13$H$#7.912K1I$LM$N5O)3)*F$53@$ !P59,5C)3$)Q$R.32.$ND)S8/5*.$#-./.)$... Date Added: 2009-02-17 22:39:53 |
| Lecture_25_SlideHandouts.pdf Path: W. Kentucky >> EECS >> 841 Fall, 2008 Description: #,?.2-.@$A.5@13? !\"#$%)*+,-./$0121)3 4/153$6)-.-7 8599$:;% <.=-,/.$>:G5+-./$\';J\'J$ #-./.)( 8)/2F-G$H$6)3=.I$\"G5+-./$\'J #=G5/2-.13$H$#7.912K1I$LM$N5O)3)*F$53@$ !P59,5C)3$)Q$R.32.$ND)S8/5*.$#-./.)$... Date Added: 2009-02-17 22:39:53 |
| CH305 Chapter 6 notes part 2 Path: Texas >> CH >> 305 Spring, 2008 Description: CH 305 Chapter 6 part 2: Neutralizing the Threat of Acid Rain pH - Concentration Calculations Links pH, [H+] or [OH-] with [acid] or [base] with mass. Method: 1. Write equation for acid or base dissociating in water: Acid one or more H+ and anion Ba... Date Added: 2008-03-19 10:34:07 |
| MathInduction.pdf Path: UMBC >> CS >> 203 Fall, 2005 Description: CLASS NOTES ON MATHEMATICAL INDUCTION PROFESSOR LOMONACO Denition 1 (Weak Principle of Mathematical Induction (WPMI). Let S be a subset of the natural numbers N = {0, 1, 2, . . .}. Then 0S = S = N n S n + 1 S Denition 2 (Strong Principle of Ma... Date Added: 2009-02-17 23:08:31 |
| pretreatment.pdf Path: Illinois Tech >> IPRO >> 346 Fall, 2009 Description: June 2002 NREL/TP-510-32438 Lignocellulosic Biomass to Ethanol Process Design and Economics Utilizing Co-Current Dilute Acid Prehydrolysis and Enzymatic Hydrolysis for Corn Stover A. Aden, M. Ruth, K. Ibsen, J. Jechura, K. Neeves, J. Sheeh... Date Added: 2009-04-15 23:50:43 |
| PracMid2Soln.pdf Path: San Jose State >> SE >> 116b Spring, 2008 Description: (4\"1p ru\", n^id?ci\',-t d,;+ p\\a-ceu\"*v,t t^\\ae o\' znr/\'Pa:,\'\" s4 ali^g to d,b 1\\u.n tl^-u w. \':,\\ q.ri/\'-t +he o\'vea\"4 e- oc affse-e fl^,- ehAPoi^Js 9v\')\'tt*u ,. rar\',dont pand<l^r +r bstu\'ree.^ f \"{a- , -1 ,^, . . \", J yJ o\\ \\,t(- a. ... Date Added: 2009-02-02 16:07:57 |
| 060330gdp.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: IndustryWeek: Printer Friendly Home : Economics & Public Policy : Global Economy : British Economy Grows 1.8% In 2005 British Economy Grows 1.8% In 2005 Thursday, March 30, 2006 By . Agence France-Presse At its slowest pace since 1992, the British ec... Date Added: 2009-02-11 17:51:52 |
| 060330gdp.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: IndustryWeek: Printer Friendly Home : Economics & Public Policy : Global Economy : British Economy Grows 1.8% In 2005 British Economy Grows 1.8% In 2005 Thursday, March 30, 2006 By . Agence France-Presse At its slowest pace since 1992, the British ec... Date Added: 2009-02-11 18:02:57 |
| dojnsa11906wp.pdf Path: Mich Tech >> SS >> 2610 Fall, 2008 Description: U.S. Department of Justice Washington, D.C. 20530 January 19, 2006 LEGAL AUTHORITIES SUPPORTING THE ACTIVITIES OF THE NATIONAL SECURITY AGENCY DESCRIBED BY THE PRESIDENT As the President has explained, since shortly after the attacks of September ... Date Added: 2009-01-12 03:39:33 |
| dojnsa11906wp.pdf Path: Mich Tech >> SS >> 3910 Fall, 2008 Description: U.S. Department of Justice Washington, D.C. 20530 January 19, 2006 LEGAL AUTHORITIES SUPPORTING THE ACTIVITIES OF THE NATIONAL SECURITY AGENCY DESCRIBED BY THE PRESIDENT As the President has explained, since shortly after the attacks of September ... Date Added: 2009-01-12 03:39:33 |
| dojnsa11906wp.pdf Path: Mich Tech >> SS >> 3990 Fall, 2008 Description: U.S. Department of Justice Washington, D.C. 20530 January 19, 2006 LEGAL AUTHORITIES SUPPORTING THE ACTIVITIES OF THE NATIONAL SECURITY AGENCY DESCRIBED BY THE PRESIDENT As the President has explained, since shortly after the attacks of September ... Date Added: 2009-01-12 03:39:33 |
| dojnsa11906wp.pdf Path: Mich Tech >> ENG >> 3990 Spring, 2008 Description: U.S. Department of Justice Washington, D.C. 20530 January 19, 2006 LEGAL AUTHORITIES SUPPORTING THE ACTIVITIES OF THE NATIONAL SECURITY AGENCY DESCRIBED BY THE PRESIDENT As the President has explained, since shortly after the attacks of September ... Date Added: 2009-01-12 03:39:34 |
| dojnsa11906wp.pdf Path: Mich Tech >> SS >> 3660 Spring, 2008 Description: U.S. Department of Justice Washington, D.C. 20530 January 19, 2006 LEGAL AUTHORITIES SUPPORTING THE ACTIVITIES OF THE NATIONAL SECURITY AGENCY DESCRIBED BY THE PRESIDENT As the President has explained, since shortly after the attacks of September ... Date Added: 2009-01-09 23:53:33 |
| 395.pdf Path: University of Illinois, Urbana Champaign >> CHP >> 395 Fall, 2008 Description: Course Schedule - Spring 2009 Campus Honors Program Courses 395 Interdisciplinary Seminar credit: 3 hours. Seminar on interdisciplinary topics in the natural sciences, social sciences, humanities, and arts. Open to Chancellor\'s Scholars and other hon... Date Added: 2009-02-02 18:27:00 |
| Six Practices of Exemplary Leadership (496).pdf Path: Alabama >> RHM >> 496 Fall, 2008 Description: Leadership Six Practices of Exemplary Leadership Leadership is not something you do to people, Its something you do with people. Ken Blanchard, Patricia Zigarmi, and Drea Zigarmi Leadership and the One Minute Manager Six Practices of Exemplary Leade... Date Added: 2009-02-02 16:23:39 |
| howtotalk.pdf Path: Michigan >> EECS >> 584 Fall, 2008 Description: HowtoGiveanAcademicTalk,v3.1 PaulN.Edwards SchoolofInformation UniversityofMichigan www.si.umich.edu/~pne/ Youmayredistributethisdocumentfreely,foranypurposeexceptprivateprofit, solongasnothingisaddedorremoved,andsolongasthiscopyrightnoticeremain... Date Added: 2009-02-11 21:13:23 |
| hsa104.pdf Path: UNC >> HP >> 04 Fall, 2008 Description: Western HSA I Number of Counties in Region: 26 2004 ACTIVE HEALTH PROFESSIONALS* Physicians Non-Federal Physicians Primary Care Physicians Family Practice General Practice Internal Medicine Obstetrics/Gynecology Pediatrics Other Specialties Physici... Date Added: 2009-02-18 01:46:35 |
| Notes ch 1-7 Path: UMass (Amherst) >> PSYCH >> 100 Fall, 2008 Description: Multiple files are bound together in this PDF Package. Adobe recommends using Adobe Reader or Adobe Acrobat version 8 or later to work with documents contained within a PDF Package. By updating to the latest version, youll enjoy the following benefit... Date Added: 2009-03-04 20:40:29 |
| CHM 101 – Chap4notes.ppt Path: University of North Carolina, Wilmington >> CHM >> 101 Fall, 2008 Description: CHM 101 Chapter Four Properties of Aqueous Solutions Precipitation Reactions Acid Base Reactions Concentrations of Solutions Solution Stoichiometry Department of Chemistry and CHM 101 - Reeves Properties of Aqueous Solutions A solution is a ... Date Added: 2009-02-02 19:58:41 |
| CooksWysocki.pdf Path: McGill >> CHEM >> 2 Fall, 2008 Description: This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the authors institution, sharing with colleagues and providing to institution ... Date Added: 2009-02-18 13:32:14 |
| CooksWysocki.pdf Path: Arizona >> CHEM >> 2 Fall, 2008 Description: This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and education use, including for instruction at the authors institution, sharing with colleagues and providing to institution ... Date Added: 2009-02-18 13:32:14 |
| Practice Midterm 1 Path: Columbia >> MATH >> V1202 Fall, 2007 Description: Practice Questions for the 1st Midterm The following consists of practice questions to help you prepare for the midterm. They are similar in style and difficulty to what you can expect to see on the actual midterm. The actual midterm will be shorter,... Date Added: 2008-04-07 03:03:36 |
| ancel08.pdf Path: IUPUI >> ECON >> E304 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-09 01:57:33 |
| ancel08.pdf Path: IUPUI >> ECON >> E325 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-12 03:24:17 |
| ancel08.pdf Path: IUPUI >> ECON >> E337 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-09 01:57:33 |
| ancel08.pdf Path: IUPUI >> ECON >> E514 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-12 03:24:17 |
| ancel08.pdf Path: IUPUI >> ECON >> E408 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-09 01:57:33 |
| ancel08.pdf Path: IUPUI >> ECON >> E521 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-12 03:24:17 |
| ancel08.pdf Path: IUPUI >> ECON >> S201 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-09 01:57:33 |
| ancel08.pdf Path: IUPUI >> ECON >> E522 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-12 03:24:17 |
| ancel08.pdf Path: IUPUI >> ECON >> E305 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-09 01:57:47 |
| ancel08.pdf Path: IUPUI >> ECON >> E582 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-12 03:24:17 |
| ancel08.pdf Path: IUPUI >> ECON >> E600 Fall, 2008 Description: Sarah B. Ancel 6160 N. Olney St., Indianapolis, IN 46220 317.417.2447 Sarah.Ancel@yahoo.com Profile Trained economic and fiscal analyst with solid educational background and developed empirical skills. A proven innovator, developed multiple models ... Date Added: 2009-01-09 01:57:47 |
| CLNS93-1249.ps Path: Cornell >> LNS >> 93 Fall, 1993 Description: CLNS 93/1249 CLEO 93-18 Measurements of Exclusive Semileptonic Decays of D Mesons A. Bean,1 J. Gronberg,1 R. Kutschke,1 S. Menary,1 R.J. Morrison,1 S. Nakanishi,1 H.N. Nelson,1 T.K. Nelson,1 J.D. Richman,1 A. Ryd,1 H. Tajima,1 D. Schmidt,1 D. Sperka,... Date Added: 2009-02-17 21:36:35 |
| INDEX.txt?annotate=524&pathrev=1619 Path: Wisconsin >> ENGLISH >> 524 Fall, 2008 Description: <!DOCTYPE html PUBLIC \"-/W3C/DTD XHTML 1.0 Strict/EN\" \"http:/www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd\"> <html xmlns=\"http:/www.w3.org/1999/xhtml\" xml:lang=\"en\" lang=\"en\"> <!- ViewVC : http:/www.viewvc.org/ -> <head> <title>[svn] Annotation of /vdt/... Date Added: 2009-02-03 14:31:24 |
| scripts.ps Path: NMT >> CS >> 307 Fall, 2008 Description: One problem with learning to use shell scripts is that you may create a monster|a script that spawns processes without limit|that will drag down the system you\'re running on, and maybe even the whole network. If you\'re not sure what you\'re doing, it ... Date Added: 2009-02-06 18:04:23 |
| Epimetheus.pdf Path: Ohio State >> ECE >> 582 Fall, 2008 Description: Team Epimetheus EE682 Dr. Steven Bibyk Matt Beerman John Fatica Hubert Ho Erik Justen Brad Kramer Matt Rankin Karl Yeh * Wireless Sensor Module for Robot Platform * Epimetheus, which means afterthought, was a scatterbrained person in Greek mytholo... Date Added: 2009-01-11 22:31:00 |
| Epimetheus.pdf Path: Ohio State >> ECE >> 682y Fall, 2008 Description: Team Epimetheus EE682 Dr. Steven Bibyk Matt Beerman John Fatica Hubert Ho Erik Justen Brad Kramer Matt Rankin Karl Yeh * Wireless Sensor Module for Robot Platform * Epimetheus, which means afterthought, was a scatterbrained person in Greek mytholo... Date Added: 2009-01-11 22:31:00 |
| Epimetheus.pdf Path: Ohio State >> ECE >> 682z Fall, 2008 Description: Team Epimetheus EE682 Dr. Steven Bibyk Matt Beerman John Fatica Hubert Ho Erik Justen Brad Kramer Matt Rankin Karl Yeh * Wireless Sensor Module for Robot Platform * Epimetheus, which means afterthought, was a scatterbrained person in Greek mytholo... Date Added: 2009-01-11 22:31:00 |
| d02-BrainMethodMacro.ppt Path: Tulane >> NSCI >> 611 Fall, 2008 Description: How we know what we know; Macrostructure of the brain Brain & Language LING 411/412/489 NSCI 411/611/489 Harry Howard Tulane University Course administration Pass around roster Are the 3 students who didn\'t show up on Wednesday here? Nikhil is ... Date Added: 2009-01-11 21:09:59 |
| d02-BrainMethodMacro.ppt Path: Tulane >> NSCI >> 689 Fall, 2008 Description: How we know what we know; Macrostructure of the brain Brain & Language LING 411/412/489 NSCI 411/611/489 Harry Howard Tulane University Course administration Pass around roster Are the 3 students who didn\'t show up on Wednesday here? Nikhil is ... Date Added: 2009-01-11 21:09:59 |
| d02-BrainMethodMacro.ppt Path: Tulane >> SRVC >> 489 Fall, 2008 Description: How we know what we know; Macrostructure of the brain Brain & Language LING 411/412/489 NSCI 411/611/489 Harry Howard Tulane University Course administration Pass around roster Are the 3 students who didn\'t show up on Wednesday here? Nikhil is ... Date Added: 2009-01-11 21:09:59 |
| d02-BrainMethodMacro.ppt Path: Tulane >> LING >> 411 Fall, 2008 Description: How we know what we know; Macrostructure of the brain Brain & Language LING 411/412/489 NSCI 411/611/489 Harry Howard Tulane University Course administration Pass around roster Are the 3 students who didn\'t show up on Wednesday here? Nikhil is ... Date Added: 2009-01-11 21:09:59 |
| d02-BrainMethodMacro.ppt Path: Tulane >> NSCI >> 411 Fall, 2008 Description: How we know what we know; Macrostructure of the brain Brain & Language LING 411/412/489 NSCI 411/611/489 Harry Howard Tulane University Course administration Pass around roster Are the 3 students who didn\'t show up on Wednesday here? Nikhil is ... Date Added: 2009-01-11 21:09:59 |
| lecture 4.pdf Path: N.C. State >> ARE >> 201 Fall, 2008 Description: 9/2/2008 Demand and Supply Applications Demand Responsiveness P With a steep demand curve, quantity drops just little with a given price increase. Less Steep Demand Steeper Demand Q 1 9/2/2008 Demand Responsiveness P With a less steep demand c... Date Added: 2009-02-04 14:44:38 |
| lecture 4.pdf Path: N.C. State >> ARE >> 2 Fall, 2008 Description: 9/2/2008 Demand and Supply Applications Demand Responsiveness P With a steep demand curve, quantity drops just little with a given price increase. Less Steep Demand Steeper Demand Q 1 9/2/2008 Demand Responsiveness P With a less steep demand c... Date Added: 2009-02-04 14:44:38 |
| CH07.pdf Path: UNC Charlotte >> ACCT >> 6299 Fall, 2008 Description: Equity Valuation and Analysis Lundholm & Sloan Chapter 7 Structured Forecasting 1 Forecast Sales 2 2 Forecast Margins Op. Expenses Interest Expense 6 Forecast Tax Rate Tax Expense 7 Pro Forma Inc. Stmt. 4 Forecast Depr. Rate Forecast Turnover ... Date Added: 2009-02-02 19:54:48 |
| Lecture11.ppt Path: Texas Tech >> PHYS >> 1408 Fall, 2008 Description: Chapter 11 Angular Momentum; General Rotation Units of Chapter 11 Angular MomentumObjects Rotating About a Fixed Axis Vector Cross Product; Torque as a Vector Angular Momentum of a Particle Angular Momentum and Torque for a System of Particles; Gene... Date Added: 2009-04-15 20:19:46 |
| index.txt Path: Arizona >> DRG >> 024 Fall, 2009 Description: FILE: DRG_LIST.TXT DATE: February 6, 1997 * FILE LISTING AND DESCRIPTION OF THE DATA SETS This section contains a full file listing and size description of the data. There is a one-to-one correspondence between data files and their respective wor... Date Added: 2009-04-15 22:47:17 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 706 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 819 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> HIST >> 633 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 712 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> GEOG >> 650 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 801 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 897 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> HIST >> 634 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 717 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> GEOG >> 695 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 606 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 806 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> HIST >> 645 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 650 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 719 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> GEOG >> 696 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 668 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 807 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> HIST >> 660 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 697 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 722 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> GEOG >> 697 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 702 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 852 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> ECON >> 698 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:55 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 794 Spring, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> HIST >> 616 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> IS >> 706 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:54 |
| IRTheory_Tom_Lansford_Final_3_.pdf Path: Old Dominion >> POLS >> 697 Fall, 2008 Description: IR Theory and the Post-Iraq World by Tom Lansford Like many other academic fields, international relations (IR) has been criticized for increasing specialization, and a narrowness of inquiry, which when combined, limit the overall utility of the dis... Date Added: 2009-01-09 05:51:56 |
| Chap012.doc Path: Washington State >> VANCOUVER >> 7 Fall, 2008 Description: Chapter 12 Macroeconomics and Industry Analysis 1. Expansionary (i.e., looser) monetary policy to lower interest rates would help to stimulate investment and expenditures on consumer durables. Expansionary fiscal policy (i.e., lower taxes, higher gov... Date Added: 2009-02-18 13:48:50 |
| Chap012.doc Path: Martin Luther >> VANCOUVER >> 7 Fall, 2008 Description: Chapter 12 Macroeconomics and Industry Analysis 1. Expansionary (i.e., looser) monetary policy to lower interest rates would help to stimulate investment and expenditures on consumer durables. Expansionary fiscal policy (i.e., lower taxes, higher gov... Date Added: 2009-02-18 13:48:50 |
| European Claims in North America, 1750 and 1763 Map.rtf Path: Illinois State >> THE >> 330 Fall, 2008 Description: ... Date Added: 2009-01-12 03:22:14 |
| HW3.pdf Path: Penn State >> I E >> 419 Spring, 2008 Description: HW #3 1) The following production line has 5 operations with elemental times: 1=0.2, 2=0.5, 3=0.3, 4=0.2, 5=0.5 (in minutes). Develop a set of workstations that would most efficiently balance the production line and decrease the idle time. Management... Date Added: 2009-01-09 06:12:48 |
| v31n2-195-209.pdf Path: Hawaii >> SCHOLARSPA >> 10125 Fall, 1989 Description: Pacific Science (1977), vol. 31, no. 2 1977 by The University Press of Hawaii. All rights reserved The Genus Pittosporum (Pittosporaceae) on Rapa Island and on the Austral Islands, Polynesia Pacific Plant Studies 31 1 HAROLD ST. JOHN 2 Up TO THE P... Date Added: 2009-02-17 19:43:15 |
| v31n2-195-209.pdf Path: Hawaii >> SCHOLARSPA >> 1192 Fall, 2008 Description: Pacific Science (1977), vol. 31, no. 2 1977 by The University Press of Hawaii. All rights reserved The Genus Pittosporum (Pittosporaceae) on Rapa Island and on the Austral Islands, Polynesia Pacific Plant Studies 31 1 HAROLD ST. JOHN 2 Up TO THE P... Date Added: 2009-02-17 19:43:15 |
| v31n2-195-209.pdf Path: University of Hawaii, Manoa >> BUS >> 209 Spring, 2008 Description: Pacific Science (1977), vol. 31, no. 2 1977 by The University Press of Hawaii. All rights reserved The Genus Pittosporum (Pittosporaceae) on Rapa Island and on the Austral Islands, Polynesia Pacific Plant Studies 31 1 HAROLD ST. JOHN 2 Up TO THE P... Date Added: 2009-02-02 17:54:38 |
| q-101.cisco.call.manager.privilege.escalation.txt Path: Purdue >> SA >> 101 Fall, 2008 Description: _ The U.S. Department of Energy Computer Incident Advisory Capability _ _ _ _ _ / | /_\\ / \\_ _|_ / \\ \\_ _ INFORMATION BULLETIN Cisco Call Manager Privilege Escalation [Document ID: 68792] January 18, 2006 17:00 GMT Number Q-101 _ PROBLEM: A vulnerabi... Date Added: 2009-02-02 15:49:43 |
| set14.ps Path: FSU >> CS >> 4101 Fall, 2008 Description: Spatial Locality one word lines do not exploit spatial locality for typical computations spatial locality implies if address A is needed then A + will be needed soon. Caches attempt to exploit spatial locality by using multiple word cache lines. when... Date Added: 2009-02-17 18:59:39 |
| set14.ps Path: S.F. State >> CS >> 4101 Fall, 2008 Description: Spatial Locality one word lines do not exploit spatial locality for typical computations spatial locality implies if address A is needed then A + will be needed soon. Caches attempt to exploit spatial locality by using multiple word cache lines. when... Date Added: 2009-02-17 18:59:40 |
| 5A.pdf Path: UCSD >> ECE >> 101 Fall, 2008 Description: ECE 101 Discussion #5a Weeks 0-4 Review: Signal Basics System Properties (M, C, S, I, TI, L) Convolution LTI System Properties Impulse vs. Step Response Fourier Series (CT and DT) - Synthesize and Analyze - Properties - Filtering Drill Problems: - Ne... Date Added: 2009-01-11 21:37:24 |
| P91-1026.pdf Path: UPenn >> P >> 91 Fall, 2009 Description: AUTOMATIC NOUN CLASSIFICATION BY USING JAPANESE-ENGLISH WORD PAIRS* Naomi Inoue KDD R [Harris] in linguistics. Focusing on nouns, the idea claims th... Date Added: 2009-04-15 21:39:32 |
| references.pdf Path: George Mason >> UNIT >> 4 Fall, 2009 Description: Resources (bibliography and websites): Books Ellis, Joseph, His Excellency. New York: Alfred A. Knopf, 20004. An important biography of Washington that includes his role in the development of the Constitution. Foner, Eric & John A. Garraty, eds. The ... Date Added: 2009-04-16 01:28:55 |
| 18-cavity-plasmon.ppt Path: Texas A&M >> PHYS >> 674 Fall, 2008 Description: Cavities and plasmonics in solid state quantum computing Chang DE, et al., Strong coupling of single emitters to surface plasmons, PHYSICAL REVIEW B 76 (3): Art. No. 035420 JUL 2007 Chang DE, Sorensen AS, Hemmer PR, et al., Quantum optics with surf... Date Added: 2009-02-03 13:25:43 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 482 Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-11 17:07:37 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 390 Spring, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-09 20:26:36 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 101 Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-11 20:45:22 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 340 Spring, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-09 20:29:14 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 351 Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-10 17:53:54 |
| Chapter_07.ppt Path: N. Illinois >> ELE >> 215 Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-09 20:26:36 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 470 Spring, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-11 17:07:37 |
| Chapter_07.ppt Path: N. Illinois >> ELE >> 215s Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-09 20:26:36 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 481 Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-11 17:07:37 |
| Chapter_07.ppt Path: N. Illinois >> MEE >> 350 Fall, 2008 Description: Chapter 7: Dimensional Analysis and Modeling Eric G. Paterson Department of Mechanical and Nuclear Engineering The Pennsylvania State University Spring 2005 Note to Instructors These slides were developed1, during the spring semester 2005, as a tea... Date Added: 2009-01-09 20:26:36 |
| eng 151 persuasive ideas Path: Ohio >> ENG >> 151 Spring, 2008 Description: Journal 11 What to Persuade March 3, 2008 406 Words I could write about adult cartoons. Cartoons should not feature adult content. I will borrow ideas from the sample in the textbook. It\'s bad because it\'s a cartoon, so parents just assume its oka... Date Added: 2008-05-29 11:47:26 |
| DiffractionHO.pdf Path: Colorado >> G >> 5200 Fall, 2008 Description: Diffraction Diffraction X-ray Neutron Electron An atom in space will elastically scatter X-rays as a function of angle. It will behave as a point source, but the intensity will decrease with angle. The intensity is calculated from theoretical wa... Date Added: 2009-02-04 14:05:48 |
| fys_sample_assignment_kalamazoo.pdf Path: Simmons >> SCHOLAR >> 10090 Fall, 1940 Description: KalamazooCollege SampleFirstYearSeminarAssignment2005 SurvivorintheLibrary:CollegeInformationLiteracySkills OldsUptonOU321B,W25September VisionsofAmerica:ByEar(ZaidePixley) OurSeminarwillparticipateinoneclasssessioncalledSurvivorintheLibrary:College... Date Added: 2009-02-11 20:49:57 |
| fys_sample_assignment_kalamazoo.pdf Path: Simmons >> SCHOLAR >> 139 Fall, 2008 Description: KalamazooCollege SampleFirstYearSeminarAssignment2005 SurvivorintheLibrary:CollegeInformationLiteracySkills OldsUptonOU321B,W25September VisionsofAmerica:ByEar(ZaidePixley) OurSeminarwillparticipateinoneclasssessioncalledSurvivorintheLibrary:College... Date Added: 2009-02-11 20:49:57 |
| CRC text 2.doc Path: East Carolina >> JUST >> 6700 Spring, 2008 Description: 12741528.doc The examples listed in the sidebar highlight the disconnect between what the person really wants to accomplish and the information the system provides. In each example, the information could exist within the system, but it didnt allow fo... Date Added: 2009-02-02 14:10:12 |
| p34-ferraiolo.pdf Path: Syracuse >> CIS >> 774 Fall, 2008 Description: A Role-Based Access Control Model and Reference Implementation Within a Corporate Intranet DAVID F. FERRAIOLO, JOHN F. BARKLEY, and D. RICHARD KUHN National Institute of Standards and Technology This paper describes NISTs enhanced RBAC model and our... Date Added: 2009-01-12 04:19:35 |
| p34-ferraiolo.pdf Path: Syracuse >> CSE >> 774 Fall, 2008 Description: A Role-Based Access Control Model and Reference Implementation Within a Corporate Intranet DAVID F. FERRAIOLO, JOHN F. BARKLEY, and D. RICHARD KUHN National Institute of Standards and Technology This paper describes NISTs enhanced RBAC model and our... Date Added: 2009-01-12 04:19:35 |
| GEPL 4110 final.ppt Path: Toledo >> GEPL >> 4110 Fall, 2008 Description: GEPL 4110 Final Project Created By: Jennifer Shrock ... Date Added: 2009-02-02 20:20:47 |
| 051011doha.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / World / International economy - US and EU pressed on Doha concessionsSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Wednesday Oct 12 2005 . All times are London time. Roger Bove Edit Profile Take a Tour Log out World / Intern... Date Added: 2009-02-11 18:28:36 |
| LeadAcid.pdf Path: Mississippi State >> ECE >> 4522 Fall, 2009 Description: Batteries Lead-Acid Batteries by Richard Perez n 1970, we realized that our dreams depended on cheap land. The only desirable property we could afford was in the outback. Everything was many miles down a rough dirt road and far from civilized conve... Date Added: 2009-04-15 21:35:14 |
| opamp.pdf Path: UCSD >> ECE >> 60 Fall, 2008 Description: Linear Ampliers and OpAmps References: Hayes & Horowitz (pp 163-240), Rizzoni (Chapter ?) Ampliers are two-port networks in which the output voltage or current is directly proportional to either input voltage or current. Four dierent kind of ampliers... Date Added: 2009-02-06 18:39:50 |
| hw1.pdf Path: UC Davis >> ECS >> 231 Fall, 2008 Description: ECS231 Homework Assignment 1 Due: April 21, 2008 1. The polynomial p1 (x) = (x 1)6 has the value zero at x = 1 and is positive elsewhere. The expanded form of the polynomial p2 (x) = x6 6x5 + 15x4 20x3 + 15x2 6x + 1, is mathematically equivalen... Date Added: 2009-01-12 14:44:25 |
| CHRNA7.gbAUG.doc Path: UCSD >> ELCAPITAN >> 7 Fall, 2008 Description: LOCUS DEFINITION ACCESSION VERSION KEYWORDS SOURCE ORGANISM NT_010194 145436 bp DNA linear CON 20-AUG-2004 Homo sapiens chromosome 15 genomic contig. NT_010194 REGION: 3108355.3253790 NT_010194.16 . Homo sapiens (human) Homo sapiens Eukaryota; ... Date Added: 2009-02-17 18:31:34 |
| Lecture #2 Path: USC >> BUAD >> 304 Spring, 2008 Description: Mahoney 1 Neil Mahoney Discussion Section # 14739 Lecture Assignment #2 Why is this group a team? The group from TA Stearns is a team because they generate positive synergy through a coordinated effort. They also are not only accountable for their i... Date Added: 2008-04-26 06:52:31 |
| HW19soln Path: Clemson >> ME201 >> Me201 Fall, 2008 Description: 1/4 Fall 2008 HW # 19 ... Date Added: 2009-04-05 18:22:00 |
| Assignment-GFV3.pdf Path: Utah State >> CEE >> 6500 Fall, 2008 Description: HJ D/s of gate with finite length of D/s channel pp. 214-215 HW #2 Re-do Problem 4 on page 215 Given U/s gate, releases flow at 2 ft depth., M3 curve to HJ, M2 from HJ to critical depth at end of channel (free fall), channel is 1000 feet long (not 80... Date Added: 2009-02-17 22:23:31 |
| Chapter 5 Path: St. Vincent >> BA >> 104 Spring, 2008 Description: Chapter 5 Planning - Planning = choosing a goal and developing a strategy to achieve that goal. - Benefits of planning are intensified effort, persistence, direction, and creation of task strategies - - First step in planning is to set goals S.M.A... Date Added: 2008-04-17 17:56:12 |
| v52n3-259-272.pdf Path: Hawaii >> SCHOLARSPA >> 1578 Fall, 2008 Description: Pacific Science (1998), vol. 52, no. 3: 259-272 1998 by University of Hawai\'i Press. All rights reserved Age, Growth, and Mortality of Caulolatilus affinis (Osteichthyes: Branchiostegidae) from the Southern Gulf of California 1 JUAN F. ELORDUY-GARA... Date Added: 2009-02-17 19:46:30 |
| v52n3-259-272.pdf Path: Hawaii >> SCHOLARSPA >> 10125 Fall, 1989 Description: Pacific Science (1998), vol. 52, no. 3: 259-272 1998 by University of Hawai\'i Press. All rights reserved Age, Growth, and Mortality of Caulolatilus affinis (Osteichthyes: Branchiostegidae) from the Southern Gulf of California 1 JUAN F. ELORDUY-GARA... Date Added: 2009-02-17 19:46:30 |
| Convince note cards_Notes Path: Cornell >> COMM >> 2010 Spring, 2007 Description: INTRO: To be or not to beAssisted suicide! Also known as voluntary euthanasia creates a highly charged discussion, both for and against, almost every time its brought up in conversation. And deservingly too, it is a topic that deserves much attention... Date Added: 2009-02-19 22:50:55 |
| PL4-4.pdf Path: UConn >> CSE >> 4102 Fall, 2008 Description: \" CSE 2100 \" ! Overview Controlling the Control ! ! Closures Continuation Closures ! Bindings Revisited Consider the following fragment fun foo f = f 10; val special = let val x = 100 in fn y => x ... Date Added: 2009-01-11 22:06:38 |
| PL4-4.pdf Path: UConn >> CSE >> 5102 Fall, 2008 Description: \" CSE 2100 \" ! Overview Controlling the Control ! ! Closures Continuation Closures ! Bindings Revisited Consider the following fragment fun foo f = f 10; val special = let val x = 100 in fn y => x ... Date Added: 2009-01-11 22:06:38 |
| DAG092.pdf Path: Caltech >> GE >> 261 Spring, 2008 Description: ... Date Added: 2009-01-11 18:30:16 |
| DAG092.pdf Path: Caltech >> CE >> 300 Spring, 2008 Description: ... Date Added: 2009-01-11 18:30:16 |
| DAG092.pdf Path: Caltech >> GE >> 010 Winter, 2008 Description: ... Date Added: 2009-01-11 18:30:16 |
| DAG092.pdf Path: Caltech >> GE >> 013 Spring, 2008 Description: ... Date Added: 2009-01-11 18:30:16 |
| DAG092.pdf Path: Caltech >> GE >> 191 Fall, 2008 Description: ... Date Added: 2009-01-11 18:30:16 |
| Chapter One Psychology Path: N. Colorado >> PHIL >> 1000 Fall, 2006 Description: Chapter One: Famous Faces in Psychology: The Greeks: Socrates: love of wisdom and truth (epistemology) Plato: memory, perception, lack of intellectual functioning Aristotle: dreams, thought, causation, para psyche (deanima, latin) Heavens: Copernicus... Date Added: 2008-02-27 09:48:55 |
| an2004l.txt Path: Michigan >> LIB >> 200499 Fall, 1999 Description: ADMINISTRATIVE NOTES NEWSLETTER OF THE FEDERAL DEPOSITORY LIBRARY PROGRAM Vol. 20, no. 04 GP 3.16/3-2:20/04 February 15, 1999 STAT-USA/Internet Demonstration One STAT-USA demonstration session will be held for depository librarians attending the A... Date Added: 2009-02-11 21:16:37 |
| pracexam3.pdf Path: UC Davis >> MATH >> 3 Fall, 2008 Description: ... Date Added: 2009-02-06 18:05:44 |
| ch_5_link_layer_LAN.ppt Path: George Mason >> INFS >> 612 Fall, 2008 Description: Chapter 5 Link Layer and LANs A note on the use of these ppt slides: Were making these slides freely available to all (faculty, students, readers). Theyre in PowerPoint form so you can add, modify, and delete slides (including this one) and slide co... Date Added: 2009-01-10 17:03:58 |
| summ2.pdf Path: Washington >> POL S >> 583 Fall, 2008 Description: Math 583 Lecture 5 (May 14) LECTURES 5-6 SUMMARY Spring 2008 1. For a continuous map on a compact metric space, the ergodic measures are the extreme points of the compact of invariant probability measures. By Krein-Milman, ergodic measures exist. ... Date Added: 2009-02-02 20:36:26 |
| 31295017082479.pdf Path: Texas Tech >> ETD >> 07012008 Fall, 2009 Description: PRODUCTIVITY, BEHAVIOR, AND ENVIRONMENTAL IMPACT OF OUTDOOR GESTATING SOWS by HAROLD ANINDO RACHUONYO, B.Sc, M.Sc. A DISSERTATION IN ANIMAL SCIENCE Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements ... Date Added: 2009-04-15 20:22:48 |
| Handout_1.pdf Path: UF >> EML >> 5595 Fall, 2008 Description: ... Date Added: 2009-01-10 18:25:04 |
| CSCE 3612 ch8-3 Path: North Texas >> CSCE >> 3612 Fall, 2008 Description: Networks Example: elevator controller. 2008 Wayne Wolf Overheads for Computers as Components 2nd ed. Terminology Elevator car: holds passengers. Hoistway: elevator shaft. Car control panel: buttons in each car. Floor control panel: elevator ... Date Added: 2008-09-30 22:37:23 |
| project.pdf Path: Santa Clara >> CSE >> 174 Fall, 2009 Description: Computer Engineering 174 Project Assignment 1 Introduction The course project requires you to work in teams with your classmates in order to build a room reservation and scheduling system. You will be randomly assigned to a team of 68 people to form... Date Added: 2009-04-15 20:19:03 |
| psym986.pdf Path: UC Davis >> ANIMALSCIE >> 986 Fall, 2008 Description: Egg Processing - Ideas for the Future bY Glenn W. Froning University of Nebraska Lincoln NE 68583-0919 Introduction In the past, most eggs were believed to be essentially sterile at the time of laying. As far as spoilage organisms this is likely tr... Date Added: 2009-02-06 18:14:39 |
| hw7soln.pdf Path: Purdue >> ECE >> 202 Fall, 2008 Description: ECE 202 - Linear Circuit Analysis II Homework 7 Solutions November 13, 2008 Solution 18.6 Mesh a: vin (t) (ia ic ) 2 d (ia ib ) + dt dia dib vin (t) ia + ic 2 +2 + dt dt dic dt dic dt =0 =0 Mesh b: 2 d dic (ib ia ) (ib ic ) ib dt dt dia ... Date Added: 2009-01-11 17:58:48 |
| 450syllabus.pdf Path: S.F. State >> BIOL >> 450 Fall, 2008 Description: Biology of the Protozoa Biology 450 Fall 2004 DATE 26 August 31 G. Antipa, antipa@sfsu.edu Office Hours T 4-5, Th 11-12 723 HH, 338-2951 READING pgs 1-12, pgs 296-300 pgs 13-29, pgs 180-198 pgs 30-43 pgs 44-86 pgs 44-86 pgs 164-166 pgs 170-179 pgs 1... Date Added: 2009-02-17 17:33:45 |
| power.pdf Path: Washington >> ART >> 207 Fall, 2008 Description: English 207: Intro. to Cultural Studies Fight the Power Lyrics 1989 the number another summer (get down) Sound of the funky drummer Music hittin\' your heart cause I know you got sould (Brothers and sisters, hey) Listen if you\'re missin\' y\'all Swingin... Date Added: 2009-02-02 20:30:42 |
| ashleysmith.pdf Path: UNC >> ECON >> 363 Fall, 2008 Description: Ashley M Smith. American libraries in wartime: the role of propaganda. A Masters Paper for the M.S. in L.S degree. April, 2007. 38 pages. Advisor: Jerry Saye. This paper examines several periods of military conflict in American history and how these ... Date Added: 2009-02-03 14:04:08 |
| nursing.pdf Path: UCM >> X >> 65070 Fall, 2008 Description: UCM Nursing Functional Major, BS(N) Degree Students who hold an Associate of Arts Degree from SFCC or have met the Missouri 42-hour General Education Core requirements are considered to have fulfilled all UCM General Education requirements, except: ... Date Added: 2009-02-06 20:06:04 |
| 9 Annual Rev Neur 2001.pdf Path: NYU >> E10 >> 2001 Fall, 2008 Description: Annu. Rev. Neurosci. 2001. 24:32755 Copyright c 2001 by Annual Reviews. All rights reserved SIGNALING AND TRANSCRIPTIONAL MECHANISMS IN PITUITARY DEVELOPMENT Jeremy S. Dasen and Michael G. Rosenfeld Howard Hughes Medical Institute, Cellular and Mole... Date Added: 2009-02-02 15:00:54 |
| prof19.pdf Path: UF >> ENC >> 3310 Fall, 2008 Description: Its five minutes til ten oclock. Sinking into the couch, you have your feet up on the coffee table and glass of water, no ice, in your hand. All the lights in the apartment are out save for the dim glow of the slender silver lamp behind you. Bowies D... Date Added: 2009-01-11 22:46:30 |
| prof19.pdf Path: UF >> ENC >> 4260 Fall, 2008 Description: Its five minutes til ten oclock. Sinking into the couch, you have your feet up on the coffee table and glass of water, no ice, in your hand. All the lights in the apartment are out save for the dim glow of the slender silver lamp behind you. Bowies D... Date Added: 2009-01-11 22:46:56 |
| Memory Path: Texas >> PSY >> 301 Summer, 2008 Description: Memory Memory Memory Memory Memory Memory Memory Memory Memory Memory Memory Memory Memory True or False? 1. When people go around a circle saying their names, their poorest memories are for what was said by the person just before them. 2. Our... Date Added: 2008-08-12 10:54:40 |
| Spatial Order Path: USC >> ARCH >> 114 Fall, 2006 Description: Spatial Order 2/1/2007 10:45:00 AM -To start to construct a building What is the relationship the building and its landscape, they are going to be there for ever -Los Angeles, single family house, one car, family doin the landscape. Hor did we end ... Date Added: 2008-02-27 23:32:23 |
| Sec_2.5 Path: Virginia Tech >> MATH >> 2214 Fall, 2006 Description: 2.5 Linear Equations Definition 2.5 Linear Equation A differential equation of the form dy a1 x a0 x y dx is said to be a linear equation. Integrating Factor: g x a1 x dy dx dy dy dx a0 x y p x y p x y g x dy dx a0 x y a1 x g x a1 x 0 f x d... Date Added: 2008-04-01 18:02:56 |
| labE2.pdf Path: CUNY Baruch >> CC >> 30 Fall, 2009 Description: cc30.03 Brooklyn College, CUNY c 2007 lab E.2: Obstacle-avoidance Name: vocabulary obstacle avoidance touch sensor bumper fork branch jump lamp materials Make sure you have all of the following materials before you start the lab: lego go-... Date Added: 2009-04-15 23:58:30 |
| BET-4.pdf Path: Hawaii >> SOEST >> 15 Fall, 2008 Description: SCTB15 Working Paper BET4 A summary of aggregate catch/effort and size composition data available to the SCTB BIGEYE Oceanic Fisheries Programme Secretariat of the Pacific Community Noumea, New Caledonia July 2002 1 INTRODUCTION The following pr... Date Added: 2009-02-17 19:25:18 |
| PhysNoteDesc.pdf Path: UCLA >> PHYSICS >> 6b Fall, 2008 Description: PhysNote File Description Later: PhysNote Class/Style/Package Description Andrew Forrester September 1, 2007 Contents 1 Purpose and Usage 2 File Placement: The texmf Tree 3 Features 4 Packages Included 5 Dened Macros 6 Package Suggestions and Descri... Date Added: 2009-01-09 19:52:58 |
| 506.pdf Path: Utah State >> HR >> 500 Fall, 2008 Description: POLICY MANUAL OPERATING POLICIES AND PROCEDURES Number 506 Subject: Uniform Wiring for Voice/Data Effective Date: October 27, 1997 506.1 POLICY All new construction, remodeling, and extensions to the Campus telecommunications/data communications in... Date Added: 2009-02-17 22:21:52 |
| 276.pdf Path: Wisconsin Milwaukee >> MUSIC >> 276 Fall, 2008 Description: ... Date Added: 2009-02-02 20:42:06 |
| PhysiolPlant07.pdf Path: Minot State University >> BIOL >> 142 Fall, 2008 Description: ... Date Added: 2009-01-09 08:15:14 |
| PhysiolPlant07.pdf Path: Minot State University >> BIOL >> 347 Fall, 2008 Description: ... Date Added: 2009-01-09 08:15:14 |
| PhysiolPlant07.pdf Path: Minot State University >> ED >> 497 Fall, 2008 Description: ... Date Added: 2009-01-09 08:15:51 |
| PhysiolPlant07.pdf Path: Minot State University >> BIOL >> 346 Fall, 2008 Description: ... Date Added: 2009-01-12 04:30:52 |
| PhysiolPlant07.pdf Path: Minot State University >> BIOL >> 111 Fall, 2008 Description: ... Date Added: 2009-01-09 08:15:14 |
| are157-homework-4-key Path: UC Davis >> ARE >> 157 Spring, 2009 Description: ... Date Added: 2009-03-31 19:08:43 |
| Sociology Lecture Path: BU >> SOC >> SO 242 Spring, 2008 Description: Sociology Lecture January 22, 2008 1/22/2008 12:26:00 PM Country terms Developing countries- implies that they are all developing or in a certain way, seems like a good thing in the west, conceals differences. Less developed countries (LDC`s)- impl... Date Added: 2008-04-29 11:28:46 |
| v53.0150_hardin_s07.pdf Path: NYU >> POLITICS >> 5397 Fall, 2008 Description: p. 1 Spring 2007, Nationalism and Ethnic Conflict, V53.0150 Russell Hardin Mondays and Wednesdays 2:00-3:15 This course is a discussion seminar. The course will focus on ways to understand nationalism and ethnic identification and the conflict that ... Date Added: 2009-02-06 19:44:40 |
| resume.doc Path: Dallas >> CE >> 6354 Fall, 2008 Description: CE/CS/SE 6354 Advanced Software Engineering Spring 2006 Project Description for Resume Eclipse Plugin Based CASE Tool The CASE tool provides a set of visual modeling diagrams for software engineers, including goal, UML use case, UML sequence, and UML... Date Added: 2009-02-02 20:18:48 |
| notes110106 Path: Cal Poly Pomona >> CS >> 140 Winter, 2006 Description: heres a while loop, write a for loop study the assignments for do while loops custom methods week 3 part 1 and 2 arithmetic operators 5%2 = 1 7%6 = 1 9%3 = 0 ranking operators i=0 i+=3 = i=i+3 increment operator i+ = i+1 switch statements /more than ... Date Added: 2008-03-11 16:59:34 |
| ch03_100-101.pdf Path: Ohio State >> B >> 861 Fall, 2008 Description: Weed Management in Brambles Plan to start controlling weeds one to two years before planting brambles. Persistent and perennial weeds such as quackgrass, nutsedge, and thistle should be eliminated before planting brambles (see Controlling Weeds Befor... Date Added: 2009-04-16 00:59:53 |
| minutes071009.pdf Path: WPUNJ >> SENATE >> 071023 Fall, 2008 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 William Paterson University FACULTY SENATE MINUTES October 9, 2007 FACULTY SENATE WEB PAGE http:/www.wpunj.e... Date Added: 2009-02-17 23:05:26 |
| Homework #4 Path: UCSD >> MAE >> MAE 9 Fall, 2008 Description: /* MAE9: Homework #4, Fall 2008 Turnin by Monday, October 27, by 9:00pm A mathematical relationship between x and y is described by the following expressions: y= A*x^2-B*x^3+x/4 y=A*x-B*x^4+C y=A*log10(x)-B/x-2*C if if if x<=0 0<x<1 x>=1 (Case 1) (Ca... Date Added: 2009-01-10 06:55:45 |
| Hand-Lec27-BJT3-4spp.pdf Path: UF >> EEL >> 3304c Fall, 2008 Description: L27. Bipolar Junction Transistor (BJT) Review BJT I-V in active mode Common-base Common-emitter BJT Small-signal Model B IB + VBE IE E IC C IB Large-Signal - model Consider instantaneous voltage, vBE, and resulting currents BJT DC analysis ... Date Added: 2009-01-10 18:22:37 |
| Hand-Lec27-BJT3-4spp.pdf Path: UF >> EEL >> 6323 Spring, 2008 Description: L27. Bipolar Junction Transistor (BJT) Review BJT I-V in active mode Common-base Common-emitter BJT Small-signal Model B IB + VBE IE E IC C IB Large-Signal - model Consider instantaneous voltage, vBE, and resulting currents BJT DC analysis ... Date Added: 2009-01-10 18:23:07 |
| K&C-a.pdf Path: UC Irvine >> ECON >> 299 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> SOC SCI >> 299 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> POL SCI >> 299 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> ANTHRO >> 121aw Winter, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-09 19:41:41 |
| K&C-a.pdf Path: UC Irvine >> HISTORY >> 299 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> SOCIOL >> 161 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> SOC SCI >> 249a Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-09 19:46:11 |
| K&C-a.pdf Path: UC Irvine >> SOCIOL >> 229 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> ANTHRO >> 299 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
| K&C-a.pdf Path: UC Irvine >> SOCIOL >> 299 Fall, 2008 Description: The Navigability of Strong Ties: Small Worlds, Tie Strength, and Network Topology Self-organization in Strong-tie Small Worlds DOUGLAS R. WHITE AND MICHAEL HOUSEMAN regular lattices in which edge small world (SW) is a probability is an inverse power... Date Added: 2009-01-10 17:50:40 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
