Course Solutions And Notes - currentsupercomputers 33
| 20010718_o03c_012758.pdf Path: Stanford >> USWCE >> 1019 Fall, 2009 Description: http:/securities.milberg.com/mw-cgi-bin./55;E/56;E/57;E/58;E/59;&story_numb=7/11 Complaint for Violation of the Federal Securities Laws (Elan v. U.S. Wireless Corp., et al., Case No. C-01-2758-EDL) Source: Milberg Weiss Date: 07/18/01 Time: 3:02 PM ... Date Added: 2009-04-26 03:03:59 |
| lecture9-6in1.pdf Path: Stanford >> CS >> 276 Fall, 2009 Description: Pseudo Feedback initial query Pseudo-Feedback: Performance apply relevance feedback label top k docs relevant retrieve documents documents top k documents 3 4 Today\'s topics User Interfaces Browsing Visualization The User in Information Acc... Date Added: 2009-04-26 03:05:16 |
| elec477lab5_sp08.doc Path: Bucknell >> ELEC >> 477 Fall, 2009 Description: ELEC 477L Topics in Wireless System Design Lab #5: Coupled-Resonator Band-Pass Filters (Part 1) Spring 2008 Introduction Band-pass filters are vital parts of almost all wireless systems. However, their design and construction is often one of the m... Date Added: 2009-04-26 03:06:02 |
| rpc_proposal.pdf Path: Hudson VCC >> CS >> 361 Fall, 2009 Description: Control Flow Authorization for Remote Procedure Calls in TinyOS GROUP MEMBERS: Peter Chapin Diana Tatar Abe Barth-Werb Rob Rohr pchapin@cems.uvm.edu dtatar@uvm.edu abebarthwerb@gmail.com robert.rohr@uvm.edu DESCRIPTION: Remote Procedure Calls (RPCs)... Date Added: 2009-04-26 03:10:15 |
| CIS634DL8-2.pdf Path: NJIT >> CIS >> 634 Fall, 2009 Description: CIS 634 Information Retrieval Distance Learning Lecture 8 Part 2 Text Mining Applications Material: Sullivan Ch13, or read this paper: Don R. Swanson and Neil R. Smalheiser, An interactive system for finding complementary literatures: a stimulus to ... Date Added: 2009-04-26 03:14:20 |
| coursedesc157_03.pdf Path: Stanford >> ECON >> 157 Fall, 2009 Description: Stanford University Department of Economics Fall 2003 Econ 157: Imperfect Competition Class Meetings: Tuesday and Thursday, 1:15 p.m. to 3:05 p.m., Education Bldg. 128. Professor: Susan Athey. Oce: Landau Economics room 243. Phone: 650-725-8696. Em... Date Added: 2009-04-26 03:14:27 |
| GlobalWarming.ppt Path: Wisc Eau Claire >> ECON >> 268 Fall, 2009 Description: The Economics of Global Warming Global Warming: The Problem Greenhouse gases (including carbon dioxide (CO2), methane, and chlorofluorocarbons (CFCs) trap heat near the earth\'s surface, thus contributing to global warming. Evidence: CO2 concentr... Date Added: 2009-04-26 03:14:43 |
| 2000424_r02k_9900457.pdf Path: Stanford >> SJK >> 1010 Fall, 2009 Description: US District Court Civil Docket as of 04/24/2000 Retrieved from the court on Wednesday, August 10, 2005 U.S. District Court Central District Of California (Southern Division - Santa Ana) CIVIL DOCKET FOR CASE #: 8:99-cv-00457-DOC-EE Binary Traders I... Date Added: 2009-04-26 03:14:45 |
| clark73.pdf Path: Penn State >> IST >> 590 Fall, 2008 Description: ... Date Added: 2009-04-26 03:19:11 |
| ep476_sp06_lp24.pdf Path: Wisconsin >> ENGR >> 476 Fall, 2009 Description: EP 476 Lesson Plan Class 24, 4/13/06: Initial implementation and numerical analysis for application 2 OBJECTIVES: Emphasize planning and modularity Introduce numerical analysis for PDEs OUTCOMES: Students shall be able to plan an implementation of... Date Added: 2009-04-26 03:20:01 |
| qz1f03-v2-sol.pdf Path: Wisconsin >> ECE >> 352 Fall, 2008 Description: Last (family) name: _ First (given) name: _ Student I.D. #: _ Circle section: Saluja Ramanathan Department of Electrical and Computer Engineering University of Wisconsin - Madison ECE/CS 352 Digital System Fundamentals Quiz #1 - SOLUTION Thursday, ... Date Added: 2009-04-26 03:21:23 |
| BT_Owns_Links.pdf Path: Michigan >> SI >> 110 Fall, 2008 Description: British Telecom: We Own Linking by Craig Bicknell 5:00 p.m. Jun. 19, 2000 PDT For years, British Telecom says it tolerated the royalty-free use of a technology it patented in 1989, but recently it had a change of heart and decided it was time to col... Date Added: 2009-04-26 03:23:46 |
| hw_3_mwell.pdf Path: Wisconsin >> BENSON >> 635 Fall, 2009 Description: CEE/GLE 635 REMEDIATION GEOTECHNICS HOMEWORK 3 MONITORING WELL DESIGN Design the monitoring wells along Section A-A including type and size of casing, screen type and length(s), filter pack criteria, sealant, and other factors you believe to be imp... Date Added: 2009-04-26 03:24:36 |
| project.pdf Path: Sveriges lantbruksuniversitet >> MATH >> 408 Fall, 2009 Description: Upper and Lower Bounds and a Network Formulation of the Knapsack Problem Ryo Takei MATH 408, rrtakei@sfu.ca March 30, 2004 A certain wide class of practical problems appears to be just beyond the range of modern computing machinery. These problems o... Date Added: 2009-04-26 03:31:45 |
| usccse2003-505.pdf Path: East Los Angeles College >> PW >> 308 Fall, 2009 Description: COVER FEATURE Value-Based Software Engineering: A Case Study The value-based approach to software development integrates value considerations into current and emerging software engineering principles and practices, while developing an overall framew... Date Added: 2009-04-26 03:31:46 |
| NormalizationExample.pdf Path: Virgin Islands >> CSC >> 212 Fall, 2009 Description: The original table: Employee Number 234242 7657345 name Adam Parkin Micaela Serra Micaela Serra Micaela Serra Yvonne Coady Yvonne Coady position Sessional Instructor Professor Years Salary Class 0 15 Tiny Huge CSC 212 CSC 230 CSC 598 Term Fall 06 Des... Date Added: 2009-04-26 03:34:27 |
| 01164009.pdf Path: Virgin Islands >> GROUP >> 499 Fall, 2009 Description: IEEE TRANSACTIONS ON ACOUSTICS, SPEECH, AND SIGNAL PROCESSING, VOL. ASSP-31, NO. 1, FEBRUARY 1983 32 3 [ 71 G. Amir and R. Gregorian, The implementation ofa speech synthesis algorithm, in ZCASSPProc., Mar. 1981. [8] R. Gregorian and S. C. Fan, O... Date Added: 2009-04-26 03:34:28 |
| RWA-survey.pdf Path: W. Alabama >> ECE >> 710 Fall, 2009 Description: A Review of Routing and Wavelength Assignment Approaches for WavelengthRouted Optical WDM Networks HUI ZANG Department of Computer Science University of California, Davis Davis, CA 95616 ABSTRACT This study focuses on the routing and WavelengthAssig... Date Added: 2009-04-26 03:35:29 |
| lect09-logical-shift-1.pdf Path: Allan Hancock College >> ELEC >> 2041 Fall, 2009 Description: Overview ELEC2041 Microprocessors and Interfacing Lecture 9: C/Assembler Logical and Shift - I http:/webct.edtec.unsw.edu.au/ March 2006 Saeid Nooshabadi saeid@unsw.edu.au ELEC2041 lec9-logical-I.1 Saeid Nooshabadi ELEC2041 lec9-logical-I.2 Saeid Noo... Date Added: 2009-04-26 03:44:26 |
| 61.5stevenson07.pdf Path: Allan Hancock College >> V >> 061 Fall, 2009 Description: January 2008 207 world of parasites. The text starts off with a paradigm shift (You Are a Habitat!) and then goes on to discuss the different kinds of parasites (ectoparasites live outside the body, endoparasites live inside of it), the complicat... Date Added: 2009-04-26 03:46:30 |
| lslsb2003347.pdf Path: Allan Hancock College >> LSLSB >> 2003347 Fall, 2009 Description: THE LEGISLATIVE ASSEMBLY FOR THE AUSTRALIAN CAPITAL TERRITORY LONG SERVICE LEAVE (PRIVATE SECTOR) BILL 2003 EXPLANATORY STATEMENT Circulated by authority of Wayne Berry MLA Authorised by the ACT Parliamentary Counselalso accessible at www.legisl... Date Added: 2009-04-26 03:51:40 |
| ab200694.txt Path: Allan Hancock College >> AB >> 200694 Fall, 2009 Description: 2004-2005-2006 The Parliament of the Commonwealth of Australia HOUSE OF REPRESENTATIVES Presented and read a first time AusCheck Bill 2006 No. , 2006 (Attorney-General) A Bill for an Act to provide a regulatory framework for coo... Date Added: 2009-04-26 03:52:32 |
| L19.txt Path: Allan Hancock College >> CSE >> 1301 Fall, 2009 Description: Topics - Recursion - Unary Recursion - N-ary Recursion What is recursion? - A procedure defined in terms of (simpler versions of) itself - Base case - Recursive definition - Convergence to base case Unary recursion - Functio... Date Added: 2009-04-26 03:56:29 |
| lect11.pdf Path: Allan Hancock College >> CSE >> 1303 Fall, 2009 Description: Computer Science Monash University Overview CSE1303 Part A Data Structures and Algorithms Summer Semester 2003 Lecture A11 Recursion Kymberly Fergusson Unary Recursion Binary Recursion Examples Features Stacks Disadvantages Advantages 2 Wha... Date Added: 2009-04-26 03:56:48 |
| lect08.ppt Path: Allan Hancock College >> CSE >> 1303 Fall, 2009 Description: The MIPS computer architecture Lecture B08 Lecture notes section B08 04/24/09 CSE1303 Part B lecture notes 1 Last time Interpreters Machine language Assembly language structure what a compiler does Compilers Stages of code generation co... Date Added: 2009-04-26 03:56:49 |
| 5121-2008-sem1-topic9.ppt Path: Allan Hancock College >> LAW >> 5121 Fall, 2009 Description: Last topic Remedies Personal remedies These are the most common. Action for money paid Quantum meruit or claim for reasonable remuneration Rescission of contract made under duress Account of profits Restitutionary damages Features Personal remedies... Date Added: 2009-04-26 04:00:05 |
| 3101-2008-sem2-st2-overheads-for-topic4.ppt Path: Allan Hancock College >> LAW >> 3101 Fall, 2009 Description: Topic 4: Grounds of Judicial Review III Procedural Fairness Procedural fairness The basic obligations The Hearing Rule The Rule against Bias The rationale for procedural fairness Instrumental benefits Non-instrumental benefits Procedural fairn... Date Added: 2009-04-26 04:01:06 |
| 4190-2008-s1-lec-week8-insurance-handouts1.pdf Path: Allan Hancock College >> LAW >> 4190 Fall, 2009 Description: ... Date Added: 2009-04-26 04:01:41 |
| test.txt Path: Allan Hancock College >> CSE >> 1402 Fall, 2009 Description: README.txt for version 5.6 of Vim: Vi IMproved. WHAT IS VIM Vim is an almost compatible version of the UNIX editor Vi. Many new features have been added: multi level undo, syntax highlighting, command line history, on-line help, filename completi... Date Added: 2009-04-26 04:02:26 |
| ManipulationPaper2009.pdf Path: East Los Angeles College >> C >> 2678 Fall, 2009 Description: Manipulation and the Allocational Role of Prices Itay Goldstein Wharton School University of Pennsylvania Alexander Guembel Sad Business School and Lincoln College University of Oxford 22 June, 2006 Abstract Prices in secondary financial markets are... Date Added: 2009-04-26 04:02:44 |
| fit2022-2007-sol.pdf Path: Allan Hancock College >> FIT >> 2022 Fall, 2009 Description: Monash University Semester Two 2007 Examination Period Faculty of Information Technology EXAM CODES: CSE/FIT TITLE OF PAPER: FIT2022 Computer Systems II EXAM DURATION: 3 hours writing time READING TIME: 10 minutes THIS PAPER IS FOR STUDENTS STUDYING... Date Added: 2009-04-26 04:04:50 |
| 7336-2008-s1-add-mat-unit-guide.doc Path: Allan Hancock College >> LAW >> 7336 Fall, 2009 Description: Faculty of Law LAW 7336 Taxation of Financial Arrangements Unit Guide Prepared by: Teresa Dyson Monash University Law Chambers Monash University Produced and Published by: Faculty of Law Monash University Law Chambers 472 Bourke St Melbourne - VIC... Date Added: 2009-04-26 04:05:59 |
| abstract.txt Path: Allan Hancock College >> CCP >> 256 Fall, 2009 Description: Gafurov256 -+ No -+ Poster -+ Physics of Polymers and Macromolecules -+ Molecular Model of Slippage of Macromolecules in the Loaded Oriented Crystalline Polymer -+ The molecular model of slippage of macromolecular chains in the loaded oriented crysta... Date Added: 2009-04-26 04:08:17 |
| w03-tut-submit-ans.pdf Path: Allan Hancock College >> ISYS >> 123 Fall, 2009 Description: ISYS123 Week 2: Tutor Solution Guide Case Three Singapore Government Deploys OpenOffice.Org on 5000 PCs Discussion Questions 1. What are the characteristics of OpenOffice.org and the benefits of using it for personal use? OpenOffice is open source, w... Date Added: 2009-04-26 04:11:49 |
| slides.pdf Path: Allan Hancock College >> COMP >> 318 Fall, 2009 Description: \' $ Slides for Lecture 3 & comp318Non-Procedural Languages % 1 \' More About Rules $ Rules and facts are dierent versions of the same thing: a clause. A rule consists of a head and a body separated by the special prolog operator :-. The he... Date Added: 2009-04-26 04:13:16 |
| A5.txt Path: Allan Hancock College >> STAT >> 300 Fall, 2009 Description: Notes for Asst 5 : There are 6 Sites not 4 ! To model the weed abundance at Site 9 only, create a new data frame \'data9\' via data9 <- data[data$Site=9,] attach(data9) assuming that the original data are stored in the data frame \'da... Date Added: 2009-04-26 04:13:38 |
| slides10.pdf Path: Allan Hancock College >> STAT >> 300 Fall, 2009 Description: LECTURE 10 POWER 443 In hypothesis testing we can make a Type I or a Type II error. Accept H0 H0 true H0 false correct (1) Type II error () Reject H0 Type I error () correct(2) The power of the test is P = 1 , which is P(reject H0 |H0 is false) =... Date Added: 2009-04-26 04:13:58 |
| mid08.pdf Path: Allan Hancock College >> COMP >> 1200 Fall, 2009 Description: COMP1200 Perspectives on Computing 2008 THE AUSTRALIAN NATIONAL UNIVERSITY COMP1200 - Perspectives on Computing Mid-semester Exam - Semester 1 - 2008 Writing Period Study Period Permitted Materials Maximum Marks Answer : 60 minutes duration : 0 mi... Date Added: 2009-04-26 04:19:27 |
| How_to_prepare_the_solar_cells.ppt Path: Allan Hancock College >> VSJ >> 110 Fall, 2009 Description: Preparation of the substrate A typical size of the cell 15 mm 15 mm Substrate Flouride doped tin oxide 200 nm thick (conductive and transparent) No reason for that thickness, that is just how it comes from the manufacturer Clean (?) Wash in EtOH (K... Date Added: 2009-04-26 04:20:53 |
| EPJB_CorrReturn07.pdf Path: Allan Hancock College >> TAS >> 110 Fall, 2009 Description: Eur. Phys. J. B 55, 209217 (2007) DOI: 10.1140/epjb/e2006-00414-4 THE EUROPEAN PHYSICAL JOURNAL B Correlation based networks of equity returns sampled at different time horizons M. Tumminello1 , T. Di Matteo2 , T. Aste2 , and R.N. Mantegna1,a 1 2 ... Date Added: 2009-04-26 04:20:54 |
| exam03.pdf Path: Allan Hancock College >> MTH >> 3021 Fall, 2009 Description: Office Use Only Monash University Semester One 2003 Faculty Of Science EXAM CODES: TITLE OF PAPER: EXAM DURATION: READING TIME: MTH3021 DYNAMICAL SYSTEMS & COMPLEX ANALYSIS 3 hours writing time 10 minutes o Open Learning o Other (specify) THIS PAPE... Date Added: 2009-04-26 04:21:44 |
| c4100-sample.txt Path: Allan Hancock College >> COMP >> 4100 Fall, 2009 Description: comp4100 Software Quality Management final exam semester 1 2006 part 2: Process Oriented Quality Management sample case for essay question Question 1. [25 marks] The AquaLush company wishes to produce a computer-based controller for home irrigati... Date Added: 2009-04-26 04:22:53 |
| solnDS.pdf Path: Allan Hancock College >> COMP >> 3610 Fall, 2009 Description: Department of Computer Science, Australian National University COMP3610 Principles of Programming Languages Semester 2, 2007 Week 12 Practical Class Exercises Denotational Semantics Solutions Solution 1 Following the same idea as the while loop cla... Date Added: 2009-04-26 04:23:08 |
| function.c.txt Path: Allan Hancock College >> COMP >> 6300 Fall, 2009 Description: #include <stdio.h> int nextYear(int y); int main(void) { int a, b; a = 1981; b = nextYear(a); if (b = 1982) { printf(\"1982\ \"); } else { printf(\"Help!\ \"); } printf(\"Final value of a=%d\\... Date Added: 2009-04-26 04:23:24 |
| FDNatali.pdf Path: Allan Hancock College >> ENGN >> 3214 Fall, 2009 Description: IEEE TRANSACTIONS O N COMMUNICATIONS, VOL. COM-X, NO. 8, AUGUST i 9 8 4 935 AFC Tracking Algorithms FRANCIS D. NATAL1 Abstract-The automatic frequency control (AFC) loopis beginning to 11. AFC CONFIGURATIONS play an important role in digital data ... Date Added: 2009-04-26 04:23:47 |
| ContactShapeFactorDistItlVW.pdf Path: Allan Hancock College >> ABG >> 110 Fall, 2009 Description: ... Date Added: 2009-04-26 04:24:25 |
| PoreTortuosityItl.pdf Path: Allan Hancock College >> ABG >> 110 Fall, 2009 Description: ... Date Added: 2009-04-26 04:24:27 |
| SeminarProgram2004v150904.pdf Path: Allan Hancock College >> ENGN >> 8104 Fall, 2009 Description: ENGN4200 INDIVIDUAL PROJECTS SEMINAR SERIES 2004 SESSION 1 WEDNESDAY 22 SEPTEMBER (IAN ROSS SEMINAR ROOM) Session 1/A Reviewers: 1. Mick Cardew-Hall (Chair)/ Rob Gresham (Chair) 2. Paul Compston 3. Keith Lovegrove Lesh, Andrew Natural fibres as rei... Date Added: 2009-04-26 04:25:18 |
| week6.ppt Path: Allan Hancock College >> ITC >> 242 Fall, 2009 Description: ITC242 Introduction to Data Communications Chapter 10 1 Last Week Internet Operation Describe the characteristics of an Internet Address Describe the different classes of IP addresses Explain the purpose of subnet masks. 2 Last Week LAN archi... Date Added: 2009-04-26 04:27:41 |
| 51364Intprog01.doc Path: Allan Hancock College >> MKT >> 3003 Fall, 2009 Description: ServicesMarketing Unit 51364, S2, 2002 Notes and assessment details for day students Pleasenote that the assessment for day students varies slightly from that for external students. Pleaseread this handout carefully. Assessment weighting Item Casebr... Date Added: 2009-04-26 04:29:46 |
| lerup-met_form.pdf Path: Allan Hancock College >> MC >> 163 Fall, 2009 Description: ... Date Added: 2009-04-26 04:30:44 |
| tutorial10.pdf Path: Allan Hancock College >> MATH >> 3925 Fall, 2009 Description: The University of Sydney Math3925 Public Key Cryptography Semester 2 Exercises and Solutions for Week 10 2004 Let E be an elliptic curve of the form E : y 2 = x3 + ax + b. Let O denote the point at innity, which is dened to be the identity element f... Date Added: 2009-04-26 04:35:16 |
| Lecture4_slides.pdf Path: Allan Hancock College >> E >> 4384 Fall, 2009 Description: E4384 Lecture 4 The basic principles of metal cutting Basic metal removal processes Turning Boring Shaping Planing Milling Grinding Drilling Broaching Turning and boring Turning Boring Shaping and Planing Shaping Planing Milling and G... Date Added: 2009-04-26 04:37:32 |
| 07N1485.TXT Path: Allan Hancock College >> N >> 1451 Fall, 2009 Description: Sheet1 Err:510 MESSAGE IDENTIFIER: ISO/IEC JTC1/SC7/Secretariat/1996-46 Err:510 ISO/IEC JTC1/SC7 N1485 1996-02-25 TITLE: LETTER BALLOT SUMMARY Change of NP 14579 to a Type II TR and PDTR Registration of N1431 Software Life Cycle Model Taylored for ... Date Added: 2009-04-26 04:39:48 |
| 07N1485.TXT Path: Allan Hancock College >> SC >> 1451 Fall, 2009 Description: Sheet1 Err:510 MESSAGE IDENTIFIER: ISO/IEC JTC1/SC7/Secretariat/1996-46 Err:510 ISO/IEC JTC1/SC7 N1485 1996-02-25 TITLE: LETTER BALLOT SUMMARY Change of NP 14579 to a Type II TR and PDTR Registration of N1431 Software Life Cycle Model Taylored for ... Date Added: 2009-04-26 04:39:48 |
| PlanMarkingGuide.pdf Path: Allan Hancock College >> ISYS >> 3400 Fall, 2009 Description: Marking Guide for Project Plan 1. 1.1 Extract from course outline Project Plan The project plan contributes 10% towards the final mark and is a group task. During the first three weeks of semester the team is required to prepare project plan using ... Date Added: 2009-04-26 04:43:01 |
| SNPIntegrative.pdf Path: Allan Hancock College >> CITP >> 0046 Fall, 2009 Description: Swinburne University of Technology - TAFE CITP0046N NETWORK PROJECT Integrative Practices When writing a Scope document or proposal for your case study or major project, you must ensure that you address how you will meet the 9 functions of project ... Date Added: 2009-04-26 04:46:13 |
| lect7_SP5_2008.ppt Path: Allan Hancock College >> EDUC >> 4063 Fall, 2009 Description: WEB Construction Technologies: under the hood Internet and Education Week 7 Alan Barnes & Andrew Barr 2008 Overview html Xml tasks HTML: hypertext markup language The World Wide Web consists of a large number of web serving computers serving w... Date Added: 2009-04-26 04:47:45 |
| tut_5.pdf Path: Allan Hancock College >> MATH >> 130 Fall, 2009 Description: MATH130 Semester 1 2008 Tutorial Exercises Week 5 There are more tutorial exercises here than your tutor is likely to be able to do during the tutorial class. The idea is for you to practise by doing several examples of each type of exercise. You sh... Date Added: 2009-04-26 04:50:21 |
| cab2002394.txt Path: Allan Hancock College >> CAB >> 2002394 Fall, 2009 Description: PARLIAMENT OF VICTORIA Constitution (Water Authorities) Act 2002 Act No. TABLE OF PROVISIONS Clause P... Date Added: 2009-04-26 04:50:24 |
| icab1996347.txt Path: Allan Hancock College >> ICAB >> 1996347 Fall, 2009 Description: _ IMMIGRATION (EDUCATION) CHARGE AMENDMENT BILL 1996 1996 THE PARLIAMENT OF THE COMMONWEALTH OF AUSTRALIA HOUSE OF REPRESENTATIVES IMMIGRATION (EDUCATION) CHARGE AMENDMENT BILL 1996 EXPLANATORY MEMORANDUM (Circulated by aut... Date Added: 2009-04-26 04:50:37 |
| 06120.pdf Path: East Los Angeles College >> UKHR >> 0607 Fall, 2009 Description: Table 120 Help with housing costs: income support and housing benefits in Northern Ireland million 1980/81 1985/86 1986/87 1987/88 1988/89 1989/90 1990/91 1991/92 1992/93 1993/94 1994/95 1995/96 1996/97 1997/98 1998/99 1999/00 2000/01 2001/02 2002/... Date Added: 2009-04-26 04:51:58 |
| Geog5011Munit9.pdf Path: East Los Angeles College >> GEOG >> 5015 Fall, 2009 Description: Geog5011M Principles of GIS Unit 9 Notes GIS and Modelling The aims of this unit are to: introduce what modelling is explain the different approaches to modelling introduce some of the issues to be aware of when modelling in a GIS. On completion ... Date Added: 2009-04-26 04:52:21 |
| MP-Ch05.pdf Path: Hiram >> PHYS >> 320 Fall, 2008 Description: Modern Physics Physics 320 Lecture Notes Dr. Joseph Gallant Hiram College Fall 2008 Chapter 5: Bound States In the previous chapters Blackbody Radiation, Photoelectric Effect Compton Effect, Electron 2-slit Experiment Bohr Model, de Broglies matter... Date Added: 2009-04-26 04:54:58 |
| wed20sept_1.pdf Path: Toledo >> STA >> 302 Fall, 2009 Description: ... Date Added: 2009-04-26 04:55:00 |
| CH134.pdf Path: East Los Angeles College >> SCI >> 134 Fall, 2009 Description: Module proposal UNIVERSITY OF WARWICK Proposal Form for New or Revised Modules (MA1- version 2) For consideration by the Undergraduate Studies Committee/Sub-Faculty or Graduate Studies Committee only. NB: If it is unclear whether or not a change to a... Date Added: 2009-04-26 04:55:38 |
| function.c.txt Path: Allan Hancock College >> C >> 2300 Fall, 2009 Description: #include <stdio.h> int nextYear(int y); int main(void) { int a, b; a = 1981; b = nextYear(a); if (b = 1982) { printf(\"1982\ \"); } else { printf(\"Help!\ \"); } printf(\"Final value of a=%d\\... Date Added: 2009-04-26 04:56:14 |
| function.c.txt Path: Allan Hancock College >> COMP >> 2300 Fall, 2009 Description: #include <stdio.h> int nextYear(int y); int main(void) { int a, b; a = 1981; b = nextYear(a); if (b = 1982) { printf(\"1982\ \"); } else { printf(\"Help!\ \"); } printf(\"Final value of a=%d\\... Date Added: 2009-04-26 04:56:14 |
| usq_connect.pdf Path: Allan Hancock College >> CIS >> 3009 Fall, 2009 Description: USQConnect 1 USQConnect USQConnect provides you with online access to information, services and course resources relevant to your studies from a convenient, central point. To access USQConnect, from the USQ home page at <http:/www.usq.edu.au> click... Date Added: 2009-04-26 04:57:27 |
| 74.1duffy.pdf Path: Allan Hancock College >> V >> 074 Fall, 2009 Description: 446 letters in canada 2003 with the revival of fine printing, limited editions, and improved technology (permitting the inclusion, for instance, of colour plates). By examining the designs of Laurence Housman, Arthur Rackham, and Florence Harrison, a... Date Added: 2009-04-26 04:57:33 |
| module-outline-for-eap.pdf Path: Allan Hancock College >> FET >> 5621 Fall, 2009 Description: NCUK Module Outline for EAP The EAP course has the dual purpose of supporting students with their academic studies and preparing for future university study. The four skills of reading, writing, listening and speaking are covered, as well as grammar ... Date Added: 2009-04-26 05:00:35 |
| Basics04.4up.pdf Path: Allan Hancock College >> COMP >> 1100 Fall, 2009 Description: Values Values are things such as 42 (an integer), \"Hello, it\'s 2pm\" (a string of Values, Functions, Types COMP1100 - Introduction to Programming and Algorithms characters) and 3.1412 (a floating point number). Values may be passed to functions whic... Date Added: 2009-04-26 05:00:39 |
| answers20.pdf Path: Allan Hancock College >> ENGN >> 3214 Fall, 2009 Description: AUSTRALIAN NATIONAL UNIVERSITY Department of Engineering ENGN3214 Telecommunications Systems Lecture #20 Quick Question Answers 1. Removes long strings of 0s or 1s making the data more random which aids in timing recovery. Generally optimized for enc... Date Added: 2009-04-26 05:01:05 |
| RSI_2_03.pdf Path: Allan Hancock College >> HOP >> 112 Fall, 2009 Description: REVIEW OF SCIENTIFIC INSTRUMENTS VOLUME 74, NUMBER 3 MARCH 2003 Measurements of poloidal rotation velocity using cross-correlation spectroscopy in the H-1 heliac M. G. Shats,a) H. Punzmann, H. Xia, and W. M. Solomon The Australian National Univers... Date Added: 2009-04-26 05:01:19 |
| ssabosaoeap20071003.pdf Path: Allan Hancock College >> SSABOSAOEA >> 20071003 Fall, 2009 Description: Published in Gazette 29.3.2007 p 939 South Australia Senior Secondary Assessment Board of South Australia (Designation of Employing Authority) Proclamation 2007 under section 4 of the Senior Secondary Assessment Board of South Australia Act 1983 1... Date Added: 2009-04-26 05:02:33 |
| hw7sol.pdf Path: Toledo >> MIE >> 566 Fall, 2009 Description: 14.11. If the two agree on the bet, then for both EU(Bet) > U(0). a. If P(Rain tomorrow) = 0.10, and they agree on this probability, For A, 0.10 U(40) + 0.90 U(-10) > U(0), and E(Payoff) = -5. For B, 0.10 U(-40) + 0.90 U(10) > U(0), and E(Payoff) = 5... Date Added: 2009-04-26 05:07:10 |
| Ch07.pdf Path: Cal Poly Pomona >> EC >> 401 Fall, 2009 Description: Topics to be Discussed Chapter 7 n Measuring Cost: Which Costs Matter? n Cost in the Short Run n Cost in the Long Run n Long-Run Versus Short-Run Cost Curves The Cost of Production Chapter 7 1 Chapter 7 2 Introduction n The production technol... Date Added: 2009-04-26 05:07:34 |
| solutions3.pdf Path: East Los Angeles College >> MATH >> 29671 Fall, 2009 Description: 2R1 Mathematics Solutions 3 1 f f = 8x + y and = x + 1. x y f u b) f (x, y) = (xy)1/2 . To nd we use the chain rule. Say u = xy then =y x x f 1 and = u1/2 . So u 2 f f u 1 1 = = u1/2 y = (xy)1/2 y x u x 2 2 1 y 1/2 This rearranges to . Similarly, ... Date Added: 2009-04-26 05:09:01 |
| ps5.pdf Path: Haverford >> PHYS >> 106 Fall, 2008 Description: Physics 106b-2009 Assignment 5 Due: Friday 3-6-09, 4 pm Reading: Ch. 29 (omitting pp. 760-761), 30-1, 30-2 Assigned exercises: Individual problems: 28?11 (Explain your answer briefly) 28?27 28-12 28-47 Group problems: 27?13 Assume V = constant. Hint:... Date Added: 2009-04-26 05:11:01 |
| probweek06f06.pdf Path: CSU Northridge >> SF >> 70713 Fall, 2009 Description: Department of Mathematics Proposed by Bernardo brego and Silvia Fernndez October 16-23 There are exactly 12 cities in One-Way Country. For every pair of cities there is either a one-way direct flight in one of the two possible directions or no fli... Date Added: 2009-04-26 05:11:21 |
| chapter3.pdf Path: CSU LA >> CS >> 370 Fall, 2009 Description: CHAPTER 3: PARALLEL PROGRAMMING TECHNIQUES This chapter considers some simple parallel programming techniques. In the last chapter, you learned about process contention and the errors it can cause. We will look into that topic in greater detail here.... Date Added: 2009-04-26 05:11:47 |
| pubs.pdf Path: University of Iowa >> ISSUES >> 11072003 Fall, 2009 Description: 6 November 7, 2003 The University of Iowa PUBLICATIONS Ajlouni R; Oonsombat C, dentistry administration: an article, Evaluation of a new curing light on the sheer bond strength of orthodonti... Date Added: 2009-04-26 05:12:01 |
| 2007WASA.pdf Path: Dallas >> DHK >> 051000 Fall, 2009 Description: Constructing Connected Dominating Sets with Bounded Diameters in Wireless Networks Yingshu Li Department of Computer Science Georgia State University Atlanta, GA 30303 yli@cs.gsu.edu Donghyun Kim Feng Zou Ding-Zhu Du Department of Computer Science U... Date Added: 2009-04-26 05:12:30 |
| nac0206.pdf Path: CSU San Marcos >> WEBSITE >> 0506 Fall, 2009 Description: Native Advisory Council 7 February 2006 Present: Patricia Dixon, Tishmall Turner, Wendy Schlater, Brandie Taylor, Andrew Masiel, Cheryl Hinton, Karen Haynes, Bonnie Biggs, Al Schwartz, Elena Hood, Vicki Golich, Peter Zwick Geneva Lofton-Fitzsimmons, ... Date Added: 2009-04-26 05:13:43 |
| 102sch.pdf Path: CSU Northridge >> HCCHM >> 102 Fall, 2009 Description: Summer 2007 D. Miller CHEMISTRY 102, GENERAL CHEMISTRY Text: Chemistry: The Molecular Science by Moore, Stanitski & Jurs, Second Edition, Brooks/Cole, 2005. TENTATIVE LECTURE SCHEDULE Date Week 1 July 16, 17 July 18, 19 July 20 Topic Chemical Kinetic... Date Added: 2009-04-26 05:13:57 |
| FourthRootNeg16.pdf Path: UNF >> N >> 00487649 Fall, 2009 Description: The Completeness of the Complexes Now that we have seen complex numbers, we know that ? \"\' %3 but what about % ? \"\'? % Well, we could say ? \"\' ? \"\' %3 %3 #3, but what does 3 mean? To fully understand this, we have to look at both forms of a... Date Added: 2009-04-26 05:15:08 |
| exam03m06.pdf Path: Ill. Chicago >> BIOS >> 100 Fall, 2008 Description: BIOS 100 - Summer 2006 Exam III, 26 July, 2006 Michael Muller, Instructor Name: TA: This exam consists of 52 questions over 7 pages. Please check to see that all the pages are present before you begin. Use a #2 pencil and bubble in all answers. You... Date Added: 2009-04-26 05:16:40 |
| ex9_2waybetw.pdf Path: Maple Springs >> PSYCH >> 6130 Fall, 2009 Description: PSYC 6130 - UNIVARIATE ANALYSIS SPSS Exercise #9 Question 1 a) Dr. Smith is interested in determining if level of exercise (no exercise, moderate exercise, intense exercise) or type of medication (Tylenol, Advil) will affect pain relief (measured on... Date Added: 2009-04-26 05:16:54 |
| ss6.pdf Path: East Los Angeles College >> COMS >> 30205 Fall, 2009 Description: \" $ ( 1 5 ( . . 4 ) ) * $ # ) 67/8# . 4 . 4 . 4 1 ) * 9; 9; 1 ) ) # . # # # ; ! % . 9: 9: 67/8 7 4 3 9: % . 9; 0 9; # 4 4 4 # # ) \"; ! 1 $ 1 - ) .9 &9... Date Added: 2009-04-26 05:18:00 |
| Jack_Noire.pdf Path: SEMO >> BI >> 151 Fall, 2009 Description: Biological Reasoning BI 151-05 Spring 2007 JACK NOIRE AND THE LAW OF NATURE The universe is a deck of cards and the instructor is Mother Nature. Mother Nature has stacked the deck according to a natural law of her own devising. You are a scientist; y... Date Added: 2009-04-26 05:18:52 |
| vennquiz.pdf Path: George Mason >> MATH >> 112 Fall, 2008 Description: ... Date Added: 2009-04-26 05:19:37 |
| ece545_lecture9.pdf Path: George Mason >> ECE >> 545 Fall, 2008 Description: ECE 545Digital System Design with VHDL Lecture 9 Timing of Digital Systems, Advanced Testbenches 11/4/08 1 Outline Timing of digital systems Critical path and setup time violations Min-Max-Avg via Synplicity critical path example Clock Skew an... Date Added: 2009-04-26 05:20:09 |
| Gross_51.pdf Path: UCSD >> SIO >> 295 Summer, 2008 Description: ... Date Added: 2009-04-26 05:20:52 |
| tom_werner_tip_1.pdf Path: East Los Angeles College >> MD >> 0608 Fall, 2009 Description: ... Date Added: 2009-04-26 05:22:36 |
| lec3.pdf Path: East Los Angeles College >> PX >> 266 Fall, 2009 Description: PX266 Geophysics (2008/09) Lecture 3 Handout Geological Time and Geochronology Dr. Gavin Bell The symbol for 1 year is a (annum) so that 1 Ma = 1 million years, 1 Ga = 1 billion (109) years. Other symbols such as yr are often used. Age of Earth and ... Date Added: 2009-04-26 05:23:09 |
| Cointegration_Supplement.pdf Path: East Los Angeles College >> EC >> 501 Fall, 2009 Description: University of Essex Session 200809 Department of Economics Professor M. J. Chambers EC501 Econometric Methods and Applications Cointegration and Dynamic Econometric Modelling Cointegration Economic theory typically suggests equilibrium relationship... Date Added: 2009-04-26 05:25:09 |
| SDQI_VarScor.pdf Path: East Los Angeles College >> GREE >> 1434 Fall, 2009 Description: SDQI Self Description Questionnaire I VARIABLE NAMES FOR DATA ENTRY & SCORING OF THE SDQI The following pages reveal the factor structure of the SDQI. This information should be used during data entry and scoring. Suggested structure variable name... Date Added: 2009-04-26 05:27:14 |
| 1725h06.pdf Path: East Los Angeles College >> MATH >> 1725 Fall, 2009 Description: June06: Section B mark vs. section A mark 40 Section B mark 0 0 10 20 30 10 20 Section A mark 30 40 ... Date Added: 2009-04-26 05:27:40 |
| aiasstd.pdf Path: East Los Angeles College >> U >> 0000605 Fall, 2009 Description: ACCIDENT INVESTIGATION (1999 TO 2000) ASSIGNMENT - to be handed in by Friday the 14th of January 2000 Mr James Joyce was driving a Ford Escort motor car eastwards along Caine Avenue when his car was in collision with a Vauxhall Astra motor car being ... Date Added: 2009-04-26 05:27:48 |
| risk-aversion.pdf Path: East Los Angeles College >> EC >> 992 Fall, 2009 Description: 1 Risk Aversion In this lecture we dene and describe risk aversion in a formal way. For that we shall conne our attention to gambles whose outcome consist of dierent amount of wealth. Denition 1.1 Let A = <+ denotes the set of outcome. Even thoug... Date Added: 2009-04-26 05:28:12 |
| coursework.pdf Path: East Los Angeles College >> CFAS >> 415 Fall, 2009 Description: Coursework - Bayesian Methods 2009 Use the le child-vocab-type-scores.txt and OpenBUGS. These data are: Collected by Jude Lunn from Psychology took a sample of 100 children. She asked them questions in the form of a narrative, the answer to each qu... Date Added: 2009-04-26 05:30:25 |
| RR-06-12.pdf Path: East Los Angeles College >> WL >> 259 Fall, 2009 Description: 22 ISSN 1470-5559 Approaching Real-time Network Traffic Classification Wei Li, Kaysar Abdin, Robert Dann and Andrew Moore RR-06-12 October 2006 Department of Computer Science Approaching Real-time Network Traffic Classification Wei Li, Kaysar A... Date Added: 2009-04-26 05:30:36 |
| lect21.pdf Path: East Los Angeles College >> COMP >> 205 Fall, 2009 Description: Comp 205: T u p le T y p es Comparative Programming Languages Functional Programming Languages: H ask \" tup el l l ing al l ow \" , e.g s com . p osite ty p es to be buil t up by More Haskell (Integer,Integer) is th e ty Integers; sim il arl... Date Added: 2009-04-26 05:34:55 |
| lecture26-27.pdf Path: East Los Angeles College >> COMP >> 523 Fall, 2009 Description: Lectures 26 - 27 Randomised algorithms: Preliminaries COMP 523: Advanced Algorithmic Techniques Lecturer: Dariusz Kowalski Overview Previous lectures: Distributed message-passing model Consensus in synchronized setting Broadcast in asynchronous s... Date Added: 2009-04-26 05:35:06 |
| 07-08CultGeog.pdf Path: East Los Angeles College >> GEOG >> 0708 Fall, 2009 Description: Cultural Geographies (L7020) Autumn Term 2007 Cultural Geographies Course Information Code: L7020 Credits: 12 Level: 2 Course Convenor & Tutor Dr Simon Rycroft Email: S.P.Rycroft@sussex.ac.uk Office/Tel: C167, ext. 2364 Office Hour: Tuesdays 14.00-... Date Added: 2009-04-26 05:36:37 |
| PS04_S09.pdf Path: University of Illinois, Urbana Champaign >> ASTRO >> 405 Fall, 2008 Description: Astronomy 405 Spring 2009 Homework Set #4 Due in class: Wednesday, Feb. 25 1. Analytic functions can be derived for the pressure and density structure in the interior of Jupiter if an approximate relationship between pressure and density is assumed.... Date Added: 2009-04-26 05:39:33 |
| ST517_office_UW15-K.pdf Path: Washington >> STAT >> 517 Winter, 2008 Description: South Central Campus Map, Health Sciences Building F-wing, office room: F-653, Department of Biostatistics 15 K HS Bldg F (HSF) Computing & Communications help@u.washington.edu Modified: December 17, 2007 http:/www.washington.edu/home/maps/?HSF ... Date Added: 2009-04-26 05:46:10 |
| hw2.pdf Path: Washington >> STAT >> 538 Fall, 2008 Description: z8yv g~krc~8~ k!c 6 ~!Q8$~8~vS 0 0 ! 320 ( cRR #Q z8y \"R6y~Rc8~ 8~y ! Rc~ py8 T~y ppB8 8rzpB~ ~y p QQ ... Date Added: 2009-04-26 05:46:12 |
| 0rcs37-430.pdf Path: Neumont >> CSC >> 1906 Fall, 2009 Description: ... Date Added: 2009-04-26 06:26:10 |
| 0rcs37-430.pdf Path: Neumont >> EN >> 1906 Fall, 2009 Description: ... Date Added: 2009-04-26 06:26:10 |
| en193s08-flyer.pdf Path: Sanford-Brown Institute >> EN >> 193 Fall, 2009 Description: EN193S08 - 3D Photography Instructor: Gabriel Taubin Mondays & Wednesdays 8:30 9:50 am By 3D Photography we refer to a number of processes that use cameras and lights to capture the shape and appearance or 3D objects, data structures used to repres... Date Added: 2009-04-26 06:28:59 |
| BE248_w5_2_Handout.pdf Path: Caltech >> BE >> 248 Fall, 2009 Description: BE/CNS 248 5.2 Diffusion MRI Mike Tyszka, Ph.D Caltech Brain Imaging Center Fall Semester 2006-2007 1 Lecture Summary 5.2 Diffusion MRI Clinical Applications of DTI DTI Tract Tracing Methods Limitations of Deterministic Fiber Tracking Probabi... Date Added: 2009-04-26 06:29:32 |
| FinalDissertation.pdf Path: Bowling Green >> ETD >> 07272006 Fall, 2009 Description: AUTHORS STATEMENT In presenting this dissertation as a partial fulfillment of the requirements for an advanced degree from Georgia State University, I agree that the Library of University shall make it available for inspection and circulation in acco... Date Added: 2009-04-26 06:31:40 |
| studyabroad_en.pdf Path: Iowa State >> FRE >> 304 Spring, 2009 Description: Cost Comparison A student taking 8 credits at ISU who opts to live in the dorms and eat at the campus refectory would incur the following expenses: ON-CAMPUS ISU Tuition, Fees, Housing & Meals Summer 2005 (Session 2- 8 Cr.): Resident Tuition (8 credi... Date Added: 2009-04-26 06:32:47 |
| RWA-survey.pdf Path: Iowa State >> CS >> 686 Fall, 2009 Description: A Review of Routing and Wavelength Assignment Approaches for WavelengthRouted Optical WDM Networks HUI ZANG Department of Computer Science University of California, Davis Davis, CA 95616 ABSTRACT This study focuses on the routing and WavelengthAssig... Date Added: 2009-04-26 06:32:53 |
| June2008.pdf Path: Iowa State >> NR >> 80467 Fall, 2009 Description: June 2008 To Your Health You can prepare appealing and nutritious meals and stay within your budget. You can please your family and save money by planning meals, shopping carefully and using your basic food preparation skills. First, look at your fo... Date Added: 2009-04-26 06:33:04 |
| kane_and_rouse.pdf Path: Maryville MO >> ECON >> 4345 Fall, 2009 Description: American Economic Association The Community College: Educating Students at the Margin between College and Work Author(s): Thomas J. Kane and Cecilia Elena Rouse Source: The Journal of Economic Perspectives, Vol. 13, No. 1 (Winter, 1999), pp. 63-84 P... Date Added: 2009-04-26 06:33:24 |
| Handout-26.pdf Path: Arizona >> CS >> 372 Fall, 2009 Description: Higher-Order Functions CSc 372 Comparative Programming Languages 26: Haskell Higher-Order Functions Christian Collberg collberg@cs.arizona.edu A function is Higher-Order if it takes a function as an argument or returns one as its result. Higher-ord... Date Added: 2009-04-26 06:33:28 |
| 406_lect5_2007_LeopoldBiodiversity.pdf Path: Arizona >> ECOL >> 406 Fall, 2008 Description: Lecture 05, 04 Sept 2007 Leopold, Biodiversity Conservation Biology ECOL 406R/506R University of Arizona Fall 2007 Kevin Bonine Cathy Hulshof Upcoming Readings today: Leopold readings, Text Ch. 4, Costanza et al. 1997, Driessen 2004 Thurs 06 Sept: W... Date Added: 2009-04-26 06:33:54 |
| lecture_02.pdf Path: Wisconsin >> ECE >> 335 Fall, 2009 Description: ECE 335 Lecture 2 Lecture 2 Semiconductors: Mostly Doping F. Cerrina Electrical and Computer Engineering University of Wisconsin Madison Spring Semester 2006-07 0 Madison, 2007 ECE 335 Lecture 2 Outline Goal of todays class is to determine t... Date Added: 2009-04-26 06:34:43 |
| design.pdf Path: BU >> CS >> 105 Fall, 2009 Description: Database Design and the Entity-Relationship Model Computer Science 105 Boston University Spring 2009 David G. Sullivan, Ph.D. Database Design In database design, we determine: which data fields to include how they are related how they should be... Date Added: 2009-04-26 06:34:48 |
| 05061713.pdf Path: Wisconsin >> SH >> 050617 Fall, 2009 Description: ... Date Added: 2009-04-26 06:35:00 |
| nsc68.pdf Path: Wisconsin >> HIST >> 102 Fall, 2009 Description: 1 NSC-68 (1950)1 The following report is submitted in response to the President\'s directive of January 31 which reads: \"That the President direct the Secretary of State and the Secretary of Defense to undertake a reexamination of our objectives in p... Date Added: 2009-04-26 06:35:25 |
| SMT-CMP-6up.pdf Path: Duke >> CPS >> 220 Fall, 2009 Description: Administrivia Homework #5 Due Today Homework #6 Due Dec 6 Projects Presentations Dec 6 (or Dec 4 & Dec 6) Documents ~10 pages Good writing is important Progress is important On-chip Parallelism Alvin R. Lebeck CPS 220 Final is Dec 14 Alvi... Date Added: 2009-04-26 06:38:43 |
| discintergroup.pdf Path: Duke >> ECON >> 681 Fall, 2009 Description: 2.3 Discrimination Due to Inter-Group Interactions 2.3.1 Moro and Norman (2001) Moro and Normans (2001) paper builds upon Coate and Loury. The main changes are: An aggregate production function y (C, S) where C is the total quantity (measure) o... Date Added: 2009-04-26 06:38:50 |
| 16-xml.pdf Path: Duke >> CPS >> 216 Fall, 2009 Description: Announcements (March 21) XQuery CPS 216 Advanced Database Systems Midterm has been graded Homework #3 will be assigned next Tuesday Reading assignment due next Wednesday XML processing in Lore (VLDB 1999) and Niagara (VLDB 2003) 2 Project milestone... Date Added: 2009-04-26 06:39:05 |
| L6C_fract_microstructure_5Nov07.pdf Path: Carnegie Mellon >> MEMS >> 27301 Fall, 2009 Description: 1 Microstructure-Properties: I Fracture Toughness: how to maximize it through microstructure control Processing 27-301 Lecture 6C Fall, 2007 Prof. A. D. Rollett Performance Objective Overview Crack Minimztn. Energy Absrptin. Microstructure Proper... Date Added: 2009-04-26 06:42:20 |
| hw03-prop-logic.pdf Path: Mich Tech >> CS >> 4811 Fall, 2008 Description: CS 4811 Articial Intelligence Homework 3 Propositional Logic Due: Tuesday, March 17, 2009, beginning of class (Assigned: Tuesday, March 3, 2009) Reminder: This is an individual assignment. All the work should be the authors and in accordance with th... Date Added: 2009-04-26 06:42:21 |
| wills.pdf Path: N.C. State >> MA >> 798 Fall, 2008 Description: Googles PageRank: The Math Behind the Search Engine Rebecca S. Wills Department of Mathematics North Carolina State University Raleigh, NC 27695 rmwills@ncsu.edu May 1, 2006 Introduction Approximately 94 million American adults use the internet on a... Date Added: 2009-04-26 06:42:25 |
| duffmassey.pdf Path: Columbia >> WW >> 2040 Fall, 2009 Description: ( ( ( ( % # ( % )4c47\'941)44\'!1\"Ip9Q9pwVu 99p4\"14\'9!e!\"\'9!) 4\"w\"\'\"!~\'7p\'4b!\"47p!\'4\"\'79!p\'! % ... Date Added: 2009-04-26 06:42:27 |
| Oscillator_Design_Project.pdf Path: Mich Tech >> EE >> 3305 Fall, 2008 Description: EE 3305 Oscillator Design Objective The objective of this experiment is to give the student experience in designing simple oscillator circuits, to explore the relationship between amplifiers, active filters and oscillators and to experience the effec... Date Added: 2009-04-26 06:42:27 |
| hw7_sol.pdf Path: N.C. State >> CSC >> 570 Fall, 2008 Description: Homework 7 Solution Guidelines ECE/CSC 570-001, Fall 2008 1. (Ungraded) What class is the IP address 152.7.302.14 ? 1. Such an IP address is impossible, of course none of the octets can have value more than 255. 2. (Adapted from Tanenbaum, 5.37) Su... Date Added: 2009-04-26 06:43:10 |
| Safety.pdf Path: Michigan State University >> ECE >> 307 Fall, 2009 Description: ECE 307 LABORATORY SAFETY CONSIDERATIONS Spring 2000 This document addresses safety considerations for students participating in the EE 306 laboratory. Students should review all safety material provided by previous lab supervisors and be aware of th... Date Added: 2009-04-26 06:46:15 |
| lect1.pdf Path: UNC >> CS >> 144 Fall, 2009 Description: COMP 144 Programming Language Concepts Lecture 1: Introduction January 9, 2002 The University of North Carolina at Chapel Hill COMP 144 Programming Language Concepts Spring 2002 Lecture 1: Introduction Felix Hernandez-Campos HernandezJan 9 COMP 1... Date Added: 2009-04-26 06:48:37 |
| Lecture03.pdf Path: UNC >> COMP >> 524 Fall, 2008 Description: Lecture 3: Lexical Analysis COMP 514 Programming Language Concepts Aaron Block January 18, 2007 Based on notes by N. Fisher, F. Hernandez-Campos, and D. Stotts The University of North Carolina at Chapel Hill Goal of Lecture Character Stream Scanne... Date Added: 2009-04-26 06:48:40 |
| Scheme.pdf Path: Virginia Tech >> CS >> 3304 Fall, 1999 Description: )3)RXQGDWLRQV6FKHPH ,Q 7H[W &KDSWHU 0DWKHPDWLFDO )XQFWLRQV T \'HI $ PDWKHPDWLFDO IXQFWLRQ LV D PDSSLQJ RI T 7KH LQSXW VHW LV FDOOHG WKH GRPDLQ T 7KH RXWSXW VHW LV FDOOHG WKH UDQJH T (DFK LQSXW PDSV WR H[DFWO\\ RQH RXWSXW PHPEHUV RI RQH VHW WR DQRW... Date Added: 2009-04-26 06:49:12 |
| multinom.pdf Path: UNC >> BIOS >> 765 Fall, 2008 Description: Appendix to Notes 6 In this appendix, we derive asymptotic theory results for the (constrained) loglinear model under single multinomial sampling. First, we give two matrix derivative results that will be used in the subsequent derivations. Lemma 1. ... Date Added: 2009-04-26 06:49:15 |
| hw1.pdf Path: UNC >> INLS >> 723 Fall, 2006 Description: INLS 723, Dr. Capra Assigned: Tues, Sept 19 Homework 1 Fall 2006 Due: 5:00pm, Wed, Sept 27 Prepare your answers to this assignment using a word processor or text formatting system. Acceptable formats are MS Word, Open Office, and PDF. Turn in this... Date Added: 2009-04-26 06:49:21 |
| EMPLOYMENT+FLYER.pdf Path: UNC >> READ >> 4761881 Fall, 2009 Description: EXECUTIVE DIRECTOR TRIANGLE J COUNCIL OF GOVERNMENTS RESEARCH TRIANGLE PARK, NC Background: The Triangle J Council of Governments (TJCOG) is a voluntary membership organization that strives to promote harmony and cooperation among its members, seekin... Date Added: 2009-04-26 06:49:34 |
| DeokroLee7_12.pdf Path: Fayetteville State University >> ETD >> 07082004 Fall, 2009 Description: THE FLORIDA STATE UNIVERSITY COLLEGE OF SOCIAL SCIENCES COMPETING MODELS OF EFFECTIVENESS IN RESEARCH CENTERS AND INSTITUTES IN THE FLORIDA STATE UNIVERSITY SYSTEM: A DATA ENVELOPMENT ANALYSIS By DEOKRO LEE A Dissertation submitted to the Askew S... Date Added: 2009-04-26 06:50:22 |
| Lect22-review_2.pdf Path: Fayetteville State University >> PHY >> 2053 Fall, 2009 Description: L21Ch11Ch12 PHY 2053C College Physics A n Motion, Forces, Energy, Heat, Waves Dr. David M. Lind Dr. Kun Yang Dr. David Van Winkle Spring 2004 Today: v SPOT evaluations: 10:10-10:20 v Recap Mini-exam#7 v Review for Final Kinematics Force & acce... Date Added: 2009-04-26 06:50:31 |
| LAB_1_SM06.ppt Path: UF >> CLAS >> 3514 Fall, 2009 Description: ANT3514IntrotoBioAnthLab MeganHosford mhosford@anthro.ufl.edu B329andB301 MWR(2:003:15) ANT 3415C Lab Policies Rules for Turlington B304 NO food or drinks allowed in the room. NO cell phones or pagers during lab session these must be turned off. Ha... Date Added: 2009-04-26 06:51:36 |
| Exam2_soln_f05.pdf Path: UF >> PHY >> 2061 Fall, 2008 Description: PHY2061 11-8-05 Name:_ _ Exam 2 Solutions 1. An RC circuit is discharged by closing a switch at time t = 0. The initial potential difference across the capacitor is 5 V. The potential difference across the capacitor drops to half of its value in 35... Date Added: 2009-04-26 06:52:13 |
| Italy_IntlMktg_syl.doc Path: Seattle >> MKTG >> 591 Fall, 2009 Description: Seattle University MKTG 491/591 International Marketing Intersession 2003 Instructor: Course Description: This course is a portion of the study tour in Italy. Web Site: http:/fac-staff.seattleu.edu/pvraven/ Our objective is to develop a better and d... Date Added: 2009-04-26 06:56:12 |
| paper_guidelines.doc Path: George Mason >> EOS >> 704 Spring, 2008 Description: EOS 704 Spatial Analysis and Modeling of Population Guidelines for the Term Paper/Project Double-spaced, 12-point font, at least 1 inch margin on each side. The paper should be at least 15 pages in length, but no more than 25 pages. The term paper sh... Date Added: 2009-04-26 06:56:31 |
| pa1.doc Path: UCSC >> CMPS >> 101 Spring, 2008 Description: CMPS 101 Algorithms and Abstract Data Types Spring 2006 Programming Assignment 1 Due Friday April 21, 10:00 pm Introduction The purpose of this assignment is threefold: to make sure everyone is up to speed with Java, to practice modularity and ADTs,... Date Added: 2009-04-26 06:57:23 |
| Individual_paper_-_paper_1.pdf Path: San Jose State >> MATE >> 270 Fall, 2008 Description: ChemE/ MatE 270 Spring 2003 Individual Paper Paper 1 A 6-10 page report is due at the start of class on February 12th. Your topic and a list of three references are due by the start of class on February 5th. In this report, you will detail how thi... Date Added: 2009-04-26 06:57:49 |
| 74.1duffy.pdf Path: Johns Hopkins >> V >> 074 Fall, 2009 Description: 446 letters in canada 2003 with the revival of fine printing, limited editions, and improved technology (permitting the inclusion, for instance, of colour plates). By examining the designs of Laurence Housman, Arthur Rackham, and Florence Harrison, a... Date Added: 2009-04-26 06:57:52 |
| 29SpStudyGuideCS147Midterm1.doc Path: San Jose State >> CS >> 147 Fall, 2008 Description: 2009 Spring Study Guide of CS 147 Midterm 1 Exam date: Thursday Feb., 17,2009 Lecture notes on Combinational Logic Number base Conversion Horners Method Boolean Algebra Gates, Half adder, Full adder, SOP, POS Truth tables, Karnaugh map Multiple... Date Added: 2009-04-26 06:57:54 |
| L10cov.pdf Path: Ill. Chicago >> MATH >> 512 Fall, 2008 Description: Lecture 10: Covers of the multiplicative group of John T. Baldwin Department of Mathematics, Statistics and Computer Science University of Illinois at Chicago October 19, 2003 C The rst approximation to a quasiminimal axiomatization of complex expo... Date Added: 2009-04-26 06:59:06 |
| resist_lab_write_up_A.pdf Path: Texas A&M >> PHYS >> 208 Fall, 2009 Description: Study of Resistance Components Purpose: The purpose of this exercise is to apply fundamental electrical circuit concepts to determine the response of electrical components subjected to a mechanical input with the intent that the information gathered ... Date Added: 2009-04-26 07:01:07 |
| SOM120CH9CLASSSLIDES.ppt Path: CSU Northridge >> HCACT >> 120 Fall, 2009 Description: Estimation and Confidence Intervals Chapter Nine McGrawHill/Irwin 2006TheMcGrawHillCompanies,Inc.,AllRightsReserved. A Point estimate is a single value (statistic) used to estimate a population value (parameter). Eg. i s a poi nt esti mate of ... Date Added: 2009-04-26 07:02:21 |
| 557lecture03.pdf Path: Colorado State >> CS >> 557 Fall, 2008 Description: CS 557 - Lecture 3 Network Architecture End to End Arguments in System Design Saltzer, Reed, Clark, 1984 Design Philosophy of the DARPA Internet Protocols Clark 1988 Spring 2009 Architecture Dictionary definitions A style and method of design and ... Date Added: 2009-04-26 07:03:40 |
| 01-01_Introduction.pdf Path: UC Davis >> VEN >> 0601 Fall, 2009 Description: 1 WINE AS AN ACADEMIC SUBJECT Wine is a serious and challenging subject for academic study. It engages scholars in many disciplines in the sciences and in the humanities. One can approach wine from the perspective of biology and study the growth and... Date Added: 2009-04-26 07:06:27 |
| HR_Exam1.pdf Path: New Mexico >> PHYS >> 161 Fall, 2009 Description: ... Date Added: 2009-04-26 07:06:29 |
| Patent_Infringement_Damages_in_France.pdf Path: Washington >> P >> 506 Fall, 2009 Description: Patent Infringement Damages in France Stanislas ROUX-VAILLARD VRON & ASSOCIS 6, square de l\'Opra Louis Jouvet F 75009 PARIS Tel. + 33.1.53.05.91.91 Fax + 33.1.53.05.91.98 53, avenue Marchal Foch F 69006 LYON Tel. + 33.4.72.69.39.39 Fax + 33.4.72.69.... Date Added: 2009-04-26 07:06:36 |
| REPROTIM.doc Path: Clemson >> WS >> 301 Fall, 2009 Description: Time-Line on Reproductive Rights 1839 1842 1847 With the vulcanization of rubber by Goodyear, rubber condoms become available for use. Oliver Wendell Holmes in \"The Contagiousness of Puerperal Fever\" calls for obstetricians to wash hands and use ster... Date Added: 2009-04-26 07:06:52 |
| lecture29--1may07.pdf Path: Colorado >> ASTR >> 1040 Fall, 2008 Description: ASTR 1040 Accel Astro: Stars Observational Cosmology\" Cosmology\" Look further at models for our universe, and universe, ideas of \"dark energy\" arising from white-dwarf energy\" whitesupernova dat... Date Added: 2009-04-26 07:07:08 |
| 01-Faculty_Services_Librarian_Final__2_.doc Path: UC Davis >> ATT >> 0014 Fall, 2009 Description: Faculty Services Librarian Drexel University College of Law Library solicits applications for the newly created position of Faculty Services Librarian. Drexel welcomed its inaugural law school class in August 2006 and will apply for ABA provisional a... Date Added: 2009-04-26 07:07:52 |
| Goat.pdf Path: Kentucky >> ASC >> 300 Fall, 2008 Description: Goats; More than just a lawn mower Grading and Carcass Evaluation of Meat Goats Dr. Gregg Rentfrow, Ph.D. Extension Meats Specialist Department of Animal and Food Science University of Kentucky Why Goats? Eat anything Low Maintenance Can be Prof... Date Added: 2009-04-26 07:08:50 |
| 1524_3.txt Path: Georgia Tech >> CS >> 4440 Fall, 2008 Description: Learning and Inferring Transporation Routines The authors of this paper developed a method of predicting a user\'s destination based on previous trips (using GPS tracing) and on current trip information. Anecdotally, their method is like a Private I... Date Added: 2009-04-26 07:10:50 |
| waters_robert_l_200412_phd.pdf Path: Georgia Tech >> ETD >> 10272004 Fall, 2009 Description: Obtaining Architectural Descriptions from Legacy Systems: The Architectural Synthesis Process (ASP) A Thesis Presented to The Academic Faculty by Robert L. Waters In Partial Fulllment of the Requirements for the Degree Doctor of Philosophy Colleg... Date Added: 2009-04-26 07:13:23 |
| SV_Fall08_Ch1(Intro&History)3.pdf Path: WVU >> PSYC >> 101 Fall, 2008 Description: 8/21/2008 Welcome to Psychology 101 Turn Off That Phone! Instructor Introduction Name and email Office and office hours g A little background Student Introduction 2 out-of-class activities (1.1, 1.3), due: _ with a copy of WVU student ID Show of ... Date Added: 2009-04-26 07:14:33 |
| Week-4-b.pdf Path: Purdue >> ECE >> 624 Fall, 2008 Description: ECE624 Week 4-b 1 Video Semantic Modeling Paradigm Knowledge-based Event Modeling High Level of Abstraction Motion Detection Analysis Iconic-based Grouping & Browsing Image Recognition Video Parsing and Segmentation Low Fine Granularity 2 C... Date Added: 2009-04-26 07:14:35 |
| FiducciaMattheysesPartitioning.ppt Path: UCSB >> CS >> 140 Fall, 2009 Description: Simplified Fiduccia-Mattheyses: Example (1) 1 a Red nodes are in Part1; black nodes are in Part2. The initial partition into two parts is arbitrary. In this case it cuts 8 edges. The initial node gains are shown in red. 0 e -1 c g 3 0 0 b 1 d h 2 f ... Date Added: 2009-04-26 07:17:16 |
| 01ex2L.pdf Path: Colorado State >> CHEM >> 543 Fall, 2008 Description: Chemistry 543 Exam 2* October 19, 2001 Name: ID#: 1. 2. 3. 4. /32 /31 /30 /22 Total /115 pts. * Note: Not PostCrypt font Exam II Potentially useful information: C543 Fall 2001 G 0 = H 0 T S 0 = RT ln K eq Gas constant R = 1.986 cal/mol K... Date Added: 2009-04-26 07:18:19 |
| Hw_9Feb09.doc Path: UMass Dartmouth >> ECE >> 263 Fall, 2009 Description: ECE263 Homework 9 Feb 09 Assignment 4: Due Feb 13 Write a short assembly language program for the following task. Write a program to convert the contents of a block of RAM into ASCII hex and leave the results in another block of RAM. Upon startup, th... Date Added: 2009-04-26 07:19:41 |
| smixed.pdf Path: CSU Sacramento >> M >> 107 Fall, 2009 Description: Author: Group Members: Negatives, Mixed Numbers and Improper Fractions 1. Compute 4 4 + algebraically. Justify each equality. 5 5 4 4 (i) 4 + 4 (ii) 0 (iii) = = 0 + = 5 5 5 5 (i) Addition in Q (ii) Addition in Z (iii) 0 as a fraction 2. Compute 4... Date Added: 2009-04-26 07:19:46 |
| MotifBIBC100Lecture.pdf Path: UCSD >> BIBC >> 100 Fall, 2008 Description: BIBC 100 Motif Simple combination of secondary structure elements with specific g geometric array y Helix-loop-helix -loop- -Hairpin - Helical Bundles Very frequent in Loop parallel -Sheets of proteins Topological Diagrams Domain a unit, ... Date Added: 2009-04-26 07:22:36 |
| lecture20.pdf Path: Lehigh >> IE >> 426 Fall, 2008 Description: What is Stochastic Programming Why use Stochastic Programming Stochastic LP What is Stochastic Programming Why use Stochastic Programming Stochastic LP Definition of Stochastic Programming Related Decision Making Technologies The Newsvendor Problem... Date Added: 2009-04-26 07:22:41 |
| MythsManifestos1.pdf Path: CSU Channel Islands >> ICS >> 234 Fall, 2009 Description: Myths and Manifestos in CSCW Research: Reflections on Research Agendas Paul Dourish School of Information and Computer Science University of California, Irvine DRAFT not for distribution Introduction As is regularly noted, CSCW is an inherently int... Date Added: 2009-04-26 07:22:50 |
| 2008929_r01x_0704819.pdf Path: Stanford >> TELK >> 1037 Fall, 2009 Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK Lead Counsel For Plaintiffs Timoth J. M fall E Bernstein Liebhard & Lifshitz, LLP (In the space above enter the full name (s) ofthe plaintij^(s)/petitioner(s).) 2008 9 : D. h0F 07- cv - 0481... Date Added: 2009-04-26 07:23:02 |
| project_proposal.doc Path: Michigan >> SEC >> 005 Fall, 2009 Description: The Great Lakes are an important part of our lives and economies in Michigan and throughout the rest of the Great Lakes area. As the lakes rise and fall, not only the ecosystems within the lakes but also the shoreline ecosystems and the people living... Date Added: 2009-04-26 07:23:57 |
| lab02-ans.txt Path: CSU Fullerton >> SEC >> 830 Fall, 2009 Description: Lab02-answers 1. What is your real name and Seneca student ID? My real name is Fedora Ten and my Seneca Student ID is 012-345-678. 2. What are the hashed passwords for the two accounts you created? The password hash for user joker is $6$l1q.Q... Date Added: 2009-04-26 07:25:06 |
| lect15.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 102 Fall, 2008 Description: Monopolistic Competition Monopolistic Competition is a market structure in which many rms sell products that are similar but not identical. Characteristics of Monopolistic Competition: 1. Many Sellers =) Firms compete. 2. Product Di erentiation =) Ea... Date Added: 2009-04-26 07:25:54 |
| 07-031abc.pdf Path: East Los Angeles College >> UKHR >> 0607 Fall, 2009 Description: Table 31a Tenure profile of heads of household by age in Great Britain Percentages Item Owner-occupiers Owned outright Ages at 1980 Under 25 25 - 29 30 - 44 45 - 64 65 - 74 75 or over All ages Ages at 1990 Under 25 25 - 29 30 - 44 45 - 59 60 - 69 70 ... Date Added: 2009-04-26 07:26:01 |
| 1sol.pdf Path: UPenn >> CIS >> 121 Fall, 2009 Description: CIS 121 Spring 2009 Midterm 1 SOLUTIONS Wednesday, February 25, 2009 Name: Penn ID: Email: Lab: circle one 201: Jay Mo 12-1 202: Jared Mo 1-2 203: Sela Mo 2-3 204: Kiuk Tu 3-4 Instructions: This is a closed-book, no-device exam: you may not make... Date Added: 2009-04-26 07:26:50 |
| raytracing3.pdf Path: Georgia Tech >> CS >> 4390 Fall, 2009 Description: 0RUH#5D\\#7UDFLQJ$ ] (IILFLHQF\\ ] %RROHDQ#RSHUDWLRQV ] $QWLDOLDVLQJ (IILFLHQF\\= ,QWHUVHFWLRQ#DOFXOD... Date Added: 2009-04-26 07:27:20 |
| 15_approx_III.pdf Path: University of Illinois, Urbana Champaign >> CS >> 473 Fall, 2008 Description: 15: Approximation algorithms III Sariel Har-Peled April 1, 2006 473G - Algorithms Version: 0.1 This is a very early version of the class notes. There are no guarantees that there are no mistakes or typos. A better version would be released in the ne... Date Added: 2009-04-26 07:28:00 |
| sp01_ps9_solns.pdf Path: Georgia Tech >> ECE >> 2040 Fall, 2009 Description: ... Date Added: 2009-04-26 07:29:50 |
| lecture6.ppt Path: Cleveland State >> EEC >> 584 Fall, 2009 Description: EEC-484/584 Computer Networks Lecture 6 Wenbing Zhao wenbing@ieee.org (Part of the slides are based on Drs. Kurose & Ross\'s slides for their Computer Networking book) 2 Outline Quiz#1 result Introduction to transport layer Multiplexing/demulti... Date Added: 2009-04-26 07:29:58 |
| 07-lec05-branch.pdf Path: Cleveland State >> CA >> 581 Fall, 2009 Description: EEC 581 Computer Architecture Lec 5 Instruction Level Parallelism Chansu Yu Electrical and Computer Engineering Cleveland State University Acknowledgement . Part of class notes are from David Patterson Electrical Engineering and Computer Scienc... Date Added: 2009-04-26 07:30:08 |
| 09mon-project3.doc Path: Georgia Tech >> CS >> 4001 Fall, 2008 Description: Choice of Part 3 Projects a) What to do now Read the descriptions below (sections b and c). You will be placed in a team of students working on either the Therac-25 case or the Code of Practice. The guidelines below for the Therac-25 case are more el... Date Added: 2009-04-26 07:30:09 |
| TCPDumpSection2.pdf Path: Benjamin Franklin Institute of Technology >> CSE >> 5636 Fall, 2009 Description: TCPDump and WinDump Section 2 of SWE5900 This material is intended for students of this course only. No further reproduction or distribution is authorized. Network Security 1-1 TCPDump UNIX tool that collects network data and displays it in specifie... Date Added: 2009-04-26 07:35:11 |
| iw3htp4_24-FINAL.ppt Path: St. Thomas >> CISC >> 270 Fall, 2009 Description: 1 2 4 Ruby on Rails 2008 Pearson Education, Inc. All rights reserved. 2 Convention is the ruler of all. Pindar Where the telescope ends, the microscope begins. Which of the two has the grander view? Victor Hugo We grow more partial for the ob... Date Added: 2009-04-26 07:35:23 |
| P09221_5min_status_week3.ppt Path: RIT >> P >> 09221 Fall, 2009 Description: P09221: Innovative Composite Parts for a Formula SAE Racecar Team Members: David Holland Theodore Kusnierz Anthony Salvo Ryan Baldi Charles Thomas Martin Iwanowicz Primary Engineering Specifications Chassis 1.) Resistant to cone impact @ 75mph 2.)... Date Added: 2009-04-26 07:36:40 |
| YouthDevelopment4pg1.pdf Path: Iowa State >> B >> 27292 Fall, 2009 Description: ... Date Added: 2009-04-26 07:37:35 |
| MillipedesinCornSoybeansMay06.pdf Path: Iowa State >> E >> 33934 Fall, 2009 Description: Agronomy Technical Bulletin May 2006 Millipedes in Corn & Soybeans Description and Background Millipedes, or thousand leggers, are tubular-shaped worms that are related to centipedes, pillbugs, and other terrestrial crustaceans. They have a hard sh... Date Added: 2009-04-26 07:38:14 |
| cattle.doc Path: Iowa State >> PUBLIC >> 0907 Fall, 2009 Description: CattleNetwork.com, KS 09-06-07 Cattle Preconditioning - Does Extra Cos & Work Bring Extra Dollars? A preconditioned calf is one that has been vaccinated, castrated and weaned for 30-45 days prior to sale date and has experience feeding from a bunk. M... Date Added: 2009-04-26 07:38:17 |
| cattle.doc Path: Iowa State >> MR >> 0907 Fall, 2009 Description: CattleNetwork.com, KS 09-06-07 Cattle Preconditioning - Does Extra Cos & Work Bring Extra Dollars? A preconditioned calf is one that has been vaccinated, castrated and weaned for 30-45 days prior to sale date and has experience feeding from a bunk. M... Date Added: 2009-04-26 07:38:17 |
| Hw1.pdf Path: Iowa State >> EE >> 523 Fall, 2009 Description: EE523: Random Processes for Communication and Signal Processing Homework #1 1. Give an example of a eld of sets that is not a -eld. 1 2. Let A and B be events with probabilities P (A) = 3/4 and P (B) = 1/3. Show that 12 P (A B) 1 and show that bot... Date Added: 2009-04-26 07:39:40 |
| Stu_Lab01_04.pdf Path: Iona >> CS >> 140 Fall, 2009 Description: L A B 1.4 SMARTER SEARCHING ON THE WEB We will begin by reviewing search engines and discussing common strategies for effective web searching. In the remainder of the lab, you will practice applying these strategies to answer a series of questions... Date Added: 2009-04-26 07:40:18 |
| postcards.doc Path: Iowa State >> MR >> 0323 Fall, 2009 Description: Des Moines Register 03-18-07 Postcards bring secrets to light in ISU project By MICHAEL MORAIN REGISTER STAFF WRITER Pssst. Hey, you over there. Listen up a sec. \"I threw away the My Little Pony.\" \"I forgot to feed the goldfish. but kind of on purpos... Date Added: 2009-04-26 07:40:37 |
| postcards.doc Path: Iowa State >> PUBLIC >> 0323 Fall, 2009 Description: Des Moines Register 03-18-07 Postcards bring secrets to light in ISU project By MICHAEL MORAIN REGISTER STAFF WRITER Pssst. Hey, you over there. Listen up a sec. \"I threw away the My Little Pony.\" \"I forgot to feed the goldfish. but kind of on purpos... Date Added: 2009-04-26 07:40:37 |
| exampleADCs.pdf Path: UCSB >> ECE >> 594 Fall, 2009 Description: Another way to implement a folding ADC J. Van Valburg and R. van de Plassche, An 8-b 650 MHz Folding ADC, IEEE JSSC, vol 27, #12, pp. 1662-6, Dec 1992 Coupled Differential Pair J. Van Valburg and R. van de Plassche, An 8-b 650 MHz Folding ADC, IEE... Date Added: 2009-04-26 07:43:57 |
| ch12b_4035.pdf Path: UPR Mayagüez >> ICOM >> 4035 Fall, 2009 Description: Red-Black Trees Chapter 12 B A 2-3-4 tree Advanced Implementations of Tables Advantages It is balanced Its insertion and deletion operations use only one pass from root to leaf Disadvantage Requires more storage than a binary search tree A... Date Added: 2009-04-26 07:44:32 |
| FatsLectureNotes.pdf Path: Colorado >> EEB >> 1210 Fall, 2009 Description: Lipids: Fats, Phospholipids, Steroids \"Water and oil don\'t mix!\" Saturated fats and unsaturated fats Fig. 5.12 The double bond introduces a structural `kink\' in the fatty acid chain Which is better for your health? Butter or canola oil? (Consumption... Date Added: 2009-04-26 07:46:14 |
| exam1.pdf Path: Idaho >> ECE >> 101 Spring, 2008 Description: ECE 101 Introduction to ECE Examination #1 Name: Show all of your work! Make it neat. No partial credit will be given if I can not easily follow your work. Where applicable, make sure that units are included as part of the answer. There is a... Date Added: 2009-04-26 07:46:44 |
| meeting3-09.ppt Path: Villanova >> CSC >> 8570 Fall, 2009 Description: CSC 8570 - USI ClassMeeting3 January23,2009 Course Textbook Carroll,HCIModels,Theories,and Frameworksisnolongerreadilyavailable forreasonablecost. Copiesofrelevantchapterswillbe provided. Homework for Today Researchteammembership Fini... Date Added: 2009-04-26 07:47:06 |
| oldexam3.pdf Path: Texas A&M >> MATH >> 171 Fall, 2008 Description: Exam 3, version A Math 171.504 12/2/05 An unsupported answer is a wrong answer! There are problems on both sides of this sheet! 1. (8 pts.) An investment doubles in 10 years. How many years will it take to triple? Assume continuous compounding of i... Date Added: 2009-04-26 07:48:27 |
| assignment_08.pdf Path: Texas A&M >> CVEN >> 365 Fall, 2008 Description: TEXAS A Stress due to Load Due 11/6/2003 at 8:00 AM Any late assignment will receive a grade of zero. Not turning in an assignment before t... Date Added: 2009-04-26 07:48:55 |
| hw6.pdf Path: S.F. State >> MATH >> 890 Fall, 2008 Description: Math 890 Homework Computational Algebraic Geometry Spring 2002 Homework VI This homework is due Friday, March 15 at the beginning of the class. If you have any questions send me e-mail (serkan@math.sfsu.edu) or call me (338 7723). Chapter 4 : 1. ... Date Added: 2009-04-26 07:49:35 |
| exam1_01_2006FA.pdf Path: Boise State >> MATH >> 170 Fall, 2008 Description: Math 170-001 September 19, 2006 Exam 1 Name This test consists of 100 points and 4 pages, none of which is intentionally left blank. Take a few seconds right now to be sure you have all the pages. The point value of each question is to the left of... Date Added: 2009-04-26 07:49:45 |
| a5_09sol.pdf Path: UWO >> SS >> 2858 Fall, 2009 Description: 1 The University of Western Ontario Department of Statistical and Actuarial Sciences Statistical Sciences 2858b Assignment 5 Solutions 1. The density function is f (x) = so the log likelihood is n n 1 x 1 /x2 , x>1 log L() = n log i=1 log(x... Date Added: 2009-04-26 07:50:25 |
| lab04DiskBrake.pdf Path: Clarkson >> AE >> 201 Fall, 2009 Description: Disk Brake Performance Measurement Andrew Ritchey, Martin Spackman, Ryan Sprague Section 10 Task 1: A grid of 3 pressures (10, 15 and 20 psi) and 3 inertia variants was chosen for this experiment. Figure 1 shows the RPM vs. Time plot and is represen... Date Added: 2009-04-26 07:51:00 |
| social.doc Path: Uni. Westminster >> BCY >> 0114 Fall, 2009 Description: Yag 1 Brendan Yag Dr. Mike Zarkin PLSC 121 September 20, 2006 My Social Structure While thinking about a social setting that I am familiar with, I decided it was necessary to talk about the restaurant business. The past two summers, I have bussed tab... Date Added: 2009-04-26 07:51:31 |
| 10-PatternIntroIteratorStrategyObserver.ppt Path: Arizona >> CS >> 335 Fall, 2009 Description: CSC 335: Object-Oriented Programming and Design Object-Oriented Design Patterns Outline Overview of Patterns Iterator Strategy The Beginning Christopher Alexander, architect A Pattern Language-Towns, Buildings, Construction Timeless Way of Build... Date Added: 2009-04-26 07:51:52 |
| lecture3.pdf Path: Caltech >> CS >> 141 Fall, 2009 Description: Recap Java and Object Orientation CS 141a - Distributed Computation Laboratory http:/www.cs.caltech.edu/~cs141/ Introduction to Threads 14 January 2003 1 Today Introduction to Threads Java Thread Mechanics CS 141a - Distributed Computation Labor... Date Added: 2009-04-26 07:53:10 |
| notes_week2.pdf Path: W. Alabama >> PMATH >> 340 Fall, 2009 Description: Week 2 Arithmetic modulo m The material in Week 2 is roughly equivalent to Chapter 3 of [Jones and Jones]. 2.1 Congruences The notation and terminology of divisibility is a bit unwieldy. The notation of congruences greatly simplies a lot of state... Date Added: 2009-04-26 07:53:13 |
| patgcab20022499.txt Path: Allan Hancock College >> PATGCAB >> 20022499 Fall, 2009 Description: 2002 THE LEGISLATIVE ASSEMBLY FOR THE AUSTRALIAN CAPITAL TERRITORY (As presented) (Ms Roslyn Dundas) ... Date Added: 2009-04-26 07:54:52 |
| HW_for060706.pdf Path: Portland >> MTH >> 212 Fall, 2008 Description: MTH 212, Hackenberg Homework for Wednesday June 7: Graphing and Writing Assignment We may start some of this work in class on May 31. Use class time on June 5 to work on this assignment. Complete all parts, using the Statistics Reading to augment wh... Date Added: 2009-04-26 07:55:42 |
| recycling.ppt Path: U. Houston >> CUIN >> 3112 Fall, 2008 Description: Recycling What is Recycling? Recycling means taking materials from products you have finished using and making brand new products with them. Why Should I Recycle? Recycling reduces the amount of trash, therefore helping our earth stay clean. Who... Date Added: 2009-04-26 07:57:39 |
| CRIM432C01.TXT Path: Sveriges lantbruksuniversitet >> ARTS >> 20012 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: CRIM 432-3 C01 LOCATION: SFU TITLE: GENDER-COURTS/LEGAL SECTION TYPE: SEC SEMESTER: 2001-2 ENROL: 31 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown... Date Added: 2009-04-26 07:57:50 |
| G1111077week2Sep11-14c.pdf Path: Sveriges lantbruksuniversitet >> GEOG >> 111 Fall, 2009 Description: 9/19/2007 GEOG 111 Sept. 11-14, 07 Power Triangle (will draw together)-science is peripheral to power Memory in the Ocean (Add. Comment) H How i th is there lif on Earth? (p.2 last week\'s life E th? ( 2 l t k\' notes)-motivation for this week . A... Date Added: 2009-04-26 07:58:39 |
| 881105.pdf Path: Michigan State University >> LIB >> 1988 Fall, 2009 Description: A Report on the New Grasses Being Developed for Golf by DR. VICTOR A. GIBEAULT University of California, Riverside, California HE SUMMER drought of 1988 has once again reminded all of us involved with golf of the fragile nature of our water supply, a... Date Added: 2009-04-26 07:59:31 |
| LECTUR_1.pdf Path: East Los Angeles College >> C >> 1001 Fall, 2009 Description: 1 Animal Social Behaviour: Lectures 1-9 Cooperation and altruism: theory and evidence Prof. Tim Roper, October 2004 Lecture synopsis 1. The aim of the course is to consider the social behaviour of non-human animals from an evolutionary perspective ... Date Added: 2009-04-26 08:00:17 |
| rozzi-notespdf.pdf Path: North Texas >> PHIL >> 1400 Fall, 2008 Description: ... Date Added: 2009-04-26 08:00:44 |
| 409wk13_x4.pdf Path: Cornell >> CS >> 409 Spring, 2009 Description: H` ` b ` k ) c ` H` `XiPi` b ` u0d ` X a G0D 4 G F 4 (ThC47F56B6CA 28 G8 W 2f 8 f0 64 4 6 W A F P 79@Y(CD5A(YQEEI P3W d (veDTS@0 U6EI h E07A6 (rh4 v333VPG @V6 H3h4 V 4 ~ D 4f 4 6 R0 ID8 24 D8 D8d ` u d `X k 4 X@U0` r0... Date Added: 2009-04-26 08:01:57 |
| 2008514_f01k_0800388.pdf Path: Stanford >> DRI >> 1039 Fall, 2009 Description: US District Court Civil Docket as of 07/01/2008 Retrieved from the court on Monday, July 07, 2008 U.S. District Court Middle District of Florida (Orlando) CIVIL DOCKET FOR CASE #: 6:08-cv-00388-PCF-DAB Plumbers and Pipefitters Local 51 Pension Fund ... Date Added: 2009-04-26 08:02:09 |
| adapt1.pdf Path: Stanford >> EE >> 359 Fall, 2009 Description: ... Date Added: 2009-04-26 08:05:48 |
| 2002118_r01b_013624.pdf Path: Stanford >> ENE >> 1020 Fall, 2009 Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF TEXAS HOUSTON DIVISION MARK NEWBY, et al., Individually and On Behalf of All Others Similarly Situated, Plaintiffs, vs. ENRON CORP., et al., Defendants. Civil Action No. H-01-3624 (Consolidated) C... Date Added: 2009-04-26 08:06:20 |
| 20051028_r11x_032522.pdf Path: Stanford >> CNO >> 1028 Fall, 2009 Description: EXHIBIT J `ar Contact us 15tte yea-c r News and Earning s May 3, 1999 CornerStone Propane Partners , L.P . Reports 46% Increase in EBITDA For Third Quarter of Fiscal 1999 Corn erStone Propane Ronald J . Goedde, EVP/CFO (831) 724-192 1 Watsonvill... Date Added: 2009-04-26 08:06:45 |
| 20020910_f01c_Herman.pdf Path: Stanford >> HRC >> 1008 Fall, 2009 Description: ... Date Added: 2009-04-26 08:08:33 |
| G02.282.043.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >G02.282.043 Chr02 contig 282 bases 396990.397561 ACAGGGCTAATTTACGTACTCAAAAGAGACTTGCCGCTTCTGTCGTCGGT GTCGGTAAGAGAAAGGTTTGGTTAGATCCAAATGAAACCTCTGAAATTGC TCAAGCCAACTCCAGAAACGCCATTAGAAAATTGGTTAAGAACGGTACCA TCGTAAAGAAGGCCGTTACCGTCCACTCTAAATCCAGAACCAGAGC... Date Added: 2009-04-26 08:09:37 |
| topic2-fractals.pdf Path: N.C. State >> HON >> 292 Fall, 2009 Description: Topic 2: Fractals Date Tues Sep 23 Thurs Sep 25 Question(s) What is a fractal? What are the Julia and Mandelbrot sets and what role did they play in the development of the field? Reading Chapter 5, The Self-Made Tapestry, through p. 120 Readings from... Date Added: 2009-04-26 08:10:25 |
| ProgrammingAbstractions-Lecture20.pdf Path: Stanford >> ICSPACS >> 106 Fall, 2009 Description: ProgrammingAbstractions-Lecture21 Instructor (Julie Zelenski):Hey there! Oh, were back. Were back and now were getting down and dirty. Well do more pointers, and link list, and implementations. Its actually going to be like our life for the next week... Date Added: 2009-04-26 08:11:06 |
| KW_Ch03-04.pdf Path: Nevada >> ECON >> 102 Fall, 2008 Description: Chapters 3 and 4 Supply and Demand and The Market Strikes Back Supply and Demand A competitive market is a market in which there are: many buyers and sellers of the same good or service (homogeneous product) with perfect information to make the be... Date Added: 2009-04-26 08:12:43 |
| Halbig_2.doc Path: University of Illinois, Urbana Champaign >> ENGL >> 109 Fall, 2008 Description: Stephanie Halbig English 109 Section D2 Hemmingway Essay Existing Life without consequence; is this possible? This was the main goal of the men and women existing after WW1. During this era of great prosperity and moral backlash the young adults of... Date Added: 2009-04-26 08:16:05 |
| 2004920_f01x_033125.pdf Path: Stanford >> MRK >> 1029 Fall, 2009 Description: Case 2:03-cv-03125-KDE-JCW Document 43 Filed 09/20/2004 Page 1 of 5 COUR T l cr,}i u^ST tl0i O LA 2M SEP 20 FM 4:42 LORE a -iA G. WHYTE CLERK UNITED STATES DISTRICT COURT EASTERN DISTRICT OF LOUISIANA FRANK PRINGLE CASE NO. 03-3125 VERSUS M... Date Added: 2009-04-26 08:16:12 |
| Nica\'sDream.pdf Path: Los Angeles Southwest College >> MUSC >> 216 Fall, 2009 Description: BAIN MUSC 216 Theory of Twentieth-Century Music ANALYSIS Silver Nicas Dream Fill in the blanks. A. Key Use key symbols and roman numerals as appropriate. 1. 2. Nicas Dream is in the key of _: In mm. 9-12, the ii7-V7-IM7 progression implies the key o... Date Added: 2009-04-26 08:16:25 |
| reflist.doc Path: Youngstown >> CHEM >> 969 Fall, 2009 Description: Spectroscopic and Structure Determination Methods Texts and References Dr. Allen D. Hunter, Department of Chemistry March 31st, 1997 I. General References on NMR Spectroscopy, Books 1. J. K. M. Sanders and B. K. Hunter, Modern NMR Spectroscopy: A Gu... Date Added: 2009-04-26 08:16:27 |
| reflist.doc Path: Youngstown >> CHEM >> 822 Fall, 2009 Description: Spectroscopic and Structure Determination Methods Texts and References Dr. Allen D. Hunter, Department of Chemistry March 31st, 1997 I. General References on NMR Spectroscopy, Books 1. J. K. M. Sanders and B. K. Hunter, Modern NMR Spectroscopy: A Gu... Date Added: 2009-04-26 08:16:27 |
| Fall2006Exam2.pdf Path: Los Angeles Southwest College >> STAT >> 205 Fall, 2009 Description: STAT 205 Fall 2006 Exam 2 Name:_ P{Y = j} = nCj pj (1 p)n-j Y - Z= n Y t s 2 n t= Y - s n (Y1 - Y2 ) t 2 2 s12 s 2 + n1 n2 t= (Y1 - Y2 ) - 0 2 s12 s 2 + n1 n2 Part I: Answer eight of the following nine questions. If you complete mo... Date Added: 2009-04-26 08:16:43 |
| hw10.pdf Path: Wisconsin >> ECE >> 431 Fall, 2008 Description: ECE 431 Digital Signal Processing Homework 10 Due Friday, December 1, 2006 1. A discrete-time filter is described by the pole/zero plot below. Im(z) pole @ (-2/3,0) zeros @ (0,0) and (1,0) ROC: |z| > 2/3 x o o Re(z) a. Find the z-transform and d... Date Added: 2009-04-26 08:17:58 |
| CS2420_s08_13f.pdf Path: Utah State >> CS >> 2420 Fall, 2008 Description: CS2420: Lecture 13 Vladimir Kulyukin Computer Science Department Utah State University Outline Trees (Chapter 4) Sorting Algorithms (Chapter 7) Trees: Terminology A tree is a set of nodes and a set of directed edges. A rooted tree has the follo... Date Added: 2009-04-26 08:18:31 |
| ch03.ppt Path: Portland >> CH >> 511 Fall, 2008 Description: 3-1 Chapter 3 - Income Statement: Reporting the Results of Operating Activities FINANCIAL ACCOUNTING AN INTRODUCTION TO CONCEPTS, METHODS, AND USES 10th Edition Clyde P. Stickney and Roman L. Weil 3-2 Learning Objectives 1. Understand the accrual... Date Added: 2009-04-26 08:19:10 |
| 3.pdf Path: Pittsburgh >> IS >> 2420 Fall, 2009 Description: SYNTAX CONTEXT-FREE GRAMMARS FOR ENGLISH SYNTAX Descriptive vs. Normative Applications: Most NLP applications Machine Translation Q/A Information extraction/summarization Grammar checking CONSTITUENCY constituent (e.g., NP) behaves as a unit (discove... Date Added: 2009-04-26 08:19:24 |
| STA2502-PS3.pdf Path: Toledo >> STA >> 2502 Fall, 2009 Description: ACT 460 / STA 2502 Stochastic Methods for Actuarial Science - Problem Set #3 due Tuesday, Dec 2 at 2pm. Hand in only questions marked with *. Grad students also hand in questions marked with + 1. Consider each of the following options: (a) digital ca... Date Added: 2009-04-26 08:20:37 |
| DrillCalipersVs.DepthbyPressure-TwoDays-current.pdf Path: Wisconsin >> MEDIA >> 0122 Fall, 2009 Description: Drill Calipers Vs. Depth by Pressure From 1/19/2008 9:49:59 to 1/22/2008 9:49:59 1 Calipers 0.8 Caliper (m) 0.6 0.4 0.2 0 -50 0 50 100 150 Depth (m) 200 250 300 350 IceCube ehwd plot, Tue Jan 22 10:03 2008 ... Date Added: 2009-04-26 08:21:19 |
| Log05.txt Path: Virginia Tech >> CS >> 2604 Fall, 2000 Description: GIS Indexer II by Bill McQuain GIS file: Bath.txt Script file: Script05.txt Time: Sun Nov 27 13:49:48 2005 - Beginning construction of initial indices. Begin parsing of GIS record file Added 516 GIS records to location index Added 5... Date Added: 2009-04-26 08:23:57 |
| heather_barrett_fall06_midterm2.pdf Path: Purdue >> ECE >> 301 Fall, 2008 Description: ... Date Added: 2009-04-26 08:24:28 |
| User_Guide.pdf Path: University of Hawaii - Hilo >> DOCUMENT >> 139 Fall, 2009 Description: User Guide Release 4.0.1 Publication date: January 2005 Copyright 2005 Xerox Corporation. All Rights Reserved. Xerox , The Document Company, the digital X and DocuShare are trademarks of Xerox Corporation. All other signs or marks are the propertie... Date Added: 2009-04-26 08:26:28 |
| 00000020.pdf Path: Carnegie Mellon >> TERA >> 05102519 Fall, 2009 Description: ... Date Added: 2009-04-26 08:26:40 |
| kidneylecture07.ppt Path: Washington >> HUBIO >> 511 Fall, 2008 Description: TheUrogenitalSystem Themes. - Close relationship of urinary and genital development - Differentiation of urogenital system requires epithelial-mesenchymal interactions Intermediate mesoderm U G U = Urinary ridge G = Gonadal ridge UR Coelom = per... Date Added: 2009-04-26 08:27:44 |
| f99.h3.pdf Path: Michigan >> EECS >> 577 Fall, 2009 Description: EECS 577 Fall 1999 John P. Hayes EECS 577 Fall 1999 Homework Assignment No. 3 Instructions: See Homework Assignment No. 1. > Distribution Date: Tuesday, Nov. 2, 1999. Due Date: Tuesday, Nov. 9, 1999 < This assignment covers material from Chapters 5... Date Added: 2009-04-26 08:32:09 |
| M101t1bw09sol.pdf Path: UMBC >> MATH >> 101 Fall, 2009 Description: ... Date Added: 2009-04-26 08:33:27 |
| M101t1aw09sol.pdf Path: UMBC >> MATH >> 101 Fall, 2009 Description: ... Date Added: 2009-04-26 08:33:27 |
| Lecture 21 - CHEM361.pdf Path: St. Francis IL >> CHEM >> 361 Fall, 2009 Description: Spectral interferences Fix spectral interferences how to distinguish between signal and background? Absorption, emission or matrix dispersion The atomization system (flame/plasma/furnace) Common approaches for interference correction: B... Date Added: 2009-04-26 08:34:13 |
| Math 347 Combinatorics Project.doc Path: St. Francis IL >> MATH >> 347 Fall, 2009 Description: Math 347 Combinatorics Project You\'re project for this term will consist of three phases. Phase one is an individual research project in which you explore the CMS (Canadian Mathematical Society) and AMS (American Mathematical Society) websites. Phase... Date Added: 2009-04-26 08:34:37 |
| stat100_2002-3.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 100 Fall, 2009 Description: STATISTICS 100-3 CHANCE AND DATA ANALYSIS Fall 2002 DAY COURSE STATISTICS WORKSHOP Instructor: DR. L. WELDON Lab Instructor: R. INSLEY Prerequisite: None Textbook: Statistics A Guide To The Unknown, 3rd edition, by Tanur, Mosteller, Kruskal, et al., ... Date Added: 2009-04-26 08:36:11 |
| stat602_2006-1.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 602 Fall, 2009 Description: STATISTICS 602-3 GENERALIZED LINEAR AND NONLINEAR MODELLING Spring 2006 DAY COURSE Students requiring accommodations as a result of disability, must contact the Centre for Students with Disabilities604-291-3112 or csdo@sfu.ca Instructor: Dr. R. Altm... Date Added: 2009-04-26 08:36:27 |
| crim101NOWkr1087.pdf Path: Sveriges lantbruksuniversitet >> CRIM >> 101 Fall, 2009 Description: CRIMINOLOGY 101-3 SFU NOW FALL SEMESTER 2008 INTRODUCTION TO CRIMINOLOGY INSTRUCTOR: KATE ROSSITER CALENDAR DESCRIPTION: Topics will include: examination of different terms and concepts commonly used in criminology, such as crime, delinquency, dev... Date Added: 2009-04-26 08:37:11 |
| t03.xls Path: Sveriges lantbruksuniversitet >> GRAD >> 0974 Fall, 2009 Description: TABLE 3 SIMON FRASER UNIVERSITY GRADUATE HEADCOUNT BY PROGRAM AND DEPARTMENT, SUMMER 1997 Masters Faculty/Department FT PT OL Applied Sciences 181 11 30 Communication 15 6 13 Computing Science 45 6 Engineering Science (MASc) 42 4 Kinesiology 25 2 Re... Date Added: 2009-04-26 08:37:28 |
| BCH371 08W January exam.pdf Path: Toledo >> BCH >> 371 Fall, 2009 Description: UNIVERSITY OF TORONTO BIOCHEMISTRY 371H FIRST TERM TEST THURSDAY, JANUARY 8TH, 2009 There are 9 questions and 19 pages (including this page). There are a total of 85 marks. Show your work. Part marks will be given for partially correct answers. Non-... Date Added: 2009-04-26 08:37:52 |
| Baranowska_2 parasties with 1 hostMANIP.pdf Path: Toledo >> BIO >> 406 Fall, 2009 Description: ANIMAL BEHAVIOUR, 2007, 74, 1311e1317 doi:10.1016/j.anbehav.2007.02.027 Differential influence of two acanthocephalan parasites on the antipredator behaviour of their common intermediate host N IC O L AS KA L DON SK I, MA R IE- J E AN NE PE R R O T... Date Added: 2009-04-26 08:39:00 |
| ingenta96.pdf Path: Allan Hancock College >> PDF >> 93 Fall, 2009 Description: 26215656-2652 chshih@mail.tku.edu.tw 2007-10/31.11/1 @TKU Library 2 . email RSS (Reader) Alert SDI(Selective Dissemination of Information) CCS(Current Contents Service) RSS(Really Simple Syndication) 3 News ... Date Added: 2009-04-26 08:40:06 |
| IEL.pdf Path: Allan Hancock College >> PDF >> 93 Fall, 2009 Description: IEL IEL Electronic Library (IEEE/IET) IEEE IEEE (Institute of Electrical and Electronic Engineers) IET(IEE) (Institution of Engineering and Technology) : 3C IEEE IEEEIET 250,000 Journals, Magazines, Transactions (,) 750,000 conferenc... Date Added: 2009-04-26 08:40:08 |
| pyildiz.pdf Path: Allan Hancock College >> VIII >> 8 Fall, 2009 Description: TELEV ZYON STDYOLARINDA HAZIRLANAN PROGRAMLARIN ZAMAN VE MEKN ENTEGRASYONU VE TRK YEDEN B R STDYO TV-8 RNE YLE ANAL Z ALIMASI The Integration of Time and Space in the Programs Made by Television Studios and the Analysis of \'TV-8\' Studio as a Sample i... Date Added: 2009-04-26 08:40:34 |
| set8.pdf Path: Washington >> B >> 571 Fall, 2009 Description: 2009 Jon Wakefield, Stat/Biostat 571 CHAPTER 14: MISSING DATA A serious problem in data analysis is the existence of missing data. We concentrate on missing responses in a dependent data situation. Implications of missing data: 1. Data are unbalance... Date Added: 2009-04-26 08:41:45 |
| selection5.txt Path: Cornell >> CS >> 100 Fall, 2008 Description: public class selection5 { public static void main(String[] args) { / Syntax 5: / many $else if$s / if (c1) / s1; / else if (c2) / s2; / else if (c3) / s2; / else if (c3) / s3; / and so forth / can als... Date Added: 2009-04-26 08:43:51 |
| problem_4189.pdf Path: Wisconsin >> ME >> 363 Fall, 2008 Description: Problem 4.189 ... Date Added: 2009-04-26 08:44:36 |
| 13.pdf Path: Colorado >> AMATH >> 5600 Fall, 2009 Description: ... Date Added: 2009-04-26 08:44:53 |
| pub3095ReniformNematodeHIGHRES.pdf Path: LSU >> NR >> 51961 Fall, 2009 Description: Reniform Nematode in Louisiana Rotylenchulus reniformis Linford & Oliveira During the past two decades, the reniform nematode (Rotylenchulus reniformis) has emerged as one of the most important nematode species of plant crops in Louisiana. It attacks... Date Added: 2009-04-26 08:46:20 |
| 2006_Winter_Board_Meeting_Lockett_Hall1.pdf Path: LSU >> NR >> 39479 Fall, 2009 Description: LCAAA Winter Board Meeting December 18, 2006 Lockett Hall Room B6 8:30AM 1. Welcome/Call to order R.L. Frazier 2. Minutes Brian Chandler 3. Treasurer\'s Report Keith Normand 4. Awards Report a. 2007 DSA & AA - Eddie Eskew b. 2006 Search for Excelle... Date Added: 2009-04-26 08:46:21 |
| Kanwisher2003.pdf Path: Sanford-Brown Institute >> CG >> 195 Fall, 2009 Description: Chalupa, L. & Werner, J. (2003). The Visual Neurosciences. Cambridge, MA: MIT Press. ... Date Added: 2009-04-26 08:48:43 |
| geen136011.pdf Path: Colorado >> GEEN >> 1360 Fall, 2008 Description: b } q 3 3p #i #$RW3`Xc%#a%#$pIa$YTEe#2p2WEV0!t# 2 x#r4%ar5!7ml$ p # # p 3 # E # \" X # # 3 f p W E 3 # 5 3 X 3 T # \"& # ... Date Added: 2009-04-26 08:49:42 |
| 26-Kagan-Kristol-Right-War.pdf Path: Oakland University >> POLS >> 53002 Fall, 2009 Description: The Right War for the Right Reasons The liberation of Iraq was abundantly justified. BY ROBERT KAGAN & WILLIAM KRISTOL here we disagree with what Paul Wolfowitz said to Vanity Fair a few months ago-liberating the Iraqi people from Saddam\'s brutal, to... Date Added: 2009-04-26 08:49:48 |
| cs457_8_4.pdf Path: UWO >> CS >> 546 Fall, 2009 Description: Chapter 2 roadmap 2.1 What is network security? 2.2 Principles of cryptography 2.3 Authentication 2.4 Integrity 2.5 Key distribution and certification 2.6 Firewalls and IDS 2.7 Attacks and counter measures 2.8 Security in many layers CS457/546a 1 Cr... Date Added: 2009-04-26 09:06:29 |
| tut_5.pdf Path: Allan Hancock College >> ICS >> 130 Fall, 2009 Description: MATH130 Semester 1 2008 Tutorial Exercises Week 5 There are more tutorial exercises here than your tutor is likely to be able to do during the tutorial class. The idea is for you to practise by doing several examples of each type of exercise. You sh... Date Added: 2009-04-26 09:06:39 |
| week9lect.pdf Path: Allan Hancock College >> ICS >> 123 Fall, 2009 Description: More about progressions Arithmetic progressions are lists of numbers in which the dierence between consecutive terms is the same all along the list. Geometric Progessions are lists of numbers in which the ratio of consecutive terms is the same all... Date Added: 2009-04-26 09:06:40 |
| Specifications.pdf Path: Penn State >> MHS >> 5019 Fall, 2009 Description: SECTION 03 21 00 Reinforcing Bar Support PART 1 GENERAL 1.01 RELATED WORK SPECIFIED ELSEWHERE A. B. C. Concrete Formwork: Section 03100. Cast-In-Place Concrete: Section 03300. Fibrous Reinforcement: Section 03240. 1.02 REFERENCES A. Except as shown ... Date Added: 2009-04-26 09:06:58 |
| Specifications.pdf Path: Penn State >> RGJ >> 5003 Fall, 2009 Description: SECTION 03 21 00 Reinforcing Bar Support PART 1 GENERAL 1.01 RELATED WORK SPECIFIED ELSEWHERE A. B. C. Concrete Formwork: Section 03100. Cast-In-Place Concrete: Section 03300. Fibrous Reinforcement: Section 03240. 1.02 REFERENCES A. Except as shown ... Date Added: 2009-04-26 09:09:54 |
| info.doc Path: East Los Angeles College >> LEC >> 21211 Fall, 2009 Description: DIABETES MELLITUS AND RAMADAN FASTING Shahid Athar, MD, FACP, FACE Diabetes Mellitus affects people of all faiths. Muslims are no exception. Many diabetic Muslims have a desire to... Date Added: 2009-04-26 09:10:31 |
| 08.11.20.CozCh.11.ppt.pdf Path: UH Clear Lake >> PSYC >> 4731 Spring, 2008 Description: 11/20/08 ProgramEvalua1on) December4th Methodsdue Homework#6due Readchapter3andCPHSapplica1on hUp:/prt... Date Added: 2009-04-26 09:29:47 |
| HW4Solution.pdf Path: Berkeley >> EE >> 105 Fall, 2009 Description: EE105 HOMEWORK2 SOLUTION Spring 2006 1. SOLUTIONS: a) N 3.3 1017 = Vth ln d = 0.026 ln = 0.45V n ni 1 1010 p + = 0.55V VFB = b) Cox = ox ( p+ n ) = 1V Tox = 3.9 8.85 10 34.5 10 7 2 n 14 = 1 10 7 F / cm 2 n VTn = VFB 2q si N d ( 2 Cox 2 1.6... Date Added: 2009-04-26 09:39:15 |
| CFFinFinFin.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 0847 Fall, 2009 Description: On the relation of Voevodskys algebraic cobordism to Quillens K-theory I. Panin K. Pimenov June 1, 2007 O. Rndigs o Abstract Quillens algebraic K-theory is reconstructed via Voevodskys algebraic cobordism. More precisely, for a ground eld k the alge... Date Added: 2009-04-26 09:48:23 |
| 578hw6.pdf Path: ASU >> MAT >> 578 Fall, 2009 Description: ... Date Added: 2009-04-26 09:51:11 |
| 00000088.pdf Path: Carnegie Mellon >> TERA >> 05102480 Fall, 2009 Description: ... Date Added: 2009-04-26 09:52:06 |
| lecture12a.pdf Path: Colorado State >> CS >> 553 Fall, 2008 Description: Interprocedural Analysis Last time Alias analysis Today Interprocedural analysis CS553 Lecture Interprocedural Analysis 2 Using Alias Information Example: reaching definitions Compute at each point in the program a set of (s,v) pairs, indicati... Date Added: 2009-04-26 09:56:18 |
| chistyakov.pdf Path: Stanford >> C >> 0405241 Fall, 2009 Description: Photon splitting in a strongly magnetized plasma M. V. Chistyakov, D. A. Rumyantsev Division of Theoretical Physics, Yaroslavl State (P.G. Demidov) University, Sovietskaya 14, 150000 Yaroslavl, Russian Federation E-mail: mch@uniyar.ac.ru, rda@uniyar.... Date Added: 2009-04-26 09:57:16 |
| 2004423_o01c_0402848.pdf Path: Stanford >> SCON >> 1030 Fall, 2009 Description: UNITED STATES DISTRICT COURT CENTRAL DISTRICT OF CALIFORNIA SANDY GOLDFINE, Individually and On Behalf of All Others Similarly Situated, ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) Case No.: Plaintiff, vs. SUPERCONDUCTOR TECHNOLOGIES INC.,... Date Added: 2009-04-26 09:58:09 |
| p131.pdf Path: N.C. State >> P >> 121 Fall, 2009 Description: ... Date Added: 2009-04-26 10:00:49 |
| CharacteristicFunction.pdf Path: N.C. State >> ST >> 779 Fall, 2008 Description: Charactersitic Function In studying (probability) measures (on R, say), often it is helpful to study a family of integrals defined by K(x, t)dP (x), t T (some index set), known as an integral transformation, K(x, t) is known as the kernel. Examples:... Date Added: 2009-04-26 10:01:39 |
| or705_ch4.pdf Path: N.C. State >> OR >> 705 Fall, 2008 Description: # LP with Innitely Many Constraints [ 1 ] Anderson E.J./Nash P. Linear Programming in Innite-Dimensional Spaces Wiley, Chichester, 1987. [ 2 ] Hettich R./Kortanek K.O. Semi-innite Programming: Theory, Methods, and Applications SIAM Review, V. 35, 38... Date Added: 2009-04-26 10:04:13 |
| syllabus.pdf Path: N.C. State >> MEA >> 712 Fall, 2008 Description: MEA 712: (An Introduction to) Mesoscale Atmospheric Modeling Fall Semester 2007 Final syllabus (revised 12/04/07): week 1 2 3 4 5 6 7 dates 8/23 8/28, 8/30 9/4, 9/6 9/11, 9/13 9/18, 9/20 9/25, 9/27 10/2, 10/4 topics Intro to models; basis of forecast... Date Added: 2009-04-26 10:04:43 |
| M030353-00.pdf Path: Caltech >> M >> 030353 Fall, 2009 Description: LIGO-M030353-00-M Attachment Number Z to the (LIGO-M97007 -00-M) 7 Memorandumof Understanding between German/British Collaboration for the Detectionof Gravitational Waves (GEO 600) and the Laser InterferometerGravitationalWave Observatory(LIGO) Augu... Date Added: 2009-04-26 10:06:10 |
| 2006127_o01c_Hoerr.pdf Path: Stanford >> AMKR >> 1035 Fall, 2009 Description: UNITED STATES DISTRICT COURT EASTERN DISTRICT OF PENNSYLVANI A BRUCE HOERR, Individually and On Behalf of All Others Similarly Situated, Plaintiff, vs . CIVIL ACTION NO . CLASS ACTION COMPLAIN T AMKOR TECHNOLOGY INC ., JAMES J KIM, KENNETH T . JO... Date Added: 2009-04-26 10:08:31 |
| 20081224_r01k_0801041.pdf Path: Stanford >> ZMH >> 1040 Fall, 2009 Description: US District Court Civil Docket as of 12/24/2008 Retrieved from the court on Tuesday, January 06, 2009 U.S. District Court Southern District of Indiana (Indianapolis) CIVIL DOCKET FOR CASE #: 1:08-cv-01041-DFH-JMS PLUMBERS AND PIPEFITTERS LOCAL UNION... Date Added: 2009-04-26 10:12:40 |
| 051116%20ece638%20lecture.pdf Path: Purdue >> ECE >> 638 Fall, 2008 Description: ... Date Added: 2009-04-26 10:15:23 |
| myoung.pdf Path: Washington University in St. Louis >> BIO >> 4342 Fall, 2008 Description: Myoung 1 The annotation of Drosophila littoralis fosmid, XAAA122 Jenny Myoung Washington University Bio4031: Research Explorations in Genetics May 5, 2004 Myoung 2 I. Overview The annotation of a 41 kilobase portion of the Drosophila littoralis g... Date Added: 2009-04-26 10:15:55 |
| 200768_r03o_043364.pdf Path: Stanford >> NTPA >> 1032 Fall, 2009 Description: I Case 5 :04-cv-03364- RMW 5:04-cv-03364-RMW Document 182 Document 179 Filed 06/08/2007 Filed 05/3112007 Page 1 of 8 Page 1 of 8 I 2 3 4 Michael D. Braun (167416) BRAUN LAW GROUP, P.C. 12400 Wilshire Blvd., Suite 920 Los Angeles, CA 90025 (314... Date Added: 2009-04-26 10:18:07 |
| 46.2.peterson.pdf Path: Johns Hopkins >> V >> 046 Fall, 2009 Description: Enlightenment and Freedom Jonathan PEtErson* freedom is the central concept of liberal political theory. For most contemporary political philosophers, the concept of enlightenment does not play a central role. nevertheless, I want to claim in this p... Date Added: 2009-04-26 10:21:59 |
| sug_ex_1.pdf Path: UF >> EML >> 4312 Spring, 2008 Description: EML 4312 Spring 2009 Control of Mechanical engineering systems University of Florida Mechanical and Aerospace Engineering Suggested exercises for midterm 1 Issued: February 11, 2009 Chance favors the prepared mind. - Louis Pasteur Problem 1. Are t... Date Added: 2009-04-26 10:22:32 |
| Quiz9.pdf Path: UF >> PHY >> 4523 Fall, 2009 Description: Imagine our current universe as a sphere of radius 1026 m. The temperatures associated with the thermally excited photons in our universe is presently about 3 K. Estimate the radius of the universe when the temperature of the photon (cosmic) backgrou... Date Added: 2009-04-26 10:22:52 |
| potab3.pdf Path: Oregon State >> SR >> 1049 Fall, 2009 Description: 2002 Annual Report Table 3. Tuber yield by grade for potato entries in the Oregon Statewide Trial, Klamath Falls, OR, 2002. Variety or selection 4-8 oz Yield U.S. No. 1s 8-12 oz >12 oz total cwt/acre Russet Burbank Ranger Russet Shepody Russet Norkot... Date Added: 2009-04-26 10:23:07 |
| PetrovicSPAWC2005.pdf Path: Berkeley >> EECS >> 219 Fall, 2008 Description: Coding for Sensor Networks Using Untuned Radios Dragan Petrovi, Kannan Ramchandran, Jan Rabaey {dragan, kannanr, jan}@eecs.Berkeley.edu Department of Electrical Engineering and Computer Sciences University of California, Berkeley Abstract The drive t... Date Added: 2009-04-26 10:24:37 |
| syllabus.pdf Path: Iowa State >> SPCOM >> 322 Fall, 2009 Description: SP CM 322: ARGUMENTATION, CRITICAL THINKING & DEBATE Fall, 2007 Jean Goodwin goodwin@iastate.edu 223 Ross Hall, Mon 1:10-3:00, Tues 10:00-10:50 GOALS: This class promises to make you a skilled arguer when debating issues of public importance. In pa... Date Added: 2009-04-26 10:25:39 |
| syl212.pdf Path: Berkeley >> MBA >> 212 Fall, 2009 Description: BA212 Energy and Environmental Markets The University of California at Berkeley Haas School of Business Professors Severin Borenstein & James Bushnell Spring 2008 Syllabus Course Description: In the past 30 years, some of the largest industries have... Date Added: 2009-04-26 10:27:57 |
| RR80-16.pdf Path: NYU >> ECON >> 9403 Fall, 2009 Description: ... Date Added: 2009-04-26 10:28:02 |
| 03-27-07.ppt Path: UMass (Amherst) >> RESEC >> 453 Fall, 2009 Description: Public Policy in Private Markets Merger Policy III Announcements Cases 6 and 7 on Tue, 4/1 No class on 4/3 Horizontal Merger Guidelines 1. Market Definition Emphasis on cross price elasticity (also looks at other factors) Do 2 products belon... Date Added: 2009-04-26 10:30:25 |
| 100syllabus_s05.pdf Path: University of Hawaii - Hilo >> MATH >> 100 Fall, 2008 Description: Math 100 Survey of Mathematics Spring 2005 Syllabus PLEASE READ THIS DOCUMENT CAREFULLY. IT SETS OUT THE POLICIES BY WHICH THIS COURSE WILL BE RUN, AND ALL STUDENTS WILL BE ASSUMED TO HAVE READ AND AGREED TO THEM. 1 Professor and contact informat... Date Added: 2009-04-26 10:31:27 |
| ANS14F06.pdf Path: Wisconsin >> MATH >> 221 Fall, 1992 Description: MATH 221: Calculus and Analytic Geometry Prof. Ram, Fall 2006 HOMEWORK 14: SELECTED ANSWERS Problem A. Derivatives with all functions mixed together. (1) 2(sec x + tan x sin x) dy = . dx (tan x + cos x)3 dy x cos x sin x . = dx 2 x sin x dy cos 3x(... Date Added: 2009-04-26 10:35:19 |
| quiz2.pdf Path: Wisconsin >> STAT >> 771 Fall, 2009 Description: STAT 771 Quiz 2 Record all answers in the blue books. Show your work. Newton: 31109. 1. Consider a generic missing data problem in which data X and missing data Z have a joint probability density function, p(x, z|), determined by a parameter . Let ... Date Added: 2009-04-26 10:35:41 |
| Lab_Notes_2.pdf Path: Colorado State >> ECE >> 312 Fall, 2008 Description: SIGNALS AND SYSTEMS LABORATORY 2: Sampling and Reconstruction of Continuous Signals in MATLAB/SIMULINK Introduction Continuous signals are often sampled to obtain discrete-time values, which can be represented digitally for computer processing or tra... Date Added: 2009-04-26 10:38:03 |
| CH09.pdf Path: Colorado State >> AT >> 606 Fall, 2009 Description: Contents 9 The Atmospheric Boundary Layer 9.1 Turbulence . . . . . . . . . . . . . . . . . . . . . . . . . 9.1.1 Eddies and thermals . . . . . . . . . . . . . . . . 9.1.2 Statistical description of turbulence . . . . . . . 9.1.3 Turbulence kinetic en... Date Added: 2009-04-26 10:38:33 |
| StatLab1_Soln.doc Path: Colorado State >> EY >> 680 Fall, 2009 Description: EY680 SOLUTIONS: Birth-and-Death Processes March 21, 2006 Task 1. Poisson process. Nothing to do here but run the code. Task 2. Yule-Furry process. Easy modification of the Poisson process code: need to change the birth parameter to lambda*X[i-1] ... Date Added: 2009-04-26 10:38:44 |
| lec04_4.pdf Path: Allan Hancock College >> COMP >> 2400 Fall, 2009 Description: Assignment 1 available via the COMP2400 Home Page COMP2400-2004-05 Assignment 1 : SQL Queries Q10 : Students who have received CR, D, or HD in COMP1100 Using IN (set membership) Q11 : Students enrolled in COMP2400 Alternative anwer to Q4 using subqu... Date Added: 2009-04-26 10:39:44 |
| week06c_slides.pdf Path: Washington >> MAT >> 084 Fall, 2009 Description: Chapter 3: Problem Solving MAT 084 Week 6: 3rd Lecture More Problem Solving: Mixtures & Distance 3.1 Further Problem Solving (#2) Mixtures (Type 2) Example #4 (GW 1a) (w/o animation) Example #4 (GW 1a) Int. Principal Rate = 1st acct. x 7% (w/o ... Date Added: 2009-04-26 10:41:25 |
| ueet601_questions.doc Path: N. Illinois >> UEET >> 601 Fall, 2009 Description: UEET 601 Emerging Technology Final Homeland Security 1. Which of the following organizations should develop and implement an effective Disaster Preparedness Plan? a. Local governments b. Hospitals c. Educational institutions d. Manufacturing Compani... Date Added: 2009-04-26 10:42:36 |
| L2.txt Path: Wisconsin Milwaukee >> CS >> 243 Fall, 2009 Description: CS243, Spring 2009, Lecture 4, 5 and 6 ATTENTION: o IN THESE NOTES BECAUSE OF LIMITED CAPABILITIES OF ASCII CHARACTERS WE USE SYMBOLS THAT ARE DIFFERENT FROM THOSE WE DEFINED IN THE CLASS. o MAKE SURE THAT YOU UNDERSTAND THE MEANING OF THOSE ... Date Added: 2009-04-26 10:44:57 |
| direct.pdf Path: Kentucky >> PR >> 432 Fall, 2009 Description: DIRECTORY Barnhisel, Richard Professor of Agronomy and Geology (859) 257-8627 E-mail: RBARNHIS@CA.UKY.EDU Surface mine reclamation, waste utilization, and clay mineralogy Barrett, Michael Professor and Chair (859) 257-5843 E-mail: MBARRETT@CA.UKY.ED... Date Added: 2009-04-26 10:46:09 |
| Project2.pdf Path: UMass (Amherst) >> FIN >> 304 Fall, 2009 Description: Sanjay Nawalkha SOM 310B Information Technology in Finance FINOPMGT 304b Fall 2009 Project 2 Topic: Portfolio Model Analysis Due Date: March 26 Project Description This project focuses on understanding relative risk and return of stocks, portfolio ... Date Added: 2009-04-26 10:50:24 |
| ICS110SyllabusSpring2009.pdf Path: University of Hawaii - Hilo >> ICS >> 110 Fall, 2009 Description: ICS 110 Introduction to Programming through 3D Animations TR 10h30am to 11h45am POST 319 Instructor : Prof. Guylaine Poisson POST 310B Class website: http:/navet.ics.hawaii.edu/~poisson/ICS110/index.html This course provides an introduction to progra... Date Added: 2009-04-26 10:54:06 |
| lab6_dac_quiz_A_solution.pdf Path: Ohio State >> ECE >> 327 Winter, 2008 Description: Name: Instructor Table number: Solution ECE 327: Electronic Devices and Circuits Laboratory I Lab 6: Digital-to-Analog Conversion Quiz A (10 points) Description. This quiz tests your understanding of digital-to-analog conversion (DAC) and demodula... Date Added: 2009-04-26 10:58:15 |
| zander_michael_MA_2008.pdf Path: Bowling Green >> ETD >> 07182008 Fall, 2009 Description: A COMPARATIVE STUDY OF THE ETHICS OF CHRISTINE M. KORSGAARD AND JEAN-PAUL SARTRE by MICHAEL C. ZANDER Under the Direction of Sebastian Rand ABSTRACT Christine M. Korsgaard and Jean-Paul Sartre both locate the source of ethical normativity in human r... Date Added: 2009-04-26 10:58:20 |
| caisob2008516.txt Path: Allan Hancock College >> CAISOB >> 2008516 Fall, 2009 Description: [Page Break] Crimes Amendment (Cognitive Impairment-Sexual Offences) Bill 2008 No , 2008 A Bill for An Act to amend the Crimes Act 1900 with respect to offences of a sexual nature committed against persons who have a cognitive impairmen... Date Added: 2009-04-26 11:01:38 |
| gpsaa1993351.txt Path: Allan Hancock College >> GPSAA >> 1993351 Fall, 2009 Description: GLADSTONE POWER STATION AGREEMENT ACT 1993 Reprinted as in force on 29 November 2004 Reprint No. 2 > Contents Part 1-Preliminary 1. Short title 2. Definitions Part 2-State agreement 3. Minister may make ... Date Added: 2009-04-26 11:02:22 |
| B516_Section1(a)(Bastress_et.al.)pp.76-108.pdf Path: Washington >> B >> 516 Fall, 2009 Description: ... Date Added: 2009-04-26 11:03:51 |
| 2007912_o01c_Brown.pdf Path: Stanford >> VCLK >> 1038 Fall, 2009 Description: SCOTT + SCOTT LLP Arthur L. Shingler III ( 181719 2 5455 Wilshire Blvd. Suite 18 0 0 Los Angeles, CA 9d036 3 Tel: 213/985-1274 Fax: 213/985-1278 4 Email : ashingler @scott-scott.com 1 Nicholas J. Licato (228402) 600 B Street Suite 1500 6 San Diego ,... Date Added: 2009-04-26 11:05:29 |
| 117_Lecture23.pdf Path: University of Illinois, Urbana Champaign >> GEO >> 117 Fall, 2009 Description: Coastal Issues: Problem with Beaches People like em Try to keep them Try to protect investments Problem: Ocean is more powerful than we are. Attempts to protect beaches from erosion usually cause problems! Expensive & Unsuccessful Hard stabi... Date Added: 2009-04-26 11:10:04 |
| 46.2.peterson.pdf Path: Allan Hancock College >> V >> 046 Fall, 2009 Description: Enlightenment and Freedom Jonathan PEtErson* freedom is the central concept of liberal political theory. For most contemporary political philosophers, the concept of enlightenment does not play a central role. nevertheless, I want to claim in this p... Date Added: 2009-04-26 11:11:13 |
| hw4sol.pdf Path: UCSD >> CSE >> 202 Winter, 1998 Description: CSE 202 Homework 4 Solutions Chris Calabro March 13, 2009 1 pg 653, problem 4 A b-hypergraph is a set of nodes and subsets of nodes, called hyperedges, each of size b. A normal graph is a 2-hypergraph. The weighted vertex cover problem is, given ... Date Added: 2009-04-26 11:11:43 |
| p3k_ob_hardware.pdf Path: Caltech >> PALM >> 3000 Fall, 2009 Description: Hardware PALM-3000 Jenny Roberts, Antonin Bouchez PALM-3000 Major components to reuse LODM Xinetics 349-actuator DM 4um stroke FSM Custom 8 mirror assembly with 3 PI actuators +/-3 arcsec of stroke OAPs 8 optics from SORL Stimulus... Date Added: 2009-04-26 11:12:20 |
| Williams_Desha_L_200708_PhD.pdf Path: Bowling Green >> ETD >> 12032007 Fall, 2009 Description: ACCEPTANCE This dissertation, STUDENT TEACHING IN AN URBAN CONTEXT: STUDENT TEACHERS VIEWS AND CONSTRUCTION OF IDENTITITIES, by DESHA L. WILLIAMS, was prepared under the direction of the candidates Dissertation Advisory Committee. It is accepted by t... Date Added: 2009-04-26 11:13:57 |
| Our_latest_vacancy.pdf Path: Allan Hancock College >> ITS >> 121033 Fall, 2009 Description: Accounts Payable CBD - Engineering Firm Temp to Perm Strong communication and computer skills Consider Accounting Graduate CALL US IF YOU\'RE INTERESTED Our valued Engineering client, one of Australia\'s largest and longest established companies is... Date Added: 2009-04-26 11:18:29 |
| mt2_rev.pdf Path: Colorado >> ASTR >> 1030 Fall, 2008 Description: ASTR1030, Accelerated Solar System Astronomy Midterm 2 Study Sheet I. PHYSICS 1. Energy and Power Energy Power = -Time Photons: hc E = - h = 6.626 10 34 J s 2. Types of light: Radio Waves are the same as light - the lowest frequency (longest w... Date Added: 2009-04-26 11:22:20 |
| Ch07.ppt Path: UMBC >> CS >> 471 Fall, 2004 Description: Logical Agents Chapter 7 1 A Knowledge-Based Agent A knowledge-based agent consists of a knowledge base (KB) and an inference engine (IE). A knowledge-base is a set of representations of what one knows about the world (objects and classes of obje... Date Added: 2009-04-26 11:23:43 |
| 13.pdf Path: Allan Hancock College >> LAW >> 1984 Fall, 2009 Description: Norwest Refrigeration Services v. Bain Dawes (W.A.) 63 64 F. NORWEST REFRIGERATZON SERVICES PTY LEVIITED V. BAIN DAwES (W.A.) PTY LXk\'IITED AND GERALDTON FISHEliahIAN\'S CO-OPEEATWE LI1\\IITED1 A decision of the High Corlrt of Australia, 2 October 19... Date Added: 2009-04-26 11:27:49 |
| chapter17.ppt Path: UF >> AST >> 1002 Fall, 2008 Description: A Universe of Galaxies Edwin Hubble (1889-1953) Hubble\'s Galaxy Classification Spiral Galaxies M51 M81 galaxies like the Milky Way with arcing structures lying in a plane and emanating from the nuclear bulge Lenticular Galaxies Galaxies that... Date Added: 2009-04-26 11:28:18 |
| Annotations2.pdf Path: Sveriges lantbruksuniversitet >> CS >> 760 Fall, 2009 Description: ui9P #u w sBd2XpYBH@Tt%# 3HG@YcCg2 G... Date Added: 2009-04-26 11:28:24 |
| Exam3_F05 Path: Texas >> EE >> EE302 Fall, 2006 Description: EE 302, Introduction to Electrical and Computer Engineering - Honors Dr. Archie Holmes, Jr. Exam #3 Name: _ EID: _ Please remember. Read the entire exam before starting All answers must include units and an appropriate number of significant figur... Date Added: 2009-04-26 11:29:31 |
| final.2006.pdf Path: Colorado State >> AT >> 540 Fall, 2009 Description: AT540 Daily Weather Laboratory I Final Exam NAME: _ 8 December 2006 Total Points: 100 Instructions: 1) 2) 3) 4) 5) Answer all the questions on the question paper Show ALL your working where applicable Include all units where applicable The back pa... Date Added: 2009-04-26 11:29:34 |
| resid1.pdf Path: UNC >> B >> 545 Fall, 2009 Description: 2 q q q q q 100 q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q q qq q q q q q qqq q q q q qq q q q q q q 1 q q q q q q q q q q q q qq q q q q q q q q q q q q q q q Residuals q qq q sigma*X 0 50 0 q qq -1 q q q q 0 ... Date Added: 2009-04-26 11:30:50 |
| 12-16-02agenda.doc Path: Rose-Hulman >> CS >> 414 Fall, 2009 Description: Software Engineering I, Team 8 Union Hospital Linear Accelerator Project Project Meeting, December 12, 2002 Agenda 1. 2. Review Agenda [1 min] Review and modify the agenda Discuss Current State of Project [4 min] What do we have now? What do ... Date Added: 2009-04-26 11:31:15 |
| land_r.ppt Path: Wayne State University >> WEEK >> 7800 Fall, 2009 Description: Introduction to Land Rent Land Rent and Fertility Fixed prices of inputs and outputs. Zero economic profit. Three types of land high fertility medium fertility low fertility Land to highest bidder. Zero transport costs. Fig. 7.1 - Fertilit... Date Added: 2009-04-26 11:33:11 |
| linreg.pdf Path: Brookdale >> ENGM >> 2032 Fall, 2009 Description: 50 55 60 65 Water Temp. (0F) 70 75 Derease in bpm e e } sd47f b3i~| BizGw } { yx u 9 C H 8 9 Qx d 6 6 X C A d e 9 t n e 6 vRkg@`bbS `X GuYsbbBsr baH 9 d C H 8 9 w 9 q 8 9 C p n m H C H p 6X xx u 9 U e 9 C A xx u R... Date Added: 2009-04-26 11:34:13 |
| Ch12-OHs-5-6-03.doc Path: University of Iowa >> PSYCHOLOGY >> 31043 Fall, 2009 Description: Chapter 12-Quasi-experimental design Seat-belt law-does it decrease fatalities & severe accidents ? Problems with doing such a study? Difficult to randomly assign folks following instructions Would need huge sample Ethical NOT possible to desi... Date Added: 2009-04-26 11:34:56 |
| ncaa.pdf Path: UNC Charlotte >> MBAS >> 6310 Spring, 2008 Description: Institutional Change in the NCAA and Competitive Balance in Intercollegiate Football Craig A. Depken, II Department of Economics University of Texas Arlington Arlington, TX 76019 Office: 817-272-3290 Fax: 817-272-3145 E-mail: depken@uta.edu Dennis ... Date Added: 2009-04-26 11:35:00 |
| Formula-sheet.pdf Path: McGill >> P >> 101 Fall, 2009 Description: Physics 198-101A Formula sheet (revised Nov 2000) GEOMETRY Area of a triangle 1 A = bh 2 Right-angled triangle: Area of a circle A = r 2 Surface area of a sphere A = 4r 2 Volume of a sphere 4 V = r 3 3 y x y r 2 = x 2 + y 2 ; sin = ; cos = ; tan... Date Added: 2009-04-26 11:39:36 |
| Exam3.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 220 Fall, 2009 Description: Math 220Test 3 University of Illinois, November 14, 2008 NAME: SECTION: No calculators, notes, text or phones during the exam. 1. 2. 3. 4. 5. 6. 7. 8. (4) (8) (8) (10) (10) (10) (10) (10) Total. (70) 1 1. (HW) Newtons Method (4 points) Use New... Date Added: 2009-04-26 11:40:49 |
| 31295005999940.pdf Path: Texas Tech >> ETD >> 02262009 Fall, 2009 Description: PRECURSORS OF HUMANISTIC, EXISTENTIAL, AND SOCIAL COGNITIVE APPROACHES IN AMERICAN PSYCHOLOGY: THE CONTRIBUTIONS OF EMERSON AND THOREAU by ANDREA KAY GOUDIE. B.A., M.A., Ph.D. A DISSERTATION IN PSYCHOLOGY Submitted to the Graduate Faculty of Texas Te... Date Added: 2009-04-26 11:41:17 |
| 06_Husserl_CM.pdf Path: Kentucky >> PHI >> 516 Fall, 2008 Description: Lecture: Husserl\'s Vorlesungen Page 1 of 3 Vorlesungen, 3rd Section Husserl, Edmund. \"Third Section: The Levels of Constitution Pertaining to Time and Temporal Objects.\" In On the Phenomenology of the Consciousness of Internal Time (1893-1917). Tra... Date Added: 2009-04-26 11:41:36 |
| lecture7.pdf Path: UCF >> CECS >> 6530 Fall, 2009 Description: Le(,~ MpSk: s~MI~ Mpc;I( Si~ Do a. 7 ~b-L6s30 PfDbltbiLi~ po;~ o\\\" ~ P.leto And f\"w0Y\' Un~-k~ ,\'(\'eo rJ\'dtibthd c.(de. (etw et\'1tVjY aw.pl,n.Jc). 1X~ Si~ A Co~ (w:t.,. 9A ) Si9MJ ~ ow,>\' pw sYMbol 4~ = Jf/.T .:. \'\" ~ _ $Ylllbol SNR. : ~ ... Date Added: 2009-04-26 11:46:28 |
| Lecture12.pdf Path: UCSB >> ECE >> 124 Fall, 2009 Description: ECE 124A VLSI Principles Lecture 12 Interconnect Design: Repeater Insertion and High-Frequency Issues Prof. Kaustav Banerjee Electrical and Computer Engineering E-mail: kaustav@ece.ucsb.edu Lecture 12, ECE 124A, VLSI Principles Kaustav Banerjee R... Date Added: 2009-04-26 11:46:52 |
| 200828_r01s_0610933.pdf Path: Stanford >> AMT >> 1036 Fall, 2009 Description: Case 1:06-cv-10933-MLW Document 78 Filed 02/08/2008 Page 1 of 33 UNITED STATES DISTRICT COURT DISTRICT OF MASSACHUSETTS IN RE AMERICAN TOWER CORPORATION SECURITIES LITIGATION No. 06-CV-10933 (MLW) STIPULATION AND AGREEMENT OF SETTLEMENT Subje... Date Added: 2009-04-26 11:47:41 |
| 20020812_r01x_003645.pdf Path: Stanford >> RAMP >> 1016 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 SFRLIB1\\MB2X\\ 6191379.03 Paul R. Bessette (SBN 139675) BROBECK, PHLEGER & HARRISON LLP 4801 Plaza on the Lake Austin, Texas 78746 Telephone: (512) 330-4000 Facsimile: (512) 3... Date Added: 2009-04-26 11:48:14 |
| Test1Review.pdf Path: UNL >> STAT >> 380 Fall, 2008 Description: ... Date Added: 2009-04-26 11:48:39 |
| CHE302o.F2001.doc Path: Cal Poly Pomona >> CHE >> 302 Fall, 2009 Description: CHE 302 CALIFORNIA STATE POLYTECHNIC UNIVERSITY, POMONA Chemical and Materials Engineering Thermodynamics I Fall 2001 Instructor: Thuan K. Nguyen Office Hour: MTWThF 8:00-9.00 A.M Room: 17-2108 E-mail:TKNguyen@csupomona.edu http:/www.csupomona.edu... Date Added: 2009-04-26 11:53:01 |
| test1s08.pdf Path: Duke >> CPS >> 140 Fall, 2009 Description: CPS 140 Exam 1 Dr. Rodger Spring 2008 NOTE: na (w) means the number of as in the string w. 1. (14 pts) Complete or answer the following. If the resulting answer has less than 10 items, just list the items. Otherwise give a formal description of th... Date Added: 2009-04-26 11:54:58 |
| Local_Cover__2_0_4_-1_2_10_0_-1_0_28__minimal.txt Path: Duke >> MATH >> 290 Fall, 2009 Description: < minimal [ 2, 0, -1, 0 ; 0, 4, 2, -1 ; -1, 2, 10, 0 ; 0, -1, 0, 28 ] < 0 ; [ 32 , 125 , 2197 , 24389 ] ; [ ] ; [ ] > [ [ [ 4, 4, -1 ; 4, 38, 0 ; -1, 0, 28 ] ] , [ [ 2, -2, 0 ; -2, 36, 4 ; 0, 4, 444 ] ] , [ [ 4, 8, -1 ;... Date Added: 2009-04-26 11:55:05 |
| topics.txt Path: Duke >> CPS >> 001 Fall, 2009 Description: TOPICS The Internet HTML Tags References Ethernets and routing The Web Connecting multiple computers by passing through different networks Programming in Java Java as a programming language \"Java is a simple, obje... Date Added: 2009-04-26 11:55:49 |
| note4.ppt Path: Plymouth >> CS >> 1100 Fall, 2009 Description: Chapter 4: Talking in HTML: A Hypertext Markup Language Primer Introduction to Computers CS1100.01 Dr. Zhizhang Shen Copyright 2008 Pearson Education, Inc. Publishing as Pearson Addison-Wesley What about it? Computers used to be a computing machi... Date Added: 2009-04-26 11:59:24 |
| 2140872624.PPT Path: TN Tech >> CSC >> 2140872624 Fall, 2009 Description: Multi Jet Modeling What is Multi Jet Modeling? It is a rapid prototyping technique developed by 3D Systems. Designed for concept modeling in an office environment or molds in manufacturing environment. It uses a 448element print head to depos... Date Added: 2009-04-26 12:00:43 |
| Lesson11.pdf Path: Tarleton >> PHYSICS >> 1224 Fall, 2009 Description: Lesson 11 Newton IV - Circular Motion and Friction I. A. Circular Motion Problems Circular motion problems are NO Different than any other Newton II problem. We draw free body diagrams and inventory forces just like any other problem. Coordinate Axis... Date Added: 2009-04-26 12:01:56 |
| Networks.doc Path: Wisc Parkside >> CS >> 370 Fall, 2009 Description: Networks 1 Network Structures Distributed Systems 370 Text: Chapters 15-16 Operating Systems Concepts with Java, Sixth Edition, Silberschatz, Galvin, Gagne Objectives: During this class the student shall learn to: Define Local Area Network (LAN), ... Date Added: 2009-04-26 12:02:28 |
| Syllabus.pdf Path: Case Western >> EEAP >> 282 Fall, 2009 Description: EEAP 282 INTRODUCTION TO MICROPROCESSORS COURSE OUTLINE Topic Informational (1 lecture) a. Course syllabus b. grading policies c. CWRUnet ethics code d class notes e. CWRUnet 1. connecting via PPP 2. connecting to the Kern Lab f. Where microprocessor... Date Added: 2009-04-26 12:02:33 |
| proposal.pdf Path: Rutgers >> CS >> 672 Fall, 2008 Description: CS 672 Meaning Machines Guide for project proposal Nov 3 2004 The end of the semester is in sight, so you need to get moving on your project. Now is your chance to frame your ideas, plan your project and get some feedback. For November 3, prepare a ... Date Added: 2009-04-26 12:03:33 |
| RAD.pdf Path: Michigan State University >> READ >> 1987 Fall, 2009 Description: ... Date Added: 2009-04-26 12:03:38 |
| rosenfriedrich.pdf Path: Michigan State University >> HA >> 445 Fall, 2009 Description: One of the most radical aspects of early Romanticism was the attempt to replace history painting-large formal depictions of historical or religious scenes-by landscape. It is not that painters turned their attention to landscape and away from the lar... Date Added: 2009-04-26 12:03:41 |
| DPG10.TXT Path: Michigan State University >> GEO >> 5450 Fall, 2009 Description: Sheet1 DIVISION: 10 COUNTY: MONROE YEAR 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 JAN 3 4 3 7 6 5 4 7 4 3 2 5 4 5 3 6 4 5 5 8 4 6 9 5 4 9 3 8 4 8 ... Date Added: 2009-04-26 12:03:53 |
| Sections.pdf Path: WVU >> CS >> 100 Fall, 2009 Description: Summer 2009 Semester Section Time Schedule Information Updated on 4/2/2009 3:00pm Day Time MTWRF 9:00am-10:15am MTWRF 10:30am-11:45am MTWRF 12:00pm-1:15pm Extended Learning Total On-Campus Total All Sections Section 1 4 5 7D1 May 19, 2008 - June 27, ... Date Added: 2009-04-26 12:09:05 |
| Wilson2004MYXAM.pdf Path: Toledo >> BIO >> 418 Fall, 2009 Description: Test Cases, Resolvability, and Group Selection: A Critical Examination of the. Robert A Wilson Philosophy of Science; Jul 2004; 71, 3; Research Library pg. 380 Reproduced with permission of the copyright owner. Further reproduction prohibited withou... Date Added: 2009-04-26 12:10:47 |
| COE-introduction.pdf Path: East Los Angeles College >> KU >> 14008 Fall, 2009 Description: One Day Seminar on the Japanese Centre of Excellence for Fire Safety Science and Developing a Global Fire Research Network 3 December 2007 Dorich House Museum, Kingston University 67 Kingston Vale, London SW15 3RN Introduction The Japanese government... Date Added: 2009-04-26 12:10:58 |
| forloop1.ppt Path: Bowling Green >> CSC >> 1310 Fall, 2009 Description: Some Programming Examples Swap If we have a=10 and b=5, how do we swap their values to make a=5, b=10? Swap We need another variable to store the value temp=a a=b b=temp Find Max Given a list, how to find the maximum value by using the for loop?... Date Added: 2009-04-26 12:11:05 |
| reproduction.pdf Path: Davidson >> BIO >> 112 Fall, 2009 Description: Animal Diversity Annelids Other Inverts Cnidarians Nematodes Flatworms Vertebrates Myriapods Crustacean Chelicerate Other Insects Reproductive ecology Consider mating and reproductive strategy in the context of the environment Strategies evolved in... Date Added: 2009-04-26 12:12:27 |
| RR80-16.pdf Path: NYU >> ECON >> 1980 Fall, 2009 Description: ... Date Added: 2009-04-26 12:13:59 |
| 20061117_r01m_042297.pdf Path: Stanford >> OVTI >> 1031 Fall, 2009 Description: 1 MILBERG WEISS BERSHAD & SCHULMAN LLP 2 JEFF S. WESTERMAN (94559) jwesterman@milbergweiss.com 3 CHERYL A. WILLIAMS (193532) cwilliams@milbergweiss.com 4 MICHIYO MICHELLE FURUKAWA (234121) mfurukawa@milbergweiss.com 5 One California Plaza 300 South G... Date Added: 2009-04-26 12:14:00 |
| probset2.pdf Path: UF >> PHZ >> 7427 Spring, 2008 Description: PHZ7427Solid State II Spring 2000 Problem Set 2 Jan. 14, 2000 Due: Feb. 11, 2000 Reading: A 6 p. 116 1. 2-Site Hubbard Model. Given the Hubbard Hamiltonian H = t i,j 1 c cj + U i 2 n.n, i ni ni (1) where i, j label latti... Date Added: 2009-04-26 12:14:36 |
| P20.pdf Path: Harvard >> MATH >> 192 Fall, 2009 Description: Math 192r, Problem Set #20 (due 12/11/01) 1. Let f () be some polynomial (in one variable), and dene a sequence of rational functions rn = rn (x, y) with the initial conditions r0 = x, r1 = y and the recurrence rn+2 = f (rn+1 )/rn (n 0). Here x and... Date Added: 2009-04-26 12:16:54 |
| ch-tutorial.pdf Path: Purdue >> AAE >> 564 Fall, 2009 Description: 1 Simple oscillator (oscillator.mdl) Here we obtain a Simulink model of the simple spring-mass-damper system described by m + cy + ky = 0 y To obtain a Simulink model, we first note that y=- k c y- y m m Simple oscillator (oscillator) yddot 1... Date Added: 2009-04-26 12:17:11 |
| 2006-October.txt Path: Stanford >> SBPOGENERA >> 0607 Fall, 2009 Description: From danielag at stanford.edu Thu Oct 19 13:34:57 2006 From: danielag at stanford.edu (Dan Ackerman Greenberg) Date: Thu, 19 Oct 2006 13:34:57 -0700 Subject: [sbpogeneral_0607] SUPost - Stanford Classifieds [please forward widely] Message-ID: <4537... Date Added: 2009-04-26 12:18:21 |
| 220-2001-P01b.doc Path: Portland >> ARCH >> 220 Fall, 2009 Description: PSU ARCH 220 FALL 2001 Project 01 Visual Notes DESIGN DRAWING MARTIN/MOSBY/SIEMENS/ZAL By this time they were getting near Eeyores Gloomy Place, which was where he lived, and as it was still very snowy behind Piglets ears, and he was getting tire... Date Added: 2009-04-26 12:20:09 |
| linear_sys_notes.pdf Path: Utah >> CS >> 6640 Spring, 2008 Description: CS6964: Notes On Linear Systems 1 Linear Systems Systems of equations that are linear in the unknowns are said to be linear systems For instance ax1 + bx2 = c dx1 + ex2 = f gives 2 equations and 2 unknowns. More generally we have a11 x1 + . . . + a... Date Added: 2009-04-26 12:21:12 |
| mac_perf.pdf Path: Washington University in St. Louis >> CSE >> 567 Fall, 2009 Description: Survey on Performance Evaluation Techniques for Medium Access Control Protocols Ritun Patney, ritun.patney@gmail Abstract Medium Access Control (MAC) protocols, in data networks, are responsible for arbitrating access to a shared medium. This survey ... Date Added: 2009-04-26 12:23:11 |
| B1B7_Landsat7ETM.txt Path: Neumont >> GEO >> 2522 Fall, 2009 Description: 250.0000 69.3000 0.0000 0.0000 0.0000 0.0000 0.0000 0.0000 252.5000 77.6500 0.0000 0.0000 0.0000 0.0000 0.0000 0.0000 255.0000 86.0000 0.0000 0.0000 0.0000 0.0000 0.0000 0.0000 257.5000 100.0600 0.0000 0.0000 0.0000 0.0000 0.0000 0.0000 260.0000 1... Date Added: 2009-04-26 12:23:55 |
| K492-ov.pdf Path: Cuyamaca College >> MUSI >> 2233 Fall, 2009 Description: Le nozze di Figaro Presto 2 Flauti 2 Oboi Ouvertura W.A. Mozart 2 Clarinetti in A 2 Fagotti a2 2 Corni in D pp 2 Trombe in D Timpani in D und A Violin ... Date Added: 2009-04-26 12:24:10 |
| Final_01_sol.pdf Path: Acton School of Business >> ELEC >> 428 Fall, 2008 Description: Final Exam Solution 1. A computer system has 3 disks. The system administrator checks the system each day over a long period of time and observes the following. An individual disk that is working one day fails the next day with probability 0.01, inde... Date Added: 2009-04-26 12:24:33 |
| nota.pdf Path: UPenn >> VHM >> 802 Fall, 2009 Description: q u p v u v q u v u u w p 4jF(tp\"p\"0x$u\"h4F\"jx\"4`BF\"v\"t\" \"4r0IF4 x u q puu u v u w u \"F\"tpBu } 84h f 0r$ 4(xx p w v v v xz (S\"rx4 f v n 4Fv(F(\"~(rr f Fv x FDr u4BFBI f Fv x rr v o u v u f v n ... Date Added: 2009-04-26 12:25:34 |
| Security.doc Path: Winthrop >> CSCI >> 101 Fall, 2008 Description: Security Resources you can use Norton AntiVirus Response Center Web Page http:/securityresponse.symantec.com/ Test the vulnerability of your computer: Gibson Research Corporation (http:/www.grc.com) look for Freeware at the top Windows updates fo... Date Added: 2009-04-26 12:30:06 |
| 00000040.pdf Path: Carnegie Mellon >> TERA >> 05101322 Fall, 2009 Description: ... Date Added: 2009-04-26 12:30:43 |
| HW06.pdf Path: UGA >> MATH >> 2200 Spring, 2005 Description: MATH 2200 SOLUTIONS TO THE EVEN-NUMBERED PROBLEMS Page 159, #28. A farmer wants to hire workers to pick 900 bushels of beans. Each worker can pick 5 bushels per hour and is paid $1.00 per bushel. The farmer must also pay a supervisor $10 per hour w... Date Added: 2009-04-26 12:31:45 |
| ssamara2.pdf Path: University of Illinois, Urbana Champaign >> CS >> 598 Fall, 2008 Description: Trust Breaks Down in Electronic Contexts but Can Be Repaired by Some Initial Face-to-Face Contact Elena Rocco Reviewed by Suraj Samaranayake Face to Face (F-t-F) interaction is the most trusting form of interaction. I\'m from Missouri which has a mott... Date Added: 2009-04-26 12:33:05 |
| taskanalysispresentation-spring2009_topost.ppt Path: Wisconsin >> ENGR >> 349 Fall, 2009 Description: ISyE 349 Spring 2009 Agenda for Today Questions Work analysis Work analysis exercise Questions? From previous discussions? From previous lectures? In general? Work Analysis What is work analysis? Your thoughts Why do we do work analysis? Your... Date Added: 2009-04-26 12:33:21 |
| annuities.pdf Path: George Mason >> MATH >> 106 Fall, 2008 Description: ... Date Added: 2009-04-26 12:35:09 |
| P21_east_SIGMA0_upper_1250.pdf Path: UCSD >> P >> 1250 Fall, 2009 Description: Computer Generated 142 137 132 127 122 117 112 107 0 (kg/m3) for P21 17S (1250:1) EAST 102 97 88 79 74 69 64 59 54 45 33 29 24 18 14 m 0 24.5 200 25 25.2 25.4 25.6 25.8 26 26.2 26.4 26.6 26.7 26.8 26.9 27 27.1 27.2 800 27.3 1000 25 25.2 25.4 25.6 ... Date Added: 2009-04-26 12:39:15 |
| StockExchangespre1914.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 238 Fall, 2009 Description: How It All Began: The Rise of Listing Requirements in the First Global Markets The Berlin, London, New York, and Paris Stock Exchanges before World War I Lance Davis (CalTech NBER), and Eugene White (Rutgers & NBER) W... Date Added: 2009-04-26 12:41:53 |
| OR_20080525.pdf Path: Washington >> ESS >> 200805 Fall, 2009 Description: OR 2008/ 5/25 0:00:00; 1.5 5.0 Hz; Envelope lowpass at 0.05 Hz 0 KMOZ 20 1 VLLZ 80 2 TDHZ 80 3 SSOZ 40 4 GMOZ 50 5 FRISZ 20 6 HUOZ 10 7 MOONZ 40 8 IROZ 10 9 DBOZ 20 10 BBOZ 30 11 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 ... Date Added: 2009-04-26 12:45:23 |
| profitability.doc Path: Iowa State >> MR >> 0413 Fall, 2009 Description: American Farm, MD 04-10-07 Profitability depends on corn yields, prices exceeding soybeans (Editors Note: This is the last of a three-part series by DTN agronomist Dr. Daniel Davidson looking at how the farmers have overcome the challenge of continuo... Date Added: 2009-04-26 12:46:54 |
| profitability.doc Path: Iowa State >> PUBLIC >> 0413 Fall, 2009 Description: American Farm, MD 04-10-07 Profitability depends on corn yields, prices exceeding soybeans (Editors Note: This is the last of a three-part series by DTN agronomist Dr. Daniel Davidson looking at how the farmers have overcome the challenge of continuo... Date Added: 2009-04-26 12:46:54 |
| tamaras.pdf Path: N.C. State >> SERVICE >> 004 Fall, 2009 Description: Environmental Toxicology and Chemistry, Vol. 26, No. 3, pp. 521527, 2007 2007 SETAC Printed in the USA .00 0730-7268/07 $12.00 LINKAGE OF BIOCHEMICAL RESPONSES TO POPULATION-LEVEL EFFECTS: A CASE STUDY WITH VITELLOGENIN IN THE FATHEAD MINNOW (PIMEPH... Date Added: 2009-04-26 12:47:02 |
| MLE-mini-lecture.pdf Path: St. Mary MD >> SOC >> 740 Fall, 2009 Description: Maximum-Likelihood Estimation: Basic Ideas 1 Sociology 740 John Fox The method of maximum likelihood provides estimators that have both a reasonable intuitive basis and many desirable statistical properties. The method is very broadly applicabl... Date Added: 2009-04-26 12:47:23 |
| PresentationEvaluation371.pdf Path: Elon >> PHY >> 371 Fall, 2009 Description: PRESENTATION EVALUTION FORM INTRODUCTION TO ASTROPHYSICS Speaker: _ [ 5=Outstanding 4=Exceeds Expectations Section: _ 3=Average 2=Poor 1=Dismal ] CONTENT (15 POINTS) 1. The speaker was able to answer questions related to the material. 2. The speaker... Date Added: 2009-04-26 12:47:47 |
| 19540210_0000481861.pdf Path: Princeton >> MC >> 019 Fall, 2009 Description: 3 ; I 14th Quadripartite P l e n a r y Session, Berlin, Feb. 10, 1954. m ! . ! i M t . Dullels: The United States certainly cannot take offense at the suggeetion of the Soviet F o r e i g n Minister that the E u r o p e a n c o u n t r i e s e... Date Added: 2009-04-26 12:48:37 |
| Chapter3Revised.pdf Path: Acton School of Business >> COMP >> 412 Fall, 2009 Description: ENGINEERING A COMPILER Draft of Second Edition Keith D. Cooper Linda Torczon Rice University Houston, Texas Limited Copies Distributed Reproduction requires explicit permission Copyright 2006, Morgan-Kaufmann Publishers and the authors All rights r... Date Added: 2009-04-26 12:49:16 |
| constraints-2pp.pdf Path: Acton School of Business >> COMP >> 440 Fall, 2009 Description: Constraint satisfaction Devika Subramanian Lecture 5 Comp 440 Outline Representing constraint satisfaction problems (CSPs) Choice of variables and values Formulating constraints Constraint graph representation Solving CSPs Constructive techniques f... Date Added: 2009-04-26 12:49:32 |
| reading8.pdf Path: San Diego State >> ASTRO >> 660 Fall, 2009 Description: Week #8 Handout, 2007.03.06 Astronomy 660, Prof. Leonard Announcements Midterm Exam on Thursday, March 15. As stated on the course syllabus, the midterm exam in this class will take place next Thursday, March 15. Details about the form and content o... Date Added: 2009-04-26 12:49:35 |
| lecture16_1.pdf Path: Minnesota >> CSCI >> 5980 Fall, 2008 Description: CSCI5980: Functional Genomics, Systems Biology and Bioinformatics Kernel Methods and Support Vector Machines Rui Kuang and Chad Myers Department of Computer Science and Engineering University of Minnesota March 2008 Kuang and Myers (University of ... Date Added: 2009-04-26 12:50:46 |
| 2.Amino_Acids-Protein_Structure-Function.ppt Path: Minnesota >> BIOSCI >> 6011 Fall, 2009 Description: Amino Acids, Protein Structure R\" group ... Date Added: 2009-04-26 12:50:50 |
| BRCFeb1606Meeting.pdf Path: Minnesota >> AREND >> 011 Fall, 2009 Description: Blue Ribbon Commission Meeting Record February 16, 2006 5:30-6:30 p.m. Philadelphia, PA Submitted by Johanna Dvorak, BRC Secretary The BRC members present: David Arendale, Jackie Harris, Jan Norton, Johanna Dvorak, Sherry Lusk, Jane McGrath, Vashti M... Date Added: 2009-04-26 12:51:31 |
| 482MidtermRevQsVer2-S09.doc Path: Winona >> COURSE >> 482 Fall, 2009 Description: MIS 482 Review Questions for the Midterm Exam Chapter 1 Page 40, Questions 1 -7 Chapter 2 Page 95, Questions 1 7 & 11 12 Chapter 3 Page 129, Questions 1 10 Chapter 4 Pages 167-168, Questions 1 12 Chapter 5 Page 210, Questions 1 10 Chapter ... Date Added: 2009-04-26 12:52:11 |
| ms122NW19960907.pdf Path: Southern Utah >> MS >> 122 Fall, 2009 Description: R.S. 2477 MISUNDERDSTANDINGS CONVEYED IN EDITORIAL Mark Walsh The Salt Lake Tribune. Salt Lake City, Utah: September 7, 1996. pg. A.11. Copyright The Salt Lake Tribune September 7, 1996 The Aug. 27 Tribune editorial on R.S. 2477 rights of way, `Road... Date Added: 2009-04-26 12:53:56 |
| 20081222_r03x_0601691.pdf Path: Stanford >> UNH >> 1036 Fall, 2009 Description: UNITED STATES DISTRICT COURT DISTRICT OF MINNESOTA In re UNITEDHEALTH GROUP INCORPORATED) PSLRA LITIGATION ) } This Document Relates To: ) Civil File No. 0:06-cv- 01691-JMR-FLN CLASS ACTION PROOF OF CLAIM AND RELEASE GENERAL INSTRUCTIONS 1. To recov... Date Added: 2009-04-26 12:54:55 |
| 20030714_o01c_Mahoney.pdf Path: Stanford >> ITMN >> 1028 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 FRANCIS M. GREGOREK (144785) BETSY C. MANIFOLD (182450) FRANCIS A. BOTTINI, JR. (175783) RACHELE R. RICKERT (190634) WOLF HALDENSTEIN ADLER FREEMAN & HERZ LLP 750 B Street, S... Date Added: 2009-04-26 12:57:05 |
| 2004727_r01o_0110456.pdf Path: Stanford >> IN >> 1022 Fall, 2009 Description: ` 1 OINAL CLERK, U.S. DISTRICT COURT . klf ICT OF CALIFORNI A DEPUTY 2 WILLIAM S . LERACH (68581) KEITH F . PARK 54275 3 DARREN J . ROB INS 168593) EDWARD P . DIETRIC ( 176118) 4 JEFFREY D . LIGHT (159515) BENNY C. GOODMAN III (21130e) 5 401 B S... Date Added: 2009-04-26 12:57:16 |
| 20011115_f01c_0110111.pdf Path: Stanford >> FCOM >> 1021 Fall, 2009 Description: JUDGE SCHEINDLIN UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK PHILIP DUGGAN, on behalf of himself and all others similarly situated, CIVIL ACTION NO. Plaintiff, V. CLASS ACTION COMPLAINT FOR VIOLATIONS OF FEDERAL SECURITIES LAWS JURY T... Date Added: 2009-04-26 12:57:42 |
| 1998.0323.pdf Path: Harvard >> CFA >> 165 Fall, 2009 Description: ... Date Added: 2009-04-26 12:58:02 |
| pres.pdf Path: Minnesota >> CSCI >> 8551 Fall, 2008 Description: Introduction The Algorithm Threshold Calculation Results Allocating Tasks in Extreme Teams Paul Scerri, Alessandro Farinelli, Steven Okamoto, Milind Tambe Presented by Maxwell Walter Intelligent Agents Class, 2007 Maxwell Walter CSCI 8551, 200... Date Added: 2009-04-26 13:00:13 |
| ch18.ppt Path: SUNY Albany >> KS >> 126361 Fall, 2009 Description: 18 Open-Economy Macroeconomics: Basic Concepts PRINCIPLES OF MACROECONOMICS FOURTH EDITION N. G R E G O R Y M A N K I W PowerPoint Slides 2007 Thomson South-Western, all rights reserved In this chapter, look for the answers to these questions: ... Date Added: 2009-04-26 13:01:08 |
| Wasserman-Abstract.doc Path: Oregon State >> ECE >> 478 Fall, 2008 Description: Brett Wasserman May 14th, 2004. Topic: Campus Network Access Control Vulnerabilities. Abstract: To control access to the campus network, Oregon State University uses MAC address authentication on the DHCP servers. Systems with hardware addresses not ... Date Added: 2009-04-26 13:01:55 |
| lec1.2p.pdf Path: Maryland >> CMSC >> 430 Spring, 2001 Description: CMSC 430 CMSC 430| Theory of Language Translation\" Topics in the design of programming language translators, including scanning, parsing, error recovery, code generation, and code improvement. Prerequisite: CMSC 330 Course Overview Basis for grades:... Date Added: 2009-04-26 13:02:09 |
| lecture 9 robust design.pdf Path: Berkeley >> EE >> 290 Spring, 2004 Description: EE290H F05 Spanos Robust Design A New Definition of Quality. The Signal-to-Noise Ratio. Orthogonal Arrays. Lecture 9: Robust Design 1 EE290H F05 Spanos The Taguchi Philosophy Taguchi starts with a new definition of Quality: Quality is relate... Date Added: 2009-04-26 13:07:41 |
| hw5.pdf Path: Bergen CC >> CS >> 191 Fall, 2009 Description: Chem/CS/Phy191 Problem Set 5 Out: September 29, 2008 1. The energy difference between the ground state (lowest energy level) and rst excited state (next level up) in a hydrogen atom is about 10 eV (eV = electron volt). The diameter of a hydrogen a... Date Added: 2009-04-26 13:08:06 |
| em4878.pdf Path: Midwestern State University >> EM >> 2778 Fall, 2009 Description: to Positive Behavior STRENGTHENING FAMILIES AND YOUTH STEPS EM4878 STEPS TO POSITIVE BEHAVIOR TO POSITIVE BEHAVIOR STEPS to Positive Behavior STRENGTHENING FAMILIES AND YOUTH Introduction: Those of us who work or live with kids would probably ag... Date Added: 2009-04-26 13:09:08 |
| Music2.pdf Path: N. Michigan >> CS >> 255 Fall, 2008 Description: Katie Graham 10 March 2006 Music in North America Worksheet Name_ Date_ 1. The instrument that was made in Alaska is called the _. Its made out of cedar and _ strips. It belongs in the __ family. 2. The _ was found in Canada. Its also made of cedar... Date Added: 2009-04-26 13:13:32 |
| 118abortion05.ppt Path: Wesleyan >> BIOL >> 118 Fall, 2009 Description: Spontaneous abortion Fate of a fertilized egg Availability of contraception Availability of abortion 50% of unintended pregnancies due to lack of contraceptionrest failed contraception Guttmacher Institute Data * Half of all pregnancies to Americ... Date Added: 2009-04-26 13:14:02 |
| Lect08-9-22-04-Concepts-from-Physics-2pp-all-pix.pdf Path: Minnesota >> ASTRONOMY >> 1011 Fall, 2009 Description: What is it that we need to understand? 1. How we can use Newtons theory of gravitation to find the masses of planets, stars, and galaxies. 2. Energy conservation and some of its implications. 3. How gravitational potential energy is liberated when a ... Date Added: 2009-04-26 13:14:54 |
| Lecture29-11-25-03-spiral-structure-6pp-few-pix.pdf Path: Minnesota >> ASTRONOMY >> 1011 Fall, 2009 Description: Galactic Structure Lecture #2 Paul Woodward 4/16/03 Perseus Arm Orion Arm (spur?) Rotation Sun Optical features Concentrated radio features ? General neutral hydrogen (radio > 1 atom/cm3) + Center Sagitarius Arm Fig. 20.11 Centaurus Arm Parsecs... Date Added: 2009-04-26 13:15:01 |
| Lect08-9-22-04-Concepts-from-Physics-2pp-few-pix.pdf Path: Minnesota >> ASTRONOMY >> 1011 Fall, 2009 Description: What is it that we need to understand? 1. How we can use Newtons theory of gravitation to find the masses of planets, stars, and galaxies. 2. Energy conservation and some of its implications. 3. How gravitational potential energy is liberated when a ... Date Added: 2009-04-26 13:15:08 |
| M143SEx2S09_Solu.pdf Path: Idaho State >> MATH >> 143 Fall, 2008 Description: SOLUTIONS OF SAMPLE EXAM TWO Problem 1 (8 points). Suppose that a straight line passes through the points (3, 1) and (3, 2) in the xy-coordinate plane. (a) Find the slope of this straight line. Solution. Use the slope formula: m = (y2 y1 )/(x2 x1 ... Date Added: 2009-04-26 13:15:53 |
| Disc7.pdf Path: Berkeley >> EE >> 105 Fall, 2009 Description: Discussion Notes 7: Frequency Response: 1) Review and practice dB calculations: Ratio of voltages in decibels: 20log|Vout/Vin| dB Vout/Vin 1/2 2 10 40 dB -6dB 6dB 20dB 32dB Explain how to easily calculate dB of 40 knowing dB of 10 and 2. 2) Finding ... Date Added: 2009-04-26 13:16:42 |
| Specifications.pdf Path: Penn State >> PCR >> 115 Fall, 2009 Description: SECTION 03 21 00 Reinforcing Bar Support PART 1 GENERAL 1.01 RELATED WORK SPECIFIED ELSEWHERE A. B. C. Concrete Formwork: Section 03100. Cast-In-Place Concrete: Section 03300. Fibrous Reinforcement: Section 03240. 1.02 REFERENCES A. Except as shown ... Date Added: 2009-04-26 13:23:12 |
| chp5.pdf Path: San Jose State >> EE >> 227 Fall, 2008 Description: CHAPTER 5: Non-Quasi Static Model 5.1 Background Information As MOSFETs become more performance-driven, the need for accurate prediction of circuit performance near cut-off frequency or under very rapid transient operation becomes more essential. Ho... Date Added: 2009-04-26 13:27:49 |
| 1-31-08 notes Path: Colorado >> EBIO >> 1220 Spring, 2008 Description: Biology January 31, 2008 CQ: Which of the following characteristics are NOT used to classify animals? A) Presence of Absence of Real Tissues B) Number of cell types C) Symmetry D) Features of embryonic development Invertebrates 1 Animals without \"bac... Date Added: 2009-04-26 18:25:59 |
| KIDNEYS Path: Colorado >> BCOR >> 1010 Fall, 2007 Description: Kidneys: Osmoregulation-Salt and Water balance I. Mammalian Urinary System: The Kidney A. Anatomy of the human kidney: they are shaped like a kidney bean that is approx. 5\" long and 2.5\" wide. 1. renal cortex: this is the outer layer of the kidney wh... Date Added: 2009-04-26 19:14:21 |
| M350_N400.pdf Path: NYU >> HOMEPAGES >> 108 Fall, 2008 Description: LP, Aug 03, Tateshina M350 = N400? Polarity A typical M350 source should generate a negativity at the top of the head. N400 usually largest at central/midline electrodes. _ + Polarity NB: The M350 is often bilateral. Both the LH and RL M350 ... Date Added: 2009-04-27 04:45:47 |
| M350_N400.pdf Path: NYU >> MP >> 108 Fall, 2009 Description: LP, Aug 03, Tateshina M350 = N400? Polarity A typical M350 source should generate a negativity at the top of the head. N400 usually largest at central/midline electrodes. _ + Polarity NB: The M350 is often bilateral. Both the LH and RL M350 ... Date Added: 2009-04-27 04:45:47 |
| M350_N400.pdf Path: QMUL >> HOMEPAGES >> 108 Fall, 2008 Description: LP, Aug 03, Tateshina M350 = N400? Polarity A typical M350 source should generate a negativity at the top of the head. N400 usually largest at central/midline electrodes. _ + Polarity NB: The M350 is often bilateral. Both the LH and RL M350 ... Date Added: 2009-04-27 04:45:48 |
| lecture5.pdf Path: East Los Angeles College >> COMSM >> 0121 Fall, 2009 Description: Greville Commins greville.commins@setsquared.co.uk Last week Innovation Business Strategy Innovation starts with an idea Example innovations solving problems A solution looking for a problem Incremental & Disru... Date Added: 2009-04-27 04:49:07 |
| homework1_spring2009_key.pdf Path: Alabama >> ECE >> 383 Fall, 2008 Description: ECE 383 - Microcomputers Spring 2009 Homework 1 Solution Problem 3: Given the following C code, what is the corresponding Assembly code? ORG $1000 MAX MIN SUM AVE REM STR DS.B DS.B DS.B DS.B DS.B DC.B 1 1 1 1 1 5, 0, 6, 1, 3 ORG $2000 MOVB STR, MIN... Date Added: 2009-04-27 04:52:19 |
| LECT13-2.pdf Path: Alabama >> ECE >> 480 Fall, 2008 Description: Digital Systems Design NIOS II Processor Software Development Electrical & Computer Engineering Dr. D. J. Jackson Lecture 13-1 Outline Navigating the NIOS II Integrated Development Environment Write a simple C program that executes on a prebuilt... Date Added: 2009-04-27 04:52:37 |
| sex_and_the_bible.doc Path: Alabama >> WATER >> 030 Fall, 2009 Description: Stephen Waters 03-17-05 Sex and the Bible I\'ve been meaning to write this for a while but I\'ve been putting it off. I was inspired to write a paper on the Bible and sex as I was doing some fact checking on a website I ran across that asserted sex bef... Date Added: 2009-04-27 04:53:05 |
| lab3.doc Path: Pittsburgh >> ENGR >> 1201 Fall, 2009 Description: EE 1201 Electronic Measurements and Circuits Laboratory Spr 2004 Experiment #3 - Time Constants, Capacitance/Inductance, Impedance Plan Due: Before laboratory session Final Report Due : Jan 26, 2004 In this experiment you will be working with RC ... Date Added: 2009-04-27 04:55:54 |
| 0018.pdf Path: USF >> LIT >> 0018 Fall, 2009 Description: The Chimes, a Goblin sTory by Charles DiCkens We have all listened at some time or other to the music of the church bells as they ring out their pleasant chimes every quarter of the hour. The chimes we are now to hear about ring also in four quarte... Date Added: 2009-04-27 04:57:49 |
| C04.pdf Path: Concordia Chicago >> STAT >> 200 Fall, 2009 Description: MAKING COMPARISONS Suppose some study turns out this way: . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .... Date Added: 2009-04-27 04:58:49 |
| islamconst.pdf Path: Macalester >> RUSS >> 364 Fall, 2009 Description: Article 1 The form of government of Iran is that of an Islamic Republic, endorsed by the people of Iran on the basis of their longstanding belief in the sovereignty of truth and Qur\'anic justice, in the referendum of Farwardin 9 and 10 in the year 13... Date Added: 2009-04-27 04:58:58 |
| tut08.pdf Path: Allan Hancock College >> MATH >> 2068 Fall, 2009 Description: The University of Sydney MATH2068 Number Theory and Cryptography (http:/www.maths.usyd.edu.au/u/UG/IM/MATH2068/) Semester 2, 2008 Tutorial 8 Lecturer: R. Howlett Let n be a positive integer. A complex number is called an n-th root of 1 if n = 1.... Date Added: 2009-04-27 04:59:23 |
| Tech_Paper_Team_19.pdf Path: RIT >> P >> 02019 Fall, 2009 Description: RIT Proceedings of KGCOE-MD2003: Multi-Disciplinary Engineering Design Conference Kate Gleason College of Engineering Rochester Institute of Technology Rochester New York May, 2003 MD2003-02019 MINIATURE INERTIAL MEASUREMENT/NAVIGATION SYSTEM Bren... Date Added: 2009-04-27 05:00:45 |
| 18SoluteXport.pdf Path: ESF >> EFB >> 530 Fall, 2009 Description: EFB530 Plant Physiology Friday, February 27, 2009 Essential Mineral Elements (cont.) - Micronutrients Mineral deficiencies Solute transport (mineral element uptake) - electrochemical gradients - passive vs. active transport - carriers and channels - ... Date Added: 2009-04-27 05:15:24 |
| Z-Values.pdf Path: Minnesota >> MATH >> 4707 Fall, 2008 Description: Standard Normal Distribution Table 0 z z 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 3.0 3.1 3.2 3.3 3.4 3.5 .00 .0000 .0398 .0793 .1179 .1554 .1915 .2257 .2580 .2881 .31... Date Added: 2009-04-27 05:21:16 |
| CherokeeMemorials.pdf Path: Idaho >> ENGL >> 504 Fall, 2008 Description: ... Date Added: 2009-04-27 05:21:23 |
| thesis_gracechang.pdf Path: Caltech >> ETD >> 05302003 Fall, 2009 Description: Neural Representation of Surface Ordering in Visual Areas V1, V2 and MT Thesis by Grace C. Chang In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy California Institute of Technology Pasadena, CA 2003 (Defended May 20... Date Added: 2009-04-27 05:31:07 |
| M350_N400.pdf Path: NYU >> MP >> 108 Fall, 2009 Description: LP, Aug 03, Tateshina M350 = N400? Polarity A typical M350 source should generate a negativity at the top of the head. N400 usually largest at central/midline electrodes. _ + Polarity NB: The M350 is often bilateral. Both the LH and RL M350 ... Date Added: 2009-04-27 05:31:28 |
| E030243-A.doc Path: Caltech >> E >> 030243 Fall, 2009 Description: LASER INTERFEROMETER GRAVITATIONAL WAVE OBSERVATORY E030243 -A- D DrawingNo Rev. Group SPECIFICATION 70 x 60 mm sapphire Q substrate APPROVALS AUTHOR:G.Billingsley CHECKED: APPROVED: DATE 7-29-03 REV A DCNNO. E030244-00 BY Sheet 1 of 1 CHEC K ... Date Added: 2009-04-27 05:36:08 |
| AMB01Dissertation.pdf Path: Fayetteville State University >> ETD >> 08312003 Fall, 2009 Description: } | | { z u t w q t t g p u djhvvx1yxhuQ w it iuy v ttugt 7uErPvudv9 d q ip X u w e WdhQRtdrdxsH9 t t u g t i t w u q w t t up q t PdvQPQxrdlErQ u t w w t ii i i p w u y QdrrponmlkjyxQhp d yug yte wt wuy t WddQfaCd5xQv9 t ... Date Added: 2009-04-27 05:38:02 |
| L17QuickCheckMonads.ppt Path: Portland >> CS >> 410 Winter, 2008 Description: CS510AP Quick Check Monads QuickCheck Quick check is a Haskell library for doing random testing. You can read more about quickcheck at http:/www.math.chalmers.se/~rjmh/QuickCheck/ Overview Programmers define properties they would like to be tru... Date Added: 2009-04-27 05:39:36 |
| b407.n.b.pdf Path: Sveriges lantbruksuniversitet >> BISC >> 407 Fall, 2009 Description: NICHOLSON-BAILEY MODEL Assumptions: all parasitisms lead to host death a host death in generation t leads to appearance of a parasitoid adult in generation t+1 hosts that escape parasitism reproduce at R parasitoid functional response is lin... Date Added: 2009-04-27 05:41:30 |
| lessonplan4.doc Path: U. Houston >> CUIN >> 3112 Fall, 2008 Description: Lesso n Title: Author Leaps and Bounds of Growth! First and Last Name Lesson Overview Context Unit Title Real world applications Lesson Description Belinda Flores The World Around Us Students will learn how to keep track of the growth of their p... Date Added: 2009-04-27 05:41:33 |
| solution4.pdf Path: Stanford >> MATH >> 113 Fall, 2009 Description: Solutions Homework 4 Tuesday, February 3rd 2009 Math 113 2. Solution: Notice that even if the vector space is finite dimensional, the collection of subspaces might be infinite (consider the collection of all lines in R2 that pass through the origin... Date Added: 2009-04-27 05:45:13 |
| quiz3.pdf Path: Stanford >> MATH >> 024 Fall, 2009 Description: 18.024 QUIZ III (This quiz has two pages.) Write your name on the rst page of your solutions. Time: 50 minutes. Justify all steps. If you have any questions, please ask. GOOD LUCK! 1. (16 points) Suppose : [0, 1] R3 given by (t) = (t, t2 , t3 ), a... Date Added: 2009-04-27 05:45:39 |
| Haskell_Monads.pdf Path: BU >> CS >> 520 Fall, 2009 Description: Theres Something about Haskell Lecture Notes for CS520 The Haskell Language Haskell is a popular functional programming language Non-strict Pure Type classes Monads Higher ranked polymorphism and existential types Guarded recursive datatypes... Date Added: 2009-04-27 05:46:47 |
| 20040203_o01c_Yu.pdf Path: Stanford >> NENG >> 1029 Fall, 2009 Description: UNITED STATES DISTRICT COURT FOR THE DISTRICT OF MASSACHUSETTS WING KAM YU, on Behalf of Himself and All Others Similarly Situated, Plaintiff, vs. NETWORK ENGINES INC., JOHN CURTIS and DOUGLAS G. BRYANT, Defendants. ) ) ) ) ) ) ) ) ) ) ) ) ) CASE NO.... Date Added: 2009-04-27 05:49:39 |
| 2005613_f01c_King.pdf Path: Stanford >> EK >> 1034 Fall, 2009 Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK HERBERT T. KING, On Behalf of Himself and All Others Similarly Situated, Plaintiff, vs. EASTMAN KODAK COMPANY, DANIEL A. CARP, and ROBERT H. BRUST, Defendants. x : : : : : : : : : : : x Ci... Date Added: 2009-04-27 05:50:04 |
| 200796_r01k_023013.pdf Path: Stanford >> NTLD >> 1023 Fall, 2009 Description: US Court Civil Docket as of 9/6/2007 Retrieved from the court on Tuesday, April 15, 2008 U.S. District Court Southern District of New York (Foley Square) CIVIL DOCKET FOR CASE #: 1:02-cv-03013-LAK In Re: Ntl, Inc. Securities, et al v. , et al Assig... Date Added: 2009-04-27 05:50:15 |
| w02-ghc.pdf Path: Allan Hancock College >> COMP >> 1100 Fall, 2009 Description: Department of Computer Science, Australian National University COMP1100 Introduction to Programming and Algorithms Semester 1, 2009 Week 2 Practical Class Exercises Basic Unix and Haskell Objectives This session is an introduction to the Unix opera... Date Added: 2009-04-27 05:52:15 |
| blockrev_jpsbpp2006.pdf Path: Dallas >> SON >> 051000 Fall, 2009 Description: HIGHLIGHT Computer Simulation of Aqueous Block Copolymer Assemblies: Length Scales and Methods VANESSA ORTIZ,13 STEVEN O. NIELSEN,4 MICHAEL L. KLEIN,2,3 DENNIS E. DISCHER1,3 Biophysical Engineering and Polymers Laboratory, Department of Chemical and ... Date Added: 2009-04-27 05:57:30 |
| 2004811_r01k_0105425.pdf Path: Stanford >> DDDC >> 1019 Fall, 2009 Description: US District Court Civil Docket as of 08/11/2004 Retrieved from the court on Friday, August 18, 2006 U.S. District Court Southern District of New York (Foley Square) CIVIL DOCKET FOR CASE #: 1:01-cv-05425-SAS Deltathree.com IPO, et al v. Deltathree.... Date Added: 2009-04-27 05:59:44 |
| 015.pdf Path: Stanford >> C >> 8210281 Fall, 2009 Description: 277 SUMMARY SESSION OF THE GAS SAMPLING CALORIMETRY WORKSHOP Jeffrey A. Appel Fermi National Accelerator Laboratory P.O. Box 500, Batavia, Illinois 60510 ABSTRACT The sum~ary session of the Gas Sampling Calorimetry Workshop was a reVlew and discuss... Date Added: 2009-04-27 06:00:14 |
| 2008819_f01k_0802162.pdf Path: Stanford >> WAG >> 1039 Fall, 2009 Description: US District Court Civil Docket as of 08/19/2008 Retrieved from the court on Thursday, August 28, 2008 United States District Court Northern District of Illinois (Chicago) CIVIL DOCKET FOR CASE #: 1:08-cv-02162 Plumbers and Steamfitters Local No. 7 P... Date Added: 2009-04-27 06:00:31 |
| mt_sols.pdf Path: N.C. State >> CSC >> 570 Fall, 2008 Description: ECE/CSC 570 Section 001 Midterm test October 22, 2007 Qustions 1 4 carry 5 marks each. Answer by circling a, b etc. for multiple choice questions (for each question, circle all the correct answers). For the rest, answer briefly, in no more than one ... Date Added: 2009-04-27 06:03:15 |
| cb3872.pdf Path: Stanford >> ICPSR >> 3872 Fall, 2009 Description: U.S. Department of Justice Office of Justice Programs National Institute of Justice ICPSR 3872 Impact of Immigration on Ethnic-Specific Violence in Miami, Florida, 1997 Ramiro Martinez Jr. Florida International University Codebook First ICPSR Vers... Date Added: 2009-04-27 06:04:48 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 344 Fall, 2009 Description: 22978:16889:2256:64 59974:51693:2748:73 39690:28954:3304:73 39680:28579:3539:73 42011:28213:1069:64 60178:50723:2523:73 42000:27847:1079:64 41989:27480:1079:64 39445:29696:3795:73 60744:50366:823:54 42000:27123:1069:54 42000:26748:1026:64 41989:263... Date Added: 2009-04-27 06:05:05 |
| 9720609f1motion092598.pdf Path: Stanford >> LUMI >> 1009 Fall, 2009 Description: f 1 2 3 4 TOWER C. SNOW, J R . (State Bar No. 58342) PAUL R. BESSETTE (State Bar No. 139675) JAMES A. LICO (State Bar No. 169017) BROBECK, PHLEGER & HARRISON LLP One Market Spear Street Tower San Francisco, CA 94105 Telephone: (4 15) 442-0900 Attor... Date Added: 2009-04-27 06:05:38 |
| evaluation.pdf Path: RIT >> NTID >> 345 Fall, 2009 Description: Evaluation Form De La Salle College of Saint Benilde School of Deaf Education and Applied Studies Manila, Philippines Presenter(s): Robb Adams & Lee Twyman Title of Workshop: Counseling Workshops Total number of respondents: 31 Secondary: 1 Post-seco... Date Added: 2009-04-27 06:08:01 |
| petersen_etal_1999.pdf Path: Texas A&M >> ATMO >> 689 Fall, 2008 Description: AT690 Polarimetric Radar Meteorology Review by Larry Carey 9/16/04 Petersen, W. A., L. D. Carey, S. A. Rutledge, J. C. Knievel, N. J. Doesken, R. H. Johnson, T. B. McKee, T. Vonder Haar, and J. F. Weaver, 1999: Mesoscale and Radar Observations of the... Date Added: 2009-04-27 06:09:35 |
| problem1_solution_step2.pdf Path: Utah State >> MATH >> 0900 Fall, 2008 Description: Order of Operations with Dierent Signs Problem 1. Solve the following problem. 3 [(5 3) (5 + 3)] Solution Step 1: Simplify within the grouping symbols. Remember the denition of subtraction. You should wind up with: 3 (6) Solution Step 2: Finish u... Date Added: 2009-04-27 06:10:16 |
| Daily_04_2008.pdf Path: Wisconsin >> GEN >> 466 Fall, 2009 Description: Genetics 466, Lecture 4 Probability for Repeated Trials Objective: Learn how to calculate probabilities for repeated trials using the binomial, multinomial and Poisson formulae. Know what is meant by \"binomial distribution\" and how this distribution ... Date Added: 2009-04-27 06:12:33 |
| 060831NESR_HBBLW01.pdf Path: Wisconsin >> CAL >> 060831 Fall, 2009 Description: 05:45:18 05:13:48 time (UTC) 04:42:18 04:10:48 03:39:18 03:07:48 SHIS LW Noise Estimates 31Aug2006 UTC HBB Radiances (FBF) TOTAL NOISE ESTIMATE 1.5 1 0.5 600 700 800 900 1000 1100 1200 0 05:45:18 05:13:48 time (UTC) 04:42:18 04:10:48 03:... Date Added: 2009-04-27 06:12:43 |
| Nordstrom_1.ppt Path: Oregon State >> BA >> 495 Fall, 2008 Description: Nordstrom RetailMarketing BA495 Taking Customer Service One Step Further By Vida Atchulo Vanessa Caron Ashleigh Artoff Mission Statement In simple terms, fashion is what sells. With compelling merchandise and an unyielding commitment to customer se... Date Added: 2009-04-27 06:13:14 |
| 565syllab-07-v4.doc Path: Wisconsin >> ME >> 565 Fall, 2009 Description: Revision 4: October 24th, 2007 NEEP-565: POWER PLANT TECHNOLOGY FALL 2007: INSTRUCTOR: Monday, Wednesday and Friday 8:50 to 9:40am Class may begin at 8:30am to make up for missed classes Michael Corradini, ERB-151 (3-1648) corradini@engr.wisc.edu Of... Date Added: 2009-04-27 06:13:36 |
| HW1.pdf Path: Caltech >> EE >> 160 Winter, 2008 Description: EE 160 Communication System Fundamentals draft of March 30, 2000 Homework Assignment 1 (Final version) Due (in class) 1pm April 5, 2000 Reading: Haykin, Chapter 3, Secs. 3.13.3 R. J. McEliece 162 Moore Problems to Hand In: Problem 1. In class on Ma... Date Added: 2009-04-27 06:14:03 |
| short.pdf Path: Maryville MO >> DRURYE >> 121608 Fall, 2009 Description: STRESS RESPONSE AND HYPOTHETICAL GENES IN DESULFOVIBRIO VULGARIS HILDENBOROUGH Elliott C. Drury Dr. Judy D. Wall, Thesis Advisor ABSTRACT The sulfate-reducing bacteria have a significant impact on the environment and the economy, necessitating furth... Date Added: 2009-04-27 06:14:34 |
| Behavioral_Genetics.ppt Path: Arizona >> VSC >> 330 Fall, 2009 Description: Human behavioral Genetics Sir Francis Galton (1822-1911) first one to study heredity and human behavior. Heredity is the study of biological variations (genetics). Human behavioral genetics seeks to understand both the genetic and environmental contr... Date Added: 2009-04-27 06:15:00 |
| lecture12.pdf Path: University of Illinois, Urbana Champaign >> ASTRO >> 330 Fall, 2009 Description: Astronomy 330 This class (Lecture 12): Origin of Life Next Class: Origin of Life HW 5 is due Sunday Good job class! Average: 85% Median: 87% Dont forget, there is a chance to increase score on the final exam. Exam 1 Music: Bring Me to Life Evanesce... Date Added: 2009-04-27 06:22:36 |
| 23 52 33.doc Path: UT MD Anderson Cancer Center >> DIV >> 2 Fall, 2009 Description: MDACC Project No. XX-XXXX A/E Name A/E Project No. SECTION 23 52 33 HOT WATER BOILERS MDACC PROJECT NAME Issue Description Month, 00, 0000 PART 1 - GENERAL 0.1 RELATED DOCUMENTS A. Drawings and general provisions of the Contract, including General... Date Added: 2009-04-27 06:23:24 |
| 23 73 13.doc Path: UT MD Anderson Cancer Center >> DIV >> 2 Fall, 2009 Description: MDACC Project No. XX-XXXX A/E Name A/E Project No. SECTION 23 73 13 MODULAR AIR HANDLING UNITS MDACC PROJECT NAME Issue Description Month, 00, 0000 PART 1 - GENERAL 0.1 RELATED DOCUMENTS A. Drawings and general provisions of the Contract, includin... Date Added: 2009-04-27 06:23:27 |
| Rumen.ppt Path: Western Kentucky University >> AGRI >> 101 Fall, 2008 Description: The ruminant animal Rumen Reticulum Rumen Reticulum SMALL INTESTINE ESOPHAGUS ABOMASUM gas VFAS mat layer RUMEN Rumen microbes fluid OMASUM RETICULUM RumenDigestion Fiberdigesters 4typesoffiber lignin~0%digestible cellul... Date Added: 2009-04-27 06:24:00 |
| Lect_15.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 497 Fall, 2008 Description: ECE 497 JS Lecture - 15 Tools Spring 2004 Jose E. Schutt-Aine Electrical & Computer Engineering University of Illinois jose@emlab.uiuc.edu ECE 497-JS, Spring 2004 Copyright by Jose E. Schutt-Aine , All Rights Reserved 1 Announcements Thursday Ma... Date Added: 2009-04-27 06:25:39 |
| eg Root of z.pdf Path: UMBC >> M >> 261 Fall, 2009 Description: FINDING THE N-TH ROOTS OF A COMPLEX NUMBER EXAMPLES REMEMBER: The n solutions of the equation wn = r (cos + j sin ) are: wn = n r (cos + k 360 n + j sin + k 360 n ) with k = 0, 1, 2, 3, ., ( n 1) Example # 1 Solve w3 = 5(cos 60 + j sin 6... Date Added: 2009-04-27 06:27:21 |
| Chapter 3.doc Path: St. Francis IL >> CHEM >> 100 Fall, 2009 Description: Chapter 3: Stoichiometry Chemical Equations: Consider the reaction between H2 and O2: Reactants Products 2H2 + O2 2H2O Coefficients used to balance the # of atoms of each type on both sides of the equation (atoms can neither be created nor destroyed... Date Added: 2009-04-27 06:29:05 |
| 260 2009 Lecture 9.pdf Path: Sveriges lantbruksuniversitet >> CHEM >> 260 Fall, 2009 Description: Expectation (Average) Values Operator represents a measurement of an observable operates on wave function value Expectation value = average value of many measurements Average value (Expectation value) = d d Integrate over all space Norm... Date Added: 2009-04-27 06:29:33 |
| acma335_2006-3.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 335 Fall, 2009 Description: ACMA ACMA 335 Risk Theory Fall 2006 Day Course Students requiring accommodations as a result of disability, must contact the Centre for Students with Disabilities 604-291-3112 or csdo@sfu.ca Instructor: Dr. Cary Tsai Prerequisite: ACMA 320 Requi... Date Added: 2009-04-27 06:30:19 |
| stat270_2008-1.pdf Path: Sveriges lantbruksuniversitet >> STAT >> 270 Fall, 2009 Description: STAT STAT 270 Introduction to Probability and Statistics Spring 2008 Day Course Statistics Workshop Students requiring accommodations as a result of disability, must contact the Centre for Students with Disabilities 778-782-3112 or csdo@sfu.ca In... Date Added: 2009-04-27 06:30:56 |
| 11-2.pdf Path: Sveriges lantbruksuniversitet >> MATH >> 152 Fall, 2009 Description: Section 11.2 C11S02.006: The most obvious pattern is that an = C11S02.008: One pattern is that an = 15 2 1 for n n2 + 1 1. 5 2 (1)n . Another is that for n 1. an = 5 1 + C11S02.012: This sequence diverges because an = as n +. 1 (1)n 2 n3... Date Added: 2009-04-27 06:31:06 |
| petersen62.pdf Path: Sveriges lantbruksuniversitet >> CMPT >> 888 Fall, 2009 Description: ... Date Added: 2009-04-27 06:31:16 |
| PS1_Solutions.pdf Path: Toledo >> PHY >> 357 Fall, 2009 Description: ... Date Added: 2009-04-27 06:31:59 |
| topics-fall07.rtf Path: Toledo >> STA >> 442 Fall, 2009 Description: Topics covered in STA 442/2101 Fall Term 2007 Linear regression (Ex G): fitting, transformation of variables, interaction, residuals, influence, model selection, analysis of variance, multicollinearity, model choice via AIC and stepwise selection Bal... Date Added: 2009-04-27 06:33:10 |
| Lecture39.pdf Path: Toledo >> ENV >> 200 Fall, 2009 Description: Of all the social and natural resource crises we humans face, the water crisis is the one face that lies at the heart of our survival (and that of planet Earth) p ) - UN World Water Development Report 2003 Of all the planet s renewable resources, f... Date Added: 2009-04-27 06:33:45 |
| eakpinar.pdf Path: Allan Hancock College >> VI >> 6 Fall, 2009 Description: DOU ANADOLU BLGES NDE ALTERNAT F TUR ZM MERKEZ OLMAYA ADAY B R LE: KEMAL YE Erdal AKPINAR ZET Dnyada ve Trkiyede turizm sektr, deniz-kum-gne eksenli klasik turizm anlayna alternatif olabilecek yeni araylar ierisine girmitir. lkemizde turizm etkinlikl... Date Added: 2009-04-27 06:34:26 |
| 11mustafaguler.pdf Path: Allan Hancock College >> IV >> 4 Fall, 2009 Description: AH RESUL ZV YES VE H SARCIK\'A A T BELGELER Mustafa Gler* ZET Mahalli tarih alimalari bilhassa sosyal tarihilik aisindan son derece nemlidir. Byk merkezlerden balayarak kasabalar ve kylerin tarihi dokularini konu alan bu alimalar son yillarda hayli f... Date Added: 2009-04-27 06:34:31 |
| AbdullahKose.pdf Path: Allan Hancock College >> VII >> 7 Fall, 2009 Description: TRK YEDE GELENEKSEL KIRSAL KONUT PLANLARINDA GEBE TRK KLTR ZLER Traces of Nomadic Turkish Culture on the Plans of Traditional Rural Houses in Turkey Abdullah KSE* ZET Konutlar yap malzemesi, ekil ve plan bakmndan bir yerden dierine deitii iin corafya... Date Added: 2009-04-27 06:34:46 |
| enhance.doc Path: U. Houston >> CUIN >> 6345 Fall, 2008 Description: Technology Does Enhance Learning When technology is successfully integrated within the curriculum, it is very effective. Results can be seen in student performance, graduation rates, assessment test results, and the quality of our workers. (Cyndi Dun... Date Added: 2009-04-27 06:36:00 |
| CSCE-491-Syllabus.pdf Path: Los Angeles Southwest College >> CSCE >> 491 Fall, 2009 Description: CSCE 491 Capstone Project in Computer Engineering Spring 2002 Course Description: We will analyze and design selected portions of a wireless local area network (WLAN) medium access control (MAC) function block. The material in this course is premised... Date Added: 2009-04-27 06:36:52 |
| Lecture34_AT529.pdf Path: Arizona >> ATMO >> 529 Fall, 2008 Description: ... Date Added: 2009-04-27 06:37:14 |
| Interim+progress+review.doc Path: East Los Angeles College >> MI >> 7677 Fall, 2009 Description: Interim progress review Michael Ioannidis A big problem of our days is the greenhouse effect. Scientist believe that it is natural and it would happen but we cannot deny that we help a lot to make this problem bigger and worse. The UK government is ... Date Added: 2009-04-27 06:37:43 |
| paper5.ppt Path: Cal Poly Pomona >> ECON >> 190 Fall, 2009 Description: Currency Unions Andrew Rose ? OLD NEW RESULTS ? ROBUST Q: So tell me Rose, Why do Currency Unions matter? A: I have no clue! Q: Why do YOU think Currency Unions Matter? Watch Out Now Questions Is this simply a case of trade diversion? Wh... Date Added: 2009-04-27 06:37:47 |
| ps1_05sol.pdf Path: Cornell >> ASTRO >> 342 Fall, 2008 Description: EAS/Astro 342 Atmospheric Dynamics Problem Set #1 Solution Notes 1. Hurricane. The pressure drops by 50 hPa = 5000 Pa. Thus the average gradient is !p 5 \" 10 3 Pa = = 5 \" 10 #2 kg m -2 s-2 . !r 10 5 m v 2 1 \"p = . The data Appendix at the back of th... Date Added: 2009-04-27 06:39:23 |
| BGP-rev2.pdf Path: Western Michigan >> CS >> 6030 Fall, 2008 Description: Exterior Gateway Protocols (BGP) Internet Structure Large ISP Stub Dial-Up ISP Stub Small ISP Large ISP Stub Stub Autonomous Systems (AS) Internet is not a single network! The Internet is a collection of networks, each controlled by different a... Date Added: 2009-04-27 06:39:24 |
| lect_13.pdf Path: Wisconsin >> ME >> 368 Fall, 2008 Description: ... Date Added: 2009-04-27 06:39:37 |
| Summary_Semester_Review.pdf Path: Wisconsin >> BIOCHEM >> 651 Fall, 2008 Description: BIOCHEMISTRY 651 OUTLINE OF IMPORTANT TOPICS Gel electrophoresis-GEP Charged particles, migration in a electric field, and heating. Importance of buffer pH and ionic strength to the motility of ions. Use of the Henderson-Hasselbalch equation to deter... Date Added: 2009-04-27 06:39:54 |
| hw5.doc Path: DePaul >> ECT >> 582 Fall, 2009 Description: Homework 5, ECT582 Calvin Chang 11/3/2003 Assumptions: -To use the Radio 4 U device, one must plug in a hardware token and input the correct corresponding pin number. A pin number is 10 characters long -Token specific Private key, Public Key, certifi... Date Added: 2009-04-27 06:43:32 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now! |
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses. |
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now! |
||
