Course Solutions And Notes - 243CourseList 39
| LactMed_Jan_2007.pdf Path: Idaho State >> MSTH >> 160 Spring, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-09 20:10:29 |
| LactMed_Jan_2007.pdf Path: Idaho State >> R S >> 450 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-11 20:40:40 |
| LactMed_Jan_2007.pdf Path: Idaho State >> NTD >> 457 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-09 20:10:36 |
| LactMed_Jan_2007.pdf Path: Idaho State >> HCA >> 110 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-11 20:40:43 |
| LactMed_Jan_2007.pdf Path: Idaho State >> BIOL >> 411 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-09 20:11:00 |
| LactMed_Jan_2007.pdf Path: Idaho State >> PTOT >> 514 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-12 05:10:18 |
| LactMed_Jan_2007.pdf Path: Idaho State >> IDEP >> 523 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-09 20:11:32 |
| LactMed_Jan_2007.pdf Path: Idaho State >> NURS >> 425 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-10 17:52:58 |
| LactMed_Jan_2007.pdf Path: Idaho State >> NURS >> 426 Fall, 2008 Description: Why a Database for Breastfeeding and Drugs? .it is critical that up-to-date information about the effects of medication use during pregnancy and lactation and the management of maternal conditions be available to women and healthcare providers. A com... Date Added: 2009-01-10 17:52:58 |
| P05-3002.pdf Path: Penn >> P >> 05 Fall, 2009 Description: Accessing GermaNet Data and Computing Semantic Relatedness Iryna Gurevych and Hendrik Niederlich EML Research gGmbH Schloss-Wolfsbrunnenweg 33 69118 Heidelberg, Germany http:/www.eml-research.de/ gurevych Abstract We present an API developed to acc... Date Added: 2009-04-15 21:38:16 |
| dp89189.pdf Path: Wisconsin >> IRP >> 1989 Fall, 2008 Description: University of Wisconsin-Madison IRP Discussion Papers Institute for Research on Poverty Discussion Paper no. 891-89 THE EFFECT OF ROUTINE INCOME WITHHOLDING ON CHILD SUPPORT COLLECTIONS Irwin Garfinkel and Marieka M. Klawitter Institute for Resea... Date Added: 2009-02-11 16:37:54 |
| ._m5l1 Path: Berkeley >> UGBA 10 >> 08403 Spring, 2009 Description: # #2# #R#SLD8PPT3# ... Date Added: 2009-03-22 21:04:02 |
| mss06-05-p02.pdf Path: UNC >> MSS >> 06 Fall, 2008 Description: Copyright 2005 by the University Library, The University of North Carolina at Chapel Hill, all rights reserved. Documenting the American South (http:/docsouth.unc.edu/index.html) ... Date Added: 2009-02-18 01:50:17 |
| CRD 511 for SPRING 2007 KEY.doc Path: Alabama >> AHE >> 625 Fall, 2008 Description: CRD 511 Beginning Reading The University of Alabama Gadsden Center Spring 2007 Dr. Dana Key danakey@bama.ua.edu 256-546-2886 Office Hours by Appointment Catalog course description: This course examines the nature of literacy development and research-... Date Added: 2009-01-09 15:40:05 |
| CRD 511 for SPRING 2007 KEY.doc Path: Alabama >> CD >> 511 Fall, 2008 Description: CRD 511 Beginning Reading The University of Alabama Gadsden Center Spring 2007 Dr. Dana Key danakey@bama.ua.edu 256-546-2886 Office Hours by Appointment Catalog course description: This course examines the nature of literacy development and research-... Date Added: 2009-02-02 16:22:33 |
| 060526trinidad.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / Home UK - Trinidad\'s grand industrial plan under threat from environmentalistsSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Friday May 26 2006 . All times are London time. Roger Bove Edit Profile Take a Tour Log out Home UKP... Date Added: 2009-02-11 18:41:46 |
| 060526trinidad.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / Home UK - Trinidad\'s grand industrial plan under threat from environmentalistsSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Friday May 26 2006 . All times are London time. Roger Bove Edit Profile Take a Tour Log out Home UKP... Date Added: 2009-02-11 20:00:44 |
| hw04 Path: N.C. State >> CSC >> 200 Spring, 2008 Description: 1 A. Damaged by a type of liquid substance B. Stolen C. Eaten by my dog 2 A. Always us a backup hard drive 3 A. Lock the diary B. Hide the diary C. Put a password on the diary (voice activated) ... Date Added: 2008-03-31 07:39:55 |
| 041203tirana.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: seeurope.net : View Story Home | About Us | Ad Info | Contacts | Top 100 | Newsletter | NEWS TODAYWednesday, December 8, 2004 The Event: SEEF 2004 NATO Review Investment Guide Country Ratings Investment Projects Calendar of Events SEE Countries SEE ... Date Added: 2009-02-11 20:17:27 |
| CS 120 INTRO TO SOCIOLOGY OF THE CHICANO.pdf Path: Palomar >> CS >> 120 Fall, 2008 Description: ... Date Added: 2009-02-02 15:21:33 |
| 051118euro.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: EU: Hungary still may join euro by 2010Careers Main News Archive Compare Cost of Living Compare Salaries Exec MBA Search EMBA Comparator Careers Videos Newsletter Sponsored by: B-Schools Main MBA Insider MBA Blogs Calendar Forums MBA Rankings & Profi... Date Added: 2009-02-11 20:11:23 |
| 09.07_pp9-14.pdf Path: Texas >> PDF >> 1875 Fall, 2009 Description: ept. 7, 1875.] CONSTITUTIO-AL CONVEITIOI. 9 followin,a members: Messrs. Stockdale, Dohoney, Norvell, West, Ferris, Flournoy and Fleming. The President appointed the fo]lowin committee, under Mr. Dohoneys resolution on the subject of standing commi... Date Added: 2009-03-19 00:26:10 |
| 09.07_pp9-14.pdf Path: Caribbean >> LAW >> 1875 Fall, 2008 Description: ept. 7, 1875.] CONSTITUTIO-AL CONVEITIOI. 9 followin,a members: Messrs. Stockdale, Dohoney, Norvell, West, Ferris, Flournoy and Fleming. The President appointed the fo]lowin committee, under Mr. Dohoneys resolution on the subject of standing commi... Date Added: 2009-03-19 00:26:10 |
| staiger.pdf Path: Berkeley >> NSF >> 99 Fall, 2008 Description: Preliminary and incomplete Do not quote Estimating treatment effects with observational data: A new approach using hospital-level variation in treatment intensity Mark McClellan Stanford University and the NBER Douglas Staiger Dartmouth College and... Date Added: 2009-02-17 17:43:15 |
| lecture4.621.pdf Path: Penn >> STAT >> 621 Fall, 2008 Description: Fall Semester, 2001 Robert Stine Statistics 621 Lecture 4 1 Multiple Regression Preliminaries Grading on this and other assignments Assignment will get placed in folder of first member of Learning Team. Will post solution set this week. Please ... Date Added: 2009-04-15 21:00:07 |
| 76.pdf Path: UCLA >> ANDERSON >> 4150 Fall, 2008 Description: ... Date Added: 2009-02-11 22:00:58 |
| ProcessOptionsAZBuyWays1.doc Path: Arizona >> QUIZ >> 2 Fall, 2009 Description: Process Options for Ordering/ Approving From AZ BuyWays -Multiple Vendor website from Purchasing1. Faculty approve the purchase ordered by a member of their staff a. Support Person b. Member of their research staff c. Accountant This requires that th... Date Added: 2009-04-15 22:44:03 |
| ProcessOptionsAZBuyWays1.doc Path: Arizona >> CHEM >> 546 Fall, 2008 Description: Process Options for Ordering/ Approving From AZ BuyWays -Multiple Vendor website from Purchasing1. Faculty approve the purchase ordered by a member of their staff a. Support Person b. Member of their research staff c. Accountant This requires that th... Date Added: 2009-01-09 15:50:16 |
| ProcessOptionsAZBuyWays1.doc Path: Arizona >> CHEM >> 687 Fall, 2008 Description: Process Options for Ordering/ Approving From AZ BuyWays -Multiple Vendor website from Purchasing1. Faculty approve the purchase ordered by a member of their staff a. Support Person b. Member of their research staff c. Accountant This requires that th... Date Added: 2009-01-09 15:50:16 |
| ProcessOptionsAZBuyWays1.doc Path: Arizona >> PHYS >> 560b Fall, 2008 Description: Process Options for Ordering/ Approving From AZ BuyWays -Multiple Vendor website from Purchasing1. Faculty approve the purchase ordered by a member of their staff a. Support Person b. Member of their research staff c. Accountant This requires that th... Date Added: 2009-01-09 15:50:16 |
| 210Neuroanatomy.ppt Path: Palomar >> PSYC >> 210 Spring, 2008 Description: Brain Organization Spinal Cord Anatomy Dorsal Ventral Dorsal Horn: Sensory information in Ventral Horn: Motor information out Brainstem: arousal center (ARAS) sensory in pathway motor out pathway Midbrain Superior Colliculus Inferior Colliculus Po... Date Added: 2009-01-11 17:26:31 |
| assessment.pdf Path: Duke >> STA >> 294 Fall, 2008 Description: Probability Assessment Topics: Causal independence Accuracy of probability assessment for diagnosis. Causal Independence Flu Rabies Ear Infection Bronchitis Fever Discrete distn: ( S 1 ) D 1 D n 2 independent parameters. n Assessments: W... Date Added: 2009-01-10 02:55:22 |
| Chapter 5 Path: Michigan State University >> STT >> 200 Summer, 2008 Description: Chapter 5 Describing Distribution Numerically ActivStats: 5-1 to 5-4 Read: Chapter 5 Measures of the center: midrange median mean Measures of the spread: range interquartile range (IQR) variance standard deviation Data: 45 46 49 35 76 80 89 94 37 ... Date Added: 2008-07-25 14:44:37 |
| cheat sheet exam 1 Path: Texas >> MAN >> 320F Summer, 2008 Description: Manager -Someone who coordinates and oversees the work of other people so that organizational goals can be accomplished. first-line managers -Managers at the lowest level of the organization who manage the work of non-managerial employees. middle man... Date Added: 2008-07-08 18:29:31 |
| 07F CHEM 14CL Exam1practicequestions-key Path: UCLA >> CHEM >> 14CL Fall, 2007 Description: Chemistry14CLExam1StudyQuestionsKey Fall2007 Note:Distillation,whichwasdiscussedinLecture5andstudiedinlabperiodsonNovember1,2will notbetestedonthemidterm.Itwillbeincludedonthefinalexam.Studentswithsurnames beginningwithAthroughPawnerwilltaketheexamin... Date Added: 2009-02-02 18:18:06 |
| survey.pdf Path: Duke >> PSY >> 117 Fall, 2008 Description: PSY 117 Fall 2008 Last 4 digits of SSN: _ Sex (please circle): MALE Year in school (please circle): or FEMALE SOPHOMORE JUNIOR SENIOR FRESHMAN What dorm do you live in? (please fill in, or write off-campus) _ How many math (i.e., QS) classes have y... Date Added: 2009-01-11 22:14:43 |
| quiz2_S07_solutions Path: Princeton >> MAT >> 202 Spring, 2008 Description: Princeton University Department of Mathematics MAT 202 Linear Algebra with Applications QUIZ 2 Spring 2007 SOLUTIONS 0 1 2 (1) Let A = 1 1 and b = 3. 1 1 5 (a) Find the least-squares solution of the system Ax = b. (b) What is the vector in the... Date Added: 2008-04-28 11:34:38 |
| Huang.pdf Path: Michigan State University >> CEM >> 850 Fall, 2008 Description: Organic Chemistry, Synthetic Chemistry, Nanoscience and Immunology Iterative One-Pot Oligosaccharide Synthesis, Huang, X., Huang, L., Wang, H., Ye, X.-S., Angew. Chem. Int. Ed. 2004, 43, 5221-5224. Highly Ecient Syntheses of Hyaluronan Oligosaccharid... Date Added: 2009-01-11 16:37:41 |
| Age of Uncertainty in CIA Path: Duke >> POLI SCI >> Poli Sci 1 Spring, 2008 Description: The Age of Uncertainty After the assassination of Kennedy, Intel community had a lot of failures. TET offensive and Vietnam war Nixon didn\'t like the CIA- thought they were liberals who tried to undermine his election DCI and 800 Pound Gorilla Mi... Date Added: 2008-04-20 21:55:10 |
| FNP-SWRegion06.pdf Path: Missouri (Mizzou) >> EXTENSION >> 2005 Fall, 2008 Description: From: Sent: Location: Subject: Egan, Terry A. Friday, April 07, 2006 2:30 PM Southwest Missouri Family Nutrition Education Impact for 2005 Making a Difference in Nutrition and Physical Activity for Youths The Family Nutrition Education program for ... Date Added: 2009-02-17 22:47:37 |
| Franklin Roosevelt and the new deal Path: Ohio State >> HIST >> 152 Spring, 2007 Description: Franklin Roosevelt and the new deal. New definition of liberals by the time that Roosevelt leaves office. In the 30\'s. most of the liberals are the democrats. The lodges and the Rockefellers are still republicans. Mr. republican/mr. conservative is b... Date Added: 2008-04-19 18:42:02 |
| 493.pdf Path: University of Illinois, Urbana Champaign >> BIOE >> 493 Fall, 2008 Description: Course Schedule - Spring 2007 Bioengineering 493 Senior Research Project Credit: 2 to 4 hours. Individual research project under the guidance of a faculty member. Intended for students planning to complete BIOE 499 (Senior Thesis) in the following se... Date Added: 2009-02-02 18:18:48 |
| Math 121 Chapter2 Section1 Handout.doc Path: University of South Dakota >> MATH >> 121 Fall, 2008 Description: Chapter 2, Section 1 Handout FUNCTIONS One of the most important ideas in mathematics is the function concept, looking at the relationship between two sets of elements. In order to study mathematics beyond algebra, we need to have a firm understandin... Date Added: 2009-02-02 20:12:25 |
| kiceniuk.pdf Path: Cornell >> AAS >> 347 Fall, 2008 Description: ... Date Added: 2009-01-09 07:51:35 |
| midterm_S05_solutions Path: Princeton >> MAT >> 202 Spring, 2008 Description: MATH 202 - MIDTERM EXAM Wednesday, March 9, 2005, 7:30PM-9:00PM The average on this exam was 59 percent. 1 -1 2 1 3 . 1. (16 points) Consider A = 2 1 1 1 (a) Compute A-1 . A-1 2 -3 5 = -1 1 -1 -1 2 -3 (b) If B is a 3 3 matrix such that A... Date Added: 2008-04-28 11:34:56 |
| NUR 106 prereq.doc Path: Palo Verde College >> ART >> 105 Fall, 2008 Description: PALO VERDE COLLEGE PREREQUISITE/COREQUISITE/ADVISORY JUSTIFICATION Course: NUR 106 Introduction to Pharmacology II 1. SEQUENTIAL: List the specific skills and knowledge a student must possess in order to be ready to take the course. These skills must... Date Added: 2009-01-12 04:00:47 |
| NUR 106 prereq.doc Path: Palo Verde College >> ART >> 125 Fall, 2008 Description: PALO VERDE COLLEGE PREREQUISITE/COREQUISITE/ADVISORY JUSTIFICATION Course: NUR 106 Introduction to Pharmacology II 1. SEQUENTIAL: List the specific skills and knowledge a student must possess in order to be ready to take the course. These skills must... Date Added: 2009-01-12 04:00:47 |
| 85-685.pdf Path: Cornell >> CS >> 685 Fall, 2008 Description: ... Date Added: 2009-02-02 14:00:08 |
| phy3050handout_lecture14_atomicstructure.pdf Path: N.E. Illinois >> PHY >> 3050 Fall, 2009 Description: Atomic Structure Elements Only about 118 different elements make up all the materials we know Greater than 99% of matter on earth is formed by about elements Life mostly is most abundant element in universe Page 1 First Photo of Individual Atoms... Date Added: 2009-04-15 22:14:31 |
| sa16.pdf Path: San Jose State >> MATH >> 112 Fall, 2008 Description: u r R H @ F` G i 4 V ` i R P r b F` r CCf$1W1qp4 p@ qh1fWQ6 | | { w 7p R H @V V f$W16 p@ G F @ X @ i u F` b` i 4 R P H H @ G R i R H F 1paYqW7eqp9Q$eCQhfgCR 1W1pqTpjqhfWCh1QEh(au r 6` G @ i S 4 R i R P r` 8 R P i R 6 R P H R w ... Date Added: 2009-01-11 18:09:50 |
| homework3.doc Path: UNC >> ENST >> 202 Fall, 2008 Description: ENST 202, 3rd homework for Rich Kamens, Due Thurs. April 15,2008 1a. Write the reactions for the formation of PAN. 1b. How does the PAN reaction pathway tie up NO2 when it is cool, or give NO2 back to the atmosphere when it is warm? 2. Although we di... Date Added: 2009-02-18 01:44:21 |
| it03march.pdf Path: Minnesota >> IT >> 03 Fall, 2008 Description: IEEE TRANSACTIONS ON INFORMATION THEORY, VOL. 49, NO. 3, MARCH 2003 707 Complex-Field Coding for OFDM Over Fading Wireless Channels Zhengdao Wang, Member, IEEE, and Georgios B. Giannakis, Fellow, IEEE AbstractOrthogonal frequency-division multiplex... Date Added: 2009-02-17 20:41:05 |
| it03march.pdf Path: Minnesota >> IT >> 04 Fall, 2008 Description: IEEE TRANSACTIONS ON INFORMATION THEORY, VOL. 49, NO. 3, MARCH 2003 707 Complex-Field Coding for OFDM Over Fading Wireless Channels Zhengdao Wang, Member, IEEE, and Georgios B. Giannakis, Fellow, IEEE AbstractOrthogonal frequency-division multiplex... Date Added: 2009-02-17 20:41:05 |
| September 18th Path: Delaware >> SOCI >> 201 Fall, 2007 Description: September 18th, 2006 Soci201-16 Victor Perez Measurment o Validity- truth in measurement If measures aren\'t valid, conclusions cannot be valid o Reliability- consistency in measurement In order to have a valid measurement it must be reliable If so... Date Added: 2008-04-07 15:44:37 |
| P11.2144.pdf Path: NYU >> P11 >> 2144 Fall, 2008 Description: ROBERT F. WAGNER GRADUATE SCHOOL OF PUBLIC SERVICE NEW YORK UNIVERSITY P11.2144, Spring 2005 Prof. Dick Netzer1 DEBT FINANCING AND MANAGEMENT FOR PUBLIC ORGANIZATIONS This course is mostly about debt financing by state and local governments and non... Date Added: 2009-02-02 15:01:11 |
| 9-part2-intelligence Path: N.C. State >> PSY >> 200 Spring, 2008 Description: Intelligence. Standardization, standardization is the process of establishing rules for administering a test, and for interpreting the scores. An important step in standardizing a test is determing the norms, norms are descriptions of how frequently ... Date Added: 2008-04-01 20:18:00 |
| Bio lab write-up Path: MSOE >> BIOLOGY >> 100 Spring, 2008 Description: Concentration of Cell Division by Location in an Onion Root Tip Adam Klagues Brian Richard Kyongmin Song Milwaukee School of Engineering BI-102 Section 002 October 5, 2008 Abstract This study was conducted to determine if the concentration of cells ... Date Added: 2008-10-12 23:12:43 |
| 4.27 Physics 202 Path: Penn State >> PHYS >> 212 Spring, 1999 Description: Physics 202 Tuesday, April 27, 1999 Announcements: Recitation and Lab Grades: Recitation overall score (HW and quizzes) will be normalized to an average of 75% for each instructor. The lowest quiz and homework assignment will be dropped. Lab reports... Date Added: 2008-02-21 16:48:02 |
| ethics1 Path: Rhode Island >> PHL >> PHL Spring, 2008 Description: Jeffrey DArrigo Ethics journal PHL 212 Kant readings from (9/11-9/18) Section 1 The introduction of Good Will, Duty, and the transition from Common Sense Knowledge of Morals to the Philosophical Kants foundations of the meta physics of morals is idea... Date Added: 2008-11-07 10:25:05 |
| app.pdf Path: Pasadena >> ESL >> 246 Fall, 2008 Description: WRITING ACROSS THE CURRICULUM INSTRUCTIONAL AIDE APPLICATION Name:_ Tel. _ E-mail: _ Soc. Sec. # _ 1. Describe your educational background - degrees earned, present academic status, and content specialization, e.g. History, Math, Music, Psychology... Date Added: 2009-01-10 17:22:10 |
| Nov_14_sec_11_1.pdf Path: Minnesota >> MATH >> 1151 Fall, 2008 Description: Section 11.1 - Method of Elimination Friday, November 14, 2008 12:23 PM Elimination Method: - Multiply or divide both sides of one equation by the same (nonzero) number - Replace any equation by the sum or difference of that equation and a nonzero m... Date Added: 2009-02-17 20:31:03 |
| notes4.pdf Path: SUNY Stony Brook >> CSE >> 626 Fall, 2008 Description: ... Date Added: 2009-01-09 07:16:59 |
| notes4.pdf Path: SUNY Stony Brook >> ESE >> 536 Fall, 2008 Description: ... Date Added: 2009-01-09 07:16:59 |
| Ispysexism Path: Victoria AU >> WOMEN'S S >> WS 104 Spring, 2008 Description: Dust off your spectacles, binoculars, or magnifying glass; it\'s time to lend your 20/20 to the fight against sexism, racism, homophobia, ageism, ableism in your community. The first step is to sit up and take notice of what\'s going on around you. How... Date Added: 2008-04-20 15:12:40 |
| 1091.pdf Path: UMBC >> ID >> 385 Fall, 2008 Description: Role Based Access Control and OWL T. Finin1 , A. Joshi1 , L. Kagal2, J. Niu3 , R. Sandhu3 , W. Winsborough3 , B. Thuraisingham4 1 University of Maryland, Baltimore County 2 Massachusetts Institute of Technology 3 University of Texas at San Antonio 4... Date Added: 2009-02-17 23:11:27 |
| CNS Project Plan example.pdf Path: Rutgers >> 790 >> 569 Fall, 2008 Description: Year Three Plan I. Cover sheet and Program Summary II. Year Three Objectives A. _X_ Community Impact _ Participant Impact _ Institutional Impact 1. What work will be done? What activities will the program undertake? (a) CASE will increase number of s... Date Added: 2009-01-12 05:26:16 |
| info.pdf Path: Okaloosa-Walton >> MAC >> 1105 Fall, 2009 Description: OKALOOSA-WALTON COLLEGE Department of Mathematics MAC 1105 College Algebra Spring 2007 Prerequisites: MAT 1033A with \"C\" or better Course Description: Prerequisites: MAT 1033A with \"C\" or better. Function-based college algebra course which will incl... Date Added: 2009-04-15 23:42:01 |
| Kroenke_TIF_ch07 Path: North Dakota >> ISYS >> 317 Spring, 2008 Description: Chapter 7 Experiencing MIS 1 Chapter 7 Competitive Advantage with Information Systems within Organizations True-False Questions 1. A calculation system is a type of application called an island of automation. 2. Independent, isolated systems are g... Date Added: 2008-04-19 00:10:18 |
| Week9.pdf Path: UCSB >> HIST >> 4b Winter, 2008 Description: Week 9 1 Week 9: 1. The Witches of Huntingdon, Their Examinations and Confessions Introduction Historians refer to the mass persecution of alleged witches during the sixteenth and seventeenth centuries as the great European witch-hunt (or craze or ... Date Added: 2009-01-10 02:05:07 |
| Chapter 3 Activity.doc Path: UCF >> ACG >> 3131 Fall, 2008 Description: Chapter 3 In-Class Activity Part 1: Prepare a Classified Balance Sheet for Blueville Nursery. The information below lists their account balances at the end of the year on 12/31/06. (See back for Part 2.) Equipment, $140,000 Cash, $16,000 Common Stock... Date Added: 2009-01-12 05:56:16 |
| Energy1.rtf Path: S.F. State >> CFS >> 349 Fall, 2008 Description: Alternative Energy Systems Active Solar Systems Sunday, November 18, 2001 Definition of Active An active solar system uses some type of mechanical power to collect, store, and distribute the sun\'s heat to a building. Active solar equipment includ... Date Added: 2009-02-17 19:04:56 |
| Trig 135 printable syllabus.pdf Path: Antelope Valley College >> MATH >> 080 Spring, 2008 Description: SYLLABUS Fall 2008 COURSE Math 135 (CRN 73780) Trigonometry (3 units) Completion of MATH 102, or eligibility for MATH 135 and completion of MATH 080, and eligibility for college level reading or satisfactory completion of ENGL 101. Jim Disbrow 661- 2... Date Added: 2009-01-09 18:14:09 |
| Trig 135 printable syllabus.pdf Path: Antelope Valley College >> MATH >> 135 Summer, 2008 Description: SYLLABUS Fall 2008 COURSE Math 135 (CRN 73780) Trigonometry (3 units) Completion of MATH 102, or eligibility for MATH 135 and completion of MATH 080, and eligibility for college level reading or satisfactory completion of ENGL 101. Jim Disbrow 661- 2... Date Added: 2009-01-09 18:14:09 |
| finance_unhm.pdf Path: New Hampshire >> IR >> 2002 Fall, 2008 Description: UNIVERSITY OF NEW HAMPSHIRE AT MANCHESTER STATEMENT OF CURRENT FUNDS REVENUES, EXPENDITURES AND OTHER CHANGES FOR THE YEAR ENDED JUNE 30, 2002 GENERAL OPERATING REVENUES Educational and general Tuition and fees State of New Hampshire appropriations F... Date Added: 2009-02-18 02:10:33 |
| s05ch4.pdf Path: SC State >> C >> 150 Fall, 2009 Description: South Carolina State University Department of Biological and Physical Sciences General Chemistry I, Chemistry 150-Hamidi, Homework chapter 4, s05ch4 Name:. Identify the letter of the choice that best completes the statement or answers the question. _... Date Added: 2009-04-15 21:42:06 |
| 6 Path: UC Davis >> CHEMISTRY >> 2B Winter, 2009 Description: ... Date Added: 2009-03-12 16:57:10 |
| 11636162658201.pdf Path: Penn >> PLC >> 31 Fall, 2009 Description: The acquisition of evidentiality This paper investigates the acquisition of evidentiality (linguistic encoding of information source) in Turkish and its relation to the acquisition of abstract, mental-state semantic categories in general. Previous st... Date Added: 2009-04-15 21:40:57 |
| 04Lect11.ppt Path: NYU >> G89 >> 2247 Spring, 2008 Description: G89.2247 Lecture 11 SEM analogue of General Linear Model Fitting structure of mean vector in SEM Numerical Example Growth models in SEM Willett and Sayer (1994) Examples G89.2247 Lecture 11 1 SEM as Analogue of General Linear Model Regressio... Date Added: 2009-02-02 15:03:03 |
| HW8_21B.pdf Path: UC Davis >> MAT >> 236b Fall, 2008 Description: ... Date Added: 2009-01-09 19:34:09 |
| L15_Circuits08 Path: Elon >> PHY >> 113 Fall, 2008 Description: Ranking Task Activity One more capacitor network 1F 30V What is the charge stored on each? 5F 2F What is the total energy stored? 3F 4F Remember: Qon a capacitor=Cof that capacitor Vacross that capacitor 6F Which of these diagrams represent the ... Date Added: 2008-04-08 18:16:03 |
| Tough times plague mbs.PDF Path: Virginia Tech >> ECON >> 4124 Fall, 2008 Description: Dow Jones Interactive Page 1 of 4 Article 1 Return to Headlines Credit Markets Tough Times Plague Mortgage-Backed Securities By Barbara Donnelly Granito and Laura Jereski Staff Reporters of The Wall Street Journal Customize This Area Set your pre... Date Added: 2009-02-02 20:53:26 |
| 27SlidesCivpro2002.ppt Path: Catholic >> FACULTY >> 02 Fall, 2008 Description: CIVIL PROCEDURE CLASS 27 Professor Fischer Columbus School of Law The Catholic University of America October 28, 2002 WRAP-UP Last time we learned about two more judicial controls that exist for juries - Remittitur/Additur, Order to Vacate Judgment ... Date Added: 2009-02-06 19:55:37 |
| 5DC7D74DBF9149B3BB54AB64071DB88F.pdf Path: Pasco-Hernando Community College >> BSC >> 1011 Fall, 2008 Description: ANATOMY AND BASIC FUNCTION OF THE ENDOCRINE GLANDS Know these endocrine organs of the cat: thymus, thyroid, pancreas, adrenal glands, ovaries and testes. Review and know microslides, hormones and structures of the thyroid and parathyroid glands: THY... Date Added: 2009-01-11 17:27:47 |
| 1086_lab_objectives_set_02.pdf Path: Pasco-Hernando Community College >> BSC >> 1011l Fall, 2008 Description: ANATOMY AND BASIC FUNCTION OF THE ENDOCRINE GLANDS Know these endocrine organs of the cat: thymus, thyroid, pancreas, adrenal glands, ovaries and testes. Review and know microslides, hormones and structures of the thyroid and parathyroid glands: THY... Date Added: 2009-01-09 06:03:55 |
| 1086_lab_objectives_set_02.pdf Path: Pasco-Hernando Community College >> BSC >> 1085l Spring, 2008 Description: ANATOMY AND BASIC FUNCTION OF THE ENDOCRINE GLANDS Know these endocrine organs of the cat: thymus, thyroid, pancreas, adrenal glands, ovaries and testes. Review and know microslides, hormones and structures of the thyroid and parathyroid glands: THY... Date Added: 2009-01-09 06:04:05 |
| 1086_lab_objectives_set_02.pdf Path: Pasco-Hernando Community College >> BSC >> 1086l Fall, 2008 Description: ANATOMY AND BASIC FUNCTION OF THE ENDOCRINE GLANDS Know these endocrine organs of the cat: thymus, thyroid, pancreas, adrenal glands, ovaries and testes. Review and know microslides, hormones and structures of the thyroid and parathyroid glands: THY... Date Added: 2009-01-09 06:04:19 |
| 1086_lab_objectives_set_02.pdf Path: Pasco-Hernando Community College >> BSC >> 1010l Fall, 2008 Description: ANATOMY AND BASIC FUNCTION OF THE ENDOCRINE GLANDS Know these endocrine organs of the cat: thymus, thyroid, pancreas, adrenal glands, ovaries and testes. Review and know microslides, hormones and structures of the thyroid and parathyroid glands: THY... Date Added: 2009-01-11 17:27:46 |
| lecture10student.pdf Path: Berkeley >> ECON >> 100a Fall, 2008 Description: Key issues 1. measuring costs 2. short-run cost minimization 3. long-run cost minimization 4. costs are lower in long run 5. costs of producing multiple goods simultaneously Two-step procedure to choose technology 1. pick all technologically efficie... Date Added: 2009-01-09 19:24:49 |
| lecture10student.pdf Path: Bergen CC >> ECON >> 100 Fall, 2009 Description: Key issues 1. measuring costs 2. short-run cost minimization 3. long-run cost minimization 4. costs are lower in long run 5. costs of producing multiple goods simultaneously Two-step procedure to choose technology 1. pick all technologically efficie... Date Added: 2009-04-16 01:40:56 |
| lecture10student.pdf Path: Berkeley >> ECON >> 100 Fall, 2005 Description: Key issues 1. measuring costs 2. short-run cost minimization 3. long-run cost minimization 4. costs are lower in long run 5. costs of producing multiple goods simultaneously Two-step procedure to choose technology 1. pick all technologically efficie... Date Added: 2009-04-16 01:40:56 |
| 130-unknown-06fa01-v2 Path: Wisconsin >> MATH >> 130 Spring, 2007 Description: NOTICE: This Material May Be Protected By Copyright Law (Title 17, U.S. Code) ... Date Added: 2008-08-08 14:55:38 |
| BA_420_Fall_08_Syllabus.pdf Path: TAMU Commerce >> BA >> 420 Fall, 2008 Description: BA 420 International Business ONLINE COURSE SYLLABUS Fall, 2008 Instructor: Class Day/Time: Office: Phone: Fax: E-Mail: Office Hours: Dr. Janet Walker Online BA Building, Room 321 903-886-5685 903-886-5693 janet_walker@tamu-commerce.edu By appointmen... Date Added: 2009-02-02 16:20:19 |
| rawgroud.pdf Path: Auburn >> ARCH >> 2020 Spring, 2008 Description: Table of Contents Introduction.1 Principles of HACCP Principle No. 1.1 Principle No. 2..1 Principle No. 3.1 Principle No. 4.1 Principle No. 5..1 Principle No. 6.1 Principle No. 7.1 Definitions..2 Corrective action.2 Criterion.2 Critical Control Poin... Date Added: 2009-01-12 04:21:51 |
| oldlabeling.ppt.ppt Path: Southern Methodist >> EMIS >> 8374 Spring, 2008 Description: The Ford-Fulkerson Algorithm aka The Labeling Algorithm Ford-Fulkerson Algorithm begin x := 0; label node t; while t is labeled do begin unlabel all nodes; pred(j) := 0 for all j in N; label s; LIST := {s}; while LIST is not empty and t is not labe... Date Added: 2009-01-09 07:13:41 |
| cvthomas3.pdf Path: Cornell >> CS >> 3 Fall, 2008 Description: BIOGRAPHICAL SKETCH Thomas W. Finley PhD Student in Computer Science Cornell University, Ithaca, New York Education Institution Area Degree Year Cornell University Computer Science (Current GPA : 4.104) Ph.D. Candidate 2008? Committee members: Thors... Date Added: 2009-02-17 21:27:21 |
| 2-14 Path: Minnesota >> AEM >> 3031 Spring, 2008 Description: ... Date Added: 2008-04-17 21:28:44 |
| L13_1 Path: Texas A&M >> ENGR >> 111 Spring, 2004 Description: Spring 2004 Math 253/501503 13 Multiple Integrals 13.1 Double Integrals over Rectangles c 2004, Art Belmonte Thu, 19/Feb Summary Single Riemann Integral First, a little review from Calc 1. Let f be a function defined on I = [a, b]. Split [a, b] into ... Date Added: 2008-03-27 17:52:45 |
| stage1.txt Path: Minnesota >> CS >> 8995 Fall, 2008 Description: CS 8995 Tuesday March 20, 1pm The deadline for stage 1 of the final project has been adjusted. Your gold standard data is still due at 4pm, Friday Mar 23. You must submit your gold standard data by this time, and it must be a unicode file that exactl... Date Added: 2009-02-17 20:39:39 |
| SAMIAPOPALTURCHINPOWERPOINT.ppt Path: UC Irvine >> ANTHRO >> 121aw Winter, 2008 Description: The Principate Cycle 30 BCE-285 CE By: Samia Sara Popal Overview of the Cycle *The Participate cycle covers the three centuries between 27 BCE and 285 CE * The bulk of territorial expansion was accomplished by the end of Augustus reign, fluctuations... Date Added: 2009-01-09 19:41:16 |
| PhoneBook.txt Path: Texas >> CS >> 2008 Fall, 2008 Description: import string class ContactInfo: # Create initializer def _init_ (self, street, city, state, zip, country, phone, email): # Define global dictionary to hold all the contact information phoneBook = {} # This function adds the contact information of a ... Date Added: 2009-03-19 00:20:27 |
| PhoneBook.txt Path: Texas >> CS >> 303 Fall, 2008 Description: import string class ContactInfo: # Create initializer def _init_ (self, street, city, state, zip, country, phone, email): # Define global dictionary to hold all the contact information phoneBook = {} # This function adds the contact information of a ... Date Added: 2009-03-19 00:20:27 |
| PhoneBook.txt Path: Caribbean >> CS >> 303 Fall, 2008 Description: import string class ContactInfo: # Create initializer def _init_ (self, street, city, state, zip, country, phone, email): # Define global dictionary to hold all the contact information phoneBook = {} # This function adds the contact information of a ... Date Added: 2009-03-19 00:20:27 |
| invention_techniques.doc Path: TAMU Commerce >> ENG >> 102 Fall, 2008 Description: TAMU-Commerce Writing Center INVENTION TECHNIQUES FREEWRITING is the practice of writing as freely as possible without stopping. It is a simple but powerful strategy for exploring important issues and problems. The only absolute requirement for free... Date Added: 2009-01-09 15:34:05 |
| x02-fiboheap.pdf Path: University of Illinois, Urbana Champaign >> CS >> 373 Fall, 2008 Description: CS 373 Non-Lecture B: Fibonacci Heaps Fall 2002 B B.1 Fibonacci Heaps Mergeable Heaps A mergeable heap is a data structure that stores a collection of keys 1 and supports the following operations. Insert: Insert a new key into a heap. This oper... Date Added: 2009-02-02 18:32:05 |
| Midterm 1 essay Path: UMass (Amherst) >> POLISCI >> 150 Fall, 2008 Description: Implicit vs. Explicit Racism American Political Thought 10/26/2007 Matthew O\'Donnell O\'Donnell2 The United States has been plagued by racism throughout history. Conservatism can be defined as, the disposition to preserve or restore what is establi... Date Added: 2008-04-07 10:24:30 |
| Kimmerer2005L&OSilica.pdf Path: S.F. State >> CS >> 0108 Fall, 2008 Description: Limnol. Oceanogr., 50(3), 2005, 793798 2005, by the American Society of Limnology and Oceanography, Inc. Long-term changes in apparent uptake of silica in the San Francisco estuary Wim Kimmerer1 Romberg Tiburon Center, 3152 Paradise Drive, Tiburon, ... Date Added: 2009-02-06 19:42:48 |
| Jiang2008-2009.pdf Path: Maryland >> COMM >> 2008 Fall, 2008 Description: CURRICULUM VITAE _ HUA JIANG Department of Communication University of Maryland College Park, MD 20742-7635 Email: hyjiang@umd.edu Fax: 301-314-9471 Cell: 301-906-9288 EDUCATION Ph.D. Expected August 2009 Communication, University of Maryland, Colleg... Date Added: 2009-02-06 19:13:21 |
| courseDesc07.doc Path: Arizona >> ECE >> 575 Fall, 2008 Description: Object-Oriented Simulation/Discrete Event Models ECE-575, Fall 2007 Instructor: Bernard Zeigler Offices: ECE 350 Office Hours: After Class Email: zeigler@ece.arizona.edu Website: http:/www.acims.arizona.edu/EDUCATION/education.shtml Phone: 520-621-21... Date Added: 2009-01-11 19:58:23 |
| 242.pdf Path: University of Illinois, Urbana Champaign >> CS >> 242 Spring, 2008 Description: Course Schedule - Spring 2009 Computer Science 242 Programming Studio credit: 3 hours. Intensive programming lab intended to strengthen skills in programming. Prerequisite: CS 241. CRN 43558 Type laboratory Section AB1 Time ARRANGED Days Locati... Date Added: 2009-02-02 18:32:03 |
| Microsoft Word - B essays Path: UMass (Amherst) >> DEANS BOOK >> 291 Spring, 2008 Description: The essays below received a grade between 80 and 89. M. P. Prof. Grant English 1102 21 April 2007 Rules on Life Rules have many significant meanings throughout the world. A rule is most commonly defined as a principle or regulation governing conduct... Date Added: 2008-10-19 07:59:05 |
| rotunda.pdf Path: WVU >> HIST >> 717 Fall, 2008 Description: A Study of Teachers Confidence Levels Toward Meeting the Computer Technology Instructional Objectives of the WV Dept. of Education Cathy J. Rotunda Dissertation submitted to the College of Human Resources and Education at West Virginia University i... Date Added: 2009-02-03 14:41:29 |
| MSJ2e_Ch13_ISM1_June26_p565 Path: SUNY Stony Brook >> CHE >> 131 Spring, 2008 Description: Chapter 13: Chemical Kinetics: Rates of Reactions 16 Chapter13:ChemicalKinetics:RatesofReactions TeachingforConceptualUnderstanding Kinetics is a topic with which students have many misconceptions. Among them are: (1) a catalyst gives the reactants... Date Added: 2008-09-10 16:50:42 |
| frog twitching[1] Path: Berkeley >> MCB >> 32 Fall, 2008 Description: Kelly Lunt MCB 32L 10/23/06 Muscle Excitability and Contractility I. Introduction Background: Muscles are composed of myofibrils which are made up of thick and thin filaments. Each of these filaments is made up of different proteins. The thin filamen... Date Added: 2008-06-28 15:31:17 |
| thesis.pdf Path: Virginia Tech >> LIB >> 32398 Fall, 2008 Description: 6ROYLQJ 1RQOLQHDU 1RQTXDGUDWLF RPSXWDWLRQDO .OHLQPDQ1HZWRQ 0HWKRG LQ \'LVVHUWDWLRQ VXEPLWWHG WR WKH )DFXW\\ RI WKH 9LUJLQLD 3RO\\WHFKQLF ,QVWLWXWH DQG 6WDWH 8QLYHUVLW\\ LQ SDUWLDO IXOILOOPHQW RI WKH UHTXLUHPHQWV IRU ... Date Added: 2009-02-18 01:27:05 |
| 79-391.ps Path: Cornell >> VIVO >> 23036 Fall, 2008 Description: 5 > ) * 4 > * / 9 6 * ^ 6 5 ` I > ) $ $ $ Z I b $ H $ t ] ] ` I $ b h g ` ` ] ... Date Added: 2009-02-17 21:55:28 |
| Fall 2007 Lecture 11 inventory continued and financial analysis of AR AND INVENTORY Path: Georgetown >> ACCT >> 101 Spring, 2008 Description: ACCT-101 Lecture 11 Inventory continued and make financial decisions based on A/R and Inventory Outline Review of the consequences of different inventory methods Principles: Lower-of-cost-or-market rule (LCM) Adjusting from LIFO to FIFO Ratio ... Date Added: 2008-04-08 09:53:51 |
| cochrane1994QJE.pdf Path: BU >> SMG LA >> 346 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED DE >> 692 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> CGS HU >> 111 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SMG LA >> 349 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED IE >> 493 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED CH >> 655 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SMG LA >> 450 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED SE >> 493 Spring, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED DE >> 592 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED SE >> 598 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED DE >> 690 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED SE >> 807 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| cochrane1994QJE.pdf Path: BU >> SED DE >> 691 Fall, 2008 Description: Cochrane (1994) QJE Permanent and Transitory Components of GNP and Stock Prices Tamon ASONUMA 11/28/2006 Outline of Presentation Background Motivation Result and Implication GNP and Consumption - Specification of VARs -Detrending GNP Stock prices a... Date Added: 2009-01-09 07:37:29 |
| 050702.pdf Path: Penn >> N >> 48 Fall, 2008 Description: UNIVERSITY of PENNSYLVANIA Tuesday, May 7, 2002 Volume 48 Number 33 www.upenn.edu/almanac/ GSFAs 2002 G. Holmes Perkins Award: Dr. David De Long The G. Holmes Perkins Award is given in recognition of distinguished teaching and innovation in the meth... Date Added: 2009-02-06 17:42:41 |
| 050702.pdf Path: Penn >> N >> 33 Fall, 2008 Description: UNIVERSITY of PENNSYLVANIA Tuesday, May 7, 2002 Volume 48 Number 33 www.upenn.edu/almanac/ GSFAs 2002 G. Holmes Perkins Award: Dr. David De Long The G. Holmes Perkins Award is given in recognition of distinguished teaching and innovation in the meth... Date Added: 2009-02-06 17:42:41 |
| EPI-1.pdf Path: Ohio State >> ISE >> 503 Fall, 2008 Description: 1 2 Epidemiology Learning objectives: Introduce basic epidemiological concepts and methods, with focus on relevance to occupational epidemiology Review recordkeeping requirements How to use of OSHA logs Epidemiology Basics What is epidemiolog... Date Added: 2009-02-17 22:25:21 |
| islam mmw3 Path: UCSD >> MMW >> 3 Spring, 2008 Description: 5/28/2008 12:58:00 PM Within 100 year of prophet\'s death: c730 Charles \"Martel\" stops Arab advance into Europe How could small Arab forces quickly beat 2 empires? Wars of Byzantium(Eastern Roman empire) vs Persia had exhausted both empires \"heretical... Date Added: 2008-07-15 11:35:12 |
| MERS0101.pdf Path: BYU >> MERS >> 0101 Fall, 2008 Description: Brigham Young University Department of Electrical and Computer Engineering 459 Clyde Building Provo, Utah 84602 Multipath Analysis of the QuikSCAT Calibration Ground Station Arden Anderson 16 April 2001 MERS Technical Report # MERS 01-01 ECEN Dep... Date Added: 2009-02-11 21:31:21 |
| bme 121.pdf Path: UC Irvine >> BME >> 121 Fall, 2008 Description: BME121 QUANTITATIVE PHYSIOLOGY: ORGAN TRANSPORT SYSTEMS (Required for BME and BMEP) Catalog Data: BME121 Quantitative Physiology: Organ Transport Systems (Credit Units: 4) A quantitative and systems approach to understanding physiological systems. Sy... Date Added: 2009-02-02 17:13:56 |
| 243CourseList.pdf Path: LSU >> ART >> 2762 Spring, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:29 |
| 243CourseList.pdf Path: LSU >> ART >> 4886 Fall, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:30 |
| 243CourseList.pdf Path: LSU >> CMST >> 3107 Fall, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:15 |
| 243CourseList.pdf Path: LSU >> THTR >> 7008 Spring, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:39:10 |
| 243CourseList.pdf Path: LSU >> ART >> 4762 Spring, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:30 |
| 243CourseList.pdf Path: LSU >> CMST >> 4113 Fall, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:15 |
| 243CourseList.pdf Path: LSU >> ISDS >> 2011 Fall, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:15 |
| 243CourseList.pdf Path: LSU >> ART >> 4300 Spring, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:30 |
| 243CourseList.pdf Path: LSU >> BIOL >> 2510 Summer, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:39:10 |
| 243CourseList.pdf Path: LSU >> CMST >> 4100 Fall, 2008 Description: _ ACCOUNTING ACCT 2000 Survey of A ccounting (3) C redit will not be given for both this course and AC C T 2001. Students in nonbusiness curricula are advised to enroll in AC C T 2000 if they are given the option of AC C T 2000 or AC C T 2001, unles... Date Added: 2009-01-09 02:38:15 |
| NotesIV.pdf Path: Maryland >> PHYS >> 374 Spring, 2001 Description: ... Date Added: 2009-02-18 00:18:52 |
| TOX201_Test1-Fall04.pdf Path: N.C. State >> TOX >> 201 Fall, 2008 Description: NAME_ Multiple Choice (only one answer is correct) TEST 1A- 250 pts all questions worth 5 pts _ 1. The person I feel most confident in providing me with the best information regarding poisonous substances and their impact on my life is a) Meryl Str... Date Added: 2009-01-12 05:11:48 |
| Quiz 3 Path: Minnesota >> ACCT >> 3001 Winter, 2008 Description: Segment Reporting- Columns: Totals | Segment 1| Segment 2. Rows: SalesVariable expenses= Contribution Margin- traceable fixed expenses= divisional segment margin- common fixed expenses (just total column)= NOI Further? Segment Column numbers now tota... Date Added: 2008-03-30 18:08:12 |
| stat475_notes4.doc Path: Penn >> STAT >> 475 Fall, 2009 Description: Stat 475 Notes 4 Reading: Lohr, Chapter 3.1 Corrections from earlier notes: Notes 2: Bottom of page 10, top of page 11, the true population standard deviation should be truesd.samplemean=(sd(dioxin)/sqrt(50)*sqrt(1-50/646) # true SD of sample mean >... Date Added: 2009-04-15 20:46:49 |
| Chapter 05 Text Notes Ebbing 8e Path: Wayne State University >> CHM >> 1220 Fall, 2007 Description: Chapter 5: The Gaseous State Gas Laws Because light behaves as a wave, we need to understand more about waves . . . 1. Gas Pressure and Its Measurement a. Pressure and Its Units Pressure is defined as the force per unit area of surface. P = F A To f... Date Added: 2008-04-02 13:45:53 |
| HaulingBucketRoof.doc Path: Arizona >> MATH >> 129074 Fall, 2009 Description: Math 129-17 Work Problem 2007 A worker on a roof 50 ft above the ground needs to lift a 300 lb bucket of cement from the ground to the point 20 ft above the ground by pulling on a rope weighing 4 lb/ft. How much work is required? Some clarificatio... Date Added: 2009-04-15 22:45:39 |
| Exam3 Path: Penn State >> CHEM >> 476 Fall, 2007 Description: Chemistry 476 (Biological Chemistry) Examination 3 Due: Monday December 3, 2007 Name: _ (First) _ (Last) This is a take-home exam, which counts as 20/130th of your final grade. It is based largely on reading and understanding a paper from the litera... Date Added: 2008-07-23 11:00:12 |
| fs05final.pdf Path: Bryn Mawr >> BASCOM1 >> 1 Fall, 2008 Description: Bryn Mawr College Statements of Financial Position May 31, 2005 and 2004 (in thousands) 2005 2004 Assets: Cash Short-term investments Accounts receivable (less allowance of $31 in 2005 and $48 in 2004) Inventories and prepaid expenses Contribution... Date Added: 2009-02-11 22:10:33 |
| Exam_1 - seq - 2 Path: UNC >> DRAM >> 115 Spring, 2007 Description: Drama 115/002: - Sequence #2 - Fill in your name and PID # and sign your honor pledge on your bubble sheet. Be sure to put your exam in the correct pile or it will not be graded correctly. 1. It is commonly believed that drama originated from: 1) cer... Date Added: 2008-03-30 18:07:55 |
| SM_PDF_chapter11 Path: UCLA >> PHYSICS >> 6B Winter, 2007 Description: Gravity, Planetary Orbits, and the Hydrogen Atom CHAPTER OUTLINE 11.1 11.2 11.3 11.4 Newton\'s Law of Universal Gravitation Revisited Structural Models Kepler\'s Laws Energy Considerations in Planetary and Satellite Motion Atomic Spectra and the Bohr T... Date Added: 2008-04-29 23:41:42 |
| SM_PDF_chapter11 Path: Drexel >> PHYS >> 101-102 Spring, 2008 Description: Gravity, Planetary Orbits, and the Hydrogen Atom CHAPTER OUTLINE 11.1 11.2 11.3 11.4 Newton\'s Law of Universal Gravitation Revisited Structural Models Kepler\'s Laws Energy Considerations in Planetary and Satellite Motion Atomic Spectra and the Bohr T... Date Added: 2008-06-01 16:42:24 |
| SM_PDF_chapter11 Path: UCLA >> PHYS >> 6A Fall, 2007 Description: Gravity, Planetary Orbits, and the Hydrogen Atom CHAPTER OUTLINE 11.1 11.2 11.3 11.4 Newton\'s Law of Universal Gravitation Revisited Structural Models Kepler\'s Laws Energy Considerations in Planetary and Satellite Motion Atomic Spectra and the Bohr T... Date Added: 2008-04-02 02:46:57 |
| SM_PDF_chapter11 Path: UC Riverside >> PHY >> 2A/B/C Spring, 2008 Description: Gravity, Planetary Orbits, and the Hydrogen Atom CHAPTER OUTLINE 11.1 11.2 11.3 11.4 Newton\'s Law of Universal Gravitation Revisited Structural Models Kepler\'s Laws Energy Considerations in Planetary and Satellite Motion Atomic Spectra and the Bohr T... Date Added: 2008-04-07 08:42:40 |
| intro.doc Path: TAMU Kingsville >> PHYS >> 4323 Fall, 2008 Description: Introduction. Theevolutioninourunderstandingofthephysicalnatureoflightforms oneofthemostfascinatingaccountsinthehistoryofscience.Sincethedawnof modernscienceinthesixteenthandseventeenthcenturies,lighthasbeen picturedeitherasparticlesorwavesincompatib... Date Added: 2009-02-03 13:31:46 |
| Joyce Morris.doc Path: Goucher >> X >> 23708 Fall, 2008 Description: Identifying Gifted and Talented Students With Verbal and Nonverbal Measures Joyce Morris July 2004 The purpose of this study was to compare achievement and ability scores for gifted and non-gifted students to find out if there were students who shou... Date Added: 2009-02-11 21:40:34 |
| rsa.ppt Path: Drexel >> CS >> 300 Fall, 2003 Description: AppliedSymbolicComputation (CS680/480) Lecture5:ModularArithmeticandtheRSAPublicKey Cryptosystem JeremyR.Johnson April25,2001 April 2, 2001 Systems Architecture I 1 Introduction Objective:Tounderstandwhatapublickeycryptosystemis andhowtheRSAalg... Date Added: 2009-02-06 20:37:20 |
| Building_Musical_Intuitions.pdf Path: Amherst >> MEDIA >> 38268 Fall, 2008 Description: ... Date Added: 2009-02-11 21:51:20 |
| Building_Musical_Intuitions.pdf Path: Amherst >> CMS >> 84230 Fall, 2008 Description: ... Date Added: 2009-02-11 21:51:23 |
| ans12withpics Path: ASU >> PHY >> 121 Summer, 2008 Description: ... Date Added: 2008-07-12 23:03:05 |
| hndbk475.ms.apr01.doc Path: Michigan State University >> SOC >> 475 Fall, 2008 Description: February, 2001 Sociology 475: Sociology of Health Care Systems HANDBOOK State of the State Surveys Harry Perlstadt, PhD, MPH INTRODUCTION TO THE ASSIGNMENT The purpose of this assignment is to increase your knowledge of medical sociology and socio... Date Added: 2009-02-02 14:54:05 |
| Exam 1 answer key-1 Path: Iowa State >> BIOL >> 212 Spring, 2008 Description: Exam 1, spring 2007 Answer key Question 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29. Key A C E B D E B A D C A A C D B E E A B C D A E D C B C C B Key B D C A A C D B E E A B C D A E D C B C C C B E B D E B A Key C D... Date Added: 2008-03-27 10:08:50 |
| LakeCV2008_scrubbed.pdf Path: MUSC >> CVS >> 2008 Fall, 2008 Description: Brian Matthew Lake, D.O. EDUCATION: Fellowship in Endocrinology, Diabetes, and Medical Genetics, Medical University of South Carolina, Charleston, SC 7/1/20076/30/2009 Internship and Internal Medicine Residency, Northside Hospital and Heart Institu... Date Added: 2009-02-17 18:37:13 |
| r-212.Vul.in.RPC.Win.DNS.txt Path: Purdue >> COM >> 212 Spring, 2008 Description: _ The U.S. Department of Energy Computer Incident Advisory Capability _ _ _ _ _ / | /_\\ / \\_ _|_ / \\ \\_ _ INFORMATION BULLETIN Vulnerability in RPC on Windows DNS Server [Microsoft Security Advisory (935964)] 212 April 13, 2007 19:00 GMT [REVISED 19 ... Date Added: 2009-02-02 15:46:53 |
| Hall, Laila M..pdf Path: NMT >> DSPACE >> 10136 Fall, 1922 Description: Measuring Salinity Changes in the Vadose Zone Using Downhole Electromagnetic Induction by Laila M. Hall Submitted in Partial Fulfillment of the Requirements for the Masters of Science in Hydrology New Mexico Institute of Mining and Technology Depar... Date Added: 2009-02-11 22:10:07 |
| Hall, Laila M..pdf Path: NMT >> DSPACE >> 280 Fall, 2008 Description: Measuring Salinity Changes in the Vadose Zone Using Downhole Electromagnetic Induction by Laila M. Hall Submitted in Partial Fulfillment of the Requirements for the Masters of Science in Hydrology New Mexico Institute of Mining and Technology Depar... Date Added: 2009-02-11 22:10:07 |
| 060511riyadh.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / By industry / Financial services - Saudis to construct $6.7bn financial district in RiyadhSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Wednesday May 10 2006 . All times are London time. Roger Bove Edit Profile Take a Tour Lo... Date Added: 2009-02-11 17:38:20 |
| 060511riyadh.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / By industry / Financial services - Saudis to construct $6.7bn financial district in RiyadhSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Wednesday May 10 2006 . All times are London time. Roger Bove Edit Profile Take a Tour Lo... Date Added: 2009-02-11 18:16:34 |
| Worksheet21.pdf Path: Berkeley >> MATH >> 07 Fall, 2008 Description: Worksheet 21 November 20th, 2007 1. Evaluate the following denite integrals. (a) (b) (c) (d) (e) 3 dx 1x 4 x2 +3x+1 dx 1 x 3 4 sin(x) dx 1sin2 (x) e (ln(x) + 1)dx 0 n sin2 xdx 0 2. Write the Riemann sums for the following using left, right and ... Date Added: 2009-02-17 17:59:05 |
| AmyBloom.pdf Path: St. Joseph CT >> PAGEID >> 4946 Fall, 2008 Description: _ FOR IMMEDIATE RELEASE April 10, 2008 Contact: Cynthia A. Mariani, Director of Marketing and Communications Telephone: 860.231.5387 E-mail: cmariani@sjc.edu National Book Award Finalist Amy Bloom to Speak at Saint Joseph College on April 23 WEST H... Date Added: 2009-02-11 21:44:53 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> MGT >> 740 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-10 17:56:16 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> P H >> 899 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 07:00:55 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> ECON >> 740 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-10 17:56:16 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> MALAS >> 600a Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 10:20:21 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> MGT >> 729 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-11 19:38:37 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> MGT >> 496 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 10:21:05 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> MGT >> 722 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 10:21:05 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> MGT >> 356 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 07:00:44 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> P H >> 722 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 10:21:05 |
| rprnts.2005.10.10Hallstrom.pdf Path: San Diego State >> P H >> 664 Fall, 2008 Description: 4 T the Environmental crisis threats to HEALTH and ways forward by Niclas Hallstrom INTRODUCTION he world is currently facing an unprec edented health and environmental crisis. Despite progress in both the health and the environment fields, the si... Date Added: 2009-01-09 07:00:55 |
| sre2.pdf Path: Southern Methodist >> CSE >> 8317 Fall, 2008 Description: Software Reliability and Safety CSE 8317 (SRE.2) 1 Software Reliability and Safety CSE 8317 Fall 2007 Prof. Je Tian, tian@engr.smu.edu CSE, SMU, Dallas, TX 75275 (214) 768-2861; Fax: (214) 768-3085 www.engr.smu.edu/tian/class/8317.07f SRE.2: TBR... Date Added: 2009-01-09 07:12:49 |
| cover1.doc Path: Idaho State >> PHYS >> 533 Fall, 2008 Description: Cover Sheet ISU Department of Physics This document must accompany any research paper submitted for credit in PHYS 100 or PHYS 152 I affirm that this document is an original work produced solely by me for the purpose of earning points in _. I also a... Date Added: 2009-01-10 17:07:55 |
| cover1.doc Path: Idaho State >> PHYS >> 100 Fall, 2008 Description: Cover Sheet ISU Department of Physics This document must accompany any research paper submitted for credit in PHYS 100 or PHYS 152 I affirm that this document is an original work produced solely by me for the purpose of earning points in _. I also a... Date Added: 2009-01-10 17:07:55 |
| Project_F05__Intro Path: Maryland >> ENES >> 102 Fall, 2008 Description: TOWER CRANE DESIGN PROJECT ENES 102 Fall 2005 The objective of this project is to design a tower crane like the one shown in the attached photograph (Figure 1). Tower cranes are used in the construction of large buildings. The two major parts of the... Date Added: 2008-04-07 15:37:08 |
| 526.pdf Path: University of Illinois, Urbana Champaign >> EALC >> 526 Fall, 2008 Description: Course Schedule - Spring 2005 History 526 Problems in Japanese History Credit: 4 hours. (HIST 474) Period covered will alternate between the Early Modern (1550 - 1850) and Modern (1850 - present) eras. Same as EALC 526. May be repeated to a maximum o... Date Added: 2009-02-02 18:36:47 |
| Jazz Flashcards Path: University of Iowa >> MUSIC >> 025:141:SC Spring, 2008 Description: Cool Jazz Counterpoint Hard Bop Funky/Soul jazz Fugue Third Stream Music Bossa Nova Locked Hands Style the use of simultaneously sounding musical lines. Music that has counter point is often called polyphonic. a reaction to bebop. It embrace... Date Added: 2008-03-30 17:40:57 |
| 103.handout2.lines.doc Path: Grossmont >> MATH >> 090 Fall, 2008 Description: HANDOUT #2 Chapter 3 1. Find the slope of the line that passes through the points (-4, 10) and (-6, -6) 2. Determine whether the lines below are perpendicular, parallel, coincident, or none of these. -x + 2y = 1 4x + 2y = 9 3. Find the equation of ... Date Added: 2009-01-11 05:01:22 |
| viet1027.txt Path: Lehigh >> DMD >> 1 Fall, 2008 Description: Subject: A sorrow from Vietnam From: \"Nguyen H. V. Hung\" <nhvhung@math.wayne.edu> Date: Tue, 26 Oct 2004 10:58:37 -0400 (EDT) I regret to inform that Pham Anh Minh suddenly passed away on October 23, 2004 after a massive stroke. Normally, he had been... Date Added: 2009-02-18 13:28:37 |
| History 2301, Fall 2008, First Day Handout1.pdf Path: Del Mar College >> ECON >> 2301 Fall, 2008 Description: DEL MAR COLLEGE TEXAS HISTORY TO PRESENT HISTORY 2301 Fall 2008 Instructor: Dr. Bruce Olson Office: Heritage Hall, Rm 100 Office Telephone: 698-1354 Email: bolson@delmar.edu Office Hours: TTh: 12:30 a.m. - 1:00 p.m.; 5:00-5:30 p.m. In Class: TTh 1-2... Date Added: 2009-02-02 14:07:19 |
| Fundamental-mechanisms-of-3He-relaxation-on-glass.pdf Path: Wisconsin Milwaukee >> POL >> 3 Fall, 2009 Description: Chemical Physics Letters 370 (2003) 261267 www.elsevier.com/locate/cplett Fundamental mechanisms of 3He relaxation on glass R.E. Jacob b a,* , B. Driehuys b, B. Saam a a University of Utah, 115 S. 1400 E., Salt Lake City, UT 84112, USA Amersham ... Date Added: 2009-04-15 22:20:51 |
| 430.pdf Path: University of Illinois, Urbana Champaign >> EPSY >> 430 Fall, 2008 Description: Course Schedule - Spring 2005 Psychology 430 Early Adolescent Development Same as EPSY 430. See EPSY 430. Credit: 2 to 3 hours. CRN 41573 Type laboratory lecturediscussion Section 1 1 Time 12:00 PM - 12:50 PM 11:00 AM - 11:50 AM Days R R Locat... Date Added: 2009-02-02 18:45:26 |
| momentum-001-07F.pdf Path: St. Mary's CA >> PHYS >> 002 Fall, 2009 Description: 6 CONSERVATION OF MOMENTUM 7 6 Adjust the target holder screw so that both balls hit the ground at the same time. Listen for the sound of the balls hitting the ground. Purpose Place a piece of paper on ground so that The purpose of this laborat... Date Added: 2009-04-15 23:38:16 |
| 10_InstSolManual_PDF_Part34 Path: Pitt. State >> PHYS >> 114 Spring, 2008 Description: 10-34 Chapter 10 10.84. Set Up: When the marble rolls without slipping it has both rotational and translational kinetic energy and vcm 5 Rv. Icm 5 2 mR 2. Let 1y be upward. Take y 5 0 at the bottom of the hill so yi 5 0 and yf 5 h. The initial 5 sp... Date Added: 2009-03-06 15:37:26 |
| MSIS 3223 - Ireland.pdf Path: Oklahoma State >> MSIS >> 3223 Fall, 2008 Description: OPERATIONS MANAGEMENT MSIS 3223 SPRING 2008 Instructor: Office: Telephone: Office Hours: E-mail: Web page: Dr. T. Ireland Business 425 744-8642 9:30-10:20 MWF and 2:30-4:30 MW mgmttci@okstate.edu oc.okstate.edu (Desire2Learn website) and by appointm... Date Added: 2009-02-02 21:43:24 |
| Worksheet1.doc Path: Maryland >> CMSC >> 132 Fall, 2005 Description: CMSC 132 Quiz 1 Worksheet The first Quiz of the course will be on Wednesday, Sept 7 during your lab (discussion) session. The following list provides more information about the quiz: You will have 25 minutes to complete the quiz. It will be a... Date Added: 2009-02-18 00:14:11 |
| organic quiz 1.pdf Path: Marshall >> CHM >> 628 Fall, 2008 Description: Name: _ CHM 218H Draw the correct structure for the following names: ethylcyclopropane 3-methyl-4-propyloctane Provide a correct name for the following structures: CH2 CH3 CH2 C CH3 CH3 CH3 CH2 CH3 CH CH CH2 CH2 CH3 CH2 CH2 Bonus: This structu... Date Added: 2009-01-11 16:35:31 |
| 060131agric.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Viorel Chivriga: government should draft agri-industrial sector development strategyViorel Chivriga: government should draft agri-industrial sector development strategy (BASA-economic) Interview with Viorel Chivriga, expert of the Coalition for Rural... Date Added: 2009-02-11 19:01:47 |
| 060131agric.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Viorel Chivriga: government should draft agri-industrial sector development strategyViorel Chivriga: government should draft agri-industrial sector development strategy (BASA-economic) Interview with Viorel Chivriga, expert of the Coalition for Rural... Date Added: 2009-02-11 19:26:37 |
| midterm notes Path: Cornell >> AEM >> 2300 Spring, 2007 Description: OPA (offshore assembly provision) bonded warehouse = imports can be temporarily left there. it can be stored, repacked up to five years. but this is more costly. so therefore, we use FTZ (foreign trade zone) eliminates restrictive surveillance. This ... Date Added: 2008-02-13 20:13:31 |
| finalkey.doc Path: Caribbean >> CS >> 307 Fall, 2008 Description: 1 A. / 12 / \\ 8 15 \\ 86 / 45 \\ 90 2 B. 11 12 39 2010 101 7 28 13 2991 571 C. 2010 39 101 12 7 28 11 2001 13 571 D. 2010 101 39 28 7 12 2001 571 13 11 E. Average: O(1) or 1 or constant time or constant Worst: O(N) or N or linear time or linear F. ... Date Added: 2009-03-19 00:16:52 |
| finalkey.doc Path: Texas >> CS >> 307 Fall, 2009 Description: 1 A. / 12 / \\ 8 15 \\ 86 / 45 \\ 90 2 B. 11 12 39 2010 101 7 28 13 2991 571 C. 2010 39 101 12 7 28 11 2001 13 571 D. 2010 101 39 28 7 12 2001 571 13 11 E. Average: O(1) or 1 or constant time or constant Worst: O(N) or N or linear time or linear F. ... Date Added: 2009-03-19 00:16:52 |
| pdc2002-soi.pdf Path: Colorado >> L3D >> 2002 Fall, 2008 Description: Symmetry of Ignorance and Informed Participation Analyzing the Synergy of Related, But Different Approaches to Participatory Design of three Research Centers ORGANIZERS Pelle Ehn School of Arts and Communication Malm University S-205 06 Malm, Swed... Date Added: 2009-02-06 20:49:29 |
| cpu-data-storage.ppt Path: Scranton >> CIL >> 102 Fall, 2009 Description: Chapter 2: CPU &Data Storage CPU Each computer has at least one CPU CPU execute instructions to carry out tasks MS Word Examples of microprocessors Manufacture of CPUs defines its own set of instructions Pentium IV by Intel PowerPC by Appl... Date Added: 2009-04-15 19:54:04 |
| Alcohol Path: Loyola Marymount >> PHIL >> 320 Spring, 2008 Description: Alcohol: Harmful Drug or Beneficial Substance? By: Jeremy LaMell The Truth About Alcohol Excessive consumption of alcohol is one of the most serious problems in today\'s society. The truth is that alcohol is a drug, and many people can\'t control th... Date Added: 2008-04-08 04:59:15 |
| 18-review.pdf Path: Harvard >> MATH >> 21 Fall, 2009 Description: 11/19/2002, REVIEW (second Midterm) MIDTERM TOPICS. Partial derivatives, gradient Extrema of functions of two variables. Extrema of functions with constraints. Parameterized surfaces. Integration of functions of two variables. LEVELS OF UNDERSTA... Date Added: 2009-04-16 00:27:20 |
| license.txt Path: Hawaii >> SCHOLARSPA >> 10125 Fall, 1989 Description: Item submitted by brownke@hawaii.edu (brownke@hawaii.edu) on 2008-07-15T04:22:05Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) t... Date Added: 2009-02-17 19:39:03 |
| license.txt Path: Hawaii >> SCHOLARSPA >> 1897 Fall, 2008 Description: Item submitted by brownke@hawaii.edu (brownke@hawaii.edu) on 2008-07-15T04:22:05Z (GMT): NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to University of Hawaii at Manoa (UHM) t... Date Added: 2009-02-17 19:39:03 |
| Bio October Midterm Path: UWO >> BIOLOGY >> 1222 Spring, 2009 Description: UNIVERSITY OF WESTERN ONTARIO B I O L O G Y 1222 October 25, 2008 Time: 2 1/2 Hours Student No. _ Test Room _ Row _ INSTRUCTIONS - FOLLOW ( ) Print name Signature Instructor Course Student number Exam Code Section Answer Sheet ( ) Student number T... Date Added: 2009-04-04 22:04:39 |
| clns97-1483.ps Path: Cornell >> LNS >> 97 Fall, 1997 Description: CLNS 97/1483, HUTP-97/A020, NUB 3159 A Chiral N = 1 Type I Vacuum in Four Dimensions and Its Heterotic Dual Lyman Laboratory of Physics, Harvard University, Cambridge, MA 02138 2 Department of Physics, Northeastern University, Boston, MA 02115 3 New... Date Added: 2009-02-17 21:38:41 |
| My 13.doc Path: Pace >> BIO >> 343 Fall, 2008 Description: Chapter 13- An Introduction to Ultraviolet/Visible Molecular Absorption Spectrometry A: Measurement of Transmittance and Absorbance An introduction into any field requires that one learn the terms and symbols associated with work in that field. Unfor... Date Added: 2009-01-09 09:32:59 |
| My 13.doc Path: Pace >> SOC >> 116 Fall, 2008 Description: Chapter 13- An Introduction to Ultraviolet/Visible Molecular Absorption Spectrometry A: Measurement of Transmittance and Absorbance An introduction into any field requires that one learn the terms and symbols associated with work in that field. Unfor... Date Added: 2009-01-09 09:32:59 |
| My 13.doc Path: Pace >> BIO >> 306 Fall, 2008 Description: Chapter 13- An Introduction to Ultraviolet/Visible Molecular Absorption Spectrometry A: Measurement of Transmittance and Absorbance An introduction into any field requires that one learn the terms and symbols associated with work in that field. Unfor... Date Added: 2009-01-09 09:33:29 |
| My 13.doc Path: Pace >> BIO >> 113 Fall, 2008 Description: Chapter 13- An Introduction to Ultraviolet/Visible Molecular Absorption Spectrometry A: Measurement of Transmittance and Absorbance An introduction into any field requires that one learn the terms and symbols associated with work in that field. Unfor... Date Added: 2009-01-09 09:32:59 |
| My 13.doc Path: Pace >> BIO >> 125 Fall, 2008 Description: Chapter 13- An Introduction to Ultraviolet/Visible Molecular Absorption Spectrometry A: Measurement of Transmittance and Absorbance An introduction into any field requires that one learn the terms and symbols associated with work in that field. Unfor... Date Added: 2009-01-09 09:32:59 |
| 020117krona.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Prague Business Journal - Article Last updated: 17th Jan 2002, 8:53 Banking Politics Industry Telecom Real Estate This week\'s PBJ Enter keyword(s): Advanced Search Q&A Political Economy Word on ... Date Added: 2009-02-11 19:42:43 |
| math1005-8-syllabus-fall2008.doc Path: Minnesota >> MATH >> 1005 Fall, 2008 Description: Fall 2008 College Algebra-Math 1005 Section 8 Instructor: Office Hours: Class times: Text: Mingqian Duan SCC 102 726-8255 mduan@d.umn.edu MTWR 1:00 - 1:50PM You can also arrange other times to meet. 12:00 P.M. - 12:50 P.M. , M MonH 203, Tu,W,Th,F VKH... Date Added: 2009-02-17 20:39:12 |
| Phys chapter 22 notes Path: Drexel >> PHYS >> 102 Spring, 2008 Description: CHAPTER - 22 MAGNETIC FORCES AND MAGNETIC FIELDS A stationary charge q experiences a force F in an electric field E according to F = qE. A charge q moving with velocity v experiences a force F in a magnetic field B according to F = qvxB. The magneti... Date Added: 2008-06-02 08:20:29 |
| ME 363 SYLLABUS_2004.doc Path: Purdue >> M E >> 363 Fall, 2008 Description: ME 363 Principles and Practice of Manufacturing Processes Fall 2004 Instructors: Prof. Yung C. Shin, ME80, 4-9775 email: shin@ecn.purdue.edu email: rpatwa@ecn.purdue.edu email: sskvaren@ecn.purdue.edu Teaching Assistant: Mark Anderson, ME56, 4-2499 ... Date Added: 2009-02-02 15:45:55 |
| nutritionpowerpoint.ppt Path: St. John Fisher >> ECS >> 3 Fall, 2009 Description: CLICK HERE TO ENTER THE GUIDE TO NUTRITION PRESENTATION. NUTRITION BACKGROUND ON NUTRITION FOOD GROUPS WHENEVER YOU SEE THIS SYMBOL, CLICK TO RETURN HOME. NUTRITION WHAT IS NUTRITION? NUTRITION IS THE RELATIONSHIP BETWEEN HEALTH AND DIET. NUTRI... Date Added: 2009-04-15 19:43:20 |
| nutritionpowerpoint.ppt Path: St. John Fisher >> ECS >> 06832 Fall, 2009 Description: CLICK HERE TO ENTER THE GUIDE TO NUTRITION PRESENTATION. NUTRITION BACKGROUND ON NUTRITION FOOD GROUPS WHENEVER YOU SEE THIS SYMBOL, CLICK TO RETURN HOME. NUTRITION WHAT IS NUTRITION? NUTRITION IS THE RELATIONSHIP BETWEEN HEALTH AND DIET. NUTRI... Date Added: 2009-04-15 19:43:20 |
| Chapter8Part1.pdf Path: Purdue University Calumet >> MET >> 325 Fall, 2008 Description: Notes: Chapter 8 Part A: Ignoring Pump Work _ Know this for test! Learn to draw quickly. 3 Isentropic wT 4 C qr T B qin 2 win or work of the pump Isentropic 1 T sub cooled liquid 2 1 sat liquid (fluid) generally 3 superheated maybe superhea... Date Added: 2009-02-02 15:51:13 |
| lec4.pdf Path: Berkeley >> CS >> 174 Fall, 2008 Description: CS174 Lecture Note 4 Based on notes by Alistair Sinclair, September 1998; based on earlier notes by Manuel Blum/Douglas Young. More on random permutations We might ask more detailed questions, such as: Q3: What is the probability that contains at le... Date Added: 2009-04-16 01:51:49 |
| lec4.pdf Path: Berkeley >> CS >> 4 Fall, 2008 Description: CS174 Lecture Note 4 Based on notes by Alistair Sinclair, September 1998; based on earlier notes by Manuel Blum/Douglas Young. More on random permutations We might ask more detailed questions, such as: Q3: What is the probability that contains at le... Date Added: 2009-04-16 01:51:49 |
| fall2002.pdf Path: Purdue >> SA >> 458 Fall, 2008 Description: Fall 2002 FROM THE DIRECTOR H. Leon Thacker, DVM, PhD Fall, what a great time of the year!. Harvest; crisp, clear days; new school year; frost and the passing of another season of mosquitoes. This year, the disappearance of the mosquitoes will be es... Date Added: 2009-01-11 20:52:50 |
| P03-2024.pdf Path: Penn >> P >> 03 Fall, 2009 Description: A Limited-Domain English to Japanese Medical Speech Translator Built Using REGULUS 2 Manny Rayner Research Institute for Advanced Computer Science (RIACS), NASA Ames Research Center, Moffet Field, CA 94035 Pierrette Bouillon University of Geneva TIM/... Date Added: 2009-04-15 20:57:07 |
| wk12.rtf Path: Arizona >> NATS >> 104 Spring, 2008 Description: A. People in your room. 12 10 8 people 6 Human Population Growth 4 Name: Introduction: Darwins first two2observations in the exposition of Natural Selection involve population ecology: Populations have the potential to increase exponentially, but... Date Added: 2009-01-11 19:56:22 |
| IS 247 assignment 8.doc Path: E. Michigan >> IS >> 247 Fall, 2008 Description: IS 247 Assignment 8 60 points Due date: 11/29/2005 Text book chapter 22 page 712, 713 problem 22.2 and 22.7 Please initialize both objects and print out both the values of the attributes Please write these two javascript programs in one HTML pa... Date Added: 2009-02-02 21:23:19 |
| t1solution.pdf Path: Georgia Tech >> PHYS >> 3122 Fall, 2008 Description: Electro Magnetostatics Midterm 1 Solution Problem 1 (a) Use equation E(r) = V (r) (1) The Gradient in Spherical coordinates is V= 1 V 1 V V + r + r r r sin (2) In this case E(r) = V (r) 2 = er r r 2 = 2rer r (3) (4) (5) (b) To n... Date Added: 2009-02-02 21:31:59 |
| Chapter 34 Non Corporate Forms Path: USC >> FBE >> 429 Spring, 2009 Description: Non Corporate Forms Entrepreneurship, Sole Proprietorships, and General Partnerships Chapter 34 Entrepreneurial Forms of Conducting Business Sole Proprietorship A unincorporated business that is owned by one person. A voluntary association of tw... Date Added: 2009-02-02 22:14:24 |
| lecture_9.pdf Path: NYU >> G25 >> 2651 Fall, 2008 Description: G25.2651: Statistical Mechanics Notes for Lecture 9 I. DISTRIBUTION FUNCTIONS IN CLASSICAL LIQUIDS AND GASES (CONT\'D) A. General correlation functions A general correlation function can be de ned in terms of the probability distribution function co... Date Added: 2009-01-09 04:40:08 |
| 551.pdf Path: University of Illinois, Urbana Champaign >> SPAN >> 551 Fall, 2008 Description: Course Schedule - Spring 2005 Spanish 551 Spanish Morphology Credit: 4 hours. Introductory course to basic concepts of morphological strucure and word formation from a functional perspective. The course centers around the specific morphological chara... Date Added: 2009-02-02 18:43:24 |
| course-workbook--4523--CSCE--Database-Management-Systems--CThompson.doc Path: Arkansas >> CSCE >> 4523 Fall, 2008 Description: CSCE 4523 Database Management Systems 3 credits Spring 2005 Course Description General Information Time/Location: TR 9:00-10:20 pm in ENGR 307 Course Coordinator: Dr. Craig Thompson, ENGR 340B, 479-575-6519, cwt@uark.edu, http:/csce.uark.edu/~c... Date Added: 2009-01-09 19:11:44 |
| intro.pdf Path: UCSB >> ECON >> 155 Fall, 2008 Description: Introduction Many sources of risk in life Thomas G. Koch ECON 155 1(6) Introduction Many sources of risk in life Medical expenditures Thomas G. Koch ECON 155 1(6) Introduction Many sources of risk in life Medical expenditures Do I get s... Date Added: 2009-01-10 02:16:36 |
| vldb03_journal.pdf Path: Portland >> IT >> 410 Winter, 2008 Description: The VLDB Journal (2003) / Digital Object Identier (DOI) 10.1007/s00778-003-0095-z Aurora: a new model and architecture for data stream management Daniel J. Abadi1 , Don Carney2 , U ur Cetintemel2 , Mitch Cherniack1 , Christian Convey2 , Sangdon Lee2... Date Added: 2009-01-11 17:46:55 |
| test1solution.pdf Path: San Diego State >> CS >> 237 Fall, 2008 Description: San Diego State University Computer Science Department CS 370 Computer Architecture, Test # 1 Fall 2007 October 2, 2007 First Name:_ Last Name:_ Email:_ Grade: Problem 1. _/10 Problem 2. _/20 Problem 3. _/10 Problem 4. _/25 Problem 5. _/15 Problem ... Date Added: 2009-01-11 18:08:06 |
| test1solution.pdf Path: San Diego State >> CS >> 370 Fall, 2008 Description: San Diego State University Computer Science Department CS 370 Computer Architecture, Test # 1 Fall 2007 October 2, 2007 First Name:_ Last Name:_ Email:_ Grade: Problem 1. _/10 Problem 2. _/20 Problem 3. _/10 Problem 4. _/25 Problem 5. _/15 Problem ... Date Added: 2009-01-11 18:08:06 |
| BenT0001.pdf Path: Allegheny >> WEBPUB >> 0001 Fall, 2008 Description: ... Date Added: 2009-02-06 20:19:09 |
| pp1-17.pdf Path: Kent State >> FR >> 13202 Fall, 2008 Description: Electronic Transactions on Numerical Analysis. Volume 19, pp. 1-17, 2005. Copyright 2005, Kent State University. ISSN 1068-9613. Kent State University etna@mcs.kent.edu ETNA ORTHOGONALITY OF JACOBI POLYNOMIALS WITH GENERAL PARAMETERS A.B.J. KUIJL... Date Added: 2009-01-09 02:28:46 |
| pp1-17.pdf Path: Kent State >> FR >> 23201 Fall, 2008 Description: Electronic Transactions on Numerical Analysis. Volume 19, pp. 1-17, 2005. Copyright 2005, Kent State University. ISSN 1068-9613. Kent State University etna@mcs.kent.edu ETNA ORTHOGONALITY OF JACOBI POLYNOMIALS WITH GENERAL PARAMETERS A.B.J. KUIJL... Date Added: 2009-01-09 02:28:46 |
| Kineticsolid.doc Path: Mary Baldwin >> CHEM >> 321 Fall, 2008 Description: MOLECULAR BASIS: KINETIC THEORY AND SOLIDS The kinetic theory of solids began with the work of two French scientists, Dulong and Petit. Based on their studies of heat capacities of metals, they proposed that crystalline solids have heat capacities o... Date Added: 2009-02-11 21:43:44 |
| hist exam2 Path: Colorado >> HIST >> 1020 Spring, 2008 Description: EXAM 2- ID\'S Progressivism, WWI, WWII, The New Era-1920\'s, The Great Depression Progressivism Muckracking Jane Addams Hull House WCTU Triangle Shirtwaist Factory New Women Margaret Sanger NAWSA Booker T. Washington W.E.B. DuBois Theodore Roosevelt Wi... Date Added: 2008-06-02 16:17:41 |
| PE 32B Signature Pg FA07.doc Path: Fresno City College >> PE >> 32b Fall, 2008 Description: Curriculum Signature Page Please check off the form(s) this signature page will pertain. New Course Proposal and Outline $ Revised Course Proposal Form A Form B Form C Form D $ Five-Year Review Form Form E Advise and Consent Special Studies 47 Speci... Date Added: 2009-02-02 14:18:33 |
| chowmeats.pdf Path: Ohio State >> DENT >> 540 Spring, 2008 Description: The Ohio State University Ohio State University Extension Ohio Agricultural Research and Development Center For the week of May 29, 2005 By Martha Filipic (614) 292-9833 filipic.3@osu.edu Know your cuts when choosing meat I had dinner at a friend... Date Added: 2009-01-12 06:09:48 |
| BUS 202.doc Path: Palo Verde College >> BUS >> 202 Fall, 2008 Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 2/19/04 Board Approval: 12/10/02 P al o V er d e C o l l eg e 1. Completed by the Course Initiator: Brian Thiebaux Subject Area and Course Number... Date Added: 2009-02-02 15:23:14 |
| Chapter 13 Path: UGA >> BIOL >> 1107 Spring, 2008 Description: Biology 1107 Lecture # 25 03-05-08 Chapter 13 Meiosis and sexual life cycles Meiosis and Sexual Life Cycles n Meiosis reduces the number of chromosomes by half in the formation of haploid gametes (animals) or spores (plants) Two families Can you... Date Added: 2008-08-26 19:06:01 |
| A Mountain of Shoes Path: Monroe CC >> ENG >> 108 Spring, 2008 Description: tsMSswimWffi*nw$rt$Sryq Sucha rnountoin Sucharnountuinlsmry A.ndsuelder,ly a strangething happened. . The rnountain moved m ov ed. . . . thernselrcs aruanged and the thousandeof stroes by size by pairs and in rows and nroved. Hear! Flearthe nrar... Date Added: 2008-06-16 20:54:35 |
| MineralList.doc Path: UCSB >> GEOL >> 114a Fall, 2008 Description: RequiredMineralCompositions Thefollowingisalistofmineralformulaeorapproximatecompositionsyouwilllearn thisquarter. Orthosilicates:tet.Si:O=1:4;(SiO4)4 garnet grossular pyrope almandine spessartine forsterite(magnesianolivine) fayalite(ferrousolivine)... Date Added: 2009-01-10 02:20:47 |
| IACUCProtocol806.doc Path: LSU >> VMED >> 8000 Fall, 2008 Description: Revised August 2006 1INSTRUCTIONS FOR SUBMITTING AN ANIMAL CARE AND USE PROTOCOL 1. When does the Animal Care and Use Protocol need to be reviewed by the Institutional Animal Care and Use Committee (IACUC)? At the next scheduled IACUC meeting becaus... Date Added: 2009-01-09 02:45:10 |
| IACUCProtocol806.doc Path: LSU >> VMED >> 9000 Fall, 2008 Description: Revised August 2006 1INSTRUCTIONS FOR SUBMITTING AN ANIMAL CARE AND USE PROTOCOL 1. When does the Animal Care and Use Protocol need to be reviewed by the Institutional Animal Care and Use Committee (IACUC)? At the next scheduled IACUC meeting becaus... Date Added: 2009-01-09 02:45:10 |
| Fall_2007_Hwk1_solution Path: UCLA >> PHYS >> 1B Spring, 2008 Description: ... Date Added: 2008-11-25 14:27:08 |
| Civ 201 202 revised 2007.pdf Path: BYU >> GREEK >> 201 Fall, 2008 Description: Foundation Document Civilization Approved by the FGEC, October 22, 2007 REQUIREMENT PURPOSE The universitys Mission Statement affirms the importance of a broad university education . . . which will help students . . . understand important ideas in ... Date Added: 2009-02-02 13:41:13 |
| Slides14ConLaw2007.ppt Path: Catholic >> FACULTY >> 2007 Fall, 2008 Description: CONSTITUTIONAL LAW SPRING 2007 Class 14: Thursday February 8 More Limits on State Legislative Powers Preemption, Consent; Introduction to Executive Powers Inherent Powers? CONSENT Can Congress approve state laws that without federal consent would... Date Added: 2009-02-06 19:55:48 |
| Navier_stokes.pdf Path: Delaware >> CIEG >> 675 Fall, 2008 Description: Navier-Stokes Equations x-direction 2u 2u 2u u u u u 1 P +u +v +w = + g x + 2 + 2 + 2 t x y z x y z x y-direction 2v 2v 2v 1 P v v v v +u +v + w = + g y + 2 + 2 + 2 y t x y z y z x z-direction 2w 2w 2w w w w w 1 P +u +v +w = + g ... Date Added: 2009-01-10 03:32:31 |
| lab8.pdf Path: UGA >> CS >> 1301 Fall, 2007 Description: CSCI 1301 Lab 8 ReverseString.java Today\'s lab involves using the length, charAt, and concat String methods to reverse a String that you\'ve read from the user. Youll also be writing a static method other than main. This is our first taste of method d... Date Added: 2009-02-18 13:51:57 |
| Christianity Notes Path: SMU >> RELI >> 1301 Spring, 2008 Description: Christianity (Section II, Semester I, 2007) *2000 years ago Jesus instituted new covenant between God and human beings As Christians understand this new covenant is now between God and ALL human beings regardless of their ethnic entity. Views of this... Date Added: 2008-04-14 21:20:51 |
| 010706indicators.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Print Story TABLE-INDICATORS - Croatia - updated July 6 06 jul 2001 14:45 ZAGREB - Croatian economic indicators, updated on July 6 with January-May budget details, amended rating by Fitch IBCA. GROSS DOMESTIC PRODUCT (GDP) Q1 Q4 2000 Q1 2000 Total (... Date Added: 2009-02-11 19:32:36 |
| Monk 1961.pdf Path: Rutgers >> HMF >> 52 Fall, 2008 Description: ... Date Added: 2009-02-04 14:56:59 |
| webservices.pdf Path: University of San Francisco >> CS >> 682 Fall, 2009 Description: Distributed Software Development Web Services Chris Brooks Department of Computer Science University of San Francisco Department of Computer Science University of San Francisco p. 1/? 10-2: Service-Oriented Computing Services are the hot new m... Date Added: 2009-04-15 20:32:15 |
| 100sequence4.pdf Path: Maine >> ENG >> 2 Fall, 2008 Description: _11_\" , . ~ - I I I; c EssayTopic 1 In his article, \"Grief and a Headhunter\'s Rage,\" Renato Rosaldo uses the ideas and words of a variety of other people. He quotes other anthropologists, Ilongot friends, his wife Michelle, as well as his own ear... Date Added: 2009-02-17 23:45:52 |
| 03fe1.pdf Path: Wisconsin >> ECE >> 0 Fall, 2008 Description: ECE 730, Lec. 1 Exam 1 Tuesday, 21 Oct. 2003 5:156:45 pm 100 Points Justify your answers! Be precise! Closed Book Closed Notes You may bring one sheet of 8.5 in. 11 in. paper on which you have prepared formulas. ECE 730, Lec. 1 Exam 1 Tuesda... Date Added: 2009-02-17 15:51:04 |
| 03fe1.pdf Path: Wisconsin >> ECE >> 730 Fall, 2008 Description: ECE 730, Lec. 1 Exam 1 Tuesday, 21 Oct. 2003 5:156:45 pm 100 Points Justify your answers! Be precise! Closed Book Closed Notes You may bring one sheet of 8.5 in. 11 in. paper on which you have prepared formulas. ECE 730, Lec. 1 Exam 1 Tuesda... Date Added: 2009-02-17 15:51:04 |
| 03fe1.pdf Path: SJR CC >> ECE >> 0 Fall, 2008 Description: ECE 730, Lec. 1 Exam 1 Tuesday, 21 Oct. 2003 5:156:45 pm 100 Points Justify your answers! Be precise! Closed Book Closed Notes You may bring one sheet of 8.5 in. 11 in. paper on which you have prepared formulas. ECE 730, Lec. 1 Exam 1 Tuesda... Date Added: 2009-02-17 15:51:04 |
| 03fe1.pdf Path: SJR CC >> ECE >> 730 Fall, 2008 Description: ECE 730, Lec. 1 Exam 1 Tuesday, 21 Oct. 2003 5:156:45 pm 100 Points Justify your answers! Be precise! Closed Book Closed Notes You may bring one sheet of 8.5 in. 11 in. paper on which you have prepared formulas. ECE 730, Lec. 1 Exam 1 Tuesda... Date Added: 2009-02-17 15:51:04 |
| PS2 Solution.xls Path: Arizona >> CHEE >> 502 Fall, 2008 Description: Problem Set 2 Solution 0.2 k= ka= K B= PB0= PH0= h= tmax= 100 0.07 10 0.05 0.2 0.1 30 t 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 2 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 3 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 0.18 0.16 PB ... Date Added: 2009-01-11 19:56:41 |
| HW5Sols.pdf Path: University of Alaska Fairbanks >> MATH >> F215 Fall, 2008 Description: Math F215: Homework 5 Solutions March 7, 2006 Problem 4.14. Let a, b, and m be integers. If 2a + 3b 12m + 1, then a 3m + 1 or b 2m + 1. Proof: We proceed by proof by contrapositve. So suppse a < 3m + 1 and b < 2m + 1. Hence a 3m and b 2m (sinc... Date Added: 2009-01-09 15:41:53 |
| CCAGlec7.pdf Path: Rice >> MATH >> 7 Spring, 2006 Description: Math 465 Lecture Notes Brendan Hassett March 31-April 7, 2004 7 7.1 Cech cohomology An obstruction computation Let X be a topological space and consider an exact sequence of sheaves of abelian groups on X 0 K F G 0. Taking global sections g... Date Added: 2009-02-06 20:14:06 |
| ch12_pt2.ppt.pdf Path: N. Illinois >> BIOS >> 447 Spring, 2008 Description: Fi g u r e 1 2. 2 2 Anterior, posterior and common cardinal veins develop early Receive blood from intersegmental veins from pectoral limbs Brachiocephalic from intercardinal anastomosis Fi g u r e 1 2. 2 3 a e Right vitelline vein changes to incl... Date Added: 2009-01-09 05:16:46 |
| SYLL_F07.pdf Path: UCF >> PCB >> 6365 Fall, 2008 Description: BSC 1050 Biology and Environment - Fall 2007 Instructor: Office: Phone: e-mail: URL: Dr. John F. Weishampel (pronounced \"WHY - sample?\"), Professor of Biology Room 102B Biological Sciences 407-823-6634 (has voice mail) jweisham@mail.ucf.edu http:/... Date Added: 2009-01-10 02:31:21 |
| SYLL_F07.pdf Path: UCF >> PCB >> 6938 Fall, 2008 Description: BSC 1050 Biology and Environment - Fall 2007 Instructor: Office: Phone: e-mail: URL: Dr. John F. Weishampel (pronounced \"WHY - sample?\"), Professor of Biology Room 102B Biological Sciences 407-823-6634 (has voice mail) jweisham@mail.ucf.edu http:/... Date Added: 2009-01-10 02:31:21 |
| SYLL_F07.pdf Path: UCF >> PET >> 6938 Fall, 2008 Description: BSC 1050 Biology and Environment - Fall 2007 Instructor: Office: Phone: e-mail: URL: Dr. John F. Weishampel (pronounced \"WHY - sample?\"), Professor of Biology Room 102B Biological Sciences 407-823-6634 (has voice mail) jweisham@mail.ucf.edu http:/... Date Added: 2009-01-10 02:31:21 |
| (Chapter 2) Problem Set 1 - Due September 17, 2006 Path: Rutgers >> ACCT >> 325 Spring, 2008 Description: Questions 1. A conceptual framework is \"a coherent system of interrelated objectives and fundamentals that can lead to consistent standards and that prescribes the nature, function, and limits of financial accounting and financial standards.\" Pretty ... Date Added: 2008-04-04 01:48:13 |
| AAR70-01.pdf Path: Embry-Riddle FL/AZ >> AMELIA >> 70 Fall, 2008 Description: SA-404 FILE NO. 1-0005 AIRCRAFT ACCIDENT REPORT LOS ANGLES AIRWAYS, INC. SIKORSKY S-61L, N303Y PARAMOUNT, CALIFORNIA MAY 22,1968 ADOPTED: DECEMBER 18, 1969 i NATIONAL TRANSPORTATION SAFETY BOARD Bureau of Aviation Safety Washington, 0. C. 20591 P... Date Added: 2009-02-06 19:58:32 |
| test 2 Path: N. Arizona >> ANT >> 301 Summer, 2007 Description: Daniel Schiller ANT 301 Dr. Francis Smiley Test # 2 07/23/2007 Indigenous ways of extracting valuable resources from the rainforests such as medicines and agricultural techniques have been part of their culture for thousands of years. Only recently h... Date Added: 2008-04-04 21:00:49 |
| al-colloquium-carol.pdf Path: Iowa State >> ENGL >> 101b Fall, 2008 Description: Applied Linguistics Colloquium Series What about content? Beginning level language learning materials and the case of French in the U.S. Carol A. Chapelle Iowa State University Date: Monday April 2, 2007 Time: 12:00 p.m. A Location: 212 Ross Hall... Date Added: 2009-01-11 16:20:00 |
| al-colloquium-carol.pdf Path: Iowa State >> ENGL >> 101d Fall, 2008 Description: Applied Linguistics Colloquium Series What about content? Beginning level language learning materials and the case of French in the U.S. Carol A. Chapelle Iowa State University Date: Monday April 2, 2007 Time: 12:00 p.m. A Location: 212 Ross Hall... Date Added: 2009-01-11 16:20:00 |
| al-colloquium-carol.pdf Path: Iowa State >> ENGL >> 099l Fall, 2008 Description: Applied Linguistics Colloquium Series What about content? Beginning level language learning materials and the case of French in the U.S. Carol A. Chapelle Iowa State University Date: Monday April 2, 2007 Time: 12:00 p.m. A Location: 212 Ross Hall... Date Added: 2009-01-11 16:20:00 |
| al-colloquium-carol.pdf Path: Iowa State >> ENGL >> 099r Fall, 2008 Description: Applied Linguistics Colloquium Series What about content? Beginning level language learning materials and the case of French in the U.S. Carol A. Chapelle Iowa State University Date: Monday April 2, 2007 Time: 12:00 p.m. A Location: 212 Ross Hall... Date Added: 2009-01-11 16:20:00 |
| hw12SLN Path: Lafayette >> ECE >> 212 Spring, 2008 Description: ECE 212 HW 12 SOLUTIONS p 1 of 9 D:\\ECE212\\HW\\212Spr08\\hw12\\hw12SLN.doc ECE 212 Homework Set 12 SOLUTIONS 1. For the given memory contents and initial register contents, determine the register contents after each instruction executes. All values ... Date Added: 2008-04-17 14:38:16 |
| 393.pdf Path: University of Illinois, Urbana Champaign >> AVI >> 393 Spring, 2008 Description: Course Schedule - Spring 2006 Aviation 393 Turboprop Pilot Orientation Credit: 3 hours. Introduction to multi-engine turboprop airplane operations. Forty-five hours of lecture-discussion, and 16 hours (as pilot and co-pilot) of simulated flight in a ... Date Added: 2009-02-02 18:16:45 |
| Mechanics 2 Path: UCLA >> PHYSICS >> 10 Fall, 2008 Description: Mechanics 2 Remember the difference between weight and mass? An anvil will be weightless in space because there is no gravity. But it still has mass, so it would be hard to shake. Something with a large mass requires a large force to make it accele... Date Added: 2008-10-14 17:42:16 |
| milwaukeeusgsfigures.pdf Path: Iowa State >> C E >> 473 Fall, 2008 Description: Modflow Domain N Figure 5-1. Regional and local model domains. Dashed area: Recharge= 3.0 in/yr Undashed area: Recharge= 0.6 in/yr LAND SURFACE = 750 feet PLEISTOCENE TILL TILL LAND SURFACE = 590 feet HOLOCENE ESTUARY/FILL DEPOSITS 525 feet T... Date Added: 2009-01-09 02:08:43 |
| milwaukeeusgsfigures.pdf Path: Iowa State >> C E >> 573 Fall, 2008 Description: Modflow Domain N Figure 5-1. Regional and local model domains. Dashed area: Recharge= 3.0 in/yr Undashed area: Recharge= 0.6 in/yr LAND SURFACE = 750 feet PLEISTOCENE TILL TILL LAND SURFACE = 590 feet HOLOCENE ESTUARY/FILL DEPOSITS 525 feet T... Date Added: 2009-01-09 02:08:43 |
| Saxena_P_CF_99.pdf Path: Cornell >> VIVO >> 22892 Fall, 2008 Description: PDF Simulations of Turbulent Combustion Incorporating Detailed Chemistry Sibley School of Mechanical and Aerospace Engineering, Cornell University, Ithaca, NY 14853 USA Recently, the technique of in situ adaptive tabulation (ISAT) was proposed to acc... Date Added: 2009-02-17 22:10:06 |
| CHAPTER 12 posting Path: East Carolina >> FINA >> 2244 Spring, 2008 Description: CHAPTER 12 Negotiable Instruments, Credit & Bankruptcy I. Negotiable Instruments A. Definition B. Function C. Common negotiable instruments D. Four types of negotiable instrument two categories 1. Orders to pay three party instruments a. drafts (ty... Date Added: 2008-04-29 01:38:51 |
| Lecture14.pdf Path: Syracuse >> MAT >> 221 Fall, 2008 Description: Binomial Probability Suppose that a count X has the binomial distribution B(n, p). Then X is a discrete random variable taking the possible values from 0 to n. If k is one of the possible values 0, 1, 2, . . . , n then P(X = k ) = where nk p (... Date Added: 2009-01-11 18:21:56 |
| hist 1302 chapter 25 notes Path: Lone Star College >> HIST >> 1302 Summer, 2008 Description: CHAPTER 25: THE GREAT DEPRESSION AND THE NEW DEAL 19291939 I. HARD TIMES IN HOOOOVERVILLE A. Introduction 1. The prosperity of the 1920s ended in a stock-market crash that revealed the flaws honeycombing the economy. As the nation slid into a catastr... Date Added: 2009-01-05 17:26:20 |
| hmwk0.pdf Path: Duke >> ME >> 211 Fall, 2008 Description: Duke University Department of Physics Physics 211 Fall Term 2008 HOMEWORK 0 Available: August 26 Due: August 29, by email. Problem 1: Introduce Yourself By Friday, please send me an email (schol@phy.duke.edu) introducing yourself, indicating: Your ... Date Added: 2009-02-02 14:08:42 |
| hw2f08.pdf Path: Berkeley >> EE >> 245 Fall, 2009 Description: EE C245 / ME C218 INTRODUCTION TO MEMS DESIGN FALL 2008 PROBLEM SET #2 Issued: Thursday, Sept.18, 2008 Due (at 5 p.m.): Thursday, Sept. 25, 2008, during class 1. The cross-section below is to be etched via reactive ion etching (RIE). For this prob... Date Added: 2009-04-16 01:58:03 |
| buckler et al - molecular diverstiy structure and domestication of grasses-study questions.pdf Path: ND State >> PLSC >> 431 Fall, 2008 Description: PLSC 731: Paper Review Buckler et al Molecular Diversity, Structure and Domestication of Grasses Questions (reference pages in parentheses) 1. What suggests that similar genes were selected in grasses? (213) 2. What does synteny mean and how does th... Date Added: 2009-01-09 04:52:06 |
| buckler et al - molecular diverstiy structure and domestication of grasses-study questions.pdf Path: ND State >> PLSC >> 731 Spring, 2008 Description: PLSC 731: Paper Review Buckler et al Molecular Diversity, Structure and Domestication of Grasses Questions (reference pages in parentheses) 1. What suggests that similar genes were selected in grasses? (213) 2. What does synteny mean and how does th... Date Added: 2009-01-09 04:52:12 |
| Disorder Conceptualization p.7 Path: STLCOP >> N/A >> n/a Spring, 2008 Description: ... Date Added: 2008-04-18 11:40:18 |
| Issues_Related_to_Returning_to_School[1] Path: University of Phoenix >> GEN >> GEN300 Spring, 2008 Description: University of Phoenix Material Issues Related to Returning to School Name: Maurice Glover Please answer the following questions: 1. What stimulated your interest in returning to school? Because I realized that most of my peers have their degrees ... Date Added: 2008-07-09 11:53:25 |
| communicator-504.pdf Path: Ohio >> ECON >> 504 Fall, 2008 Description: THE OUC COMMUNICATOR _ Office of the Dean Volume 2 , Number 8 May 2004 CALENDAR MAY 3 New Employee Welcome Reception, Patricia Scott Memorial Gallery, 2:30 p.m. Red Cross Blood Drive, Stevenson Center, noon 6:00 p.m. Reception for Roberto Palacios,... Date Added: 2009-02-02 15:17:44 |
| Faculty_Beyond_Fundamentals.pdf Path: St. Xavier >> LZ >> 1 Fall, 2009 Description: 4th Annual LiveText Collaboration Conference July 20th 23rd, 2005 Workshop 2B Beyond LiveText Fundamentals The Drake Hotel Chicago Illinois Table of Contents Introduction .. 2 Prerequisite Skills. 2 Goals .. 2 Sharing Documents with Groups . 3 ... Date Added: 2009-04-16 00:04:35 |
| eir2008 Path: UCSB >> ENV S >> 2 Winter, 2009 Description: Executive Summary EXECUTIVE SUMMARY This Environmental Impact Report (EIR) has been prepared to document the development of a Long-term Protection Plan (Plan) for the Goleta Beach County Park (Park). The purpose of this Plan is to protect the uses ... Date Added: 2009-04-02 14:41:41 |
| FINAL_reading_3.pdf Path: Seattle >> THRS >> 230 Fall, 2009 Description: ... Date Added: 2009-04-15 21:53:36 |
| DelayedHrvstAflotoxin112007Doc1.pdf Path: Minnesota >> FARMMANAGE >> 112007 Fall, 2008 Description: Crop Insurance Procedures for Delayed Harvest and Aflatoxin Damage Prepared by: Gary A. Hachfeld, Regional Extension Educator, University of Minnesota Extension Mark Schull, Crop Insurance Services, Mankato, MN. November 2007 Introduction: Minnesot... Date Added: 2009-02-17 20:45:47 |
| Chap+53+Pop+Ecology Path: North Texas >> BIOL >> 1720 Spring, 2007 Description: POPULATION ECOLOGY Ecology: the study of how organisms relate to one another and to their environments. Physical environment (abiotic factors): Temperature, Water, Sunlight, Soil Homeostasis: plants and animals maintain an internal environment Confo... Date Added: 2008-09-16 14:10:08 |
| littlemermaid Path: Chapman >> BUS >> 215 Spring, 2008 Description: An Essay on \"The Little Mermaid\" Hans Christian Andersen seems to say that a girl\'s main interest is her desire to grow up. Growing up includes the finding of the self, love, and, above all, happiness. This quest seems to be the little mermaid\'s pass... Date Added: 2008-04-07 17:39:25 |
| Mar350_3march04_cruise_2_logsheet.xls Path: Hawaii >> MAR >> 350 Spring, 2004 Description: Co-Chiefs _ _ MARE 350 Four Winds Log Sheet Date _ Mare 350 3-Mar-04 Data\\Station 1 2 Latitude 19\"47\'19.68 19\"44\'04.50 Longitude 154\"55\'39.24 155\"04\'05.22 EPE (ft) 13 12 depth 915m 12m Time 15:44 17:15 surface salinity SPM? (Y/N) volume filtered(m... Date Added: 2009-02-17 19:22:29 |
| Vampire publications.pdf Path: Montana >> MB >> 400 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 433 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:48:28 |
| Vampire publications.pdf Path: Montana >> MB >> 525 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-09 04:18:52 |
| Vampire publications.pdf Path: Montana >> MB >> 450 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 403 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 437 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:48:28 |
| Vampire publications.pdf Path: Montana >> MB >> 537 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-09 04:18:52 |
| Vampire publications.pdf Path: Montana >> HDFN >> 227 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 415 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 490r Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:48:32 |
| Vampire publications.pdf Path: Montana >> N >> 503 Summer, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-09 04:19:36 |
| Vampire publications.pdf Path: Montana >> MB >> 402 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:48:28 |
| Vampire publications.pdf Path: Montana >> MB >> 430 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> LRES >> 545 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 407 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:48:28 |
| Vampire publications.pdf Path: Montana >> MB >> 431 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 100 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| Vampire publications.pdf Path: Montana >> MB >> 420 Fall, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:48:28 |
| Vampire publications.pdf Path: Montana >> MB >> 449 Spring, 2008 Description: Vampire Publications from Webster and Hsiao labs Hao Zhang, Janice S Bailey, Djurdjica Coss, Bo Lin, Rie Tsutsumi, Mark A Lawson, Pamela L Mellon, and Nicholas J.G. Webster. (2006) This contains a particularly good description of Vampire. Activin mod... Date Added: 2009-01-11 16:47:29 |
| 030120politics.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Prague Business Journal - Article Last updated: 23rd Jan 2003, 8:59 Banking Politics Industry Telecom Communications Real Estate Agriculture Law & Order Social Services Business Life Lifestyle This week\'s PBJ E... Date Added: 2009-02-11 19:50:15 |
| Career Exploration #3 Path: Grand Valley State >> BUS >> 101 Winter, 2008 Description: BUS 101 2/14/07 Kyle Binford Career Exploration The job I chose to do is an advertising M Research Director has many responsibilities tha... Date Added: 2008-04-02 07:11:51 |
| ch17 Path: W. Kentucky >> ACCT >> 310 Fall, 2008 Description: Chapter 17 1 CHAPTER 17 IMPLEMENTING QUALITY CONCEPTS QUESTIONS 1. Quality refers to the dimensions or characteristics of a product or service that make it able to meet the stated or implied needs of the person acquiring it. Quality can be viewed f... Date Added: 2008-12-12 14:51:47 |
| hours.ps Path: Florida State >> CS >> 4101 Fall, 2008 Description: O ce Hours O ce Hourse for Computer Organization will be from 1:15 PM { 3:15 PM Mondays and Wednesdays in 214 Love Building. Appointments for meetings at other times should be arranged in advance via email. 1 ... Date Added: 2009-02-17 18:59:26 |
| hours.ps Path: S.F. State >> CS >> 4101 Fall, 2008 Description: O ce Hours O ce Hourse for Computer Organization will be from 1:15 PM { 3:15 PM Mondays and Wednesdays in 214 Love Building. Appointments for meetings at other times should be arranged in advance via email. 1 ... Date Added: 2009-02-17 18:59:26 |
| ml1100.pdf Path: UC Davis >> ML >> 1100 Fall, 2008 Description: UNIVERSITY OF CALIFORNIA COOPERATIVE EXTENSION TULARE COUNTY November 2000 The Milk Lines EQIP$ CRIME DAIRY DAYS Applicants may sign up by making an appointment with the FSA office, 734-8732, ext. 2. Supporting documentation and reliable cost est... Date Added: 2009-02-06 18:10:20 |
| UNIT III EXAM Path: Westmont >> EB >> 011 Spring, 2008 Description: UNIT III EXAM 1. Flexible Exchange Rate System = The system whereby exchange rates are determined by the forces of supply and demand for a currency Fixed Exchange Rate System = the system whereby a nations currency is set at a fixed rate relative to... Date Added: 2008-04-16 18:26:45 |
| pg197to215.ppt Path: Arkansas >> ANTH >> 4903 Fall, 2008 Description: Spatial tolerances applied to data Line weeding Dangle truncation Node matching Fuzzy tolerance Simple polygon single unit of space bounded by three (or more) lines and containing no holes this is essentially the same definition as the cell b... Date Added: 2009-01-10 17:47:19 |
| pg197to215.ppt Path: Arkansas >> ANTH >> 5033 Spring, 2008 Description: Spatial tolerances applied to data Line weeding Dangle truncation Node matching Fuzzy tolerance Simple polygon single unit of space bounded by three (or more) lines and containing no holes this is essentially the same definition as the cell b... Date Added: 2009-01-10 17:47:19 |
| pg197to215.ppt Path: Arkansas >> ENDY >> 5033 Fall, 2008 Description: Spatial tolerances applied to data Line weeding Dangle truncation Node matching Fuzzy tolerance Simple polygon single unit of space bounded by three (or more) lines and containing no holes this is essentially the same definition as the cell b... Date Added: 2009-01-10 17:47:19 |
| AERO 105.doc Path: San Bernardino Valley College >> AERO >> 105 Spring, 2008 Description: DEPARTMENT: Aeronautics COURSE: Aero 105 TITLE: Powerplant Maintenance Lecture Accessories Overhaul WORKSHEET Course Objectives (not part of SLO-but derives SLO) Prepare students for Powerplant Technician FAA examinations in reciprocating engine acc... Date Added: 2009-02-02 16:00:06 |
| VisComm Notes Path: LSU >> VISS. COMM >> 2015 Spring, 2009 Description: January 26, 2009 Visual Communications This course is fundamentally about COMMUNICATION Three types of communication: Visual Oral Written Visuals dominated communications until around 1456; Gutenberg is credited with moveable type-which lead to th... Date Added: 2009-02-12 22:22:57 |
| ch06-pt4.pdf Path: JMU >> SMAD >> 307 Fall, 2008 Description: ... Date Added: 2009-01-12 03:28:44 |
| 15 Path: UNC >> ECON >> 101 Spring, 2008 Description: ECON 101 BALABAN MONOPoLIES Monopolies are price makers, not price takers. The marginal cost of a monopoly\'s product is low. Monopolies, though they control their prices, do not have unlimited profits because the market will not buy the product if i... Date Added: 2008-04-27 21:48:27 |
| 450F6.pdf Path: UC Davis >> PHR >> 450 Fall, 2006 Description: Food Chain PHR 450, F6 production retail consumer HACCP Elsewhere distribution processing food service HAACP was created for processing. Successful application of the HACCP approach in other segments of the food system requires that critical cont... Date Added: 2009-02-06 18:12:01 |
| ENGL1120July06.pdf Path: Auburn >> ARTS >> 1120 Spring, 2008 Description: ENGL 1120: OBJECTIVES, REQUIREMENTS AND GRADING Objectives for ENGL 1120 To continue to develop the students proficiency at using writing processes, with more attention on the research process. This would include locating sources in a variety of me... Date Added: 2009-01-09 18:21:09 |
| ENGL1120July06.pdf Path: Auburn >> ENGL >> 1120 Fall, 2008 Description: ENGL 1120: OBJECTIVES, REQUIREMENTS AND GRADING Objectives for ENGL 1120 To continue to develop the students proficiency at using writing processes, with more attention on the research process. This would include locating sources in a variety of me... Date Added: 2009-01-09 18:21:10 |
| ENGL1120July06.pdf Path: Auburn >> ENGL >> 1100 Fall, 2008 Description: ENGL 1120: OBJECTIVES, REQUIREMENTS AND GRADING Objectives for ENGL 1120 To continue to develop the students proficiency at using writing processes, with more attention on the research process. This would include locating sources in a variety of me... Date Added: 2009-01-09 18:40:25 |
| test 20001 Path: Colorado >> FILM >> 3051 Fall, 2008 Description: FILM 3051: Film History 1 TEST #2 (200 points) MATCHING (5 points each) L1 L-1 +-It ~ 1PO t:,~-!:~ -l b~ Your name: C>:Vtfln ~tf7Y Ph- II dA\'Y\\ J:\' Michael 2. Pandora\'s Box \'/3: Different from the Others 4: Entr \'acte .\".5: Napoleon I Rene Cl... Date Added: 2009-04-06 12:47:16 |
| 070604rice.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Making Perfect Rice The Japanese Way Can Cost Big Bucks - WSJ.com June 4, 2007 PAGE ONE DOW JONES REPRINTS This copy is for your personal, non-commercial use only. To order presentation-ready copies for distribution to your colleagues, clients or cus... Date Added: 2009-02-11 18:14:07 |
| Chapter 30 Path: LSU >> BIOLOGY >> 1202 Spring, 2009 Description: Chapter 30 Plant Diversity II: The Evolution of Seed Plants I. Concept 30.1: The reduced gametophytes of seed plants are protected in ovules and pollen grains a. Characteristics common to all seed plants i. Seeds ii.Reduced gametophytes iii.Heterospo... Date Added: 2009-02-26 23:15:59 |
| summaryresponse Path: JCCC >> ENG >> 122 Spring, 2008 Description: Jon Sabo Summary 6/11/07 In On Sale at Old Navy: Cool Clothes for Identical Zombies! Damien Cave argues that there is certain culture alive and well in our society that is turning is into thoughtless clones. Thomas Frank, a writer opposed to contempo... Date Added: 2008-09-02 12:24:53 |
| Psych Page 3 Path: Colorado >> PSYC >> 1001 Fall, 2007 Description: ... Date Added: 2008-04-29 13:35:58 |
| Templates.ppt Path: UMBC >> CSEE >> 202 Spring, 2001 Description: CMSC 202 Templates A form of Polymorphism Provide parametric polymorphism Polymorphism: ability of variable/function/class to take more than one form ad-hoc polymorphism: function overloading true polymorphism: virtual member functions; dynamic ... Date Added: 2009-02-17 23:49:45 |
| Large(Nystrom)Heart.pdf Path: MTSU >> BIOL >> 2021 Fall, 2008 Description: ... Date Added: 2009-01-10 17:53:35 |
| Large(Nystrom)Heart.pdf Path: MTSU >> BIOL >> 2031 Fall, 2008 Description: ... Date Added: 2009-01-10 17:53:35 |
| Problem_Set_4 Path: Purdue >> CHEM >> 370 Fall, 2008 Description: CHEM 370 PROBLEM SET 4 SPRING 2008 PROBLEMS FROM MCQUARRIE AND SIMON From Chapter 4/Some Postulates and General Principles of Quantum Mechanics Problem 4.25 (p. 138) Note the wavefunction the wavefunction n x, t corresponds to a stationary state whi... Date Added: 2008-06-27 12:51:52 |
| Yoshida99spie-ComponentsLIGO-abs.pdf Path: UF >> PHZ >> 6426 Fall, 2008 Description: High-power testing of optical components for LIGO Sanichiro J. Yoshida, Alexander S. Gorlenko, David B. Tanner, David H. Reitze, Justin D. Mansell, Em A. Khazanov, and Oleg P. Kulagin Publication: Proc. SPIE Vol. 3736, p. 430-436, ICONO 98: Quantum O... Date Added: 2009-01-10 18:21:39 |
| 1854.ps Path: Minnesota >> IMA >> 02 Fall, 2008 Description: ... Date Added: 2009-02-17 20:52:52 |
| 1032-Syllabus-Spr-02.pdf Path: FIU >> CHM >> 1032 Fall, 2008 Description: FIU Department of Chemistry CHM 1032 \"Chemistry and Society\" Spring 2002 Meeting: Mondays and Wednesdays or Tuesdays and Thursdays 11.00 am - 12.15 pm, GL-100 Instructor: Konstantinos Kavallieratos, Ph. D. email: kavallie@fiu.edu Office: CP 326, tel.... Date Added: 2009-02-02 21:25:51 |
| 699hmwk031007.doc Path: Maryland >> SURV >> 699c Fall, 2008 Description: Sociology 699. Homework 6: Statistical procedures using SAS. Assigned October 7, 2003, due October 14, 2003. In this assignment you will analyze a the relationship between marital status, sex, and several political variables in the context of a three... Date Added: 2009-02-03 14:00:10 |
| Study Guide Path: Texas >> SOC >> 302 Spring, 2008 Description: Culture of poverty - the thesis popularized by Oscar Lewis, that poverty is not the result of individual inadequacies, but is instead the outcome of a larger social and cultural atmosphere into which successive generations of children are socialized... Date Added: 2008-04-13 23:16:38 |
| 050518abuse.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: A witness\'s plea to end Myanmar abuse: printer friendly version A witness\'s plea to end Myanmar abuse By John Macgregor International Herald Tribune THURSDAY, MAY 19, 2005 CHIANG MAI, Thailand Over the last five years, Guy Horton has been secretly en... Date Added: 2009-02-11 20:17:37 |
| Part7.pdf Path: San Jose State >> BUS >> 225j Spring, 2008 Description: Taxation of E-Commerce Part 7 Annette Nellen, SJSU Some Final Points To Ponder A. Nexus Issues Should Congress just pass the Bumpers bill or similar legislation?1 * What about collection of use tax on sales exempted from the bill either because the... Date Added: 2009-01-11 18:09:11 |
| Part7.pdf Path: San Jose State >> BUS >> 223f Spring, 2008 Description: Taxation of E-Commerce Part 7 Annette Nellen, SJSU Some Final Points To Ponder A. Nexus Issues Should Congress just pass the Bumpers bill or similar legislation?1 * What about collection of use tax on sales exempted from the bill either because the... Date Added: 2009-01-11 19:39:28 |
| InternetMotivation.ppt Path: University of San Francisco >> CS >> 680 Fall, 2009 Description: Internet Research Outrageous goals are now Reachable Google\'s mission: Organize the world\'s information and make it universally accessible and useful. Brewster Kahle of Internet Archive says it this way: The Goal Universal Access to all Human Kno... Date Added: 2009-04-15 20:31:31 |
| 050320corrupt.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: SEE Portal - English - Citizens of Budva on Corruption SEE Portal - Homepage > News > News:This Week\'s News Citizens of Budva on Corruption Dejan Milovac Last week, MANS organized a public debate in Budva, to discuss the problem of corruption in Mont... Date Added: 2009-02-11 19:41:33 |
| Research Methods Exam- Chapter 7 Path: Ithaca College >> PSYC >> 30800 Spring, 2008 Description: Repeated Measures Designs (aka within-subjects design because you are trying to find out if there are any differences in the way the participants within a single sample behave). It is the opposite of between-groups design, where you test different pa... Date Added: 2008-07-13 15:58:18 |
| MajidMalaikaFirstPresentation.ppt Path: Southern Methodist >> CSE >> 8380 Fall, 2008 Description: An Analysis of Efficient Multi-Core Global Power Management Policies: Maximizing Performance for a Given Power Budget Authors: Canturk Isci, Alper Buyuktosunoglu, Chen-Yong Cher, Pradip Bose and Margaret Martonosi Represented by: Majid Malaika Age... Date Added: 2009-01-11 18:16:13 |
| MajidMalaikaFirstPresentation.ppt Path: Southern Methodist >> CSE >> 8383 Spring, 2008 Description: An Analysis of Efficient Multi-Core Global Power Management Policies: Maximizing Performance for a Given Power Budget Authors: Canturk Isci, Alper Buyuktosunoglu, Chen-Yong Cher, Pradip Bose and Margaret Martonosi Represented by: Majid Malaika Age... Date Added: 2009-01-11 18:16:13 |
| starcheck.txt Path: Harvard >> MAR >> 0104 Fall, 2009 Description: - Starcheck V4.18 - Run on Tue Jun 7 11:40:11 EDT 2005 by brett Configuration: AGASC 1.6 ASCDS release (7.5.4) - PROCESSING FILES - Using DOT file /data/mpcrit1/mplogs/2004/MAR0104/oflsb/mps/md060_0717.dot Using fidsel file /data/mpcrit1... Date Added: 2009-04-16 00:23:16 |
| Chapter reading January 20 Path: Clemson >> WESTERN CI >> 172 Spring, 2007 Description: Summary of the Cook Reading 99-121 January 20, 2007 This section of the book began in Africa and it set the stage for the way in which certain evolutionary advances took place here. Cook first begins to explain how people never really migrated to Afr... Date Added: 2008-04-19 08:30:30 |
| ReScaled1CubedDreamCatcher.pdf Path: MSCD >> MTH >> 1310 Fall, 2008 Description: ... Date Added: 2009-01-11 20:43:17 |
| ReScaled1CubedDreamCatcher.pdf Path: MSCD >> MTH >> 3420 Fall, 2008 Description: ... Date Added: 2009-01-11 20:43:17 |
| ReScaled1CubedDreamCatcher.pdf Path: MSCD >> MTH >> 4410 Fall, 2008 Description: ... Date Added: 2009-01-12 05:11:18 |
| p5.pdf Path: Washington >> ECON >> 485 Summer, 2008 Description: ECON 485 Fahad Khalil Problem Set 5 1. 2. Problem 2.6 from the text. Consider two firms that compete in prices. The demand firm for firm i, i = 1,2, is qi = 100 20pi + 10pj. Cost of production is zero for both. Consider a game in which a home firm... Date Added: 2009-02-02 20:35:01 |
| Introduction to Trees Path: Wisconsin >> CS >> 367 Spring, 2008 Description: Introduction to Trees Page 1 of 6 INTRODUCTION TO TREES Contents Introduction: Trees and Binary Trees Representing Trees Test Yourself #1 Tree Traversals Test Yourself #2 Test Yourself #3 Answers to Self-Study Questions Introduction Lists, stacks... Date Added: 2008-03-27 13:36:46 |
| Flank1.txt Path: BYU >> RV >> 0040 Fall, 2009 Description: ATAAACGGTGGCCATGCCGCCTGCGAAGACCCGCCAGGTGCGCGCGATCTGGATCATTTGCGTCGGTCCCTCCGAATGGC CGGGCGACGGTGCCCGTCGTCGAGGCTGAATGTAACCAGCGCTCCATGGCAGTGCACAGGCTTGAAATGCAGCTGGAATG AACCTCTGATCGTGGTGCAACGGAACCGAGACCAACCCGTGGCCGGTAGCGCGGCCCCGGAGGTTCCCGGGCCACCCTTA TACCCTG... Date Added: 2009-04-16 00:01:10 |
| scan_610_100702.pdf Path: Maryland >> EE >> 610 Fall, 2000 Description: ... Date Added: 2009-02-06 19:17:22 |
| predict-2.pdf Path: UConn >> CSE >> 340 Spring, 2008 Description: Prophet/Critic Hybrid Branch Prediction Ayose Falc n Jared Stark o Alex Ramirez Konrad Lai Mateo Valero Computer Architecture Department Universitat Polit` cnica de Catalunya e {afalcon, aramirez, mateo}@ac.upc.es Abstract This paper introduce... Date Added: 2009-01-11 22:06:31 |
| Math 556 December 1995 sheet 2.pdf Path: Michigan >> MATH >> 556 Fall, 2008 Description: ... Date Added: 2009-02-02 19:37:29 |
| kingsolver_p8-9.pdf Path: UNC Wilmington >> BIOL >> 36608 Fall, 2009 Description: ... Date Added: 2009-04-16 02:07:22 |
| Course Bio tech start-up.rtf Path: Arizona >> CHEM >> 546 Fall, 2008 Description: 664 The Biotech Startup Company: Law, Science & Business Issues David Adelman and Graeme Austin Units: 2 units pass/fail Prerequisites: None. Recommended Courses: None. Course Overview: This is a new interdisciplinary course focusing on the contribut... Date Added: 2009-01-09 15:50:06 |
| Course Bio tech start-up.rtf Path: Arizona >> CHEM >> 687 Fall, 2008 Description: 664 The Biotech Startup Company: Law, Science & Business Issues David Adelman and Graeme Austin Units: 2 units pass/fail Prerequisites: None. Recommended Courses: None. Course Overview: This is a new interdisciplinary course focusing on the contribut... Date Added: 2009-01-09 15:50:06 |
| Course Bio tech start-up.rtf Path: Arizona >> PHYS >> 560b Fall, 2008 Description: 664 The Biotech Startup Company: Law, Science & Business Issues David Adelman and Graeme Austin Units: 2 units pass/fail Prerequisites: None. Recommended Courses: None. Course Overview: This is a new interdisciplinary course focusing on the contribut... Date Added: 2009-01-09 15:50:06 |
| UFO15.ppt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: 15.UltrafastLaserSpectroscopy Howandwhyultrafastlaserspectroscopy? Genericultrafastspectroscopyexperiment Theexciteprobeexperiment Transientgratingspectroscopy Ultrafastpolarizationspectroscopy Opticalheterodynedetection(OHD) Spectrallyresolvedexcite... Date Added: 2009-02-02 21:31:13 |
| Project 2 Path: Colorado >> BCOR >> 2200 Fall, 2008 Description: Problem 1 The Green Cells are Input Cells. The Orange Cells are Output Cells. For each calculator, place the correct formula in the Orange Output Cell to calculate the correct value for a bond. The Green Cells are Inp The Orange Cells are O SEMI-AN... Date Added: 2009-03-17 18:57:30 |
| j60.pdf Path: Maryland >> CS >> 60 Fall, 2008 Description: SIAM J. SCI. COMPUT. Vol. 23, No. 4, pp. 12911315 c 2001 Society for Industrial and Applied Mathematics A MULTIGRID METHOD ENHANCED BY KRYLOV SUBSPACE ITERATION FOR DISCRETE HELMHOLTZ EQUATIONS HOWARD C. ELMAN , OLIVER G. ERNST , AND DIANNE P. OLEA... Date Added: 2009-02-06 19:22:34 |
| SummerReading2008.pdf Path: Keene State >> PSYC >> 470 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> PSYC >> 496 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> PSYC >> 499 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> ESEC >> 465 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> SPED >> 401 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> PE >> 150 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> SPED >> 460 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> PE >> 460 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| SummerReading2008.pdf Path: Keene State >> SPED >> 465 Fall, 2008 Description: Summer 2008 Dear Parents, Congratulations on your daughters or sons decision to come to Keene State College! It was the right choice for our children and we believe it will be for your student as well. The years your student spends at Keene State wi... Date Added: 2009-01-11 16:26:27 |
| 1178_104115_ncrr_reporter_summerfall2005.pdf Path: Charles Drew >> PAGE >> 1034 Fall, 2008 Description: national institutes of health national center for research resources w w w . n c r r. n i h . g o v Reporter Summer/Fall 2005 NCRR U.S. Department of Health and Human Services critical resources for your research Minority Research Program Celeb... Date Added: 2009-02-17 18:48:14 |
| nine_hills_one_valley Path: UC Davis >> DRAMA >> 10 Spring, 2008 Description: Saru Mehta Drama 20 Section 2 Extra Credit Nine Hills One Valley As I watched Ratan Thiyam\'s play, Nine Hills One Valley, I noticed the actors used simple and unique props to help tell the story. The function of these props was to add definition and ... Date Added: 2008-04-19 22:10:59 |
| Group presentations.pdf Path: Auburn >> FINC >> 2400 Fall, 2008 Description: November 18th AUsome Tropic Thunder Investment Group December 2nd Short-term Capital Management War Eagle Investments December 4th AU Capital ... Date Added: 2009-01-11 20:34:00 |
| Group presentations.pdf Path: Auburn >> FINC >> 3640 Spring, 2008 Description: November 18th AUsome Tropic Thunder Investment Group December 2nd Short-term Capital Management War Eagle Investments December 4th AU Capital ... Date Added: 2009-01-11 20:34:00 |
| Group presentations.pdf Path: Auburn >> FINC >> 4660 Spring, 2008 Description: November 18th AUsome Tropic Thunder Investment Group December 2nd Short-term Capital Management War Eagle Investments December 4th AU Capital ... Date Added: 2009-01-11 20:34:00 |
| day36.pdf Path: UF >> STA >> 3032 Fall, 2008 Description: 10.3 Shewhart Control Charts for Qualitative and Count Data Types of Attribute Data 1. Each item produced is either defective or not defective (Yes/No). 2. A single item may have one or more defects and the number of defects is determined. p-Chart f... Date Added: 2009-01-11 22:50:06 |
| ECON331HW3KEYFALL2007 Path: JMU >> ECON >> 331 Fall, 2007 Description: Economics 331 Fall 2007 Homework #3: Key 1. For each of the following cases, draw a set of indifference curves. Indicate in which direction utility increases. Provide a brief explanation with your diagrams. a. A typical person\'s indifference curve be... Date Added: 2008-04-20 14:21:15 |
| SLS2261.doc Path: Pasco-Hernando Community College >> AST >> 1002 Spring, 2008 Description: SLS 2261 Leadership Fundamentals COURSE DESCRIPTION: Leadership Fundamentals (3) A. A. Three hours per week. This course is designed to look at leadership as an inside out, relational phenomenon-from individual development to group dynamics and event... Date Added: 2009-01-09 06:03:14 |
| SLS2261.doc Path: Pasco-Hernando Community College >> CHM >> 2210c Fall, 2008 Description: SLS 2261 Leadership Fundamentals COURSE DESCRIPTION: Leadership Fundamentals (3) A. A. Three hours per week. This course is designed to look at leadership as an inside out, relational phenomenon-from individual development to group dynamics and event... Date Added: 2009-01-11 17:28:48 |
| SLS2261.doc Path: Pasco-Hernando Community College >> PHY >> 2048c Fall, 2008 Description: SLS 2261 Leadership Fundamentals COURSE DESCRIPTION: Leadership Fundamentals (3) A. A. Three hours per week. This course is designed to look at leadership as an inside out, relational phenomenon-from individual development to group dynamics and event... Date Added: 2009-01-11 17:30:11 |
| QUIZ 1 STUDENT GUIDE Path: UGA >> BIOL >> 1108 Spring, 2009 Description: QUIZ #1 STUDENT GUIDE (with answers) Exam date: THURSDAY JAN 22 VOCABULARIO p. 221, y 240-1 A. Eleccin mltiple. Elige la opcin adecuada en cada oracin. (5x4=20) 1. Lawyer se dice en espaol _: a) el/la ingeniero/a b) el/la abogado/a c) el/la contad... Date Added: 2009-03-26 09:06:28 |
| 2393.009.ps Path: Hawaii >> SOEST >> 2393 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207381774.0388276 Float: 2393 Profile: 009 Location: 31.7N 146.0E Date: 07/13... Date Added: 2009-02-17 19:56:28 |
| EDUC 322.pdf Path: S.E. Louisiana >> IT >> 322 Fall, 2008 Description: EDUCATION 322 Diagnostic and Prescriptive Reading Generic Syllabus Credit: 3 hours. Prerequisites: Education 304 and Full SARTE Status Course Description: This course is designed to equip the student with knowledge of and skill in reading instruction... Date Added: 2009-02-02 16:11:17 |
| Satoshi_CV.pdf Path: Penn State >> C E >> 555 Fall, 2008 Description: Research interest: Genetic algorithms, Reinforcement learning, Neural networks Finished research: Study on inverse model learning by neural networks, (Doctoral dissertation of Kyoto Univ., 1996/3) Ongoing research: Methods for acceleration for conver... Date Added: 2009-01-09 06:21:23 |
| Satoshi_CV.pdf Path: Penn State >> C E >> 563 Spring, 2008 Description: Research interest: Genetic algorithms, Reinforcement learning, Neural networks Finished research: Study on inverse model learning by neural networks, (Doctoral dissertation of Kyoto Univ., 1996/3) Ongoing research: Methods for acceleration for conver... Date Added: 2009-01-09 06:21:23 |
| Satoshi_CV.pdf Path: Penn State >> C E >> 360 Fall, 2008 Description: Research interest: Genetic algorithms, Reinforcement learning, Neural networks Finished research: Study on inverse model learning by neural networks, (Doctoral dissertation of Kyoto Univ., 1996/3) Ongoing research: Methods for acceleration for conver... Date Added: 2009-01-09 06:21:16 |
| Satoshi_CV.pdf Path: Penn State >> C E >> 361 Fall, 2008 Description: Research interest: Genetic algorithms, Reinforcement learning, Neural networks Finished research: Study on inverse model learning by neural networks, (Doctoral dissertation of Kyoto Univ., 1996/3) Ongoing research: Methods for acceleration for conver... Date Added: 2009-01-09 06:21:23 |
| midterm.pdf Path: Concordia Chicago >> MATH >> 195 Fall, 2008 Description: Math 19520-47 Midterm Directions: (1) Read carefully and attempt all problems. Write your answers in the blue book provided, and ask for an additional blue book if more space is necessary. Be sure to write your name on each blue book you use! (2) SHO... Date Added: 2009-04-15 21:59:12 |
| VSW-057.DOC Path: College of the Desert >> VSW >> 057 Spring, 2008 Description: COLLEGE OF THE DESERT Course Outline of Record 1. 2. 3. Course Code: VSW-057 Course Title: Varsity Softball (W) Course Code: VSM-057 Catalog Description: This course is intercollegiate competition for Performance Oriented students who demonstrate a... Date Added: 2009-02-02 13:57:13 |
| TR-90-52.pdf Path: Virginia Tech >> CS >> 00000234 Fall, 2008 Description: ... Date Added: 2009-02-18 00:46:09 |
| hwfile1.pdf Path: Rutgers >> 640 >> 501 Fall, 2008 Description: Problems I; Real Analysis, 640:501, Fall, 2003 Problems 1-9 are on topics from undergraduate real analysis and elementary point set topologylimits inferior and superior, compactness and continuity. For compactness and continuity on Rn , most of what ... Date Added: 2009-01-09 06:55:47 |
| Lecture #15 Path: Union >> CIV >> 019 Spring, 2009 Description: ... Date Added: 2009-02-03 23:31:43 |
| Dec 1-5.pdf Path: Delaware >> PHYS >> 201 Fall, 2008 Description: Sunday, November 30, 2008 11:00 PM Dec 1-5 Page 1 Dec 1-5 Page 2 Dec 1-5 Page 3 Friday, December 05, 2008 9:09 AM Dec 1-5 Page 4 ... Date Added: 2009-01-10 03:35:02 |
| c8s2bw.ps Path: ETSU >> MATH >> 1920 Fall, 2008 Description: 8.2 Subsequences, Bounded Sequences, and Picards Method 1 Chapter 8. Innite Series 8.2 Subsequences, Bounded Sequences, and Picards Method Denition. If the terms of one sequence appear in another sequence in their given order, we call the rst sequ... Date Added: 2009-02-17 23:41:52 |
| Chapter3.5.ppt Path: Richmond >> CS >> 315 Fall, 2009 Description: Skip Lists S3 - S2 - S1 - S0 - 10 15 15 15 23 23 36 + + + + 04/10/09 17:19 Skip Lists 1 Outline and Reading What is a skip list (3.5) Operations Implementation Analysis (3.5.3) Search (3.5.1) Insertion (3.5.2) Deletion (3.5.2) Space ... Date Added: 2009-04-15 23:34:56 |
| week4q Path: Western Michigan >> MDVL >> 1450 Summer, 2007 Description: Week Four Reading Questions Read: Chapter 5 in the Rosenwein and the additional reading \"Pope Urban II\" found in Learning Module Four. Due: July 23 by 11:55 pm Post to Drop Box 1. Your text mentions a medieval \"commercial revolution.\" What were the c... Date Added: 2008-04-07 12:49:02 |
| Krystal_Kluber_poetry handout.doc Path: N. Illinois >> TLCI >> 511 Fall, 2008 Description: Krystal Kluber July 8, 2008 TLCI 526 Teacher Tidbit Concept or Skill Addressed: Can be used as an introduction to a poetry unit, an activity within the unit, or a final review activity (poetry terms) Observation Practicing showing not telling Rev... Date Added: 2009-01-11 17:09:00 |
| Class_notes_15 Path: Penn State >> AERSP >> 308 Spring, 2005 Description: ... Date Added: 2008-07-23 10:30:44 |
| Problem 2-31 Path: Penn State >> E MCH >> 013 Spring, 2007 Description: From Mechanics of Materials, Sixth Edition by R. C. Hibbeler, ISBN 0-13-191345-X. 2005 R. C. Hibbeler. Published by Pearson Prentice Hall, Pearson Education, Inc., Upper Saddle River, NJ. All rights reserved. This material is protected under all cop... Date Added: 2008-04-01 16:19:01 |
| TPAH160.ps Path: Texas >> HEP >> 160 Fall, 2008 Description: THE NUMI HADRONIC HOSE R. Ducar,J. Hylen, C. Jensen, M. May, D. Pushka, W. Smart, J. Walton, FNAL, Batavia, IL 60510 M. Messier, Harvard University, Cambridge, MA 02138 V. Garkusha, F. Novoskoltsev, V. Zarucheisky, IHEP, Protvino, Russia G. Unel, Nor... Date Added: 2009-02-11 22:31:49 |
| methods7.pdf Path: UF >> ENC >> 4260 Fall, 2008 Description: Maranda M. Almy Methods Florida Indians I, Missions to the Calusa, and other ethnohistorical reports of the Indians provided detailed information on the culture and movements of the Seminole, Calusa, and Creek Indians. Dr. McEwan is the archaeologist... Date Added: 2009-01-10 18:27:33 |
| 050411EU1.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Reuters AlertNet - EU to recommend closer ties with Serbia - sources Alerting humanitarians to emergencies Username: Password: Sign me in automatically Get a password Forgot your password? Login Reuters websites United States Japan United Kingdom -- ... Date Added: 2009-02-11 20:22:39 |
| CourseInfo32_08Spring Path: Pittsburgh >> CHEM >> 320 Spring, 2008 Description: Page 1 of 3 C HEMISTRY 0320 - ORGANIC C HEMISTRY II #10474 Prof. C. S. Wilcox TH 11:00-12:15 PM Course Information - Spring 2008 Instructor: Office Hours: Recitation: Required Texts: Professor C. S. Wilcox daylite@pitt.edu Chvrn 12A TF 1:00-1:50 PM... Date Added: 2008-04-29 21:02:46 |
| RyanFogaren_Week7LABAssig4 Path: S. New Hampshire >> IT >> 100 Spring, 2008 Description: Ryan Fogaren 2/4/2008 My Budget Year 2006 Figures Monthly Figures Income My Salary Total Jan-08 1,800 1,800 Feb-08 1,800 3,600 Mar-08 1,800 5,400 Apr-08 1,800 7,200 Expenses Rent Food Phone/Internet Loan Payments Car Payments Car Insurance Miscella... Date Added: 2008-04-19 07:56:51 |
| 012808.pdf Path: Arizona >> ATMO >> 595c Fall, 2008 Description: ATMO/GEOS595C PatternsandMechanismsofDecadalClimateVariability MichaelN.Evans LaboratoryofTreeRingResearch/Geosciences/AtmosphericSciences coursewebpages:http:/ic.ltrr.arizona.edu/ic/dv/ January28,2008:IntroductiontoPaleoproxyData, AnalysisandPaleor... Date Added: 2009-01-09 15:48:33 |
| 012808.pdf Path: Arizona >> GEOS >> 595c Fall, 2008 Description: ATMO/GEOS595C PatternsandMechanismsofDecadalClimateVariability MichaelN.Evans LaboratoryofTreeRingResearch/Geosciences/AtmosphericSciences coursewebpages:http:/ic.ltrr.arizona.edu/ic/dv/ January28,2008:IntroductiontoPaleoproxyData, AnalysisandPaleor... Date Added: 2009-01-09 15:48:33 |
| 012808.pdf Path: Arizona >> HIST >> 595c Spring, 2008 Description: ATMO/GEOS595C PatternsandMechanismsofDecadalClimateVariability MichaelN.Evans LaboratoryofTreeRingResearch/Geosciences/AtmosphericSciences coursewebpages:http:/ic.ltrr.arizona.edu/ic/dv/ January28,2008:IntroductiontoPaleoproxyData, AnalysisandPaleor... Date Added: 2009-01-09 15:48:33 |
| hw1.pdf Path: F & M >> FND >> 111 Spring, 2009 Description: Franklin & Marshall College - Physics and Astronomy Department Foundations 111V: Energy Issues in Science and Society Spring 2009, F. Crawford Homework/Research Assignment #1 Due Tue Feb 3 at 4:00 p.m. 1. (5 pts) Wolfson, Ch. 1, Question 5 2. (5 pt... Date Added: 2009-04-15 23:51:27 |
| Ethicslecture.ppt Path: Southern Utah >> MGMT >> 4200 Spring, 2008 Description: The most important human endeavor is the striving for morality in our actions. Our inner balance, and even our very existence depends on it. Only morality in our actions can give beauty and dignity to our lives. Albert Einstein Ethics The study of w... Date Added: 2009-01-11 18:17:17 |
| Lecture 20.doc Path: Western Washington >> GEOL >> 525 Fall, 2008 Description: Geo525Lecture20Activities Announcements Goalsfortoday Maineqforpurephasesatequilibrium(847inSpear,p.269): GT1 ,P1 T1 CP = H(298,1) + CP dT + VdP - T1S(298,1) + dT 298 1 298 T T1 P1 Cp=a+bT+cT +dT 2 1/ Chemicalpotential Describeshowener... Date Added: 2009-02-02 21:07:19 |
| Mitchell_2005.pdf Path: Humboldt State University >> MDJ >> 510 Fall, 2009 Description: O P P I I N I I O O N Opinion is intended to facilitate communication between reader and author and reader and reader. Comments, viewpoints or suggestions arising from published papers are welcome. Discussion and debate about important issues i... Date Added: 2009-04-16 01:00:59 |
| Mitchell_2005.pdf Path: Humboldt State University >> MDJ >> 6 Fall, 2009 Description: O P P I I N I I O O N Opinion is intended to facilitate communication between reader and author and reader and reader. Comments, viewpoints or suggestions arising from published papers are welcome. Discussion and debate about important issues i... Date Added: 2009-04-16 01:00:59 |
| chapter 15 outline Path: Tallahassee >> HUN >> 1201 Spring, 2008 Description: Chapter 15: Pregnancy and Lactation Nutrition prior to pregnancy Both a man\'s and a woman\'s _ may affect _. _: the capacity of a woman to produce a normal ovum periodically and of a man to produce normal sperm; the ability to reproduce. Once _ ha... Date Added: 2008-04-17 22:13:50 |
| S14 Path: Texas >> BIO 325 >> 325 Spring, 2009 Description: S1.Researchers have identified mutations in the promoter region of the lacI gene that make it more difficult for the lac operon to be induced. These are called lacIQ mutants, because a greater Quantity of lac repressor protein is made. Explain why an... Date Added: 2009-04-06 22:02:01 |
| guide-essay2.pdf Path: Washington State >> GENED >> 111 Fall, 2008 Description: GenEd 111, Section 20 Short Essay Guidelines Short Essay #2 (Due Date: January 27, 2009) For this second essay, like the first, 250 to 400 words will suffice. Unlike the first essay, you must utilize at least one outside source, in addition to the c... Date Added: 2009-02-18 02:25:37 |
| guide-essay2.pdf Path: Martin Luther >> GENED >> 111 Spring, 2008 Description: GenEd 111, Section 20 Short Essay Guidelines Short Essay #2 (Due Date: January 27, 2009) For this second essay, like the first, 250 to 400 words will suffice. Unlike the first essay, you must utilize at least one outside source, in addition to the c... Date Added: 2009-02-18 02:25:37 |
| HW12Solns_F08 Path: Cornell >> ECE >> 210 Spring, 2008 Description: ECE 2100 Fall 2008 Introduction to Circuits for Electrical and Computer Engineers Homework Assignment #12 {Last homework assignment for the course!} Due Friday 11/21/08 9:00 AM Please complete all of problems: P12.1, 12.2, 12.3, 12.5, 12.9, 12.14 [... Date Added: 2009-03-31 02:12:19 |
| syll220f06.doc Path: UConn >> PSYC >> 1103 Fall, 2008 Description: LEARNING PSYC220:03Fall2006 TueThu5:006:15 MONT101 EricLundquist Office:BOUS136 Phone:(860)4864084 OfficeHours: MonWed4:005:00, andbyappointment Email:Eric.Lundquist@UConn.Edu WebPage: http:/vm.uconn.edu/~lundquis/learning.html READING: 1. 2. 3. REQ... Date Added: 2009-01-10 02:41:06 |
| syll220f06.doc Path: UConn >> PSYC >> 2500 Fall, 2008 Description: LEARNING PSYC220:03Fall2006 TueThu5:006:15 MONT101 EricLundquist Office:BOUS136 Phone:(860)4864084 OfficeHours: MonWed4:005:00, andbyappointment Email:Eric.Lundquist@UConn.Edu WebPage: http:/vm.uconn.edu/~lundquis/learning.html READING: 1. 2. 3. REQ... Date Added: 2009-01-10 02:41:06 |
| syll220f06.doc Path: UConn >> COM >> 291 Spring, 2008 Description: LEARNING PSYC220:03Fall2006 TueThu5:006:15 MONT101 EricLundquist Office:BOUS136 Phone:(860)4864084 OfficeHours: MonWed4:005:00, andbyappointment Email:Eric.Lundquist@UConn.Edu WebPage: http:/vm.uconn.edu/~lundquis/learning.html READING: 1. 2. 3. REQ... Date Added: 2009-01-11 22:06:02 |
| syll220f06.doc Path: UConn >> PSYC >> 291 Fall, 2008 Description: LEARNING PSYC220:03Fall2006 TueThu5:006:15 MONT101 EricLundquist Office:BOUS136 Phone:(860)4864084 OfficeHours: MonWed4:005:00, andbyappointment Email:Eric.Lundquist@UConn.Edu WebPage: http:/vm.uconn.edu/~lundquis/learning.html READING: 1. 2. 3. REQ... Date Added: 2009-01-11 22:06:02 |
| syll220f06.doc Path: UConn >> COM >> 1100 Fall, 2008 Description: LEARNING PSYC220:03Fall2006 TueThu5:006:15 MONT101 EricLundquist Office:BOUS136 Phone:(860)4864084 OfficeHours: MonWed4:005:00, andbyappointment Email:Eric.Lundquist@UConn.Edu WebPage: http:/vm.uconn.edu/~lundquis/learning.html READING: 1. 2. 3. REQ... Date Added: 2009-01-10 02:41:06 |
| syll220f06.doc Path: UConn >> PSYC >> 1100 Fall, 2008 Description: LEARNING PSYC220:03Fall2006 TueThu5:006:15 MONT101 EricLundquist Office:BOUS136 Phone:(860)4864084 OfficeHours: MonWed4:005:00, andbyappointment Email:Eric.Lundquist@UConn.Edu WebPage: http:/vm.uconn.edu/~lundquis/learning.html READING: 1. 2. 3. REQ... Date Added: 2009-01-10 02:41:06 |
| 040511taxes.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: BBC NEWS | Business | Tax cuts key to Australian budget Tax cuts key to Australian budget Australia\'s voters are in line for tax cuts and increases in family support as the conservative government prepares for an upcoming election. In his budget spee... Date Added: 2009-02-11 19:56:34 |
| CHEM-Notes Path: USC >> CHEM >> 105ALg Fall, 2005 Description: 8/28/03 Pre Lab o Title o Purpose o Procedure o Statement of Expected hazards What is hazard What is point of entry How to prevent Sources Material Safety Data Sheet Consumer Information Manufacturer Customer Service (FAQs) Journal of Chemical Educat... Date Added: 2007-10-16 20:10:58 |
| 2387.014.ps Path: Hawaii >> SOEST >> 2387 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207379924.0388276 Float: 2387 Profile: 014 Location: 36.7N 152.6E Date: 08/15... Date Added: 2009-02-17 20:06:34 |
| post lab 13 Path: Georgia Tech >> CHEM >> 1310 Fall, 2006 Description: Chem1310 Name: Partner\'s Name: Section: Date of Experiment Performed: Date of Report Prepared: Electrolysis pH [OH] Time (min) Observations [OH] Final 6.429 11.296 0.000000027 0.0019770 0 15 rust colored clear solution solution 0.001977 Initial I10 ... Date Added: 2008-04-07 22:09:14 |
| French001syllabus Path: Penn State >> FR >> 001 Spring, 2008 Description: French 1 Course Objectives and Syllabus Spring 2008 Section Number: 004 Instructor: Michle Cahen Instructor\'s e-mail: mac554@psu.edu Meeting times and place: M T W R 4:40pm 5:30pm Office Hours: M 2pm-4pm Office Phone: 814-865-9580 Required Textbooks... Date Added: 2008-03-31 20:27:09 |
| L10b-JavaBeans.pdf Path: SUNY Stony Brook >> CSE >> 336 Fall, 2008 Description: Session 10b Java Beans Reading & Reference Reading Head First Chapter 3 Session 10b Reference JavaBeans 1.01 Specification java.sun.com/products/javabeans/docs/spec.html JavaBeans 1 Robert Kelly, 2001-2008 2 Lecture Objectives Understand ho... Date Added: 2009-01-09 07:16:31 |
| L10b-JavaBeans.pdf Path: SUNY Stony Brook >> CSE >> 596 Fall, 2008 Description: Session 10b Java Beans Reading & Reference Reading Head First Chapter 3 Session 10b Reference JavaBeans 1.01 Specification java.sun.com/products/javabeans/docs/spec.html JavaBeans 1 Robert Kelly, 2001-2008 2 Lecture Objectives Understand ho... Date Added: 2009-01-09 07:16:31 |
| lecture30.pdf Path: Maryland >> CS >> 30 Fall, 2008 Description: n P P # ~ H m C wpm#wq D ( P )%FBEptU)emcF)e# !0 pq%#D%Qc @ Fe# %# P ~ D ( P # P H m C \" P # P & ( m # m {8 \'9 ( ... Date Added: 2009-02-06 19:05:57 |
| vcinequality.pdf Path: Ohio State >> STAT >> 881 Spring, 2008 Description: 4 RISK BOUNDS FOR AN INFINITE CLASS 18 4.2 Generalization of Glivenko-Cantelli Theorem In the previous section, it was observed that the supremum dierence between the empirical distribution function of a random variable and its true distribution ... Date Added: 2009-01-12 06:10:35 |
| 2389.128.ps Path: Hawaii >> SOEST >> 2389 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207380662.0388276 Float: 2389 Profile: 128 Location: 37.8N 154.0E Date: 03/25... Date Added: 2009-02-17 20:14:35 |
| Chem HW 5 Path: Texas >> CH >> 301 Fall, 2007 Description: Marek, Erin Homework 5 Due: Oct 17 2007, 11:00 pm Inst: Brodbelt This print-out should have 21 questions. Multiple-choice questions may continue on the next column or page find all choices before answering. The due time is Central time. Brodbelt ... Date Added: 2008-06-25 16:32:31 |
| Quiz 4.2006 Path: Michigan >> ACC >> 471 Winter, 2006 Description: ACCOUNTING 471 FINANCIAL ACCOUNTING WINTER 2006 Quiz #4 Name: (Print) Student Number: Instructions 1. This quiz has 15 points and ends in 45 minutes. 2. Print your name on this cover sheet and initial each page in the upper right-hand corner. 3. ... Date Added: 2008-06-11 20:14:13 |
| Completed version of Assignment 2 Path: Texas >> J 310 >> 07240 Fall, 2007 Description: Levi 1 October 25, 2007 Assignment # 2 On April 20, 1999 in Littleton, Colorado, two students, Eric Harris and Dylan Klebold, opened fire throughout the school hallways on their classmates at Columbine High School. The professional questions and issu... Date Added: 2008-03-18 23:25:36 |
| hw2_solutions.pdf Path: SUNY Stony Brook >> PHY >> 252 Fall, 2008 Description: PHY 251 Spring 2008: homework problem set 2, due Thursday, Feb. 14. Serway problem 1.24 Answer: As seen from earth in frame S1 , we have v1,x,A = 0 and v1,y,A = 0.90c. If we shift into the frame of ship B, we need to do a frame shift of v = +0.90c (w... Date Added: 2009-01-11 18:18:38 |
| hw2_solutions.pdf Path: SUNY Stony Brook >> HIS >> 251 Spring, 2008 Description: PHY 251 Spring 2008: homework problem set 2, due Thursday, Feb. 14. Serway problem 1.24 Answer: As seen from earth in frame S1 , we have v1,x,A = 0 and v1,y,A = 0.90c. If we shift into the frame of ship B, we need to do a frame shift of v = +0.90c (w... Date Added: 2009-01-11 18:18:38 |
| review07.pdf Path: SUNY Stony Brook >> ESE >> 124 Fall, 2008 Description: ESE 333 Real-Time Operating Systems Course Review Handed out: December 14, 2007 Major class topics: Process: multiprogramming, state, implementation, scheduling. Interprocess communication: race conditions, critical sections, test and set lock, se... Date Added: 2009-01-09 07:18:03 |
| review07.pdf Path: SUNY Stony Brook >> ESE >> 333 Fall, 2008 Description: ESE 333 Real-Time Operating Systems Course Review Handed out: December 14, 2007 Major class topics: Process: multiprogramming, state, implementation, scheduling. Interprocess communication: race conditions, critical sections, test and set lock, se... Date Added: 2009-01-09 07:18:03 |
| 210A_W07_HW3Soln.PDF Path: UCSB >> PHYS >> 210a Winter, 2008 Description: ... Date Added: 2009-01-11 21:51:34 |
| FREUD, ERICKSON, HORNEY, PIAGET Path: Midwestern >> PHIL >> 3233 Spring, 2008 Description: FREUD The Oral Stage 0-18 The oral stage begins at birth, when the oral cavity is the primary focus of libidal energy. The child, of course, preoccupies himself with nursing, with the pleasure of sucking and accepting things into the mouth. The oral... Date Added: 2008-04-08 21:07:34 |
| Outline V Path: Furman >> HST >> 22 Fall, 2007 Description: David McHugh World Civ. II Honors Outline V - pp. 585-593 Mr. Potter March 11, 2004 I. Post-Vienna shifts in government in Europe A. Parliament was divided into two political parties: Tories and Whigs. The Tories maintained dominance until some eco... Date Added: 2008-06-01 13:30:48 |
| Lecture5.pdf Path: Maryland >> CMSC >> 424 Fall, 2001 Description: CMSC 424 Database design Lecture 5: Relational Model Queries SQL.maybe Book: Chap. 2 Chap. 3.maybe Mihai Pop Logistics Homework.NOW No office hours tomorrow! Oracle accounts. have you tried them? SQL assignment will be issued Thursday part 1 d... Date Added: 2009-02-06 19:29:57 |
| Lecture5.pdf Path: Maryland >> CMSC >> 5 Fall, 2008 Description: CMSC 424 Database design Lecture 5: Relational Model Queries SQL.maybe Book: Chap. 2 Chap. 3.maybe Mihai Pop Logistics Homework.NOW No office hours tomorrow! Oracle accounts. have you tried them? SQL assignment will be issued Thursday part 1 d... Date Added: 2009-02-06 19:29:57 |
| Lecture 20 - Propulsion Lab with MATLAB - 06.ppt Path: Ohio State >> PHYSICS >> 132i Winter, 2008 Description: Engineering H192 - Computer Programming Propulsion Lab with MATLAB Lecture 20 Winter Quarter The Ohio State University Gateway Engineering Education Coalition Lect 20 P. 1 Engineering H192 - Computer Programming Recording a Session With the MA... Date Added: 2009-01-10 03:20:34 |
| Lecture 20 - Propulsion Lab with MATLAB - 06.ppt Path: Ohio State >> ENGINEER >> H192 Fall, 2008 Description: Engineering H192 - Computer Programming Propulsion Lab with MATLAB Lecture 20 Winter Quarter The Ohio State University Gateway Engineering Education Coalition Lect 20 P. 1 Engineering H192 - Computer Programming Recording a Session With the MA... Date Added: 2009-01-10 03:20:34 |
| Lec25.pdf Path: Washington State >> BSYSE >> 595 Fall, 2008 Description: Introduction to Ground-Water Flow Simulation 1. Usefulness of Ground-water Model A central tenet: properly designed they can corroborate hypothesis elucidate discrepancies in other models be used... Date Added: 2009-02-18 13:48:16 |
| Lec25.pdf Path: Martin Luther >> BSYSE >> 595 Fall, 2008 Description: Introduction to Ground-Water Flow Simulation 1. Usefulness of Ground-water Model A central tenet: properly designed they can corroborate hypothesis elucidate discrepancies in other models be used... Date Added: 2009-02-18 13:48:16 |
| bsuecwp199601mcclure.pdf Path: Ball State >> ID >> 705 Fall, 2008 Description: TOURNAMENT PERFORMANCE AND \"AGENCY\" PROBLEMS: AN EMPIRICAL INVESTIGATION OF \"MARCH MADNESS\" James E. McClure and Lee C. Spector Associate Professors of Economics Ball State University Muncie, IN Tournament Performance and \"Agency\" Problems: An Empi... Date Added: 2009-01-09 23:39:31 |
| Activity 56 Worksheet Blank.doc Path: Sierra >> AT >> 56 Fall, 2008 Description: Name_ Activity 56 Worksheet Directions: Fill in the worksheet using the information from the Web sites you are exploring. Section A 1. Is there a directory section? _ Section B 1. Place a check mark next to the features that appear on the Netcent... Date Added: 2009-02-02 16:09:57 |
| 040115won.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: WSJ.com - Seoul Acts to Curtail Won \'Manipulation\' January 15, 2004 4:02 p.m. EST ASIAN BUSINESS NEWS Seoul Acts to Curtail Won \'Manipulation\' By HYE-SEUNG SEO DOW JONES NEWSWIRES SEOUL, South Korea - Faced with a recent rise in the won\'s value, Sout... Date Added: 2009-02-11 18:18:17 |
| Chapter19.pdf Path: Old Dominion >> PHYS >> 112 Spring, 2003 Description: current Chapter 19 current, resistance and dc circuits previously we considered electrostatic situations in which no E-eld could exist inside a conductor now we move to the case where an electric eld is maintained within a conductor by an external... Date Added: 2009-02-17 19:13:09 |
| Chapter19.pdf Path: Old Dominion >> PHYS >> 19 Spring, 2008 Description: current Chapter 19 current, resistance and dc circuits previously we considered electrostatic situations in which no E-eld could exist inside a conductor now we move to the case where an electric eld is maintained within a conductor by an external... Date Added: 2009-02-17 19:13:09 |
| 481.workbook.pdf Path: Washington >> ARCH >> 481 Fall, 2008 Description: Arch 481 : 3D Modeling and Rendering Model & Rendering by Doo Young Kwon, Aut 02. Exercise Workbook Autumn 2008 by Brian Johnson brj@u.washington.edu ARCH 481: 3D MODELING AND RENDERING P2 The Project: Overview At the center of this course is a... Date Added: 2009-02-02 20:29:35 |
| Quiz14,PrinceI Path: BU >> CGS >> 101 Fall, 2008 Description: QUIZ #14 SS-101 Team F \"The Prince\" chs. I-XI Prof. Susan Lee 1) In composing his reflections on power in princedoms, Machiavelli drew on a) b) c) d) traditional Church teaching courses in politics at the University of Milan ancient Greek and Roman ... Date Added: 2008-04-16 20:19:38 |
| ENGL240 - LCC - Maltese Falcon Path: Lansing >> ENGL >> 240 Spring, 2007 Description: When examining John Hustons classic 1941 detective film, The Maltese Falcon, one must look at the source material employed to truly gain a complete understanding of the film. The film was the third Hollywood adaptation of Dashiell Hammetts 1930 novel... Date Added: 2008-03-19 12:39:40 |
| ima05.ppt Path: Minnesota >> IMA >> 05 Fall, 2008 Description: Scheduling High Speed Data in (Adversarial) Wireless Networks Matthew Andrews Bell Labs June 27, 2005 Standard single server scheduling problem server rate C Choose queue/user to serve Serve at rate C Service rate constant in time & user indep... Date Added: 2009-02-17 21:03:56 |
| 1501.doc Path: U. Houston >> ARAB >> 1501 Fall, 2008 Description: ARAB 1501 Beginning Arabic I, FALL 2002 Instructor: Tawhida El-Askary Office: 616 Agnes Arnold Hall, Tel: (713) 743-9141 E-mail: Telaskary@UH.edu Time: TTH 1:00-3:30 - Room: 34H Office Hours: 11:00-1:00 TTH , and by appointment Arabic Web Site: http:... Date Added: 2009-02-03 13:45:23 |
| tetracyc.pdf Path: Towson >> CHEM >> 332 Spring, 2008 Description: TOTAL SYNTHESIS OF A TETRACYCLINE The first synthesis of the tetracycline skeleton by the legendary Robert B. Woodward and a group at Pfizer, was published in J. Am. Chem. Soc. 1962, 84, 3222 - 4. This compound, now called sancycline, is active as an... Date Added: 2009-01-09 07:26:30 |
| tetracyc.pdf Path: Towson >> ART >> 373 Spring, 2008 Description: TOTAL SYNTHESIS OF A TETRACYCLINE The first synthesis of the tetracycline skeleton by the legendary Robert B. Woodward and a group at Pfizer, was published in J. Am. Chem. Soc. 1962, 84, 3222 - 4. This compound, now called sancycline, is active as an... Date Added: 2009-01-11 18:24:09 |
| tetracyc.pdf Path: Towson >> SOCI >> 373 Summer, 2008 Description: TOTAL SYNTHESIS OF A TETRACYCLINE The first synthesis of the tetracycline skeleton by the legendary Robert B. Woodward and a group at Pfizer, was published in J. Am. Chem. Soc. 1962, 84, 3222 - 4. This compound, now called sancycline, is active as an... Date Added: 2009-01-11 18:24:09 |
| 5A Climate.pdf Path: Maryland >> GVPT >> 273 Fall, 2008 Description: 5A: Climate Change Greenhouse effect 1824: Fourier argues gases affect earths surface temperature 1859: Tyndall finds important GHGs water vapor and CO2 1957: measure of atmospheric CO2 begins Major greenhouse gases CO2: coal, oil, gas (most forms... Date Added: 2009-02-03 13:55:43 |
| lec18-binomial Path: Michigan >> EECS >> 203 Winter, 2007 Description: EECS 203, Winter 2007 Discrete Mathematics Lecture 18 Binomial Coefficients March 13 Reading: Rosen [5.4] March 13 Binomial Coefficients, Page 1 18.1 Binomial Theorem n (x + y) = j=0 n n n-j j x y . j March 13 Binomial Coefficients, Page 2 ... Date Added: 2008-04-01 22:29:56 |
| 05final Path: UC Davis >> CHA >> 101 Winter, 2005 Description: ... Date Added: 2008-08-09 12:01:26 |
| 1151_dgt.pdf Path: Minnesota >> MATH >> 1151 Fall, 2008 Description: Name(Print):. Circle Section Number, 21, 22, 23, 24, 25 ID(Number):. Signature:. Math 1151, Lecture 20 Diagnostic Test September 7, Friday, 2007. Professor Peter A. Rejto. 1. (40 pts.) If Mary ate 3 th of a pizza and Mathew ate 2 th of a pizza,... Date Added: 2009-02-17 20:45:49 |
| exam2.pdf Path: ETSU >> PHYS >> 2010 Fall, 2008 Description: PHYS-2010 Constants and Formulae Sheet Useful Constants u kB k G h c R K 1 mm 1 km 1 mi 1 inch 1 min 1 day 1 A.U. = = = = = = = = = = = = = = = = = 1.661 1027 kg R/NA = 1.381 1023 J/K 1/4 = 9.00 109 N m2 / C2 6.672 1011 N m2 / kg2 1/( c2 ) = 8.... Date Added: 2009-02-17 23:43:14 |
| 1999scan135.pdf Path: Cornell >> HORT >> 115 Spring, 2008 Description: ... Date Added: 2009-01-12 04:26:29 |
| 1999scan135.pdf Path: Cornell >> HORT >> 243 Fall, 2008 Description: ... Date Added: 2009-01-12 04:26:29 |
| 1999scan135.pdf Path: Cornell >> HORT >> 499 Fall, 2008 Description: ... Date Added: 2009-01-12 04:26:29 |
| 1999scan135.pdf Path: Cornell >> HORT >> 636 Fall, 2008 Description: ... Date Added: 2009-01-12 04:26:29 |
| Marketing StrategyBB Path: Lehigh >> MKT >> 111 Spring, 2009 Description: Company and Marketing Strategy Chapter 2 Learning Goals Explain strategic planning 2. Describe business portfolios and growth strategies 3. Describe elements of customer-driven marketing strategy 1. Strategic Planning Org. Objectives Strategic Fi... Date Added: 2009-01-21 09:58:29 |
| Grammar-Syntax.pdf Path: Penn >> LING >> 255 Fall, 2008 Description: Ling 255: Sem machine\" that ... Date Added: 2009-02-06 17:36:16 |
| safetynotebookreport.pdf Path: Missouri S&T >> COMP ENG >> 391 Fall, 2008 Description: Safety Avoidance of preventable accidents is an important measure of the foresight and capability of supervision in the engineering industries. You may soon be supervising technical work involving varying degrees of hazard. Give serious thought to th... Date Added: 2009-01-11 16:46:56 |
| safetynotebookreport.pdf Path: Missouri S&T >> COMP ENG >> 392 Fall, 2008 Description: Safety Avoidance of preventable accidents is an important measure of the foresight and capability of supervision in the engineering industries. You may soon be supervising technical work involving varying degrees of hazard. Give serious thought to th... Date Added: 2009-01-11 16:46:56 |
| HUM 111 Test 1 Path: Pepperdine >> HUM >> 111 Fall, 2007 Description: Prehistoric Era: Paleolithic-early stone age, last great ice age, land bridge, migration, nomadic ppl, temporary shelters, cave paintings, art is shift from simple to complex, means to bring order, jewelry to distinguish groups/classes, Woman of Will... Date Added: 2008-04-18 15:50:52 |
| death.pdf Path: UCLA >> ANDERSON >> 18147 Fall, 2008 Description: J Econ Growth (2008) 13:81124 DOI 10.1007/s10887-008-9029-3 Death and development Peter Lorentzen John McMillan Romain Wacziarg Published online: 15 March 2008 Springer Science+Business Media, LLC 2008 Abstract Analyzing a variety of cross-nati... Date Added: 2009-02-11 22:03:10 |
| MaciasVitae.pdf Path: UCLA >> CHAVEZ >> 2 Fall, 2008 Description: ... Date Added: 2009-02-11 22:08:35 |
| HW4_Soln Path: N.C. State >> ECE >> 200 Fall, 2008 Description: Masnari/Escuti/Brickley ECE 200 Fall 2008 Homework 4 Basic DC Circuits with Diodes and Capacitors 1. [12 pts] Find the minimum voltage Vx needed to keep the diode on. Assume the diode has a turn-on voltage of 1 V. In order to determine the minimu... Date Added: 2009-03-10 07:07:27 |
| CENE 270.doc Path: N. Arizona >> CENE >> 270 Fall, 2008 Description: UNIVERSITY CURRICULUM COMMITTEE PROPOSAL FOR COURSE CHANGE 1. Is this a Liberal Studies or Diversity Course? Liberal Studies Diversity Both 2. Course change effective beginning of what term and year? (ex. Spring 2008, Summer 2008) See effective dates... Date Added: 2009-02-02 15:11:38 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
