Course Solutions And Notes - Section times for PAM TAs 32

Displaying 1-500 of 23004 documents:
next page of documents

qb_gps3.pdf
Path: Purdue >> GRAD >> 590d Fall, 2008
Description: OPUS Solution vs. Static Solution (Broadcast Ephemeris) All coordinates in NAD 83 Point Obs Time min OPUS (X) m OPUS (Y) m OPUS (Z) m X error mm Y error mm Z error mm P1 149 309761.743 -4898908.541 4059215.521 21 20 P2 153 316984.859 -4898156.93 4059...
Date Added: 2009-01-09 06:47:53

qb_gps3.pdf
Path: Purdue >> CE >> 597z Fall, 2008
Description: OPUS Solution vs. Static Solution (Broadcast Ephemeris) All coordinates in NAD 83 Point Obs Time min OPUS (X) m OPUS (Y) m OPUS (Z) m X error mm Y error mm Z error mm P1 149 309761.743 -4898908.541 4059215.521 21 20 P2 153 316984.859 -4898156.93 4059...
Date Added: 2009-01-11 17:55:34

qb_gps3.pdf
Path: Purdue >> C E >> 597z Fall, 2008
Description: OPUS Solution vs. Static Solution (Broadcast Ephemeris) All coordinates in NAD 83 Point Obs Time min OPUS (X) m OPUS (Y) m OPUS (Z) m X error mm Y error mm Z error mm P1 149 309761.743 -4898908.541 4059215.521 21 20 P2 153 316984.859 -4898156.93 4059...
Date Added: 2009-01-11 17:55:34

qb_gps3.pdf
Path: Purdue >> COM >> 590d Fall, 2008
Description: OPUS Solution vs. Static Solution (Broadcast Ephemeris) All coordinates in NAD 83 Point Obs Time min OPUS (X) m OPUS (Y) m OPUS (Z) m X error mm Y error mm Z error mm P1 149 309761.743 -4898908.541 4059215.521 21 20 P2 153 316984.859 -4898156.93 4059...
Date Added: 2009-01-09 06:47:53

license.txt
Path: Hawaii >> SCHOLARSPA >> 10125 Fall, 1989
Description: License granted by sethib@hawaii.edu (sethib@hawaii.edu) on 2008-09-15T00:55:59Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) th...
Date Added: 2009-02-17 19:32:31

license.txt
Path: Hawaii >> SCHOLARSPA >> 2507 Fall, 2008
Description: License granted by sethib@hawaii.edu (sethib@hawaii.edu) on 2008-09-15T00:55:59Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) th...
Date Added: 2009-02-17 19:32:32

Irontriangle
Path: Texas San Antonio >> POL >> 1133 Spring, 2008
Description: ...
Date Added: 2008-04-07 19:21:21

CAM assign.
Path: Rider >> BIO >> 116 Spring, 2008
Description: Arunabh Sinha 3/3/08 Response to CAM Lab 1) Plant B 2) Plant A 3) Malic acid is used to fix carbon, therefore the plant in the sunlight for 24 hrs. would have a higher pH than the plant in 24 hrs. dark. 4) 5) Extreme heat would because the stomates ...
Date Added: 2008-04-07 14:24:53

ee100Su07-WRAPUP.pdf
Path: Berkeley >> EE >> 21 Fall, 2009
Description: EE100 Summer 2007: WRAP UP Alls well that ends well Bharathwaj Muthuswamy NOEL: Nonlinear Electronics Lab 151M Cory Hall Department of EECS University of California, Berkeley mbharat@eecs.berkeley.edu Dr. Leon O Chua Director 151M Cory Hall Univer...
Date Added: 2009-04-16 01:38:04

ee100Su07-WRAPUP.pdf
Path: Berkeley >> EE >> 100 Fall, 2008
Description: EE100 Summer 2007: WRAP UP Alls well that ends well Bharathwaj Muthuswamy NOEL: Nonlinear Electronics Lab 151M Cory Hall Department of EECS University of California, Berkeley mbharat@eecs.berkeley.edu Dr. Leon O Chua Director 151M Cory Hall Univer...
Date Added: 2009-04-16 01:38:04

amesresults
Path: Davidson >> BIO >> 111/112 Spring, 2008
Description: Results To get comparative data for both experiments, the colonies on the plates were counted. This data is then shown in bar graphs for a qualitative projections and tables for quantitative projections. The bar graph shows the comparative quantities...
Date Added: 2008-04-07 11:35:11

Hastings
Path: Colorado >> BCOR >> 1010 Fall, 2007
Description: ...
Date Added: 2009-03-17 18:46:54

cap_08_deoudes.pdf
Path: Washington and Lee >> WWW1 >> 1 Fall, 2008
Description: Charter Schools A Response to the Achievement Gaps Andrea Deoudes April 20, 2008 Washington and Lee University Deoudes 2 Introduction The racial and SES-based student achievement gaps that plague United States public school children have devastating...
Date Added: 2009-02-17 23:18:58

cap_08_deoudes.pdf
Path: Washington and Lee >> WWW1 >> 13139 Fall, 2008
Description: Charter Schools A Response to the Achievement Gaps Andrea Deoudes April 20, 2008 Washington and Lee University Deoudes 2 Introduction The racial and SES-based student achievement gaps that plague United States public school children have devastating...
Date Added: 2009-02-17 23:18:58

cap_08_deoudes.pdf
Path: Charleston Law >> X >> 13139 Fall, 2008
Description: Charter Schools A Response to the Achievement Gaps Andrea Deoudes April 20, 2008 Washington and Lee University Deoudes 2 Introduction The racial and SES-based student achievement gaps that plague United States public school children have devastating...
Date Added: 2009-02-18 13:30:02

cap_08_deoudes.pdf
Path: Washington and Lee >> X >> 13139 Fall, 2008
Description: Charter Schools A Response to the Achievement Gaps Andrea Deoudes April 20, 2008 Washington and Lee University Deoudes 2 Introduction The racial and SES-based student achievement gaps that plague United States public school children have devastating...
Date Added: 2009-02-18 13:30:02

cap_08_deoudes.pdf
Path: Charleston Law >> WWW1 >> 1 Fall, 2008
Description: Charter Schools A Response to the Achievement Gaps Andrea Deoudes April 20, 2008 Washington and Lee University Deoudes 2 Introduction The racial and SES-based student achievement gaps that plague United States public school children have devastating...
Date Added: 2009-02-17 23:18:58

cap_08_deoudes.pdf
Path: Charleston Law >> WWW1 >> 13139 Fall, 2008
Description: Charter Schools A Response to the Achievement Gaps Andrea Deoudes April 20, 2008 Washington and Lee University Deoudes 2 Introduction The racial and SES-based student achievement gaps that plague United States public school children have devastating...
Date Added: 2009-02-17 23:18:58

212.pdf
Path: Michigan >> AT >> 212 Fall, 2008
Description: A 3.000 Hours Endurance Testing of RIT-22 Thruster in the New Aerospazio Test Facility IEPC-2005-212 Presented at the 29th International Electric Propulsion Conference, Princeton University, October 31 November 4, 2005 E. Bonelli*, S. Scaranzin*, F....
Date Added: 2009-02-02 19:38:12

se.pdf
Path: Wisconsin >> CURRIC >> 336 Fall, 2008
Description: Standard English Standard English Which English do you prefer? 1. I did it. 2. Come quick! 3. the book that I bought 4. them books 5. I didnt break anything. 6. Im first, aint I? 1. I done it. 2. Come quickly! 3. the book what I bought 4. those boo...
Date Added: 2009-02-03 14:28:15

t1spr00.pdf
Path: Columbus State University >> MATH >> 97 Fall, 2008
Description: Test 1, Math 3107 Spring 2000, Dr. Howard Name: _ Please work the problems on the blank paper provided. Staple these sheets in front of your work when finished. 1. Find the general solution of the differential equation 3y x 4 y 2xy. 2. Find th...
Date Added: 2009-01-09 07:51:27

t1spr00.pdf
Path: Columbus State University >> MATH >> 98 Fall, 2008
Description: Test 1, Math 3107 Spring 2000, Dr. Howard Name: _ Please work the problems on the blank paper provided. Staple these sheets in front of your work when finished. 1. Find the general solution of the differential equation 3y x 4 y 2xy. 2. Find th...
Date Added: 2009-01-09 07:51:27

H-1ATTES_LCA.pdf
Path: Mississippi State >> HRM >> 1 Fall, 2008
Description: Attestation for Labor Condition Application I understand that a Labor Condition Application (LCA) must be filed with the U.S. Department of Labor prior to filing an H1-B petition. I certify that this department/unit will comply with the following req...
Date Added: 2009-02-17 17:53:33

fachand2008_09.pdf
Path: New College FL >> PUBLIC >> 2008 Fall, 2008
Description: NEW COLLEGE of Florida FACULTY HANDBOOK Office of the Provost New College of Florida 5800 Bay Shore Road Sarasota, Florida 34243-2109 August 2008 NEW COLLEGE FACULTY HANDBOOK TABLE OF CONTENTS Privacy and the Release of Student Information __ v Ca...
Date Added: 2009-02-17 18:48:15

3706-S2002.pdf
Path: Virginia Tech >> HIST >> 3706 Spring, 2008
Description: CENTER FOR INTERDISCIPLINARY STUDIES/HISTORY HISTORY 370612702 HUMANITIES, SCIENCE, AND TECHNOLOGY 3706-12867 HISTORY OF MODERN SCIENCE Prof. Barbara J. Reeves Spring Semester 2002 TR 11:00-12:15 McBryde 210 Email: reeves@vt.edu Office: Lane 331 (thi...
Date Added: 2009-02-02 20:51:52

compete3.pdf
Path: Rutgers >> 640 >> 244 Fall, 2008
Description: Phase plane near (0,4): strong competition 5.0 4.5 y 4.0 3.5 3.0 0.0 0.25 0.5 x 0.75 1.0 ...
Date Added: 2009-01-11 18:02:14

2006quiz3.pdf
Path: UGA >> MATH >> 3 Fall, 2004
Description: QUIZ-3 Name: Please show all your work! Math/CSCI 2610 Spring 2006 Zubeyir Cinkir 1. Determine whether the following is a valid argument. if x2 is irrational, then x is irrational. The number, 2 is irrational. Therefore, the number is irrational....
Date Added: 2009-02-06 19:53:49

Minor Pentatonic.pdf
Path: BYU - ID >> EMP >> 1 Fall, 2008
Description: Scale Worksheet Write all scales up to the 9th and down. Do not use key signatures. Include accidentals ascending and descending. EXAMPLE C b b b b b b j Minor Pentatonic Related to Major Penta...
Date Added: 2009-02-17 23:36:01

13108k-statement.pdf
Path: Kansas State >> MUSIC >> 203 Spring, 2008
Description: oh, by the way. Konza environmental education program seeks volunteers for docent training The Konza environmental education program, offered through KStates Konza Prairie Biological Station, will begin its 2008 docent training program at 9 a.m. Satu...
Date Added: 2009-01-09 02:21:13

glassmenagerie
Path: Augusta >> ENGL >> 1102 Spring, 2008
Description: Chris Kemp Topic Number 1 Thesis: In Tennessee Williams\' play, The Glass Menagerie, Tom is a pathetic character because the suffering and ban fortune that happens to him is not because of his own doing, but it is instead because of the inopportune s...
Date Added: 2008-04-29 04:38:35

intro-2-Zou.ppt
Path: UCF >> CAP >> 6938 Fall, 2008
Description: Honeypot, Botnet, Security Measurement, Email Spam Cliff C. Zou CDA6938 02/01/07 1 What Is a Honeypot? A honeypot is a faked vulnerable system used for the purpose of being attacked, probed, exploited and compromised. 2 Example of a Simple Honeyp...
Date Added: 2009-01-10 02:29:15

intro-2-Zou.ppt
Path: UCF >> COM >> 6938 Fall, 2008
Description: Honeypot, Botnet, Security Measurement, Email Spam Cliff C. Zou CDA6938 02/01/07 1 What Is a Honeypot? A honeypot is a faked vulnerable system used for the purpose of being attacked, probed, exploited and compromised. 2 Example of a Simple Honeyp...
Date Added: 2009-01-10 02:29:15

hw11sol
Path: Cornell >> ENGRD >> 202 Spring, 2008
Description: ...
Date Added: 2008-09-07 14:22:15

Top20Lenders.pdf
Path: Columbia >> SFS >> 20 Fall, 2008
Description: Top 20 Lenders Ranked by FY 2006 FFEL Loan Originations 1. Direct Loans* 2. Sallie Mae - http:/www.salliemae.com/ 3. Citibank - Student Loan Corp - http:/studentloan.citibank.com/ 4. JP Morgan Chase Bank - http:/www.chasestudentloans.com/ 5. Bank of...
Date Added: 2009-02-06 17:54:17

LECTURE 9-08.ppt
Path: Arizona >> BIOC >> 595b Fall, 2008
Description: The Grant Review Process Understanding NIH Peer Review NIH 2008 Budget ~ 29 Billion 27 Billion for Research Timeline Submission Oct 5/Nov 5*06 Review Post-Review Phase May/Jun 07 Jul 1 07 Sep/Oct 07 Dec 1 07 Apr 1 08 Feb Mar 07 Mar- Jun07 Sep 30 0...
Date Added: 2009-02-02 16:26:14

Cheng_kkdm06.pdf
Path: Berkeley >> PHYSICS >> C290c Fall, 2008
Description: Kaluza-Klein Dark Matter Hsin-Chia Cheng UC Davis Pre-SUSY06 Workshop Complementary between Dark Matter Searches and Collider Experiments Introduction Dark matter is the best evidence for physics beyond the standard model. The most appealing ca...
Date Added: 2009-01-09 19:27:59

10.30
Path: Oregon State >> HST >> 106 Spring, 2009
Description: Russian influence from 19th century o Russians radicals living outside of Russia, foreigners living in Russia o The influence of the Bolsheviks Russia took the initiative to export revolutionary ideas in the 1920s and 30s (comintem) o Few no...
Date Added: 2009-03-15 14:12:53

PAM 200 Lec 1 Final Exam_StudyGuide
Path: Cornell >> PAM >> 2000 Fall, 2007
Description: PAM 200 Lec 1 Final Exam Information Date: Friday, December 7th, 2007 Time: 2:00 pm - 4:30 pm Room: Plant Sciences 233 EXAM TOPICS -The exam will cover all the material we covered this semester. That corresponds to chapters 1 - 14; however, the empha...
Date Added: 2009-02-19 23:07:48

syllabus_2008.doc
Path: Wisconsin >> M E >> 510 Fall, 2008
Description: ISyE510 Facilities Planning Fall 2008 Instructor: Shiyu Zhou Location and Time: 1164 ME Building, 9:30p-10:45p, T, R. Office: 3254 Mechanical Engineering Building Office Hour: 11:00~12:00am T and 12:00~1:00pm R Phone: 608-262-9534 Email: szhou@engr.w...
Date Added: 2009-02-03 14:25:24

REWG2008.pdf
Path: Hawaii >> HAWAIIENER >> 2008 Fall, 2008
Description: Legislative Briefing Renewable Energy January 17, 2008 Renewable Energy Working Group Co-Chairs: Warren Bollmeier, HREA Rick Reed, HSEA Status/Outlook (Technologies/Projects) Status/Outlook (Legislative/Regulatory) Summary RPS Performance is on...
Date Added: 2009-02-17 19:52:26

0400545.pdf
Path: Berkeley >> ICIP >> 2007 Fall, 2009
Description: FINDING REGIONS OF INTEREST IN HOME VIDEOS BASED ON CAMERA MOTION Golnaz Abdollahian and Edward J. Delp Video and Image Processing Lab School of Electrical and Computer Engineering Purdue University, West Lafayette, IN 47907, USA ABSTRACT In this pa...
Date Added: 2009-04-16 02:03:56

MIDTERM STUDY GUIDE\'07GEA1000
Path: FSU >> GEA >> 1000 Fall, 2007
Description: MIDTERM STUDY GUIDE The following is a list of locations, physical features, terms and subjects that may be on the Midterm. As stated on the syllabus, I reserve the right to include material from the book that is not present on this study guide. Term...
Date Added: 2008-10-05 16:47:27

12
Path: UCF >> MAN >> 3025 Spring, 2008
Description: 1. Swamp Monster, Inc. (SMI) has a relatively high turnover rate among its new employees. Recently, the human resource department conducted a series of interviews with employees who were choosing to leave SMI after a short period of time. It was con...
Date Added: 2008-04-18 06:48:10

lecture20.pdf
Path: Colorado >> ASTR >> 3730 Fall, 2008
Description: Nuclear processes in stars Mass of nuclei with several protons and / or neutrons does not exactly equal mass of the constituents - slightly smaller because of the binding energy of the nucleus. Since binding energy differs for different nuclei, can r...
Date Added: 2009-02-17 15:49:28

project2
Path: Michigan State University >> CSE >> 410 Summer, 2008
Description: CSE 410 Summer 2008 PROJECT ASSIGNMENT #2 60 POINTS Your source files must be dated on or before midnight, Monday, 23 June 2008. OVERALL OBJECTIVE You are to write a C or C+ concurrent Shearsort program using POSIX PTHREAD library and semaphore op...
Date Added: 2008-07-25 14:01:09

project2.pdf
Path: Michigan State University >> CSE >> 410 Fall, 2008
Description: CSE 410 Summer 2008 PROJECT ASSIGNMENT #2 60 POINTS Your source files must be dated on or before midnight, Monday, 23 June 2008. OVERALL OBJECTIVE You are to write a C or C+ concurrent Shearsort program using POSIX PTHREAD library and semaphore op...
Date Added: 2009-01-12 03:37:07

03commitmentstudent4
Path: Iowa State >> PSYCHOLOGY >> 280 Spring, 2007
Description: Lecture Outline 1. Commitment and Consistency 2. Foot-in-the-door 3. Low-ball 4. Why commitment and consistency works 5. Factors that affect commitment and consistency Commitment and Consistency Remember cognitive dissonance? Feeling of anxiety or ...
Date Added: 2008-03-26 20:02:03

Fall 2007 - Hohnhold\'s Class - Exam 2 (Version A)
Path: UCSD >> MATH >> 20B Fall, 2007
Description: Midterm 2 for Math 20B Fall Quarter 2007, UCSD Henning Hohnhold Name: Section: #1: #2: #3: #4: Total: (1) Sequences and Series. (a) (5 points) Explain briefly which of the following two sequences are convergent. If a sequence converges, find ...
Date Added: 2008-04-29 23:37:12

MarketPowerElectMarket.QLearn.NanduriDas2007.pdf
Path: Iowa State >> HCI >> 504 Spring, 2008
Description: IEEE TRANSACTIONS ON POWER SYSTEMS, VOL. 22, NO. 1, FEBRUARY 2007 85 A Reinforcement Learning Model to Assess Market Power Under Auction-Based Energy Pricing Vishnuteja Nanduri, Student Member, IEEE, and Tapas K. Das, Member, IEEE AbstractAuctions ...
Date Added: 2009-01-09 08:01:56

Exam2d.doc
Path: Harold Washington College - CCC >> CHEM >> 212 Fall, 2008
Description: Chem212 SurveyofOrganicandBiochemistry Spring2006 _ Printyourfullnamelegiblyinthespaceabove. Exam2:Ch.610 30March2006 Instructions: 1.Nobooksornotesofanykindarepermitted.Youmayborrowamodelkit. 3.Putallyouranswersonthisexampaper.Ifyouwantsomething...
Date Added: 2009-01-11 05:03:20

Exam2d.doc
Path: Richard J. Daley College - CCC >> CHEM >> 212 Fall, 2008
Description: Chem212 SurveyofOrganicandBiochemistry Spring2006 _ Printyourfullnamelegiblyinthespaceabove. Exam2:Ch.610 30March2006 Instructions: 1.Nobooksornotesofanykindarepermitted.Youmayborrowamodelkit. 3.Putallyouranswersonthisexampaper.Ifyouwantsomething...
Date Added: 2009-01-11 05:03:20

lecture7-08.pdf
Path: UC Davis >> MAE >> 298 Fall, 2008
Description: MAE 298, Lecture 7 Jan 30, 2008 More important network measures Today Complete discussion of network epidemiology (lling in details) More basic network measures/features Partitioning networks: spectral methods community structure Classic math...
Date Added: 2009-01-11 21:23:49

handout08.pdf
Path: Santa Clara >> MECH >> 143 Fall, 2009
Description: ...
Date Added: 2009-04-15 20:14:51

a 007 nov appts.pdf
Path: DeAnza College >> PHIL >> 007 Fall, 2008
Description: Approved by the Board of Trustees November 11, 2004 7 Board Meeting November 11, 2004 Revised 4-3-07 APPOINTMENTS TO THE FACULTY, ADMINISTRATIVE/PROFESSIONAL STAFF, AND INTERCOLLEGIATE ATHLETIC STAFF APPOINTMENTS TO THE FACULTY According to State s...
Date Added: 2009-02-02 14:03:43

chapter12.pdf
Path: UCSD >> PHYS >> 7 Fall, 2008
Description: Chapter 12 Star Stuff We are star stuff because the elements necessary for life were made in stars 12.1 Star Birth Our Goals for Learning How do stars form? How massive are newborn stars? How do stars form? Stars are born in molecular clouds c...
Date Added: 2009-01-11 21:37:07

Criticial Thinking Worksheet #1
Path: MS Mary >> GNSCI >> 101 Fall, 2007
Description: Stephanie Drybala Dr. Solis Critical Thinking Worksheet #1 September 7, 2007 I am choosing to write my essay on Chapter 3 of \"Voodoo Science\". Placebos have many side effects that are not listed on the label. Many people can do more harm to themselve...
Date Added: 2008-07-31 17:03:17

010226week.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: Polish business news from Warsaw Business Journal Article Page Fri., March 2, 2001 Subscribe/Login Home This Week\'s WBJ Real Estate Listings Story Archives Web Library Companies Info from WBJ\'s Book of Lists Columns Conference Calendar Press Release...
Date Added: 2009-02-11 19:24:49

Phys141_Lecture39_2006.pdf
Path: Maryland >> PHYS >> 141 Fall, 2008
Description: Phys141 Wed 12/6 TODAY: Chapter 20 Fri: Chapter 21 SKIP: Chapter 21.7 Chapter 22 No Pre-Class Quizzes Last HW due next week Monday Final exam Sat Dec 16, 8am How does a material expand with increasing temperature? Atoms interact through Lennard-Jon...
Date Added: 2009-02-06 19:25:13

sciam.pdf
Path: Purdue >> BIOL >> 197 Fall, 2008
Description: ...
Date Added: 2009-01-11 19:23:30

ch1terminology.doc
Path: UCF >> ISM >> 6407 Fall, 2008
Description: MAN 6325 Spring 2009: PMSM Program Chapter 1 Terminology: Page 1 of 1 Chapter 1 Terminology Continuous data Cross-sectional data Discrete data Interval data Quantitative data that can possess an unlimited number of values within a prescribed interva...
Date Added: 2009-01-11 21:58:09

Physics1.Test2.p1.spring05
Path: LeTourneau >> PHYS >> 2113 Spring, 2005
Description: ...
Date Added: 2008-04-15 12:35:49

HIS 225.doc
Path: Palo Verde College >> ART >> 105 Fall, 2008
Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 11/14/02 Board Approval: 12/10/02 P al o V er d e C o l l eg e 1. Completed by the Course Initiator: Greg Nall Subject Area and Course Number: HI...
Date Added: 2009-01-10 17:22:03

HIS 225.doc
Path: Palo Verde College >> ART >> 125 Fall, 2008
Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 11/14/02 Board Approval: 12/10/02 P al o V er d e C o l l eg e 1. Completed by the Course Initiator: Greg Nall Subject Area and Course Number: HI...
Date Added: 2009-01-10 17:22:03

Keeping it Real
Path: U. Houston >> ENGL >> 1304 Fall, 2006
Description: Stephen Reagin September 20, 2006 Keeping it Real There is a growing problem in my America, and it has to do with people thinking that they can push the rest of the population around. They feel that just because they\'re passionate about an issue it ...
Date Added: 2008-05-07 08:10:23

hw4-sol.pdf
Path: Rutgers >> 300 >> 442 Fall, 2008
Description: Ph 442 Solutions for Problem Set 4 1. In an isothermal shock, the energy jump condition is replaced by the relation that the temperature ahead of and behind the shock is the same, T0 = T1 . The perfect gas law, P = kT / where is the mean molecular...
Date Added: 2009-02-02 15:54:31

Observing the Sky.ppt
Path: Georgia State >> ASTR >> 1010 Fall, 2008
Description: Observing the Universe for Yourself Patterns in the Night Sky Our goals for learning: What does the universe look like from Earth? Why do stars rise and set? Why do the constellations we see depend on latitude and time of year? What does the uni...
Date Added: 2009-02-02 21:33:25

22896072.pdf
Path: Illinois State >> EAF >> 526 Fall, 2008
Description: Every man takes the limits of his own vision for the limits of the world. Arthur Schopenhauer * Dr. Judith Mogilka EAF 228 Online Summer, 2007 Mail, Please use WebCt MAIL Office Hours: Posted in Live Chat OR, by Chat appointment COURSE LOCATION: h...
Date Added: 2009-01-11 16:09:29

22896072.pdf
Path: Illinois State >> THE >> 228 Summer, 2008
Description: Every man takes the limits of his own vision for the limits of the world. Arthur Schopenhauer * Dr. Judith Mogilka EAF 228 Online Summer, 2007 Mail, Please use WebCt MAIL Office Hours: Posted in Live Chat OR, by Chat appointment COURSE LOCATION: h...
Date Added: 2009-01-11 16:09:30

22896072.pdf
Path: Illinois State >> THE >> 498 Fall, 2008
Description: Every man takes the limits of his own vision for the limits of the world. Arthur Schopenhauer * Dr. Judith Mogilka EAF 228 Online Summer, 2007 Mail, Please use WebCt MAIL Office Hours: Posted in Live Chat OR, by Chat appointment COURSE LOCATION: h...
Date Added: 2009-01-11 16:09:30

22896072.pdf
Path: Illinois State >> NUR >> 235 Fall, 2008
Description: Every man takes the limits of his own vision for the limits of the world. Arthur Schopenhauer * Dr. Judith Mogilka EAF 228 Online Summer, 2007 Mail, Please use WebCt MAIL Office Hours: Posted in Live Chat OR, by Chat appointment COURSE LOCATION: h...
Date Added: 2009-01-11 16:09:29

22896072.pdf
Path: Illinois State >> NUR >> 415 Summer, 2008
Description: Every man takes the limits of his own vision for the limits of the world. Arthur Schopenhauer * Dr. Judith Mogilka EAF 228 Online Summer, 2007 Mail, Please use WebCt MAIL Office Hours: Posted in Live Chat OR, by Chat appointment COURSE LOCATION: h...
Date Added: 2009-01-11 16:09:29

4-H-449-W.doc
Path: Purdue >> ABE >> 285 Fall, 2008
Description: 4-H 449-W Vice Presidents Guide The vice president works with the president and takes the presidents place when he/she is not present. Therefore, in addition to knowing his/her job, the vice president should be familiar with the job of the president...
Date Added: 2009-01-09 06:30:32

2002natr.pdf
Path: Kansas State >> HIST >> 906 Fall, 2008
Description: letters to nature 21. Karr, J. R. Diamond, J. M.) 258291 (Harvard Univ. Press, Cambridge, 1975). 22. Ricklefs, R. E. & ORourke, K. Aspect diversity in moths: a temperate-tropical ...
Date Added: 2009-01-09 08:05:14

2002natr.pdf
Path: Kansas State >> HIST >> 982 Spring, 2008
Description: letters to nature 21. Karr, J. R. Diamond, J. M.) 258291 (Harvard Univ. Press, Cambridge, 1975). 22. Ricklefs, R. E. & ORourke, K. Aspect diversity in moths: a temperate-tropical ...
Date Added: 2009-01-09 08:05:14

2002natr.pdf
Path: Kansas State >> BIOL >> 823 Fall, 2008
Description: letters to nature 21. Karr, J. R. Diamond, J. M.) 258291 (Harvard Univ. Press, Cambridge, 1975). 22. Ricklefs, R. E. & ORourke, K. Aspect diversity in moths: a temperate-tropical ...
Date Added: 2009-01-09 08:05:14

Enrollment_Discrepancy_Petition_Procedure.pdf
Path: Southern Methodist >> ENGL >> 6382 Fall, 2008
Description: SOUlHERN METIIODIST UNIVERSITY UNIVERSITY REGISTRAR DIVISION OF ENROLLMENT SERVICES EN4275C ENROLLMENT DISCREPANCY PETITION PROCEDURE Student\'s Name: _ SMU In: _ Each student is personally responsible for complying with enrollment procedures and...
Date Added: 2009-01-10 00:46:33

Enrollment_Discrepancy_Petition_Procedure.pdf
Path: Southern Methodist >> LAW >> 6180 Fall, 2008
Description: SOUlHERN METIIODIST UNIVERSITY UNIVERSITY REGISTRAR DIVISION OF ENROLLMENT SERVICES EN4275C ENROLLMENT DISCREPANCY PETITION PROCEDURE Student\'s Name: _ SMU In: _ Each student is personally responsible for complying with enrollment procedures and...
Date Added: 2009-01-11 21:01:24

Enrollment_Discrepancy_Petition_Procedure.pdf
Path: Southern Methodist >> ENGL >> 4332 Fall, 2008
Description: SOUlHERN METIIODIST UNIVERSITY UNIVERSITY REGISTRAR DIVISION OF ENROLLMENT SERVICES EN4275C ENROLLMENT DISCREPANCY PETITION PROCEDURE Student\'s Name: _ SMU In: _ Each student is personally responsible for complying with enrollment procedures and...
Date Added: 2009-01-11 21:01:24

Enrollment_Discrepancy_Petition_Procedure.pdf
Path: Southern Methodist >> ENGL >> 6310 Fall, 2008
Description: SOUlHERN METIIODIST UNIVERSITY UNIVERSITY REGISTRAR DIVISION OF ENROLLMENT SERVICES EN4275C ENROLLMENT DISCREPANCY PETITION PROCEDURE Student\'s Name: _ SMU In: _ Each student is personally responsible for complying with enrollment procedures and...
Date Added: 2009-01-11 21:01:24

assn2
Path: ASU >> EEE >> 203 Spring, 2007
Description: Di HcHV s X s HS6@u s wPcd fs s Hwu s H6i s vuc%ewHvi%pQ s vxwvuSSHV tr V xux y iRi V fV xR idV y x V f I iV y f f X X s VCD hHqCpE FGpE D IQV D SWhqCpE i IQV C D eQ SWhWFgC fQdQR IQV a D 6eSSQ SWcb`YC XQR IQV U D 6SQ SWFTC RQI G D SAPHFEC 797 5...
Date Added: 2008-09-29 20:04:11

Louis Armstrong
Path: FSU >> MUH >> 2019 Spring, 2007
Description: WEEK TWO. Media Journal Questions. \"The Wonderful World of Louis Armstrong.\" September 14, 2007 MUH2019 1. According to one of the commentators in this film, Armstrong is to be considered a genius because he along can change the world. 2. What was t...
Date Added: 2008-04-17 21:34:59

Anthracnose Management.doc
Path: University of Illinois, Urbana Champaign >> NRES >> 489 Fall, 2008
Description: NRES 489, Prof. Wilkinson: Week 2 Anthracnose Basal Stem Rot of Bentgrass Turfgrass Management Factors and How They Affect the \"Health\" of Turf! 1.Mowing: height of cut should not be so short as to stress bentgrass, but not tall enough to maintain ...
Date Added: 2009-02-02 18:24:43

GEOG373_fall08.pdf
Path: Maryland >> GEOG >> 373 Fall, 2008
Description: Geographic Information Systems GEOG 373 Fall 2008 (3 credits) Instructor: Aaron P. Mulhollen, Department of Geography apm74@umd.edu Phone: 301.405.4050 2176 LeFrak Hall Office hours: Thursdays 12-3pm 1113 LeFrak Hall Class Times: Lectures 2166 LeF...
Date Added: 2009-02-03 13:55:24

RaffrayAA.pdf
Path: UCSD >> ARIES >> 0201 Fall, 2008
Description: Chamber Engineering Action Items (I) Parameter window for film formation (S. Abdel-Khalik) Method of injection Constraints on thickness (maximum and minimum) Coverage issues (how to avoid dry spots) Constraints from beam ports Aerosol paramet...
Date Added: 2009-02-18 00:41:33

Patil_01.pdf
Path: Wisconsin >> SKOP >> 9 Fall, 2008
Description: REPORTS 12. H. Yoshikawa, N. Sueoka, Proc. Natl. Acad. Sci. U.S.A. 49, 559 (1963). 13. K. P. Lemon, A. D. Grossman, Science 282, 1516 (1998). ` 14. V. Bidnenko, S. D. Ehrlich, L. Janniere, Mol. Microbiol. 28, 1005 (1998). 15. C. Bruand, S. D. Ehrlich...
Date Added: 2009-02-04 14:19:55

1982-Chakravarti-Nei.pdf
Path: Penn State >> BIOL >> 601 Spring, 2008
Description: ...
Date Added: 2009-01-12 04:42:55

1982-Chakravarti-Nei.pdf
Path: Penn State >> BIOL >> 611 Fall, 2008
Description: ...
Date Added: 2009-01-12 04:42:55

resume.pdf
Path: Virginia Tech >> LIB >> 041999 Fall, 2008
Description: Inez M. Giles 7505-N Ashby Lane, Alexandria, VA 22315-5213 703-719-5985 SUMMARY: Over thirteen years experience developing and delivering classroom-based and online distance education courses and seminars for the Adult Learner. Experienced college a...
Date Added: 2009-02-18 01:15:40

2007-10-01-640.pdf
Path: Oregon State >> ECE >> 483 Spring, 2008
Description: .\'que^nE ISJ>I Jelrrrplss rwIuelnEfn ezq {ruoJDIeIe {o5nq ecuQ uep^esJeH al (5nB1s,{rsuereyp trsuq ot\'d!D!@rol \'Jo,{PIereS \'ueurez)puel uef reptq \' (.ro,(r-1eraE rsutuloururq 8\'6\'0 {auIulpe nunurnrns \'udt rpurp .ISSuedO e{s,r uoBcperd-qcuurq -p1 e...
Date Added: 2009-01-12 04:39:41

2007-10-01-640.pdf
Path: Oregon State >> TA >> 401 Fall, 2008
Description: .\'que^nE ISJ>I Jelrrrplss rwIuelnEfn ezq {ruoJDIeIe {o5nq ecuQ uep^esJeH al (5nB1s,{rsuereyp trsuq ot\'d!D!@rol \'Jo,{PIereS \'ueurez)puel uef reptq \' (.ro,(r-1eraE rsutuloururq 8\'6\'0 {auIulpe nunurnrns \'udt rpurp .ISSuedO e{s,r uoBcperd-qcuurq -p1 e...
Date Added: 2009-01-12 04:39:41

2007-10-01-640.pdf
Path: Oregon State >> NR >> 405 Fall, 2008
Description: .\'que^nE ISJ>I Jelrrrplss rwIuelnEfn ezq {ruoJDIeIe {o5nq ecuQ uep^esJeH al (5nB1s,{rsuereyp trsuq ot\'d!D!@rol \'Jo,{PIereS \'ueurez)puel uef reptq \' (.ro,(r-1eraE rsutuloururq 8\'6\'0 {auIulpe nunurnrns \'udt rpurp .ISSuedO e{s,r uoBcperd-qcuurq -p1 e...
Date Added: 2009-01-12 04:39:41

2007-10-01-640.pdf
Path: Oregon State >> NR >> 499 Fall, 2008
Description: .\'que^nE ISJ>I Jelrrrplss rwIuelnEfn ezq {ruoJDIeIe {o5nq ecuQ uep^esJeH al (5nB1s,{rsuereyp trsuq ot\'d!D!@rol \'Jo,{PIereS \'ueurez)puel uef reptq \' (.ro,(r-1eraE rsutuloururq 8\'6\'0 {auIulpe nunurnrns \'udt rpurp .ISSuedO e{s,r uoBcperd-qcuurq -p1 e...
Date Added: 2009-01-12 04:39:41

W08 314 HW03 solutions
Path: Michigan >> EECS >> 314 Winter, 2008
Description: EECS 314 Winter 2008 HW 03 Solutions Problem 1 Part 1 First, before using the golden rule, construct a node voltage equation at the V+ node. This is done by applying KCL to account for all currents exiting or entering the node, followed by rewriting ...
Date Added: 2008-04-10 07:27:55

09sn1_091.pdf
Path: N. Kentucky >> CHE >> 310 Fall, 2008
Description: Since you now have experience with the basic organic laboratory techniques you will need (recrystallization, distillation, chromatography and extraction), this next section of the course is devoted to reaction chemistry. We have endeavored to try to ...
Date Added: 2009-02-04 14:38:14

Pac03_Preprint.pdf
Path: Maryland >> PAC >> 03 Fall, 2008
Description: MEASUREMENT OF ELECTRON BEAM DIVERGENCE USING OTR-ODR INTERFEROMETRY* R. B. Fiorito*, A. G. Shkvarunets and P. G. OShea, Institute for Research in Electronics and Applied Physics, University of Maryland, College Park, MD. 20742, USA Abstract Optical ...
Date Added: 2009-02-06 19:23:00

pixels4.txt
Path: Arizona >> CS >> 372 Fall, 2009
Description: * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *...
Date Added: 2009-04-15 23:03:26

midterm_2004.pdf
Path: Berkeley >> EEP >> 101 Fall, 2009
Description: Department of Agricultural and Resource Economics University of California Economics EEP101/ECON125, Spring 2004 Professor Zilberman Midterm Solutions 1 Question 1 (30 points) The inverse demand facing a farm sector is denoted by p = 20 x where...
Date Added: 2009-04-16 01:41:03

Christians_Information.pdf
Path: University of Illinois, Urbana Champaign >> LA >> 593 Fall, 2008
Description: CLIFFORD Director, Institute of G. CHRISTIANS Communications Research University of Illinois at Urbana-Champaign Information Ethics in a Complicated Age INTRODUCTION The old order of kinship and social class in Europe broke apart during the nin...
Date Added: 2009-02-02 18:10:10

ASKim016_DLCA_cake.pdf
Path: Hawaii >> PAM >> 016 Fall, 2008
Description: Journal of Membrane Science 286 (2006) 260268 Cake resistance of aggregates formed in the diffusion-limited-cluster-aggregation (DLCA) regime Albert S. Kim a, , Rong Yuan b a Department of Civil and Environmental Engineering, University of Hawaii a...
Date Added: 2009-02-17 19:17:23

ch9 solutions
Path: UPenn >> PHYS >> 150 Spring, 2008
Description: CLjl.,\' 21, Jv.*-k Trt )- I ?ro[. *ot te-b.\"1< -4/,1, 55oota-J + qsolval /o\"r( 4*r = 5500 hg co t[ i1 i o\'1 L +5500 v- asLw fx c-\\< 2 i r v, t . : { r \' lf ooo Lq t Lo^d V1= A{ohw/, v -0 4 - v 6sb*/. tl V=o r-t u g,g+. 3.o .u,.4_ [\"*rt ...
Date Added: 2008-04-07 22:41:42

schatz5.pdf
Path: Arizona >> PHYS >> 540 Fall, 2008
Description: ...
Date Added: 2009-02-02 16:27:30

Federating-96.pdf
Path: Arizona >> AI >> 96 Fall, 2008
Description: ...
Date Added: 2009-02-06 20:26:09

8.pdf
Path: UCLA >> ANDERSON >> 4150 Fall, 2008
Description: ...
Date Added: 2009-02-11 22:00:44

060927airplanes.txt
Path: Chester >> ECO >> 338 Fall, 2008
Description: BULGARIA: January 1, 2007: Bulgaria Joins EU but Without Airplanes | seeurope.net HOME | NEWS TODAY | ABOUT US | CONTACTS Navigation INVESTMENT GUIDE COUNTRY RATINGS SEE COUNTRIES SEE HOLIDAYS SIGHT SEEING Poll Do you consider BiH election a positive...
Date Added: 2009-02-11 18:46:55

060927airplanes.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: BULGARIA: January 1, 2007: Bulgaria Joins EU but Without Airplanes | seeurope.net HOME | NEWS TODAY | ABOUT US | CONTACTS Navigation INVESTMENT GUIDE COUNTRY RATINGS SEE COUNTRIES SEE HOLIDAYS SIGHT SEEING Poll Do you consider BiH election a positive...
Date Added: 2009-02-11 19:56:24

Core Competency, CIT 010.doc
Path: San Bernardino Valley College >> CIT >> 010 Fall, 2008
Description: Course Name and Number: CIT 010 For each course, use an X to identify the degree of emphasis for the core competencies. No Emphasis Some Emphasis Major Emphasis Core competencies, sub-categories: Critical Thinking Information Competency 1.1 1.2 1...
Date Added: 2009-02-02 16:01:33

Chem370_Handout_01_09_08
Path: Purdue >> CHEM >> 370 Fall, 2008
Description: ...
Date Added: 2008-06-27 12:50:38

FACS 195C handbook.doc
Path: CSU Sacramento >> FACS >> 195c Fall, 2008
Description: CALIFORNIA STATE UNIVERSITY, SACRAMENTO FAMILY AND CONSUMER SCIENCES 195C INTERNSHIP PROGRAM HANDBOOK Prior to graduation, students majoring in FACS with concentrations in Apparel Marketing and Design, Consumer Studies, Family Studies, Nutrition and ...
Date Added: 2009-02-02 13:52:25

SeminarOutline.doc
Path: SFASU >> FOR >> 570 Spring, 2008
Description: Seminar Outline Title: _ Slide 1: What is the history? Who was involved in this area of physics? Where and when did the research take place? Paste in an image. Slide 2: What techniques and equipment were used in this research? Paste in an image....
Date Added: 2009-01-11 18:21:35

Chap2_Lectures_Slides
Path: Mississippi State >> ME >> 3513 Spring, 2008
Description: Engineering Thermodynamics Chapter 2/Lecture6 Slides: Thermodynamic Quantities Russell 1 Learning Outcomes Understands the use of dimensions and units to characterize a measurable physical quantity Und...
Date Added: 2008-08-21 08:04:37

H92-1093.pdf
Path: UPenn >> H >> 92 Fall, 2009
Description: Weight Estimation for N-Best Rescoring* Ashvin Kannant, Mari Ostendorj]\', J. Robin Rohlicekl: t Boston University 44 Cummington St. Boston, MA 02215 :~ BBN Inc. 10 Moulton St. Cambridge, MA 02138 ABSTRACT This paper describes recent improvements in ...
Date Added: 2009-04-15 21:09:53

Homework_Zone_Volunteer.pdf
Path: Palomar >> ART >> 131 Spring, 2008
Description: VOLUNTEER POSITION DESCRIPTION Position Title Purpose Department Position Location Homework Zone Volunteer Assist students, grades K-12 with homework. Childrens Library Carlsbad City Library: Dove Library, Cole Library or The Learning Center (formerl...
Date Added: 2009-01-09 09:36:25

501.pdf
Path: University of Illinois, Urbana Champaign >> ARCH >> 501 Fall, 2008
Description: Course Schedule - Fall 2004 Architecture 501 Architectural Practice Credit: 4 hours. (ARCH 330) Role of the architect in the building enterprise, professional ethics, and the conduct of professional practice; legal aspects of architectural practice a...
Date Added: 2009-02-02 18:10:30

hw5.pdf
Path: Caltech >> ACM >> 104 Winter, 2008
Description: ACM 104 Handout Homework 5 Due date: Wedesday, January 21 1. Franklin Chapter 4, Problem 4, page 102. 2. Franklin Chapter 4, Problem 4, page 109. 3. Franklin Chapter 4, Problem 5, page 109. 4. Franklin Chapter 4, Problem 4, page 115. 5. Franklin Ch...
Date Added: 2009-01-09 19:56:26

(12-6-06)
Path: San Diego State >> ANTH >> 101 Fall, 2006
Description: (12-6-06) Epidemiology Study of diseases Non-infectious diseases Caused by genetic or environmental influences Can be linked to: o Diet/nutrition o Work place o Pollution/contaminants o Technology Types of non-infectious diseases Cancer Heart disease...
Date Added: 2008-04-17 01:30:09

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 634 Spring, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:46:25

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 442 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 19:03:59

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 320 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 18:59:39

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 677 Spring, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:49:48

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 636 Spring, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:47:04

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 450 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 19:04:40

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 330 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 19:00:26

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 680r Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:50:21

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 657 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:47:37

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 600 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:44:16

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 331 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 19:01:10

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 685r Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:51:07

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 658 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:48:09

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 630 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:44:54

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 351 Winter, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 19:02:33

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 674 Winter, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:48:40

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 133 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 18:57:53

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 633 Spring, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:45:40

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 438 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 19:03:16

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 230 Fall, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 18:58:35

ASLP636Spring2005Fujiki.pdf
Path: BYU >> COMD >> 675 Winter, 2008
Description: ASLP 636, Multicultural Issues in Speech Language Pathology Spring 2005 T, T 8:20-1050, 177 TLRB h Dr. Fujiki Office hours: 11-12 Th, 130 TLRB, or by appointment Overview: The mission of BYU is to provide an education that is (1) spiritually strengt...
Date Added: 2009-01-09 23:49:14

Outlineclasspersonal
Path: BU >> IR >> 101 Spring, 2008
Description: I. Introduction Topic: Assess post-Desert Storm changes in US National-Security Policy Agenda: Military Thought During the 1990s Compare US Military - 1980s vs 1990s II. Military Thought During the 1990s A. Revolution in Military Affairs(RMA) B. M...
Date Added: 2008-04-13 09:20:35

arduino.pdf
Path: Washington >> ART H >> 471 Fall, 2008
Description: DXARTS 471 Lecture 4: Arduino Overview Introducing the Arduino The Ardunio is a microcontroller development platform (not a microcontroller) Its hardware/software system is open source It has a programming language very similar to Processing It...
Date Added: 2009-02-02 20:30:56

BIO 5653 NIR.pdf
Path: Texas San Antonio >> BIO >> 5653 Fall, 2008
Description: ...
Date Added: 2009-02-03 14:20:56

206.pdf
Path: UCSB >> LING >> 206 Fall, 2008
Description: ...
Date Added: 2009-02-02 17:36:45

finalprep2sol.pdf
Path: UNC >> MATH >> 192 Fall, 2008
Description: a1 Ha1 e1 Figure 1: Sketch to recall how Householder re ections are derived. a1 is the vector we act on with the re ection matrix H to obtain Ha1 colinear with 0: the unit vector e1 = 1 0 Math 192 - Final Examination Preparation 2 1. Recall that t...
Date Added: 2009-02-18 01:45:08

Chapter 6 - Accounting for Merchandising Businesses€”Advanced Topics
Path: Maryland >> BMGT >> 220 Spring, 2008
Description: Chapter Six Accounting for Merchandising Businesses- Advanced Topics McGraw-Hill/Irwin The McGraw-Hill Companies, Inc. 2006 Inventory Cost Flow Methods Specific Identification First-in, FirstOut (FIFO) Four Common Inventory Cost Flow Methods Last...
Date Added: 2008-04-10 07:15:32

Thermo_5th_Chap14_P100
Path: UMass (Amherst) >> MIE >> 273 Spring, 2008
Description: 14-45 Adiabatic Mixing of Airstreams 14-100C This will occur when the straight line connecting the states of the two streams on the psychrometric chart crosses the saturation line. 14-101C Yes. 14-102 Two airstreams are mixed steadily. The specific...
Date Added: 2008-04-07 17:06:47

Thermo_5th_Chap14_P100
Path: Stevens >> E >> 234 Spring, 2008
Description: 14-45 Adiabatic Mixing of Airstreams 14-100C This will occur when the straight line connecting the states of the two streams on the psychrometric chart crosses the saturation line. 14-101C Yes. 14-102 Two airstreams are mixed steadily. The specific...
Date Added: 2008-04-08 10:39:33

372.pdf
Path: University of Illinois, Urbana Champaign >> IB >> 372 Fall, 2008
Description: Course Schedule - Fall 2007 Integrative Biology 372 Ecology and Evolution credit: 5 hours. Integrated study of ecology, population genetics, and evolution. Conceptual themes and techniques from the molecular, cellular, and organismal levels of biolog...
Date Added: 2009-02-02 18:05:41

Lecture06.pdf
Path: Florida >> EEL >> 5225 Fall, 2008
Description: EEL5225: Principles of MEMS Transducers (Fall 2003) Fabrication Technology, Part II Agenda: Process flow examples (diodes) Micromachining-Overview Bulk micromachining Reading: Senturia, pp. 45-49. Next time: Senturia, pp. 29-44. 1 EEL5225: Princi...
Date Added: 2009-01-10 18:22:55

Mktg 3650 New Product Development
Path: North Texas >> MKTG >> 3650 Spring, 2008
Description: New Product Development New Product Development Dr. Kenneth N. Thompson University of North Texas Marketing Foundations 3/9/2008 University of North Texas 1 Objectives & Overview Marketing Foundations What is a new product? Types of new product...
Date Added: 2008-03-27 21:01:35

az118511c.pdf
Path: Arizona >> AZ >> 1185 Fall, 2008
Description: Sweet Resinbush Herbicide Study at Marijilda and Frye Mesa Sites, 1998-1999 L.J. Clark and R. Walser Abstract Ten herbicide treatments were applied to two sites containing high infestation levels of Sweet Resinbush (Euryops subcarnosus sub. Vulgaris...
Date Added: 2009-04-15 23:14:32

Fermat\'s Principle- Concave Mirror.pdf
Path: Arizona >> OPTI >> 502 Fall, 2008
Description: ...
Date Added: 2009-01-09 15:50:56

ex1fulldoc.pdf
Path: Ohio State >> AEDE >> 1 Fall, 2008
Description: Township Growth Community Resource Development Ohio State University Extension The Ohio State University & ...
Date Added: 2009-02-17 22:35:27

BridgesTails.pdf
Path: ASU >> ESS >> 591 Fall, 2008
Description: Galactic Bridges and Tails or Simulations-A-Plenty Alar Toomre & Juri Toomre ApJ, Vol. 178, pp. 623-666 (1972) Natalie R. Hinkel AST 591: Journal Club Prof. Rolf Jansen February 16th, 2007 1 What to Expect Why we care Five Initial Simulations (t...
Date Added: 2009-02-02 21:17:31

Mar4.pdf
Path: Caribbean >> MA >> 408 Fall, 2002
Description: ...
Date Added: 2009-02-17 18:49:45

Mar4.pdf
Path: Texas >> M >> 408 Fall, 2002
Description: ...
Date Added: 2009-02-17 18:49:44

211q06msols.pdf
Path: N. Illinois >> MATH >> 211 Fall, 2008
Description: ...
Date Added: 2009-01-09 05:17:22

Recitation 5ans
Path: Virginia Tech >> MATH >> 1224 Fall, 2007
Description: Recitation 5 1. a. linear combination. <3, 2> = 11 <1, 2> - 4 <2, 5> b. not linear combination 2a. linearly independent b. not linearly independent c1-3c3, c2 = c3, c3 = c3 3. a. c1 = u u 2 or u u u b c2 = v v 2 or v vv , c3 = w w 2 o...
Date Added: 2008-04-01 15:46:11

bsc320-bfl_methods.doc
Path: Marshall >> BSC >> 320 Spring, 2008
Description: Principles of Ecology BSC 320 Marshall University Fall Semester 2008 Dr. Frank S. Gilliam: 380 Science Bldg; 696-3636; gilliam@marshall.edu Dr. Jeffrey D. May: 378 Science Bldg; 696-3637; may@marshall.edu Methods used in sampling Beech Fork Lake ...
Date Added: 2009-01-09 02:48:49

Soln07144
Path: Toledo >> CIVE >> 1150 Spring, 2008
Description: COSMOS: Complete Online Solutions Manual Organization System Chapter 7, Solution 144. ymax = c cosh Tmax = wymax , ymax = L =h+c 2c ymax = Tmax w 80 lb = 40 ft 2 lb/ft c cosh 9 ft = 40 ft c Solving numerically, c1 = 2.6388 ft c2 = 38.958 ft h =...
Date Added: 2008-05-14 16:37:32

001024NotAllowed.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: The Iron Fist Still Rules in The Land of \'Not Allowed\' Front Page International Finance Opinion Letters Travel Traveler Update People Sports To see an image of today\'s front page download This File Bureaus Columnists Features Money Report TribTech F...
Date Added: 2009-02-11 18:05:56

chap12 - greens theorem
Path: Cornell >> MATH >> 1220 Fall, 2008
Description: Greens theorem 1 Chapter 12 Greens theorem We are now going to begin at last to connect dierentiation and integration in multivariable calculus. In addition to all our standard integration techniques, such as Fubinis theorem and the Jacobian formul...
Date Added: 2008-09-28 16:17:56

Exam 2
Path: Texas Tech >> HIST >> 2301 Fall, 2007
Description: Exam 2 Review Sheet History 2301-006 and 009 Instructor Chris Trobridge Bolshevik Revolution- The October Revolution overthrew the Russian Provisional Government and gave the power to the Soviets dominated by Bolsheviks. It was followed by the Russia...
Date Added: 2008-04-10 01:14:07

program9
Path: City College SF >> CS >> CS 110A Spring, 2009
Description: CS 110A Rule \\handouts\\pgm9 Program 9 Completion Date: _ Using the modular approach, write a program that will produce a student grade report. Data: Input the student data from the keyboard into two one-dimensional arrays. For each student, the us...
Date Added: 2009-04-01 21:42:15

PHYS 2326 Syll Fall_08.pdf
Path: HCCS >> PHYS >> 1402 Fall, 2008
Description: HOUSTON COMMUNITY COLLEGE SOUTHWEST COLLEGE UNIVERSITY PHYSICS II PHYS 2326 COURSE SYLLABUS FALL 2008 Course Title: University Physics II Course No.: PHYS 2326 Class No.: 64810 Time and Location: 2:00 PM - 4:30 PM Tuesdays and Thursdays Westloop Cent...
Date Added: 2009-01-11 15:59:58

PHYS 2326 Syll Fall_08.pdf
Path: HCCS >> PHYS >> 2325 Fall, 2008
Description: HOUSTON COMMUNITY COLLEGE SOUTHWEST COLLEGE UNIVERSITY PHYSICS II PHYS 2326 COURSE SYLLABUS FALL 2008 Course Title: University Physics II Course No.: PHYS 2326 Class No.: 64810 Time and Location: 2:00 PM - 4:30 PM Tuesdays and Thursdays Westloop Cent...
Date Added: 2009-01-11 15:59:58

PHYS 2326 Syll Fall_08.pdf
Path: HCCS >> PHYS >> 2326 Fall, 2008
Description: HOUSTON COMMUNITY COLLEGE SOUTHWEST COLLEGE UNIVERSITY PHYSICS II PHYS 2326 COURSE SYLLABUS FALL 2008 Course Title: University Physics II Course No.: PHYS 2326 Class No.: 64810 Time and Location: 2:00 PM - 4:30 PM Tuesdays and Thursdays Westloop Cent...
Date Added: 2009-01-11 15:59:58

PHYS 2326 Syll Fall_08.pdf
Path: HCCS >> ASTR >> 1303 Fall, 2008
Description: HOUSTON COMMUNITY COLLEGE SOUTHWEST COLLEGE UNIVERSITY PHYSICS II PHYS 2326 COURSE SYLLABUS FALL 2008 Course Title: University Physics II Course No.: PHYS 2326 Class No.: 64810 Time and Location: 2:00 PM - 4:30 PM Tuesdays and Thursdays Westloop Cent...
Date Added: 2009-01-11 15:59:58

PHYS 2326 Syll Fall_08.pdf
Path: HCCS >> ASTR >> 1304 Fall, 2008
Description: HOUSTON COMMUNITY COLLEGE SOUTHWEST COLLEGE UNIVERSITY PHYSICS II PHYS 2326 COURSE SYLLABUS FALL 2008 Course Title: University Physics II Course No.: PHYS 2326 Class No.: 64810 Time and Location: 2:00 PM - 4:30 PM Tuesdays and Thursdays Westloop Cent...
Date Added: 2009-01-11 15:59:58

project1.pdf
Path: Delaware >> CISC >> 303 Fall, 2008
Description: Project 1 Using Lex and Yacc for Higher Level Abstraction CISC 471 Compiler Design This is an individual assignment, other than the partner for deliverable D5. You may discuss your ideas with others, but your work should be your own. Deliverables an...
Date Added: 2009-01-10 03:33:43

project1.pdf
Path: Delaware >> CISC >> 471 Fall, 2008
Description: Project 1 Using Lex and Yacc for Higher Level Abstraction CISC 471 Compiler Design This is an individual assignment, other than the partner for deliverable D5. You may discuss your ideas with others, but your work should be your own. Deliverables an...
Date Added: 2009-01-10 03:33:43

875_PERL_06.ppt
Path: Wisconsin >> GASCH >> 875 Fall, 2008
Description: Introduction to PERL Genetics 875 10/19/06 PERL is a language that is easy to use and was designed to do certain tasks (like reading, writing, moving text & sequences) very well Advantages of PERL: - its intuitive - its easy to get started you dont...
Date Added: 2009-02-04 14:16:24

exam2c.pdf
Path: Texas El Paso >> MATH >> 2326 Fall, 2008
Description: Math 2326, Test II Name _ 1. a. Find the general solution to the following system. x y = 4 2 1 3 x y answer: x y = C1 e2t 1 1 + C2 e5t 2 1 b. Give the equations of two lines such that if (x(0), y(0) is on the line, (x(t), y(t) remains on the l...
Date Added: 2009-02-03 14:19:39

article2.txt
Path: Richmond >> V >> 6 Fall, 2009
Description: Richmond Journal of Law Interruption of Computer Services to Authorized Users\" ...
Date Added: 2009-04-15 23:36:27

ProgReview99.pdf
Path: Mt. SAC >> LIT >> 47 Fall, 2008
Description: MT. SAN ANTONIO COLLEGE 1999 PROGRAM EVALUATION DUE NOVEMBER 22, 1999 ACADEMIC PROGRAM DEPARTMENT: DIVISION: PROGRAM CONTACT PERSON: 1. Program Mission Statement The primary mission of the English, Literature, and Journalism Department is to offer a ...
Date Added: 2009-01-09 04:22:42

ProgReview99.pdf
Path: Mt. SAC >> ENGL >> 1b Spring, 2008
Description: MT. SAN ANTONIO COLLEGE 1999 PROGRAM EVALUATION DUE NOVEMBER 22, 1999 ACADEMIC PROGRAM DEPARTMENT: DIVISION: PROGRAM CONTACT PERSON: 1. Program Mission Statement The primary mission of the English, Literature, and Journalism Department is to offer a ...
Date Added: 2009-01-12 14:33:21

puk2-12.doc
Path: Sierra >> BIOSCI >> 4 Fall, 2008
Description: PUK2#12 Combinedsequencewithendseditedandoverlapremoved: GGCCTAACACATGCAAGTCGAGCGGTAACAGAAAAGAAGCTTGCTTCTTTTGC TGACGAGCGCCGGACGGGTGAGTAATGCCTGGGAATATACCCTGATGTGGGGG ATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAGAGGG GGACCTTCGGGCCTCTCGCGTCAGGATTAG...
Date Added: 2009-01-10 00:17:31

puk2-12.doc
Path: Sierra >> BIOSCI >> 1 Fall, 2008
Description: PUK2#12 Combinedsequencewithendseditedandoverlapremoved: GGCCTAACACATGCAAGTCGAGCGGTAACAGAAAAGAAGCTTGCTTCTTTTGC TGACGAGCGCCGGACGGGTGAGTAATGCCTGGGAATATACCCTGATGTGGGGG ATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAGAGGG GGACCTTCGGGCCTCTCGCGTCAGGATTAG...
Date Added: 2009-01-10 00:17:31

puk2-12.doc
Path: Sierra >> BIOSCI >> 2 Fall, 2008
Description: PUK2#12 Combinedsequencewithendseditedandoverlapremoved: GGCCTAACACATGCAAGTCGAGCGGTAACAGAAAAGAAGCTTGCTTCTTTTGC TGACGAGCGCCGGACGGGTGAGTAATGCCTGGGAATATACCCTGATGTGGGGG ATAACTATTGGAAACGATAGCTAATACCGCATAATCTCTTCGGAGCAAAGAGGG GGACCTTCGGGCCTCTCGCGTCAGGATTAG...
Date Added: 2009-01-10 00:17:31

LIB 805.syllabus.Fall.08.doc
Path: E. Kentucky >> LIB >> 805 Fall, 2008
Description: LIB 805 A. LIB 805 Course title: Advanced Childrens Literature Credit Hours: 3 B. Course Description: A course designed to help teachers and librarians acquire knowledge of characteristics of recent literature for young children, increase their knowl...
Date Added: 2009-02-02 14:10:53

070904freedom.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: Print Story - canada.com networkTuesday September 4 2007 Canada moves a step up \'economic freedom\' index The criteria include low tax rates and little government interference Derrick Penner Vancouver Sun Tuesday, September 04, 2007 CREDIT: Peter B...
Date Added: 2009-02-11 17:55:24

FR 102 spr 08 syll.doc
Path: Alabama >> AS >> 102 Fall, 2008
Description: French 102: Elementary French Spring 2008 Instructor:_ Office:_ Office Hours:_ Email: _ Telephone:_ Course Description: French 102 is a course in which you will develop listening, speaking, reading and writing skills, as well as learn about French-...
Date Added: 2009-02-02 16:22:16

Degrees-Of-Freedom.doc
Path: UCSD >> MAE >> 3 Fall, 2008
Description: Degrees Of Freedom Definition The Degrees Of Freedom (DOF) of a mechanical system are the minimum number of variables required to completely specify the velocity of a the system. Thus, the DOF can be defined as the number of independent movements it ...
Date Added: 2009-01-10 01:46:12

ex1-key
Path: Wisconsin >> CHEM >> 345 Spring, 2007
Description: ...
Date Added: 2008-04-05 21:58:33

2004ex1-key
Path: Wisconsin >> CHEM >> chem345 Spring, 2003
Description: ...
Date Added: 2008-03-27 10:28:35

stressintensityfactor.ppt
Path: Wisconsin >> M S & E >> 362 Fall, 2008
Description: MS III loading Stress Intensity Factor Tables Plasticity at the crack tip: the concept of plastic surface energy...
Date Added: 2009-02-03 14:26:58

355_07-3.pdf
Path: CSU Long Beach >> I S >> 355 Spring, 2008
Description: Math 355 College Geometry CSULB Fall 2007 Scott Crass FO3-211 562 985 4758 scrass@csulb.edu Office: Wed 11-12 Overview Geometry is an immensely rich subject. As more than just one of the branches of math, geometry motivates and connects various mat...
Date Added: 2009-02-02 13:49:49

memotemplate.doc
Path: Purdue >> ENGL >> 203 Fall, 2008
Description: English 203 Standard Memo Template Use the following standard memo template for most professional writing situations, including writing memos to your instructors for class assignments. Memorandum To: Recipients names and job titles From: Writers nam...
Date Added: 2009-01-12 05:22:47

12.pdf
Path: Berkeley >> STAT >> 153 Fall, 2008
Description: Introduction to Time Series Analysis. Lecture 12. Peter Bartlett 1. Review: Time series modelling and forecasting 2. Parameter estimation 3. Maximum likelihood estimator 4. Yule-Walker estimation 5. Yule-Walker estimation: example 1 Review (Lecture...
Date Added: 2009-01-11 21:22:36

hw3f05.pdf
Path: Toledo >> ASTRO >> 1 Fall, 2008
Description: ASTR 4810 Problem Set 3, due Friday, 30 September 2005 In your solutions to the following problems, show your reasoning clearly. o 1. The obliquity of the ecliptic, , is equal to 23. 439. The coordinates of the star Sirius, epoch h 45m 9s and = 16o ...
Date Added: 2009-02-17 22:20:40

intro.ppt
Path: Columbia >> CS >> 6998 Fall, 2008
Description: Advanced NLP: Spe ech Resea r ch and Tec hnol ogi es Julia Hirschberg CS 6998 01/21/09 1 Spoken Natural Language Processing NLP/Computational Linguistics historically text-oriented Speech research domain of EE and Linguistics 1980s: efforts t...
Date Added: 2009-03-19 00:01:13

license.txt
Path: Hawaii >> SCHOLARSPA >> 795 Fall, 2008
Description: Item submitted by brownke@hawaii.edu (brownke@hawaii.edu) on 2008-03-13T04:44:33Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) t...
Date Added: 2009-02-17 19:28:37

license.txt
Path: Hawaii >> SCHOLARSPA >> 10125 Fall, 1989
Description: Item submitted by brownke@hawaii.edu (brownke@hawaii.edu) on 2008-03-13T04:44:33Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) t...
Date Added: 2009-02-17 19:28:32

description.txt
Path: University of San Francisco >> CS >> 601 Fall, 2008
Description: CS601 Object-Oriented Software Development Course Description ABSTRACT There is more to being a professional developer than learning the syntax and libraries of a programming language-that part is easy. You must learn how to use the myriad of progr...
Date Added: 2009-04-15 20:30:51

quiz03-219-sol.pdf
Path: Berkeley >> MATH >> 219 Fall, 2008
Description: Math 54 S218, Quiz 3 GSI: Jia Yu February 9, 2007 1. Let V denote the set of all upper triangular 3-by-3 matrices abc 0 d e , 00f where usual addition and scalar multiplication are dened. (a) Show that V is a vector space. (b) Suppose S is the s...
Date Added: 2009-02-02 17:00:00

06-03-ObjectDesign-notes
Path: Michigan State University >> CSE >> 435 Fall, 2007
Description: Object Design Chapter 7, Object Design Object design is the process of adding details to the requirements analysis and making implementation decisions The object designer must choose among different ways to implement the analysis model with the g...
Date Added: 2008-07-25 12:56:15

February 28th
Path: Colorado State >> GEOL >> 120 Spring, 2008
Description: February 28th - 3000 to 5000 B.C.: Ancient Egypt- findings of gemstones as ornaments. - Greek and Roman times: personal adornment, traded and valued as much as today. - Romans wore them as charms, endowed them with magical powers. - Astrology played ...
Date Added: 2008-04-30 02:09:25

BedDy16_151
Path: USF >> EGN >> 3311 Spring, 2008
Description: Problem 16.151* A crate of mass m slides across a smooth oor pulling a chain from a stationary pile. The mass per unit length of the chain is L . If the velocity of the crate is v0 when s = 0, what is its velocity as a function of s? Solution: The ma...
Date Added: 2009-03-31 19:45:57

homework1.pdf
Path: UNL >> STAT >> 883 Fall, 2008
Description: STAT 883 Spring, 2008 Homework 1 due Tuesday, 22 January 2008 From Casella else (a) Find the joint pdf of the order statistics...
Date Added: 2009-02-02 19:49:48

?method=getElement&element=~week14~oaipmh-co.ppt
Path: Old Dominion >> CS >> 751 Fall, 2008
Description: Introduction to Digital Libraries Week 14: OAI & Complex Objects for Preservation Old Dominion University Department of Computer Science CS 751/851 Fall 2006 Michael L. Nelson mln@cs.odu.edu Joan A. Smith jsmit@cs.odu.edu 11/29/06 several slides bor...
Date Added: 2009-01-09 05:54:00

?method=getElement&element=~week14~oaipmh-co.ppt
Path: Old Dominion >> CS >> 851 Fall, 2008
Description: Introduction to Digital Libraries Week 14: OAI & Complex Objects for Preservation Old Dominion University Department of Computer Science CS 751/851 Fall 2006 Michael L. Nelson mln@cs.odu.edu Joan A. Smith jsmit@cs.odu.edu 11/29/06 several slides bor...
Date Added: 2009-01-09 05:54:00

externalities
Path: Baylor >> ECON >> 1000 Spring, 2008
Description: 1. Externalities An Externality is the uncompensated impact of one persons actions on the well being of a bystander. A byproduct of a persons actions, not necessarily intended, that affects the people around him or her. An example of an externality w...
Date Added: 2008-10-23 21:19:11

comp127.pdf
Path: Alaska Pacific >> CMSPROD >> 12553 Fall, 2008
Description: ...
Date Added: 2009-02-18 14:02:50

6b5.ppt
Path: UNC >> SPAN >> 004 Fall, 2008
Description: viernes 21.XI: Presentaciones finales White, Vickers, MacDonald, Weis, Vickery, Selig y Hayes lunes 24.XI: Presentaciones finales any above plus: Tonks, Pileika, Kovach, Kingberg, Green y Espeland lunes 1o.XII: Presentaciones finales any above plus: ...
Date Added: 2009-02-18 01:46:00

6b5.ppt
Path: UNC >> SPAN >> 204 Fall, 2008
Description: viernes 21.XI: Presentaciones finales White, Vickers, MacDonald, Weis, Vickery, Selig y Hayes lunes 24.XI: Presentaciones finales any above plus: Tonks, Pileika, Kovach, Kingberg, Green y Espeland lunes 1o.XII: Presentaciones finales any above plus: ...
Date Added: 2009-02-18 01:46:00

Gladiator essay
Path: Delaware >> ANTH >> 103 Spring, 2008
Description: When historical movies are made quite often inaccuracies are added to give the movie a greater appeal to the audience. The film \"Gladiator\" starring Russell Crowe as the main character Maximus Decimus Meridius is no exception. Many of the scenes in t...
Date Added: 2008-04-06 09:56:01

brazildebt.pdf
Path: Penn State >> ECON >> 434 Fall, 2008
Description: A Note on Brazil and Debt Dynamics Econ 434 Fall 2002 Brazil has a new President. He faces tough choics. Net public sector debt is large (see gure 1) and a lot of it is linked to the dollar. So as the real has weakened the share of debt to gdp has ri...
Date Added: 2009-01-11 17:44:17

Phys171_Lecture04_2007.pdf
Path: Maryland >> PHYS >> 171 Fall, 2008
Description: Phys171 Tue 1/30 No office hour next Monday Safa Montesharrei will do sample problems on Monday 10am-10.50am Erin Rericha will teach for me Tuesday I will be back Thursday NOTE: HW due on Fri Instantaneous Velocity Mathematically: The limit of...
Date Added: 2009-02-06 19:24:55

Arias_Lily_Thesis.pdf
Path: Texas Tech >> ETD >> 03312008 Fall, 2009
Description: ECOMORPHOLOGICAL STRUCTURE OF AN AMAZONIAN PHYLLOSTOMID BAT ASSEMBLAGE by Lily C. Arias, B. S. A Thesis In BIOLOGY Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIEN...
Date Added: 2009-04-15 20:33:28

brzezinski_grl_02.pdf
Path: UCLA >> AN N EA >> 221b Spring, 2008
Description: GEOPHYSICAL RESEARCH LETTERS, VOL. 29, NO. 12, 10.1029/2001GL014349, 2002 A switch from Si(OH)4 to NO depletion in the glacial 3 Southern Ocean Mark A. Brzezinski, Carol J. Pride,1 and Valerie M. Franck Department of Ecology Evolution and Marine Bio...
Date Added: 2009-01-09 19:46:43

150_050_Syllabus_20082
Path: USC >> SPAN >> 150 Summer, 2007
Description: UNIVERSITY OF SOUTHERN CALIFORNIA SPANISH 150 SUMMER 2008 (050) INSTRUCTOR: Montes, A. Required text: EMAIL: emontes@usc.edu Castells, Guzmn, Lapuerta, & Garca. 2006. Mosaicos: Spanish as a World Language. Upper Saddle River, NJ: Prentice-Hall. (V...
Date Added: 2008-07-22 17:08:26

paper40-x.pdf
Path: The University of Akron >> 2260 >> 275 Summer, 2008
Description: ...
Date Added: 2009-01-11 21:10:31

paper40-x.pdf
Path: The University of Akron >> 3530 >> 498 Spring, 2008
Description: ...
Date Added: 2009-01-11 21:10:31

paper40-x.pdf
Path: The University of Akron >> 4400 >> 693 Summer, 2008
Description: ...
Date Added: 2009-01-09 15:39:45

proj1_2001.pdf
Path: Florida >> EEL >> 6537 Spring, 2008
Description: EEL 6537 Project 1 Nonparametric Methods Consider the data set x(n) = 2 cos(2f1 n + 1 ) + 2 cos(2f2 n + 2 ) + 2 cos(2f3 n + 3 ) + z(n), where f1 = 0.05, f2 = 0.40, f3 = 0.42, and n = 0, 1, , N 1. The 1 , 2 , and 3 are independent random variable...
Date Added: 2009-01-11 22:45:32

mcfin_proposal.pdf
Path: UCLA >> ANDERSON >> 21521 Fall, 2008
Description: CIBER RESEARCH GRANT PROPOSAL Complete this form and attach any extra sheets if necessary. Return to Shaumir Acharya in Gold Hall, B-307. CIBER will review your proposal and will inform you of approval and budget allowance. Print Form THIS PROPOSAL...
Date Added: 2009-02-11 22:02:57

Zakharov.pdf
Path: Colorado >> ATOC >> 1 Fall, 2008
Description: ...
Date Added: 2009-02-17 15:50:16

391W.pdf
Path: UMass (Amherst) >> SOCIOL >> 391w Fall, 2008
Description: WOST 391W: WRITING FOR WOMENS STUDIES MAJORS FALL 2006 Mondays, Wednesdays, Fridays 10:10-11 a.m. Instructor: Kirsten Isgro E-mail: kisgro@comm.umass.edu WebCT Course id: wost391wki https:/webct.oit.umass.edu/ Classroom: Dickinson 210 COURSE DESCRIPT...
Date Added: 2009-02-02 19:32:47

BielefeldEnglishWeb.pdf
Path: USC >> GERMAN >> 2 Fall, 2008
Description: Arnold Heidsieck Bellow, Styron, Roth: representation of anti-Semitism and its relationship to German cultural history in Jewish and non-Jewish American novels. From a non-European perspective, important aspects of the relation between antiSemitism...
Date Added: 2009-02-18 01:57:01

CVEN2121 5
Path: Colorado >> CVEN >> 2121 Summer, 2008
Description: 1 2 3 4 ...
Date Added: 2008-06-18 10:01:57

Applied_2007_Jan.pdf
Path: Tulane >> MATH >> 721 Fall, 2008
Description: (1) (2) (3) (4) (5) (6) (7) (8) (9) Qualifying Exam in Applied Mathematics January 2007 Do at least 10 problems Suppose f is a smooth vectoreld in Rn and |f (x) f (y)| 2|x y| for all x, y. Prove, in this case, that the solution to the initial...
Date Added: 2009-01-10 01:07:32

LTA-1000G-GreenLEDDisplay.pdf
Path: Berkeley >> EE >> 100 Fall, 2008
Description: ! \" # $ # %+ ,( ),)1 2\'(30)1 22 , ) 4),\', 6,\'.%* (/,-7/\',4\'-( ., 9)2& ,9 ) + )...
Date Added: 2009-04-16 01:32:10

Container Project Spreadsheet Norfolk
Path: USMMA >> DECK >> dn220 Spring, 2008
Description: Bay 1 20\' Forward Bay 5 20\' Forward 09 08 Bay 9 20\' Forward 09 08 07 06 10 08 06 04 02 01 03 05 07 09 05 04 03 05 04 03 RB RB RB RB RB RB RB RB 01 03 05 Bay 13 20\' Forward 08 FB FB FB FB FB 06 04 02 01 03 05 08 06 04 02 01 03 05 07 LB FB LB FB 0...
Date Added: 2008-04-25 08:51:59

Lecture12.pdf
Path: Purdue >> ECE >> 650r Fall, 2008
Description: EE650R: Lecture 12: Date: ClassNotes: Review: Reliability Physics of Nanoelectronic Devices Temperature Dependence of NBTI Degradation Oct 6, 2006 Jaydeep P. Kulkarni Jing Li, Kynh-yuk Kang 12.1 Review In the last class, we started an analysis of t...
Date Added: 2009-01-09 20:44:31

AP04-04.pdf
Path: Hawaii >> AP >> 04 Fall, 2008
Description: June 1, 2004 ADMINISTRATIVE PROCEDURES MEMORANDUM NO. 04-04 TO: FROM: Management Team James R. W. Sloane Vice President for Administration and Chief Financial Officer REVISED ADMINISTRATIVE PROCEDURES SUBJECT: Personnel and/or Administrative Offi...
Date Added: 2009-02-17 19:24:09

25FL20Midterm_3_Revision.ppt
Path: San Jose State >> CS >> 157a Fall, 2008
Description: Midterm 3 Revision 2 Prof. Sin-Min Lee Department of Computer Science Normal Forms 1NF 2NF 3NF BCNF 4NF 5NF Functional dependencies Multivalued dependencies Join dependencies F+: dependencies induced by Armstrongs Axioms Axioms for reasoning abo...
Date Added: 2009-01-09 07:05:07

Capitulo10.pdf
Path: InterAmerican Aguadilla >> ELEN >> 3302 Fall, 2009
Description: ...
Date Added: 2009-04-15 19:32:26

ClassNote4.pdf
Path: SUNY Albany >> PAD >> 504 Fall, 2008
Description: RPAD 504 Rethemeyer Fourth Lecture: Difference Equations February 12, 2003 Announcements, questions and comments Adobe Acrobat issues Expectations regarding homework submissions Answer questions regarding problem set on probability Answer questions ...
Date Added: 2009-02-04 14:35:33

assign01.pdf
Path: Okaloosa-Walton >> STA >> 2023 Fall, 2009
Description: STA 2023 Dr. D. P. Story Daily Class Assignments Statistics Fall 2006 The following are exercises that should be done on a daily basis. The problems illustrate the ideas and techniques of the course, reinforce skills, and prepares you for the test...
Date Added: 2009-04-15 23:48:46

Word2002-dickinsonlaw.pdf
Path: Penn State >> PSERIE >> 2002 Fall, 2008
Description: Dickinson School of Law Microsoft Word 2002 Instructional & Information Technology Department October 2002 Alternative Format Statement This publication is available in alternative media upon request. Statement of Non-discrimination The Pennsylva...
Date Added: 2009-02-06 19:59:09

Big Picture of Soc wld
Path: University of Dayton >> SOC >> 101 Spring, 2008
Description: Principles The Big Picture of the social world: Nature Nature (Ecological Context) Fall 2004 Culture Society Non-material (\"ideal\" + \"real\") Material Social Structure Institutions Values Symbols (language) Organizations Norms - Folkways - More...
Date Added: 2008-04-07 22:58:58

Syllabus.pdf
Path: JMU >> ISAT >> 350 Fall, 2008
Description: CS-350: Computer Organization, Spring 2003 Semester Course Syllabus 2003 Charles Abzug Summary Course Description: This course provides a solid theoretical foundation that provides insight into the innermost workings of the modern digital computer...
Date Added: 2009-02-02 14:40:09

Legal Issues in the Church Notes
Path: Northwest College >> PMIN >> 3523 Spring, 2008
Description: Legal Issues in the Church The Truth Project Video Difference between the past and the future: past events that have already happened, future events are events that have already happened. What you believe in the present is powerfully influenced by th...
Date Added: 2008-04-21 15:07:38

assymmetric info.pdf
Path: Berkeley >> ECON >> 100a Fall, 2008
Description: Asymmetric Information Main topics problems due to asymmetric information response to adverse selection how ignorance about quality drives out highquality goods price discrimination due to false beliefs about quality market power from price ign...
Date Added: 2009-01-09 19:24:53

Lab 2B- #1
Path: Hofstra >> PHY >> 2B Summer, 2008
Description: Experiment #1 Hooke\'s Law June 30, 2008 Erin Samplin Abstract The main purpose of this laboratory experiment is to calculate the spring constant for a given spring and to determine the effective spring constant. Students will utilize a spring mass...
Date Added: 2008-07-05 17:02:54

2375.030.ps
Path: Hawaii >> SOEST >> 2375 Fall, 2008
Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207376623.0388276 Float: 2375 Profile: 030 Location: 33.0N 142.2E Date: 10/24...
Date Added: 2009-02-17 20:05:44

Chapter 1 Notes
Path: FSU >> OCE >> 1001 Spring, 2009
Description: ...
Date Added: 2009-02-24 13:35:30

Philanthropy.pdf
Path: Wisconsin Milwaukee >> SPGSUM >> 2005 Fall, 2009
Description: PHILANTHROP\\ An Important Cause, Honestly Explained President Timothy J. Sullivan 66 Reflects on Fundraising one that transformed William and Mary from a strong Virginia college into a worldclass university. By almost every index, William and Mary ha...
Date Added: 2009-04-15 22:18:55

Final Review Sheet.pdf
Path: BYU >> CHEM >> 729r Fall, 2008
Description: Some Review Material for the Chem 223 Final Exam Equations that will be given to you: d m\' 1 d a w m= d (x i x)2 1 a d s= i n 1 = x ts n t= x1 x 2 n1n 2 spooled 1 + n 2 n spooled = 2 s12 (n1 1) + s2 (n 2 1) n1 + n 2 2 G = nFE = RT ...
Date Added: 2009-01-09 18:48:36

Final Review Sheet.pdf
Path: BYU >> CHEM >> 223 Fall, 2008
Description: Some Review Material for the Chem 223 Final Exam Equations that will be given to you: d m\' 1 d a w m= d (x i x)2 1 a d s= i n 1 = x ts n t= x1 x 2 n1n 2 spooled 1 + n 2 n spooled = 2 s12 (n1 1) + s2 (n 2 1) n1 + n 2 2 G = nFE = RT ...
Date Added: 2009-02-11 21:30:35

051014energy.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: RedNova News - Science - Survey Finds Slovenia Well Prepared for Possible Energy Shocks Home News Video Images Space Science Health Technology Education Community Fun Shopping Site Map SPECIAL NEWSReturn to Flight REDNOVA NEWSSpace Science Technology...
Date Added: 2009-02-11 19:33:09

formulas_2.pdf
Path: N.C. State >> PY >> 413 Fall, 2008
Description: Ideal Gas Ideal gas law P V = kN T f kN T 2 with f = 3 for a mono-atomic gas and f = 5 for a di-atomic gas. Adiabatic expansion pV = const, = (f + 2)/f U= Entropy of an ideal mono-atomic gas S = kN log Chemical potential = kT log V N vQ V N vQ + 5...
Date Added: 2009-01-10 17:18:10

BME300FinalPoster.pdf
Path: Wisconsin >> BME >> 300 Fall, 2008
Description: Pelvic Organ Prolapse Teaching Model Team Members: Andrew Bertram, Graham Bousley, Hallie Kreitlow, Sarah Switalski Department of Biomedical Engineering Advisor: Paul Thompson, PhD Client: Dr. Tova Ablove, MD Abstract Pelvic organ prolapse occurs wh...
Date Added: 2009-02-11 16:30:23

Fishburn08.pdf
Path: Rutgers >> 125 >> 575 Spring, 2008
Description: REVIEW The Pharmacology of PEGylation: Balancing PD with PK to Generate Novel Therapeutics C. SIMONE FISHBURN Nektar Therapeutics, 150 Industrial Road, San Carlos, California 94070 Received 16 September 2007; revised 9 November 2007; accepted 9 Nove...
Date Added: 2009-01-12 14:37:26

611syl.f04.pdf
Path: Alabama >> ME >> 611 Fall, 2008
Description: Huebner, et al., 4th Edition August 23, 2004 Mtg 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 Date 23-Aug 25-Aug 27-Aug 30-Aug 1-Sep 3-Sep 6-Sep 8-Sep 10-Sep 13-Sep 15-Sep 17-Sep 20-Sep 22-S...
Date Added: 2009-01-11 19:52:25

23-002.pdf
Path: DeAnza College >> PERS >> 002 Winter, 2008
Description: ...
Date Added: 2009-02-02 14:03:37

CommandLectureNotes.doc
Path: Arizona >> CS >> 335 Fall, 2009
Description: Advanced Topics in JAVA (part 1) (all those little things you might want to use in your final project) Today, we will cover the following advanced topics: - Basic Reflection (useful for Plugins, AI Strategies, and building dynamic environments (ie M...
Date Added: 2009-04-15 23:02:47

hw11 Risk calc - Air.doc
Path: Arkansas >> CVEG >> 3243 Fall, 2008
Description: CVEG 3243 Homework #11 Due: Wed, April 30 1. Did you read the Trashmore articles on the class webpage? 2. NastiChem Amalgamated Industries 2500 m Tech One Office Park A new risk-based standard mandates that the risk to human health as the result ...
Date Added: 2009-01-09 19:11:59

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> PHY >> 2424 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:15:09

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> BIO >> 1314 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:14:13

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> PHY >> 2524 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:15:15

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> CHE >> 1214 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:14:33

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> BIO >> 2924 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-11 16:45:44

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> CHE >> 1224 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:14:33

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> CHE >> 1314 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-11 16:46:06

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> PHY >> 2244 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:15:04

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> BIO >> 1134 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:14:07

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> PHY >> 2254 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:15:04

CHAPTER7 PRACTICE TEST.doc
Path: MGCCC >> BIO >> 1144 Spring, 2008
Description: 1/27/04 Dr. Robert G. Molsbee A&P-I Chapter 7 (Bones) Name _ 1. The girdles attach the limbs (extremities) to the axial skeleton. The girdles are considered to be part of the axial skeleton. a. Both statements are true. b. Both statements are false. ...
Date Added: 2009-01-09 04:14:07

final 08S.pdf
Path: Auburn >> MECH >> 3200 Fall, 2008
Description: MECH 3200 08S Final Examination NAME_ 150 minutes, 10 questions, 100 points, weighted as marked. Closed book. Closed notes, except for both sides of one 8 11 in. page. Read each problem very carefully. There are many scoring opportunities ...
Date Added: 2009-01-09 18:27:20

ChinaPros.pdf
Path: NYU >> B >> 40 Fall, 2008
Description: Supplement to Fidelitys Targeted International Equity FundsR December 30, 2002 Prospectus On February 20, 2003, the Board of Trustees of Fidelity Canada Fund, Fidelity China Region Fund, Fidelity Emerging Markets Fund, Fidelity Japan Fund, Fidelity J...
Date Added: 2009-02-17 17:36:02

ChinaPros.pdf
Path: QMUL >> B >> 40 Fall, 2008
Description: Supplement to Fidelitys Targeted International Equity FundsR December 30, 2002 Prospectus On February 20, 2003, the Board of Trustees of Fidelity Canada Fund, Fidelity China Region Fund, Fidelity Emerging Markets Fund, Fidelity Japan Fund, Fidelity J...
Date Added: 2009-02-17 17:36:02

050518resurg.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: Japanese economy shows surprising resurgence: printer friendly version Japanese economy shows surprising resurgence By Todd Zaun The New York Times WEDNESDAY, MAY 18, 2005 TOKYO Japan announced first quarter of 2005 recovered from a mild long overdue...
Date Added: 2009-02-11 17:49:38

catalog_p98.pdf
Path: Trinity Valley Community College >> EMSP >> 1355 Fall, 2008
Description: SOPHOMORE YEAR First Semester Sem. Hrs. LGLA 2307 Law Office Management . . . . . . . . . 3 POFT 2312 Business Correspondence and Communication . . . . . . . . . . . . . . . . . . . . . . . . 3 LGLA 2303 Torts and Personal Injury . . . . . . . . . 3 ...
Date Added: 2009-01-12 04:54:17

catalog_p98.pdf
Path: Trinity Valley Community College >> HIST >> 2327 Fall, 2008
Description: SOPHOMORE YEAR First Semester Sem. Hrs. LGLA 2307 Law Office Management . . . . . . . . . 3 POFT 2312 Business Correspondence and Communication . . . . . . . . . . . . . . . . . . . . . . . . 3 LGLA 2303 Torts and Personal Injury . . . . . . . . . 3 ...
Date Added: 2009-01-12 04:54:17

catalog_p98.pdf
Path: Trinity Valley Community College >> ARTS >> 2327 Fall, 2008
Description: SOPHOMORE YEAR First Semester Sem. Hrs. LGLA 2307 Law Office Management . . . . . . . . . 3 POFT 2312 Business Correspondence and Communication . . . . . . . . . . . . . . . . . . . . . . . . 3 LGLA 2303 Torts and Personal Injury . . . . . . . . . 3 ...
Date Added: 2009-01-12 04:54:17

catalog_p98.pdf
Path: Trinity Valley Community College >> DEVL >> 0305 Fall, 2008
Description: SOPHOMORE YEAR First Semester Sem. Hrs. LGLA 2307 Law Office Management . . . . . . . . . 3 POFT 2312 Business Correspondence and Communication . . . . . . . . . . . . . . . . . . . . . . . . 3 LGLA 2303 Torts and Personal Injury . . . . . . . . . 3 ...
Date Added: 2009-01-12 04:54:17

catalog_p98.pdf
Path: Trinity Valley Community College >> PSYC >> 1300 Fall, 2008
Description: SOPHOMORE YEAR First Semester Sem. Hrs. LGLA 2307 Law Office Management . . . . . . . . . 3 POFT 2312 Business Correspondence and Communication . . . . . . . . . . . . . . . . . . . . . . . . 3 LGLA 2303 Torts and Personal Injury . . . . . . . . . 3 ...
Date Added: 2009-01-12 04:54:17

catalog_p98.pdf
Path: Trinity Valley Community College >> PSYC >> 2308 Fall, 2008
Description: SOPHOMORE YEAR First Semester Sem. Hrs. LGLA 2307 Law Office Management . . . . . . . . . 3 POFT 2312 Business Correspondence and Communication . . . . . . . . . . . . . . . . . . . . . . . . 3 LGLA 2303 Torts and Personal Injury . . . . . . . . . 3 ...
Date Added: 2009-01-12 04:54:17

040819report.txt
Path: Chester >> ECO >> 338 Fall, 2008
Description: FT.com / World / International economy - Sweatshop report identifies problems in 20 countries Thursday Aug 19 2004 . All times are London time. Roger Bove Edit Profile Take a Tour Log out HomeWorldUSUKEuropeAsia-PacificMiddle East & AfricaAmericas...
Date Added: 2009-02-11 18:16:28

Why Internet Companies Generate Tax Issues.pdf
Path: San Jose State >> BUS >> 223f Spring, 2008
Description: Why Internet Companies Generate Tax Issues By Annette Nellen, CPA, Esq. San Jos State University January 2001 E-commerce represents a new business model. As such, it creates some challenges to tax systems that were designed with a different model in ...
Date Added: 2009-01-09 10:22:16

Why Internet Companies Generate Tax Issues.pdf
Path: San Jose State >> BUS >> 225j Spring, 2008
Description: Why Internet Companies Generate Tax Issues By Annette Nellen, CPA, Esq. San Jos State University January 2001 E-commerce represents a new business model. As such, it creates some challenges to tax systems that were designed with a different model in ...
Date Added: 2009-01-11 18:09:21

sc2_ana_s210_002.pdf
Path: Hawaii >> SC >> 002 Fall, 2008
Description: Doc No: Vers: Category: Doc Type: State: Author: Date: SC2/ANA/S210/002 1.7 Report A LTEX Released Alexander van Engelen 2005/05/21 Analysis of Atmospheric Emission using SHARC-II Data and Implications for the SCUBA-2 Simulator 1 Introduction In t...
Date Added: 2009-02-17 19:18:07

sc2_ana_s210_002.pdf
Path: Hawaii >> SC >> 2 Fall, 2001
Description: Doc No: Vers: Category: Doc Type: State: Author: Date: SC2/ANA/S210/002 1.7 Report A LTEX Released Alexander van Engelen 2005/05/21 Analysis of Atmospheric Emission using SHARC-II Data and Implications for the SCUBA-2 Simulator 1 Introduction In t...
Date Added: 2009-02-17 19:18:07

exam-credit.pdf
Path: Concordia Chicago >> PDF >> 09 Fall, 2009
Description: Examination Credit and Transfer Credit In order to earn a degree from the College of the University of Chicago, a student must obtain credit for at least forty-two quarter courses, distributed among general education requirements, major program requi...
Date Added: 2009-04-15 22:00:00

070117EU.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: China and EU begin renegotiating commercial relations treaty - Print Version International Herald Tribune China and EU begin renegotiating commercial relations treaty The Associated Press Wednesday, January 17, 2007 BEIJING The European Union and Chi...
Date Added: 2009-02-11 17:35:29

emotdesign.ppt
Path: St. Lawrence >> MFC >> 2007 Fall, 2009
Description: Emotional Design and Your Next Syllabus: A Discussion of Emotional Design: Why We Love (or Hate) Everyday Things by Donald Norman Facilitator: Paul Doty, Electronic Services Librarian St. Lawrence University May Faculty College May 23rd, 2007 Assum...
Date Added: 2009-04-15 23:39:55

PHYS R102 CS.doc
Path: Oxnard College >> PHYS >> R102 Spring, 2008
Description: COURSE OUTLINE COVER SHEET OXNARD COLLEGE 1. COURSE IDENTIFICATION & CHANGE INFORMATION COURSE ID: APPENDICES: CO-LISTED AS: FULL TITLE: PHYS R102 / REV X / SUSP / REIN / DEL / / PREREQ-COREQ-ADVIS X / DISTANCE ED None College Physics 2 CHANGE TYPE: ...
Date Added: 2009-02-02 15:19:44

2382.137.ps
Path: Hawaii >> SOEST >> 2382 Fall, 2008
Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207378646.0388276 Float: 2382 Profile: 137 Location: 31.5N 152.7E Date: 04/28...
Date Added: 2009-02-17 20:18:56

checklistcultural.pdf
Path: Kenyon >> X >> 25094 Fall, 2008
Description: International Studies Major Cultural Studies Track Course Checklist Sophomore course (INST 201) Core Cultural Studies Track courses (8 courses) Choose one of the following themes within the track: 1. Religious and Cultural Studies Introductory Uppe...
Date Added: 2009-02-18 00:08:40

SolidPropulsionGO.pdf
Path: Harvey Mudd College >> ENG >> 80 Fall, 2008
Description: ESTIMATION AND ANALYSIS OF QUASI-1D SOLID ROCKET MOTOR Graham Orr, Harvey Mudd College, FEB 2008r4 INCLUDED TOPICS: 1. THERMODYNAMICS 2. CHEMICAL KINETICS 3. THRUST ANALYSIS 4. IMPULSE ANALYSIS 1. THERMODYNAMICS Thermodynamic entropy is defined as (i...
Date Added: 2009-02-06 18:54:55

Indivisible Labor and the Business Cycle.pdf
Path: UC Davis >> ECN >> 200e Fall, 2008
Description: ...
Date Added: 2009-01-11 20:23:22

030120FDI1.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: Prague Business Journal - Article Last updated: 23rd Jan 2003, 8:59 Banking Politics Industry Telecom Communications Real Estate Agriculture Law & Order Social Services Business Life Lifestyle This week\'s PBJ E...
Date Added: 2009-02-11 19:50:14

USC_Myth_Paper_Assignment_3_Fall_2005
Path: USC >> CLAS >> 280g Fall, 2005
Description: Introduction to Classical Mythology CLAS 280g, Fall 2005 ESSAY 3: 5-6 full pages, due on or before the beginning of class, November 18. TOPIC: Adopt A Myth! This paper is an opportunity for you to research one particular god, hero, monster, or other ...
Date Added: 2008-05-07 16:49:31

08-control
Path: Michigan State University >> CSE >> 452 Fall, 2005
Description: CSE 452: Programming Languages Control Flow Outline Control Structures Selection Statements Iterative Statements Unconditional Branches Subprograms and Procedures Organization of Programming Languages-Cheng 2 1 Iterative Statements Repe...
Date Added: 2008-07-25 15:08:22

581.pdf
Path: University of Illinois, Urbana Champaign >> CEE >> 581 Fall, 2008
Description: Course Schedule - Fall 2008 Civil and Environmental Engineering 581 Earth Dams credit: 4 hours. Fundamentals of problems of slope stability; seepage in composite sections and anisotropic materials; methods of stability analysis; mechanism of failure ...
Date Added: 2009-02-02 18:24:05

agenda3.pdf
Path: Shepherd >> BOGWEB >> 08 Fall, 2008
Description: Shepherd University Board of Governors April 10, 2008 Agenda Item No. 3 REVISED MEETING SCHEDULE FOR 2007-2008 The following list of dates reflects the remaining Board of Governors meetings for the 2007-2008 academic year. May 7, 2008 June 12, 2008...
Date Added: 2009-02-17 23:01:29

cfpl.log.txt
Path: UPenn >> OPIM >> 910 Fall, 2007
Description: GAMS Rev 136 Copyright (C) 1987-2003 GAMS Development. All rights reserved Licensee: Monique Guignard G031030:1031AB-HP7 University of Pennsylvania, The Wharton School DC1954 - Starting compilation...
Date Added: 2009-04-15 21:01:02

challenge_solutions_problem_set_8
Path: Cornell >> CHEM >> 3590 Fall, 2007
Description: Chem 359 Problem Set 8 Chapter 8: Organic Chemistry: A Biological Approach Key Ideas: 1. Huckel Rule 2. Electrophilic aromatic substitution 3. Aromatic directing groups Suggested Problems: 8.1-8.22, 8.29, 8.32, 8.33, 8.34, 8.37, 8.40, 8.42, 8.43, 8.4...
Date Added: 2008-09-19 15:34:30

1078.pdf
Path: Minnesota >> IMA >> 1992 Fall, 2008
Description: ...
Date Added: 2009-02-17 21:15:12

Final Exam 2007
Path: Virginia Tech >> BCHM >> 2024 Spring, 2008
Description: Name _ Student # _ BCHM 2024 Final Examination May, 2007 Use the following amino acids to answer questions 1 through 5. Note that none of these amino acids is shown in the correct charge form at pH 7. O H2N CH CH2 CH2 H2N CH CH2 OH NH C NH2 O O H2N...
Date Added: 2008-05-06 16:37:06

pettycashpolicy.pdf
Path: Hartwick >> X >> 12992 Fall, 2008
Description: ...
Date Added: 2009-02-11 21:34:09

ps08soln
Path: Cornell >> PHYS >> 651 Fall, 2003
Description: PHYS651: Problem Set 8 Solutions 1. In this problem set, I use the notation xP = (x0 , x) and xT = (x0 , x). (a) The complex KG elds are (x) = (x) = d3 p (2)3 d3 p (2)3 1 ap eipx + b eipx p Ep 1 bp eipx + a eipx p Ep Under parity we have that U (P ...
Date Added: 2008-09-28 14:54:29

152
Path: Ohio State >> KOR >> 251 Winter, 2008
Description: ...
Date Added: 2008-04-22 22:34:49

060227textile.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: seeurope.net : View StorySEEUROPE Google HOMENEWS TODAYNEWSLETTERABOUT USCONTACTSAD INFOTOP 100 INVESTMENT GUIDE COUNTRY RATINGS EVENTS CALENDAR SEE COUNTRIES SEE HOLIDAYS USEFUL LINKS DISCUSSION BOARD SIGHT SEEING TURKEY: Textile Crisis Begins to...
Date Added: 2009-02-11 19:36:56

060227textile.txt
Path: Chester >> ECO >> 338 Fall, 2008
Description: seeurope.net : View StorySEEUROPE Google HOMENEWS TODAYNEWSLETTERABOUT USCONTACTSAD INFOTOP 100 INVESTMENT GUIDE COUNTRY RATINGS EVENTS CALENDAR SEE COUNTRIES SEE HOLIDAYS USEFUL LINKS DISCUSSION BOARD SIGHT SEEING TURKEY: Textile Crisis Begins to...
Date Added: 2009-02-11 20:31:18

FinalCHEE3334Fall1999Solutions
Path: U. Houston >> CHEE >> 3334 Fall, 2006
Description: CHEE 3334 Fall \'99 FINAL EXAM Michael Nikolaou Open-book, open-notes. Total points 100. Please, budget your time! Do NOT try to read the textbook during the exam! Write neatly! Do NOT use your programmable calculator to find results you are asked ...
Date Added: 2008-04-15 16:53:06

Chapter 3 Notes
Path: Iowa State >> CHEM >> 177 Spring, 2008
Description: Chemical equations Reactants and products Equations must be balanced Aqueous, liquid, solid, gas Some Simple Patterns of Chemical reactivity Combination and decomposition reactions Combustion reactions Hydrocarbons react with oxygen to form carbon d...
Date Added: 2008-03-27 05:39:55

tshippop2.pdf
Path: Ohio State >> AEDE >> 2 Fall, 2008
Description: Townships by Population Size: 2000 Legend Small: 0 to 1,249 People Medium: 1,250 to 2,499 People Large: 2,500 to 4,999 N Largest: 5,000 or more W E Cities & Villages 10 S ...
Date Added: 2009-02-17 22:35:34

predhealth18projects.pdf
Path: Emory >> PREDICTIVE >> 18 Fall, 2008
Description: T h e e m o ry / G e o r G i a T e c h P r e d i c T i v e h e a lT h i n i T i aT i v e Evaluation of PatiEnt CharaCtEristiCs as PrEdiCtors of aCutE trEatmEnt toxiCity Andre Rogatko, PhD, Biostatistics, Rollins School of Public Health, Winship Canc...
Date Added: 2009-02-06 20:01:54

predhealth18projects.pdf
Path: Emory >> PHI >> 18 Fall, 2008
Description: T h e e m o ry / G e o r G i a T e c h P r e d i c T i v e h e a lT h i n i T i aT i v e Evaluation of PatiEnt CharaCtEristiCs as PrEdiCtors of aCutE trEatmEnt toxiCity Andre Rogatko, PhD, Biostatistics, Rollins School of Public Health, Winship Canc...
Date Added: 2009-02-06 20:01:56

hw 09.doc
Path: Wisc Green Bay >> COMP SCI >> 242 Fall, 2008
Description: COMP SCI 242 Discrete Mathematics II F. Baulieu Homework #9. NAME Due Friday 27 February Once again, we return to the digraph for the maze in homework #3. Spring 2004 This digraph has no spanning tree rooted at Aa since Bf cannot be reached. S...
Date Added: 2009-02-02 20:40:57

assignment2.pdf
Path: Iowa State >> C E >> 203 Fall, 2008
Description: CE 203 Civil Engineering Synthesis I Spring 2006 Assignment 2 Due February 1 Instructions: As usual, remember that only one person records the homework. Either send an electronic version of your solutions to this assignment as an attachment to an ema...
Date Added: 2009-01-09 02:08:37

MolCell06.pdf
Path: UPenn >> MED >> 06 Fall, 2008
Description: Molecular Cell 23, 425438, August 4, 2006 2006 Elsevier Inc. DOI 10.1016/j.molcel.2006.05.042 Destruction or Potentiation of Different Prions Catalyzed by Similar Hsp104 Remodeling Activities James Shorter1 and Susan Lindquist1,* 1 Whitehead Instit...
Date Added: 2009-02-06 17:45:27

co131.txt
Path: Lehigh >> DMD >> 1 Fall, 2008
Description: Subject: question for the group From: ogle@math.ohio-state.edu Date: Sat, 29 Jan 2005 09:37:40 -0500 (EST) To: dmd1@lehigh.edu Call a cellular n-complex K resolvable if there is a collapsible n-complex X and a surjective cellular map r:X -> K with co...
Date Added: 2009-02-17 23:15:02

herbspice.ppt
Path: Iowa State >> EEOB >> 569 Fall, 2008
Description: Herbs and Spices Robert S. Wallace Dept. of Ecology, Evolution and Organismal Biology Iowa State University Herbs versus Spices There are several differences in definitions of herbs versus spices. Some suggestion that herbs come from the herb...
Date Added: 2009-01-10 17:53:08

Ex2.pdf
Path: Berkeley >> STAT >> 204 Fall, 2008
Description: Statistics 205 Prof. S. Evans Homework 2. Due: Friday, Sept. 12 Note: As in class, random vectors will always be thought of as column vectors. 1. Recall that a random variable has the gamma(, ) distribution if it has the density f (x) = 1 x1 ex/ () ...
Date Added: 2009-01-11 20:21:24

AbortionQuagmire
Path: NMSU >> RELIGION >> 101 Spring, 2008
Description: Jesus spoke to a woman caught in the act of adultery: \"Neither do I condemn you; go and sin no more\" (John 8:11). God forgives, but He expects us to stop sinning. One last case A man and wife who thought they could never have children sat anxiously ...
Date Added: 2008-05-07 11:36:23

106L08_notes
Path: UC Riverside >> CBNS >> 106 Winter, 2008
Description: Introduction to Neuroscience Lecture 8: The Somatic Sensory System Reading Assignment: Sensation and Perception The function of each sensory system is to provide the CNS with a representation of the external world Bear et al., Ch. 12 CBNS 106...
Date Added: 2008-04-15 11:50:06

Chapter 5 Soc Study guide
Path: Penn State >> SOC >> 001 Fall, 2007
Description: [Type text] Page 1 Study Guide Ch 5 1. What are groups? What is the largest one? Group: people who have something in common and who believe that what they have in common is significant; also called a social group. Groups are the essence of life in ...
Date Added: 2008-03-18 09:43:02

amst_IDs1
Path: USC >> AMST >> 301g Spring, 2008
Description: Restrictive covenants Restrictive covenants are meant to keep certain races in certain areas, separated from each other. A policy was written into the deed of a house before being sold stating that it can\'t be sold to certain races. Ex. Palos Verdes....
Date Added: 2008-04-07 00:10:15

HolocaustReview
Path: UVA >> HIUS >> 342 Spring, 2008
Description: Review Summary Member: David Abrams Location: Maryland Reviews written: 611 Trusted by: 1338 members About the Author Must-Cry TV Jun 15 \'02 (Updated Jun 15 \'02) Pros A rare instance of television jolting the potatoes off the couch, it\'s shocking ...
Date Added: 2008-04-07 13:19:18

Syllabus.doc
Path: SIU Edwardsville >> IME >> 458 Fall, 2008
Description: Syllabus IME 458 (Fall 2008) Instructor: Jacob Van Roekel e-mail: van_roekel@sbcglobal.net Phone: 618-980-9037 Sept 2 Sept 9 Sept 16 Sept 23 Sept 30 Oct 7 Oct 14 Oct 21 Oct 28 Nov 4 Nov 11 Nov 18 Nov 25 Dec 2 Dec 9 Dec 16 Chapter 3 Chapter 4 Chapter ...
Date Added: 2009-01-09 07:11:54

Syllabus.doc
Path: SIU Edwardsville >> IME >> 477 Spring, 2008
Description: Syllabus IME 458 (Fall 2008) Instructor: Jacob Van Roekel e-mail: van_roekel@sbcglobal.net Phone: 618-980-9037 Sept 2 Sept 9 Sept 16 Sept 23 Sept 30 Oct 7 Oct 14 Oct 21 Oct 28 Nov 4 Nov 11 Nov 18 Nov 25 Dec 2 Dec 9 Dec 16 Chapter 3 Chapter 4 Chapter ...
Date Added: 2009-01-09 07:11:54

hw6.pdf
Path: St. Mary's CA >> MATH >> 160 Fall, 2009
Description: Math 160: History of Mathematics Assignment 6 Due Wed Apr 13 Your solutions should be written so-as to be clear to an audience of fellow math 160 students. Use the Diophantine method of adequating to find two non-negative rational numbers summing to ...
Date Added: 2009-04-15 23:38:14

Test 1 Review
Path: Baylor >> PSC >> 2302 Spring, 2008
Description: Chapter 1 Constitution [5] a framework for providing basic principles of organization and operation Constitutionalism [5] Rule of the law [6] The manner in which the constitution accomplishes its role as an organizational framework and national sy...
Date Added: 2008-04-30 11:18:24

VisualLiteracy.ppt
Path: Purdue >> ENGL >> 505b Spring, 2008
Description: Visual Literacy and Document Design in Our Culture By Allen Brizee Ph.D. Student, Rhetoric and Composition Purdue University 1 Visual Literacy and Doc Design in Our Culture Introduction 3. What is visual literacy/visual thinking/visual rhetoric? 5....
Date Added: 2009-01-09 20:45:33

VisualLiteracy.ppt
Path: Purdue >> ENGL >> 505m Fall, 2008
Description: Visual Literacy and Document Design in Our Culture By Allen Brizee Ph.D. Student, Rhetoric and Composition Purdue University 1 Visual Literacy and Doc Design in Our Culture Introduction 3. What is visual literacy/visual thinking/visual rhetoric? 5....
Date Added: 2009-01-09 20:45:33

VisualLiteracy.ppt
Path: Purdue >> ENGL >> 680a Fall, 2008
Description: Visual Literacy and Document Design in Our Culture By Allen Brizee Ph.D. Student, Rhetoric and Composition Purdue University 1 Visual Literacy and Doc Design in Our Culture Introduction 3. What is visual literacy/visual thinking/visual rhetoric? 5....
Date Added: 2009-01-09 20:45:33

VisualLiteracy.ppt
Path: Purdue >> ENGL >> 680t Fall, 2008
Description: Visual Literacy and Document Design in Our Culture By Allen Brizee Ph.D. Student, Rhetoric and Composition Purdue University 1 Visual Literacy and Doc Design in Our Culture Introduction 3. What is visual literacy/visual thinking/visual rhetoric? 5....
Date Added: 2009-01-09 20:45:33

orientation.ppt
Path: UPenn >> CIT >> 591 Fall, 2009
Description: Welcome to the Computer and Information Technology program http:/www.cis.upenn.edu/~matuszek Who am I? David Matuszek (muh-TOOZ-ik) I prefer Dave, or maybe Dr. Dave Im the director of the MCIT program Im here to teach, not to do research Im ne...
Date Added: 2009-04-15 21:00:30

UGprereq0506.pdf
Path: Arizona >> C SC >> 577 Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:38

UGprereq0506.pdf
Path: Arizona >> C SC >> 652 Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:38

UGprereq0506.pdf
Path: Arizona >> C SC >> 296h Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:37

UGprereq0506.pdf
Path: Arizona >> C SC >> 695a Spring, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:38

UGprereq0506.pdf
Path: Arizona >> C SC >> 437 Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:38

UGprereq0506.pdf
Path: Arizona >> CS >> 0506 Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-02-06 20:25:50

UGprereq0506.pdf
Path: Arizona >> C SC >> 496h Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:38

UGprereq0506.pdf
Path: Arizona >> C SC >> 536 Fall, 2008
Description: Undergraduate Course Prerequisite Graph 127A F,S Intro. CS Department of Computer Science The University of Arizona 4 4 4 Prior Programming Experience: No? Yes? Legend: 127B F,S F,S Prog. Dev. & Design Intro. CS 100 3 F,S Credits Course Numbe...
Date Added: 2009-01-09 15:51:38

q2solns
Path: Princeton >> MAT >> 104 Spring, 2008
Description: Mathematics 104 Quiz 2, Friday, Feb 22, 2008 1. Find dx . (x + 2)(x2 + 1) A Bx + C 1 = + 2 Ax2 + A + Bx2 + 2Bx + Cx + 2C = 1 + 0x + 0x2 . 2 + 1) (x + 2)(x x+2 x +1 This gives the system A + B = 0, 2B + C = 0 and A + 2C = 1 which we solve to find A ...
Date Added: 2008-04-07 13:19:56

s-314.Vul.Bluetooth.txt
Path: Purdue >> COM >> 314 Spring, 2008
Description: _ The U.S. Department of Energy Computer Incident Advisory Capability _ _ _ _ _ / | /_\\ / \\_ _|_ / \\ \\_ _ INFORMATION BULLETIN Vulnerability in Bluetooth Stack [Microsoft Security Bulletin (MS08-030)] June 12, 2008 14:00 GMT Number S-314 [REVISED 27 ...
Date Added: 2009-02-02 15:46:59

timothyludwig.pdf
Path: St. Cloud >> CPSY >> 433 Fall, 2008
Description: JOURNAL. OF APPLIED BEHA\\lOR ANALYSIS 1998,31,683-686 NUMBER 4 ( W I N T E R 1998) INCREASING RECYCLING IN ACADEMIC BUILDINGS: A SYSTEMATIC REPLICATION TIMOTHY D. LUDWIG, TIMOTHY W. GRAY, APPALACHIAS AND ALLISON ROWELI STATE USIVERSIl3 We p...
Date Added: 2009-02-02 15:56:07

1735.238.ps
Path: Hawaii >> SOEST >> 1735 Fall, 2008
Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207371730.0388276 Float: 1735 Profile: 238 Location: 31.8N 141.6E Date: 09/17...
Date Added: 2009-02-17 20:20:41

MTH0120f019A_sample.pdf
Path: CUNY Baruch >> MTH >> 2003 Fall, 2008
Description: ...
Date Added: 2009-01-11 20:34:04

S08.hw04
Path: Cornell >> ECE >> 3200 Spring, 2008
Description: ECE 320 Networks and Systems Spring 20072008 Problem Set 4 Due March 3, 2008 1. This problem considers source encoding for a source which generates 4 different symbols. (a) The 4 symbols and their probabilities are shown in the following table. si e ...
Date Added: 2008-03-10 12:18:05

final_wi08_ans
Path: Seattle >> FINC >> 340 Spring, 2008
Description: Final Exam Finance 340 Winter 2008 Name: Exam Instructions: This exam has 9 pages (including this one), plus a blank, last page. Multiple-choice questions total 10, and are worth 2 points each. There are 8 shortanswer and problem-solving questions, s...
Date Added: 2008-04-11 15:24:52

Lab5.pdf
Path: Maryland >> BSCI >> 338 Fall, 2008
Description: Name MAMMALOGY LAB 5 REPRODUCTION Todays exercise focuses on the reproductive structures and diversity of mammals. Examine the slides, specimens, and diagrams carefully and answer the questions completely. Males 1) Observe the slides of the boar (pi...
Date Added: 2009-02-18 00:25:04

Campbell.pdf
Path: BYU >> BEFOREFORE >> 8 Fall, 2008
Description: Publications v Ensign Articles v Wedding Preparation Cutting the CostsAlong with the Cake Carolyn Campbell Holly and Steve are engaged! This is an exciting time, with many decisions to make. Because she and Steve plan to be married in the temple wit...
Date Added: 2009-02-11 21:31:57

hw2.pdf
Path: Richmond >> CMSC >> 222 Fall, 2009
Description: CMSC 222: Fall 2008 Homework 2 Beyond this assignment, homework problems will be assigned simply by referencing problems from Rosen\'s fifth-edition text. By the next assignment, you should have obtained your used copy of the text. 1. Express each o...
Date Added: 2009-04-15 23:37:02

exam2-sol
Path: Texas >> ECO >> 304K Spring, 2007
Description: Economics 304K EXAM II Helen Schneider Spring 2007 SOLUTIONS Part I. Multiple Choice. Do the following 15 multiple choice questions: Read each question carefully and CIRCLE the best answer. THERE IS ONLY ONE ANSWER TO EACH QUESTION. It often helps ...
Date Added: 2008-05-01 18:47:10

Week08_SDLCAlternatives.ppt
Path: SIU Edwardsville >> CMIS >> 470 Summer, 2008
Description: CMIS 470 Structured Systems Design RAD, JAD, Extreme Programming, Developmental Prototyping, Spiral Approach Our Plan This week: Alternative methods RAD, Extreme Programming, Developmental prototyping, Spiral Approach Alternative Development ...
Date Added: 2009-01-09 07:11:31

Leader_as_Ethical_Decision_Maker
Path: USC >> ARLT >> 100g Fall, 2007
Description: Leader as Ethical Decision Maker Where Do You Stand? What does \"ethics\" mean to you? Does ethical behavior in business add value? What is ethics? Ethkos a disposition to behave in a certain way to lead a particular kind of life Business Ethi...
Date Added: 2008-03-05 10:38:35

Leader_as_Ethical_Decision_Maker
Path: USC >> BUAD >> 304 Spring, 2007
Description: Leader as Ethical Decision Maker Where Do You Stand? What does \"ethics\" mean to you? Does ethical behavior in business add value? What is ethics? Ethkos a disposition to behave in a certain way to lead a particular kind of life Business Ethi...
Date Added: 2008-09-07 10:18:04

PSYCH 115 - W08 WK7 Tue Lec Notes 02-19
Path: UCLA >> PSYCH >> 115 Winter, 2008
Description: [PSYCH 115, WK:7, T., Lecture, 2/21/08] ...
Date Added: 2008-03-06 11:14:39

living_primates[1]
Path: Michigan >> ANTHROBIO >> 161 Spring, 2008
Description: Our Place in Nature: The living primates I. Why study primates A. Primates are our closest living relations B. Primates provide comparative behavioral data II. What is a primate? III. Primate biogeography IV. Who are the primates? A Taxonomy B. Prosi...
Date Added: 2008-04-03 07:04:57

Photo 42 Assignment 2.pdf
Path: Santa Monica >> PHOTO >> 9 Fall, 2008
Description: Photo 42 Assignment 2 (I Love LA) Grade Weight Factor 2 Objective You will create a composite image of every tourists dream the perfect Los Angeles. On closer inspection your viewers will note that you have included three widely separated LA landma...
Date Added: 2009-01-10 17:43:41

Photo 42 Assignment 2.pdf
Path: Santa Monica >> PHOTO >> 42 Fall, 2008
Description: Photo 42 Assignment 2 (I Love LA) Grade Weight Factor 2 Objective You will create a composite image of every tourists dream the perfect Los Angeles. On closer inspection your viewers will note that you have included three widely separated LA landma...
Date Added: 2009-02-02 16:09:07

8.pdf
Path: Arizona >> RESRPT >> 2002 Fall, 2009
Description: Cracking the Code in Maize Gene studies offer tools for plant improvement By Susan McGinley V icki Chandler has spent 17 years study ing the mechanisms that turn genes on and off in maize, especially those that control color expression in the kerne...
Date Added: 2009-04-15 23:07:20

BT 28 Course Outline FA09.doc
Path: Fresno City College >> BT >> 28 Spring, 2008
Description: FRESNO CITY COLLEGE COURSE OUTLINE OF RECORD Course Subject and Number Business & Technology 28 Discipline(s) Business Education/Office Technologies Course Title Microsoft Word I Term Effective Fall 2009 (Formerly Business Information Processing 2...
Date Added: 2009-02-02 14:17:11

litsurvey.pdf
Path: Caribbean >> ECE >> 382 Spring, 1997
Description: Time Triggered Protocol (TTP/C): A Safety-Critical System Protocol Howard Curtis and Robert France EE382C Literature Survey (October 24, 1999) * Abstract This paper examines the Time Triggered Protocol (TTP), for the support of distributed real-time...
Date Added: 2009-03-19 00:18:37

Sibrian-Vazquez_dis.pdf
Path: LSU >> ETD >> 1104103 Fall, 2008
Description: DESIGN, SYNTHESIS, AND APPLICATIONS OF BIO-DERIVED CROSSLINKING MONOMERS FOR MOLECULAR IMPRINTING A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of th...
Date Added: 2009-02-17 17:32:02

syllabus-BMGT-833-Ball-Chen-Spring07.doc
Path: Maryland >> BMGT >> 833 Fall, 2008
Description: BMGT 833 INTEGER PROGRAMMING Spring, 2007 VMH 2509; Wednesday 2:30 5:10PM Instructors: Prof. Michael Ball, mball@rhsmith.umd.edu, 301-405-2227, VMH 4471 Prof. Zhi-Long Chen, zchen@rhsmith.umd.edu, 301-213-0591, VMH 4317 Office hours: Ball & Chen, We...
Date Added: 2009-02-03 13:56:52

lecture11_042207
Path: Cornell >> CHEM >> 2080 Spring, 2007
Description: Entropy More states with larger volume, Free energy and Spontaneity A chemical engineer wants to determine the feasibility of making ethanol (CH3CH2OH) by reacting water with ethylene (C2H4) according to the equation C2H4(g) + H2O(l) CH3CH2OH(l) a...
Date Added: 2008-05-18 16:35:18

453.pdf
Path: University of Illinois, Urbana Champaign >> LA >> 453 Spring, 2008
Description: ...
Date Added: 2009-02-02 18:10:03

550.pdf
Path: Cal Poly >> MATH >> 550 Fall, 2008
Description: MATH 550 Real Analysis 1. Catalog Description MATH 550 Real Analysis (4) September 2008 Introduction to Lebesgue measure and integration, convergence theorems, L1 spaces, Radon-Nikodym Theorem and Fubinis Theorem. 4 seminars. Prerequisite: Satisfac...
Date Added: 2009-02-02 13:47:18

Comorbidity and Vitimization.pdf
Path: Kentucky >> STA >> 702 Fall, 2008
Description: General Considerations about Substance Misuse and Family Violence Theodore M. Godlaski College of Social Work University of Kentucky General Considerations about Substance Misuse and Family Violence In reviewing the data about the coincidence of s...
Date Added: 2009-02-03 13:54:15

gh5983.pdf
Path: Missouri (Mizzou) >> GH >> 5983 Fall, 2008
Description: Information from Human Environmental Sciences Extension Housing Energy Management Checklist for the Home Atiya Mahmood and Ronald Phillips, Extension State Specialists and Becky Snyder, Extension Research Assistant ment will allow you to p...
Date Added: 2009-02-17 22:47:59

LAB_9.pdf
Path: Ferris State >> SURE >> 215 Spring, 2008
Description: FERRIS STATE UNIVERSITY SURVEYING ENGINEERING SURE 339 - REMOTE SENSING LAB #9 PURPOSE: SPRING 2006/07 The purpose of this lab is to acquaint the student to radar imagery and the IMAGINE Radar Interpreter PROCEDURE: 1. Complete the tutorial that i...
Date Added: 2009-01-10 03:01:00

LAB_9.pdf
Path: Ferris State >> SURE >> 340 Fall, 2008
Description: FERRIS STATE UNIVERSITY SURVEYING ENGINEERING SURE 339 - REMOTE SENSING LAB #9 PURPOSE: SPRING 2006/07 The purpose of this lab is to acquaint the student to radar imagery and the IMAGINE Radar Interpreter PROCEDURE: 1. Complete the tutorial that i...
Date Added: 2009-01-10 03:01:15

kine1127.doc
Path: St. Philips College >> KINE >> 1106 Fall, 2008
Description: ST. PHILIPS COLLEGE 1801 MARTIN LUTHER KING, SAN ANTONIO, TX 78203 KINESIOLOGY DEPARTMENT/210-531-3470 Instructor Addendum to Course Syllabus COURSE NUMBER AND TITLE: SEMESTER AND YEAR INSTRUCTORS NAME: 1127 Advanced Cardiokickboxing SPRING 2009 Greg...
Date Added: 2009-01-09 15:29:13

kine1127.doc
Path: St. Philips College >> KINE >> 1155 Fall, 2008
Description: ST. PHILIPS COLLEGE 1801 MARTIN LUTHER KING, SAN ANTONIO, TX 78203 KINESIOLOGY DEPARTMENT/210-531-3470 Instructor Addendum to Course Syllabus COURSE NUMBER AND TITLE: SEMESTER AND YEAR INSTRUCTORS NAME: 1127 Advanced Cardiokickboxing SPRING 2009 Greg...
Date Added: 2009-01-09 15:29:13

Problem Set 5
Path: Cornell >> CHEM >> 2080 Spring, 2008
Description: ...
Date Added: 2008-04-16 12:08:14

q8sol.ps
Path: Minnesota >> MATH >> 8 Fall, 2003
Description: ...
Date Added: 2009-02-17 20:29:44

women_working-tudo.pdf
Path: BYU >> M B A >> 543 Winter, 2008
Description: ...
Date Added: 2009-01-09 15:10:23

women_working-tudo.pdf
Path: BYU >> P MGT >> 682 Fall, 2008
Description: ...
Date Added: 2009-01-09 15:10:23

women_working-tudo.pdf
Path: BYU >> P MGT >> 692r Fall, 2008
Description: ...
Date Added: 2009-01-09 15:10:23

women_working-tudo.pdf
Path: BYU >> M B A >> 501 Fall, 2008
Description: ...
Date Added: 2009-01-09 15:10:23

women_working-tudo.pdf
Path: BYU >> M B A >> 539 Fall, 2008
Description: ...
Date Added: 2009-01-09 15:10:23

lavy.pdf
Path: Princeton >> ERS >> 2002 Fall, 2008
Description: Paying for Performance: The Effect of Teachers Financial Incentives on Students Scholastic Outcomes Victor Lavy The Hebrew University of Jerusalem August 2002 Special thanks go to Alex Levkov for outstanding research assistance and for Josh Angr...
Date Added: 2009-02-11 21:04:05

1.31
Path: Berkeley >> PACS >> 119 Spring, 2008
Description: 1. Peace and Conflict Studies: Hague Law: Examples? \"Hague\" Law- Examples: Hague law is misleading as all laws were not made in Hague. It just titles this category of laws 1868 St. Petersburg Declaration, prohibiting explosive projectiles of less we...
Date Added: 2008-04-02 11:13:36

?method=getElement&element=~week5~MadduriMahanandaraju.ppt
Path: Old Dominion >> CS >> 791 Fall, 2008
Description: Impact of Search Engines on Page Popularity by Junghoo Cho and Sourashis Roy (2004) Presented by : Manoj Kumar Popularity Popularity Evolution - Experimental study - Theoretical study Interes...
Date Added: 2009-01-09 05:52:08

?method=getElement&element=~week5~MadduriMahanandaraju.ppt
Path: Old Dominion >> CS >> 891 Fall, 2008
Description: Impact of Search Engines on Page Popularity by Junghoo Cho and Sourashis Roy (2004) Presented by : Manoj Kumar Popularity Popularity Evolution - Experimental study - Theoretical study Interes...
Date Added: 2009-01-09 05:52:08

?method=getElement&element=~week5~MadduriMahanandaraju.ppt
Path: Old Dominion >> IS >> 802 Fall, 2008
Description: Impact of Search Engines on Page Popularity by Junghoo Cho and Sourashis Roy (2004) Presented by : Manoj Kumar Popularity Popularity Evolution - Experimental study - Theoretical study Interes...
Date Added: 2009-01-09 05:52:08

proposalf15587.pdf
Path: Florida >> ENC >> 4260 Fall, 2008
Description: Labor Market Data Needs Relating to Antidiscrimination Activity Executive Summary Although progress has been made over the last decade regarding trends in the labor market position of minorities and women, a great deal more [youve implied more progr...
Date Added: 2009-01-10 18:25:49

583.pdf
Path: University of Illinois, Urbana Champaign >> PHYS >> 583 Spring, 2008
Description: Course Schedule - Spring 2009 Physics 583 Advanced Field Theory credit: 4 hours. Quantization and Feynman path integral; gauge theories and renormalization; renormalization group with applications to particle physics and critical phenomena; approxima...
Date Added: 2009-02-02 18:29:01

2a-Overall Waste Management.pdf
Path: Michigan State University >> CE >> 485 Spring, 2008
Description: ...
Date Added: 2009-01-11 16:37:19

1003-001.ps
Path: UCLA >> MATH >> 1003 Fall, 2008
Description: The Bulletin of Symbolic Logic Volume 10, Number 3, Sept. 2004 FORCING IN PROOF THEORY JEREMY AVIGAD Abstract. Paul Cohens method of forcing, together with Saul Kripkes related semantics for modal and intuitionistic logic, has had profound eects on...
Date Added: 2009-02-06 17:56:58

Plato
Path: University of Toronto >> PHI >> 312F Summer, 1997
Description: ...
Date Added: 2008-06-12 15:06:29

hw9.pdf
Path: George Mason >> ECE >> 646 Fall, 2008
Description: ECE646 Cryptography and Computer Network-Security Fall 2006 HW # 9 Due Date: Tuesday, December 5th , 2006, 7:20 PM at the beginning of class Project track: You only have to solve the problems for all tracks. Please indicate that you are in the pro...
Date Added: 2009-04-16 01:28:38

050307clean.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: Latin America Leans Clean | csmonitor.com from the March 07, 2005 edition - http:/www.csmonitor.com/2005/0307/p08s01-comv.html Latin America Leans Clean Electing leftists isn\'t as critical as fighting corruption The...
Date Added: 2009-02-11 19:59:43

3-26-07
Path: Virginia Tech >> HIST >> 1025 Spring, 2007
Description: The Renaissance The Renaissance starts so much earlier in Italy than it starts in Europe. It takes almost a century for the ideas and actions to get to Europe. Renaissance re-naissance - \"rebirth\" Rebirth of ideals of classical civilization Humanism...
Date Added: 2008-03-30 18:42:40

ipm1013.pdf
Path: Missouri (Mizzou) >> OUTREACH >> 1013 Fall, 2008
Description: Safety INTEGRATED PEST MANAGEMENT MU Guide PUBLISHED BY MU EXTENSION, UNIVERSITY OF MISSOURI-COLUMBIA muextension.missouri.edu/xplor/ Pesticide Storage Fred Fishel Department of Agronomy The safe and proper storage of pesticide is a component of go...
Date Added: 2009-02-17 22:47:50

maint1.ps
Path: Rice >> ELEC >> 422 Fall, 1997
Description: Magic Maintainers Manual #1: Hints for System Maintainers John Ousterhout Walter Scott Computer Science Division Electrical Engineering and Computer Sciences University of California Berkeley, CA 94720 (Updated by others, too.) This tutorial corresp...
Date Added: 2009-02-06 20:11:41

callister7e_sm_ch02_09
Path: WPI >> ES >> 2001 Spring, 2008
Description: 2-9 The Periodic Table 2.9 Each of the elements in Group IIA has two s electrons. Excerpts from this work may be reproduced by instructors for distribution on a not-for-profit basis for testing or instructional purposes only to students enrolled in...
Date Added: 2009-01-17 17:52:28

Kollock 1998 - Social Dilemmas.pdf
Path: UCLA >> SOCIOL >> 102 Fall, 2008
Description: Annu. Rev. Sociol. 1998. 24:183214 Copyright 1998 by Annual Reviews. All rights reserved SOCIAL DILEMMAS: The Anatomy of Cooperation Peter Kollock Department of Sociology, University of California at Los Angeles, Los Angeles, California 90095-1551;...
Date Added: 2009-01-10 01:36:23

Kollock 1998 - Social Dilemmas.pdf
Path: UCLA >> SOCIOL >> 133 Winter, 2008
Description: Annu. Rev. Sociol. 1998. 24:183214 Copyright 1998 by Annual Reviews. All rights reserved SOCIAL DILEMMAS: The Anatomy of Cooperation Peter Kollock Department of Sociology, University of California at Los Angeles, Los Angeles, California 90095-1551;...
Date Added: 2009-01-10 01:36:23

Kollock 1998 - Social Dilemmas.pdf
Path: UCLA >> SOCIOL >> 145 Winter, 2008
Description: Annu. Rev. Sociol. 1998. 24:183214 Copyright 1998 by Annual Reviews. All rights reserved SOCIAL DILEMMAS: The Anatomy of Cooperation Peter Kollock Department of Sociology, University of California at Los Angeles, Los Angeles, California 90095-1551;...
Date Added: 2009-01-10 01:36:23

Kollock 1998 - Social Dilemmas.pdf
Path: UCLA >> SOCIOL >> 168 Fall, 2008
Description: Annu. Rev. Sociol. 1998. 24:183214 Copyright 1998 by Annual Reviews. All rights reserved SOCIAL DILEMMAS: The Anatomy of Cooperation Peter Kollock Department of Sociology, University of California at Los Angeles, Los Angeles, California 90095-1551;...
Date Added: 2009-01-10 01:36:23

050822firms.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: Who\'s Got Performance? Close Window AUGUST 22, 2005 CHINA AND INDIA - THE NEW CORPORATE MODEL Who\'s Got Performance? Investor alert: India\'s companies beat China\'s When it comes to economic growth between these two up-and-coming powerhouses, China is...
Date Added: 2009-02-11 17:28:31

Week_8_Guide
Path: UCSB >> PSY >> 9999 Winter, 2008
Description: Psychology 1 Introduction to Psychology Winter Quarter, 2008 Reading Guide for Chapters 5.1, 12.1-2, 14.3 pp. 150-162, 414-425, 434-464M, 509-517 Week 8 This sheet is pretty comprehensive, but youll notice some terms missing as you read. I chose n...
Date Added: 2008-04-07 17:48:40

Thesis.pdf
Path: Virginia Tech >> LIB >> 4598 Fall, 2008
Description: Multidisciplinary Design Optimization of a Strut-Braced Wing Aircraft Joel M. Grasmeyer Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Master ...
Date Added: 2009-02-18 01:12:53

BobTracyTalk.pdf
Path: LSU >> GEOLOGY >> 7900 Fall, 2008
Description: Special Presentation Bob Tracy Department of Geosciences Virginia Tech Monazite in Extreme Environments: Constraining the Dependability of Monazite Geochronology in Thermally and Mechanically Extreme Conditions Abstract The accessory mineral monazit...
Date Added: 2009-02-17 17:31:20

vistaSavvy.doc
Path: Florida >> EEL >> 5701 Summer, 2008
Description: How do I access Vista? Use Internet Explorer, Netscape or Mozilla browser (Safari works for MAC users). Do not use AOL. Point your browser to http:/lss.at.ufl.edu. You must have the correct type of Java for use with Vista. The upper right side of ...
Date Added: 2009-01-10 18:22:58

vistaSavvy.doc
Path: Florida >> EEL >> 6535 Fall, 2008
Description: How do I access Vista? Use Internet Explorer, Netscape or Mozilla browser (Safari works for MAC users). Do not use AOL. Point your browser to http:/lss.at.ufl.edu. You must have the correct type of Java for use with Vista. The upper right side of ...
Date Added: 2009-01-10 18:23:22

vistaSavvy.doc
Path: Florida >> EEL >> 6503 Fall, 2008
Description: How do I access Vista? Use Internet Explorer, Netscape or Mozilla browser (Safari works for MAC users). Do not use AOL. Point your browser to http:/lss.at.ufl.edu. You must have the correct type of Java for use with Vista. The upper right side of ...
Date Added: 2009-01-11 22:45:28

Chapter 6 Notes
Path: Grand Rapids CC >> BI >> 151 Fall, 2007
Description: Chapter six A tour of the cell Methods of cell study 1. Microscopy makes cells and their structures visible a. Characteristics of microscopes - Magnification ratio of image to actual size - Resolution minimum distance at which two points are seen ...
Date Added: 2008-02-22 21:43:03

a_vega_050605.pdf
Path: Washington State >> SOC >> 345 Summer, 2008
Description: THE POTENTIAL ROLE OF HIGH PHOTOSYNTHETIC CAPACITY IN PEST RESISTANCE MECHANISMS IN Fragaria chiloensis By ALEXIS R. VEGA A dissertation submitted in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY IN HORTICULTURE WA...
Date Added: 2009-02-02 21:00:45

hw3_solutions
Path: Cornell >> MS&E >> 303 Fall, 2004
Description: MS&E 303 Fall 2003 Homework #3 Due Wednesday, September 24 1. Yet more practice. Reduce the following thermodynamic questions to their simplest forms involving only coordinates P, V, T, S, physical parameters and (expansion coecient and the isoth...
Date Added: 2008-09-21 21:58:32

482calendar.doc
Path: University of Illinois, Urbana Champaign >> GLBL >> 482 Fall, 2008
Description: Calendar Week # Reading and In-Class Activities Engl 482: Writing Technologies Updated 1/17/09 16:38 A1/P1 Note that all electronic texts listed with the root \"archive/[author and article name]\" can be found at https:/netfiles.uiuc.edu/spencers/www...
Date Added: 2009-02-02 18:52:23

T11-EX-E2D
Path: Colorado >> SYST >> 2010 Fall, 2007
Description: Paradise Electronics - Franklin Invoice # Invoice Amount Salesperson ID 106 2,504.78 AB 109 15.00 AB 102 1,200.50 AJ 107 900.67 AJ 111 1,723.57 AJ 104 25.90 CG 113 14.08 CG 103 67.89 DZ 100 250.95 LJ 110 25.49 LJ 114 1,500.70 LJ 101 678.56 NP 108 89....
Date Added: 2008-04-17 22:11:04

I05-5010.pdf
Path: UPenn >> I >> 05 Fall, 2009
Description: Automatic generation of large-scale paraphrases Richard Power and Donia Scott Centre for Research in Computing The Open University Walton Hall Milton Keynes MK7 6AA {r.power,d.scott}@open.ac.uk Abstract Research on paraphrase has mostly focussed on ...
Date Added: 2009-04-15 21:18:13

201Spring08-L18
Path: Penn State >> CMPSC >> 201 Spring, 2008
Description: CMPSC 201C Spring 2008 Lecture 18 February 25, 2008 Nesting Loops Loops can be \"nested\" inside another loop for (int j = 1; j < 6; j+) / outer loop { cout< \" j = \"< j <\" \"; for (int k = 1; k<= 8; k+) / inner { cout<k<\" \"; } cout<endl; } The inner...
Date Added: 2008-03-19 16:22:30

07
Path: Colorado >> HUMN >> 1010 Fall, 2007
Description: Goodness/truth/beauty symmetria symmetry Citadel of Athens = acropolis (high city in greek) Model of the Acropolis, Athens 5-41 (garnder) Athenian pride/identity, 5th century Athens pride = acropolis other poleis jealous Parthenon (Temple of Athena ...
Date Added: 2008-09-22 07:13:45

greenbuild-article.doc
Path: Skidmore >> HUDSON >> 2 Fall, 2009
Description: Copyright(c) 2002 Congressional Information Service, Inc. A building revolution: How ecology and health concerns are transforming construction SOURCE: Worldwatch Institute AUTHOR: Roodman, David M.; Lenssen, Nicholas [David Malin Roodman is a researc...
Date Added: 2009-04-15 21:06:02

031107budget.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: FT.com / World / Americas Friday Nov 7 2003. All times are London time. Roger Bove Edit Profile Take a tour Log out Home World US UK Europe Asia-Pacific Middle East & Africa Americas International economy Brussels briefing News headlines News in d...
Date Added: 2009-02-11 18:27:46

project3design.pdf
Path: Kent State >> CS >> 23021 Summer, 2008
Description: Time Design Problem Statement: The problem is to calculate and display a new time of day given as input a current time and a wait time. Specifically each input will be entered as two integer values representing hours and minutes. Time is expected to ...
Date Added: 2009-01-09 02:27:36

535.pdf
Path: University of Illinois, Urbana Champaign >> MATH >> 535 Fall, 2008
Description: Course Schedule - Spring 2009 Mathematics 535 General Topology credit: 4 hours. Study of topological spaces and maps, including Cartesian products, identifications, connectedness, compactness, uniform spaces, and function spaces. Prerequisite: Consen...
Date Added: 2009-02-02 18:16:18

OmegaTest-1.ppt
Path: UCLA >> EE >> 201 Fall, 2008
Description: The Omega Test A practical algorithm for exact Array Dependence analysis William Pugh Presentation by, Anitha Vijayakumar & Doris Ching EE- 201A - Spring 2003 Agenda The Omega Test Normalizing and Elimination of constraints Fourier-Motzkin Elimin...
Date Added: 2009-03-18 23:57:12

feb2-8.pdf
Path: Minnesota >> SWROC >> 2 Fall, 1999
Description: Official Weather Station - 1999 University of Minnesota Southwest Research and Outreach Center Lamberton, MN 56152 (507) 752-7372 Historic Max Historic Historic Cumm Cumm Air Min Air Max Air Min Air Daily Precip Precip Temp Temp Precip for 1999 For 1...
Date Added: 2009-02-17 20:59:30

P07-2008.pdf
Path: UPenn >> P >> 07 Fall, 2009
Description: zipfR: Word Frequency Distributions in R Stefan Evert IKW (University of Osnabr ck) u Albrechtstr. 28 49069 Osnabr ck, Germany u stefan.evert@uos.de Marco Baroni CIMeC (University of Trento) C.so Bettini 31 38068 Rovereto, Italy marco.baroni@unitn.it...
Date Added: 2009-04-15 21:36:04

AuditsonTranscript.doc
Path: Iowa State >> AN S >> 599a Fall, 2008
Description: RequestforAudit(s)toAppearonTranscript SubmitthisrequestnosoonerthantheMIDDLEoftheterminwhichthecourseistaken Pleasetypeorprintclearly Name ISUID# Email (Lastname)(Firstname) Department Irequestthefollowingcourse(s)beaddedtomypermanentrecord...
Date Added: 2009-01-09 02:06:09

594.pdf
Path: University of Illinois, Urbana Champaign >> NRES >> 594 Spring, 2008
Description: Course Schedule - Fall 2005 Natural Resources and Environmental Sciences 594 NRES Professional Orientation Credit: 1 hours. (NRES 494) The philosophy and components of graduate education with development of the principles useful in teaching, research...
Date Added: 2009-02-02 18:24:57

eb0311.pdf
Path: Cornell >> AEM >> 0311 Fall, 2008
Description: AUGUST 2003 E.B. 2003-11 DAIRY FARM BUSINESS SUMMARY SOUTHEASTERN NEW YORK REGION 2002 Wayne A. Knoblauch Linda D. Putnam Stephen E. Hadcock Larry R. Hulle Mariane Kiraly Joseph J. Walsh Department of Applied Economics and Management College of ...
Date Added: 2009-02-17 21:34:03

TSLL07_proceedings.pdf
Path: Iowa State >> ENGL >> 099r Fall, 2008
Description: TowardsAdaptiveCALL NaturalLanguageProcessingfor DiagnosticLanguageAssessment IowaStateUniversity Editedby CarolA.Chapelle YooReeChung JingXu 2008 SelectedPapersfromtheFifthAnnualConferenceonTechnologyforSecondLanguageLearning ii ACKNOWLEGEMEN...
Date Added: 2009-01-12 03:27:49

TSLL07_proceedings.pdf
Path: Iowa State >> ENGL >> 101b Fall, 2008
Description: TowardsAdaptiveCALL NaturalLanguageProcessingfor DiagnosticLanguageAssessment IowaStateUniversity Editedby CarolA.Chapelle YooReeChung JingXu 2008 SelectedPapersfromtheFifthAnnualConferenceonTechnologyforSecondLanguageLearning ii ACKNOWLEGEMEN...
Date Added: 2009-01-12 03:27:50

TSLL07_proceedings.pdf
Path: Iowa State >> ENGL >> 101d Fall, 2008
Description: TowardsAdaptiveCALL NaturalLanguageProcessingfor DiagnosticLanguageAssessment IowaStateUniversity Editedby CarolA.Chapelle YooReeChung JingXu 2008 SelectedPapersfromtheFifthAnnualConferenceonTechnologyforSecondLanguageLearning ii ACKNOWLEGEMEN...
Date Added: 2009-01-12 03:27:50

TSLL07_proceedings.pdf
Path: Iowa State >> ENGL >> 099l Fall, 2008
Description: TowardsAdaptiveCALL NaturalLanguageProcessingfor DiagnosticLanguageAssessment IowaStateUniversity Editedby CarolA.Chapelle YooReeChung JingXu 2008 SelectedPapersfromtheFifthAnnualConferenceonTechnologyforSecondLanguageLearning ii ACKNOWLEGEMEN...
Date Added: 2009-01-12 03:27:49

ch78
Path: Arizona >> PHIL >> 121 Spring, 2008
Description: Walker CHAPTER 7 Work and Kinetic Energy 1) The SI unit of work is expressed as A) watt. B) newton. C) newton/second. D) joule. Answer: D Diff: 1 Page Ref: Sec. 7-1 2) The work done by the centripetal force on an object with a mass of 1 kg moving wi...
Date Added: 2008-05-04 20:28:32

060120losers.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: WSJ.com - Welcome to the Club of Losers January 20, 2006 COMMENTARY DOW JONES REPRINTS This copy is for your personal, non-commercial use only. To order presentation-ready copies for distribution to your colleagues, clients or customers, use the Orde...
Date Added: 2009-02-11 18:02:27

060120losers.txt
Path: Chester >> ECO >> 338 Fall, 2008
Description: WSJ.com - Welcome to the Club of Losers January 20, 2006 COMMENTARY DOW JONES REPRINTS This copy is for your personal, non-commercial use only. To order presentation-ready copies for distribution to your colleagues, clients or customers, use the Orde...
Date Added: 2009-02-11 17:51:35

ar0203.pdf
Path: UCSD >> FRL >> 0203 Fall, 2008
Description: ACADEMIC SENATE: SAN DIEGO DIVISION October 30, 2003 ANNUAL REPORT COMMITTEE ON FACULTY RESEARCH LECTURER 2002-2003 Thanks to the good work of Sandi Pierz, the process of selecting next years Faculty Research Lecturers went very smoothly. At our mee...
Date Added: 2009-02-17 18:32:14

nadeem1.pdf
Path: Arizona >> CS >> 620 Fall, 2009
Description: 1fsRisYqbRygs~fs0DbysRvrs~sBs ss ~ | | | } | g f&sYRwRyvy sf|v!yslc !Bhb w0 | 8Ry ~ ~}| } ~ tsgf!bgRW bywfG~s|~yzWRf|i|B | } ~ | WsbfGWRgys|~fbzfb!brtR1sygy YgYf|y|Uyw!yRs tb...
Date Added: 2009-04-15 23:03:16

HA 347 ex. 5_Solutions
Path: Cornell >> H ADM >> 347 Fall, 2007
Description: 9/26/2007 CONSUMER BEHAVIOR Exercise 5: Attitude Change 1) From the ages of 9-12, I always used to buy Nike soccer cleats because I thought they had the coolest design and because all my friends had them. However, bad product quality and a change to ...
Date Added: 2009-02-20 02:37:07

sands_2005_10f.pdf
Path: San Diego State >> ART >> 496 Fall, 2008
Description: October 2005 . Volume 9.4 San Diego SAS Users Group From the President Art Carpenter Our October meeting includes a two hour afternoon workshop (there will be no workshop fee), free dinner, featured presentation, short presentation, Coders Corner, ...
Date Added: 2009-02-02 16:02:42

88.pdf
Path: St. Thomas >> MAPS >> 88 Fall, 2008
Description: St. Paul Campus 2115 Summit Avenue St. Paul, Minnesota 55105 Sel b yA ven ue R1 C B rd va e ul Bo er iv R E Su mm it A ve n R3 R2 F A D iss P4 X P2 Gr an N e nu dA ve n I ue K L J C re tin Av e - Building Location - Visitor Parkin...
Date Added: 2009-02-17 23:57:03

Topic 1 notes
Path: CUNY Brooklyn >> CHEM >> 1.1 Spring, 2008
Description: 1-1 Topic 1 Biophilia E. O. Wilson Why Study Biology and Plants Biodiversity Need for Nature Biological Relationships Interaction within and between species 1-2 Processing debris Providing a haven Socioeconomic Consequences Malthusian theory ...
Date Added: 2008-04-08 21:38:36

quantum_dots.pdf
Path: Berkeley >> CS >> 191 Spring, 2005
Description: Chris Lay, Alan Wu, Anthony Yeh Quantum Dots Properties How to create them Possible qubit implementations Single electron spin Multiple quantum dots Double quantum dot Capacitive-coupled quantum dots 2 Confinement of electron wavefunction Typical ...
Date Added: 2009-04-16 01:49:45

CHAPTER 10 NOTES socl strat.
Path: LSU >> SOCL >> 4331 Spring, 2008
Description: CHAPTER 10 NOTES 2/12/08 Gentrification-property values in poorer areas are bought out by most likely mid class childless couples, increasing the property value in inner city poor areas. Middle class families are moving farther and farther out to th...
Date Added: 2008-04-14 20:28:35

335.pdf
Path: BYU >> DANCE >> 335 Winter, 2008
Description: BRIGHAM YOUNG UNIVERSITY COLLEGE OF HEALTH AND HUMAN PERFORMANCE Department of Dance Student Syllabus for Dance 335 Tap Dance Technique II Instructor: BYU Phone: E-mail: Office: Office Hours: and by appointment 1. Catalog Course Description: The foc...
Date Added: 2009-02-02 13:40:21

m408k-fer-fall07-day1-soltns
Path: Texas >> M >> 408K Fall, 2007
Description: ...
Date Added: 2008-10-29 11:03:27

an1612i.txt
Path: Michigan >> LIB >> 161295 Fall, 1995
Description: THE MESSAGE BELOW IS FROM ADMINISTRATIVE NOTES, VOL. 16, #12 (Sept. 15, 1995). REMINDER: SHIPPING LIST NUMBERING TO CHANGE IN OCTOBER Beginning on October 2, 1995, all shipping list numbering will reflect the Federal Government fiscal year, which at ...
Date Added: 2009-02-11 21:18:24

13.pdf
Path: Purdue >> PHYS >> 600 Fall, 2008
Description: ...
Date Added: 2009-01-09 06:50:07

PHS398_CoverPageSupplement.pdf
Path: Hawaii >> PHS >> 398 Fall, 2008
Description: PHS 398 Cover Page Supplement OMB Number: 0925-0001 Expiration Date: 9/30/2007 1. Project Director / Principal Investigator (PD/PI) Prefix: Middle Name: * Last Name: Suffix: Dr. * First Name: * New Investigator? No Yes Degrees: BA 2. Human Sub...
Date Added: 2009-02-17 20:27:46

Synthesis Summaries 4-4
Path: U. Memphis >> ENGL >> 1010 Spring, 2008
Description: Steven Ozemba Ann AL-Chokhachi Synthesis Summaries April 4, 2008 \"Should English Be the Law?\" by Robert D. King Robert D. King, a graduate of Georgia\'s Institute of Technology, believes in making English the official language in America, and making i...
Date Added: 2008-04-09 12:18:50

theisgraphs.xls
Path: San Diego State >> GEOL >> 551 Fall, 2008
Description: u 1.00E-09 5.00E-09 1.00E-08 1.00E-07 1.00E-06 1.00E-05 1.00E-04 1.00E-03 1.00E-02 1.00E-01 4.00E-01 6.00E-01 8.00E-01 9.00E-01 1.00E+00 1/u W(u) 1.00E+09 20.15 2.00E+08 18.54 1.00E+08 17.84 1.00E+07 15.54 1.00E+06 13.24 1.00E+05 10.94 1.00E+04 8.63...
Date Added: 2009-01-11 18:08:29

ns.doc
Path: UPenn >> CIS >> 700 Spring, 2006
Description: Global Illumination in Real-Time Project Proposal Abstract: Global illumination is a well known technique for producing realistic scenes and overcoming shortcomings of the local lighting model. Common algorithms for solving global illumination rely o...
Date Added: 2009-04-15 20:42:34

MATH-1297-Notes-15.1
Path: Minnesota >> MATH >> 1297 Spring, 2007
Description: ...
Date Added: 2008-04-11 18:06:53

biol 1408 Ch 2 web note.doc
Path: Kilgore >> BIOL >> 1408 Spring, 2008
Description: Chapter 2 The Chemical Basis of Life Natures Chemical Language The rattlebox moth Produces chemicals important for mating and defense The compound produced during mating Allows the moths to communicate using chemicals Thomas Eisner of Cornell Univer...
Date Added: 2009-02-02 14:43:16

md028.pdf
Path: F & M >> ATS >> 3 Fall, 2009
Description: Gradebook Settings The Gradebook Settings feature enables instructors to modify the way grades are displayed and set the values for grades. Accessing the Gradebook 1. Select and log into the course. 2. Click on the Control Panel button on the left si...
Date Added: 2009-04-15 23:51:42

Sheet composition Fall 2007.ppt
Path: Kansas State >> LAR >> 645 Fall, 2008
Description: . Sheet composition Internship summary exhibition boards LAR 645 Fall 2007 Lorn Clement Outline Goals Principles of composition Visual characteristics of form Other image considerations Munsell system of color Typography Ex.: Smithsonian M...
Date Added: 2009-02-02 14:41:19

ho3.pdf
Path: Arizona >> LING >> 696 Fall, 2008
Description: Vowel Shift Linguistics 696b (Spring 2005) (1) divine [d@vyn] divinity [d@v a In@Ri] serene [s@r in] serenity [s@rn@Ri] E profane [pr`fn] profanity [pr`fn@Ri] oe o k C0 + i d s C (C +) -stress 1 C0 V (2) V ...
Date Added: 2009-04-15 22:41:11

agenda1.pdf
Path: Shepherd >> BOGWEB >> 08 Fall, 2008
Description: Shepherd University Board of Governors April 10, 2008 Agenda Item No. 2 REVISED ENROLLMENT AND MISCELLANEOUS FEES FOR 2008-09 ACADEMIC YEAR Rising costs for utilities, increased funding for programmatic and operational initiatives, the need for cont...
Date Added: 2009-02-17 23:01:28

551-7.ps
Path: Wisconsin >> ROMANO >> 551 Fall, 2008
Description: Physics 0551 Lecture #7 The bonding of atoms If a thorough discussion of the properties in the periodic arrangements of atoms is to be performed, then it is clearly necessary to justify the existence of these solids and discuss the interactions whi...
Date Added: 2009-02-04 14:21:02

2008_LANG_02.pdf
Path: TCU >> GEO >> 1 Fall, 2008
Description: 10680 Langmuir 2008, 24, 10680-10687 Modulation of Drug Transport Properties by Multicomponent Diffusion in Surfactant Aqueous Solutions Huixiang Zhang, and Onofrio Annunziata*, Department of Chemistry, Texas Christian UniVersity, Fort Worth, Texas...
Date Added: 2009-02-11 16:28:46

90.pdf
Path: N. Arizona >> MS >> 402 Spring, 2008
Description: An Early Pleistocene Mammalian Fauna from Yuxian, Hebei Province, and its Significance toward Stratigraphic Subdivision Yingjun Tang (Institute of Vertebrate Paleontology and Paleoanthropology, Academia Sinica) Vertebrata PalAsiatica Vol. XVIII, No...
Date Added: 2009-01-09 09:04:18

CIS2270.pdf
Path: Pasco-Hernando Community College >> CIS >> 2350 Spring, 2008
Description: Information and Engineering Technology Division Computer Information Systems Course Syllabus Course Name Course Number Course Prerequisite Credit Hours Instructor Java Application Development CIS-2270 CIS 1030 (with a minimum grade of C) 3.0 Instru...
Date Added: 2009-01-09 06:06:10

jrr2f.pdf
Path: Harvard >> BIOSUN >> 1 Fall, 2009
Description: INFERENCE FOR IMPUTATION ESTIMATORS By JAMES M. ROBINS Department of Epidemiology and Biostatistics, Harvard School of Public Health 677 Huntington Avenue, Boston, Massachusetts 02115, U.S.A. e-mail: robins@hsph.harvard.edu and NAISYIN WANG Departmen...
Date Added: 2009-04-16 00:14:51

final_q4
Path: Texas >> M >> 427K Spring, 2008
Description: ...
Date Added: 2008-04-07 08:40:14

Problems_1.pdf
Path: SUNY Stony Brook >> CHE >> 301 Fall, 2008
Description: CHE 301 - Physical Chemistry I - Fall 2007 Problems 1. The Properties of Gases. Problems 1) A container is divided into two compartments. Compartment A holds ideal gas A at 400 K and 5 atm of pressure. Compartment B is lled with ideal gas B at 400 K...
Date Added: 2009-01-09 07:16:11

GBBL500 SyllabusFALL2004a.pdf
Path: Azusa Pacific >> GBBL >> 512 Spring, 2008
Description: Azusa Pacific University Haggard Graduate School of Theology Course Syllabus GBBL 500 Elements of Greek Exegesis (4 units) Instructor: Lynn Allan Losie, Ph.D., Associate Professor of New Testament (Web Site: www.apu.edu/~llosie) Prerequisites: None. ...
Date Added: 2009-01-09 18:45:17

final92.pdf
Path: UCSC >> PHYS >> 116c Fall, 2008
Description: FINAL 12/7/92 Physics 114B 1. (10 points)(a) Find the general solution to the equation d2 y 2 + 2y = 0 dx2 x where > 1/2 and is a constant. Hint: Try a power law. (b) What is the solution when y(1) = 0? Use the fact that xi = exp(i ln x) and sin() =...
Date Added: 2009-01-11 21:56:08

uwaha_nid03_w1_slides.pdf
Path: Maryland >> CSCAMM >> 03 Fall, 2008
Description: October 22-24, 2003 CSCAMM Workshop: Fundamental Physical Issues in Nonequilibrium Interface Dynami Drift-Induced Pattern Formation on Si(001) Vicinal Surfaces Effect of Alternating Anisotropy Makio Uwaha Dept. of Phys., Nagoya University uwaha@phys...
Date Added: 2009-02-18 00:29:39

TH&F 922 Syllabus_Fa 08.pdf
Path: Kansas >> TH&F >> 922 Fall, 2008
Description: Theatre 3 Office Hours: 2:00-3:30 Tuesday & by appt. I. Instructor info: Dr. Mechele Leon Office: 206 Murphy Office Ph.: 864-2062 Email: mleon@k...
Date Added: 2009-02-02 19:26:55

Incropera Heat and Mass Transfer Solutions Chapter1_18
Path: UCSD >> MATH >> 20E Spring, 2008
Description: PROBLEM 1.18 KNOWN: Chip width and maximum allowable temperature. Coolant conditions. FIND: Maximum allowable chip power for air and liquid coolants. SCHEMATIC: ASSUMPTIONS: (1) Steady-state conditions, (2) Negligible heat transfer from sides and bo...
Date Added: 2008-04-07 20:24:44

Final Exam Spring 2007.pdf
Path: LSU >> ASTR >> 4221 Fall, 2008
Description: FINAL EXAMINATION SCHEDULE 2007 Spring Semester REGULAR CLASSES SCHEDULED CLASS PERIOD EXAM DATE EXAM TIME GROUP EXAMINATIONS COURSE CHEMISTRY CIVIL ENGR COURSE NUMBER EXAM DATE EXAM TIME 7:30 - 8:30 7:30 - 9:00 8:30 - 9:30 9:00 - 10:30 9:30 - 10:3...
Date Added: 2009-01-11 16:30:28

Final Exam Spring 2007.pdf
Path: LSU >> ASTR >> 4222 Fall, 2008
Description: FINAL EXAMINATION SCHEDULE 2007 Spring Semester REGULAR CLASSES SCHEDULED CLASS PERIOD EXAM DATE EXAM TIME GROUP EXAMINATIONS COURSE CHEMISTRY CIVIL ENGR COURSE NUMBER EXAM DATE EXAM TIME 7:30 - 8:30 7:30 - 9:00 8:30 - 9:30 9:00 - 10:30 9:30 - 10:3...
Date Added: 2009-01-11 16:30:28

BEM 146 HW 1 Solution - noah.pdf
Path: Caltech >> BEM >> 146 Winter, 2008
Description: BEM 146, Caltech Organizational Design Business Economics and Management 146 Organizational Design California Institute of Technology Suggested Solutions for Homework 1 Noah Myung 1.23.06 Winter 2006 1. a. This can be viewed as a mistake of solving...
Date Added: 2009-02-02 13:44:48

BADM209 2ND EXAM _KEY_ SUMMER 2003.pdf
Path: Fayetteville State University >> ACCT >> 321 Spring, 2008
Description: BADM 209-LEGAL ENVIRONMENT OF BUSINESS REVIEW QUESTIONS 1. In the locker room, Biff playfully shoves Chad, not intending to injure him. Chad falls into a locker and breaks his arm. Has Biff committed an intentional tort? a. yes, because Chad was inj...
Date Added: 2009-01-10 03:00:40

Week 7 - Intro to Governance
Path: Arizona >> INDV >> 103 Spring, 2008
Description: 2/25 Governance Who rules? How? Why? Through what means? Can Iraq become a fully-functional government? Why is governance important? It answers one of the most basic questions of politics: Who gets what, where, when, how, and why? It\'s how we solve p...
Date Added: 2008-04-02 20:02:15

CH02
Path: Clarkson >> EE >> 264 Spring, 2008
Description: Number systems, operations and codes Chapter 2 Decimal Numbering System The decimal numbering system has 10 digits 0 through 9 The decimal numbering system has a base of 10 with each position weighted by a factor of 10 .105 104 103 102 101 100 . 10...
Date Added: 2008-04-08 11:08:00

AltimetryWilkin(1).pdf
Path: Rutgers >> 670 >> 451 Fall, 2008
Description: Remote Sensing: John Wilkin wilkin@marine.rutgers.edu IMCS Building Room 211C 732-932-6555 ext 251 Active microwave systems (1) Satellite Altimetry Active microwave instruments Scatterometer (scattering from surface roughness) ocean vector winds ...
Date Added: 2009-01-11 20:54:06

AltimetryWilkin(1).pdf
Path: Rutgers >> 712 >> 545 Fall, 2008
Description: Remote Sensing: John Wilkin wilkin@marine.rutgers.edu IMCS Building Room 211C 732-932-6555 ext 251 Active microwave systems (1) Satellite Altimetry Active microwave instruments Scatterometer (scattering from surface roughness) ocean vector winds ...
Date Added: 2009-01-11 20:54:06

AltimetryWilkin(1).pdf
Path: Rutgers >> 712 >> 552 Spring, 2008
Description: Remote Sensing: John Wilkin wilkin@marine.rutgers.edu IMCS Building Room 211C 732-932-6555 ext 251 Active microwave systems (1) Satellite Altimetry Active microwave instruments Scatterometer (scattering from surface roughness) ocean vector winds ...
Date Added: 2009-01-11 20:54:06

041112industP.txt
Path: Chester >> ECO >> 343 Fall, 2008
Description: FT.com / World - Bankers think failure of policy is good for Germany Friday Nov 12 2004 . All times are London time. Roger Bove Edit Profile Take a Tour Log out HomeWorldUSUKEuropeAsia-PacificMiddle East & AfricaAmericasInternational economyBrusse...
Date Added: 2009-02-11 18:34:40

w02R01.pdf
Path: Illinois Springfield >> MIS >> 2 Fall, 2009
Description: Chapter 2. REVIEW QUESTIONS 1. If intelligence is the capacity to acquire and apply knowledge, what is knowledge? Knowledge is one\'s capacity to acquire and apply knowledge. Knowledge is familiarizing, understanding, or awareness acquired through awa...
Date Added: 2009-04-16 01:05:02

w02R01.pdf
Path: Illinois Springfield >> MIS >> 562 Fall, 2009
Description: Chapter 2. REVIEW QUESTIONS 1. If intelligence is the capacity to acquire and apply knowledge, what is knowledge? Knowledge is one\'s capacity to acquire and apply knowledge. Knowledge is familiarizing, understanding, or awareness acquired through awa...
Date Added: 2009-04-16 01:05:03

e104l14.pdf
Path: Harvey Mudd College >> E >> 104 Fall, 2008
Description: The Real Estate Bubble of 2008 The Economics of Housing and the Early (early, early) Warning Signs 1 The general tendency for real estate prices to rise explained by demographics S1990 Supply constrained by land/water availability, regulation, etc...
Date Added: 2009-03-19 00:15:27

9986.pdf
Path: USC >> MARSHALL >> 048 Fall, 2008
Description: Talentship and HR Measurement and Analysis: From ROI to Strategic Organizational Change John W. Boudreau, University of Southern California; Peter M. Ramstad, Personnel Decisions International A looming paradox is facing HR and business leaders and...
Date Added: 2009-02-18 02:00:56

9986.pdf
Path: USC >> WWW-MARSHA >> 048 Fall, 2008
Description: Talentship and HR Measurement and Analysis: From ROI to Strategic Organizational Change John W. Boudreau, University of Southern California; Peter M. Ramstad, Personnel Decisions International A looming paradox is facing HR and business leaders and...
Date Added: 2009-02-18 02:02:06

reviewquestions-basicalgebra
Path: Colorado >> ECON >> 4808 Fall, 2006
Description: Econ 4808: review questions for basic algebra 1. Factor the expression ax+2 = ax a2 2. Expand and simplify a4 b (a2 b 3 3 )2 = a4 b a4 b 3 6 = b6 b3 = b3 4t2 + 2t x+y x(x+1) 3. Expand the expression (2t 2t3 5t2 + 4t 1 4. x+y x(x+1) y (1+ x ) x...
Date Added: 2008-07-10 18:16:47

midterm
Path: UC Davis >> ENG >> 105 Fall, 2007
Description: UNIVERSITY OF CALIFORNIA, DAVIS MECHANICAL & AERONAUTICAL ENGINEERING ENG-105: THERMODYNAMICS MIDTERM #1 SOLUTIONS Professor Aldredge 2007 Fall Quarter YOU HAVE 1 HOUR AND 40 MINUTES TO COMPLETE THIS EXAMINATION. PLEASE SHOW ALL OF YOUR WORK ON THE ...
Date Added: 2008-04-09 00:48:40

p321.pdf
Path: N.C. State >> COM >> 321 Fall, 2008
Description: APPLIED AND ENVIRONMENTAL MICROBIOLOGY, June 2003, p. 31923202 0099-2240/03/$08.00 0 DOI: 10.1128/AEM.69.6.31923202.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Vol. 69, No. 6 Bacteriophage Ecology in Commercial Sau...
Date Added: 2009-02-02 15:07:51

aaai06-linkpolarity.pdf
Path: San Diego State >> LING >> 681 Fall, 2008
Description: Predicting Movie Sales from Blogger Sentiment Gilad Mishne Informatics Institute, University of Amsterdam Kruislaan 403, 1098SJ Amsterdam, The Netherlands gilad@science.uva.nl Natalie Glance Intelliseek Applied Research Center 5001 Baum Blvd, Pittsb...
Date Added: 2009-01-09 07:00:05

3-6-08
Path: Michigan >> HISTORY >> 211 Winter, 2007
Description: HISTORY 211 A Real ,New Economy 3/6/08 \"Welcome to todays lecture, which may be abbreviated by my death.\" Terms Peter Valdes (+1215) o Merchant (unimanginable in 11th century when Ordo conceived) in Lyons o Literate person, encountered Chrisitanity a...
Date Added: 2008-04-11 21:22:49

Chatfield--Thomas Jefferson
Path: Trinity College >> PHIL >> 337 Spring, 2008
Description: Daniel Zauderer Thomas Jefferson: The Quintessential American Idealist Thomas Jefferson, in every aspect of his life, was utterly idealistic and moralistic. As such, his far-fetched dreams were not easily applied to an imperfect society, a complicate...
Date Added: 2008-04-21 00:49:22

Lab8.doc
Path: Illinois Tech >> CS >> 402 Fall, 2009
Description: LAB # 8 PRE LAB In this Lab we want to create additional events relating to the GUi built in lab 7. Most event listeners that we would use utilize the ActionListener interface and override the actionPerformed method of this interface. One technique t...
Date Added: 2009-04-15 23:44:37

Short_Paper_Assignment_triangle_Spring_ProblemSet
Path: Cornell >> ILRCB >> 101 Spring, 2008
Description: Short Paper Assignment Cowie CB 100: Labor and Working-Class History Due: in class Monday Feb 18 OPTION ONE: Context: Frances Perkins wrote that the events at Triangle and the ensuing reforms were a turning point in opening up new attitudes about so...
Date Added: 2009-02-20 04:01:41

Lect12.LifeHist.08.abrev.pdf
Path: N. Illinois >> BIOS >> 316 Fall, 2008
Description: Life History and Evolutionary Fitness Organism has finite amount time reproduction; therefore, must balance costs & benefits (i.e., there are _) Fig. -organisms lifetime pattern of allocation is its __ 10.4 T...
Date Added: 2009-01-09 05:16:43

Lect12.LifeHist.08.abrev.pdf
Path: N. Illinois >> BIOS >> 316s Fall, 2008
Description: Life History and Evolutionary Fitness Organism has finite amount time reproduction; therefore, must balance costs & benefits (i.e., there are _) Fig. -organisms lifetime pattern of allocation is its __ 10.4 T...
Date Added: 2009-01-09 05:16:43

test1a_fall07
Path: Miami >> PHY >> 206 Spring, 2008
Description: PHY 206 EXAM 1 Sep. 26, 2007 NAME: SIGNATURE: ID: 1. 2. 3. 4. 1. 2. 3. 4. Some relations you may need: 1 p + gy + v 2 = const., 2 dQ = mc dT = nCdT L = LT, V = V T, Y = 3 nRT 2 F /A , L/L dQ T = A dt L pV = nRT Ktr = dW = pdV dQ = dU ...
Date Added: 2008-04-26 14:00:05

proj2.txt
Path: Idaho >> MRC >> 441 Fall, 2008
Description: Project 2 - Five State CPU model = Goal: -Develop a multi-cycle model of the MIPS processor in which each instruction takes exactly 5 clock cycles to complete. Description: -Starting with the CPU template (available from the Project 2 web page), modi...
Date Added: 2009-02-06 20:42:34

pub99-14.pdf
Path: Maryland >> IREAP >> 99 Fall, 2008
Description: VOLUME 83, NUMBER 17 PHYSICAL REVIEW LETTERS 25 OCTOBER 1999 k Spectrum of Finite Lifetime Passive Scalars in Lagrangian Chaotic Fluid Flows Keeyeol Nam,* Thomas M. Antonsen, Jr.,*, Parvez N. Guzdar, and Edward Ott*, Institute for Plasma Research,...
Date Added: 2009-02-06 19:28:23

pub99-14.pdf
Path: Maryland >> IPR >> 99 Fall, 2008
Description: VOLUME 83, NUMBER 17 PHYSICAL REVIEW LETTERS 25 OCTOBER 1999 k Spectrum of Finite Lifetime Passive Scalars in Lagrangian Chaotic Fluid Flows Keeyeol Nam,* Thomas M. Antonsen, Jr.,*, Parvez N. Guzdar, and Edward Ott*, Institute for Plasma Research,...
Date Added: 2009-02-06 19:12:24

Genetics 466- Exam 1- Spring 00
Path: Wisconsin >> GENETICS >> 466 Spring, 2009
Description: ...
Date Added: 2009-04-07 17:34:10

Exam_1
Path: Lehigh >> ME >> 104 Spring, 2008
Description: ...
Date Added: 2008-04-07 14:10:09

kolmoineq.pdf
Path: N.C. State >> PP >> 500 Fall, 2008
Description: ON EXTENSIONS OF AN INEQUALITY OF KOLMOGOROV Tapas K. Chandra Indian Statistical Institute, Calcutta, India Subhashis Ghosal Indian Statistical Institute, Calcutta, India Summary. The inequality of Kolmogorov (Sankhy, 1963) has been exa tended to a...
Date Added: 2009-01-09 08:20:52

Vern_Heuristic_consolidated.doc
Path: Berkeley >> IS >> 213 Spring, 1999
Description: Vern Group Assignment: Heuristic Eval Heuristic Evaluation of SIMS Alumni Network Project UI 1. Reports:1, Heuristic:HELP, Severity:2 On the login page, the Sign Up Now! link should be highlighted to draw attention to itself as a link 2. Reports:1, ...
Date Added: 2009-02-18 14:14:09

SkovSherman1986JESP.pdf
Path: UCSD >> MGT >> 409 Fall, 2008
Description: -\\ ~ - \'1j \"\' (\') ~ -; -~ \'5\" \':-\' :;-\" P\' :. \'1j \'< ~ :. \'fi -~ ~ -= =- ~ -Q. _.=- <\'D ~ -5 <\'D~(\'0 2 -N ~ <\'D9 ~ ~ -~ ~ P\' :. ~ Q. <\'D <\'D =- <\'D <\'D =- Q. 3 9 ~ =-\"\' ~ <\'D =-<\'D(JQ _.OQ 00~>< 00~=- -\"\' CT -n =- ~ \"\' <\'D=- <\'D S. ~ ; <\'D-<:) =....
Date Added: 2009-01-11 21:33:01

SkovSherman1986JESP.pdf
Path: UCSD >> PSYC >> 209 Fall, 2008
Description: -\\ ~ - \'1j \"\' (\') ~ -; -~ \'5\" \':-\' :;-\" P\' :. \'1j \'< ~ :. \'fi -~ ~ -= =- ~ -Q. _.=- <\'D ~ -5 <\'D~(\'0 2 -N ~ <\'D9 ~ ~ -~ ~ P\' :. ~ Q. <\'D <\'D =- <\'D <\'D =- Q. 3 9 ~ =-\"\' ~ <\'D =-<\'D(JQ _.OQ 00~>< 00~=- -\"\' CT -n =- ~ \"\' <\'D=- <\'D S. ~ ; <\'D-<:) =....
Date Added: 2009-01-11 21:33:01

chem243_fs2005 syllabus.pdf
Path: Missouri S&T >> CHEM >> 11 Fall, 2008
Description: CHEM 243, PHYSICAL CHEMISTRY II MWF, Room 321 Schrenk Hall 9:009:50am Instructor: Dr. Charles Chusuei, chusuei@umr.edu, Office: 205 Schrenk Hall Lab: 204 Schrenk Hall, Contact hours: 3:004:30pm, Tu F and by appointment; Tel. 573-341-4537 Web: <http:/...
Date Added: 2009-01-09 04:15:29

chem243_fs2005 syllabus.pdf
Path: Missouri S&T >> CHEM >> 441 Fall, 2008
Description: CHEM 243, PHYSICAL CHEMISTRY II MWF, Room 321 Schrenk Hall 9:009:50am Instructor: Dr. Charles Chusuei, chusuei@umr.edu, Office: 205 Schrenk Hall Lab: 204 Schrenk Hall, Contact hours: 3:004:30pm, Tu F and by appointment; Tel. 573-341-4537 Web: <http:/...
Date Added: 2009-01-12 05:11:31

chem243_fs2005 syllabus.pdf
Path: Missouri S&T >> CHEM >> 12 Fall, 2008
Description: CHEM 243, PHYSICAL CHEMISTRY II MWF, Room 321 Schrenk Hall 9:009:50am Instructor: Dr. Charles Chusuei, chusuei@umr.edu, Office: 205 Schrenk Hall Lab: 204 Schrenk Hall, Contact hours: 3:004:30pm, Tu F and by appointment; Tel. 573-341-4537 Web: <http:/...
Date Added: 2009-01-09 04:15:29

chem243_fs2005 syllabus.pdf
Path: Missouri S&T >> CHEM >> 241 Fall, 2008
Description: CHEM 243, PHYSICAL CHEMISTRY II MWF, Room 321 Schrenk Hall 9:009:50am Instructor: Dr. Charles Chusuei, chusuei@umr.edu, Office: 205 Schrenk Hall Lab: 204 Schrenk Hall, Contact hours: 3:004:30pm, Tu F and by appointment; Tel. 573-341-4537 Web: <http:/...
Date Added: 2009-01-09 04:15:29

chem243_fs2005 syllabus.pdf
Path: Missouri S&T >> CHEM >> 243 Fall, 2008
Description: CHEM 243, PHYSICAL CHEMISTRY II MWF, Room 321 Schrenk Hall 9:009:50am Instructor: Dr. Charles Chusuei, chusuei@umr.edu, Office: 205 Schrenk Hall Lab: 204 Schrenk Hall, Contact hours: 3:004:30pm, Tu F and by appointment; Tel. 573-341-4537 Web: <http:/...
Date Added: 2009-01-09 04:15:29

chem243_fs2005 syllabus.pdf
Path: Missouri S&T >> CHEM >> 321 Fall, 2008
Description: CHEM 243, PHYSICAL CHEMISTRY II MWF, Room 321 Schrenk Hall 9:009:50am Instructor: Dr. Charles Chusuei, chusuei@umr.edu, Office: 205 Schrenk Hall Lab: 204 Schrenk Hall, Contact hours: 3:004:30pm, Tu F and by appointment; Tel. 573-341-4537 Web: <http:/...
Date Added: 2009-01-09 04:15:29

mormons.pdf
Path: Penn State >> ECON >> 434 Fall, 2008
Description: 1 Central Planning and Transition in the American Desert: Latter-day Saints in Present-Day Sight.1 By Gregory Grossman, University of California, Berkeley. All rights reserved. From 1847 to 1896 the Mormons ran a distinctive economic system in the we...
Date Added: 2009-01-09 06:24:30

intro1.pdf
Path: Mississippi State >> CHAPTER >> 1 Fall, 2009
Description: Chapter 1 - PLANNING AND DESIGN MANUAL INTRODUCTION Introduction This manual will provide technical guidance for the control of erosion, sediment, and stormwater from nonpoint sources (NPS) and for the preparation of erosion, sediment, and stormwater...
Date Added: 2009-04-15 21:27:46

hw7.pdf
Path: Delaware >> CISC >> 301 Fall, 2008
Description: CISC 301 Homework 7 Due on Tuesday November 15, 2005 NO LATE SUBMISSIONS 1. (10 + 5 = 15 points) a. Let M1 = (Q1 , , 1 , s1 , F1 ) and M2 = (Q2 , , 2 , s2 , F2 ) be two nite state automata. Construct a nite state automaton that accepts L(M1 ) L(M2 )...
Date Added: 2009-01-11 22:37:52

advancedIO.pdf
Path: George Mason >> CS >> 563 Fall, 2009
Description: ADVANCED I/O ISA 563: Fundamentals of Systems Programming Agenda File Locking File locking exercise Unix Domain Sockets Team Projects Time File Locking Background Both high-performance and general-purpose database systems require atomic ...
Date Added: 2009-04-16 01:09:52

outline chapter 23
Path: Michigan >> HISTORY >> 101 Spring, 2007
Description: APUSH Kaplan Chapter 23 Outline of pp. 667-684 I. March 19, 2007 II. The Republican Roosevelt A. Busting the Trusts 1. Roosevelt was young, non-isolationist President, believing the presidency to be a \"bully pulpit,\" a forum for ideas for the nati...
Date Added: 2008-08-21 19:40:22

MEDICALFORM.pdf
Path: Towson >> SOCI >> 370 Fall, 2008
Description: TOWSON UNIVERSITY STUDY ABROAD OFFICE MEDICAL SELF-ASSESSMENT AND RELEASE RETURN TO THE TOWSON UNIVERSITY STUDY ABROAD OFFICE BY DECEMBER 11 FOR MINIMESTER OR SPRING SEMESTER AND BY MAY 14 FOR SUMMER OR FALL SEMESTER. The TU Study Abroad Office stron...
Date Added: 2009-01-10 01:07:04

MEDICALFORM.pdf
Path: Towson >> KNES >> 285 Spring, 2008
Description: TOWSON UNIVERSITY STUDY ABROAD OFFICE MEDICAL SELF-ASSESSMENT AND RELEASE RETURN TO THE TOWSON UNIVERSITY STUDY ABROAD OFFICE BY DECEMBER 11 FOR MINIMESTER OR SPRING SEMESTER AND BY MAY 14 FOR SUMMER OR FALL SEMESTER. The TU Study Abroad Office stron...
Date Added: 2009-01-11 21:08:54

MEDICALFORM.pdf
Path: Towson >> KNES >> 470 Fall, 2008
Description: TOWSON UNIVERSITY STUDY ABROAD OFFICE MEDICAL SELF-ASSESSMENT AND RELEASE RETURN TO THE TOWSON UNIVERSITY STUDY ABROAD OFFICE BY DECEMBER 11 FOR MINIMESTER OR SPRING SEMESTER AND BY MAY 14 FOR SUMMER OR FALL SEMESTER. The TU Study Abroad Office stron...
Date Added: 2009-01-11 21:08:54

Get Started With Course Hero Today!

Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
 

Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners.

Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs.

What People Are Saying About Course Hero

“I was going to fail my Evidence exam, but then I found a great outline on Course Hero!”
- Kim Cowan, Cornell University



“I worked for tens of hours on my chemistry lab reports this semester, and now I can publish my hard work to thousands of people who care to read about what I found.”
- David Grauer, Princeton University




“Many times, students learn best from other students, their peers, rather than from a teacher.  Course Hero provides such a forum for students to teach students.”
- Somerset Perry, Georgetown University


“Course Hero is a great new research tool for college students.  Students can find lots of pertinent information to their studies that they previously could not find or have access to.  It’s for sure an educational innovation and potentially an educational revolution.”
- Andy Suiter, UCLA and UC Davis



“As a freshman, Course Hero will help me to decide what I am actually interested in studying in college.”
- Caity Feindt, Ithaca College



“I have found lecture notes on corporate finance created by students from multiple schools, which has really helped me learn more about the subject.”
- John Stacey III, UCSB



“I study less and learn more with Course Hero.”
- John Sweazey, CU-Boulder



 

Explore the benefits of joining Course Hero's social learning network.

Get millions of study materials now!

Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!

Click below to sign-up for FREE.
 

Get over 200,000 textbook solutions now!

Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.

Click below to sign-up for FREE.
 

Meet over 300,000 students and your fellow classmates now!

Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!

Click below to sign-up for FREE.
 

Course Hero is not sponsored or endorsed by any college or university.