Course Solutions And Notes - all3ans 32
| FILL_CommercialInvoice.pdf Path: UNC Wilmington >> BLA >> 361 Fall, 2009 Description: Print Reset Commerical Invoice Ship Date: Shipper: Consignee: Bill To: Country of Export: U.S.A No. of Pkgs./ Description Commodity Country of Origin Unit Weight (lbs) Unit Value Total Value Total No. of Pkgs: Total Weight: Total Invoice Value: E... Date Added: 2009-05-21 19:14:55 |
| cad2w09.pdf Path: Michigan >> EECS >> 522 Winter, 2008 Description: University of Michigan EECS 522: Analog Integrated Circuits Winter 2009 CAD 2 Issued 3/11/2009 Due 3/27/2009 In this assignment, you will design an LNA for the 900MHz ISM band. The LNA should meet the specifications ... Date Added: 2009-05-21 19:15:45 |
| 08-Arrays\\ArrayExerciseIncr.doc Path: Bentley >> CS >> 180 Fall, 2009 Description: Practice Problem: Arrays of Primitive Type. Find the longest increasing sub-sequence. The user will enter a set of 365 stock price values (daily value of stock). The program should output the longest increasing sequence and some other information abo... Date Added: 2009-05-21 19:17:06 |
| SampleExamQues4.pdf Path: Washington >> BIOL >> 220 Fall, 2008 Description: SAMPLE EXAM QUESTIONS Describe two approaches for studying human brain function. Sympathetic nerves exert their actions on the AV node by releasing the neurotransmitter norepinephrine that binds to beta-adrenoceptors, leading to an increase in intrac... Date Added: 2009-05-21 19:18:13 |
| Chapter2.pdf Path: Auburn >> INSY >> 8970 Fall, 2009 Description: Nonparametric Statistics The rc Contingency Tables Chapter 2 Maghsoodloo 2.1 A two-way contingency table consists of r rows and c columns, in which case it is called an rc contingency table. Each unit in the sample is classified according to at le... Date Added: 2009-05-21 19:20:13 |
| Uphoff_Reasons4Success_Ch2.pdf Path: Washington >> PBAF >> 531 Fall, 2009 Description: ... Date Added: 2009-05-21 19:22:50 |
| risc.txt Path: Michigan >> EECS >> 584 Fall, 2008 Description: Hard to do simple questions on this paper. Rather, it is good food for thought, and will probably get folded into a take home question. ... Date Added: 2009-05-21 19:24:04 |
| Exam1Sol.pdf Path: Arizona >> EEB >> 320 Fall, 2008 Description: Dr. Ted\'s comments on Exam 1. It is clear, from an average of 71 and median of 75, that many really know what is going on in this central-dogma-centric part of the course. A few comments. 1. It was clear that some still need to figure out that DNA p... Date Added: 2009-05-21 19:24:10 |
| key-e1-07.doc Path: Auburn >> MECH >> 3130 Spring, 2008 Description: Name:_ MECH 3130: Mechanics of Materials Spring 2006 (Feb. 22, 2007) Mid-Term Examination: I 1. (Figure-1) The elastic portion of the stress-strain diagram for an alloy is shown. The specimen from which it was obtained had an original diameter of 13 ... Date Added: 2009-05-21 19:24:10 |
| L11WhileLoops.ppt Path: UMBC >> CS >> 104 Fall, 2009 Description: The while Looping Structure Topics The while Loop Program Versatility Sentinel Values and Priming Reads Checking User Input Using a while Loop Reading Section 3.7 Review: Repetition Structure A repetition structure allows the programmer... Date Added: 2009-05-21 19:27:22 |
| For.pathsharpforce.pdf Path: N. Illinois >> BIOS >> 493 Fall, 2008 Description: Forensic Pathology Wounds differ according to weapon used Patterns of injury are characteristic However, different angles, body areas and other factors can make injury from a single weapon look different Weapons may be any object Weapon may be u... Date Added: 2009-05-21 19:28:08 |
| classgel.pdf Path: N. Illinois >> BIOS >> 493 Fall, 2008 Description: 1. Sample # CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_060222138S CH1.A02_06... Date Added: 2009-05-21 19:28:15 |
| Balkan Insight No.68.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: From: Balkan Investigative Reporting Network [info@birn.eu.com] Sent: Thursday, February 01, 2007 11:43 AM To: Bove, Roger Even Subject: Balkan Insight No.68 * BIRN\'S BALKAN INSIGHT, No.68, February 1, 2007 * - www.birn.eu.com -- In this issue... Date Added: 2009-05-21 19:29:05 |
| final_practice.pdf Path: UVA >> CS >> 414 Fall, 2008 Description: Computer Science 414Operating Systems Final Exam Study Questions 1 1. After a TLB miss on the VAX, the page-table lookup is managed by hardware. This means that the page-table format is defined as part of the architecture. Unfortunately that defini... Date Added: 2009-05-21 19:30:07 |
| hints4.pdf Path: UVA >> PHYS >> 521 Fall, 2008 Description: Assignment 4 Hints 3.11 In part (a), I found it easiest to work backwards: show that - y (/y) = const implies the Euler-Lagrange equations. In part (b), to set up the integral use dU = gydm = mgy ds l (1) for mass element dm occupying arc length ... Date Added: 2009-05-21 19:30:47 |
| Lab6_full_wave_peak_rectifier.pdf Path: Idaho >> ECE >> 311 Fall, 2008 Description: ECE 311 Fundamentals of Electronics Lab Page 1 of 6 Full Wave Peak Rectifier Design ECE 311 - Fundamentals of Electronics Lab Department of Electrical and Computer Engineering University of Idaho Title: Full Wave Peak Rectifier Design Goal: To desi... Date Added: 2009-05-21 19:31:25 |
| HW2.pdf Path: Sanford-Brown Institute >> CSCI >> 2950 Fall, 2009 Description: CS295-7 Homework #2 Due before class on Feb. 23 Goals 1. To familiarize you with linear filtering and regression. 2. To provide you with a baseline decoding algorithm to which you can refer later. 3. To get you used to using Matlab to quickly implem... Date Added: 2009-05-21 19:32:00 |
| L7.pdf Path: Idaho >> ECE >> 240 Fall, 2008 Description: ECE 240: Session 6; Page 1/3 ECE 240: Lecture 7 Important considerations with either logic family: 1) Noise: outside disturbances that can cause spurious changes in logic levels. Sources include: a) power supply disturbances (switching circuit brea... Date Added: 2009-05-21 19:32:10 |
| HW2.pdf Path: Sanford-Brown Institute >> CS >> 295 Fall, 2009 Description: CS295-7 Homework #2 Due before class on Feb. 23 Goals 1. To familiarize you with linear filtering and regression. 2. To provide you with a baseline decoding algorithm to which you can refer later. 3. To get you used to using Matlab to quickly implem... Date Added: 2009-05-21 19:32:43 |
| janete.ppt Path: Sanford-Brown Institute >> CSCI >> 0920 Fall, 2009 Description: What is your name? Marlene practice fight fires Explore the Firehouse Helmets Hose Firehouse Fire truck Firefighter Fire extinguisher Explore the Classroom Fire extinguisher Firehouse Helmets Fire truck Firefighter Welcome to Providence, ... Date Added: 2009-05-21 19:32:57 |
| Introduction08-09.pdf Path: FAU >> CAG >> 0809 Fall, 2009 Description: INTRODUCTION This Crisis Action Guide was developed by the Florida Atlantic University Safety Committee in an attempt to provide pertinent information for the University Community to respond to an emergency or crisis. Since no document can include ev... Date Added: 2009-05-21 19:34:07 |
| Unit2Overview.pdf Path: Penn State >> EGEE >> 102 Fall, 2008 Description: Unit 2, Overview: Environmental Consequences Welcome to Unit 2, Environmental Consequences. So far what we have learned is basically- we have looked at what is energy, units, sources, where the energy is coming from, and in chapter 2 we have already ... Date Added: 2009-05-21 19:36:55 |
| errmsg.txt Path: Coker >> CS >> 220 Fall, 2009 Description: /* Copyright Abandoned 1997 TCX DataKonsult AB Detron HB This file is public domain and comes with NO WARRANTY of any kind Translated into Romanian by Stefan Saroiu e-mail: tzoompy@cs.washington.edu */ character-set=l... Date Added: 2009-05-21 19:39:38 |
| 13.pdf Path: Hartford >> CS >> 220 Fall, 2009 Description: Case Study: The Polish Notation 13 T studies the Polish notation for arithmetic or logical expressions, first in terms of problem solving, and then as applied to a program that interactively accepts an expression, compiles it, and evaluates it. Th... Date Added: 2009-05-21 19:40:12 |
| exam1.pdf Path: UVA >> EVSC >> 350 Fall, 2008 Description: ... Date Added: 2009-05-21 19:41:05 |
| vanwiemj029.pdf Path: Texas >> VANWIEMJ >> 029 Fall, 2009 Description: Copyright by Michael James Van Wie 2002 The Dissertation Committee for Michael James Van Wie Certifies that this is the approved version of the following dissertation: DESIGNING PRODUCT ARCHITECTURE: A SYSTEMATIC METHOD Committee: Kristin L. Wood... Date Added: 2009-05-21 19:42:34 |
| 00000007.pdf Path: Carnegie Mellon >> TERA >> 05102449 Fall, 2009 Description: ... Date Added: 2009-05-21 19:44:02 |
| 00000007.pdf Path: Carnegie Mellon >> DISK >> 05102449 Fall, 2009 Description: ... Date Added: 2009-05-21 19:44:02 |
| EE434_031207.pdf Path: Maryland >> EE >> 434 Spring, 2002 Description: ... Date Added: 2009-05-21 19:45:13 |
| non-profit-sports.pdf Path: Penn State >> IST >> 331 Fall, 2008 Description: School of Information Sciences and Technology The Pennsylvania State University Web Usability Analysis in a Non Profit Sports Organization Justin Burdett, Michael Collins, Andrea Kopolow jsb314@psu.edu, msc227@psu.edu, ajk5055@psu.edu 17 December 20... Date Added: 2009-05-21 19:47:52 |
| 3--2001-7-27.txt Path: Texas >> PSY >> 394 Fall, 2009 Description: Today was boring. Dave got back from work around 12 or 1 (in the afternoon) so I slept alone most of the night, even thought I ended up falling asleep at 7am. I got up and worked on my math homework for my class, watched judge judy, and then went to ... Date Added: 2009-05-21 19:48:45 |
| 4LP criterion of meaning.doc Path: Texas >> PSY >> 387 Fall, 2008 Description: Logical positivist criterion of meaningfulness (for nonanalytic statements) Strong version: The literal semantic content of the statement must be completely reducible to empirical observations statements. Weak version: The statement must be empirical... Date Added: 2009-05-21 19:49:37 |
| KG Correlation Questionaire.doc Path: Texas >> PSY >> 418 Fall, 2008 Description: Correlation Questionnaire Reflect on yourself while answering the following questions. 1 2 3 4 5 6 7 Disagree Neutral Agree Strongly Strongly I see m... Date Added: 2009-05-21 19:49:50 |
| lecture7-07.ppt Path: Texas >> PSY >> 341 Fall, 2008 Description: Lab Reports: Introduction: Development of eye trackers Why study eye movements Goal of current experiment Terminology - Focus/fixate Results: Describe what you measured. Justify choice of measure. Tables & Figures Describing Figs in the text. Standa... Date Added: 2009-05-21 19:50:39 |
| Trull2000.pdf Path: Texas >> PSY >> 394 Fall, 2009 Description: Clinical Psychology Review, Vol. 20, No. 2, pp. 235253, 2000 Copyright 2000 Elsevier Science Ltd. Printed in the USA. All rights reserved 0272-7358/00/$see front matter PII S0272-7358(99)00028-8 BORDERLINE PERSONALITY DISORDER AND SUBSTANCE USE DI... Date Added: 2009-05-21 19:50:50 |
| lect15.ppt Path: ASU >> CSE >> 430 Fall, 2008 Description: Announcements q Today: Lecture 15 Real Time Scheduling RMS EDF q Reading for next class Ch 7: 7.1-2 q Exam and Assignments Turn in HW#4 now project and midterm grades are available CSE 430 S04 1 Real-Time Scheduling q Hard real-time sy... Date Added: 2009-05-21 19:51:54 |
| midreview.pdf Path: UCSC >> AMS >> 162 Fall, 2008 Description: Mid-Quarter Review Problems 1. When you enter your password while logging onto a computer, suppose there is a 1% chance that you will mis-type your password. (a) In five tries, what is the probability that you will correctly enter your password all f... Date Added: 2009-05-21 19:52:08 |
| c17-30integrals.pdf Path: Centre >> M >> 171 Fall, 2009 Description: A Template for Evaluating Integrals When approaching an integral, you should have the following checklist of integration techniques in mind. They are listed roughly in order of preference. 1. Basic Integrals: See the inside the front cover, pp 383, ... Date Added: 2009-05-21 19:53:41 |
| Lab4AnswerSheet.pdf Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: Lab4 Answer Sheet Report on Configuration VxWorks Overridden Properties Subjects: CG Metaclasses: CGGeneral Properties: GeneratedCodeInBrowser: False PACKAGES Default EVENTS: evAlarm An Alarm has occured somewhere in the system. The alarm type is in... Date Added: 2009-05-21 19:54:55 |
| HW1.rtf Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: constructor 1 called line 1 constructor 2 called line 2 destructor 2 called line 3 constructor 3 called line 4 destructor 3 called line 5 destructor 1 called Press any key to continue ... Date Added: 2009-05-21 19:57:06 |
| rvenkat1_FinalOutline.pdf Path: Santa Clara >> COEN >> 288 Fall, 2009 Description: http:/cseserv.engr.scu.edu/TrialPapers/rvenkat1/rvenkat1_FinalOutline.htm Ethical issues of Bioinformatics and Biocomputing 1. Introduction The rapid growth of computer processing capability and significant development in computer networking and com... Date Added: 2009-05-21 19:57:51 |
| ljohnson_midtermOutline.pdf Path: Santa Clara >> COEN >> 288 Fall, 2009 Description: Lucas Johnson Page 1 of 2 Lucas Johnson 4/19/04 COEN 288 Midterm Outline Introduction Discuss the policies of censorship in Singapore. Discuss the policies of censorship in China. Analyze the implications of each policy. Own personal thoughts Concl... Date Added: 2009-05-21 19:58:25 |
| Time Allocation.xlsx Path: CSU Long Beach >> ENGR >> 302 Fall, 2009 Description: Departments: Elements to be completed Pivoting Rotor Blade Charging System Silt/Debris Deflection Device Rotor Blade Speed controller with simple computer integration General research from real world applications with case studies Research Design Con... Date Added: 2009-05-21 20:00:23 |
| az1283review.pdf Path: Arizona >> AZ >> 1283 Fall, 2008 Description: Review of the 2001 Arizona Cotton Season Jeffrey C. Silvertooth According to the Arizona Agricultural Statistics Service (USDA), a total of 285,500 acres were planted to cotton in 2001. Approximately 278,000 acres consisted of Upland (Gossypium hirsu... Date Added: 2009-05-21 20:03:17 |
| az1442a1.pdf Path: Arizona >> AZ >> 1442 Fall, 2009 Description: Comparisons of Prism , Trilogy , Baythroid XL, and Steward for Control of Summer Alfalfa Insects Michael D. Rethwisch, Anna Grimm and Michael T. Williams Abstract Three insecticides an d one herbicide (Prism ) were evaluated efficacy against summer ... Date Added: 2009-05-21 20:03:20 |
| matrix.pdf Path: ASU >> MATH >> 342 Fall, 2009 Description: og6tv W i q` g V b q x bV XV Tx bV T R q` g T PX q X V` ` R g`x x R` x bV `x q q` g T PX q X Tx bV T R yTYUrYkcY(YcYUmicrTd(crTUU~oHyVcYWUYscYHUruU\"(yTYd(crTUi6YU) q` g V b q x bV XV q X g qV R h TI d x qV e... Date Added: 2009-05-21 20:03:27 |
| 15integral.pdf Path: ASU >> MATH >> 473 Fall, 2009 Description: MAT 473 Intermediate Real Analysis II John Quigg Integrable functions Notation and Terminology. Thoughout this section X will denote a Euclidean space. Denition 1. Let f be a measurable function. (1) The Lebesgue integral of f is f= f (x) dx := f+ f... Date Added: 2009-05-21 20:03:30 |
| Compact_121502_excel.pdf Path: WVUP >> SB >> 653 Fall, 2009 Description: UNIFORM STATEWIDE COMPACT DATA REPORT DECEMBER 15, 2002 WVU AT PARKERSBURG Uniform Statewide Compact Data Report WVU at Parkersburg Item Data Provider Base Year Base Year Data Current Year Goal Year AY 2001-02, except where otherwise noted Enroll... Date Added: 2009-05-21 20:03:53 |
| sciencequiz.doc Path: NMSU >> EDLT >> 36802 Fall, 2009 Description: 1. Explain how to find the number of protons of an element. 2. Explain how to find the number of neutrons in an element if you know that element\'s number of protons and atomic mass. 3. If the atomic number of an element is given, can you determine... Date Added: 2009-05-21 20:04:51 |
| lecture12_protocols_standards_3.pdf Path: George Mason >> ECE >> 646 Fall, 2008 Description: Lecture 12 Security Protocols Cryptographic Standards Companies Developing Cryptographic Hardware Secure Communication Systems (e.g., DMS) Security protocols (e.g., S-MIME, SSL, IPSec) Security mechanisms (e.g., digital signatures) Algorithms (e.g.,... Date Added: 2009-05-21 20:06:02 |
| final03.ps Path: Carnegie Mellon >> CS >> 15781 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: final03_v3.dvi %Pages: 18 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f final03_v3 %DVIPSPa... Date Added: 2009-05-21 20:07:56 |
| 15.pdf Path: Princeton >> CS >> 126 Fall, 2008 Description: Linked vs. Sequential Allocation 4.1: Linked Structures \"The name of the song is called \'Haddocks\' Eyes.\' \" \"Oh, that\'s the name of the song, is it?\" Alice said, trying to feel interested. \"No, you don\'t understand,\" the Knight said, looking a littl... Date Added: 2009-05-21 20:08:29 |
| LAP_Newton.doc Path: Valdosta >> MATH >> 4161 Fall, 2008 Description: Lea Newton Math 4161 Musical Fractions This project teaches the students how music and fractions are interrelated. Since middle school students are already familiar with fractions, this project reviews common knowledge and introduces unfamiliar music... Date Added: 2009-05-21 20:09:29 |
| lecture10.pdf Path: University of San Francisco >> CS >> 411 Fall, 2009 Description: Automata Theory CS411-2007F-10 Non-Context-Free Langauges Closure Properties of Context-Free Languages David Galles Department of Computer Science University of San Francisco 10-0: Fun with CFGs L = {0n 1n 2n : n > 0} {012, 001122, 000111222, 00001... Date Added: 2009-05-21 20:09:49 |
| doc.pdf Path: BYU >> HASH >> 011 Fall, 2009 Description: ... Date Added: 2009-05-21 20:10:36 |
| CS 172-00, Spring 2005 Midterm2.pdf Path: University of Montana >> CS >> 172 Fall, 2008 Description: CS 172-00, Spring 2005 Midterm 2 Midterm 2 Read the instructions carefully! 1 - Put your last name, first name, and midterm 2 on your scantron. 2- Fill in your ID number (starting with 7xx-xx-xxx) and fill boxes for them. 3- Fill in A for the test ... Date Added: 2009-05-21 20:11:33 |
| CS240A07.ppt Path: UCSB >> CS >> 240 Fall, 2009 Description: CS 240A Lecture 7 Parallelism in simulation I Course project discussion HW2 update (Viral, after break) Physical simulation paradigms: Discrete event systems Particle systems Lumped (ODE) systems Continuous (PDE) systems Jim Demmel\'s slides:... Date Added: 2009-05-21 20:12:21 |
| ps05-08.1.pdf Path: Caltech >> PH >> 136 Fall, 2009 Description: Ph 136: Solution for Chapter 5 (revised by Nate Bode, Dan Grin, Georey Lovelace and Kip Thorne) A 5.2 Filters [by Georey Lovelace(a-e) and Nate Bode(a)] (a) Equation (5.42) explains how to nd the ltered spectral density Sw from the unltered spectra... Date Added: 2009-05-21 20:12:43 |
| syllabus221-378.pdf Path: Wisconsin >> MATH >> 22108 Fall, 2008 Description: Syllabus for MATH 221, Section 378 Calculus & Analytic Geometry I Fall 2008 Course: Lecture: MWF 11:0011:50, Van Vleck B102 Discussion: TR 12:0512:55, Van Vleck B329 Teaching Assistant: Alison Gordon Office: Phone: Email: Office Hours: 722 Van Vleck... Date Added: 2009-05-21 20:13:13 |
| Sample Thesis Statements.doc Path: Middlebury >> WP >> 101 Fall, 2009 Description: Sample Thesis Statements Your thesis statement should summarize the main idea of your paper. Place it as the last sentence in your introductory paragraph. Examples of thesis statements: * \"The simple vocabulary and rhyming lines of Dr. Seusss books ... Date Added: 2009-05-21 20:14:02 |
| mar25_inclass.pdf Path: Wheaton MA >> MATH >> 236 Fall, 2009 Description: 1. Let f (x, y ) = 4xy - x 3 - 2y 2 1.1 Find and classify all critical points of f . 1.2 Find the maximum and minimum values of f (x, y ) on the unit disk {(x, y ) | x 2 + y 2 1} Hint: Parametrize the boundary. 2. Let g (x, y ) = e x + y 4 - x 3 + ... Date Added: 2009-05-21 20:15:28 |
| Lecture_8_5230_2006F.ppt Path: UMDNJ >> BINF >> 5230 Fall, 2009 Description: BLAST sequence analysis Lecture 8 BINF 5230 Spring 2006 1 Lecture 8. BLAST sequence analysis Review of the previous lecture Nucleotide and Protein Databases. Query sequences Blast programs Gapped Blast Deciphering the Output Descriptions of s... Date Added: 2009-05-21 20:16:11 |
| HowToSAS.pdf Path: UMDNJ >> BINF >> 5035 Fall, 2009 Description: How to run example problem (House Sales) in Lesson Slides using SAS Learning Edition BINF5035 Shankar Srinivasan Right Click in this title bar to select Properties to include labels and also change default data type from Character to Numeric Leave ... Date Added: 2009-05-21 20:17:21 |
| SASHelp.doc Path: UMDNJ >> BINF >> 5075 Fall, 2009 Description: SAS FUNCTIONS: Index A SAS function performs a computation or system manipulation on arguments and returns a value.Most functions use arguments supplied by the user, but a few obtain their arguments from the host operating environment. Function ... Date Added: 2009-05-21 20:18:51 |
| Ideal_gases.pdf Path: UCSB >> CHE >> 210 Fall, 2009 Description: Ideal gases ChE210A Up until now, most of what we have discussed has involved general relationships among thermodynamic quantities that are valid for any substance or system. The fundamental equation, reversibility, Legendre transforms, and Maxwell... Date Added: 2009-05-21 20:19:26 |
| ANOVA.doc Path: Penn State >> STAT >> 401 Fall, 2008 Description: Stat 401 Lab Activity 8: ONE-WAY ANOVA 1) The basic procedure. ANOVA is an acronym for Analysis Of Variance. It is a methodology for testing hypotheses regarding population means in various contexts. One-way ANOVA refers to the methodology for testin... Date Added: 2009-05-21 20:23:46 |
| HW1 Sp09.pdf Path: Berkeley >> EE >> 235 Fall, 2009 Description: EE C235 / NSE C203 Nanoscale Fabrication (Spring 2009) Prof. Connie Chang-Hasnain Homework 1 Due date: 03/02/09, by 2:40pm in class Problem 1 Density of States: We have derived the 3D, 2D, 1D and 0D density of states (DOS) in the class. Please answ... Date Added: 2009-05-21 20:24:16 |
| avr_design.txt Path: Wilfrid Laurier >> CPSC >> 425 Fall, 2009 Description: Design Document for AVR Port - The first release will support all AVR architectures except ATMega & ATtiny (i.e. all variants with 64K or less of code/data space will be supported) All functions will be REENTRANT . I) Language extensions. - a) St... Date Added: 2009-05-21 20:25:59 |
| Math1132Q1.pdf Path: UConn >> MATH >> 1132 Fall, 2009 Description: MATH1132 Quiz 1 Name: The majority of the credit you receive is based on the completeness and the clarity of your responses. Show all of your work! e5 (5 points) 1. Evaluate 1 ln x dx. x (5 points) 2. Evaluate x sin(2 + x3/2 )dx. Page 1 o... Date Added: 2009-05-21 20:26:50 |
| 20onRecursion.pdf Path: UMBC >> CSEE >> 331 Fall, 2009 Description: Lisp privileges recursion On Recursion an Honors University in Maryland Lisp has lots of powerful iteration functions Yet recursion is still very important to Lisp There are many reasons: its powerful and it elegant; its natural for processing it r... Date Added: 2009-05-21 20:27:24 |
| andersonscience.pdf Path: UCSB >> PH >> 225 Fall, 2009 Description: The Apparent Existence of Easily Deflectable Positives Author(s): Carl D. Anderson Source: Science, New Series, Vol. 76, No. 1967 (Sep. 9, 1932), pp. 238-239 Published by: American Association for the Advancement of Science Stable URL: http:/www.jsto... Date Added: 2009-05-21 20:29:03 |
| Q8_145_spr09.pdf Path: Wisc La Crosse >> MATH >> 145 Fall, 2009 Description: Name Instruction: Include your solutions to get full credit. Quiz #8 1. In a sample of 200 students, 140 are enrolled in an English course, 120 are enrolled in a Mathematics course, and 80 are enrolled in both. Let E and M denote the events of rand... Date Added: 2009-05-21 20:29:06 |
| OR542HW1.pdf Path: George Mason >> OR >> 542 Spring, 2008 Description: OR 542 Stochastic Models Problem Set #1 - Probability Review 1. If we draw one card from a 52 card deck, what is the probability that it is red? That it is a diamond? That it is an ace? That it is the ace of diamonds? 2. A pair of dice is rolled once... Date Added: 2009-05-21 20:29:33 |
| 12525.pdf Path: East Los Angeles College >> HEA >> 12525 Fall, 2009 Description: PROGRAMME DETAIL SPECIFICATION Programme Summary 1 Awarding institution 2 Teaching institution university 3a Programme accredited by: 3b Description of accreditation 4 Final award 5 Programme title 6 UCAS code 7 Subject benchmark statement Liverpoo... Date Added: 2009-05-21 20:30:52 |
| section3.1.pdf Path: Berkeley >> STAT >> 215 Fall, 2008 Description: ... Date Added: 2009-05-21 20:32:03 |
| 3705x3notedone.pdf Path: Youngstown >> CC >> 0061 Fall, 2009 Description: ! ! \" $ ( % # # ) # \" # 3 # 4+ \") $\"5+ 3 6 ) . ( # ) * # ; \' $ ( 7 : = # # + # \" ) ) / 1 ! 8 \"5 3 : 3 3 0 # \" \" \"$ \"( \"... Date Added: 2009-05-21 20:33:49 |
| foundational_calculi.pdf Path: Delaware >> CIS >> 670 Fall, 2009 Description: t t av uIC p i 3 C ! A # 8 7 5 3 C \' ! ! # \' b ! g ) # 8 7 ! d C ! b $ 7 H ! $ H W U ! T C ( # ) \' 5 # ) 8 5 P # ! \' H F 7 ) 3 C ! A # 8 7 5 3 1 ) ( $ # ! EDBB9@ fBE6VVV%%2B%S2RQIGBEDBB9@ 94\"6420%\" ... Date Added: 2009-05-21 20:35:11 |
| L11WhileLoops.ppt Path: UMBC >> CSEE >> 104 Spring, 2001 Description: The while Looping Structure Topics The while Loop Program Versatility Sentinel Values and Priming Reads Checking User Input Using a while Loop Reading Section 3.7 Review: Repetition Structure A repetition structure allows the programmer... Date Added: 2009-05-21 20:48:46 |
| assign07.pdf Path: UNL >> MATH >> 496 Fall, 2008 Description: Math 496-004 Due: Oct 13th 1. Let f (x, y) = (y - x2 )(y - 2x2 ). Assignment # 7 8 Oct 08 (a) Show that the origin is a critical point of f and the two-variable second derivative test fails at the origin. (b) Show that, if g : R R is the restrict... Date Added: 2009-05-21 21:01:34 |
| lect26.pdf Path: UNC >> COMP >> 144 Fall, 2008 Description: COMP 144 Programming Language Concepts Lecture 26: Introduction to Logic Programming with Prolog March 25, 2002 The University of North Carolina at Chapel Hill COMP 144 Programming Language Concepts Spring 2002 Lecture 26: Introduction to Logic P... Date Added: 2009-05-21 21:08:40 |
| PastureFertilization.pdf Path: LSU >> NR >> 484 Fall, 2009 Description: ... Date Added: 2009-05-21 21:17:58 |
| 32kx8_SRAM_CY7C199.pdf Path: UF >> DOCS >> 4744 Fall, 2009 Description: 99 CY7C199 32K x 8 Static RAM Features High speed - 10 ns Fast tDOE CMOS for optimum speed/power Low active power - 467 mW (max, 12 ns \"L\" version) Low standby power - 0.275 mW (max, \"L\" version) 2V data retention (\"L\" version only) Easy mem... Date Added: 2009-05-21 21:23:35 |
| 2007Lecture1.pdf Path: St. Thomas >> ES >> 111 Fall, 2009 Description: Lecture #1-3: Assignments and Topics (1) Topics: Introduction and Overview of the Course Flowcharting and Pseudocode Variables and Arrays (scalars, vectors, and matrices) Assigning variables and arrays First programs - sum data, find max, sort ... Date Added: 2009-05-21 21:25:01 |
| b6b-113.pdf Path: Texas El Paso >> CHEM >> 0608 Fall, 2009 Description: College of Science Bell Hall 100 747-5536 The University of Texas at El Paso El Paso, Texas 79968-0509 Updates: Bachelor of Science Degree Plan Chemistry - Computer Science Minor (128/45) Name Major: Chemistry Department Chair: Dr. Jorge Gardea-To... Date Added: 2009-05-21 21:25:24 |
| ex1.pdf Path: Berkeley >> E >> 240 Fall, 2008 Description: Econ. 240B, Second Half Daniel McFadden, 2001 EXERCISE 1. GROWTH AND EXIT OF FIRMS (To be handed in on Nov. 2) Firms exit through acquisition, merger, buyout, and dissolution. Economists are interested in the factors that contribute to exit. For ex... Date Added: 2009-05-21 21:26:20 |
| ENGG1803%20Ess_Q%20&%20Rep_guide_08.pdf?PHPSESSID=1f85aa728f359465295ac33787020c83 Path: Allan Hancock College >> ENGG >> 1803 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>32d1d537ed498ed1b50ed8365a6e86c78172bbeb.pdf %3FPHPSESSID</Key><RequestId>DD89E366E7FB4811</RequestId><HostId>Mj/0cHjzScjkGie... Date Added: 2009-05-21 21:29:43 |
| pgabar20002000n162560.txt Path: Allan Hancock College >> PGABAR >> 20002000 Fall, 2009 Description: PRODUCT GRANTS AND BENEFITS ADMINISTRATION REGULATIONS 2000 2000 NO. 162 PRODUCT GRANTS AND BENEFITS ADMINISTRATION REGULATIONS 2000 2000 NO. 162 - TABLE OF PROVISIONS 1. Name of Regulations 2. Commencement 3. Definitions 4. Meaning ... Date Added: 2009-05-21 21:31:59 |
| vbh065ch7.ppt Path: Allan Hancock College >> VBH >> 065 Fall, 2009 Description: VBH065 MULTIMEDIA PROJECT MANAGEMENT Chapter 7 (based on slides by T.Ganly and S. O\'Sullivan) April 28, 2009 Prepared by Steve Voudouris CIT Department 1 REFERENCES: Chapter 7 of: PROJECT MANAGEMENT TECHNIQUES - Module 211 Pond, R & Tseng, W. Dis... Date Added: 2009-05-21 21:34:25 |
| siar20056n332o2005772.txt Path: Allan Hancock College >> SIAR >> 20056 Fall, 2009 Description: [pic] Superannuation Industry (Supervision) Amendment Regulations 2005 (No. 6)1 Select Legislative Instrument 2005 No. 332 I, PHILIP MICHAEL JEFFERY, Governor-General of the Commonwealth of Australia, acting with the advice o... Date Added: 2009-05-21 21:34:54 |
| gmb2004122_2.txt Path: Allan Hancock College >> GMB >> 2004122 Fall, 2009 Description: 2004 THE LEGISLATIVE ASSEMBLY FOR THE AUSTRALIAN CAPITAL TERRITORY GAMING MACHINE BILL 2004 Government Amendments ... Date Added: 2009-05-21 21:34:56 |
| duma.txt Path: Allan Hancock College >> PHYSICS >> 0311 Fall, 2009 Description: bra: diagram.jpg duma: Az SN 1998bu visszfnynek nem mretarnyos geometriai modellje. Mindkt gyrt az eltrben lev porfelhkrl a Fld irnyba reflektld fnysugarak hozzk ltre. ... Date Added: 2009-05-21 21:35:26 |
| RcodeChap1_1.txt Path: Idaho >> STAT >> 514 Fall, 2008 Description: # The exact upper tail binomial probability for Example 1.1.2 # Note that pbinom is the CDF for the binomial distribution > 1 -pbinom(25, 40, .5) [1] 0.04034523 # Normal approximation with continuity correction > 1 -pnorm(1.74,0,1) [1] 0.0409... Date Added: 2009-05-21 21:38:22 |
| Assignment1-Groups.pdf Path: Case Western >> ASSIGNMENT >> 238 Fall, 2009 Description: USNA 238 Spring 2009 Assignment #1: Group Members Group 1 Piezo-Electric Materials: Nick Lorenzo (nal20) Sean Snack (ses74) Group 2 Cement (Roman): Kriste Susinskas (kms95) Logan Akamatsu (laa13) Group 3 Semiconductors: Andy Shaver (ats23) ... Date Added: 2009-05-21 21:38:54 |
| Assignment1-Groups.pdf Path: Case Western >> DMSEG >> 238 Fall, 2009 Description: USNA 238 Spring 2009 Assignment #1: Group Members Group 1 Piezo-Electric Materials: Nick Lorenzo (nal20) Sean Snack (ses74) Group 2 Cement (Roman): Kriste Susinskas (kms95) Logan Akamatsu (laa13) Group 3 Semiconductors: Andy Shaver (ats23) ... Date Added: 2009-05-21 21:38:54 |
| Assignment1-Groups.pdf Path: Case Western >> USNA >> 238 Fall, 2009 Description: USNA 238 Spring 2009 Assignment #1: Group Members Group 1 Piezo-Electric Materials: Nick Lorenzo (nal20) Sean Snack (ses74) Group 2 Cement (Roman): Kriste Susinskas (kms95) Logan Akamatsu (laa13) Group 3 Semiconductors: Andy Shaver (ats23) ... Date Added: 2009-05-21 21:38:54 |
| lecture30.pdf Path: Colorado >> CS >> 3308 Fall, 2004 Description: Kernel Debugging? Operating System sits on the Hardware Debugging Tools Additional Tools for Debugging in Hard Situations Guest Lecture by Brad Morrey December 3, 2004 How to debug? User-Level Operating Systems UML (http:/user-mode-linux.sourc... Date Added: 2009-05-21 21:39:33 |
| ma129D-examinfo.pdf Path: Charleston Law >> MA >> 129 Fall, 2009 Description: MA 129 (D) - EXAM INFORMATION DATE : Wednesday, April 8, 2009 TIME : 2:00 pm DURATION : 2 hours LOCATION : Athletic Complex Please be there at the latest at 1:40 pm as the exam will start on time and there are 600 students writing an exam in AC. Plea... Date Added: 2009-05-21 21:39:34 |
| 346Chapter8.doc Path: Frostburg >> MCOM >> 346 Fall, 2008 Description: 346 Chapter Eight Study Guide ~ Challenging the Dominant Paradigm: Children, Systems, and Effects Define and know the following terms: Systems theory: Social Cognitive theory: Television Violence theories: Violence, effects children: Social learning:... Date Added: 2009-05-21 21:40:25 |
| 346Chapter8.doc Path: Frostburg >> FACULTY >> 346 Fall, 2009 Description: 346 Chapter Eight Study Guide ~ Challenging the Dominant Paradigm: Children, Systems, and Effects Define and know the following terms: Systems theory: Social Cognitive theory: Television Violence theories: Violence, effects children: Social learning:... Date Added: 2009-05-21 21:40:25 |
| ME539-w2-NNets_notes.pdf Path: Oregon State >> ME >> 539 Fall, 2008 Description: ME 539, Fall 2008: Learning-Based Control Neural Network Basics 10/1/2008 & 10/6/2008 Kagan Tumer University Oregon State Neural Network Basics Questions? Announcement: Homework 1 has been posted Due Friday 10/10/08 at noon Reading assignmen... Date Added: 2009-05-21 21:40:27 |
| csce548-lect11.ppt Path: Los Angeles Southwest College >> CSCE >> 548 Fall, 2009 Description: CSCE 548 Secure Software Development Security Operations Reading This lecture: Security Operations, McGraw: Chapter 9 Bridging the Gap between Software Development and Information Security, Kenneth R. van Wyk and Gary McGraw, http:/www.computer... Date Added: 2009-05-21 21:40:42 |
| 380spring2008.pdf Path: University of Montana >> CAS >> 1126 Fall, 2009 Description: University of Montana College of Forestry TH, Jour. 306. Spring 2008. __ Office hours: 1-2:15 T, TH & by Prof. Martin Nie 402 Clapp Bldg. appointment only Telephone: 243-6795 Email:... Date Added: 2009-05-21 21:41:15 |
| Introduction.ppt Path: CSU San Marcos >> CS >> 331 Fall, 2009 Description: Computer Architecture Dr. Xiaoyu Zhang Cal State San Marcos 1 Why Study Computer Architecture? You want to call yourself a \"computer scientist\" You want to build software people use (need performance) You need to make a purchasing decision or... Date Added: 2009-05-21 21:41:49 |
| chelsea102103.pdf Path: Appalachian State >> HIS >> 1101 Fall, 2009 Description: I. All of the following are all characteristics of the Book of Changesexcept: A) a book of divination B) book of sayings by Confucius C) has the idea that everything is cyclical D) \'wuji\' 2. This book, , is a collection of wise sayings for Taoism. 3.... Date Added: 2009-05-21 21:43:45 |
| lectureExamples04.pdf Path: Washington >> M >> 120 Fall, 2009 Description: Math 120 lecture examples - Lecture 4 1. Following up on the cat example from last time, how small would the circle of mud have to be so that the cat would miss it completely? Math 120 lecture examples - Lecture 4 2. Suppose that in 1980, Steve wa... Date Added: 2009-05-21 21:45:06 |
| JJLEEFridge.rtf Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: Fridge Report on Configuration Fridge Overridden Properties Subjects: CG Metaclasses: CGGeneral Properties: GeneratedCodeInBrowser: True PACKAGES Default Overridden Properties Subjects: CG Metaclasses: Package Properties: GenerateWithAggregates: Tru... Date Added: 2009-05-21 21:45:59 |
| soft_lab3.pdf Path: Berkeley >> EE >> 141 Fall, 2008 Description: UNIVERSITY OF CALIFORNIA College of Engineering Department of Electrical Engineering and Computer Sciences Last modified on September 3, 2004 by Stanley Wang and Henry Jen (sbtwang@eecs.berkeley.edu) Borivoje Nikolic 1. Objective There are two primar... Date Added: 2009-05-21 21:46:50 |
| 00000030.pdf Path: Carnegie Mellon >> DISK >> 05101288 Fall, 2009 Description: ... Date Added: 2009-05-21 21:48:52 |
| 00000030.pdf Path: Carnegie Mellon >> TERA >> 05101288 Fall, 2009 Description: ... Date Added: 2009-05-21 21:48:52 |
| draft-2.doc Path: Kennesaw >> IS >> 8826 Fall, 2008 Description: The Help Desk of the Future in Sunrise Chemical Corporation Student: Sunqing (Sunny) Qiu Instructor: Dr. Amy Woszczynski Course: 8826 Nov. 18, 2002 2 Table of Contents Summary--3 Introduction-4 Introduction to IT department-4 Problems exiting in IT... Date Added: 2009-05-21 21:51:39 |
| 00000037.pdf Path: Carnegie Mellon >> TERA >> 05101824 Fall, 2009 Description: ... Date Added: 2009-05-21 21:52:04 |
| karyotype.ppt Path: Kennesaw >> BIO >> 3300 Fall, 2009 Description: Karyotype Analysis Chromosome staining Structure Metaphase chromosome spread Staining techniques G-banding R-banding Q-banding A. Chromosome Staining & Structure Cen... Date Added: 2009-05-21 21:52:09 |
| Site-Map 1(540).doc Path: Mt. Mercy >> IBS >> 540 Fall, 2009 Description: Page: Home Page Sassy Creations (Logo) Log In H ome About Sassy FAQs Policies Cont act Shopping Car t Welcome Message Jewelr y Galler y Shop by Pr ice Sizing Shipping Ret ur n Policy Blog Jewelr y Par t ies Tr ack Or der Discount Pr omot io... Date Added: 2009-05-21 21:52:44 |
| ece404ps-s22.pdf Path: Idaho >> ECE >> 404 Fall, 2008 Description: ... Date Added: 2009-05-21 21:54:22 |
| lab13.pdf Path: Ill. Chicago >> MATH >> 531 Fall, 2008 Description: MATH 531: Co.Co.A. Lab 13: Local dimension Dec 6, 2004 Varieties with components in several dimensions Let f = z 3 - 2zx2 + y 2 . Exercise. Determine the singular locus of V (f ); find Tjurina number at the singular point(s). Consider the variety ... Date Added: 2009-05-21 21:55:29 |
| perlclib.pdf Path: Emory >> CS >> 153000 Fall, 2009 Description: Perl Programmers Reference Guide PERLCLIB ( 1 ) NAME perlclib Internal replacements for standard C library functions DESCRIPTION One thing Perl porters should note is that perl doesn\'t tend to use that much of the C standard library internally; ... Date Added: 2009-05-21 21:55:43 |
| Lecture_14.pdf Path: N.C. State >> CH >> 331 Spring, 2008 Description: Chemistry 331 Lecture 14 Phase Diagrams Definition of a phase diagram A phase diagram is a representation of the states of matter, solid, liquid, or gas as a function of temperature and pressure. In the Figure shown below the regions of space indica... Date Added: 2009-05-21 21:56:18 |
| HW1Sols02.pdf Path: Minnesota >> ECE >> 674 Fall, 2009 Description: ... Date Added: 2009-05-21 21:57:17 |
| Petri.4up.ps Path: Allan Hancock College >> COMP >> 4100 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: Petri.dvi %Pages: 6 0 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 596 842 %DocumentFonts: Helvetica LCIRCLEW10 Helvetica-Bold Helvetica-Oblique %+ CM... Date Added: 2009-05-21 21:59:09 |
| lec27_4.ps Path: Allan Hancock College >> COMP >> 2400 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: lec27.dvi %Pages: 3 0 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 596 842 %DocumentFonts: Helvetica-Bold Helvetica Helvetica-Oblique ZapfDingbats %+ ... Date Added: 2009-05-21 21:59:36 |
| cs481-01.pdf Path: MSOE >> CS >> 481 Fall, 2009 Description: CS-481 C+ for C Programmers November 30, 1998 CS481 - Object-Oriented Programming C+ Object-Oriented Programming (CS-481) Prof. Jeffrey J. Blessing Office: MSOE, S-336 Phone: 277-7194 Email: blessing@msoe.edu http:/www.msoe.edu/~blessing 1 Logist... Date Added: 2009-05-21 22:00:00 |
| Q1SolM180S06.pdf Path: Ill. Chicago >> MATH >> 180 Fall, 2008 Description: MATH 180 (16397) Name (print) Quiz 1 (Version I) 01/20/06; Solution 01/23/06 ) Discussion hour (T Th 1. (8 pts.) Let f (x) = x2 + 2 and g(x) = x5 + 3. Find: g(x)2 + 2 = (x5 + 3)2 + 2. Thus a) (f g)(x); Solution: (f g)(x) = f (g(x) = (f g)(x)... Date Added: 2009-05-21 22:00:20 |
| tlc8.pdf Path: UMass (Amherst) >> CHEM >> 269 Fall, 2008 Description: LET\'S LOOK AT THE TLC ANALYSIS OF A MIXTURE THAT CONTAINS 2 COMPONENTS. TO START, PLACE BOTTOM OF SPOTTED PLATE INTO DEVELOPMENT SOLVENT. ALLOW SOLVENT TO TRAVEL UP PLATE. AFTER SOME TIME, SOLVENT HAS TRAVELED UP OVER THE SPOT. LESS POLAR COMPONEN... Date Added: 2009-05-21 22:01:01 |
| ex1.pdf Path: Berkeley >> E >> 240 Fall, 2008 Description: Econ. 240B, Second Half Daniel McFadden, 2001 EXERCISE 1. GROWTH AND EXIT OF FIRMS (To be handed in on Nov. 2) Firms exit through acquisition, merger, buyout, and dissolution. Economists are interested in the factors that contribute to exit. For ex... Date Added: 2009-05-21 22:02:10 |
| section02.pdf Path: Berkeley >> CS >> 186 Fall, 2009 Description: Discussion Section Week #2 CS186 Intro to Database Systems TA: Keng-hao Chang 02/04/2008 Recap: Entity, attribute, and entity set Attributes describe an entity. An entity entity set. Relationship and relationship set An n-nary relationship set con... Date Added: 2009-05-21 22:02:14 |
| QM_Plans_S06b_T06_v1.1.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Quality Management Plan (QMP) Version 1.1 USC Football Recruitment Database (Team 6) Client Jared Blank USC Football The Team Feasibility Rationale Systems Architecture & UML Modeling Operational Concept and Systems Analysis Life Cycle Plans and P... Date Added: 2009-05-21 22:03:26 |
| Slinky.pdf Path: Uni. Worcester >> PH >> 1140 Fall, 2008 Description: Longitudinal Waves on a Slinky PH1140 Introduction Most of us are familiar with the slinky and its wave motions. The caterpillar-like ripples that move up and down the length of the slinky are in fact longitudinal waves that can be described by the... Date Added: 2009-05-21 22:06:15 |
| lecture9_RSA_basics_2.pdf Path: George Mason >> ECE >> 646 Fall, 2008 Description: ECE 646 - Lecture 9 RSA Genesis, operation & security Public Key (Asymmetric) Cryptosystems Public key of Bob - KB Private key of Bob - kB Network Encryption Decryption Alice Bob 1 Trap-door one-way function Whitfield Diffie and Martin Hellma... Date Added: 2009-05-21 22:08:42 |
| webServices.pdf Path: Adams State >> CSCI >> 320 Fall, 2009 Description: Web Services Web Service Motivation There are things like currency conversion, weather reports, maps, etc that different applications need very often so why make them over and over again? Definition A software system designed to support interop... Date Added: 2009-05-21 22:09:45 |
| quiz2.ps Path: Michigan >> MATH >> 425 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: quiz2.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o quiz2.ps quiz2.dvi %DVIPS... Date Added: 2009-05-21 22:12:00 |
| Week3_2.ppt Path: Fayetteville State University >> CNT >> 5505 Fall, 2009 Description: Physical layer continued Limited Bandwidth Bandwidth is limited because of many reasons The wire itself, if too long, is a capacitor and slows down voltage transition In wireless transmissions, the whole spectrum shared by many communication part... Date Added: 2009-05-21 22:14:07 |
| Slides-15.pdf Path: Arizona >> CS >> 520 Fall, 2009 Description: CSc 520 Principles of Programming Languages 15 : Types Equivalence Christian Collberg collberg+520@gmail.com Department of Computer Science University of Arizona Copyright c 2008 Christian Collberg 520 Spring 2008 15 [1] Type Checking In stati... Date Added: 2009-05-21 22:17:25 |
| S2008KeyQuiz7a.doc Path: Baylor >> FIN >> 4360 Fall, 2008 Description: Finance 4360; Key to Quiz 7; Spring 2008; 9:00 Class Note: For any question with numbers, all of the points are earned by setting up solutions. There are no points for any calculations. As a result, you will likely earn a higher grade on this quiz if... Date Added: 2009-05-21 22:17:54 |
| 091-VxSC.pdf Path: Arizona >> SCHEDULE >> 091 Fall, 2009 Description: Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # BONINE BIO W 210 KOFFL 411 VETERINARY SCIENCE (V SC) Dr. Jack Schmitz, Depar... Date Added: 2009-05-21 22:18:00 |
| CourseNotesWeek9.doc Path: Wisc Platteville >> CS >> 243 Fall, 2009 Description: Overview of Lectures in CS/SE 2430 Week 9 I. Day 24: Spring `04 Monday, 3/22 reading/writing files- Test 2 April 2nd Review writing to files import java.io.*; . PrintWriter pw; . try { pw = new PrintWriter(new FileWriter(\"myfile.txt\"), true); p... Date Added: 2009-05-21 22:18:39 |
| PRACTICE EXAM ANSWERS 2007.pdf Path: Berkeley >> MCB >> 110 Fall, 2008 Description: PRACTICE EXAM ANSWERS 2007 1. A. Essentially, we want the tumor suppressor TS5 to be expressed at normal level. You should know that the Jak Stat pathway regulates this tumor suppressor, and that TS5 induction is good. IL25 is a cytokine that will c... Date Added: 2009-05-21 22:18:47 |
| CourseNotesWeek10.doc Path: Wisc Platteville >> CS >> 243 Fall, 2009 Description: Overview of Lectures in CS/SE 2430 Week 10 I. Fall 03 Day 27: Monday, 11/3/03 reading/writing files Return Test 2 You may demo program4 in lab tomorrow. Review writing to files import java.io.*; . PrintWriter pw; . try { pw = new PrintWriter... Date Added: 2009-05-21 22:18:53 |
| Program2.doc Path: Wisc Platteville >> CS >> 113 Fall, 2009 Description: CS113 Program-2 (30 points) Due Date: Monday, May 8, 2006 at 4:00 PM For Program Hand in Procedure, see below. Write a program in C+ (HiC) to read in numbers and produce various statistics. The program you will read in numbers from an input file whic... Date Added: 2009-05-21 22:19:36 |
| Tute Wk 6.pdf Path: Allan Hancock College >> IMS >> 3012 Fall, 2009 Description: Faculty of Information Technology School of Information Management and Systems Semester 2, 2005 IMS3012 Knowledge Management Week 6, Tutorial 5 Tutorial Topic Designing KMS for People Discussion Topic: How can ICT support knowledge work Discussion ... Date Added: 2009-05-21 22:21:25 |
| Lab Wk5.pdf Path: Allan Hancock College >> IMS >> 3012 Fall, 2009 Description: Faculty of Information Technology School of Information Management and Systems Semester 2, 2005 IMS3012 Knowledge Management Week 5 Laboratory Tasks 1. Exploring Podcasting If you have not yet explored the ABC Radio National website, please log on an... Date Added: 2009-05-21 22:21:25 |
| exam22sol.pdf Path: RIT >> SMAM >> 314 Fall, 2009 Description: SMAM 314 Exam 22 Name_ Use your textbook for tables only 1. Given the discrete probability mass function 8 1 f(x) = ,x = 1,2,3 7 2 x A. Complete the table x 1 2 4 2 f(x) 7 7 3 1 7 (6 points) B. Find (1) P(X 2) = 4 7 +2 = 7 5 7 (3 poi... Date Added: 2009-05-21 22:23:35 |
| chemact9a.pdf Path: UMBC >> CHEM >> 111 Fall, 2009 Description: Chem Activity 9 Chemical Formulas and Nomenclature Problems 1. Complete the following table: Chem 111 Dr.C Doige Name aluminum hydride boron nitride tin (IV) bromide calcium hydrogen phosphate iron(III) carbonate Formula AlH3 BN SnBr4 Ca(H2PO4)2 ... Date Added: 2009-05-21 22:24:01 |
| review_midterm1.pdf Path: UMBC >> CHEM >> 111 Fall, 2009 Description: Chem 111 Dr. C Doige Today is yesterday\'s pupil. Thomas Fuller 6. Review Midterm 1 1. 100. g of aluminum and 150. g of oxygen are reacted according to the chemical equation below, what are the final masses of the products and the reactants when th... Date Added: 2009-05-21 22:24:07 |
| chemact29_exe.pdf Path: UMBC >> CHEM >> 111 Fall, 2009 Description: Chem Activity 29 Molecular Polarity as Determined by Bond Polarity and Molecular Geometry Exercises 3. Which molecule (or ion) of each pair has a dipole moment of zero? a) N2 or NO b) CH4 or CH3Cl c) SO2 or SO3 Chem 111/112 Dr.C Doige d) NO3- or N... Date Added: 2009-05-21 22:24:09 |
| p_ass_8a.pdf Path: UMBC >> CHEM >> 111 Fall, 2009 Description: Chem 111- Dr. C Doige Adapted from Nigel Eggers (UBCO) Problem Set VIII ANSWERS Liquids, Intermolecular Forces and Phase Diagrams 1. Both molecules will have similar London dispersion forces. However carbon monoxide is polar, nitrogen is nonpolar and... Date Added: 2009-05-21 22:24:25 |
| WSF06Final.pdf Path: SUNY Geneseo >> INTD >> 105 Fall, 2009 Description: Writing Seminar: A Century of Science Fiction Final Assignment Dr. Pogo Monday, December 18, 2006 Final Assignment You are to write a 1 or 2 page discussion of the significant differences between the book The Time Machine and the movie of the same ... Date Added: 2009-05-21 22:25:55 |
| Prb11_5.xls Path: Carroll MT >> BA >> 409 Fall, 2009 Description: Data Moving Average 2-Period 4-Period -285.5 -312.0 -362.0 323.8 397.0 354.5 409.0 385.5 414.0 405.5 425.5 417.3 431.5 422.8 431.5 428.5 448.5 440.0 457.0 444.3 463.0 455.8 475.0 466.0 486.5 474.8 492.0 483.5 505.0 495.8 525.5 508.8 530.0 517.5 2-Per... Date Added: 2009-05-21 22:26:08 |
| Carbohydrate Metabolism.pdf Path: UT Arlington >> HENRY >> 2458 Fall, 2009 Description: ... Date Added: 2009-05-21 22:27:18 |
| 1312.4.BUSINESS.doc Path: UT Arlington >> HIST >> 1312 Fall, 2008 Description: The University of Texas at Arlington HIST 1312: American History: 1865-Present Instructor: Dr. Allen F. Repko Office: UH 109 Phone: 817-272-2338 \"THE NEW FRONTIER OF BUSINESS: PT 1\" #4 #1 FEDERAL SUPPORT OF THE LEADING TECHNOLOGICAL SYSTEM OF THE D... Date Added: 2009-05-21 22:27:46 |
| More sets exercises.pdf Path: NMSU >> CS >> 571 Fall, 2009 Description: EXERCISES ON DISJOINT UNION 1. Form the sum of {1,2,3} and B={a,b,c}, using the operator . 2. Form the sum of and {1,2,3,4}using the Boolean markers {true, false}. 3. Is a sum a sequence? Explain. ANSWERS ... Date Added: 2009-05-21 22:28:36 |
| Coll05.pdf Path: NMSU >> CS >> 571 Fall, 2009 Description: CS571 Notes 05 Operational semantics Assumptions The meaning of a program is dependent on three steps: We have abstract syntax for the program structure We can attach meaning to the leaves of the tree We can compose these individual meanings usi... Date Added: 2009-05-21 22:28:40 |
| 11707.pdf Path: U. Houston >> DT >> 3312 Fall, 2009 Description: SOS 3312Statistics in the Social Sciences (3-3-0) www.uhd.edu/~rydend Section 11707-Fall 2006 Meeting Time: TH 1:00 p.m.- 2:15 p.m. Classroom: C122 & S618 Instructor: Dr. David Ryden Email: rydend@uhd.edu Telephone/Fax: 713 221 2767/ 713 221 8286 Off... Date Added: 2009-05-21 22:31:49 |
| exercises3.pdf Path: U. Houston >> COSC >> 3361 Fall, 2008 Description: Exercises 3: Ordineray Differential Equations 1. a. Compute y(0.1) by solving the differential equation y (t) = ty 2 (t) y(0) = 2 with one step of the Taylor series method of order 2. 2nd order Taylor series is: y(t + h) = y(t) + hy + h2 y (t) 2! ... Date Added: 2009-05-21 22:32:12 |
| MultiMediaProjectWinter09.pdf Path: Air Force Academy >> CS >> 100 Fall, 2009 Description: CMPT 100 Assignment 5 - Multimedia Project Due Date Wednesday April 8th at 4pm Project Teams You may choose to work in a team of two for this assignment if you wish, or you may work alone. Team members can be from either section of CMPT 100 (02, 04)... Date Added: 2009-05-21 22:32:20 |
| flstandard.xls Path: San Diego State >> GEOL >> 552 Fall, 2009 Description: Fluorometer Standards from 2000 C/CON Fluorometer Reading for Gain 1 Gain 5 Gain 10 Gain 50 Gain 200 0 Off Scale Off Scale Off Scale Off Scale Off Scale 0 Off Scale Off Scale Off Scale Off Scale Off Scale 1.00E-05 1436 Off Scale Off Scale Off Scale... Date Added: 2009-05-21 22:35:22 |
| lucky5final.pdf Path: San Diego State >> GEOL >> 508 Spring, 2008 Description: 11632\'45\"W 11632\'30\"W 11632\'15\"W 11632\'0\"W 11631\'45\"W 11631\'30\"W 11631\'15\"W 11631\'0\"W 11630\'45\"W 11630\'30\"W 11630\'15\"W 11630\'0\"W 11629\'45\"W 11629\'30\"W 11629\'15\"W 11629\'0\"W 3259\'45\"N 32 3259\'30\"N 32 3259\'15\"N 32 3259\'0\"N 32 325... Date Added: 2009-05-21 22:35:37 |
| psyc181b05.pdf Path: UNL >> PSYC >> 181 Summer, 2008 Description: Psychology 181B (05) Keller Plan Orientation to Course Objectives and Requirements Blackboard All course information, study aides, and assignments are accessed through our class page on Blackboard. All course communication is also done through Bla... Date Added: 2009-05-21 22:37:21 |
| 9b_Missing_Data_Time_Invariant_Predictors.pdf Path: UNL >> PSYCH >> 944 Fall, 2009 Description: Missing Data in MLM: Implications for Longitudinal Attrition Historical Methods Types of Missingness What Missing Data Means to You What about missing data? Incomplete data patterns in longitudinal study Sparse missingness (within occasion) ... Date Added: 2009-05-21 22:38:55 |
| 11_19.pdf Path: UCSB >> PSYC >> 110 Fall, 2009 Description: Lecture Outline from 11/19 Vision and action Two visual pathways What (ventral) and Where/How (dorsal) Evidence Monkey lesions Double dissociation Blindsight Cant see but can make judgments about and point to objects in their blind field V1 l... Date Added: 2009-05-21 22:39:12 |
| Pre 6 & Post 4.pdf Path: UMass (Amherst) >> ECE >> 571 Fall, 2009 Description: University of Massachusetts Amherst Department of Electrical and Computer Engineering ECE 571 Microelectronic Fabrication Spring, 2009 Pre Lab #6: Due Monday, Mar. 30 Note: This prelab may require you to read ahead in the book. Also, please refrain f... Date Added: 2009-05-21 22:39:55 |
| Resume Pamela Sejnaui2.pdf Path: Wartburg >> BA >> 325 Fall, 2009 Description: Pamela Sejnaui Current Address: 100 Wartburg Blvd. Box #754, Waverly-Iowa Permanent Address: Calle 39 norte #4N 136 Cali-Colombia Phone US: (319) 5962626 Cell: (319) 5048594 Email: psejnaui@hotmail.com OBJECTIVE To obtain a full time position in Fi... Date Added: 2009-05-21 22:43:04 |
| Week 9 Politicians and Human Rights CMR.ppt Path: East Los Angeles College >> HU >> 100 Fall, 2009 Description: Parliament, the Executive and Human Rights Anna Hardiman-McCartney Recap: HRA 1. Protected rights 2. How the HRA protects rights: (a) Statements of compatibility (b) Interpretation (c) Declarations of incompatibility (d) Challenges to unlawful... Date Added: 2009-05-21 22:43:20 |
| Q03-Quizz-03.pdf Path: BU >> GG >> 101 Fall, 2009 Description: Natural Environments: The Atmosphere GG 101 Spring 2005 Boston University Quizz-03 Myneni Quizz-03 Feb-14-05 (1 of 1) Question: What is the meaning of the word albedo ? Answer: Albedo is the fraction of incident solar energy that is reflected by ... Date Added: 2009-05-21 22:43:39 |
| exam1s09.pdf Path: Michigan State University >> ME >> 861 Fall, 2008 Description: ... Date Added: 2009-05-21 22:45:44 |
| HEEDS.pdf Path: Michigan State University >> ME >> 475 Fall, 2008 Description: Getting Started with HEEDS Version 5.1 Red Cedar Technology 4572 South Hagadorn Rd, Suite 3-A East Lansing, Michigan 48823 (517) 664-1137 www.redcedartech.com Copyright 2007 by Red Cedar Technology, Inc. All rights reserved. No part of this publica... Date Added: 2009-05-21 22:47:01 |
| wiiremote.pdf Path: NYU >> JWB >> 8538 Fall, 2009 Description: The possibility of Wii Remote By Jee Woong Byeon Advantages 1) 2) 3) 4) 5) 6 angle movement Wireless by blue tooth Cheap, only $50 Portability Easy to use Possible Scenarios Advance setup-box remote control Most sports games like NBA, NFL and boxi... Date Added: 2009-05-21 22:50:00 |
| G41.2980(001)Fleming.pdf Path: NYU >> ENGLISH >> 10743 Fall, 2009 Description: G41.2980: Introduction to Advanced Literary Study Professor Fleming Fall 2009 Reading, writing, and literary theory This seminar aims to rehearse the protocols of reading and writing about literary texts and literary theory. We will not think about t... Date Added: 2009-05-21 22:50:03 |
| ma_eval.pdf Path: Acton School of Business >> CAAM >> 600 Fall, 2008 Description: RICE UNIVERSITY DEPARTMENT OF COMPUTATIONAL AND APPLIED MATHEMATICS EVALUATION OF MASTERS THESIS / PHD PROPOSAL student: semester entered program: date of defense: committee member: Please review the guidelines for evaluation on the reverse. excell... Date Added: 2009-05-21 22:50:18 |
| Special Relativity Part I a.pdf Path: Texas A&M >> PHYS >> 222 Fall, 2008 Description: RELATIVITY Einstein published two theories of relativity In 1905 The Special Theory For uniform motion In 1916 The General Theory For non-uniform motion a = 0 a 0. First we will discuss The Special Theory At the beginning of the century most bel... Date Added: 2009-05-21 22:51:06 |
| Economic thinking and basic theory.pdf Path: Idaho >> AGECON >> 40403 Fall, 2009 Description: Economic thinking and basic theory Levan Elbakidze AGEC 404 Economics Positive Versus Normative Allocation of resources Scarcity Unlimited wants Consumers Preferences Assumptions Ability to rank any two baskets: A (>) B, B(>)A, A(=)B Transi... Date Added: 2009-05-21 22:55:13 |
| Test1AK.pdf Path: Idaho >> AGECON >> 302 Fall, 2009 Description: UI AgEc 302 Spring 2007 Test 1: Answer Key Question #1 1 The total cost function is: TC = Q 3 8.5Q 2 + 60Q + 27. 3 1.1). Find the optimums (minimum and maximum) of the total cost function. dTC = MC = Q 2 17Q + 60 = 0 dQ (17) + (17) 2 4(1)(60) 1... Date Added: 2009-05-21 22:55:29 |
| 22Reengineering.pdf Path: Michigan State University >> CSE >> 435 Fall, 2008 Description: Recall from last time Restructuring, design recovery, and reengineering Second law of software evolutionary dynamics: Law of Increasing Entropy: The entropy of a system (its unstructuredness) increases with time, unless specific work is executed to m... Date Added: 2009-05-21 22:56:38 |
| doc1045.pdf Path: Missouri S&T >> EE >> 213 Fall, 2009 Description: Features Compatible with MCS-51 Products 1K Bytes of Reprogrammable Flash Memory Endurance: 1,000 Write/Erase Cycles 2.7V to 6V Operating Range Fully Static Operation: 0 Hz to 24 MHz Two-level Program Memory Lock 64 x 8-bit Internal RAM... Date Added: 2009-05-21 22:57:53 |
| Answers_to_PROB_SET_1.pdf Path: Michigan State University >> CEM >> 251 Fall, 2008 Description: CEM 251 Spring 2008 Answers 1st Problem Set (Chapters 1-6) 1. 2. a) 7 b) 3 c) 1 d) Sp e) Sp2 f) 28 g) 4 h) C11H14BrNO CH2 N N -1 +1 0 3. a) Carbocation: (Zero electrons on central carbon) Carbon radical: (one electron on central car... Date Added: 2009-05-21 22:58:46 |
| l7.pdf Path: Michigan State University >> LECT >> 231 Fall, 2009 Description: PHYSICS 231 Chapter 7: Rotational Motion & Gravity Remco Zegers PHY 231 1 Chapter 6 in one slide Momentum p=mv F=p/t Impulse (the change in momentum) p= Ft Types of collisions Inelastic collisions Momentum is conserved Some energy is lost in the... Date Added: 2009-05-21 23:01:09 |
| 2007418_f01k_07448.pdf Path: Stanford >> GPIC >> 1037 Fall, 2009 Description: US District Court Civil Docket as of 07/13/2007 Retrieved from the court on Monday, July 16, 2007 United States District Court District of Nevada (Las Vegas) CIVIL DOCKET FOR CASE #: 2:07-cv-00448-RCJ-RJJ Gordon v. Charlier et al Assigned to: Judge... Date Added: 2009-05-21 23:01:25 |
| mounting.pdf Path: Michigan State University >> ADV >> 317 Fall, 2009 Description: The Board: The Board: Mounting board, sometimes called matte board or illustration board, MUST BE USED. It is a sturdy cardboard material that is slightly less than 1/8\" thick. You may use black or white depending on which best sets off your work. Ma... Date Added: 2009-05-21 23:01:47 |
| 20050113-classlist.pdf Path: USC >> ISE >> 575 Fall, 2008 Description: ... Date Added: 2009-05-21 23:02:45 |
| W-Salim\'sFamily(12).pdf Path: BYU >> ARAB >> 101 Fall, 2008 Description: SALIM\'S FAMILY ON-YOUR-OWN LISTENING ASSIGNMENT In this video segment, you will listen to a young man (who happens to make his living as a cook) tell you about members of his family. ( ) - - - brother brothers sister - sisters boy (sons) -... Date Added: 2009-05-21 23:04:02 |
| ee392m_HW3.pdf Path: Stanford >> EE >> 392 Fall, 2009 Description: HW #3 1- Wiener Filter: Let u(n) denote the M complex observation samples, v(n) denote samples of a zero mean Gaussian process, and s(n) denote the samples of signal. Consider the two following hypothesis: H1 : u (n) = v(n) H 2 : u ( n) = S ( n ) + v... Date Added: 2009-05-21 23:04:06 |
| Horndahl-SurVbyN.pdf Path: UMass Lowell >> BRA >> 188 Fall, 2009 Description: Vital history by full name for persons with surname: Horndahl Reference Name: Horndahl, Emmy, Linnea Inferred data (reference): Ethnicity: Swedish2 Birth Place: Sweden Death Place: Lowell Ethnicity Swedish Page 1 of 9 Birth date: Death date: Immig.... Date Added: 2009-05-21 23:05:43 |
| 2511259.pdf Path: Michigan State University >> LIB >> 1925 Fall, 2009 Description: Nov. 16&.1925 UNITED STATES GOLF ASSOCIATION 259 subsequent damming, and stocking the lake with ducks or swans. Dragging water weeds with a heavy chain is a rather slow, cumbersome process which is not always successful. For cutting the weeds a sh... Date Added: 2009-05-21 23:05:57 |
| MS.pdf Path: Michigan State University >> READ >> 1979 Fall, 2009 Description: ... Date Added: 2009-05-21 23:05:59 |
| 250475.pdf Path: Michigan State University >> LIB >> 1925 Fall, 2009 Description: April 16, 1925 UNITED srrATEs GOLF ASSOCIATION 75 brown-patch, while the Bellingham strain is quite badly injured. There is as yet no sufficiently long test with any of the others to determine how brown-patch affects them. Apart from this factor... Date Added: 2009-05-21 23:06:35 |
| SP.Collier.BIRN.200505.pdf Path: UPenn >> RD >> 100 Fall, 2009 Description: Highly Distributive Architectures for Research Management: The BIRN Experience Elaine Collier, MD NIH Roadmap BAA PI Meeting May 9, 2005 BIRN Overview Established in 2001 - Currently includes 19 universities and 26 research groups Promotes biomedica... Date Added: 2009-05-21 23:07:52 |
| smartspice_yp.pdf Path: Cal Poly >> EL >> 547 Fall, 2009 Description: SMARTSPICE TUTORIAL EL547, fall 2004 ECE, Polytech. Univ. Overview Introduction Spicedeck Structure Smartspice Tool Usage Introduction of SPICE Simulation Program with Integrated Circuit Emphasis. The most popular circuit simulation engin... Date Added: 2009-05-21 23:08:32 |
| genbactv08.pdf Path: Eastern Washington University >> BIO >> 310 Fall, 2009 Description: Bacterial and Viral Genetics 1. Which of the following is considered evidence for recombination in viruses? a. Transduction b. Formation of a protein cost around the viral DNA c. Recovery of both parental and recombinant type viruses when bacteria ar... Date Added: 2009-05-21 23:09:11 |
| 05_Husserl_CM.pdf Path: Kentucky >> PHI >> 516 Fall, 2008 Description: Lecture: Husserl\'s Cartesian Meditations, Forth Meditation Page 1 of 4 Method of Eidetic Description What is the method of phenomenology. It appears we could say with some assurance that it is one of epoch and reduction. That is, first we suspend o... Date Added: 2009-05-21 23:10:03 |
| quiz3.pdf Path: Kentucky >> MA >> 214 Fall, 2008 Description: ... Date Added: 2009-05-21 23:10:17 |
| Flyer2_Passport_.pdf Path: New Haven >> UNH >> 11052007 Fall, 2009 Description: Do you have a valid passport? Why do you need one? You wanna go skiing or snowboarding in Canada? Spring Break in Mexico? Study or internship abroad? Traveling in South America? Bring a photo ID, two passport photos, your birth certificate or pr... Date Added: 2009-05-21 23:11:43 |
| m3309pex1.pdf Path: Texas El Paso >> M >> 3309 Fall, 2009 Description: MATHEMATICS 3309 Practice for Exam #1 Instructor: Jorge Viramontes Class Time: Student Name: Date: = Problem 1. Which are the four dierent representations of a polyhedron? Explain each one of them. Problem 2. Dene the following. pyramid prism Eul... Date Added: 2009-05-21 23:12:28 |
| output.txt Path: Washington >> V >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS7 - local directory - Volume in drive C has no label. Volume Serial Number is 10A2-98BD Directory of C:\\condor\\execute\\dir_2804 01/29/2008 02:34 PM <DIR> . 01/29/2008 02:34 PM <D... Date Added: 2009-05-21 23:12:54 |
| output.txt Path: Washington >> V >> 13500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-C0WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3752 02/02/2008 11:12 AM <DIR> . 02/02/2008 11:12 ... Date Added: 2009-05-21 23:16:35 |
| output.txt Path: Washington >> V >> 10013 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-725QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3220 12/02/2007 03:52 PM <DIR> . 12/02/2007 03:52 ... Date Added: 2009-05-21 23:17:49 |
| log.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: 000 (58965.000.000) 02/11 21:26:59 Job submitted from host: <128.95.94.28:1092> . 001 (58965.000.000) 02/12 04:44:44 Job executing on host: <172.25.101.181:1056> . 006 (58965.000.000) 02/12 05:04:52 Image size of job updated: 423340 . 005 (58965.000.... Date Added: 2009-05-21 23:18:16 |
| output.txt Path: Washington >> V >> 15500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-685QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3792 02/04/2008 04:11 PM <DIR> . 02/04/2008 04:11 ... Date Added: 2009-05-21 23:18:20 |
| submit.txt Path: Washington >> JOBS >> 11001 Fall, 2009 Description: executable = pass6_11001.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs11000-11499/11001... Date Added: 2009-05-21 23:18:28 |
| log.txt Path: Washington >> JOBS >> 30435 Fall, 2009 Description: 000 (55432.000.000) 02/10 07:50:05 Job submitted from host: <128.95.94.28:1098> . 001 (55432.000.000) 02/10 10:06:15 Job executing on host: <172.25.101.189:1062> . 006 (55432.000.000) 02/10 10:26:23 Image size of job updated: 448304 . 006 (55432.000.... Date Added: 2009-05-21 23:19:18 |
| submit.txt Path: Washington >> V >> 15250 Fall, 2009 Description: executable = allgamma_15250.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-05-21 23:20:56 |
| submit.txt Path: Washington >> JOBS >> 30527 Fall, 2009 Description: executable = pass6_30527.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30500-30999/30527... Date Added: 2009-05-21 23:21:37 |
| error.txt Path: Washington >> V >> 14775 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 05:31:58 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 06:46:15 2008 ( 4457 s elapsed) ... Date Added: 2009-05-21 23:25:11 |
| error.txt Path: Washington >> V >> 10466 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Jan 29 23:25:17 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 00:40:29 2008 ( 4512 s elapsed) ... Date Added: 2009-05-21 23:28:25 |
| output.txt Path: Washington >> JOBS >> 71881 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS1 - local directory - Volume in drive C has no label. Volume Serial Number is 5692-E1E5 Directory of C:\\condor\\execute\\dir_3124 02/17/2008 03:09 PM <DIR> . 02/17/2008 03:09 PM <D... Date Added: 2009-05-21 23:28:37 |
| log.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: 000 (52576.000.000) 02/07 03:32:18 Job submitted from host: <128.95.94.28:1098> . 001 (52576.000.000) 02/07 03:35:56 Job executing on host: <172.25.101.187:1056> . 006 (52576.000.000) 02/07 03:56:04 Image size of job updated: 437244 . 005 (52576.000.... Date Added: 2009-05-21 23:28:51 |
| 1022-small.pdf Path: Trinity U >> CS >> 4320 Fall, 2009 Description: CSCI 4320 October 19, 2007 Administrivia (None.) Slide 1 Paging Recap Recall basic ideas of paging: Divide address spaces into pages, memory into page frames; allocate memory page (frame) by page (frame). Use page tables (one per process) ... Date Added: 2009-05-21 23:29:06 |
| output.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-GYVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3164 02/10/2008 09:26 PM <DIR> . 02/10/2008 09:26 ... Date Added: 2009-05-21 23:30:43 |
| submit.txt Path: Washington >> JOBS >> 71541 Fall, 2009 Description: executable = pass6_71541.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71500-71999/71541... Date Added: 2009-05-21 23:30:49 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 18:46:10 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 19:57:21 2008 ( 4271 s elapsed) ... Date Added: 2009-05-21 23:32:50 |
| log.txt Path: Washington >> JOBS >> 70000 Fall, 2009 Description: 000 (60331.000.000) 02/16 21:22:46 Job submitted from host: <128.95.94.28:1092> . 001 (60331.000.000) 02/17 01:13:13 Job executing on host: <172.25.101.93:1057> . 006 (60331.000.000) 02/17 01:33:21 Image size of job updated: 423204 . 005 (60331.000.0... Date Added: 2009-05-21 23:33:08 |
| error.txt Path: Washington >> JOBS >> 50000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 12 17:59:03 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 12 19:19:12 2008 ( 4809 s elapsed) ... Date Added: 2009-05-21 23:34:45 |
| output.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-285QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1884 02/07/2008 04:50 AM <DIR> . 02/07/2008 04:50 ... Date Added: 2009-05-21 23:34:50 |
| log.txt Path: Washington >> JOBS >> 32282 Fall, 2009 Description: 000 (57280.000.000) 02/10 19:24:33 Job submitted from host: <128.95.94.28:1098> . 001 (57280.000.000) 02/11 02:25:24 Job executing on host: <172.25.101.181:1056> . 006 (57280.000.000) 02/11 02:45:33 Image size of job updated: 443860 . 005 (57280.000.... Date Added: 2009-05-21 23:35:41 |
| output.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-295QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3840 02/10/2008 07:09 PM <DIR> . 02/10/2008 07:09 ... Date Added: 2009-05-21 23:37:38 |
| output.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1024 02/07/2008 03:13 AM <DIR> . 02/07/2008 03:13 ... Date Added: 2009-05-21 23:38:21 |
| output.txt Path: Washington >> JOBS >> 32408 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS3 - local directory - Volume in drive C has no label. Volume Serial Number is 7A24-68F3 Directory of C:\\condor\\execute\\dir_3444 02/11/2008 03:08 AM <DIR> . 02/11/2008 03:08 AM <D... Date Added: 2009-05-21 23:38:24 |
| submit.txt Path: Washington >> JOBS >> 40001 Fall, 2009 Description: executable = pass6_40001.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40001... Date Added: 2009-05-21 23:40:30 |
| submit.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: executable = pass6_41329.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs41000-41499/41329... Date Added: 2009-05-21 23:41:11 |
| submit.txt Path: Washington >> JOBS >> 10341 Fall, 2009 Description: executable = pass6_10341.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10000-10499/10341... Date Added: 2009-05-21 23:42:44 |
| submit.txt Path: Washington >> JOBS >> 60200 Fall, 2009 Description: executable = pass6_60221.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs60200-60399/60221... Date Added: 2009-05-21 23:43:15 |
| log.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: 000 (53249.000.000) 02/07 04:21:32 Job submitted from host: <128.95.94.28:1098> . 001 (53249.000.000) 02/07 04:56:24 Job executing on host: <172.25.101.63:4234> . 005 (53249.000.000) 02/07 05:10:29 Job terminated. (1) Normal termination (return valu... Date Added: 2009-05-21 23:44:02 |
| error.txt Path: Washington >> JOBS >> 70000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 01:21:12 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 02:34:04 2008 ( 4372 s elapsed) ... Date Added: 2009-05-21 23:44:38 |
| log.txt Path: Washington >> JOBS >> 71777 Fall, 2009 Description: 000 (61660.000.000) 02/17 08:43:54 Job submitted from host: <128.95.94.28:1092> . 001 (61660.000.000) 02/17 14:04:09 Job executing on host: <172.25.101.43:1063> . 006 (61660.000.000) 02/17 14:24:17 Image size of job updated: 380676 . 005 (61660.000.0... Date Added: 2009-05-21 23:44:47 |
| error.txt Path: Washington >> JOBS >> 40470 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 17:10:03 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 18:25:10 2008 ( 4507 s elapsed) ... Date Added: 2009-05-21 23:46:08 |
| log.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: 000 (61069.000.000) 02/17 07:26:12 Job submitted from host: <128.95.94.28:1092> . 001 (61069.000.000) 02/17 08:47:34 Job executing on host: <172.25.101.91:1056> . 006 (61069.000.000) 02/17 09:07:42 Image size of job updated: 383220 . 005 (61069.000.0... Date Added: 2009-05-21 23:46:20 |
| error.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 12 03:17:46 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 12 04:29:32 2008 ( 4306 s elapsed) ... Date Added: 2009-05-21 23:50:08 |
| log.txt Path: Washington >> JOBS >> 41000 Fall, 2009 Description: 000 (58821.000.000) 02/11 21:26:10 Job submitted from host: <128.95.94.28:1092> . 001 (58821.000.000) 02/12 03:26:36 Job executing on host: <172.25.101.163:1093> . 006 (58821.000.000) 02/12 03:46:45 Image size of job updated: 372948 . 005 (58821.000.... Date Added: 2009-05-21 23:50:36 |
| error.txt Path: Washington >> JOBS >> 41356 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 12 04:34:08 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 12 05:50:09 2008 ( 4561 s elapsed) ... Date Added: 2009-05-21 23:50:38 |
| error.txt Path: Washington >> JOBS >> 41301 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 12 03:55:40 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 12 05:07:32 2008 ( 4312 s elapsed) ... Date Added: 2009-05-21 23:56:37 |
| L23.pdf Path: Loyola Chicago >> LEVY >> 620 Fall, 2009 Description: ... Date Added: 2009-05-21 23:57:17 |
| 306f2005-test-1.pdf Path: Oregon State >> MTH >> 306 Winter, 2008 Description: Mth 306 Test 1 Instructions: = If you do not read the instructions, then how will you know what to do? Read them now. Fall 2005 (This test requires you use the provided scantron) Bent Petersen 306f2005-test-1.tex Test date: October 21, 2005 Time:... Date Added: 2009-05-21 23:57:51 |
| EE2369_lab6_03F.doc Path: Texas El Paso >> EE >> 2369 Fall, 2008 Description: EE 2369 Digital Systems Design I Lab #6 (Using Roth 5th edition) Credit: 20+20 points. This lab has two parts. PART A First construct an un-clocked S-R flip-flop using two NOR gates as shown in Fig. 11.5 in the text. Employ (modified) input circuits... Date Added: 2009-05-21 23:59:10 |
| H27Aug07.txt Path: SMU - Cox School of Business >> EMIS >> 8371 Fall, 2009 Description: %- 8/27/07 5:37 PM -% x=3+2 x=3+3 x=3+3; x help elfun x = [ 1 0 -3]; signum(x) x = [ 1 0 -3]; sign(x) x y = [1 ; 2 ; 3] z = [1 2 3] help matfun help slash help matfun help specfun primes(22) eps ... Date Added: 2009-05-21 23:59:54 |
| hjiang.doc Path: SMU - Cox School of Business >> EETS >> 8311 Fall, 2009 Description: Hongling Jiang Sample Question for EETS8311 1. (F) SIB means service information blocks. 2. (T) NGN: networks that let design, create, deploy and operate communication services, tailored to your and your customers needs. 3. (F) IN means smart network... Date Added: 2009-05-22 00:00:19 |
| ph4610-e2key.pdf Path: TN Tech >> PH >> 4610 Fall, 2009 Description: Phys 4610, Fall 2007 Exam #2 1. We would like to solve the 2-dimensional potential problem (no zdependence) shown at the right. It is similar to the one which introduced the separation method in the text, the \"slot\" problem. Here, the \"hot\" side of t... Date Added: 2009-05-22 00:01:09 |
| STATUS.DOC Path: San Jose State >> DEPART >> 380 Fall, 2008 Description: CTG Client Project Status Report CUSTOMER: PROJECT: PHASE: MANAGER: A. STATUS AGAINST PLAN REPORTING PERIOD: From: To: Milestones/Tasks Completed: Work in Progress: Change Orders: Problem Areas: B. PLANS FOR NEXT PERIOD Milestones/Tasks: ... Date Added: 2009-05-22 00:01:29 |
| hw1.pdf Path: Colorado State >> M >> 340 Fall, 2009 Description: Homework #1 - M340,S6 - JAN 2009 1 Use a differential equation to model mathematically the following statement: The change in price in wheat is proportional to the negative of the product of the present price of wheat and the difference of spring ra... Date Added: 2009-05-22 00:03:04 |
| Feb 18.pdf Path: Colorado State >> M >> 418 Fall, 2009 Description: ... Date Added: 2009-05-22 00:03:10 |
| 8_22.pdf Path: Colorado State >> MATH >> 618 Fall, 2008 Description: ... Date Added: 2009-05-22 00:03:38 |
| lecture_8_29.pdf Path: Colorado State >> MATH >> 560 Fall, 2008 Description: ... Date Added: 2009-05-22 00:03:54 |
| assignment7.pdf Path: Colorado State >> MATH >> 651 Fall, 2008 Description: Math 651, Assignment 7 Due Wednesday, December 13 1. Write down the formulas defining the Gauss quadrature formula using 9 nodes for approxi1 mating -1 f (x) dx. Hint: this formula has precision 17. 2. Solve these equation using your code for solvin... Date Added: 2009-05-22 00:04:16 |
| hw4.ps Path: NJIT >> CIS >> 435 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMCSC10 CMR10 CMBX10 CMBX12 CMTT9 CMMI10 CMMI7 CMSY10 %EndComments %DVIPSWebPage: (www.r... Date Added: 2009-05-22 00:06:24 |
| exp11s01.pdf Path: N. Illinois >> ELE >> 340 Spring, 2008 Description: Experiment 11 Spring 2001 ELE 340 ELE 340 Electric Power System Page 1 of 3 Experiment 11 Induction Machines Speed-Torque Characteristics Purpose: To investigate the speed-torque character of an induction machine. Background: Induction machines ar... Date Added: 2009-05-22 00:07:16 |
| ecology of food Study questions lecture 12.pdf Path: Fayetteville State University >> ISC >> 2937 Fall, 2009 Description: Study questions lecture 12 1. What is green manure? 2. In the mutualism between plants and nitrogen fixing bacteria, what are the benefits that each partner gets? 3. What do ectomychorrizae do for/to plants? 4. In the mutualism between pollinators a... Date Added: 2009-05-22 00:07:24 |
| class 07.pdf Path: Wake Forest >> CHM >> 344 Spring, 2008 Description: ... Date Added: 2009-05-22 00:08:31 |
| wksht06.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 231 Fall, 2008 Description: Merit Worksheet #6, 2/04/09 Partial fractions 1. Find the integrals (a) 2x + 2 dx and (b) x2 - 2x x dx. (x - 1)2 2. The process of breaking a rational function into its smallest \"pieces\" is called finding the partial fraction decomposition. From wha... Date Added: 2009-05-22 00:09:31 |
| 05h5.ps Path: University of Illinois, Urbana Champaign >> MATH >> 580 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: ttemp.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -Pdownload -f ttemp %DVIPSPa... Date Added: 2009-05-22 00:10:07 |
| 247ann.ps Path: University of Illinois, Urbana Champaign >> MATH >> 247 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: groff version 1.10 %CreationDate: Fri Aug 27 02:20:14 1999 %DocumentNeededResources: font Times-Roman %+ font Times-Italic %DocumentSuppliedResources: procset grops 1.10 0 %Pages: 1 %PageOrder: Ascend %Orientation: Portrait %... Date Added: 2009-05-22 00:11:02 |
| Guide3.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 124 Fall, 2008 Description: Will\'s Guide To Life, Volume 3 Math 124, Spring 2007 Chapter 1 Section 1.5 Linear Programming in the Plane. Know the definitions for this section. A linear function in x and y is z = ax + by. Lines of constancy and lines of constant revenue. For a l... Date Added: 2009-05-22 00:12:01 |
| Lecture 12.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 555 Spring, 2008 Description: ... Date Added: 2009-05-22 00:12:21 |
| hw06sp02.pdf Path: N. Illinois >> ELE >> 340 Spring, 2008 Description: Homework 6 ELE 340 Spring 2002 Page 1 of 2 ELE 340 HW 6 Due Mon. March 25 Readings From Yamayee and Bala, Electromechanical Energy Devices and Power Systems: Transformer Performance From Nilsson and Riedel, Electric Circuits 6th Edition: The Ideal... Date Added: 2009-05-22 00:15:31 |
| ReviewFinalFal07.doc Path: MNSU >> FINA >> 460 Fall, 2008 Description: Topic Review for Investments Final Exam: Fall Semester 2007 9:30 section: Wednesday, Dec. 12 @ 8:00 3:30 section: Monday, Dec. 10 @ 12:30 Review problems on margin account and short selling Efficient Markets and the Behavioral Critique: Market Effici... Date Added: 2009-05-22 00:19:24 |
| scattering_theory.pdf Path: Catholic >> FACULTY >> 635 Fall, 2009 Description: Physics 537/635 19 March 2007 Summary of Neutron-proton Scattering Theory at Low Energy Nonrelativistic scattering theory consists of finding solutions of the Schrdinger equation (with E > 0) which have the asymptotic (r64) form . (2) (1) V(r) is ... Date Added: 2009-05-22 00:21:01 |
| m122_3cS00mock.pdf Path: Washington University in St. Louis >> MATH >> 128 Fall, 2008 Description: ... Date Added: 2009-05-22 00:22:03 |
| EE388_II-172-II-178.pdf Path: Rose-Hulman >> EE >> 388 Fall, 2009 Description: Copyright 2000 Marc E. Herniter Copyright 2000 Marc E. Herniter Copyright 2000 Marc E. Herniter Copyright 2000 Marc E. Herniter Copyright 2000 Marc E. Herniter Copyright 2000 Marc E. Herniter Copyright 2000 Marc E. Herniter Copyright 2000 Marc... Date Added: 2009-05-22 00:23:38 |
| 388hw5s.pdf Path: Rose-Hulman >> EE >> 388 Fall, 2009 Description: ... Date Added: 2009-05-22 00:24:00 |
| wk02.pdf Path: Ill. Chicago >> M >> 181 Fall, 2009 Description: Math 181h, Calculus II due January 26, 1999 1. Compare 0 Worksheet 2 1 b sin(x) dx, 0 sin (x) dx, 0 sin x b dx. 2. The hyperbolic functions are dened as ex ex , 2 ex + ex , cosh(x) = 2 ex ex . tanh(x) = x e + ex sinh(x) = Find sinh(x) dx... Date Added: 2009-05-22 00:25:05 |
| lec_13_key_terms.pdf Path: UCSD >> COGS >> 001 Spring, 2009 Description: Howard Poizner on Motor Disorders 1. Breakdown of motor control following failure of sensory of motor systems leads to what? a. Deafferentation [peripheral]- Can you define deafferentation vs afferentation? b. Parkinson\'s disease [central] c. What is... Date Added: 2009-05-22 00:27:40 |
| planend.pdf Path: BU >> LF >> 500 Fall, 2009 Description: Final weeks of CAS LF 500 Fall 2008 Heres the plan for the next few weeks of LF 500, as we are entering the home stretch :-) Please bring Ionesco and Baudelaire to class on days indicated.* Thursday, Nov. 6 Worksheet pages 3 and 4 are due. Liaisons... Date Added: 2009-05-22 00:27:58 |
| 303 HW Sol 3 SP09.pdf Path: Texas A&M >> ENTC >> 303 Fall, 2008 Description: ... Date Added: 2009-05-22 00:32:36 |
| kinetics2b.pdf Path: St. Olaf >> HW >> 126 Fall, 2009 Description: Chemical Kinetics: Integrated Rate Law (Covering Topic 2, Day 2) 1. 2. The irreversible reaction A B has the rate law Reaction Rate = k = 0.002 mol/Lhr. If the concentration of A is 1.0 M initially, how long before the concentration of A drops to ze... Date Added: 2009-05-22 00:34:21 |
| 0427outline.doc Path: SUNY Albany >> CB >> 598342 Fall, 2009 Description: I. Immigration Law to 1924 Race-based and class-based Gender biases (1907 Expatriation Act, etc.) II. Immigration/Racial Consensus Breaks Down Southern and Eastern European immigrants become \"white\" World War II forces many white Americans to fac... Date Added: 2009-05-22 00:34:27 |
| final-with-solutions.pdf Path: CSU Channel Islands >> ICS >> 171 Fall, 2009 Description: ... Date Added: 2009-05-22 00:37:05 |
| midterm.pdf Path: Minnesota >> MATH >> 315 Fall, 2009 Description: MATH 315: Ordinary Dierential Equations MIDTERM May 15, 2006 Please note that you are NOT allowed to use a calculator or any notes. 1. (10 points) Solve the initial value problem sin(x) ex dy 2 y= + 1+ , with y() = 0. dx x x On what interval around ... Date Added: 2009-05-22 00:37:38 |
| june15.pdf Path: Maryland >> WAM >> 170 Fall, 2009 Description: Simple Predicate Logic Syntax The formal system of PL is rather complicated, and in this course we shall not be studying the whole complete system. Rather, we shall only look at a simplified version of PL that we shall call \"Simple Predicate Logic\", ... Date Added: 2009-05-22 00:37:40 |
| sup_9.doc Path: Utah >> NUCLEAR >> 5700 Fall, 2009 Description: RADIATION UNITS AND DOSE CALCULATIONS: Three concepts are used in measuring ionizing radiation: 1. Measurement of the electronic charge by an ionizing particle or ray. 2. Measurement of the energy imparted to matter by the ionizing particle or ray. 3... Date Added: 2009-05-22 00:40:36 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 388 Fall, 2009 Description: / 46094:60655:1447:44 ^ 48293:60745:616:492... Date Added: 2009-05-22 00:42:57 |
| 1031_lecturenotes18.pdf Path: Minnesota >> MATH >> 1031 Fall, 2008 Description: Section 3.7 - Inverse Functions / Section 4.4 - Graphing Polynomials Friday, March 06, 2009 12:19 PM A function is one-to-one if any two different inputs in the domain correspond to two different outputs in the range. That is, if Suppose f is 1-1. ... Date Added: 2009-05-22 00:46:10 |
| 041608min.pdf Path: Ball State >> JUL >> 1408 Fall, 2009 Description: Minutes of PEC Meeting April 16, 2008 Members present: Ayres, Cross, Graham (for Beilke), Hartman, Huffman, Ignico, Melser, Merbler, Mitchell, Mullen, Roberts (for Stroud), Scheib, Seabert, Seymour, Shumaker, Truell Guests Present: Johnson, Miller,... Date Added: 2009-05-22 00:46:25 |
| CDS from M.tuberculosis chaperone.txt Path: Michigan >> MATH >> 548 Fall, 2008 Description: >gi|15607142:c2765289-2763889 Mycobacterium tuberculosis H37Rv complete genome GTGAAGAGCACCGTCGAGCAGTTGAGCCCCACCCGGGTTCGTATCAACGTGGAGGTGCCATTCGCCGAGC TTGAGCCGGATTTCCAGCGGGCCTACAAAGAGCTGGCCAAACAGGTGCGGCTGCCCGGCTTCCGGCCCGG GAAGGCGCCGGCCAAACTACTCGAAGCCC... Date Added: 2009-05-22 00:47:17 |
| 06Cepstral.pdf Path: San Diego State >> CS >> 682 Spring, 2008 Description: Cepstral processing Professor Marie Roch Huang: 6.4,6.4.1,6.4.4, 6.5.2, 9.3.3 1 Speech production Juang p. 17 a glottal excitation source g[n] an... Date Added: 2009-05-22 00:47:35 |
| supply_2perpage.pdf Path: UCSB >> ECON >> 150 Fall, 2009 Description: Income-Leisure Choice Assumptions Y 1. Complete ordering 2. More is better 3. Transitivity 4. DMRS u1 u0 leisure Utility increases as you move outward The 4 assumptions give us smooth well-behaved IDCs Potential Income Constraint Individuals try ... Date Added: 2009-05-22 00:48:00 |
| GridApril15.ppt Path: SUNY Buffalo >> CSE >> 487 Fall, 2009 Description: Grid Computing B.Ramamurthy 04/27/09 B.Ramamurthy 1 Material 1. The presentation is based on the two main publications on grid computing given below: The Physiology of the Grid, An Open Services Architecture for Distributed Systems Integration,... Date Added: 2009-05-22 00:48:12 |
| mapnet.pdf Path: UCLA >> DESIGN >> 258 Spring, 2009 Description: los angeles_california 3.1.03 6.1.03 9.1.03 12.1.03 2.1.04 5.1.04 3.1.03 6.1.03 9.1.03 12.1.03 2.1.04 5.1.04 ann arbor_michigan 3d organization_activating lines network organization ann arbor_michigan dma 258 l database aesthetics adam fure ... Date Added: 2009-05-22 00:50:05 |
| 5894_ORBH491syllabus_Cal-08.doc Path: Case Western >> DATA >> 091 Fall, 2009 Description: ORBH 491, Managing Diversity and Inclusion Department of Organizational Behavior Weatherhead School of Management Case Western Reserve University Fall, 2008 Tuesday 5:30-8:00 P.M., PBL 04 Professor Susan Schick Case PBL 440 (216) 368-5018 (WSOM) (216... Date Added: 2009-05-22 00:51:04 |
| adobetut.ppt Path: ASU >> WEST >> 546 Fall, 2009 Description: Adobe Acrobat Tutorial kindness of Todd and Miguel Saving a file to a PDF Click on: >File >Print Click the pull-down menu for Printer and check adobe pdf. Save file to the appropriate folder making sure to have a pdf extension at the end. To open... Date Added: 2009-05-22 00:51:37 |
| HW18.pdf Path: NMT >> M >> 411 Fall, 2009 Description: given: Th 4/12 due: Th 4/24 M411 HW 18 1. 24.4 a): hint: First use theorem 24.9 to show that limm !1 kAn k = 0 () limn !1 kT n k = 0 where A = QT Q . Make use of the sentence after (24.10) in the book to relate (A) < 1 with the diagonals of T . Next,... Date Added: 2009-05-22 00:53:03 |
| 04-17-dfs.pdf Path: Washington University in St. Louis >> CSE >> 241 Fall, 2008 Description: ... Date Added: 2009-05-22 00:54:42 |
| hw3-practice-sols.pdf Path: Washington University in St. Louis >> CSE >> 241 Fall, 2008 Description: CSE 241 Algorithms and Data Structures Solutions to Practice Problems for Homework 3 1. Suppose you are given the task to sort one thousand 32-bit keys. You have decided to use radix sort for this problem and want to decide how many bits each radix ... Date Added: 2009-05-22 00:55:08 |
| lab1.pdf Path: Washington University in St. Louis >> CSE >> 241 Fall, 2008 Description: CSE 241 Algorithms and Data Structures Fall Semester, 2007 Lab 1 September 4, 2007 Due Date: September 18 (early date: September 11) 1 Overview Ensure that you understand the divide-and-conquer closest-pair algorithm presented in class. Get a h... Date Added: 2009-05-22 00:55:10 |
| lab3.pdf Path: Washington University in St. Louis >> CSE >> 241 Fall, 2008 Description: CSE 241 Algorithms and Data Structures Fall Semester, 2007 Lab 3 October 30, 2007 Due Date: November 13 (early date: November 6) The goal of this lab is to help you gain experience in using the ADTs and data structures we have been studying to imp... Date Added: 2009-05-22 00:55:10 |
| new-colt93.ps Path: Washington University in St. Louis >> CS >> 527 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: colt93.dvi %Pages: 12 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o new-colt93.ps colt93.dvi %DVIPSParameters: dpi=300, co... Date Added: 2009-05-22 00:55:21 |
| parht1.txt Path: Wisconsin >> ENGR >> 602 Fall, 2009 Description: .004 1.596 1.596 1.0e-4 1.0 50.0 100.0 7 .375 .5 50000.0 .625 .5 50000.0 .517 .517 50000.0 1.083 .517 50000.0 .646 .430 50000.0 .8 .4 50000.0 .954 .430 50000.0 ... Date Added: 2009-05-22 00:55:22 |
| Section574.pdf Path: Penn State >> GEOEE >> 408 Spring, 2008 Description: ... Date Added: 2009-05-22 00:55:44 |
| alaskaquakes.pdf Path: Idaho >> GEOL >> 344 Spring, 2008 Description: Pr e-1 96 4E Po ar th stqu 19 ak 64 es Ea Ea rth rth qu qu ak ak eM es ag ni tu de U.S. DEPARTMENT OF THE INTERIOR U.S. GEOLOGICAL SURVEY Earthquakes in Alaska arthquake risk is high in much of the southern half of Alaska, but it is not the same ev... Date Added: 2009-05-22 00:56:51 |
| Homework3_03.doc Path: Rose-Hulman >> PH >> 112 Fall, 2009 Description: Physics II Homework III Chapter 22; 16, 22, 36, 56, 68, Chapter 23; 6, 26, 34 22-16: a) CHJ b) Fx = -2 1 kqQ 1 - 2kqQx cos = , Fy = 0 2 2 4 0 ( a + x ) 4 0 (a 2 + x 2 )3 / 2 c) At x = 0, F = 0. d) 22-22: a) The electric field of the Earth points... Date Added: 2009-05-22 01:01:02 |
| C8051F02x-DK.pdf Path: RIT >> P >> 05911 Fall, 2009 Description: C8051F02x-DK C8051F02 X D E V E L O P M E N T K I T U S E R \' S G U I D E 1. Kit Contents The C8051F02x Development Kit contains the following items: C8051F020 Target Board Serial Adapter (RS232 to Target Board Debug Interface Protocol Converter) ... Date Added: 2009-05-22 01:01:04 |
| Chap7EffectiveModuleDesign.pdf Path: Lincoln U. CA >> CSCI >> 4490 Fall, 2009 Description: Software Engineering CSCI4490 Lessons 22-24 Effective Module Design October 20, 22, 27, 29, 2008 Software Engineering CSCI4490 *Chap7 (Schach) From Modules to Objects The road to Object-Oriented programming: Objects Information Hiding Abstract Dat... Date Added: 2009-05-22 01:01:31 |
| Lesson 9- Array Lists and JOptionPane.pdf Path: Lincoln U. CA >> CSCI >> 3381 Fall, 2009 Description: Object-Oriented S/W Development with Java CSCI 3381 Lesson 9: Array Lists and JOptionPane February 12, 2009 Object-Oriented S/W Development with Java CSCI 3381 Array Lists and JOptionPane The for-each loop The Array List The JOptionPane for simple... Date Added: 2009-05-22 01:02:06 |
| CourseRequirements.pdf Path: Berkeley >> IB >> 133 Fall, 2009 Description: IB 133: Course Requirements Spring 2009 1. Attend orientation meeting (Jan. 26th, 4 pm, 50 Birge). 2. Attend meeting to choose teams, topics, and grade level; Berkeley and Albany presentations (Feb. 2nd, 4pm, 50 Birge). 3. Attend meeting to receive t... Date Added: 2009-05-22 01:03:18 |
| Addendum_4_Schedule_2009.pdf Path: Washington >> CM >> 321 Winter, 2008 Description: ! \" #$% % \' \' ( ) # * \" +\" \' - ) \" , . ) \" !( \" #$%. \" . ( \" \" 0 - / ) / 2 * \" 0 . . ) \" . ) \" ) 6 #$ % \" \' - / / - 03 4 \' \" ,5 % 2 6 .7 ) / ) \" \" 8 - ) . \' ()% * * * 6 .3 4 \' / / - ) - \' \" + * / + , ... Date Added: 2009-05-22 01:03:27 |
| swt_hw.pdf Path: Virginia Tech >> USERS >> 5516 Fall, 2009 Description: Switching Hardware ECP/CS 5516 Computer Networks Amitabh Mishra Electrical & Computer Engineering Department Fall 2001 ECE 5516 1 Outline 1. Switches - Switching Function - Ports and Buffering 2. Switching Fabrics - Crossbar Switch - Knockout Sw... Date Added: 2009-05-22 01:04:50 |
| WCM_15(13)b.pdf Path: Wisconsin >> BLOG >> 549 Fall, 2009 Description: Volume 15 Number 31 - University of Wisconsin Crop Manager - June 5, 2008 Plant Disease UW Madison/ Extension Plant Disease Diagnostic Clinic (PDDC) Update . 66 Crops Double Crop Soybeans in WI: More Risk than Reward .. 66 WI) have some grower... Date Added: 2009-05-22 01:05:00 |
| Exam 2ans.pdf Path: Texas A&M >> GENE >> 603 Fall, 2008 Description: Name Exam 2 October 26, 2007 1. What biosynthetic pathways could show regulation via attenuation? amino acid biosynthetic pathways in prokaryotes Very briefly explain how attenuation works. As soon as a leader containing several codons for the spec... Date Added: 2009-05-22 01:05:14 |
| sequester.pdf Path: Wisconsin >> AAE >> 344 Fall, 2009 Description: New Report Backs Planting More Trees to Fight Warming Click here for NYTimes.com Wireless Services February 10, 2001 Single-Page Format New Report Backs Planting More Trees to Fight Warming By ANDREW C. REVKIN n influential panel of scientists i... Date Added: 2009-05-22 01:08:11 |
| d2_sch.pdf Path: BYU >> ECE >> 224 Fall, 2008 Description: ... Date Added: 2009-05-22 01:08:25 |
| 05_-_Equilibria_I.ppt Path: Brookdale >> PHYC >> 6421 Fall, 2009 Description: Charged-Particle and Radiation Equilibria I Radiation Equilibrium Charged-Particle Equilibrium Introduction The concepts of radiation equilibrium (RE) and charged-particle equilibrium (CPE) are useful in radiological physics as a means of relating ... Date Added: 2009-05-22 01:10:11 |
| Section1.6.pdf Path: Purdue >> EE >> 438 Fall, 2000 Description: Sec. 1.6. Z-Transform 105 1.6 Z-Transform The z-transform is an important tool for lter design and for analyzing the stability of systems. It is dened as X(z) = n= x(n)z n , (1.44) where z is a complex variable, i.e. z = |z|ej . |z| = 1 l l ... Date Added: 2009-05-22 01:10:49 |
| 2006-01-24In a Richer China, Billionaires Put Money on Marriage.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: January 24, 2006 Shanghai Journal In a Richer China, Billionaires Put Money on Marriage By HOWARD W. FRENCH SHANGHAI, Jan. 23 - It was only a matter of time before money transformed that most intimate of private domains, love and marriage, as it ha... Date Added: 2009-05-22 01:11:07 |
| 3-31-04Freethinkers In Americas Long Culture War, Under God or Under Citizens.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Books of The Times Freethinkers In America\'s Long Culture War, Under God or Under Citizens? March 31, 2004 By MICHAEL KAZIN \"Rulers who wish to subvert the public liberty, may have found an established clergy convenient auxiliaries,\" James Madison... Date Added: 2009-05-22 01:11:16 |
| 2006-06-18The Heretic Jew.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: June 18, 2006 \'Betraying Spinoza,\' by Rebecca Goldstein The Heretic Jew Review by HAROLD BLOOM TO anatomize influence, you may well begin with its greatest denier, Baruch Spinoza. His \"Ethics\" exiles contingency, singularity and all scen... Date Added: 2009-05-22 01:11:56 |
| 2004-9-13Afghan Crowds Loot and Burn Over Governors Dismissal.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Afghan Crowds Loot and Burn Over Governor\'s Dismissal September 13, 2004 By CARLOTTA GALL HERAT, Afghanistan, Sept. 12 - Violent demonstrators ransacked and burned at least four United Nations office compounds and a human rights office here on Su... Date Added: 2009-05-22 01:12:33 |
| s11_47.pdf Path: Fayetteville State University >> PHY >> 4241 Fall, 2009 Description: PROBLEM 47 The Matrix L is dened by: L= l00 l10 l20 l30 l01 l11 l21 l31 l02 l12 l22 l32 l03 l13 l23 l33 . (a)Calculate gL. (b)Write down the transpose matrix L. (c)CalculateLg. (d)Compare (a) and (c) to nd the general form of L (i.e. ... Date Added: 2009-05-22 01:14:08 |
| announce.pdf Path: Fayetteville State University >> PHY >> 2048 Fall, 2009 Description: Announcements 1. Make-up Labs: UPL 107, M Dec 1 69 pm, W Dec 3 12:303:30 pm, F Dec 5 12:303:30 pm. Rules: You can take up to three. Pick the Lab you have to make-up and come prepared. No introduction will be given. If your lab record is not complete,... Date Added: 2009-05-22 01:14:09 |
| hw5.pdf Path: Villanova >> ECE >> 3240 Fall, 2009 Description: ECE 3240, Discrete Time Signals & Systems, Spring 2009 Problem Set # 5: continuous time convolution - the convolution integral Chapter 2 Problem Topics: 2.70-85,90 (convolution integral - all approaches) 2.86-89 (CT LTI issues) Homework # 4 (Do by Th... Date Added: 2009-05-22 01:17:23 |
| agenda20060420m.pdf Path: Arkansas >> DEPTS >> 20060420 Fall, 2009 Description: ATTACHMENT M LETTER OF NOTIFICATION - 10 GRADUATE CERTIFICATE PROGRAM (12-18 SEMESTER CREDIT HOURS) 1. Institution submitting request: University of Arkansas 2. Contact persons/title: Dr. Roy Farley, Department Head Educational Leadership, Counselin... Date Added: 2009-05-22 01:17:36 |
| H55_DeptStack.pdf Path: Wisconsin >> C >> 636 Fall, 2009 Description: Dept-90 C13 Dept-135 H55 (H:C-15) in CDCl3 w/ ~2 drops MeOD Athena Automation 300MHz 26.March.03 D. R. Mowrey 201.296 200 150 100 174.977 145.756 134.037 132.482 130.978 128.413 128.085 126.781 126.628 126.023 125.606 O H H H H H OH 77.425 ... Date Added: 2009-05-22 01:17:43 |
| lect11rev.pdf Path: UMBC >> CMSC >> 104 Fall, 2006 Description: Problem-Solving and Computer Programming Review Questions - Lecture 11 Peter Olsen October 25, 1999 1. The programmer uses a C code. 2. C Code is also called . to create or modify files containing and a file containing it is called a 3. To actually ... Date Added: 2009-05-22 01:18:58 |
| IRS-td.9003.pdf Path: IUPUI >> DN >> 893 Fall, 2009 Description: DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 1 and 602 Treasury Decision 9003 RIN 1545-AW64 [1] AGENCY: Internal Revenue Service (IRS), Treasury. [2] ACTION: Final regulations. [3] SUMMARY: This document contains final regulations... Date Added: 2009-05-22 01:20:51 |
| hibbeler-7e-solns-ch15.pdf Path: University of Illinois, Urbana Champaign >> GE >> 310 Fall, 2008 Description: ... Date Added: 2009-05-22 01:22:19 |
| o\'odham-health-issues.pdf Path: Arizona >> TRAD >> 101 Fall, 2008 Description: Oodham: Health Issues Part I: Indian Health Service Part II: Desert Diet and Diabetes Mascha N. Gemein TRAD 101 Many Nations of Native America 19 Nov 2008 Indian Health Health care part of Federal trust responsibility Prevalent diseases 19th/earl... Date Added: 2009-05-22 01:22:31 |
| Learning Goals for Test 3.doc Path: South Carolina Upstate >> CHEM >> 112 Fall, 2009 Description: Learning Goals for Test 3 Ch. 15 1. Identify solutions which can act as buffers and determine which solutions would have the greater buffer capacity. Explain how buffers maintain pH. (15.6, 15.34, 15.60, 15.62, 15.64) 2. Given the initial concentrati... Date Added: 2009-05-22 01:25:27 |
| grp6_wk2.ppt Path: UCSD >> ECE >> 191 Fall, 2004 Description: ECE 191: Group 6 Physical Activity Meter Mentor: Paul Blair, Ph.D Group: Joshua Ramos Joseph Sabet Tommy Truong Sponsored by: Calit2 1 Agenda Gantt Chart Tasks performed Statement of Work Project Overview Summary and Plans for next week 2 Ga... Date Added: 2009-05-22 01:26:35 |
| BooleanCircuits.doc Path: CSB-SJU >> CSCI >> 130 Fall, 2009 Description: CSCI 130 01A Boolean Logic and Circuit Design Study Sheet Truth Tables for Gates NOT: - single input and single output \"flips\" the bit. Determines the \"opposite\" \"NOT A\" written as A\' NOT Truth Table A 1 0 NOT A (A\') 0 1 AND: two or more inputs ... Date Added: 2009-05-22 01:26:52 |
| lecture_3_cm4655.pdf Path: Mich Tech >> CM >> 4655 Fall, 2008 Description: CM4655 Polymer Rheology Lab Elongational Flow Measurement x3 Prof. Faith A. Morrison Michigan Technological University x1 , x2 1 Faith A. Morrison, Michigan Tech U. Two main standard flows in rheology: Shear Flow capillary flow; torsional flow ... Date Added: 2009-05-22 01:29:06 |
| hoffman-Kim.pdf Path: Georgia Tech >> COA >> 8672 Fall, 2008 Description: COMPUTER-AIDED DESIGN Computer-Aided Design 33 (2001) 8190 www.elsevier.com/locate/cad Towards valid parametric CAD models C.M. Hoffmann a,1,*, K.-J. Kim b,2 b Department of Computer Sciences, Purdue University, West Lafayette, IN 47907, USA The Pr... Date Added: 2009-05-22 01:30:17 |
| School_Stats.xls Path: University of Illinois, Urbana Champaign >> CI >> 436 Fall, 2008 Description: Country Number of Children (Age 0-14) School Life Expectancy (Years) Education Expenditures elow poverty line (%) Literacy (%) (%) B Afghanistan 14595539 8 28.10 53.00 Albania 853883 11 2.90 98.70 25.00 Algeria 8878665 13 5.10 69.90 25.00 Angola 5467... Date Added: 2009-05-22 01:32:06 |
| 980922.txt Path: Virginia Tech >> CS >> 5944 Spring, 2008 Description: \"Sieve: A Java-Based Framework for Collaborative Component Composition\" Dr. Clifford Shaffer, Associate Professor, Dept. of Computer Science September 22, 1998 Computer Science Graduate Seminar CS 59... Date Added: 2009-05-22 01:33:40 |
| hw3.pdf Path: Virginia Tech >> CS >> 1044 Fall, 2000 Description: CS 1044 Project 3 Spring 99 The Program Specification: Party Music You are putting together a music tape for a party and have arranged a list of songs in the order in which you want to play them. However, you do not know whether all the songs wil... Date Added: 2009-05-22 01:34:16 |
| JH_3+.pdf Path: Georgia Tech >> MATH >> 8823 Fall, 2008 Description: 4.8 Perfect matchings in random uniform hypergraphs Random d-regular graph on V = {1, ., n} P Conguration Model Gd (n) Uniform Model Gd (n) Uniform Model Gd (n) P Pairing Model Gd (n) Superposition Model (with/without multiple edges) Permu... Date Added: 2009-05-22 01:34:23 |
| SYLLABUS-Spring 2008 PY101.pdf Path: Pine Manor College >> PY >> 101 Fall, 2009 Description: PY101 Introduction to Psychology- Spring 2008 Instructor: Le Ngu, Ph.D. Teaching Assistant: Priscila Assis Class Time: MWF 10:00-10:50 am Lab Time: Wednesday 1:45-3:45 or Thursday 1:00-3:00 Office: Haldan 104 Contact: 617-731-7063; ngule@pmc.edu Offi... Date Added: 2009-05-22 01:36:52 |
| PY364 study qs exam 1 spr 09.pdf Path: Pine Manor College >> PY >> 364 Fall, 2009 Description: PY364 Adulthood B, Chaps 1, 2, 3, Tuesday, February 17, 2009 1. Define normative age-graded changes. Discuss the three varieties that influence adult development. Then, define and discuss normative history-graded i... Date Added: 2009-05-22 01:37:02 |
| Bi 101 Chapter 1 fall 08.ppt Path: Pine Manor College >> BI >> 101 Fall, 2009 Description: Chapter 1: Biology Today Chapter 1 Learning Objectives 1. 2. 3. 4. 5. To understand the characteristics of living organisms To understand the levels of biological organization To distinguish between the three domains and four eukaryotic kingdoms To... Date Added: 2009-05-22 01:37:07 |
| hw2_problems.pdf Path: Utah >> PHYSICS >> 4410 Fall, 2009 Description: University of Utah, PHYS 4410, Classical Physics I, Fall Semester 2008 Homework #2 Assigned: Due: Tuesday 09/09/2008 Tuesday 09/16/2008 1. Consider the matrices 1 2 3 1 A = 4 5 6 ; B = 7 7 8 9 0 (b) AC Find (a) |AB| [10 points] 0 2 8 2 ... Date Added: 2009-05-22 01:37:29 |
| lec11_supp.pdf Path: Utah >> PHYS >> 3410 Fall, 2008 Description: ... Date Added: 2009-05-22 01:39:18 |
| Oct1.08.doc Path: Johns Hopkins >> DATA >> 3601 Fall, 2009 Description: OFFICE OF CAREER COUNSELING AND PLACEMENT Virginia Probasco, Admin. Ass\'t ginpro@peabody.jhu.edu Hours, 1 - 5 p.m. 1 E. Mount Vernon Place Room P06, Conservatory Baltimore, MD 21202 (410) 659-8100 x4450 www.peabody.jhu.edu/jvb JOB VACANCY BULLETIN ... Date Added: 2009-05-22 01:39:35 |
| hwk_42_sprg09_09.pdf Path: Georgia Tech >> ECE >> 3042 Fall, 2008 Description: ECE 3042 Spring 2009 Homework Problem Set 9 Due Week of April 13 1. Use SPICE (either Cadence or National Instruments) to plot the dc transfer characteristic of a basic BJT INVERTER. The dc power supply voltage is +5 V, the base resistor 470 k, and ... Date Added: 2009-05-22 01:39:42 |
| 1960rcs0-110.pdf Path: Neumont >> CSC >> 1959 Fall, 2009 Description: Supreme Court of Canada Kolstad v. The Queen, [1960] S.C.R. 110 Date: 1959-12-21 Robert Kolstad Appellant; and Her Majesty The Queen Respondent. 1959: November 4; 1959: December 21. Present: Kerwin C.J. and Taschereau, Fauteux, Abbott and Martland JJ... Date Added: 2009-05-22 01:44:52 |
| MP Lecture 13 Path: UAB >> NSM >> BY 404 Fall, 2008 Description: ... Date Added: 2009-05-23 17:02:13 |
| Exam3-S03 Path: Penn State >> CHEM >> 110 Fall, 2009 Description: ... Date Added: 2009-05-24 19:50:00 |
| Uncertain Economics.pdf Path: Idaho >> CE >> 215 Fall, 2008 Description: Risk and Uncertainty Uncertainty in Economic Analysis CE 215 2008, Richard J. Nielsen Weve already mentioned that interest rates reflect the risk involved in an investment. Risk and uncertainty can affect an investment in a variety of ways. In s... Date Added: 2009-05-26 15:23:42 |
| lec26.doc Path: UNC Asheville >> CSCI >> 333 Fall, 2009 Description: CSCI 333: Sorting by Comparison of Keys The lower bound for sorting only by comparison of keys Can we develop sorting algorithms with complexities better than order (n lg n)? If we limit our selves to sorting by only by (binary) comparison of keys,... Date Added: 2009-05-26 15:28:04 |
| Internet Connection Sharing.doc Path: ECPI >> CIS >> 150 Fall, 2009 Description: Internet Connection Sharing Objectives: Understand the process for configuring an Ad-Hoc wireless network to access the Internet Identify and understand the process for configuring Internet Connection Sharing (ICS) Materials needed: Windows ... Date Added: 2009-05-26 15:29:31 |
| 0_PC_Intro.ppt Path: ECPI >> IST >> 205 Fall, 2009 Description: PC Overview 1 Topic: Exterior Three major models of Personal Computers (PCs) Tower Desktop Stands upright on floor Lays flat on top of desk Monitor sits on top of case Laptop (Covered Later) 2 Items Accessible from the Front ... Date Added: 2009-05-26 15:29:50 |
| security.ps Path: Princeton >> CS >> 461 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - security %Creator: Windows NT 4.0 %CreationDate: 9:27 3/20/2000 %Pages: (atend) %BoundingBox: 13 13 599 780 %LanguageLevel: 2 %... Date Added: 2009-05-26 15:31:57 |
| license.txt Path: Texas >> ISCHOOL >> 32828 Fall, 2009 Description: License granted by Jennifer Lindley (jlindley@ischool.utexas.edu) on 2007-05-05T16:40:57Z (GMT): NON-EXCLUSIVE PRESERVATION AND DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to the Schoo... Date Added: 2009-05-26 15:34:39 |
| Assignment 1 - Site Review.doc Path: Brookdale >> ECMM >> 6012 Fall, 2009 Description: ASSIGNMENT 1 ECMM6012 Philip K. Kuruvilla (B00378922) Options for the online purchase of the book for this course: Web Security, Privacy and Commerce, by Simson Garfinkel and Gene Spafford: Comparisons and risk assessment Online procurement of goods... Date Added: 2009-05-26 15:35:29 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 1810 Fall, 2009 Description: 58 8136:3017:2006:1059 a 20312:2898:1532:1119 16021:56441:1003:719 50934:7474:975:719 33603:2878:1421:1079 above 7857:39093:5377:699 ago 42157:28000:3566:739 an 44720:18527:2145:739 42965:9053:2201:739 ancient 24018:40572:6742:799 and 46476:39113:331... Date Added: 2009-05-26 15:35:33 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2626 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>325a59eae8be180e36474dde01d113c6e6b1dea0.txt</Key><RequestId>F393329E20BB1498</RequestId><HostId>biE2RLZtUhQLuA89oaREy5/pnYUF... Date Added: 2009-05-26 15:37:09 |
| quiz3.pdf Path: Wisconsin >> MATH >> 211 Fall, 2008 Description: Name . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Math 211 Quiz 3 Section 307 (12:05-12:55pm) 313 (3:30-4:20pm) Mar 11, 2008 Show work and box your answers. 1. (7pt... Date Added: 2009-05-26 15:42:43 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2784 Fall, 2009 Description: 1 8230:57063:690:554 24383:25889:715:593 2 46646:25889:766:574 39643:57083:792:574 a 53879:57340:664:415 55234:58191:766:435 14134:23731:511:435 6262:19021:511:415 11067:24662:511:415 acting 47336:55579:3194:692 active 53598:40239:3859:435 actively 4... Date Added: 2009-05-26 15:50:07 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2132 Fall, 2009 Description: - 36532:31366:363:132 -sid 39752:41667:3695:397 /fnni 36112:10786:7922:1102 28 12709:7058:1371:551 a 33593:33704:783:617 23151:47403:783:617 58592:13984:699:705 54169:18595:783:617 48850:15484:755:617 46918:23139:755:595 about 34461:54880:4843:970 al... Date Added: 2009-05-26 15:50:09 |
| output.txt Path: Virginia Tech >> CS >> 1704 Spring, 2003 Description: Face: right white blue yellow white orange blue yellow white blue Face: left green red green green red blue white orange orange Face: face orange green blue red blue red yellow orange green Face: rear blue white red orange green red red blue blue ... Date Added: 2009-05-26 15:50:48 |
| ELSyllabus_05-06.doc Path: Johns Hopkins >> CTE >> 473 Fall, 2009 Description: Johns Hopkins University School of Professional Studies in Business and Education Graduate Division of Education Effective Leadership SELA 851.705.9S Summer 2005 Online Instructor: Gene Streagle (H) 410-465-3003 dgba4@comcast.net TBD- See website ... Date Added: 2009-05-26 15:51:10 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 1519 Fall, 2009 Description: 311 5809:2980:5544:1361 4 59239:23267:6272:6384 ^n 38300:8244:8592:2117 boys 27366:8380:10447:2117 e 23457:19485:2584:1724 girls 47400:8229:11375:2148 how 18288:12208:10094:2178 j. 27101:19424:2120:1754 study 35119:12132:13319:2117 tmching 6758:8471:... Date Added: 2009-05-26 15:51:46 |
| W-EMTALA.ppt Path: George Mason >> DOIT >> 547 Fall, 2009 Description: The Emergency Medical Treatment and Active Labor Act (EMTALA) George Mason University College of Nursing and Health Science Regulatory Requirements for Health Systems Summer 2004 Legislative Background The Emergency Medical Treatment and Active Labo... Date Added: 2009-05-26 15:51:47 |
| SevenState.pdf Path: Columbia >> WW >> 2040 Fall, 2009 Description: EDU> P = [.3 0 .7 0 0 0 0; .2 .6 .2 0 0 0 0; .1 .6 .3 0 0 0 0; . 0 0 0 .3 .7 0 0; 0 0 0 .8 .2 0 0; .1 0 .3 .2 .3 .1 0;. .1 .2 0 .1 0 .3 .3] P= 0.3000 0 0.7000 0 0 0 0 0.2000 0.6000 0.2000 0 0 0 0 0.1000 0.6000 0.3000 0 0 0 0 0 0 0 0.3000 0.7000 0 0 0... Date Added: 2009-05-26 15:52:47 |
| 20011018_dynamic.ps Path: Duke >> CPS >> 130 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.78 Copyright 1998 Radical Eye Software (www.radicaleye.com) %Title: 20011018_dynamic.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMSSBX10 CMSS10 CMR10 CMMI10 CMR7 CMMI7 CMSSI10 CMSY7 ... Date Added: 2009-05-26 15:59:01 |
| Actuators_and_Sorters.ppt Path: BYU >> ME >> 486 Fall, 2009 Description: Assembly Components: End Effectors Spencer Shore October 13, 2008 Actuators Definition: a transducer that changes some form of input into an output of physical movement (i.e. electrical current to rotational displacement, such as an electric motor).... Date Added: 2009-05-26 16:00:38 |
| Student_ID09.pdf Path: Johns Hopkins >> DATA >> 4065 Fall, 2009 Description: Summer 2009 PreParatory Student Id requeSt Form For new Peabody Campus Preparatory students only. Continuing students who already have an identification card do not need to fill out this form. Your card will be re-activated once your registration is ... Date Added: 2009-05-26 16:02:27 |
| KurzweilPoems.pdf Path: Loyola Maryland >> CS >> 111 Fall, 2009 Description: 1. is beauty itself that they were walking there. All along the new world naked, cold, familiar wind2. Pink confused with white flowers and flowers reversed take and spill the shaded flame darting it back into the lamp\'s horn 3. The winds of the oozy... Date Added: 2009-05-26 16:02:43 |
| Concurrency Control Using Non-Locking Methods.ppt Path: SIU Edwardsville >> CS >> 534 Spring, 2008 Description: Concurrency Control Using Non-Locking Methods -by Rajesh Mulampaka. INTRODUCTION A major objective in developing a database is to allow concurrent access to the shared data for all the users who are accessing the database. Concurrency contr... Date Added: 2009-05-26 16:03:12 |
| Zerega-2005.pdf Path: Millersville >> HERBARIUM >> 325 Fall, 2009 Description: Nyree Zerega, Diane Ragone, and Timothy J. Motley CHAPTER 10 Breadfruit Origins, Diversity, and Human-Facilitated Distribution I received the seeds of the bread tree. . . . One service of this kind rendered to a nation, is worth more to them than a... Date Added: 2009-05-26 16:04:40 |
| HW14.pdf Path: Union College >> PHYSICS >> 270 Fall, 2009 Description: ... Date Added: 2009-05-26 16:06:45 |
| rubberpadexpt.doc Path: Ohio State >> STAT >> 528 Summer, 2006 Description: Chapter 7 -Several Crossed Treatment Factors Case Study Base rubber blocks (the experimental units in this study) are formed into flat rubber pads that are used in an inductive heat transfer container sealing process. An experiment was conducted to t... Date Added: 2009-05-26 16:08:42 |
| p10413.pdf Path: LSU >> V >> 104 Fall, 2009 Description: Problem C Crazy Savages Input: standard input Output: standard output Time Limit: 30 seconds Memory Limit: 64 MB There are crazy savages on a mysterious island. There are m caves arranged in a circle. The caves are numbered 1,2,.m in clockwise order... Date Added: 2009-05-26 16:09:33 |
| p10437.pdf Path: LSU >> V >> 104 Fall, 2009 Description: Brightness of Brain Contest Problem I Time limit: 1 second Memory: 16 MB Playing With Fraction The Problem Sometimes it may be found that some numbers if represented in normal integer or floating point value will not be precise enough for some calcu... Date Added: 2009-05-26 16:09:36 |
| WSLimitsSol.pdf Path: MN State >> M >> 261 Fall, 2009 Description: ... Date Added: 2009-05-26 16:10:07 |
| L4 Money Intrates Exrates.pdf Path: East Los Angeles College >> EC >> 368 Fall, 2009 Description: EC368 International Money and Finance Money, interest rates and exchange rates Dr. Aris Kartsaklas akarts@essex.ac.uk Lecture 4 Spring Term 2008/2009 1 1 Money, interest rates and exchange rates in the short and long run The role of money Medium ... Date Added: 2009-05-26 16:11:10 |
| ece309f_s04a.pdf Path: W. Alabama >> ECE >> 309 Fall, 2009 Description: ECE309 INTRODUCTION TO THERMODYNAMICS & HEAT TRANSFER 3 August 2004 Final Examination R. Culham This is a 3 hour, closed-book examination. You are permitted to use one 8.5 in. 11 in. crib sheet (both sides), Conversion Factors (inside cover of tex... Date Added: 2009-05-26 16:11:50 |
| 16f84onProtoBrd.pdf Path: SUNY Canton >> ELEC >> 213 Fall, 2009 Description: ... Date Added: 2009-05-26 16:11:58 |
| hw1.pdf Path: UC Davis >> ECS >> 140 Fall, 2009 Description: Assignment 1 Due: Thursday, 9 April 2009 (in class) This assignment asks you to prepare written answers to questions on BNF, EBNF, and Syntax Diagrams. Each of the questions has a short answerno essays, please! You may discuss this assignment with ot... Date Added: 2009-05-26 16:12:14 |
| chapter4-4up.pdf Path: Duke >> CPS >> 006 Fall, 2009 Description: Tools we have, Tools we need We know about input and output Streams: cin and cout (also cerr, whats it for?) We know about functions for abstraction/decomposition Singing songs, Printing one-million lines We know about arithmetic operators: +, -, *, ... Date Added: 2009-05-26 16:13:40 |
| quiz1.pdf Path: Redlands >> PHYS >> 102 Fall, 2009 Description: Name _ Section: _ PHYSICS 102 QUIZ 1 January 22, 2003 1. (1) Which of the following is a real, historic, manned space mission? a. Apollo 3 b. Faith 7 c. Gemini 2 d. Mercury-Redstone 1 e. Enterprise 7 2. (1) Is the moon ever visible in the afternoon... Date Added: 2009-05-26 16:15:40 |
| 10-c-store-rdf.pdf Path: Duke >> CPS >> 399 Spring, 2009 Description: D.Abadi et al. Presented by: Nedyalko Borisov Instructor: Jun Yang Duke University Computer Science Jan 29, 2008 Introduction Semantic Web Extension of Word Wide Web Integration and share of data Data model Resource Description Framework (... Date Added: 2009-05-26 16:15:45 |
| Exam1Spring2005.pdf Path: Puget Sound >> CS >> 455 Fall, 2009 Description: Computer Science 455 First Hour Exam Name _ Friday, Feb. 20 100 pts. Page 1 I. a. Some basics. (10 pts.) Give a brief definition of a database and of a database management system, including some descriptive detail (i.e., a one sentence answer wi... Date Added: 2009-05-26 16:16:10 |
| 308183916.pdf Path: Allan Hancock College >> DECO >> 1012 Fall, 2009 Description: Assignment 3: Toys and Games I N D I V ID U AL ST U D E N T Student Lookup Research Class Average 308183916 71.6% 0.0% Experiments 73.4% 0.0% Documentation 74.4% 20.0% Design 77.4% 40.0% Code 75.0% 40.0% Total 69.7% 22.0% No docs. Obscene code. Comm... Date Added: 2009-05-26 16:17:56 |
| 308183916.pdf Path: Allan Hancock College >> ASSIGNMENT >> 1012 Fall, 2009 Description: Assignment 3: Toys and Games I N D I V ID U AL ST U D E N T Student Lookup Research Class Average 308183916 71.6% 0.0% Experiments 73.4% 0.0% Documentation 74.4% 20.0% Design 77.4% 40.0% Code 75.0% 40.0% Total 69.7% 22.0% No docs. Obscene code. Comm... Date Added: 2009-05-26 16:17:56 |
| eastwest.pdf Path: UMass Lowell >> FACULTY >> 491 Fall, 2009 Description: East Side, West Side . . . an introduction to combinatorial familieswith Maple programming Herbert S. Wilf University of Pennsylvania Philadelphia, PA, USA May 28, 2002 1 2 Contents 1 Introduction 1.1 What this is about . . . . . . . . . . . . . ... Date Added: 2009-05-26 16:19:26 |
| CarbonNanoTubes.Fall2002.269.pdf Path: Youngstown >> CHEM >> 6991 Fall, 2008 Description: Carbon 40 (2002) 8185 Multi-step purification of carbon nanotubes P.X. Hou, S. Bai, Q.H. Yang, C. Liu, H.M. Cheng* Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110015, China Received 20 October 2000; accepted 8 ... Date Added: 2009-05-26 16:21:31 |
| Recitation 2006-11-21.pdf Path: Rutgers >> CS >> 352 Spring, 2006 Description: PPP, Frame Relay and ATM CS 352 Internet Technology Rutgers University Rob Moore 21 November, 2006 1 Point-to-Point Protocol (PPP) Requirements (IETF) [p.489 2nd ed.] \"Unrequirements\" Packet framing Transparency Multiple network-layer protoco... Date Added: 2009-05-26 16:22:18 |
| Course plan.doc Path: Washington >> MGMT >> 300 Fall, 2008 Description: MGMT 300 Course Plan Session 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Topic Intro to OB Job performance Organizational commitment Teams: Characteristics Personality and cultural values Ability Job satisfaction Motivation Midterm exam Teams: Processes L... Date Added: 2009-05-26 16:22:49 |
| ps3.pdf Path: Wesleyan >> ECON >> 385 Fall, 2008 Description: Professor Joyce Jacobsen Economics 385 Spring Semester 2008-09 Assignment #3 Due Friday 2/13/09 by 6 p.m. Always explain and show the calculations used to arrive at your answers. 1) i) Two variables y and x are believed to be related by the stocha... Date Added: 2009-05-26 16:23:29 |
| RCDecay.pdf Path: George Mason >> PHYS >> 261 Fall, 2008 Description: 11 RC Decay Introduction: A capacitor is a device for storing charge and energy. It consists of two conductors insulated from each other. A typical capacitor is called a parallel-plate capacitor and is usually symbolized by -| |-or -|(- in circuits. ... Date Added: 2009-05-26 16:24:09 |
| counter.ps Path: BU >> CS >> 511 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dot version 2.2 (Fri Mar 11 01:01:09 UTC 2005) %For: (mlong) Michael %Title: G %Pages: (atend) %BoundingBox: 35 35 331 289 %EndComments save %BeginProlog /DotDict 200 dict def DotDict begin /setupLatin1 { mark /EncodingVector... Date Added: 2009-05-26 16:25:24 |
| hwk9.pdf Path: Iowa State >> LSSU >> 112 Fall, 2009 Description: HOMEWORK 9 - MATH 112 DUE DATE: Monday, April 19 INSTRUCTOR: George Voutsadakis Read each problem very carefully before starting to solve it. One part of each problem will be chosen at random and graded. Each question is worth 1 point. It is necessar... Date Added: 2009-05-26 16:26:33 |
| log.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: 000 (62129.000.000) 02/17 15:43:24 Job submitted from host: <128.95.94.28:1092> . 001 (62129.000.000) 02/17 18:44:30 Job executing on host: <128.95.101.202:1057> . 006 (62129.000.000) 02/17 19:04:39 Image size of job updated: 483120 . 006 (62129.000.... Date Added: 2009-05-26 16:27:50 |
| output.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS9 - local directory - Volume in drive C has no label. Volume Serial Number is DAF6-276D Directory of C:\\condor\\execute\\dir_2512 02/17/2008 05:35 PM <DIR> . 02/17/2008 05:35 PM <D... Date Added: 2009-05-26 16:29:30 |
| log.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: 000 (62032.000.000) 02/17 15:42:57 Job submitted from host: <128.95.94.28:1092> . 001 (62032.000.000) 02/17 17:40:15 Job executing on host: <172.25.101.49:1056> . 006 (62032.000.000) 02/17 18:00:24 Image size of job updated: 349744 . 005 (62032.000.0... Date Added: 2009-05-26 16:31:06 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 18:51:29 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 20:04:09 2008 ( 4360 s elapsed) ... Date Added: 2009-05-26 16:31:42 |
| error.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 16:42:38 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 18:04:06 2008 ( 4888 s elapsed) ... Date Added: 2009-05-26 16:31:44 |
| submit.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: executable = pass6_72106.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs72000-72499/72106... Date Added: 2009-05-26 16:32:10 |
| output.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS1 - local directory - Volume in drive C has no label. Volume Serial Number is 5692-E1E5 Directory of C:\\condor\\execute\\dir_3532 02/17/2008 05:38 PM <DIR> . 02/17/2008 05:38 PM <D... Date Added: 2009-05-26 16:33:07 |
| submit.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: executable = pass6_72342.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs72000-72499/72342... Date Added: 2009-05-26 16:33:38 |
| hw2sol.pdf Path: UC Riverside >> CS >> 120 Fall, 2009 Description: Homework #2 Solution Variable usage Register Variable 0 n 1 prime 2 i Control words 16 In Input n 1 Prime = 1 0 i=1 0 n mod i Prime = 0 0 i + 0 Out Prime State diagram Start = 0 S0 15 0 0 0 0 0 14 WA2 - 0 0 0 1 0 1 13 0 1 0 1 0 12 WE 1 1 ... Date Added: 2009-05-26 16:35:20 |
| Base02av45yamo_IMPROVE_Model_Data.txt Path: UC Riverside >> FEB >> 308 Fall, 2009 Description: Station Col Row Year Jdate SO4 NO3 NH4d OC EC TCM SOIL CM ... Date Added: 2009-05-26 16:36:02 |
| L0123-6.pdf Path: University of Iowa >> PSYCHOLOGY >> 31001 Fall, 2009 Description: 3/26/09 Elementary Psychology Science of Psychology 23 January 2009 What we will discuss Thinking critically about human behavior and cognition The role of theory in psychological research Research methods Contributions of animal research to human... Date Added: 2009-05-26 16:38:54 |
| 4_SEPrinciples.ppt Path: Drexel >> CS >> 575 Fall, 2009 Description: Some Software Engineering Principles D. L. Parnas Drexel University Software Engineering Research Group (SERG) http:/serg.cs.drexel.edu 1 What is Software Engineering Software Engineering = MultiPerson construction of multiversion programs ... Date Added: 2009-05-26 16:40:40 |
| HE3.pdf Path: Bemidji State >> CHEM >> 1212 Fall, 2009 Description: Name:_ CHEM 1212: Principles of Chemistry Hour Exam III April 11, 2003 Instructions: This exam consists of 11 free response questions, with point values given by each question. In all cases, write your final answer in the space provided. To receive f... Date Added: 2009-05-26 16:41:21 |
| SDOFVibration2009.ppt Path: Boise State >> ME >> 485 Fall, 2008 Description: Single Degree of Freedom Free Vibration m k c fixed / ground FBD of single mass x m xstatic Fspring Fdamper = - Fc - Fs = ma x F x m + cx + kx = 0 x Solution A: Critically damped Case A. Critically damped ( = 1 ) let n = k / m = g/x stat... Date Added: 2009-05-26 16:44:33 |
| cvs_examples.pdf Path: Idaho State >> ENGR >> 364 Fall, 2008 Description: Example Programs for cvodes v2.5.0 Radu Serban and Alan C. Hindmarsh Center for Applied Scientic Computing Lawrence Livermore National Laboratory November 6, 2006 UCRL-SM-208115 DISCLAIMER This document was prepared as an account of work sponsored ... Date Added: 2009-05-26 16:45:39 |
| alberts_solnc.pdf Path: Idaho State >> CS >> 187 Fall, 2009 Description: SOLUTIONS TO QUESTIONS IN CHAPTER 6 five vertices. There are five binary trees with four leaves: These are the binary trees with seven vertices. 4.3 ( a ) Left subtree Right subtree al a3 a5 a7 (b) Left subtree Right subtree o (C) Left subtree... Date Added: 2009-05-26 16:45:55 |
| M417Hmwk3Sols.pdf Path: UNL >> M >> 417 Fall, 2009 Description: M417 Homework 3 Solutions Spring 2004 (1) (a) For any subsets C1 , C2 A, show that f (C1 C2 ) = f (C1 ) f (C2 ): We must show that any element of f (C1 C2 ) is an element of f (C1 ) f (C2 ), and vice versa. So let y f (C1 C2 ). Then y = f (x) ... Date Added: 2009-05-26 16:47:30 |
| ProbStatLecture-384H.pdf Path: UNL >> TSHORES >> 384 Fall, 2009 Description: A TOUR OF PROBABILITY AND STATISTICS FOR JDEP 384H Thomas Shores Department of Mathematics University of Nebraska Spring 2007 Contents 1. 2. 2.1. 2.2. 2.3. 3. 3.1. 3.2. 4. 4.1. 4.2. 5. 5.1. 5.2. 5.3. 6. 6.1. 6.2. 6.3. Probability Univariate Statisti... Date Added: 2009-05-26 16:48:28 |
| lecture12notes.pdf Path: Wisconsin Milwaukee >> PHYS >> 475 Fall, 2009 Description: -1\' lecture { rz d\"toc,o\"4.l f,ih.i o\"t 1 a S-\"lr,lio-Lla\".-.q-a-r.4gt se+ o+ ntX\' Hi \'-{+:ltllD-e \" - o r-.). 1r- -lrr- l\"/ oq/+t(\" - ;t Jtu eautru qrr ort(nt6\"a.{ }qt!.0*rc[, [d hfs4)ras}{-blrd].I)Jsd{rgt^ dtr-r sl\"+r0,.! *ha+ e.,\' ;hq ,... Date Added: 2009-05-26 16:49:01 |
| casc8b.ppt Path: Minnesota >> ME >> 3031 Fall, 2009 Description: ... Date Added: 2009-05-26 16:50:23 |
| hw8.pdf Path: Acton School of Business >> COMP >> 481 Fall, 2009 Description: COMP 481: Automata, Formal Languages, and Computability Spring 2009 Homework Assignment #8 (Due date: 9 April 2009) 1. Let A be a language in SD consisting of descriptions of Turing machines, { M1 , M2 , . . . , }, where every Mi is a decider. Prove ... Date Added: 2009-05-26 16:51:08 |
| Lecture13.pdf Path: Syracuse >> PHY >> 101 Fall, 2008 Description: PHY 101 Lecture #13: Electrical Energy in Daily Life, and Electrochemical Energy Prof. Peter R. Saulson saulson@physics.syr.edu http:/physics.syr.edu/courses/PHY101/ Office Hrs: Tues 10 11:30, Physics 263-4, 3-5994 PHY 101 Lecture #13 Electrical Ener... Date Added: 2009-05-26 16:52:39 |
| q1.pdf Path: Los Angeles Southwest College >> M >> 122 Fall, 2009 Description: Math 122 (Section 5) Name Quiz 1 September 3, 2008 1. (3 points) Tables for the three functions, f (t), g(t), and h(t), are shown below. Write the word linear by each function which could be linear, and write the words not linear by each function ... Date Added: 2009-05-26 16:55:11 |
| 4080hw1.pdf Path: Maple Springs >> ATKINSON >> 4080 Fall, 2009 Description: Assignment 1 MATH 4080 DUE DATE: Thursday, September 20 (1) Find all pairs of the letters from the english alphabet that are homeomorphic. For our purposed, the english alphabet is the following list of letters: ABCDEFGHIJKLMNO PQRSTUVWXYZ (2) Chapt... Date Added: 2009-05-26 16:59:38 |
| hw3.pdf Path: Cal Poly Pomona >> CS >> 450 Fall, 2009 Description: Homework 3 CS 450 Fall 1993 Craig A. Rich co-RE is the class of languages L whose complements are recursively enumerable, i.e., co-RE = { L | L L RE }. Prove or disprove the following theorems. 1 Theorem. L RE = L is accepted by a DTM in wh... Date Added: 2009-05-26 17:00:04 |
| chapter2.pdf Path: Uni. Worcester >> EE >> 578 Fall, 2009 Description: ... Date Added: 2009-05-26 17:01:31 |
| 241-e2-f-97-p4.pdf Path: Los Angeles Southwest College >> MATH >> 241 Fall, 2009 Description: 4 ClJ r {t/ -:.J(: -tit l J.t \"-\'\" 7. Find the length of the curve -+ -:+ -:t -:-t r (t) = .J6t2 i + ~t3 J + 6t k for 3 :S;t :S;6 . .~ I \"\'\"1.- flb t. 1/ ~/{JJI-=JJIt-2-+*t\'f t~h -;. ~ =- 1 Je-/:2- +3) 2. : 1. (-t.l-t 3.) k\"51~ : ;t~ 3 (... Date Added: 2009-05-26 17:02:12 |
| 2005_IFT785_final-v2.pdf Path: Rush >> IFT >> 785 Fall, 2009 Description: IFT785 Approches oriente objets Date : jeudi 21 avril 2005 Heure : 18 h 45 21 h 45 Note :./100 points Toute documentation permise. Professeur : Sylvain GIROUX Premire partie : lments de programmation par objets (10 points) Question 1 ( /10 points)... Date Added: 2009-05-26 17:02:30 |
| Math241Test2Answers1992.pdf Path: Los Angeles Southwest College >> MATH >> 241 Fall, 2009 Description: Answers to Test 2, 1992 1. (a) x3 cos(xy) (b) 4, 3 (c) 0 (d) 3/2 (e) - 2 2. 6x + y + 3z = 4 3. 18wy 5/2 cos(x + y) 4. (0, 1, 0) and (1/2, -1/2, -1/4) 5. There is a local minimum (-2, 1, -1). 6. Maximum Value: 12 at (1, 3) Minimum Value: -15 at (-2... Date Added: 2009-05-26 17:03:17 |
| Math241Test2AnswersSp01.pdf Path: Los Angeles Southwest College >> MATH >> 241 Fall, 2009 Description: Answers to Test 2, Spring 2001 1. (a) 56/5 (b) 13 2. 36x 3. (3x2 y)(4u3 ) + (x3 2y)(v sin(uv) 4. 5x 2y 2z = 5 5. 12 6. The critical points are (0, 0) and all (x, y) satisfying x2 + y 2 = 9. The maximum value is 48 and it occurs at the points (2, ... Date Added: 2009-05-26 17:03:18 |
| slac-pub-11752.pdf Path: Stanford >> PUBS >> 11750 Fall, 2009 Description: SLAC-PUB-11752 THE PEP-II Movable Collimators S. DeBarger, S. Metcalfe, C. Ng, T.G. Porter, J. Seeman, M. Sullivan, U. Wienands, Stanford Linear Accelerator Center, SLAC, CA 94309, USA Abstract Three movable collimators have been manufactured for in... Date Added: 2009-05-26 17:05:17 |
| TigerUnitPlanTemplate.doc Path: North Texas >> COURSEWEB >> 4100 Fall, 2009 Description: UnitPlanTemplate Note: Type in the gray areas. Unit Author FirstandLastName Author\'sEmailAddress CourseName(s) CourseNumber(s) CourseSection(s) SchoolCity,State,Zip InstructorName(s): Jane Ingles yummychip@hotmail.com CECS 4100 003 Denton TX Dr. G... Date Added: 2009-05-26 17:06:56 |
| ProjectCharter.doc Path: Wisc Parkside >> CS >> 476 Fall, 2009 Description: Project Charter Project Description: Project/Product Purpose What does this project hope to accomplish, both generally and as high-level bullet points?> Product Acceptance Criteria: <You may add or subtract here> Requirements ... Date Added: 2009-05-26 17:08:15 |
| king.pdf Path: North Texas >> CSCE >> 1040 Fall, 2008 Description: The Mad Hatter You are one of 20 prisoners on death row with the execution date set for tomorrow. Your king is a ruthless man who likes to toy with his peoples miseries. He comes to your cell today and tells you: \"Im gonna give you prisoners a chance... Date Added: 2009-05-26 17:08:22 |
| Yu.ppt Path: UCSD >> ARIES >> 0110 Fall, 2008 Description: Design Considerations for Beam Port Insulator Rings Simon Yu Lawrence Berkeley National Laboratory ARIES Meeting October 24, 2001 The Heavy Ion Fusion Virtual National Laboratory What is the Propagation Window for Channel Assisted Pinch? Beam D... Date Added: 2009-05-26 17:09:47 |
| 3824_001.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 181 Fall, 2008 Description: ... Date Added: 2009-05-26 17:10:12 |
| mul_reg_soln.xls Path: Wake Forest >> FIN >> 203 Fall, 2008 Description: Return on Sales Operating Debt/ Capital (%) ( millions) Margin (%)Capital (%) Bank of New York 32.53 7178 38.1 28.5 Bank United 15.29 1437 26.7 24.3 Comerica 21.66 3948 38.9 65.6 Compass Bancshares 15.09 1672 27 26.4 Fifth Third Bancorp 21.32 4123 34... Date Added: 2009-05-26 17:12:47 |
| 200613_r02o_0501027.pdf Path: Stanford >> APSG >> 1033 Fall, 2009 Description: Case 4:05-cv-01027-SBA Document 58 Filed 01/03/2006 Page 1 of 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 DLA PIPER RUDNICK GRAY CARY US LLP SHIRLI FABBRI WEISS (Bar No. 079225) DLA PIPER RUDNICK CARY WARE US LLP... Date Added: 2009-05-26 17:14:37 |
| Degradation_of_Biological_Weapons_Agents.pdf Path: Stanford >> PUBS >> 21042 Fall, 2009 Description: Environ. Sci. Technol. 2005, 39, 2736-2743 Degradation of Biological Weapons Agents in the Environment: Implications for Terrorism Response AMY L. STUART* Department of Environmental & Occupational Health, University of South Florida, 13201 Bruce B.... Date Added: 2009-05-26 17:16:09 |
| Redirecting_NK_nuclear_workers.pdf Path: Stanford >> PUBS >> 22373 Fall, 2009 Description: DOI: 10.2968/065001006 Bulletin of the Atomic Scientists Redirecting North Koreas nuclear workers Threat reduction programs with former Soviet states can serve as models to create new, peaceful jobs for the Norths cadre of nuclear scientists and bo... Date Added: 2009-05-26 17:16:31 |
| Williamsbio.doc Path: Maine >> USM >> 391 Fall, 2009 Description: Williams\' Life and Career M. L. Rosenthal Williams was a medical student at the University of Pennsylvania, where he began his lifelong friendship with Pound (a \'special student\' there) and H.D. (Hilda Doolittle), the daughter of an astronomer whose ... Date Added: 2009-05-26 17:21:03 |
| 2004719_r01k_004391.pdf Path: Stanford >> ANIC >> 1014 Fall, 2009 Description: US District Court Civil Docket as of 07/19/2004 Retrieved from the court on Wednesday, August 03, 2005 United States District Court Northern District of Illinois (Chicago) CIVIL DOCKET FOR CASE #: 1:00-cv-04391 Charles Dechter v. Anicom Inc, et al ... Date Added: 2009-05-26 17:21:22 |
| error.txt Path: Washington >> JOBS >> 60238 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 13 20:19:44 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 13 21:50:47 2008 ( 5463 s elapsed) ... Date Added: 2009-05-26 17:24:01 |
| 2004528_f02o_012027.pdf Path: Stanford >> IFTA >> 1020 Fall, 2009 Description: Case 4:01-cv-02027-GJL Document 127 Filed 05/28/2004 Page 1 of 1 UNITED STATES DISTRICT COURT NORTHERN DISTRICT OF OHIO EASTERN DIVISION 2UU HAY 42 Phi 1: 19 k; i c\' i?: sRi RENALD ANELLE, et al., Plaintiffs, vs. Case No . 4:01CV2027 MAGISTRAT... Date Added: 2009-05-26 17:24:53 |
| lab4_1.pdf Path: Texas A&M >> ECEN >> 455 Fall, 2008 Description: ECEN 455: Digital Communications - Spring 2009 Lab 4: Simulation of a Communication System (I) Date assigned: March 11, 2009 Date due: March 25, 2009 Lab Objective The relationship between the reliability of a communication system and the available ... Date Added: 2009-05-26 17:26:19 |
| Plugin1.pdf Path: Minnesota >> EE >> 4940 Fall, 2008 Description: IEEE Spectrum: How Green Is My Plug-In? http:/www.spectrum.ieee.org/print/7928 Select Font Size: A A A Sponsored By How Green Is My Plug-In? By John Voelcker IMAGE: HOLLY LINDEM Our goal is to remove the car from the environmental debate, says ... Date Added: 2009-05-26 17:27:33 |
| Emmerson_PacRev_Mar_2005.pdf Path: Stanford >> PUBS >> 20899 Fall, 2009 Description: The Pacific Review, Vol. 18 No. 1 March 2005: 121 What do the blind-sided see? Reapproaching regionalism in Southeast Asia Donald K. Emmerson 1 Abstract The late Michael Leifer\'s association with an insecurity-focused realist approach to internatio... Date Added: 2009-05-26 17:29:45 |
| Mathcad - PT50805.pdf Path: San Jose State >> CHE >> 165 Spring, 2008 Description: CHE 165 - PLANT DESIGN PETERS & TIMMERHAUS 5 HOMEWORK PROBLEM 8.5 PAGE 1 OF 1 GIVEN : Alternate designs for heat exchanger insulation thickness. WANTED : Recommend the insulation thickness for the heat exchanger. BASIS : Data for each thickness:... Date Added: 2009-05-26 17:31:37 |
| Tebaldi_and_Lobell_2008.pdf Path: Stanford >> PUBS >> 22158 Fall, 2009 Description: Click Here GEOPHYSICAL RESEARCH LETTERS, VOL. 35, L08705, doi:10.1029/2008GL033423, 2008 Full Article for Towards probabilistic projections of climate change impacts on global crop yields C. Tebaldi1 and D. B. Lobell2 Received 4 February 2008; re... Date Added: 2009-05-26 17:34:21 |
| PolarizationI.ppt Path: Uni. Westminster >> PHYS >> 305 Fall, 2009 Description: Polarization Linear, circular, and elliptical polarization Mathematics of polarization Uniaxial crystals Birefringence Polarizers 45 Polarization Ex ( z , t ) = Re { E0 exp[i (kz t )]} % E y ( z , t ) = Re { E0 exp[i (kz t )]} % Here, the co... Date Added: 2009-05-26 17:34:24 |
| Along_Silk_Road_.pdf Path: Stanford >> PUBS >> 10007 Fall, 2009 Description: ... Date Added: 2009-05-26 17:35:13 |
| homework2.ps Path: UNC >> COMP >> 181 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: homework2.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o homework2.ps homework... Date Added: 2009-05-26 17:35:25 |
| Quiz_Format1_3.pdf Path: RPI >> MK >> 4090 Fall, 2009 Description: FOUNDATIONS OF ANALYSIS GENERAL QUIZ FORMAT This quiz consists of three questions. No partial credit will be assigned. On each of the questions one can earn a maximum of one point. Please work without the aid of notes, books, calculators, computers ... Date Added: 2009-05-26 17:39:58 |
| Change_Basis_Example.pdf Path: RPI >> MATH >> 4100 Fall, 2008 Description: 1 Linear Algebra Professor M. Zuker Fall 2007 Change of basis example Problem 6c of test 1 6c. Let T L(R3 ) be defined by its matrix (standard basis), 2 0 -1 1 1 M(T ) = 1 1 -1 0 What is M(T ) in terms of the basis, (1, 1, 1), (1, 1, 0), (1, 0,... Date Added: 2009-05-26 17:40:17 |
| engl221.pdf Path: Moravian >> PDFS >> 200630 Fall, 2009 Description: English 221: The English Language (Guidelines subject to change) Fall 2006 Instructor: John Black Classroom: Memorial 302 Class schedule: MW 12:50-2 Office: Zinzendorf 303 Office Hours: MW 2:15-3:45, and by appointment English Dept. Phone: 861-1390 ... Date Added: 2009-05-26 17:41:58 |
| engl221.pdf Path: Moravian >> PUBLIC >> 200630 Fall, 2009 Description: English 221: The English Language (Guidelines subject to change) Fall 2006 Instructor: John Black Classroom: Memorial 302 Class schedule: MW 12:50-2 Office: Zinzendorf 303 Office Hours: MW 2:15-3:45, and by appointment English Dept. Phone: 861-1390 ... Date Added: 2009-05-26 17:41:58 |
| phys332.pdf Path: Moravian >> PDFS >> 200770 Fall, 2009 Description: SYLLABUS FOR PHYSICS 332, MECHANICS SPRING TERM, 2008 Dr. Edward A. Roeder, instructor Office: Room 111, Collier Hall of Science Office Phone: Extension 1439 e-mail address: meear01@moravian.edu Office hours will be posted. PURPOSE and GOALS: The und... Date Added: 2009-05-26 17:42:09 |
| phys332.pdf Path: Moravian >> PUBLIC >> 200770 Fall, 2009 Description: SYLLABUS FOR PHYSICS 332, MECHANICS SPRING TERM, 2008 Dr. Edward A. Roeder, instructor Office: Room 111, Collier Hall of Science Office Phone: Extension 1439 e-mail address: meear01@moravian.edu Office hours will be posted. PURPOSE and GOALS: The und... Date Added: 2009-05-26 17:42:09 |
| hw6.pdf Path: Minnesota >> CSCI >> 5403 Fall, 2008 Description: CSci 5403, Spring 2008 Homework 6 due: March 4, 2008 1. Uncomputable bias. In class we proved that for any computable constant (0, 1), a machine with access to a coin with bias cannot efficiently compute any more languages than a machine with acc... Date Added: 2009-05-26 17:46:51 |
| hw18.pdf Path: New Mexico >> MA >> 316 Fall, 2009 Description: c Y X c $5 u gf `ba`{f `baY ha u Dbh)7 \"f c`ba`{f csaY YX tVHbt}U5{\"kQkQz{|}TURS{}k}k{kx{S| $ ~ Q~P | | P ~|P| UQ z Q~ | zP zP iggtVStgS}{yxG wurpn ~ H~| | Q |~| zP W vt s q o m d j d f Vvlv y v$ke if... Date Added: 2009-05-26 17:47:59 |
| Exam3Solution.pdf Path: Kentucky >> MA >> 111 Fall, 2008 Description: MA 111 Introduction to Contemporary Mathematics Exam 3 Score / 100 Name Solution Date: April 6, 2007 Please answer all questions completely and show all of your work. Be sure to write neatly so that your solution may be read as you intended it to b... Date Added: 2009-05-26 17:50:48 |
| 04_02.pdf Path: Willamette >> MATH >> 256 Fall, 2009 Description: Solutions to Homework Assignment 16 MATH 256-01 Section 4.2, Page 219 Problems: 1-10, 11-23 odd, 29-35 odd 1. 1 + i has magnitude 2 and polar angle /4, so we have 1 + i = 2ei/4+2in . 2. -1+ 3i has magnitude 2 (-1)2 +( 3)2 = 4). Thus 2 cos = -1 ... Date Added: 2009-05-26 17:51:35 |
| questionnaire.pdf Path: Kentucky >> MKT >> 340 Fall, 2008 Description: Dear UK-Gatton Undergraduate Student: The attached questionnaire has been developed to follow the attitudes of Kentucky undergraduate students over time. Your class was randomly selected to participate in the survey this Fall 2001 semester. Please an... Date Added: 2009-05-26 17:52:15 |
| F01-DMS.doc Path: YCP >> GOOSE >> 445 Fall, 2009 Description: Date To From Subject : August 17, 2001 : Bill Eddins : Scott Hildebrand : BSAD Project Project Objective / Executive Summary The Dispatch Management System (DMS) allows a dispatcher to track the delivery of goods & services in real time. It uses a ... Date Added: 2009-05-26 17:52:31 |
| 611.pdf Path: MO St. Louis >> OOH >> 20002001 Fall, 2009 Description: Service Occupations Cleaning, Buildings, and Grounds Service Occupations Janitors and Cleaners and Institutional Cleaning Supervisors (O*NET 61008, 67002, and 67005) Significant Points Plentiful job openings should arise primarily from the need... Date Added: 2009-05-26 17:53:14 |
| 0607_athletic_handbook.pdf Path: Northwestern MN >> PDFS >> 321 Fall, 2009 Description: STAFF DIRECTORY Name Aune, Billy Golf Borchardt, Corey Sports Information Intramural Director Cromer, Tracy Softball Grosz, Tim Assistant. AD Mens Basketball Hieb, Dave Trainer, Baseball Hill, Matt Athletic Director Johnson, Bryan Football Kleven, Sh... Date Added: 2009-05-26 17:54:02 |
| helpdesk.pdf Path: Northwestern MN >> PDFS >> 1971 Fall, 2009 Description: NWC (Northwestern College Document) Help Desk Guide This document covers scope of services, access, availability, support process overview including roles, process for support requests, and service standards including severity levels and standards. ... Date Added: 2009-05-26 17:54:02 |
| DE_HandbookFEB09_Final.pdf Path: Northwestern MN >> PDFS >> 561 Fall, 2009 Description: DISTANCE EDUCATION 200809 STUDENT HANDBOOK Northwestern College exists to provide Christ-centered higher education equipping students to grow intellectually and spiritually, to serve effectively in their professions, and to give God-honoring leaders... Date Added: 2009-05-26 17:54:17 |
| 27_hurricaneparties.pdf Path: Dallas >> PDFS >> 200510 Fall, 2009 Description: A Modest ProPosAl ut o Political Commentary | October 2005 27 Hurricane Spins Parties co n tr ol terrorists,noorganizationliketheTaliban sidearen\'tlookinganybetter.The orchestratingattacks;onlyMother administration\'slacklusterresponseto Natureher... Date Added: 2009-05-26 17:57:04 |
| hw02.pdf Path: IUPUI >> HW >> 251 Fall, 2009 Description: Ross (jr6585) Hw02 Ross (89251) This print-out should have 10 questions. Multiple-choice questions may continue on the next column or page nd all choices before answering. 001 10.0 points A sphere is charged with electrons to 8 106 C. The charge... Date Added: 2009-05-26 17:59:54 |
| czutzD3P1.doc Path: Middlebury >> FYSE >> 1144 Fall, 2009 Description: Clare Zutz 10/19/06 First Year Seminar P1D3 Perception In the beginning of Northanger Abbey, the reader is introduced to Catherine Morland, a wholesome unassuming country girl. Catherine Moorland grew up in the countryside with a big and loving famil... Date Added: 2009-05-26 18:00:27 |
| lab7_editing.pdf Path: University of Alaska Fairbanks >> NRM >> 338 Fall, 2009 Description: NRM338 Fall 2007 Lab#7 Page#1 Lab#7: Editing Shapefiles With ArcMap In this lab, you will learn how to: create a point theme from a text file create hyperlinks from features to files or web sites create a new line theme of north-south sampling ... Date Added: 2009-05-26 18:00:33 |
| Personality_and_Health.rtf Path: CSU San Marcos >> PSYC >> 334 Fall, 2009 Description: PERSONALI TY AND HEALTH Personality and Illness - Basic idea that psychological factors control physiological functioning, illness/disease, and even death * e.g., \"sudden-death syndrome\", death following a certain milestone/achievement Health Beh... Date Added: 2009-05-26 18:00:41 |
| nfm_2009.pdf Path: Toledo >> FOR >> 201 Fall, 2009 Description: Objectives: FOR201 To introduce the concept of Natural Forest Management (NFM) as one possible approach to supplying timber forest products while Natural Forest Management March 26, 2009 minimizing the negative impacts on the structure and functio... Date Added: 2009-05-26 18:02:21 |
| 319.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sun Oct 26 08:29:52 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-05-26 18:04:00 |
| USC.Computer.Forensics-Computers.and.Networks.pdf Path: USC >> ITP >> 499 Fall, 2009 Description: Introduction to Computer Forensics David Nardoni CISSP, EnCE dnardoni@firstresponseconsulting.com Chi So chiso@usc.edu 2005 First Response Consulting Services, Inc. All Rights Reserved Overview Introduction to computer systems and computer network... Date Added: 2009-05-26 18:05:32 |
| syl.doc Path: UPenn >> ARTHISTORY >> 301301 Fall, 2009 Description: HISTORY OF ART 301 (Architectural History and Theory) Prof. David B. Brownlee SCHEDULE Fall 2003 OFFICE HOURS: Wednesdays, 3-5. Please make appointments in advance. EMAIL: dbrownle@sas.upenn.edu S4 S11 S18 S25 O2 09 O16 O23 O30 N6 N13 N20 N27 D4 In... Date Added: 2009-05-26 18:05:39 |
| handout.pdf Path: UPenn >> PHYS >> 150 Fall, 2009 Description: PHYSICS 150 - Fall 2004 Instructors MWF @ 10:00 in DRL A4 M @ 4 in DRL A4 TR @ 12:00 in DRL A4 W @ 2:00 in DRL A8 MWF 11:00 in DRL A4 W @ 3 in DRL A4 MWF @ 12 in DRL A4 F@3 in DRL A8 MWF @ 1:00 in DRL A8 M @ 3 in DRL A8 Prof. Eugene Beier DRL 3N10,... Date Added: 2009-05-26 18:07:07 |
| modeltask3.pdf Path: N.C. State >> MEA >> 712 Fall, 2008 Description: MEA712: Mesoscale Modeling Class mesoscale model (CMM) project, assignment 3 Recommended completion date is Tuesday, 16 October. Hard due date is Tuesday, 23 October. Inclass supervised work period on Tuesday, 9 October. 1. Model task: read chapter 1... Date Added: 2009-05-26 18:07:50 |
| 129.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Thu Sep 18 08:32:46 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-05-26 18:08:16 |
| 8.pdf Path: N.C. State >> MA >> 242 Fall, 2008 Description: ... Date Added: 2009-05-26 18:09:10 |
| courseS2009.doc Path: USC >> MATH >> 245 Fall, 2008 Description: Math 245 Spring 2009 Lecture: 12:00-12:50 MWF in SOS B46 (Class #: 39613D) Discussion (TTh): 39614R (8:00), 39615R (9:00), 39616R (10:00) in KAP 165. Instructor: Prof. W. Proskurowski Office: DRB 220, e-mail: proskuro@usc.edu. Office hours: MWF 2:00... Date Added: 2009-05-26 18:10:25 |
| FastFoodSelection.pdf Path: N.C. State >> ST >> 514 Fall, 2008 Description: 16 Candidate Predictors for the Change in Price CO_OWNED EMPFT EMPPT NMGRS WAGE_ST INCTIME FIRSTINC BONUS PCTAFF HRSOPEN PENTREE NREGS BK, KFC, RR STATE 1 if company owned, 0 if not # of full time employees # of part time employees # of managers / as... Date Added: 2009-05-26 18:11:09 |
| lecture12.pdf Path: Toledo >> ECE >> 462 Fall, 2009 Description: ... Date Added: 2009-05-26 18:12:08 |
| Chapter11_MFW.pdf Path: CSU Long Beach >> READ >> 397 Fall, 2009 Description: 1 Part 4: Data Preparation, Analysis and Reporting the Results Chapter 11 1 Qualitative Data Analysis LEARNING OBJECTIVES After reading this chapter, you will be able to: 1. Contrast qualitative and quantitative data analysis. 2. Explain the steps i... Date Added: 2009-05-26 18:12:20 |
| MultDiv.pdf Path: GWU >> SEAS >> 136 Fall, 2009 Description: Announcement Homework assignment #4: Due on Feb 22, before class Csci 136 Computer Architecture II Multiplication and Division Readings: Sections 3.2, 3.3, B.5, B.6 Problems: 3.7, 3.9, 3.10, 3.12, 3.18-3.22 Homework assignment #5, Due on March 1,... Date Added: 2009-05-26 18:12:53 |
| gates2.pdf Path: GWU >> NSAEBB >> 116 Fall, 2009 Description: ... Date Added: 2009-05-26 18:13:25 |
| solution1.pdf Path: UC Davis >> STAT >> 235 Fall, 2008 Description: ... Date Added: 2009-05-26 18:13:34 |
| Syllabus.doc Path: UNL >> CS >> 340 Fall, 2009 Description: CSCE 340/840 Syllabus - Spring 2002 Numerical Analysis I Algorithm formulation for the practical solution of problems such as interpolation, roots of equations, differentiation and integration. Includes analysis of effects of finite precision. Prereq... Date Added: 2009-05-26 18:15:12 |
| AKAM_431_CH5_6.pdf Path: Wilfrid Laurier >> FILES >> 431 Fall, 2009 Description: Chapters 1-4: Summary So far, we have been investigating the image acquisition process. Chapter 1: General introduction. Chapter 2: Radiation source and properties. Chapter 3: Radiation interaction with the lens system. Factors affecting the geo... Date Added: 2009-05-26 18:17:14 |
| quiz3.pdf Path: UNL >> MATH >> 314 Fall, 2008 Description: Math 314 - Fall 2006 Name Quiz 3 1. Let A be the 3 3 matrix such that Aij = i + j. Compute AB where 0 1 1 0 . B= 1 0 0 -1 -1 Are the rows of B linearly dependent? 2. Let C the following matrix 1 3 0 0 C= a 1 1 0 0 0 c d (a) What value a has to h... Date Added: 2009-05-26 18:19:42 |
| W5_D3.pdf Path: Washington >> ATMOS >> 211 Fall, 2009 Description: Tackling the climate change problem: We cannot afford to wait Pieter Tans NOAA Earth System Research Laboratory Boulder, Colorado University of Washington 30 April 2008 DECADAL MASS BALANCE OF CARBON Cumulative fossil fuel emissions (Jan. 2008) (s... Date Added: 2009-05-26 18:21:13 |
| f04-a-03.pdf Path: Maple Springs >> CSE >> 3461 Fall, 2009 Description: Sequential vs. Event-driven Programming Reacting to the user 3461M GUI Program Organization Last slide on Sep 21 (lecture 3) Lets digress briefly to examine the organization of our GUI programs Well do this in stages, by examining three example p... Date Added: 2009-05-26 18:22:50 |
| 0825-small.pdf Path: Trinity U >> CS >> 3366 Fall, 2009 Description: CSCI 3366 August 25, 2006 Administrivia One purpose of the syllabus is to spell out policies, especially about: Course requirements and grading. Exam or other dates. Late work. Slide 1 Academic integrity. Most other information will be on th... Date Added: 2009-05-26 18:23:51 |
| ADT-Remarks.pdf Path: UCSC >> CMPS >> 101 Spring, 2008 Description: CMPS 101 Algorithms and Abstract Data Types Some Additional Remarks on ADTs and Modules in ANSI C Suppose you wish to implement an ADT in C. The particular ADT is unimportant, so lets just call it a Blah. You should create the following files at min... Date Added: 2009-05-26 18:24:52 |
| ASyllabus2008.doc Path: UCSC >> OCEA >> 142 Winter, 2008 Description: Winter Quarter 2007 Ocean Ecosystems: Ocean Sciences 142/242 and Biology 142/242 Course description: Discussion of selected topics in animal ecology of the open sea: zooplankton production, variability of pelagic populations (including fish), food we... Date Added: 2009-05-26 18:27:26 |
| discipline.DOC Path: Washington >> INSC >> 510 Fall, 2008 Description: The Information School University of Washington Ph.D. in Information Science INSC 510 Theoretical Foundations of Human Information Behavior Discussion Questions for Week 2 Session 1 (10/5) In class you will sign up for three questions that you will p... Date Added: 2009-05-26 18:28:26 |
| exercises-chap8.pdf Path: GA Southern >> TENS >> 2146 Fall, 2008 Description: Electrical Devices and Measurements Chap 8. Combination circuits TENS 2146 Fall 2008 Problem 1. For circuit 1 find the equivalent resistance. Assume R1 = 4, R2 = 2, R3 = 1, R4 = 5, R5 = 3, R6 = 6, and R7 = 8 . Answ: Req = 14.4 Problem 2. For cir... Date Added: 2009-05-26 18:28:33 |
| m310f08HW8.pdf Path: Washington >> MATH >> 310 Fall, 2008 Description: Math 310 Assignment 8 PROBLEMS: 7.5, 7.6, 7.8, 7.9, 7.20, 7.28(a), 7.30(a)(b) Also complete the supplemental problem below: The following is a review with explanations of what is and what is not allowed when it comes to a congruence. 1. (ADD/SUBTRACT... Date Added: 2009-05-26 18:29:16 |
| seminar_grading_sheet.pdf Path: Harding >> COMP >> 439 Fall, 2009 Description: Computing Seminar Grading Sheet Name of Student _ Date Name of Evaluator _ Title of Presentation Possible 10 10 5 5 5 5 Given _ _ _ _ _ _ Presentation Content (40%) Thorough coverage of the topic (breadth) Sufficient details supplied (depth) Releva... Date Added: 2009-05-26 18:29:23 |
| ef_01s.pdf Path: Delaware >> M >> 115 Fall, 2009 Description: MATH115 2001S FINAL Page 1 The following multiple choice questions are worth 6.25 points each. 1. Determine the interval in the domain of f where f ( x ) 0. f (x ) a. b [16, 0 ) [4, 4 ] c. d. [ 4, ) (4, 4) 2. Determine the solution set for... Date Added: 2009-05-26 18:30:40 |
| xmsr.doc Path: Washington >> FIN >> 579 Fall, 2008 Description: X M S R C a s e XM SATELLITE RADIO TOCK DATA S Current Price (12/26) Price (52 weeks) Symbol/Exchange Beta Fully diluted shares Average daily volume Current market cap $24.29 $2.40 25.66 XMSR/NASDAQ 25 20 15 10 5 0 1/15/2003 4/15/2003 5/15... Date Added: 2009-05-26 18:31:14 |
| 3028-2009_week3_Baker.pdf Path: Allan Hancock College >> ENVS >> 3028 Fall, 2009 Description: Task while we wait for latecomers Second task Focus on a couple of \"borderline\" human-environment issues and see if you agree on the circumstances for government involvement Explore the range of views in your group over this issue Be prepared to ... Date Added: 2009-05-26 18:31:50 |
| lsqrs10.pdf Path: UMBC >> MT >> 853 Fall, 2009 Description: Linear Least Squares Analysis, X prepared by Professor Jenny Baglivo This unit considers unconditional linear least squares analysis and bootstrap methods for least squares analysis problems. Simple Linear Model, Revisited. Assume that (X1 , Y1 ), ... Date Added: 2009-05-26 18:32:03 |
| cis273sp09_hw2.pdf Path: UMass Dartmouth >> CIS >> 273 Spring, 2008 Description: CIS 273: Computer Organization & Design Spring 2009 Homework #2 Due 4/2/09 Electronic submissions (typed, not handwritten and scanned) are strongly preferred for this assignment. Hard copy solutions must have all pages stapled together and must be su... Date Added: 2009-05-26 18:32:41 |
| 13.pdf Path: WPUNJ >> WW >> 071 Fall, 2009 Description: Table 3, Average Undergraduate GPA by Major for Accepted Master\'s Seeking Graduate Students Spring 2007 Under Grad GPA N Mean Program APPLIED CLINICAL PSYCHOLOGY (MA) BUSINESS (MBA) COMMUNICATION DISORDERS (MS) COMS (MA) COUNSELING (MED) EDLP (MED) E... Date Added: 2009-05-26 18:36:47 |
| SPED1.pdf Path: WPUNJ >> WW >> 9903 Fall, 2009 Description: PROGRAM (UG) PROGRAM REVIEW: SPECIAL EDUCATION I. UNDERGRADUATE ADMISSION SUMMARY A. FULL-TIME FIRST-TIME FIRST-YEAR STUDENTS 1. APPLIED & ACCEPTED Applications Acceptances Enrolled % Accepted (of applied) % Enrolled (of accepted) 2. ENROLLED Enrolle... Date Added: 2009-05-26 18:36:50 |
| netapplic.PPT Path: University of Baltimore >> HOME >> 650 Fall, 2009 Description: Networked Communication Applications Copyright 1997 Panko 1 2 Importance of Communication s The Manager\'s day s s s s s 25% 30% 5% 25% 85% In conference rooms In other face-to-face meetings On the telephone Reading and writing Total communicat... Date Added: 2009-05-26 18:38:21 |
| hw3me565solut.pdf Path: Washington >> ME >> 565 Fall, 2009 Description: Plot@8Cos@xD, 1 Cosh@xD<, 8x, 0, 15<, PlotRange 81, 1<D 1.0 0.5 2 4 6 8 10 12 14 -0.5 -1.0 Plot@Cos@xD 1 Cosh@xD, 8x, 0, 15<, PlotRange 81, 1<D 1.0 0.5 2 4 6 8 10 12 14 -0.5 -1.0 Recall: f[x_, b_] := A* ( Cos[b*x] - Cosh[b*x]... Date Added: 2009-05-26 18:39:06 |
| 1987_0201pp081087.pdf Path: Iowa State >> PUBLIC >> 1987 Fall, 2009 Description: Marina Mesopotamica Volume 2, Number 1, pp. 8187 (1987) Effect of eyestalk removal and eyestalk extract injection on oxygen consumption in the crab, Sesarma boulengeri Calman H. K. Ahmed and D. K. Sukar Department of Biology, College of Science, Uni... Date Added: 2009-05-26 18:42:58 |
| 01_Intro4.pdf Path: Allan Hancock College >> CS >> 1911 Fall, 2009 Description: COMP1911 07s2 Introduction 1 COMP1911/1091: Computing 1 Course Web Page http:/www.cse.unsw.edu.au/~cs1911 1. Introduction Lecturer-in-Charge Alan Blair Lecture Times Monday 1112: Rex Vowels Theatre Tuesday 23: Law Theatre G04 Thursday 23:... Date Added: 2009-05-26 18:47:42 |
| Quiz04Sol.doc Path: Iowa State >> EE >> 475 Fall, 2009 Description: EE 475 Fall 2006 Quiz #4 Name: Consider the following electric circuits: 1. 2. 3. 4. How many state variables should be selected: The most natural choice of the state variables are: The order of the system model is: The A matrix of the state space ... Date Added: 2009-05-26 18:49:27 |
| Bulletin081.pdf Path: Virginia Tech >> PDFS >> 1974 Fall, 2009 Description: 201 V57 no.S1 \\\'V J4~nU\'f\\11 un ~I AI t UNI VtK=>JI , WAXER RESOURCES ~IBRARY y Bulletin 81 Minimum Oxygen Levels Survived by Stream Invertebrates Eugene W. Surber William E. Bessey Bulletin 81 December 1974 Minimum Oxygen Levels Survived by... Date Added: 2009-05-26 18:49:35 |
| RSOP20aTemperatureRecordforFreezer1.pdf Path: Iowa State >> NR >> 66820 Fall, 2009 Description: FREEZER TEMPERATURE RECORD LOCATION: Day 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Time Recorded by - Freezer -External Internal MONTH: _ YEAR: _ Corrective Action Optimal Ranges: -10F to 0F Please report r... Date Added: 2009-05-26 18:49:46 |
| balancing.doc Path: Iowa State >> PUBLIC >> 0706 Fall, 2009 Description: Farms.com, Canada 07-05-07 Balancing Act - Week of July 9, 2007 Joann Alumbaugh Payment limitations, bio-energy, research funding and rural health care were among the topics discussed today by Secretary of Agriculture Mike Johanns and Iowa Congressma... Date Added: 2009-05-26 18:49:58 |
| M331_F08_Quiz5_sol.pdf Path: NJIT >> M >> 331 Fall, 2009 Description: 2.5.7(a ) 2 1 u 1 2 u u= =0 r + r r r r 2 2 u ( r , 0) = u r , = 0 3 u ( a, ) = f ( ) u (r , ) = ( )G (r ) 2 ( )G (r ) ] + r r [ ( )G ( r ) ] = 0 2 [ r r G(r ) 1 d 2 r d dG = r = 2 ( ) d G (r ) dr dr 2 d d... Date Added: 2009-05-26 18:50:23 |
| 133t2rk.pdf Path: SEMO >> MA >> 133 Fall, 2009 Description: ... Date Added: 2009-05-26 18:52:23 |
| hw2_ans.pdf Path: Iowa State >> RU >> 477 Fall, 2009 Description: Homework 2 Solutions p. 63 16. a The possibilities are classi ed by RRR, BBB , and GGG, with respective probabilities 5 4 3 + 6 5 4 + 8 7 6 = 60 + 120 + 336 19 18 17 19 18 17 19 18 17 5814 516 = 86969 0:088751289 : = 5814 5 6 8 b The probabilit... Date Added: 2009-05-26 18:53:03 |
| march2009.pdf Path: Iowa State >> NR >> 96987 Fall, 2009 Description: Non-Profit Org US Postage PAID Permit No. 156 Mason City IA 50401 Cerro Gordo County 2023 South Federal Avenue Mason City IA 50401 641.423.0844 FAX: 641.423.2642 E-mail: xcerrogordo@iastate.edu 4-H is part of the Iowa State University Extension Ser... Date Added: 2009-05-26 18:55:01 |
| 518eval_2008.pdf Path: Iowa State >> PUBLIC >> 518 Fall, 2009 Description: E E / Mteor / Agron 518 Spring 2008 Midterm Evaluation Due Thursday, March 13, 2008 Assigned Tuesday, March 4, 2008 1. Midterm course evaluation. Comment on the following: (a) assignments: diculty, appropriateness, whether or not they are clearly den... Date Added: 2009-05-26 18:55:30 |
| rec1617_p7.pdf Path: MTSU >> REC >> 1617 Fall, 2009 Description: Watch those stoplights; theyll be watching you, too A new system of red-light cameras scheduled to be in place in Murfreesboro by July 1 should help reduce injuries and property damage from traffic crashes at seven of the citys major intersections, c... Date Added: 2009-05-26 18:55:54 |
| initialization.ppt Path: Nova Southeastern University >> POLARIS >> 2950 Fall, 2009 Description: Member Initialization and Cleanup Computer Programming II Dr. Tim Margush Mathematics, Science and Technology Department Farquhar Center - Nova Southeastern University Data Members l Classes have two types of data members q q Instance variables Cla... Date Added: 2009-05-26 18:55:56 |
| Trait_Theory.ppt Path: Maryville MO >> HPR >> 412 Fall, 2009 Description: The Role of Personal Characteristics in Leadership Learning Objectives Describe the role of personal characteristics (dispositions) in leadership Nature vs. nurture perspectives of leadership Describe the role of the following personal characteri... Date Added: 2009-05-26 18:58:14 |
| msc-office-fit-out.pdf Path: UVA >> ARCH >> 721 Fall, 2008 Description: Office Fit-Out and Floor Vibrations by Christopher M. Hewitt and Thomas M. Murray, P.E., Ph.D. Taking a fresh look at the damping criteria youve been using to design offices can help you reduce or eliminate floor vibration issues from the very start... Date Added: 2009-05-26 18:58:26 |
| 01-333333333333333333333.txt Path: UVA >> ATT >> 4584 Fall, 2009 Description: archives@soton.ac.uk, holiday@bangla.net, Luton@radioramadhan.com, Glasgow@radioramadhan.com, Birmingham@radioramadhan.com, graham.fox@mrgmail.org, inayat_b@hotmail.com, asheikh@sghms.ac.uk, shabsnk@hotmail.com, jsherif@webstar.co.uk, ali@grovemedica... Date Added: 2009-05-26 18:59:16 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


