Course Solutions And Notes - PHCM9911_Outline 3c
| ecr_eedf.pdf Path: Michigan >> ECE >> 423 Fall, 2009 Description: ... Date Added: 2009-06-06 22:31:37 |
| week1_lecture_introduction.ppt Path: GWU >> WEEK >> 001 Fall, 2009 Description: Welcome SEAS 001, Fall 2007, S. Ahmadi SEAS 001, today\'s agenda: Welcome: Introduction: Announcement: Associate Dean Douglas Jones Professor Sharhokh Ahmadi SEAS Student Organizations: Nathan Denver, V.P. E-Council Professor and Chair Dianne Mart... Date Added: 2009-06-06 22:34:03 |
| 09-transaction.pdf Path: Duke >> X >> 116 Fall, 2009 Description: Announcements (September 26) Homework #2 due this Thursday 2 SQL: Transactions CPS 116 Introduction to Database Systems Help session tomorrow (Wednesday) at 5:30pm in D344 If you missed Homework #1 sample solution, pick one up from the handout bo... Date Added: 2009-06-06 22:41:33 |
| lect01-4up.pdf Path: Duke >> X >> 001 Fall, 2009 Description: W! em lo ce PilsCtrcc rcefouin ip me n o pSe e Cc oS m p i 1 Si3 o1 c6 S c W-:0 ,F02 15 01 : Psreos reJFe oofr f b Tyo o\'tp d is ac s ! ! ! ! ! Wicrau htsub ah so ts oe t i ? Hwglata oreiteh wg or t a o n? en Wigtligu htsykts oh an ? iuo s Wwoe hde... Date Added: 2009-06-06 22:48:40 |
| Gondow.pdf Path: UAB >> CS >> 693 Fall, 2009 Description: Experience with ANSI C Markup Language for a cross-referencer Hayato Kawashima and Katsuhiko Gondow Department of Information Science, Japan Advanced Institute of Science and Technology (JAIST) 1-1 Asahidai Tatsunokuchi Nomi Ishikawa, 923-1292, JAPAN... Date Added: 2009-06-06 22:49:52 |
| assembler.ppt Path: UPR Mayagüez >> INEL >> 4206 Fall, 2009 Description: Development environments Two styles Assembler/compiler-linker like MASM and Linux and Complete environments like SPIM and Visual Studio Summer 1999 ICOM 4206 - Assembler Basics Separate development components Assembler/compiler-linker like MA... Date Added: 2009-06-06 23:01:39 |
| projsched.pdf Path: Johns Hopkins >> MTS >> 252 Fall, 2009 Description: Project Scheduling Examples Example 1: Networks and Critical Paths The library at Kaufman Products has just received authorization to spend up to $40,000 on new journal subscriptions and book purchases. Accordingly, the librarian has developed the f... Date Added: 2009-06-06 23:10:15 |
| ne-tutorial.ppt Path: Berkeley >> I >> 290 Fall, 2009 Description: Named Entity Recognition http:/gate.ac.uk/ http:/nlp.shef.ac.uk/ Hamish Cunningham Kalina Bontcheva RANLP, Borovets, Bulgaria, 8th September 2003 Structure of the Tutorial task definition applications corpora, annotation evaluation and testing ... Date Added: 2009-06-06 23:10:33 |
| matlab_primer3.ps Path: Stanford >> EE >> 241 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.55 Copyright 1986, 1994 Radical Eye Software %Title: pr.dvi %Pages: 39 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o /user1/burke/.www/crs/515/PS/pr.ps pr.dvi %DVIPSParameters: ... Date Added: 2009-06-06 23:11:21 |
| ex08-80.txt Path: Purdue >> STAT >> 511 Fall, 2008 Description: \"C1\" 95 16 11 3 42 71 225 64 87 123 ... Date Added: 2009-06-06 23:23:44 |
| weiss_ppt16.ppt Path: Rose-Hulman >> CSSE >> 200930 Fall, 2009 Description: Chapter 16 Stacks and Queues Copyright 2006 Pearson Addison-Wesley. All rights reserved. 16-2 Copyright 2006 Pearson Addison-Wesley. All rights reserved. 16-3 Copyright 2006 Pearson Addison-Wesley. All rights reserved. 16-4 Copyright 2006 ... Date Added: 2009-06-07 05:19:19 |
| Imperial America.doc Path: Stanford >> E >> 297 Fall, 2009 Description: Imperial America EDGE Fall Quarter 2003 Tim Chueh Ambert Ho 12/5/03 What Is Imperialism? Imperialism is the highest stage of capitalismcharacterized by monopoly corporations and the compulsion to export capital abroad for higher profits. Unlike cap... Date Added: 2009-06-07 05:31:50 |
| C3.4u.pdf Path: Allan Hancock College >> COMP >> 6300 Fall, 2009 Description: Pointers, Arrays and Structures Pointers as Parameters q passing a pointer as a parameter to a function allows the function to change the variable the pointer refers to q pointers: example, as parameters q dynamically allocated arrays q command li... Date Added: 2009-06-07 05:34:02 |
| tutsol3.pdf Path: Allan Hancock College >> MATH >> 1111 Fall, 2009 Description: The University of Sydney School of Mathematics and Statistics Solutions to Tutorials 23/03/09,24/03/09 and 26/03/09,27/03/09 MATH1111: Introduction to Calculus Web Page: http:/www.maths.usyd.edu.au/u/UG/JM/MATH1111/ Lecturer: Clio Cresswell Semeste... Date Added: 2009-06-07 05:38:45 |
| ece529-s38.pdf Path: Idaho >> EE >> 529 Fall, 2009 Description: ... Date Added: 2009-06-07 05:45:55 |
| GIFopt.pdf Path: Laurentian >> NMED >> 1000 Fall, 2009 Description: Optimizing GIF Images Strategy 1. Be sure that your image is as small as you need it before you start. Less pixels means that your image will load quicker. 2. Reduce the number of colours. Less colours means faster loading. 3. Use lossy compression. ... Date Added: 2009-06-07 05:46:58 |
| Casa.xls Path: Penn State >> LKW >> 5000 Fall, 2009 Description: Casa Grande Resort and Spa Profit Center Analysis of Indirect Expenses Total Net Revenue Cost of Sales Direct Expenses Spa 78865 36715 14750 2622.33 4,947.50 1,663.83 1,009.69 2,100.16 1,889.89 $14,233.40 13166.60 2500 Lounge 492800 136500 152975 163... Date Added: 2009-06-07 05:49:36 |
| Reply to Carr HBR Article.pdf Path: Michigan >> SI >> 110 Fall, 2008 Description: http:/www.osopinion.com/perl/printer/21672/ osOpinion Tech Opinion Commentary For the People, By the People. \'IT Doesn\'t Matter\' - Yeah, Right Contributed by James Maguire osOpinion.com June 05, 2003 http:/www.osopinion.com/perl/story/21672.html \"I... Date Added: 2009-06-07 05:55:07 |
| CBET000772.txt Path: Harvard >> IAU >> 000700 Fall, 2009 Description: Electronic Telegram No. 772 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E... Date Added: 2009-06-07 05:57:53 |
| CBET000649.txt Path: Harvard >> IAU >> 000600 Fall, 2009 Description: Electronic Telegram No. 649 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E... Date Added: 2009-06-07 07:12:47 |
| CBET000579.txt Path: Harvard >> IAU >> 000500 Fall, 2009 Description: Electronic Telegram No. 579 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E... Date Added: 2009-06-07 07:13:28 |
| CBET000781.txt Path: Harvard >> IAU >> 000700 Fall, 2009 Description: Electronic Telegram No. 781 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E... Date Added: 2009-06-07 07:13:50 |
| CBET000010.txt Path: Harvard >> IAU >> 000000 Fall, 2009 Description: Electronic Telegram No. 10 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.ED... Date Added: 2009-06-07 07:14:06 |
| CBET000052.txt Path: Harvard >> IAU >> 000000 Fall, 2009 Description: Electronic Telegram No. 52 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.ED... Date Added: 2009-06-07 07:14:12 |
| ep_nflu.txt Path: Berkeley >> ASTRO >> 00100585 Fall, 2009 Description: # Ep lNiso 197.624 8.494 203.996 8.512 219.151 8.651 223.111 8.664 225.213 8.656 230.000 8.664 232.613 8.683 233.973 8.696 236.059 8.657 236.142 8.684 237.614 8.670 240.168 8.667 241.111 8.694 243.056 8.686 244.947 8.657 245.729 8.662 248.067 8.692 2... Date Added: 2009-06-07 07:34:56 |
| CHEM1152PSalkenerxn.doc Path: Clayton >> CHEM >> 1152 Fall, 2009 Description: CHEM 1152 Clayton State University Dr. Susan F. Hornbuckle Chapter 13a Reaction Completion Problem Set Complete the following reactions: CH3 C CH3 + Br2 CH3 C CH3 CH3 CH2 CH CH2 CH3 C CH + H2O + 2Cl2 + H2 CH3 CH + HCl H2SO4 CH2 + H2 Pt CH3 CH CH CH... Date Added: 2009-06-07 07:35:53 |
| CHEM1152PSalcoholrxn.doc Path: Clayton >> CHEM >> 1152 Fall, 2009 Description: CHEM 1152 Clayton State University Dr. Susan F. Hornbuckle Chapter 14 - Reaction Completion Problem Set Complete the following reactions: CH3 HO C CH3 CH3 CH2 CH3 H2SO4 140oC H2SO4 180oC OH CH3 CH2 K2Cr2O7 H2SO4 OH CH3 CH CH3 CH3 CH CH3 CH OH C... Date Added: 2009-06-07 07:35:54 |
| Exam_1_practice.pdf Path: Mich Tech >> MEEM >> 4403 Fall, 2008 Description: 47 MEEM 4403 COMPUTER-AIDED DESIGN METHODS MIDTERM EXAM PRACTICE QUESTIONS Name: _ You are allowed one sheet of notes. 1. What constraints could be added to fully constrain the wireframe shown? Include constraints to remove rigid body motion. Do no... Date Added: 2009-06-07 07:38:38 |
| v7.ppt Path: Bergen CC >> CS >> 150 Fall, 2009 Description: Spring 2000 EECS150 Page 1 Spring 2000 EECS150 Page 2 Spring 2000 EECS150 Page 3 Spring 2000 EECS150 Page 4 Spring 2000 EECS150 Page 5 Spring 2000 EECS150 Page 6 ... Date Added: 2009-06-07 07:38:44 |
| PLS_308_Handouts_Organizational_Culture.pdf Path: UNC Wilmington >> PLS >> 308 Fall, 2009 Description: ... Date Added: 2009-06-07 07:39:52 |
| Armstrong_JBR_2002.pdf Path: NMSU >> M >> 610 Fall, 2009 Description: Marketing Papers University of Pennsylvania Year 2003 Discovery and communication of important marketing findings: evidence and proposals J. Scott Armstrong University of Pennsylvania, armstrong@wharton.upenn.edu Postprint version. Published in Jou... Date Added: 2009-06-07 07:40:11 |
| Schwarz, Norbert (Answering Questions).pdf Path: NMSU >> M >> 610 Fall, 2009 Description: ... Date Added: 2009-06-07 07:40:19 |
| m454_intro_to_pricing_decisions_part2.ppt Path: NMSU >> M >> 454 Fall, 2009 Description: Introduction to Pricing Decisions: Part 2 Product Mix Pricing Strategies Product line pricing Optional-product pricing Captive-product pricing By-product pricing Product bundle pricing 2 Product-Line Pricing Involves setting price steps betw... Date Added: 2009-06-07 07:40:41 |
| 11_04christianNotes.pdf Path: Texas El Paso >> CS >> 5353 Fall, 2008 Description: ... Date Added: 2009-06-07 07:42:49 |
| Recitation5.08.pdf Path: Washburn >> CH >> 152 Fall, 2009 Description: Recitation 5 1. To the left is the crystal structure for AlF3 a. What type of unit cell is this? b. All of the corner atoms are the same ion, while the rest are the other ion. Which ion occupies the corners? c. How many total Al3+ ions are in the ce... Date Added: 2009-06-07 07:43:19 |
| sexual selection in guppies 04.pdf Path: Utah State >> BIOL >> 1020 Fall, 2008 Description: Biology 1020 Sexual Selection in Guppies Introduction It is difficult not to notice that in some species the sexes are alike and in other species the sexes look different in size, shape, coloration and other attributes. Examples of species where sex... Date Added: 2009-06-07 07:45:47 |
| metalesson5.doc Path: University of Illinois, Urbana Champaign >> CI >> 332 Fall, 2009 Description: Pam Ochs Math Metalesson 5 October 19, 2003 We have taken a few weeks and skipped metalessons to work on our other big projects. I think I almost forgot how to write one. Here goes nothing. During last week\'s class we discussed the Kathy article. Whe... Date Added: 2009-06-07 07:45:58 |
| GTrans.ppt Path: George Mason >> IT >> 803 Fall, 2008 Description: IT 803 Spring 2004 Mixed-Initiative Intelligent Systems Prof. G. Tecuci GTrans: MixedInitiative Planning System by Michael Cox Reviewed by Vu Le Presentation Outline Introduction to GTrans Example of using GTrans in planning Details of... Date Added: 2009-06-07 07:47:03 |
| Text.ppt Path: UC Riverside >> CS >> 179 Fall, 2009 Description: Text Similarity Dr Eamonn Keogh Computer Science & Engineering Department University of California - Riverside Riverside,CA 92521 eamonn@cs.ucr.edu Word Length 1 2 3 4 5 6 7 8 9 10 11 12 13+ Twain Sample 1 74 349 456 374 212 127 107 84 45 27 13 8 ... Date Added: 2009-06-07 07:48:35 |
| 19980204_163113_antstep.txt Path: St. Mary MD >> CDF >> 001 Fall, 2009 Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd01/19980204_163113_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 1000 Hertz Unambig_veloc... Date Added: 2009-06-07 07:50:59 |
| 19980303_193712_antstep.txt Path: St. Mary MD >> CDF >> 151 Fall, 2009 Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd20/19980303_193712_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 1000 Hertz Unambig_veloc... Date Added: 2009-06-07 07:51:18 |
| 19980217_233824_antstep.txt Path: St. Mary MD >> CDF >> 051 Fall, 2009 Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd09/19980217_233824_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 1000 Hertz Unambig_veloc... Date Added: 2009-06-07 07:51:28 |
| 19931117_215914_surv.txt Path: St. Mary MD >> CDF >> 251 Fall, 2009 Description: File: /server/02/IPIX/DATA/Dartmouth/netcdf/ohgr0021/19931117_215914_surv.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 533.3333 Hertz Unambig_veloci... Date Added: 2009-06-07 07:52:07 |
| Exam1Solutions.pdf Path: BU >> PY >> 211 Fall, 2009 Description: PY 211 Mid Term Exam I February 13, 2007 The Formulae Sheet Problem 1 Three forces are applied to a circular ring in such a way that the ring remains in equilibrium. If the forces, in Newtons, are applied to the ring as shown below, find the magni... Date Added: 2009-06-07 07:52:51 |
| AssignmentWeek3rev.doc Path: Cardinal Stritch >> EDL >> 712 Fall, 2009 Description: Assignment EdL 712 Current Issues in Assessment Week Three Study Team Discuss the assigned chapters and come to class prepared for an active discussion. Individual Read the assigned chapters: Chapters 14-17 in Paris and Stahl; chapters 4-6 in Perform... Date Added: 2009-06-07 07:53:55 |
| SP IV.B-2.pdf Path: E. Kentucky >> ITTC >> 622 Fall, 2009 Description: Special Problem IV.B-2 A plane wave propagating in the x-direction passes through a material with dielectric constant r = 4 + j 4 . If = 10 cm and W ( x = 0 ) = 1 W/m2 , what is W ( x = 1 ) ? ... Date Added: 2009-06-07 07:55:23 |
| EM Wave Propagation.pdf Path: E. Kentucky >> ITTC >> 622 Fall, 2009 Description: ... Date Added: 2009-06-07 07:55:52 |
| The Reflection Coefficient.pdf Path: E. Kentucky >> ITTC >> 622 Fall, 2009 Description: 1/27/2005 The Reflection Coefficient.doc 1/5 The Reflection Coefficient So, we know that the transmission line voltage V ( z ) and the transmission line current I ( z ) can be related by the line impedance Z ( z ) : V (z ) = Z (z ) I (z ) or equi... Date Added: 2009-06-07 07:56:01 |
| LS.pdf Path: UT Arlington >> MATH >> 5371 Fall, 2008 Description: 1 Sensitivity of the Least Squares Problem Let A Rmn (m n) having full column rank, and let b Rm . Consider the least squares problem min Ax - b 2 , x whose solution is given by xls = where A = (AT A)-1 AT . We are interested in how much perturb... Date Added: 2009-06-07 07:56:14 |
| exam4.pdf Path: Auburn >> PHYS >> 1600 Fall, 2008 Description: SAMPLE PROBLEMS: A 30 kg mass is on a spring that is initially stretched 15 cm by a 125 N force. Write down an expression for the oscillating velocity, v(t), of the spring. First, solve for the spring constant, k : x Then, solve for the angular frequ... Date Added: 2009-06-07 07:56:37 |
| Tipler03_compton.pdf Path: Auburn >> PHYS >> 2200 Fall, 2008 Description: Tipler03_001-002hr.qxd 1/15/08 11:56 Page 1 MORE: Derivation of Comptons Equation Let 1 and 2 be the wavelengths of the incident and scattered x rays, respectively, as shown in Figure 3-18. The corresponding momenta are p1 and p2 E2 c hf2 c h 2 ... Date Added: 2009-06-07 07:56:37 |
| Day24_Exceptions.doc Path: Wisc Platteville >> CS >> 243 Fall, 2009 Description: Day 24 (3/23/09) : Exceptions Test 2 Friday, April 3, 2009 Exceptions try, catch, throw, finally, throws abortion method of exception handling, not resumption method a try block can have one or more catch blocks if an exception is thrown, only... Date Added: 2009-06-07 07:57:20 |
| 7.5ihii-2.pdf Path: North-West Uni. >> MATH >> 364 Fall, 2009 Description: ... Date Added: 2009-06-07 07:58:41 |
| KimPopovits_Feb8_Handout.doc Path: Stanford >> MSANDE >> 472 Fall, 2009 Description: DFJ Entrepreneurial Thought Leaders PrOGRAM MS&E 472 Winter Quarter etl.stanford.edu Terman Auditorium Wednesday 4:30-5:30 PM February 8, 2006 bases.stanford.edu stvp.stanford.edu Winter Speaker Line-up Jan 18 Tom Byers Stanford University Jan 25... Date Added: 2009-06-07 07:59:28 |
| TB_Ch00_graphs.doc Path: UNC >> ECON >> 101 Fall, 2009 Description: In the circular-flow diagram shown, which arrow shows the flow of goods and services? a. A b. B c. C d. D ANSWER: b. B TYPE: M KEY1: G SECTION: 1 OBJECTIVE: 3 GRAPH FORMAT: M QUESTION INSTRUCTION: 1 RANDOM: N i . In the circular-flow diagram shown... Date Added: 2009-06-07 07:59:52 |
| ETL Handout - 100301.pdf Path: Stanford >> MSANDE >> 472 Fall, 2009 Description: ENTREPRENEURIAL THOUGHT LEADERS SEMINAR MS Randy Komisar (Intuit/Virtual CEO) Oct 10 David Kelley (IDEO) Oct 17 Mike Klei... Date Added: 2009-06-07 08:00:06 |
| BG7-6.pdf Path: Minnesota >> PSY >> 5137 Fall, 2008 Description: BG Contributions BEHAVIORAL GENETICS Topic #7 Behavioral Genetic Perspectives on Environmental Influences Genotype-environment interaction Genotype-environment correlation Shared vs. non-shared effects Developmental trajectories \"Environmental m... Date Added: 2009-06-07 08:00:15 |
| Monday_notesART344.rtf Path: San Diego State >> DESIGN >> 344 Fall, 2009 Description: Table-based and CSS Design internet-network of computers intranetextranet-When businesses have a proprietary network 1) Tables are for data -more quantitative info (numbers, data) -organizer -not for qualitative or visual layout 2) Designers use tabl... Date Added: 2009-06-07 08:00:26 |
| KeyExam1.2003.pdf Path: Texas >> BIO >> 357 Fall, 2008 Description: Zoology 357 - Evolutionary Ecology - First Exam _ 1. (6 points) List three types of natural selection and show how the population changes over time (graph the initial phenotype frequency distribution and the distribution after selection has occurr... Date Added: 2009-06-07 08:01:31 |
| energyGapTemperature.pdf Path: Vanderbilt >> PHYSICS >> 226 Fall, 2009 Description: ... Date Added: 2009-06-07 08:03:07 |
| chapter_17.pdf Path: Embry-Riddle FL/AZ >> PS >> 160 Fall, 2008 Description: ... Date Added: 2009-06-07 08:06:26 |
| Exam_2_2007.pdf Path: Embry-Riddle FL/AZ >> EP >> 455 Fall, 2009 Description: Exam #2 Quantum Physics April 20, 2007 Name (20 points) Problem 1 An electron is in the spin state = A 1 2i (a) Determine the normalization constant A. (b) Find the expectation values of Sx , Sy , and Sz . (c) Find the uncertainties Sx , Sy , a... Date Added: 2009-06-07 08:06:43 |
| integral007.pdf Path: Embry-Riddle FL/AZ >> EP >> 455 Fall, 2009 Description: ... Date Added: 2009-06-07 08:06:57 |
| Week14_handout.doc Path: Wisconsin >> PSY >> 710 Fall, 2009 Description: Psych 710 Week 14 Polynomial regression 4/29/09 Takeaways for nonlinear regression discussion: 1) Visualize data with best fit lines and lowess curves to detect nonlinearities especially important for residuals 2) Center variables when doing poly... Date Added: 2009-06-07 08:07:49 |
| Exam2-Sp06.doc Path: N.E. Illinois >> UX >> 5230 Fall, 2009 Description: Name: Eastern Illinois University Physical Education Department Physiology of Exercise Exam 2 Spring 2006 Answer any 5 of the 6 following questions based on class discussion and assigned readings. Be specific and detailed in your answers. This is an... Date Added: 2009-06-07 08:08:39 |
| EE335 HW#1-Chp2_1-11odd.pdf Path: Montana >> EE >> 335 Fall, 2008 Description: EE335 2.1 HW#1 Chp2: 1-11 odd u = c = 3 10 8 (m / s ) l 0.01? f = c a) l = 20cm = 0.2m l = c 3 10 8 = = 1.5 10 4 (m ) f 20 10 3 b) = 0.2 = 1.33 10 5 (ignore ) 4 1.5 10 c 3 10 8 = = 5 10 6 (m ) f 60 l = 50km l = = c) 50 10 ... Date Added: 2009-06-07 08:09:48 |
| engr125_engineers_FL08.pdf Path: Montana >> ENGR >> 125 Fall, 2009 Description: 1 ENGR 125CS Engineering Disciplines (FL08) Name: Due at the start of class on Monday, November 3, 2008 Category: ELECTRICAL ENGINEERING Start by doing some on-line or library research. (1) Write a paragraph describing what electrical engineers do... Date Added: 2009-06-07 08:10:41 |
| Scope worksheet.pdf Path: Montana >> EE >> 101 Fall, 2008 Description: Oscilloscope View #1: Always include UNITS. Vertical scale is _ per division. Waveform peak-to-peak is: _. Waveform period is: _. Waveform frequency is: _. Oscilloscope View #2: Always include UNITS. Vertical scale is _ per division. Waveform pe... Date Added: 2009-06-07 08:10:43 |
| Scope worksheet 2.pdf Path: Montana >> EE >> 101 Fall, 2008 Description: Oscilloscope View #1: Always include UNITS. Vertical scale is _ per division. Waveform peak-to-peak is: _. Waveform period is: _. Waveform frequency is: _. Oscilloscope View #2: Always include UNITS. Vertical scale is _ per division. Waveform pe... Date Added: 2009-06-07 08:10:45 |
| EE475_hw1_FL2003.pdf Path: Montana >> EE >> 475 Fall, 2008 Description: Homework Assignment #1 EE475 Fall 2003 Assigned: Thursday, September 11, 2003 Due AT THE START OF CLASS on Thursday, September 18, 2003 For each problem you need to hand in a concisely written description of your approach, your actual source code in... Date Added: 2009-06-07 08:10:50 |
| engr125_engineers_FL07.pdf Path: Montana >> ENGR >> 125 Fall, 2009 Description: 1 ENGR 125CS Engineering Disciplines (FL07) Name: Due at the start of class on Wednesday, October 31, 2007 Category: ELECTRICAL ENGINEERING Start by doing some on-line or library research. (1) Write a paragraph describing what electrical engineers... Date Added: 2009-06-07 08:10:59 |
| Velcro Original Patent.pdf Path: Union College >> MER >> 245 Fall, 2009 Description: ... Date Added: 2009-06-07 08:12:05 |
| Willis Energy review--12-2006.pdf Path: U. Houston >> FINA >> 4355 Fall, 2008 Description: Energy Market Review: Changing Priorities a=OMMS From the worst windstorm year on record to one of the most benign. From record insurance losses to bumper profits. From risk transfer to risk retention and brand protection. As the priorities of both ... Date Added: 2009-06-07 08:12:35 |
| dspJuly23.pdf Path: Minnesota >> EE >> 4541 Fall, 2008 Description: July 23 2008.GWB - 1/18 - Wed Jul 23 2008 12:19:42 July 23 2008.GWB - 2/18 - Wed Jul 23 2008 12:23:43 July 23 2008.GWB - 3/18 - Wed Jul 23 2008 12:28:30 July 23 2008.GWB - 4/18 - Wed Jul 23 2008 12:31:40 July 23 2008.GWB - 5/18 - Wed Jul 23 2008 ... Date Added: 2009-06-07 08:13:36 |
| HW_5.pdf Path: TAMU Kingsville >> EEEN >> 3449 Fall, 2008 Description: EEEN 3449 HW # 5 There will be a quiz on this homework on 4/15/09. Due: April 15, 2009 1. Assuming that S8C~S1C (ATD0CTL3) are set to 0111 and CC~CA (ATD0CTL5) are set to 101, what is the conversion sequence for this setting? 2. Write an instructio... Date Added: 2009-06-07 08:13:45 |
| 17.doc Path: CSU Northridge >> CCS >> 53520 Fall, 2009 Description: A.P. Chemistry Chapter 17 Outline: Buffers and Ksp I. Buffer Solutions: solutions that resist changes in pH when limited amounts of acid or base are added to it A. Buffering Action 1. A buffer must contain a weak acid that can react with the added ba... Date Added: 2009-06-07 08:14:49 |
| Handout - Steel Beam Selection.pdf Path: Penn State >> MET >> 210 Fall, 2009 Description: MET 210W Handout Steel Beam Selection 1. Get loads and estimate a weight for the beam. The weight of the beam is treated as a uniform load across the length of the beam. 2. Draw shear and moment diagrams OR use standard formulas to determine the max... Date Added: 2009-06-07 08:18:21 |
| 110-hands-on-12-assembly.pdf Path: Penn State >> RXM >> 110 Fall, 2009 Description: METBD 110 Hands-On 12 Bottom Up Assembly Modeling Part files: To save time, the parts for the Lapped Clips have been modeled and saved to the V:pro_e drive (METBD 110\\Pro-E\\Assembly Files folder). Copy the entire Assembly Files folder from the V:pr... Date Added: 2009-06-07 08:18:30 |
| cs360test1sheetsp2004.doc Path: Alaska Anch >> CS >> 360 Fall, 2009 Description: CAR vinno make model DS Strada Caravan Ranger Celica year stickerprice dealercost 1990 1992 1992 1995 1994 1993 $4,000.00 $5,000.00 $8,500.00 $3,000.00 $4,000.00 $8,000.00 000000000 Renault 123456789 Fiat 222222222 Dodge 333333333 Ford 444444444 Toyo... Date Added: 2009-06-07 08:19:08 |
| tut5-soln.ps Path: Toledo >> CSC >> 363 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: tut5-soln.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o tut5-soln.ps tut5-sol... Date Added: 2009-06-07 08:20:43 |
| 09-09.pdf Path: Stevens >> CS >> 115 Fall, 2009 Description: ~ y } l { z lk w u kq pr q p l m lk i h h yRp 6e 5|y Dxvk!tdsd6onDFj Hg e f x b$ # 4 ( 0$ 0 U ( h A$ 4 2 A dSR8@%PFPF( V v ibPSg Vdb T@ESsr %1A X v h A \" e 7$ 0 A g e # $ # U 4 b di4)W7 q v x b$ # 4 4 # b 0 ( $ 7 2 # b 0 ( $ # ` %Rs#h c... Date Added: 2009-06-07 08:21:07 |
| 10-05.pdf Path: Stevens >> CS >> 115 Fall, 2009 Description: x xw w} | } | x z xw u t t e0B| 8q q yw~81{yVv Hees q r i 7C E o 9 7 E 9 pBE mvm E C i (l HIHFBDB@805 BC P 9 G E 7C A9 7 6 G 7 i ek HIH&HA u 7 BC P 9 G E P 6 G 7 i Cf ... Date Added: 2009-06-07 08:21:09 |
| Homework12.pdf Path: Wisconsin Milwaukee >> EE >> 574 Fall, 2009 Description: EE/ME 574: Intermediate Control Systems Homework 12 EE/ME 574 Intermediate Control Systems Due Thursday, April 30, 2009 Homework 12 Reading: Franklin et al. Franklin chapter 8, sections 8.2-8.5. Homework: 1 Controls Tutorial in Matlab Read an... Date Added: 2009-06-07 08:21:53 |
| hw3.ps Path: Rutgers >> CS >> 314 Fall, 2002 Description: %!PS-Adobe-2.0 %Creator: dvips 5.528 Copyright 1986, 1994 Radical Eye Software %Title: hw3.dvi %CreationDate: Fri Feb 19 12:57:20 1999 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMSY10 CMTT12 %EndComments %DVI... Date Added: 2009-06-07 08:24:03 |
| PAE3251.dssp-ehl2-logo.pdf Path: UCSC >> PAE >> 3251 Fall, 2009 Description: PAE3251 dssp-ehl2 2 1 1 10 20 30 40 E 2 1 H H H H 51 60 70 80 90 E 2 1 E E E 101 110 120 130 140 E 2 1 H H H H 151 160 170 180 190 H 2 1 E E H 201 210 220 230 E E 240 LR K KRLLL QKRQWVLGRLGLRPALAVV V PR E... Date Added: 2009-06-07 08:25:59 |
| PAE1448.t04.n_notor2-logo.pdf Path: UCSC >> PAE >> 1448 Fall, 2009 Description: PAE1448.t04 n_notor2 3 2 1 1 10 20 30 40 H 3 2 1 N B N A N B A N S N B 51 60 70 80 90 N 3 2 1 G N G N B N A B A B N G N G N G N 101 110 120 130 140 B 3 2 1 N B N B N A B N A B A B N H N H B 151 160 170 180 19... Date Added: 2009-06-07 08:26:23 |
| PAE2257.t06.near-backbone-11-logo.pdf Path: UCSC >> PAE >> 2257 Fall, 2009 Description: PAE2257.t06 near-backbone-11 3 2 1 1 10 20 30 40 A G A D H A 3 2 1 G I G G I D I D I G D G I G J D A D K E D G I J G J G D A D 51 60 I D I D K D A I G J G I E A G D K I J I G 70 LR M RIDGY TVVWDPETDTVVWAGGRGN V D A 50 MA E DFSQL ... Date Added: 2009-06-07 08:27:12 |
| PAE3399.t06.bys-logo.pdf Path: UCSC >> PAE >> 3399 Fall, 2009 Description: PAE3399.t06 bys 4 3 2 1 10 20 30 40 E 4 3 2 1 P S P E P H G T P E P G T P T P H 51 60 70 80 90 G T P E 4 3 2 1 P H E P H P H E H P H P H 101 110 120 130 140 G H 4 3 2 1 G T P E P H P E 151 160 170 180 190 P H ... Date Added: 2009-06-07 08:28:00 |
| PAE2278.t06.o_sep-logo.pdf Path: UCSC >> PAE >> 2278 Fall, 2009 Description: PAE2278.t06 o_sep 3 2 1 1 10 20 30 40 D 3 2 1 A H A H D G D A D A D H 51 60 70 80 90 B D 3 2 1 G D A B D H B G D A B D 101 110 120 130 140 A 3 2 1 D H B H 151 160 170 180 D B H B 190 LK R YIDQR LEEYKGAMSGK... Date Added: 2009-06-07 08:28:56 |
| PAE3556.t06.w0.5-logo.pdf Path: UCSC >> PAE >> 3556 Fall, 2009 Description: PAE3556.t06 w0.5 2 1 1 10 20 30 40 E 2 1 V S G B A B A D E G E B A E E S E D E A E Q E Q E G V E G E V E E H 51 60 70 80 90 E D S V 2 1 E A P S G U V S H E E Q H S G T 101 110 120 130 140 U 2 1 S E S E G V E E Q D ... Date Added: 2009-06-07 08:30:07 |
| consistx2.ps Path: Duke >> X >> 212 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - consist.ppt %Creator: Windows NT 4.0 %CreationDate: 15:38 11/11/1998 %Pages: (atend) %BoundingBox: 13 13 599 780 %LanguageLevel... Date Added: 2009-06-07 08:30:57 |
| LCP_RLCA_S06b_T02_V01.90.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Life Cycle Plan (LCP) Online Reading Assessment (ORA) Team 2 Name Matthew Rettagliata Randal Romell Carol Tauro Akash Agarwal Tristan Urquico Lorenz Verzosa Jonathan Wright Yi Wang Role System Software ... Date Added: 2009-06-07 08:31:13 |
| hushmail betrays trust of users.doc Path: IPFW >> CS >> 306 Fall, 2008 Description: November 8th, 2007 Hushmail betrays trust of users Posted by Richard Stiennon @ 9:33 am One likes to think that a secure web based email provider would be able to secure your email. It is becoming more and more evident that there truly is a threa... Date Added: 2009-06-07 08:32:09 |
| logical_lesson.ps Path: Southern Oregon >> CS >> 1313 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: logical_lesson.dvi %Pages: 16 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Courier-Bold Times-Bold Times-Roman Courier %+ Times-Italic Courier-Oblique ... Date Added: 2009-06-07 08:32:55 |
| 09.sp.16_handouts.pdf Path: Washington >> FIT >> 100 Fall, 2009 Description: Announcements Changes in Lab due dates Lab 5: May 13 Labs 6/7: May 20 Conditionals, branches, or tests Adding logic to an algorithm D.A. Clements Extra C dit E t Credit Labs 8/9-50 points (combined): June 9 5/4/2009 D.A. Clements, MLIS, UW Inform... Date Added: 2009-06-07 08:34:50 |
| dis.ps Path: East Los Angeles College >> CJN >> 503 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: dis_qns.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Palatino-Roman Palatino-Bold Palatino-Italic %DocumentPaperSizes: A4 %EndCommen... Date Added: 2009-06-07 08:35:27 |
| cis.ps Path: East Los Angeles College >> CJN >> 503 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: Microsoft Word - cis.doc %Creator: Windows NT 4.0 %CreationDate: 15:29 12/1/1997 %Pages: (atend) %BoundingBox: 8 14 585 829 %LanguageLevel: 2 %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend) %EndComments % %BeginPr... Date Added: 2009-06-07 08:35:34 |
| UML_FCPackage_ExitCriteria_IIVVb_F08a_T06_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Exit Criteria for UML FC Package a) A Structure Diagram that shows the context in which the system is expected to operate (e.g. operational stakeholders, devices that they system interacts with, the hardware the software is expected to execute on) [... Date Added: 2009-06-07 08:36:19 |
| tryForProgTeam0904.pdf Path: UCF >> COP >> 3502 Fall, 2009 Description: International Collegiate Programming Contest Organized by the Association for Computing Machinery (ACM) 2-tiered process (Regionals followed by World Finals) 2008-2009 numbers 88 countries 1,800+ universities 7,000+ teams 100 teams advancing to World... Date Added: 2009-06-07 08:37:09 |
| lec16-io.pdf Path: Berkeley >> CS >> 162 Fall, 2008 Description: CS162 Operating Systems and Systems Programming Lecture 16 Page Allocation and Replacement (con\'t) I/O Systems October 27, 2008 Prof. John Kubiatowicz http:/inst.eecs.berkeley.edu/~cs162 Review: Page Replacement Policies FIFO (First In, First Out) ... Date Added: 2009-06-07 08:39:30 |
| python.pdf Path: CSU Chico >> PHYS >> 250 Fall, 2009 Description: Chapter 1 Python Basics 1.1 The Python Interpreter Python is a computer program which converts human-friendly commands into computer instructions. It is an interpreter. Its written in another language; most often C+, which is more powerful and much... Date Added: 2009-06-07 08:39:48 |
| laytnerthibedeauandpaynter2005.pdf Path: Washington >> COURSES >> 560 Fall, 2009 Description: Retaining the Rich Cultural Heritage of White Center: A Homeownership Strategy By: Miryam Laytner, Jason Thibedeau and Kristen Paynter In 2001, HomeSight, a nonprofit community development corporation, drafted a homeownership strategy for White Cent... Date Added: 2009-06-07 08:40:22 |
| sec8-6key.pdf Path: UNC >> MATH >> 232 Fall, 2008 Description: Name: _ Class: Date: _ PAGE 1 Name: _ Class: Date: _ PAGE 2 Name: _ Class: Date: _ PAGE 3 Name: _ Class: Date: _ PAGE 4 Name: _ Class: Date: _ PAGE 5 ... Date Added: 2009-06-07 08:41:13 |
| Thomas_Taylor_1990.pdf Path: Humboldt State University >> MDJ >> 510 Fall, 2009 Description: ... Date Added: 2009-06-07 08:41:47 |
| Quiz8Solutions.pdf Path: Maryville MO >> MATH >> 141 Fall, 2009 Description: ... Date Added: 2009-06-07 08:44:02 |
| Quiz6Solutions.pdf Path: Maryville MO >> MATH >> 141 Fall, 2009 Description: ... Date Added: 2009-06-07 08:44:02 |
| 04-dallas - Lipase complete2-1.ppt Path: Clayton >> BIOL >> 4900 Fall, 2009 Description: Lipase Biocomputing Project Presented By: Angel, Jason, Jeff and Kelly Outline BackgroundInformation Structure Phylogeny/Homology Overview Lipaseresponsibleforfatabsorptioninthe smallintestine Itsactivitydependsonpresenceof pancreaticcolipase... Date Added: 2009-06-07 08:45:54 |
| M202-L46.ppt Path: Salisbury >> FACULTY >> 202 Fall, 2009 Description: 9.3 Separable Equations [1] y\' = x2/y2 [2] [3] y\' = x2y SEPARABLE EQUATIONS REDUCING TO ANTIDERIVATIVES CONSTANTS OF INTEGRATION LOGS OF CONSTANTS OF INTEGRATION AUTONOMOUS EQUATIONS REDUCING TO ANTIDERIVATIVES dy = p( x) q( y ) dx dy = p ( ... Date Added: 2009-06-07 08:47:30 |
| 35208T1b.pdf Path: Eastern Washington University >> ORG >> 352 Fall, 2009 Description: 7. lblA plat. at X on thc diasran] chromltosraphy belo\ endfie ?Ol>y\' benzaldehyde (PhCHO)was spotted a thin Iayer on IBZ] h a dr e a c h o dh e l inn e s u o w !n( r r r . ) .Oo t hrd r a g r.a rm \' h o wwu c rr. et h i nu rirv ud u acu rmp u u u... Date Added: 2009-06-07 08:47:58 |
| mercer03.pdf Path: Toledo >> CSET >> 3150 Spring, 2008 Description: C+ and Object-Oriented Programming Functions 3-1 Function Calls and Headings Goals Evaluate a few math functions Use arguments in functions calls Appreciate why programmers divide software into functions Use integer objects Use quotient remai... Date Added: 2009-06-07 08:48:11 |
| Module6_MoreILP.pdf Path: Maple Springs >> CSE >> 4201 Fall, 2009 Description: COSC4201 Hardware Speculation and More ILP Prof. Mokhtar Aboelaze Parts of these slides are taken from Notes by Prof. David Patterson (UCB) Fall 08 CSE4201 Outline Data dependence and hazards Exposing parallelism (loop unrolling and scheduling... Date Added: 2009-06-07 08:49:13 |
| LING.pdf Path: San Diego State >> GB >> 0203 Fall, 2009 Description: Linguistics and Oriental Languages OFFICE: Business Administration 327 TELEPHONE: (619) 594-5268 FAX: (619) 594-4877 WEB SITE: www.rohan.sdsu.edu/dept/linguist/lol.html In the College of Arts and Letters Faculty Soonja Choi, Ph.D., Professor of Lin... Date Added: 2009-06-07 08:49:49 |
| 4-5 Oh Deer.doc Path: CSU Northridge >> AES >> 15831 Fall, 2009 Description: Oh Deer! This activity requires students to do a bit of running around. Warn them of this so the day before, so they can wear appropriate clothing and shoes. The activity simulates the boom and bust cycles of populations, which result from variations... Date Added: 2009-06-07 08:51:05 |
| mt2_fall2004.pdf Path: UPenn >> P >> 364 Fall, 2008 Description: Physics 364: Midterm Two 22 November 2004 Prof. Kroll Name: PennID# This is a closed book exam. A formula sheet is attached. There are three problems worth 20, 15, and 25 points each for a maximum score of 60 points. Do all the problems. You mus... Date Added: 2009-06-07 08:51:06 |
| t3S03th.pdf Path: UNC Charlotte >> ITCS >> 3182 Fall, 2008 Description: CS 250-01 Introduction to Computer Systems Take HomeTest Due: Wednesday April 30th, 2003 4 pages. Do not use additional paper. Attempt all questions in the spaces provided on your own.) 1024 = 210 1 (a) Name: .. Mark/30 Answer the following briefly... Date Added: 2009-06-07 08:52:22 |
| final.ps Path: Michigan State University >> PHY >> 232 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.55a Copyright 1986, 1994 Radical Eye Software %Title: 173336438.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -q 173336438.dvi -o %DVIPSParameters: dpi=600, compress... Date Added: 2009-06-07 08:53:06 |
| Agenda0924.pdf Path: Air Force Academy >> DOCS >> 20080924 Fall, 2009 Description: Midwifery Implementation in Saskatchewan Agenda September 24, 2008 08:30 09:00 Registration and Site Check-In 09:00 09:10 Welcoming Remarks and Introductions 09:10 09:25 An Overview of Midwifery Across Canada and the Model of Midwifery in Saskatch... Date Added: 2009-06-07 08:54:10 |
| Ham_183_00.pdf Path: Caltech >> REVIEW >> 20051129 Fall, 2009 Description: ... Date Added: 2009-06-07 08:54:54 |
| Review for Midterm II.pdf Path: Colorado State >> PH >> 245 Fall, 2008 Description: Prof. John Harton Office: D203 Physics (970)491-6372 John.Harton@ColoState.edu Review for Midterm II Midterm II will be on Wednesday November 16, 2005 in our classroom. The exam will have four write-it-out problems, and it has the same weight in yo... Date Added: 2009-06-07 08:55:30 |
| Free_Fallphys161fall2008.pdf Path: George Mason >> PHYS >> 161 Fall, 2008 Description: Physics 161 FREE FALL Introduction This experiment is designed to study the motion of an object that is accelerated by the force of gravity. It also serves as an introduction to the data analysis capabilities of Data Studio. To observe the relations... Date Added: 2009-06-07 08:55:52 |
| Lect05-UMLSummary.pdf Path: Texas San Antonio >> CS >> 5103 Fall, 2008 Description: Review: UML Diagrams CS5103 Software Engineering Use case diagrams The usage of the system Lecture 05 Unified Modeling Language (III) Class and object diagrams The structure of the system Sequence diagrams The reaction of the system to external ev... Date Added: 2009-06-07 08:56:03 |
| lab5.doc Path: JMU >> M >> 248 Fall, 2009 Description: Math 248 Spring 2001 March 1, 2001 As stated in lab 4, programs for most real world applications are typically neither short, nor straightforward, and when programming for these more complex problems it is usually advisable to divide the program into... Date Added: 2009-06-07 08:56:16 |
| EM_09-15-2005.ps Path: University of South Dakota >> PHYS >> 421 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.94a Copyright 2003 Radical Eye Software %Title: EM_09-15-2005.dvi %CreationDate: Sun Sep 18 11:52:49 2005 %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 595 842 %DocumentFonts: CMBX12 CMR12 CMMI12 CMR8 CMMI8 CMSY10... Date Added: 2009-06-07 08:58:02 |
| EM_09-29-2005.pdf Path: University of South Dakota >> PHYS >> 421 Fall, 2008 Description: ... Date Added: 2009-06-07 08:58:03 |
| Chapter_10_Problems.pdf Path: University of South Dakota >> PHYS >> 451 Spring, 2008 Description: ... Date Added: 2009-06-07 08:58:13 |
| stateresp04.pdf Path: East Los Angeles College >> ALLS >> 0104 Fall, 2009 Description: FHS-Lecture Handout: State Responsibility (Dr S. Talmon) Pag e 1 of 5 UNIVERSITY OF OXFORD PUBLIC INTERNATIONAL LAW RESPONSIBILITY OF STATES FOR INTERNATIONALLY WRONGFUL ACTS A. Outline: I. II. III. IV. Introduction State responsibility in context... Date Added: 2009-06-07 08:58:16 |
| mechanism.ppt Path: Allegheny >> CHEM >> 453 Fall, 2009 Description: Chemical mechanism of hairpin ribozyme self-cleavage Hairpin and hammerhead ribozymes catalyze the endonucleolytic cleavage of RNA via nucleophilic attack by a 2\'-OH group on the phosphorous of the neighboring phosphodiester bond, generating 5\'-OH a... Date Added: 2009-06-07 08:59:26 |
| Week6_lesson_1.doc Path: St. John Fisher >> CSCI >> 150 Fall, 2009 Description: #># # #v#w#x#y#z#{#| #}#~# # #3#bjbj # #4V#h#h#+#2# ##C#C#C#C#C# #W#W#W#8#4#\\#W#i#t# #5#5#5#l#8#ki#mi#mi#mi# mi#mi#mi#$#`k#n#i##C# #i#C#C# 5#5#i#C#5# #C#5#ki# ##ki#e# #h#5#< #(#W#c#ch#J#Wi#i#0#i#h#J#n #d#n#h## #n#C#h#`#0#\"# #*#i# i#[#d# #i# #... Date Added: 2009-06-07 09:00:14 |
| hw01.pdf Path: Columbia >> E >> 4215 Fall, 2009 Description: E4215: Analog Filter Synthesis and Design: HW1 Nagendra Krishnapura (nkrishnapura@mltc.com) due on 28 Jan. 2003 R + Vi(s) (a) vi(t)=1Vcos(t/RC) R + (c) i(t) + v(t) (e) C + vo(t) vi(t)=1Vcos(t/RC) ii(t) ii(t) R/2 + (d) 2C + vo(t) C + Vo(s) + Vi(s) (b)... Date Added: 2009-06-07 09:00:39 |
| Chap008.ppt Path: St. Francis IL >> BSAD >> 431 Fall, 2009 Description: McGrawHill/Irwin 2006 The McGrawHill Companies, Inc. All rights reserved. Chapter Service Recovery The Impact of Service Failure and Recovery How Customers Respond to Service Failures Customers\' Recovery Expectations Service Recovery Strategi... Date Added: 2009-06-07 09:02:40 |
| Exam1S06.results.pdf Path: Iowa State >> STAT >> 402 Fall, 2008 Description: Exam 1, Spring 2006 (Combined Take Home and In Class Maximum 100) 10 8 6 4 2 50 60 70 80 90 100 Count Stem 9 9 8 8 7 7 6 6 5 5 Leaf 5677 22224 577899 1233 Count 4 5 6 4 67 2 4 2 1 1 Exam 1 Score Quantiles 100.0% 75.0% 50.0% 25.0% 0.0% maximum... Date Added: 2009-06-07 09:02:59 |
| Mitochondrion Structure.doc Path: Erskine >> BG >> 110 Fall, 2009 Description: Mitochondrion Structure ... Date Added: 2009-06-07 09:04:22 |
| seattle_design_commission.pdf Path: Washington >> OPEN >> 2100 Fall, 2009 Description: Seattle Design Commission Paul Chasan Legislative The Seattle Design Commission was established in 1968, with the passage of Forward Thrust, a bond measure approved by voters that allocated millions of dollars to various capital improvement projects... Date Added: 2009-06-07 09:04:29 |
| chapter5.ppt Path: UCCS >> CS >> 522 Fall, 2009 Description: Chapter 5 The Network Layer 05/29/09 Tanenbaum Chapter 5 Network 1 Network Layer Design Isues Store-and-Forward Packet Switching Services Provided to the Transport Layer Implementation of Connectionless Service Implementation of Connection-O... Date Added: 2009-06-07 09:05:16 |
| US Internet Highs and Lows.pdf Path: JMU >> MKTG >> 470 Fall, 2008 Description: US Internet Highs and Lows MARCH 4, 2008 High education rates=high online penetration. Remember when online marketers had to track Internet penetration, to make sure their campaigns would reach enough people? Some still do. About two-thirds of the U... Date Added: 2009-06-07 09:07:28 |
| resumesdel.pdf Path: Penn State >> DEL >> 5006 Fall, 2009 Description: Danielle Elizabeth Larzelere 7 Hibiscus Place Newtown, PA 18940 215.666.1755 del5006@psu.edu OBJECTIVE: EDUCATION: To apply my marketing and communication skills, knowledge, and experience towards an entry-level sales position The Pennsylvania Stat... Date Added: 2009-06-07 09:08:00 |
| Site 3 ACAD.pdf Path: Penn State >> DES >> 295 Fall, 2009 Description: ... Date Added: 2009-06-07 09:08:01 |
| bicycle.xls Path: Penn State >> DEI >> 5002 Fall, 2009 Description: Spoke-Up Bicycle Shop Third Quarter Sales Burr Hills Frankfort Bicycles Accessories Repairs Refreshments Total $11,869.20 8106.93 4158.58 3437.64 $27,572.35 $7,430.90 5731.09 8665.31 1013.08 $22,840.38 Hillside $7,158.62 3742.3 5217.92 2039.34 $18,1... Date Added: 2009-06-07 09:08:05 |
| 08RD102revisedfeb28.doc Path: Cornell >> WEB >> 102 Fall, 2009 Description: 1 Economics 102 Course Outline and Reading List Spring 2008 (revised) Lecture 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. Date Jan. 22 Jan. 24 Jan. 29 Jan. 31 Feb. 5 Feb. 7 Feb. 12 Feb. 14 Feb. 19 Feb. 21 Feb. 26 Feb. 28 Topic Introduction: What is Econom... Date Added: 2009-06-07 09:08:13 |
| clockbox_connections.ps Path: CSU Channel Islands >> TWR >> 0203 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: Microsoft Word - clockbox_connections.doc %Creator: Pscript.dll Version 5.0 %CreationDate: 2/2/2003 18:46:49 %BoundingBox: (atend) %Pages: (atend) %Orientation: Portrait %PageOrder: Special %DocumentNeededResources: (atend) %Do... Date Added: 2009-06-07 09:09:54 |
| me167 - solution - hw 6 f08.pdf Path: UCSB >> ME >> 167 Fall, 2008 Description: F SoJicr\' =,09,1? w1 -r\'/\' 3oA/ I ,t-* E-= Jo xn? N/n, A ,=Ar.= * fA {m As kDx looJz c!^ A IKA t -J2 vn 4 YDY /.{\\ _-_2 A+ - A\\,. {1, cln\' ?Tnd rerction {o.u\', ZFx: 5E z_t y -5o 1/rrl\' +KA + lRnx + + Fpy C )z\' .) f-. 7\' r lQo*= /o_t!... Date Added: 2009-06-07 09:10:08 |
| COS280-lect-2006-03-13.pdf Path: Taylor IN >> CSE >> 280 Fall, 2009 Description: AI quotes while waiting Artificial intelligence is the study of how to make real computers act like the ones in the movies. - Anonymous The question of whether a computer can think is no more interesting than the question of whether a submarine can... Date Added: 2009-06-07 09:10:14 |
| COS280-lect-2007-02-21.pdf Path: Taylor IN >> CSE >> 280 Fall, 2009 Description: Lisp-ish quotes while waiting \"Lisp was far more powerful and flexible than any other language of its day; in fact, it is still a better design than most languages of today, twenty-five years later. Lisp freed ITS\'s hackers to think in unusual and c... Date Added: 2009-06-07 09:10:17 |
| q3-c.pdf Path: Portland >> CS >> 305 Fall, 2008 Description: British Computer Society Code of Practice Code of Practice British Computer Society General Code of Practice Code of Conduct 1. PURPOSE A Code of Practice is a set of principles established to ensure that Information Systems (IS) Practitioners ma... Date Added: 2009-06-07 09:11:31 |
| 6 - BradyVSPERHandout.pdf Path: UT Chattanooga >> CHM >> 121 Fall, 2009 Description: REPRESENTATIVE VSEPR STRUCTURES AX6 AX5E AX4E2 Bonding Domains Nonbonding Domains Hybridization Octahedral 6 0 sp3d2 AX5 Square pyramidal 5 1 sp d 3 2 Square planar 4 2 sp d 3 2 AX4E AX3E2 AX2E3 Bonding Domains Nonbonding Domains Hybridiza... Date Added: 2009-06-07 09:11:42 |
| L8.ppt Path: UMass (Amherst) >> FIN >> 301 Fall, 2009 Description: Chapter 6 Valuing Stocks Mila Getmansky Sherman Topics Covered Stocks and the Stock Market Book Values, Liquidation Values and Market Values Valuing Common Stocks Simplifying the Dividend Discount Model Growth Stocks and Income St... Date Added: 2009-06-07 09:13:06 |
| Quiz2Solutions_Spring09.pdf Path: UMass (Amherst) >> FIN >> 304 Fall, 2009 Description: Name: _ Finance 304 Quiz 2 Solutions March 12, 2009 Mila Getmansky Sherman The quiz should be solved within 1 hour 15 minutes. The quiz consists of four questions. Please answer all of them. Provide explicit assumptions and write down your ... Date Added: 2009-06-07 09:13:26 |
| log.txt Path: Washington >> JOBS >> 71537 Fall, 2009 Description: 000 (61420.000.000) 02/17 08:42:48 Job submitted from host: <128.95.94.28:1092> . 001 (61420.000.000) 02/17 12:10:57 Job executing on host: <172.25.101.186:1055> . 006 (61420.000.000) 02/17 12:31:06 Image size of job updated: 476432 . 006 (61420.000.... Date Added: 2009-06-07 09:15:11 |
| log.txt Path: Washington >> JOBS >> 71725 Fall, 2009 Description: 000 (61608.000.000) 02/17 08:43:41 Job submitted from host: <128.95.94.28:1092> . 001 (61608.000.000) 02/17 13:49:33 Job executing on host: <172.25.101.82:1057> . 006 (61608.000.000) 02/17 14:09:41 Image size of job updated: 471344 . 006 (61608.000.0... Date Added: 2009-06-07 09:15:16 |
| submit.txt Path: Washington >> JOBS >> 71811 Fall, 2009 Description: executable = pass6_71811.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71500-71999/71811... Date Added: 2009-06-07 09:19:07 |
| output.txt Path: Washington >> JOBS >> 71976 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3004 02/17/2008 04:12 PM <DIR> . 02/17/2008 04:12 ... Date Added: 2009-06-07 09:19:36 |
| week 06.ppt Path: Iowa State >> CE >> 552 Fall, 2009 Description: Week6,CE552 TheTrafficSafetyProfessionand theHighwaySafetyImprovement Program(HSIP) TheFourEs Engineering Education Enforcement EmergencyResponse Professionsandtheirimpact Administrators (programs) Planners(land use/networks) Designers(trade... Date Added: 2009-06-07 09:19:48 |
| log.txt Path: Washington >> JOBS >> 71746 Fall, 2009 Description: 000 (61629.000.000) 02/17 08:43:47 Job submitted from host: <128.95.94.28:1092> . 001 (61629.000.000) 02/17 13:53:19 Job executing on host: <172.25.101.67:1055> . 006 (61629.000.000) 02/17 14:13:28 Image size of job updated: 485992 . 005 (61629.000.0... Date Added: 2009-06-07 09:20:10 |
| error.txt Path: Washington >> JOBS >> 71534 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 12:05:32 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 13:21:01 2008 ( 4529 s elapsed) ... Date Added: 2009-06-07 09:20:25 |
| SILICON (IV) CHLORIDE,.pdf Path: CofC >> RM >> 205 Fall, 2009 Description: Valid 11/2002 - 01/2003 Sigma Chemical Co. P.O. Box 14508 St. Louis, MO 63178 USA Phone: 314-771-5765 M A T E R I A L S A F E T Y D A T A S H E E T SECTION 1. - - - - - - - - - CHEMICAL IDENTIFICATION- - - - - - - - - CATALOG #: S8136 NAME: SILI... Date Added: 2009-06-07 09:21:30 |
| VITAMIN B12.pdf Path: CofC >> RM >> 205 Fall, 2009 Description: SIGMA-ALDRICH Material Safety Data Sheet Date Printed: 15/JUN/2005 Date Updated: 05/MAY/2005 Version 1.1 According to 91/155/EEC 1 - Product and Company Information Product Name Product Number Company VITAMIN B12 CELL CULTURE TESTED V6629 Sigma-Aldri... Date Added: 2009-06-07 09:21:38 |
| adaptweb1.ppt Path: UCLA >> CS >> 21904 Winter, 2009 Description: Adaptive Web Caching Scott Michel, Khoi Nguyen, Adam Rosentein, Kostas Nikoloudakis, Lixia Zhang UCLA Computer Science Department Sally Floyd & Van Jacobson DARPA NGI PI Meeting October, 1998 http:/irl.cs.ucla.edu/AWC/ Research Objectives Explore b... Date Added: 2009-06-07 09:22:07 |
| assignment1.pdf Path: Cornell >> CS >> 100 Fall, 2008 Description: f%1h) 1ddtt) ro xsP(!d $ dP4hoddoPddt)e)d )Yo dttt1Xy 4Y%ttxrPPditoY dPP|t G xt oP4ho1Ixtob)|U)d oP ... Date Added: 2009-06-07 09:22:56 |
| FINALNewPefixPASH32009.pdf Path: UGA >> UCC >> 32009 Fall, 2009 Description: I 7 8 5 Unil\'ersit\\\' Council A.rhens, Georgia 30602 March 13,2009 CNIVERSITY CURRICULUM COMMITTEE - 2008-2009 Mr. David E. Shipley, Chair Agricultural and Environmental Sciences - Dr. Timothy L. Foutz Arts and Sciences - Dr. Richard E. Siegesmu... Date Added: 2009-06-07 09:24:12 |
| Reference_Guide.pdf Path: Augustana >> HELIOS >> 220 Fall, 2009 Description: Style Guidelines for References in OSA Journals (same format as Phys. Rev. Lett.) OSA now uses bracketed, numerical reference callouts [1]. References should be numbered consecutively in the order in which they are first referenced in the body of th... Date Added: 2009-06-07 09:26:42 |
| ch5.pdf Path: Toledo >> MAT >> 445 Fall, 2009 Description: CHAPTER 5 Topological Groups, Representations, and Haar Measure 5.1. Topological spaces If X is a set, a family U of subsets of X defines a topology on X if (i) U, X U. (ii) The union of any family of sets in U belongs to U. (iii) THe intersection... Date Added: 2009-06-07 09:26:44 |
| Homework_6.pdf Path: Texas A&M >> ELEN >> 457 Fall, 2009 Description: ECEN 457 Due: April 13, 2009 Homework #6 Solve the following problems from the text book: 1) Problem 4.11 (Design a third-order high-pass filter, assume H0 = 0 dB) 2) Problem 4.20 3) Problem 4.22 (Design a forth-order 1 dB Chebyshev high-pass filt... Date Added: 2009-06-07 09:27:28 |
| Structuralism.ppt Path: N. Colorado >> ENG >> 250 Fall, 2009 Description: Structuralism Attemptstoexplainhumanphenomenon byidentifyingandanalyzingconstitutive units IndebtedtoSaussurestheoriesof linguistics Languesystemoflanguage/rules Paroleindividualutterance Semiologyscienceofsigns Languagecommunity Meaningviadi... Date Added: 2009-06-07 09:27:53 |
| Structuralism.ppt Path: N. Colorado >> HUM >> 130 Fall, 2009 Description: Structuralism Attemptstoexplainhumanphenomenon byidentifyingandanalyzingconstitutive units IndebtedtoSaussurestheoriesof linguistics Languesystemoflanguage/rules Paroleindividualutterance Semiologyscienceofsigns Languagecommunity Meaningviadi... Date Added: 2009-06-07 09:28:20 |
| dental letter.doc Path: Washington >> FIT >> 100 Fall, 2009 Description: To Whom It May Concern: This is Edward Kusumo, a brother of Teasya Kusumo. I will be the one who will pay Teasya Kusumos dental bill and cover all her expenses. Teasya Kusumo will not be able to pay for her expenses because she doesnt work and a full... Date Added: 2009-06-07 09:31:58 |
| lec30-wrapup.pdf Path: Berkeley >> CS >> 150 Fall, 1996 Description: EECS150 - Digital Design Lecture 30 - Course Wrapup May 7, 2009 John Wawrzynek Spring 2009 EECS150 - Lec30-wrapup Page 1 Why Study and Learn Digital Design? We expect that many of our graduates will eventually be employed as designers. Digital... Date Added: 2009-06-07 09:32:50 |
| Web based lesson plan.doc Path: N. Georgia >> SDBRAN >> 1087 Fall, 2009 Description: Web-Based Lesson Plan Lesson Plan Title: Developed by: Subject Area: Grade Level: Purpose of the Activity: Estimating Products and Quotients of Decimals and Fractions Stefon Brandon Math 5th Grade The purpose of this activity is to refresh briefly th... Date Added: 2009-06-07 09:33:26 |
| DASO_000100.txt Path: Harvard >> CFA >> 000000 Fall, 2009 Description: DASO Circular No. 100 Issued: 2007 Apr. 14, 03:25 UT The DISTANT ARTIFICIAL SATELLITES OBSERVATION (DASO) Circulars are a private publication by staff of the Minor Planet Center and are intended t... Date Added: 2009-06-07 09:34:42 |
| dice.xls Path: Rose-Hulman >> MA >> 311 Fall, 2009 Description: Die Face Trial 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 totals probability 1 3 2 2 4 2 0 3 3 1 1 2 1 3 0 3 30 0.160 2 5 2 2 0 3 2 1 6 4 1 4 1 0 3 2 36 0.193 3 1 1 1 1 0 3 2 1 2 2 2 2 2 2 2 24 0.128 4 6 0 1 2 1 3 1 3 0 4 2 1 3 1 2 30 0.160 5 5 1 1 1 3 2 2 ... Date Added: 2009-06-07 09:37:17 |
| SIO1.txt Path: San Diego State >> SIO >> 1082602 Fall, 2009 Description: TGAAGATTGATGAGCACAGACCCAACCGACACCAAGGTTCTAAGGAAGAACGGATTGCTGCTATCCTTGAGCCTCGTTATGATAACCTACAGATGTATCACTACCGTGGTGGTAACTGTCAGGTTCTGGAAGAGGAACTTGTTTCCTACAACCCAGCGCATGACGACTGTAAAGACTGTCTTGCTGCAGCCGTTGAGGTTGCCGTTAAGCCTAGTTCAGCAGTAAAAAGAAAAAGAAGTCAAGATAATAA... Date Added: 2009-06-07 09:37:32 |
| recursion.pdf Path: SUNY IT >> CS >> 240 Fall, 2009 Description: A recursive routine or a method calls itself to accomplish its objective. The divide and rule principle is evoked. Large problem smaller problems Solve smaller problems first. Solve this A+B A #include <iostream> using namespace std; int sumsquare... Date Added: 2009-06-07 09:37:57 |
| 455 09 week 13 day 2.doc Path: UCCS >> BIO >> 455 Fall, 2009 Description: BIOL 455/555 Spring 2009, Week 13 Day 2 Finish Upper Extremity, Injuries / Lower Extremity \"In order to plan your future wisely, it is necessary to that you understand and appreciate your past.\" Jo Coudert A. UPPER EXTRZEMITY - WRAP UP 1) EMG in Th... Date Added: 2009-06-07 09:38:16 |
| simulated_experiments.doc Path: CSU Northridge >> SLB >> 68113 Fall, 2009 Description: SIMULATED EXPERIMENTS (1) Mathematics Multimedia Activities & Experiments Write a lesson plan using an online mathematics experiment. If possible, include data analysis using Excel or other spreadsheet program. SKIP (2) Simulated Internet-Based Sci... Date Added: 2009-06-07 09:38:46 |
| Class 17-children.doc Path: Nevada >> SOC >> 480 Fall, 2008 Description: PARENT-CHILD RELATIONSHIPS Parents (should) provide emotional support and exercise control over kids. Styles of Parenting Permissive Style: parents provide emotional support but exercise little control over their children Authoritarian (Disciplinaria... Date Added: 2009-06-07 09:40:29 |
| 451-07-Chpt4.ppt Path: South Carolina Upstate >> FACULTY >> 451 Fall, 2009 Description: Chapter4:Phonology notthestudyoftelephones! NOTES: Theslides/lecture/discussionforthischapterdeviatefromtheorderofthe bookYouWILLneedtoread,youdecidetoreadearly,lateorboth Aboutexercising:itkeepsyouhealthy:physically&mentally KindsofSoundCha... Date Added: 2009-06-07 09:40:53 |
| FA07-Nomenclature I.pdf Path: South Carolina Upstate >> SCHM >> 332 Fall, 2009 Description: SCHM 332 T Th Fall 2007 Nomenclature d. _ Name_ Name the following structures using IUPAC nomenclature. a. __ NO 2 O O Cl NH2 NO 2 Cl NO 2 e. _ b. _ O Cl O O O f. __ c. _ O O O O F F O O O g. _ j. _ HO O O O O O OH h. _ O ... Date Added: 2009-06-07 09:41:11 |
| scheduleparttwo.pdf Path: Richmond >> M >> 312 Fall, 2009 Description: Course Schedule and Assignments Part II (Revised 10/7/2003) MATH 312 Fall 2003 Caudill Day 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Date M 9/29 W 10/1 F 10/3 M 10/6 W 10/8 F 10/10 W 10/15 F 10/17 M 10/20 W 10/22 F 10/24 M 10/27 W 10/29 F 10... Date Added: 2009-06-07 09:42:16 |
| C5741_03.pdf Path: DeVry Mesa >> SEC >> 440 Fall, 2009 Description: CHAPTER 3 SECURITY POLICY IMPLEMENTATION After reading this chapter and completing the exercises, you will be able to: Explain best practices in security policies Formulate a security policy and identify security policy categories Explain the im... Date Added: 2009-06-07 09:42:23 |
| CIS 407 HW 04 SU 05.doc Path: DeVry Mesa >> CIS >> 407 Fall, 2009 Description: CIS 407 Student Name Instructor Part Maximum Points Web Application Development HW 4 Group Due Date 25 points 1 25 points 2 25 points 3 25 points 4 Total 100 points Your Score Textbook Reading Assignment Thoroughly read Chapt... Date Added: 2009-06-07 09:42:32 |
| lesetext6.pdf Path: Hope >> GERMAN >> 313 Fall, 2009 Description: Lesetext 6:1 Aspekte der Sozialen Marktwirtschaft Volkseinkommen der Haushalt die Werbeagentur betragern der Unternehmer der Anteil die Gerechtigkeit mittlerweile bestehen der Fall ca. frdern durchschnittlich verfgbar bar stndig der Verlust die Kaufk... Date Added: 2009-06-07 09:42:44 |
| COMP 100 LAB 10 FA 07.pdf Path: DeVry Mesa >> COMP >> 100 Fall, 2009 Description: COMP 100 Student Name h Computer Applications for Business LAB 10 Section Due Date Instructor Project Maximum Points 1 10 points 2 10 points 3 20 points 4 20 points 5 20 points 6 20 points TOTAL 100 points Your Score PROJECT ONE Objectiv... Date Added: 2009-06-07 09:43:32 |
| CCSI 330 WEEK 1 AGENDA SP 08.pdf Path: DeVry Mesa >> FACULTY >> 330 Fall, 2009 Description: CCSI 330 WEEK 1 AGENDA Laboratory Logon to course Web site: http:/faculty.chi.devry.edu/lpapadem/ccsi330.htm Review the following files that is posted on the course site: Syllabus Submitting Assignments Assignment Due Dates Week 1 Agenda Commence... Date Added: 2009-06-07 09:43:49 |
| chap_17.doc Path: George Mason >> MBA >> 603 Fall, 2008 Description: Chapter17:MarketswithAsymmetricInformation CHAPTER17 MARKETSWITHASYMMETRICINFORMATION TEACHINGNOTES Thischapterexploresdifferentsituationsinwhichonepartyknowsmorethantheother,orin otherwords,whathappenswhenthereisasymmetricinformation. Section17.1di... Date Added: 2009-06-07 09:48:04 |
| case01m.xls Path: George Mason >> MBA >> 643 Fall, 2008 Description: Sheet1 vti_encoding:SR|utf8-nl vti_timelastmodified:TR|31 May 1999 15:22:36 -0000 vti_extenderversion:SR|4.0.2.2717 vti_cacheddtm:TX|31 May 1999 15:22:36 -0000 vti_filesize:IR|45568 vti_cachedlinkinfo:VX| vti_cachedsvcrellinks:VX| vti_assignedto:SR| ... Date Added: 2009-06-07 09:48:53 |
| hw3.sol.pdf Path: Sanford-Brown Institute >> CSCI >> 1680 Fall, 2009 Description: CS 168 Computer Networks Jannotti Homework 3 Solution Key Problem 1 The picture above shows the famous TCP saw tooth behavior. We are assuming that fast retransmit and fast recovery always work, i.e. there are no timeouts and there is exactly one ... Date Added: 2009-06-07 09:49:10 |
| index.pdf Path: Temple >> C >> 085 Fall, 2009 Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Spring 2005 Course Syllabus Course: Course Title: Time: Place: Instructor: Instructor Oce: Instructor Email: Instructor Phone: Oce Hours: Prerequisites: Textbook: Course ... Date Added: 2009-06-07 09:50:30 |
| Book_cover.doc Path: San Diego State >> DESIGN >> 240 Fall, 2009 Description: UncleGill Elizabeth Rose could remember the first song she finally mastered on the piano, because she had never been so excited to show her Uncle Gill what she had achieved. It was a special relationship that the two of them had, almost as though th... Date Added: 2009-06-07 09:51:21 |
| single.pdf Path: San Diego State >> ASSIGN >> 240 Fall, 2009 Description: ... Date Added: 2009-06-07 09:51:24 |
| swb_trig1.txt Path: Berkeley >> ASTRO >> 00277356 Fall, 2009 Description: # S/N T1 T2 T90 T50 # Estimated T100 Interval: -0.010 19.430 T90= 12.240 42.1 0.710 12.590 10.080 5.280 6.1 12.710 17.150 4.200 2.520 ... Date Added: 2009-06-07 09:52:07 |
| Government Relations.ppt Path: Western Washington >> MBA >> 595 Fall, 2008 Description: Government Relations in the Global Firm Brian K. Burton Western Washington University 06/01/09 1 What is Government Relations? Scanning the environment Identifying host government priorities Identifying active interest groups Affecting the en... Date Added: 2009-06-07 09:53:28 |
| test1.pdf Path: Texas A&M >> AMESP >> 474 Fall, 2009 Description: 10-01-2003 ELEN 474 Midterm # 1 Instructor: Dr. Jose Silva-Martinez Problem 1 (40 points). For the following layout assume that the gate\'s length is 1 um, LD=0.05 um. Obtain the following information: 1. Effective W of the following transistor. 2. To... Date Added: 2009-06-07 09:54:51 |
| disc12.pdf Path: Wisconsin >> STAT >> 709 Fall, 2009 Description: TA: Yuan Jiang Email: jiangy@stat.wisc.edu STAT 709: Discussion #12 October 23, 2007 1 Location-Scale Families Example 1. Let (X1 , . . . , Xn ) be a random sample from the exponential distribution with Lebesgue density -1 e(a-x)/ I(a,) (x), whe... Date Added: 2009-06-07 09:56:24 |
| d1720.pdf Path: East Los Angeles College >> L >> 314 Fall, 2009 Description: Black plate (135,1) Clave Actividad 1.5 1 prefijo z rai sufijo Actividad 1.6 (a) Si , asi es, pensadores como el originaron los movimientos independentistas. (b) Si , estoy segura de que lo autorizaran. (c) Creo que supones mucho: los acabo de v... Date Added: 2009-06-07 09:57:47 |
| GayvertKaitlyn_set04.pdf Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009 Description: Gayvert, Kaitlyn M p112s09 Due Wed, Feb 25, 2009 at 23:30 Physics 112: General Physics II Section 1 Set 4 CA ID 7272 PA by an outside agent to move these charges slowly and steadily until they are 43.0 cm apart? 12. [2pt] What voltage is required to... Date Added: 2009-06-07 09:59:04 |
| NicholsJohn_set04.pdf Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009 Description: Nichols, John C p112s09 Due Wed, Feb 25, 2009 at 23:30 Physics 112: General Physics II Section 2 Set 4 CA ID 5323 PA by an outside agent to move these charges slowly and steadily until they are 48.0 cm apart? 12. [2pt] What voltage is required to st... Date Added: 2009-06-07 09:59:12 |
| PartamianArman_set04.pdf Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009 Description: Partamian, Arman H p112s09 Due Wed, Feb 25, 2009 at 23:30 Physics 112: General Physics II Section 2 Set 4 CA ID 9483 PA by an outside agent to move these charges slowly and steadily until they are 36.0 cm apart? 12. [2pt] What voltage is required to... Date Added: 2009-06-07 09:59:13 |
| TyleeDaniel_set04.pdf Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009 Description: Tylee, Daniel S p112s09 Due Wed, Feb 25, 2009 at 23:30 Physics 112: General Physics II Section 2 Set 4 CA ID 5212 PA by an outside agent to move these charges slowly and steadily until they are 33.0 cm apart? 12. [2pt] What voltage is required to st... Date Added: 2009-06-07 09:59:17 |
| NSA 290 FINAL PROJECT WEEK 7 AGENDA SP 07.pdf Path: DeVry Mesa >> FACULTY >> 290 Fall, 2009 Description: NSA 290 Final Project Team Name Week 7 Agenda Section Here is our project agenda for this week: Welcome to week seven of senior project. Your tasks this week are listed and described as follows: Read and review this agenda sheet. Last week, each... Date Added: 2009-06-07 10:00:04 |
| Week Fifteen 12.1.05.ppt Path: UNC Charlotte >> TEACHING >> 8210 Fall, 2009 Description: PreparationandEvaluationofa ResearchReport Bycompletingthisunit,youwill Learnstrategiestopreparearesearch report Thestructureofmostcommonresearch reports Guidelinestoevaluatearesearchreport Strategies(1) Writingisapainstakingprocess Writ... Date Added: 2009-06-07 10:00:59 |
| dvir.pdf Path: Columbia >> MC >> 2775 Fall, 2009 Description: The finite field Kakeya conjecture Date Tuesday, October 7 Time 5 pm Location 303 Mudd Abstract: A Kakeya set in F n , where F is a finite field, is a set containing a line in every direction. The finite field Kakeya conjecture states that the size o... Date Added: 2009-06-07 10:01:30 |
| MichelKhoury_SamoraNoguera.pdf Path: UPenn >> MATH >> 170 Fall, 2008 Description: Samora Noguera, Michel Khoury Math 170 Escalation Project Russo-Japanese War By the turn of the 20th century, Japan emerged on the world scenes as the newest industrial power and sought to create its own empire in the Pacific. In contrast, the Russia... Date Added: 2009-06-07 10:02:32 |
| gmix.ps Path: UCSC >> CMPS >> 242 Winter, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: gmix.dvi %Pages: 14 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Times-Italic Helvetica %EndComments %DVIPSWebPage: (www.radical... Date Added: 2009-06-07 10:02:48 |
| MeetingsSchedule.pdf Path: UPenn >> BUS >> 101 Fall, 2009 Description: MeetingswithPresentationGroups Iwouldliketomeetwitheachpresentationgroup15daysbeforethepresentation tofindouthowwellthegroupisfunctioning,andtogivethegroupachanceto discussitsplanswithme.Meetingsshouldlast1530minutes.Toarrangea meeting,callme(office... Date Added: 2009-06-07 10:03:37 |
| Lesson14B.pdf Path: Tarleton >> PHYSICS >> 2424 Fall, 2009 Description: II. Charged Particle in a Perpendicular Uniform Magnetic Field r v B q R A. The particle is undergoing _ _ _. B. The magnetic force is the _ _. C. The magnetic force 1. does _ work. 2. provides _ torque. 3. causes _ acceleration. 4. T... Date Added: 2009-06-07 10:03:44 |
| ProposalStructureOverviewHandout.pdf Path: Penn State >> ALB >> 278 Fall, 2009 Description: Arnon L. Bazemore Prepared by Arnon L. Bazemore Thesis Oral Presentation Overview Presentation Structure Presentation Structure Preliminary Analysis- \"Problem Statement\" Industry/ Project Problem Identification Critical Industry Research Methods Te... Date Added: 2009-06-07 10:04:47 |
| syllabus.pdf Path: Minnesota >> ASTRO >> 1001 Fall, 2008 Description: Syllabus AST 1001 / AST 1005 Summer 2008, Session I You are responsible for all information contained in this syllabus as well as any changes made during the session (www.astro.umn.edu/~mboyer/1001/syllabus). Basic Course Information: Title: Explo... Date Added: 2009-06-07 10:05:07 |
| ProjectManagement.ps Path: Bowling Green >> CIS >> 3300 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - ProjectManagement %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 04/21/99 12:02:46 %BoundingBox: 16 14 597 779 %Pages: (atend) %PageOrder: Ascending %Requirements: %DocumentNeededFonts: (atend) %Documen... Date Added: 2009-06-07 10:05:47 |
| units.pdf Path: University of Illinois, Urbana Champaign >> PHYS >> 598 Fall, 2008 Description: ... Date Added: 2009-06-07 10:08:12 |
| More_Sentence_Diagramming.pdf Path: Grossmont >> ENGLISH >> 098 Fall, 2009 Description: English 098: English Fundamentals Instructor: K. Sherlock MORE SENTENCE DIAGRAMMING COMPLEX, COMPOUND, AND COMPOUND-COMPLEX SENTENCES: English 098: English Fundamentals Instructor: K. Sherlock 1. A straightforward compound sentence. English 098... Date Added: 2009-06-07 10:11:13 |
| Section 1.0.xls Path: Villanova >> MATH >> 1330 Fall, 2009 Description: Objectives of Section 1.0 (1) To undertand the five major stages of the problem-solving process as pertains to this course (2) To briefly demonstrate the five stages of problem-solving process (3) To understand the twelve steps involved in the five s... Date Added: 2009-06-07 10:12:18 |
| lcd1121.pdf Path: Stanford >> NLD >> 20001121 Fall, 2009 Description: Track Vertex Axis Seed T IP L D Beam Axis ... Date Added: 2009-06-07 10:13:02 |
| no group04-09.docx Path: Air Force Academy >> GE >> 121 Fall, 2009 Description: Portable Constant Cooling Device Engineering 121-04 Design Project Group 04-09 Loyd Bartsch, Dylan Novakowski, Mikhailo Zerebecky, and Joshua Poetker Clients Statement A lot of users have been complaining that when they take their coolers to the bea... Date Added: 2009-06-07 10:13:27 |
| distprog.pdf Path: Allan Hancock College >> COMP >> 3402 Fall, 2009 Description: COMP3402 Concurrent & Real-Time Systems Message Passing Basics of distributed programming in Java and Ada References: B. Eckel, Thinking in Java, Prentice Hall, 1998. http:/www.ibiblio.org/pub/docs/books/eckel M. Ben-Ari, Principles of Concurrent an... Date Added: 2009-06-07 10:13:51 |
| 24361.txt Path: UNC >> DOCS >> 24361 Fall, 2009 Description: The Project Gutenberg EBook of Teddy: Her Book, by Anna Chapin Ray This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenbe... Date Added: 2009-06-07 10:15:08 |
| 24378.txt Path: UNC >> DOCS >> 24378 Fall, 2009 Description: The Project Gutenberg EBook of Mamma\'s Stories about Birds, by Anonymous (AKA the author of \"Chickseed without Chickweed\") This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it ... Date Added: 2009-06-07 10:15:35 |
| 24670-8.txt Path: UNC >> DOCS >> 24670 Fall, 2009 Description: Project Gutenberg\'s The Botanical Magazine Vol. 8, by William Curtis This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Guten... Date Added: 2009-06-07 10:15:45 |
| 24810-8.txt Path: UNC >> DOCS >> 24810 Fall, 2009 Description: Project Gutenberg\'s The Better Germany in War Time, by Harold Picton This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Guten... Date Added: 2009-06-07 10:15:47 |
| 24758.txt Path: UNC >> DOCS >> 24758 Fall, 2009 Description: The Project Gutenberg eBook, The Eyes of the Woods, by Joseph A. Altsheler, Illustrated by D. C. Hutchison This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use ... Date Added: 2009-06-07 10:15:49 |
| Logic Design & Synthesis Using Verilog HDL.pdf Path: Iowa State >> CPRE >> 305 Fall, 2009 Description: Logic Design & Synthesis Using Verilog An Introduction Part I Guidelines for Coding Synthesisable Verilog HDL Descriptions Combinational Circuits Usage of blocking assignment (=) Ensuring completeness of sensitivity lists Ensuring complete specific... Date Added: 2009-06-07 10:19:30 |
| 10-13-98.pdf Path: Santa Clara >> ECON >> 401 Fall, 2009 Description: Economics 401 Lecture outline 10/13/98 Coefficient of determination (R2) and goodness of fit R-squared as percentage of variation in Y explained by the regression 2 SSE 2 (Y Y ) R = = 1 2 TSS (Y Y ) where SSE = sum of squared errors or sum of s... Date Added: 2009-06-07 10:19:45 |
| faculty.pdf Path: Bridgewater State >> WIRELESS >> 0607 Fall, 2009 Description: Faculty Richard Abers Assistant Professor of Aviation Science and Chairperson of the Department of Aviation Science BS (University of Illinois); MEd (University of New Hampshire) Victoria L. Bacon* Professor of Counselor Education BA (Fitchburg Stat... Date Added: 2009-06-07 10:20:46 |
| 2005SJICatalog.pdf Path: Purdue >> CE >> 479 Fall, 2008 Description: 42nd Edition K-Series LH-Series DLH-Series Joist Girders Standard Specifications Load Tables and Weight Tables for Steel Joists and Joist Girders The information presented in this publication has been developed by the Steel Joist Institute and is... Date Added: 2009-06-07 10:21:58 |
| lecture2.pdf Path: Bridgewater State >> DOCS >> 458 Fall, 2009 Description: \'o 8\".,L1 LeJ*,e 2 Gc,c\\-.\\on: qb.J$ *+ ) -> T-+ Z d,$.\".* {o.e s *^.*\\<,r*\\s \ <. V* l^ \\ot^A*n .^:,\\ J f,r.sr,\ lui\\,*4 ri^c \\u B 6r s^x^t\\= Dv H Re\\J\' tundo. f .s, /a E S \\ r A C- 9F.*e qB .I-i : o (t - S \\ \\ (\' c\\osd sorfqre 5... Date Added: 2009-06-07 10:24:19 |
| HBR_on_KM_Ch1_3_Discussion_Arab_Salem.ppt Path: Arizona >> CLASS >> 480580 Fall, 2009 Description: Harvard Business Review on Knowledge Management Discussion of Chapters 1- 3 MIS 580 September 27, 2005 Arab Salem 1 Contents The Coming of the New Organization By Peter F. Drucker, 1988 The Knowledge-Creating Company By Ikujiro Nonaka, 19... Date Added: 2009-06-07 10:24:51 |
| specc_meth_comm-impl_x4.pdf Path: Iowa State >> CPRE >> 588 Fall, 2009 Description: SpecC Methodology June 11, 2001 Communication Synthesis Bus Allocation / Channel Partitioning PE1 PE2 B1 B1 Bus allocation / protocol selection Channel partitioning Specification model Architecture exploration Bus1 v1 Allocate busses B13rc... Date Added: 2009-06-07 10:26:05 |
| guidetest1.ps Path: San Diego State >> PHYS >> 410 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: guidetest1.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMBX12 CMSY10 CMMI12 %DocumentPaperSizes: Letter %EndComments %DVIPSWebPag... Date Added: 2009-06-07 10:27:45 |
| 1196795189-24.141.182.246.txt Path: Toledo >> PSY >> 230 Fall, 2009 Description: 11ECD12C 564651543416114556613641621224423646465463166661326111316126... Date Added: 2009-06-07 10:31:13 |
| Excel Homework.doc Path: Texas >> BIO >> 208 Fall, 2008 Description: Homework: Using Excel PLEASE USE A SEPARATE SHEET OF PAPER TO ANSWER THE FOLLOWING QUESTIONS. PLACE ANY GRAPHS OR FIGURES YOU CREATE IN EXCEL INTO A WORD DOCUMENT. ALWAYS USE THE JOURNAL FORMAT INDIACTED IN YOUR LAB SECTION! 1) A political scientist ... Date Added: 2009-06-07 10:31:38 |
| Thu_Dec_25.txt Path: Auburn >> RH >> 370 Fall, 2009 Description: ocp0002 smb24493 131.204.14.44 Thu Dec 25 19:45 - 19:55 (00:10) szh0014 smb24098 131.204.14.46 Thu Dec 25 19:38 - 19:49 (00:10) kcv0001 smb19313 131.204.14.44 Thu Dec 25 17:50 - 18:00 (00:10) dds0006 smb19225 131.2... Date Added: 2009-06-07 10:32:14 |
| Thu_Nov__1.txt Path: Auburn >> RH >> 370 Fall, 2009 Description: yonbenj smb4013 131.204.14.139 Thu Nov 1 23:18 - 23:29 (00:10) skippjh smb2223 131.204.14.146 Thu Nov 1 23:16 - 23:27 (00:10) skippjh smb29682 131.204.14.152 Thu Nov 1 23:13 - 23:14 (00:01) skippjh smb25880 131.2... Date Added: 2009-06-07 10:32:18 |
| Tue_Dec__2.txt Path: Auburn >> RH >> 370 Fall, 2009 Description: rigdowr smb7732 131.204.14.149 Tue Dec 2 23:54 still logged in willart smb5881 131.204.14.151 Tue Dec 2 23:38 - 23:39 (00:01) cdj0002 smb1715 131.204.14.129 Tue Dec 2 23:31 - 23:41 (00:10) fergujc smb23990 131.... Date Added: 2009-06-07 10:32:21 |
| error.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 00:25:47 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 01:08:12 2008 ( 2545 s elapsed) ... Date Added: 2009-06-07 10:33:07 |
| error.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 22:16:17 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 22:59:08 2008 ( 2571 s elapsed) ... Date Added: 2009-06-07 10:34:31 |
| log.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: 000 (56696.000.000) 02/10 19:21:06 Job submitted from host: <128.95.94.28:1098> . 001 (56696.000.000) 02/10 22:56:15 Job executing on host: <172.25.101.47:1056> . 006 (56696.000.000) 02/10 23:16:23 Image size of job updated: 397896 . 005 (56696.000.0... Date Added: 2009-06-07 10:34:42 |
| log.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: 000 (56934.000.000) 02/10 19:22:35 Job submitted from host: <128.95.94.28:1098> . 001 (56934.000.000) 02/11 00:20:41 Job executing on host: <172.25.101.44:1057> . 006 (56934.000.000) 02/11 00:40:49 Image size of job updated: 372372 . 005 (56934.000.0... Date Added: 2009-06-07 10:35:10 |
| 35h.pdf Path: University of Hawaii - Hilo >> MATH >> 311 Fall, 2008 Description: Math 311 Hw 35 Name _ Score_/ 18 Hw 393: 2ab, 14, 16, 18, 20, 22, 24, 26, 28. Recommended 393: 15,17,19,21,23,25,27,33. Answer page 6.4, 551. 3DJH. . Find the inverses of the following orthogonal matrices (if you can\'t immediately write the inverse, ... Date Added: 2009-06-07 10:35:48 |
| hw3-210-fa08.pdf Path: Caltech >> CDS >> 101 Fall, 2008 Description: CALIFORNIA INSTITUTE OF TECHNOLOGY Control and Dynamical Systems CDS 210 D. G. MacMynowski Fall 2008 Problem Set #3 Issued: Due: 13 Oct 08 20 Oct 08 Note: In the upper left hand corner of the second page of your homework set, please put the numb... Date Added: 2009-06-07 10:37:03 |
| JAPN100ALL.TXT Path: Sveriges lantbruksuniversitet >> ARTS >> 20013 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: JAPN 100-3 ALL SECTIONS LOCATION: SFU DOW TITLE: INTRO. JAPANESE I SECTION TYPE: TUT SEMESTER: 2001-3 ENROL: 127 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 studen... Date Added: 2009-06-07 10:37:26 |
| Hassan_summary1a_2.doc Path: CUNY Baruch >> CIS >> 718 Fall, 2009 Description: MD HASSAN SS#*-*-6218 CIS 718X Summary of Integrating Diagnostic Expert System with Image Processing via Loosely Coupled Technique. By El-Helly,M., Rafea,A., El-Gamal,S., and El-Whab,R.A. Conventional Expert systems, especially those used in diagnosi... Date Added: 2009-06-07 10:37:36 |
| f07.pdf Path: Oregon State >> ECE >> 478 Fall, 2008 Description: direction of motion direction of motion A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 24 25 26 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 21 3 15 1 19 10 14 26 20 8 16 7 22 4 11 5 17 9 12 23 18 2 25 6 24 13 26 1 2 3 4 5 6 ... Date Added: 2009-06-07 10:37:47 |
| f5-6.pdf Path: Oregon State >> ECE >> 478 Fall, 2008 Description: Key Discontinuous plaintext input Encryption algorithm Continuous ciphertext output Continuous random-data generator Figure 5.6 Traffic-Padding Encryption Device ... Date Added: 2009-06-07 10:37:51 |
| Lecture03.doc Path: Toledo >> GGR >> 375 Fall, 2009 Description: Suggested Reading: Brest, C.L. 1987. Seasonal albedo of an urban/rural landscape from satellite observations. Journal of Climate and Applied Meteorology, 26, 1169-1187. - have a good look at what this article has to say about albedo and its seasonal ... Date Added: 2009-06-07 10:39:24 |
| handout10.pdf Path: East Los Angeles College >> DOCS >> 2735 Fall, 2009 Description: MATH 2735 handout 10 Parameter estimation Example: Blood coagulation data Recall the blood coagulation data from handout 6. The overall mean was y = 64, so = 64 and the mean coagulation times on the four diets were yA = 61, yB = 66, yC = 68, yD = 6... Date Added: 2009-06-07 10:40:10 |
| Rumberger and Palardy--School Effectiveness.pdf Path: UCLA >> EDUC >> 255 Fall, 2008 Description: Multilevel Models for School Effectiveness Research Russell W. Rumberger and UC Santa Barbara Gregory J. Palardy University of Georgia [Please note that throughout this paper, estimated parameters should have the symbol \" ^ \" directly above the par... Date Added: 2009-06-07 10:40:15 |
| v02n404.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From owner-cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Mon May 18 08:57:18 1998 Date: Mon, 18 May 1998 08:25:34 -0600 From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca (Cdn-Firearms Digest) To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca... Date Added: 2009-06-07 10:41:17 |
| v02n480.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From - Wed Jul 8 12:10:22 1998 Received: from broadway.sfn.saskatoon.sk.ca (broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id RAA08687; Tue, 7 Jul 1998 17:38:08 -0600 (CST) Received: (from majordomo@loca... Date Added: 2009-06-07 10:41:18 |
| lect21.pdf Path: Contra Costa College >> COMP >> 249 Fall, 2009 Description: A Buered Input Example, page 1 of 5 For the sake of illustration, suppose that we have a BufferedReader object called br, with a buer size of only 6 bytes. Suppose we have an input le that looks like this: abc<CR><LF> de<CR><LF> fghij<CR><LF> Supp... Date Added: 2009-06-07 10:41:26 |
| class4_preenc_enc_quiz_answers.doc Path: Medical College >> ACCTING >> 101 Fall, 2009 Description: Module III: MCG Budgeting Basics Class IV: Pre-Encumbrances Explanations Pre-Encumbrance & Encumbrance Quiz I Answers 1. Purchase Orders are commonly referred to as? c. Encumbrances (see pages 2-3) 2. Requisitions are co... Date Added: 2009-06-07 10:43:51 |
| eel3111-2004fall-07.ppt Path: UNF >> EEL >> 3111 Spring, 2008 Description: TheUniverseisAlwaysin Motion Whynotsenseit? AdamShronce EricAebyPaulVranesh OspreyMotionDetector MajorComponents Physics Benefits AbilitiesandApplications TheOspreyMotionDetector Major components: TI MSP430 Processor Power source Board c... Date Added: 2009-06-07 10:44:05 |
| cs4811-ch06-k-repr-4pp.ps Path: Mich Tech >> CS >> 4811 Fall, 2008 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Creator: OpenOffice.org 1.1.0 %For: soner %CreationDate: Mon Feb 16 10:39:07 2004 %Title: Refinement Planning: Status and Prospectus %LanguageLevel: 2 %DocumentData: Clean7Bit %Pages: 18 0 %PageOrder: Ascend %End... Date Added: 2009-06-07 10:44:22 |
| Lecture13_2up.pdf Path: Harvard >> PHYS >> 151 Fall, 2009 Description: Mechanics Physics 151 Lecture 13 Oscillations (Chapter 6) What We Did Last Time Studied oscillation Discussed general features of multi-dimensional oscillators Equation of motion Eigenvalue problem Va = 2Ta Showed that oscillating solutions exis... Date Added: 2009-06-07 10:47:18 |
| h270.ps Path: Arizona >> Q >> 1150 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:30:25 2001 %DocumentData: Clean... Date Added: 2009-06-07 10:49:26 |
| h130.ps Path: Arizona >> Q >> 0121 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:04:53 2001 %DocumentData: Clean... Date Added: 2009-06-07 10:49:30 |
| ec08lectcom.ppt Path: Auburn >> FLSP >> 4320 Fall, 2008 Description: FLSP 4320 Espaol Comercial II EC, Captulo 8: Bienes y servicios Primavera de 2006 Productos y servicios El alto mando de una empresa debe ocuparse, adems de los recursos humanos, de la produccin de bienes y la oferta de servicios. Bienes y servici... Date Added: 2009-06-07 10:49:50 |
| R-BC.pdf Path: Montana >> OPA >> 200750 Fall, 2009 Description: Office of the Registrar MSU-Bozeman Bozeman, MT REPORT B - PART C PREVIOUS SCHOOLS ATTENDED BY NEW GRADUATE STUDENTS NonDegree Master\'s Candidates Law Students Includes Un-Paid Students Summer Session August 29, 2007 For Event: 200750EOT PREVIOUS ... Date Added: 2009-06-07 10:50:54 |
| R-BB.pdf Path: Montana >> OPA >> 200550 Fall, 2009 Description: Office of the Registrar MSU-Bozeman Bozeman, MT REPORT B - PART B PREVIOUS SCHOOLS ATTENDED BY NEW TRANSFER STUDENTS For Event: End of Third Week Summer Session August 16, 2005 200550CURRENT PREVIOUS SCHOOL ATTENDED New Transfers from Montana Scho... Date Added: 2009-06-07 10:51:02 |
| R-GC.pdf Path: Montana >> OPA >> 200830 Fall, 2009 Description: Office of the Registrar MSU-Bozeman Bozeman, MT REPORT G - PART C HEADCOUNT ENROLLMENT FIRST-TIME STUDENTS BY PRIMARY MAJOR For Event: UNDERGRADUATE POSTBAC PostNonBac Degree Master End of Third Week Spring Semester February 21, 2008 200830CENSUS ... Date Added: 2009-06-07 10:51:07 |
| R-BA.pdf Path: Montana >> OPA >> 200250 Fall, 2009 Description: Office of the Registrar MSU-Bozeman Bozeman, MT REPORT B - PART A PREVIOUS SCHOOLS ATTENDED BY NEW FRESHMAN Nondegree Traditional Nontraditional End of Third Week Summer Session August 30, 2002 For Event: 200250CENSUS PREVIOUS SCHOOL ATTENDED New ... Date Added: 2009-06-07 10:51:11 |
| QF164 080207.pdf Path: Stanford >> QF >> 164 Fall, 2009 Description: ... Date Added: 2009-06-07 10:51:45 |
| quiz10key.pdf Path: SDSMT >> MATH >> 381 Fall, 2009 Description: Math/IEng 381 Quiz 10 (3-20) Name_ 8 / 11 1. In a sample of 150 boards of a certain grade, the average modulus of elasticity was 1.57 psi and the variance was 0.0529. (a) Find a 95% confidence interval for the mean modulus of elasticity and interpr... Date Added: 2009-06-07 10:52:44 |
| cs122a_04fal_102604_grades.pdf Path: UC Riverside >> CS >> 122 Fall, 2009 Description: CS 122A Fall 2004 Grades 10/26/04 HASHID 2108509 3319757 105744 1221440 1045272 385915 490568 3317169 1141582 1411384 1804074 1965315 1360615 4063236 2797364 177282 3175172 256523 918442 3103914 1298220 2444160 2351934 2709280 2396916 772920 1902250 ... Date Added: 2009-06-07 10:53:08 |
| D-Aldoses.pdf Path: Michigan >> C >> 226 Fall, 2009 Description: CHEMISTRY 226 THE D -FAMILY ALDOSES CHO H OH CH2OH CHO H H OH OH R at C2 D -(+)-glyceraldehyde CHO S at C2 HO H H OH CH2OH D -(-)-threose CH2OH D-(-)-erythrose CHO H H H OH OH OH CH2OH D -(-)-ribose CHO HO R S H H H OH OH CH2OH D -(-)-arabinose ... Date Added: 2009-06-07 10:53:11 |
| 1113-MatingSystems.pdf Path: Utah >> BIOLOGY >> 5385 Fall, 2009 Description: Order: Apodiformes Common name: White-throated Swift Order: Apodiformes Common name: Sword-billed Hummingbird Order: Trogoniformes Common name: Elegant Trogon Polygyny threshold model Figure 17-2: Variation in the sizes of harems of male Red-wing... Date Added: 2009-06-07 10:56:02 |
| Membrane Filtration.pdf Path: Michigan State University >> ENE >> 806 Spring, 2008 Description: Dead End Membrane Filtration ENE 806 Laboratory Feasibility Studies in Environmental Engineering Spring 2006 Instructor: Dr. Syed A. Hashsham Report by Ahsan Munir (PID: A37589962) Acknowledgement First and foremost, my sincere thanks are due to... Date Added: 2009-06-07 10:56:14 |
| AnswersSection2_5.pdf Path: Bard >> MATH >> 141 Fall, 2009 Description: Math 141: Business Math I Sections 506 and 523 Answers to Section 2.5 Spring 2008 MW 4:10-5:25, TR 3:55-5:10 Answers to the even-numbered suggested problems from Section 2.5: 8 7 18. 7 13 5 9 4 1 13 38. The given system of linear equations can... Date Added: 2009-06-07 10:57:48 |
| info_312_Final_Exam_Key_Location_(19-Mar).pdf Path: Washington >> CHEM >> 312 Fall, 2008 Description: The Final Exam Key can be viewed on the Chem 312 bulletin board outside Bagley 154. ... Date Added: 2009-06-07 10:58:24 |
| ARMA_generator.xls Path: Allan Hancock College >> MAT >> 5102 Fall, 2009 Description: Time Series Data Generator Data Set No. of terms generated 0 12 10 8 6 4 2 0 4 10 16 22 28 34 40 46 52 58 64 70 76 82 88 94 100 1 7 13 19 25 31 37 43 49 55 61 67 73 79 85 91 97 Back to Time Series Data Generator Column H 6 52 58 64 70 76 82 88... Date Added: 2009-06-07 10:58:42 |
| math1271sec061_quiz6_sol.pdf Path: Mines >> MATH >> 1271 Fall, 2009 Description: Math 1271 Dis. 061 Quiz 6 October 31, 2005 Solutions No Work = No Credit. Write Legibly. Box your nal result. 1. 10 points Find the absolute maximum and absolute minimum values of f on the given interval. f (x) = x4 2x2 + 3, [2, 3] (1) First we ... Date Added: 2009-06-07 10:58:49 |
| gcn.txt Path: Berkeley >> ASTRO >> 00291728 Fall, 2009 Description: # Time [days] Mag Magerr Band Uplim Ref 0.11250 18.2 -0.2 none yes GCN6816 0.17045 -0.2 I yes GCN6809 0.17045 -0.2 V yes GCN6809 0.1... Date Added: 2009-06-07 11:00:11 |
| M111_ProblemSet09_Fall_2007.pdf Path: UMBC >> MATH >> 111 Fall, 2009 Description: Math 111 Fall, 2007 Problem Set 9 November 19 23 Instructions: You should attempt all of the problems in the Problem Set for this week. The problems for the quiz for this week will be selected these problems. November 19 - 23 Problem Set 9 6.5 6.... Date Added: 2009-06-07 11:00:31 |
| mm545052713.052500.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.08 106.901 -72.898 41.823 -71.446 43.248 14.922 -72.172 42.536 67.669 BDL CON ORE GDM ... Date Added: 2009-06-07 11:01:06 |
| mm545072720.072606.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 195.398 105.454 -67.432 50.689 -65.1 49.76 23.021 -66.266 50.224 4... Date Added: 2009-06-07 11:02:51 |
| mm545080213.073118.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.217 106.975 -66.799 49.401 -65.733 51.048 14.381 -66.266 50.224 4... Date Added: 2009-06-07 11:02:59 |
| mm515072620.072518.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.22 107.517 -68.562 49.997 -67.853 48.267 9.521 -68.207 49.132 3... Date Added: 2009-06-07 11:03:22 |
| mm545072920.072700.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.57 107.705 -65.822 42.879 -66.418 44.621 7.078 -66.12 43.75 2... Date Added: 2009-06-07 11:04:21 |
| mm545060920.060706.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.998 107.936 -67.118 45.573 -67.082 47.371 0.464 -67.1 46.472 2... Date Added: 2009-06-07 11:04:48 |
| DB.pdf Path: Goldey-Beacom >> CIS >> 149 Fall, 2009 Description: ITG 149 Intro to Computers II - Access Project \"Building Your Company Database\" Fall 2006 1 Introduction Note: This project is to be completed over the next two weeks; that is plenty of time, but don\'t wait until the last minute to begin! The co... Date Added: 2009-06-07 11:05:42 |
| figure-13.3.ps Path: Purdue >> CS >> 250 Fall, 2008 Description: %!PS-Adobe-1.0 %Creator: devps (Pipeline Associates, Inc.) %CreationDate: Thu Apr 1 22:28:07 2004 %Pages: (atend) %DocumentFonts: (atend) /X /exch load def /r /rmoveto load def /m /moveto load def /l /lineto load def /rl /rlineto load def /lc{yc X xc... Date Added: 2009-06-07 11:05:59 |
| figure-16.11.pdf Path: Purdue >> CS >> 250 Fall, 2008 Description: Setup(N) 1. Allocate a buffer of N bytes. 2. Create a global pointer, p, and initialize p to indicate that the buffer is empty. Input(N) 1. If the buffer is empty, make a system call to fill the entire buffer, and set pointer p to the start of the bu... Date Added: 2009-06-07 11:06:18 |
| figure-7.4.pdf Path: Purdue >> CS >> 250 Fall, 2008 Description: /* Notes: the steps below assume that two 32-bit operands are located in registers labeled R5 and R6, and that the microcode must use 16-bit registers labeled r0 through r3 to compute the results. */ add32: move low-order 16 bits from R5 into r2 move... Date Added: 2009-06-07 11:06:25 |
| Chem33SampleTest3Key.pdf Path: Maryville MO >> CHEM >> 1330 Fall, 2009 Description: CHEMISTRY 33: Section 1: M-R 11:00 Name: NOTE: _ SS 2000 - Test 3 Sample Student Number: _ _ _ _ _ _ Homework questions and/or laboratory related questions are also fair game for the upcoming test. 1. The following redox reaction occurs in nickel... Date Added: 2009-06-07 11:07:07 |
| slides11.ppt Path: Duke >> CPS >> 100 Fall, 2009 Description: Stack: What problems does it solve? q Stacksareusedtoavoidrecursion,astackcanreplacethe implicit/actualstackoffunctionscalledrecursively Stacksareusedtoevaluatearithmeticexpressions,toimplement compilers,toimplementinterpreters TheJavaVirtualMachin... Date Added: 2009-06-07 11:09:16 |
| 090429.pdf Path: Washington >> LING >> 472 Fall, 2008 Description: Statistical Parsing April 29, 2009 Overview Why probabilistic parsing? PCFGs Using the probabilities Learning the probabilities Probabilistic CKY Beyond CFGs Evaluating parsers Human sentence processing Why probabilistic parsing? Ambiguity... Date Added: 2009-06-07 11:09:53 |
| README.doc Path: MIT >> I >> 386 Fall, 2009 Description: * CLU-DOC version 1.1 * The emacs-lisp directory contains the files needed to put the CLU manual online as part of the Emacs help facility. (Basically the Emacs help facility is extended with operations to support Clu help in a manner similar to ... Date Added: 2009-06-07 11:11:05 |
| jdbcscriptlet_jsp.txt Path: NJIT >> CIS >> 631 Fall, 2009 Description: <jsp:directive.page import=\"java.sql.*\" /> <jsp:scriptlet> Class.forName(\"com.mysql.jdbc.Driver\").newInstance(); Connection connection = DriverManager.getConnection(\"jdbc:mysql:/sql2.njit.edu:3306/theo\", \"theo\", \"[password]\"); Statement statemen... Date Added: 2009-06-07 11:11:08 |
| RR84-13.pdf Path: NYU >> ECON >> 1984 Fall, 2009 Description: ... Date Added: 2009-06-07 11:11:33 |
| hnd_Design Process.pdf Path: Washington >> ENGR >> 100 Fall, 2008 Description: Engineering Design Process ENGINEERING is the process of applying scientific and mathematical principles, experience, judgement, and common sense to DESIGN products or processes that benefit society. It is an ITERATIVE process composed of the followi... Date Added: 2009-06-07 11:11:42 |
| bridging_the_gap_handout.pdf Path: Washington >> DEPTS >> 20081106 Fall, 2009 Description: Bridging the Gap: Grades PK-12 to Postsecondary We will know success when: Potential solutions to explore (on back) PK 12 Describe how these elements impact (+/-) successful transition to postsecondary ed.: 1) Goals: do we have common goals? 2) Tea... Date Added: 2009-06-07 11:12:13 |
| apr20.pdf Path: Washington >> GEN >> 351 Fall, 2009 Description: Genome 351, April 20, 2009 Last time . Meiosis also involves exchange between homologs. This produces new combinations of parental alleles for genes on the same chromosome. The likelihood of recombination between genes is proportional to their dist... Date Added: 2009-06-07 11:12:50 |
| hw5.pdf Path: SMU - Cox School of Business >> PHYSICS >> 3340 Fall, 2009 Description: PHYS 3340 Spring 2008 TE Coan Due: 5 Mar 08, 6pm via email. Homework 5 1. Use orbit.cc to verify Keplers 3rd law, 2 a3 , where is a planets period and a is the semi-major axis of its elliptical orbit. Do this by machine computing and a. Make a s... Date Added: 2009-06-07 11:14:41 |
| 1612.pdf Path: Texas >> COLA >> 092 Fall, 2009 Description: The Center for Russian, East European and Eurasian Studies presents: The Tsar is dead. Chaos Reigns. Directed by Vladimir Khotinenko and produced by Nikita Mikhalkov 1612 May 11 7:00pm GRG 102 After the brutal slaughter of Tsar Boris Godunov and h... Date Added: 2009-06-07 11:15:15 |
| Intro.ppt Path: UPR Mayagüez >> ICOM >> 4215 Fall, 2009 Description: Computer Architecture ICOM 4215 Includes Standard methodology lectures and exams Project simulating a processor using CAD tools Shorter exercises using CAD tools Webpage - http:/ece.uprm.edu/~noack/icom4015 ICOM 5007 - Noack Purpose and Objective... Date Added: 2009-06-07 11:16:49 |
| as4.f03.data2.txt Path: Slippery Rock >> CPSC >> 207 Fall, 2009 Description: print \"What is the radius: \"; $radius= <STDIN>; chop($radius); $pi = 3.1415; $result = 2 * $pi * $radius; print \"radius $radius is circumference $result\ \";... Date Added: 2009-06-07 11:17:04 |
| primer.pdf Path: Trinity U >> CS >> 2322 Fall, 2009 Description: J Primer Eric Iverson Copyright 1991-2002 Jsoftware Inc. All Rights Reserved. Last updated: 2001-3-29 www.jsoftware.com . Table of Contents 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Start here Why J Purpos... Date Added: 2009-06-07 11:18:20 |
| WhereFinalLectureHUM214DunnLS09.pdf Path: UNC Asheville >> HUM >> 214 Fall, 2009 Description: 1 Where have we come from? Where are we? Where are we going? The World in the 17th Century As Come In: Quotes about history and questions. Music by Mali griot Bassi Kouyate (professes to be in the line of Sundiatas griot) or Jomeds Montuno Noreno (Mi... Date Added: 2009-06-07 11:18:44 |
| macros.txt Path: UCSC >> CMPS >> 203 Fall, 2008 Description: GLib\'s configure options and corresponding macros = -enable-debug=no -DG_DISABLE_ASSERT -DG_DISABLE_CHECKS -enable-debug=minimum [default for stable branches] none -enable-debug=yes [default for development branches] -DG_ENABLE_DEBUG -g -enable... Date Added: 2009-06-07 11:20:30 |
| Pre02c_STN_Model_Data.txt Path: UC Riverside >> AUGUST >> 308 Fall, 2009 Description: Station Col Row Year Jdate SO4 NO3 NH4 OC EC PM25 04_013_9997 3... Date Added: 2009-06-07 11:22:32 |
| 11008womensoccer-weekly.pdf Path: Seattle Pacific >> MEDIA >> 0102 Fall, 2009 Description: S p ort s I n f or m at io n Of f i c e Linnea Jarvits, Assistant SID FOR IMMEDIATE RELEASE: OCTOBER 8, 2001 2001 womens soccer 206/281-2772 voice | 206/281-2266 fax | frmacdon@spu.edu | www.spu.edu/falconsonline Falcons Take 3-Game Win Streak Acro... Date Added: 2009-06-07 11:23:56 |
| 08notesb.pdf Path: UCSC >> BIO >> 119 Fall, 2009 Description: Bio 119 Nitrogen Metabolism 07/14/08 Nitrogen Metabolism and The Nitrogen Cycle READING: BOM-11 17.29 12.9 19.22 20.15 Genetics and regulation of N2 Fixation Free-Living Aerobic Nitrogen-Fixing Bacteria Root Nodule Bacteria and Symbiosis with Legu... Date Added: 2009-06-07 11:26:19 |
| xamlhouse_project_plan.pdf Path: RIT >> KJT >> 1549 Fall, 2009 Description: xamlhouse silverlight exploration Edward A. Baker Kevin Thomas Anna Demas Andrew Carolla Nathanael Wolfe Jess Davis Sarah Merchant Matthew Robinson James Alexander Project Overview We have been given the opportunity to explore the Microsoft... Date Added: 2009-06-07 11:27:05 |
| 3.Observation.txt Path: Virginia Tech >> CS >> 1044 Fall, 2000 Description: Observer: Roscoe P Coltrane Date: October 7, 2003 Emit Hz: 2294 Ret Hz: 2993 ... Date Added: 2009-06-07 11:27:06 |
| a6.pdf Path: W. Alabama >> CS >> 240 Fall, 2009 Description: CS240, Fall 2005, Therese Biedl, Tom Vina as r 1 Assignment 6 CS240, Fall 2005 Due November 23, 4pm You must follow the assignment guidelines available on the course web page (http: /www.student.cs.uwaterloo.ca/~cs240). All solutions must be submit... Date Added: 2009-06-07 11:27:08 |
| A_Simple_Example_to_Illustrate_Comparative_Advantage_and_Supply.doc Path: Butler >> EC >> 231 Fall, 2009 Description: A Simple Example to Illustrate Comparative Advantage and Supply Joe and Tom are each capable of producing either good A or good B. Joe can produce 12 of A per hour if he produces A. If instead he produces B, he can produce 3 per hour. The price at wh... Date Added: 2009-06-07 11:28:34 |
| OpimplJoins.ppt Path: Allan Hancock College >> CS >> 9315 Fall, 2009 Description: Evaluation of Relational Operations Chapter 14 (3rd Edition) , Part A (Joins) COMP9315 Database Systems Implementation Relational Operations We will consider how to implement: Selection ( ) Selects a subset of rows from relation. ... Date Added: 2009-06-07 11:28:39 |
| WS-7.doc Path: Washington >> CHIN >> 102 Winter, 2008 Description: Chin 102 Winter 2009 University of Washington Weekly Schedule-7 (Feb , 16-20W 2009) Date Feb 16 M Content Holiday Homework Prepare for the oral test on Tuesday. Get fluent with both the text and the questions on speaking exercise sheet of L10. (... Date Added: 2009-06-07 11:28:58 |
| one.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: ... Date Added: 2009-06-07 11:30:07 |
| SigmaNotationPractice.pdf Path: Washington >> MATH >> 310 Fall, 2008 Description: Sigma Notation Practice Your life in the rst two weeks of this course will be signicantly easier if you learn to use the notation properly and if you are organized and complete on your homework. For instance, you should practice using sigma notation ... Date Added: 2009-06-07 11:33:43 |
| addV.pdf Path: Washington >> M >> 309 Fall, 2009 Description: Assignment V: Sections 9.4 9.5 Topic Competing Species Predator-Prey Page 525 534 Assigned Problems 2bcdef 2abcd, 3abcd Practice Problems 6bcdef 4abcd Also assigned for V: is the following problem about a Predator-Prey system This problem is similar... Date Added: 2009-06-07 11:34:14 |
| ECE535_08F_hw5.pdf Path: Illinois Tech >> ECE >> 535 Fall, 2009 Description: ECE 535 DISCRETE TIME SYSTEMS HOMEWORK ASSIGNMENT #5 Due: 3 November 2008 (revised on 27 Oct 2008) FALL 2008 [The 27 October 2008 revision adjusted (in problem 1) the value of T2 to 0.6 (from 0.5) and the delay (in part (d) to 1.8 (from (1.5). If ... Date Added: 2009-06-07 11:36:11 |
| 12recaps.txt Path: Wisconsin >> BOWL >> 9899 Fall, 2009 Description: League Name : 1998 - 1999 SSEC League Bowl101w Ver 7.2.3 League President : Dave Allen League Secretary : Becky Schaffer Associ... Date Added: 2009-06-07 11:37:47 |
| SLC_Grad_App_ArtOfTeaching.pdf Path: Sarah Lawrence >> DATA >> 1403 Fall, 2009 Description: MS Ed-Art of Teaching Sarah Lawrence College Admission Procedures for Master of Science in Education - Art of Teaching This application and all the materials received in connection with the application shall be strictly confidential. These materials... Date Added: 2009-06-07 11:39:07 |
| MA385_HW1_S09_parameters.pdf Path: MSOE >> MA >> 385 Fall, 2009 Description: MA385 sec 001 Spring 2009 Hand-in assignement #1 x y a b z Baez 2873 4693 2197 4913 695 Berg 3211 5083 2873 6859 746 Bolanos 3757 3887 3211 4913 634 Borkowski 2197 3757 3757 6859 685 Casura 3757 3887 3887 4913 573 Congdon 2197 5681 4693 4913 634 Dani... Date Added: 2009-06-07 11:39:35 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2440 Fall, 2009 Description: 164 8848:62668:1198:395 1952 16294:11881:2397:652 43655:17139:2397:593 a 34017:12217:535:395 49750:19887:484:375 advisor 36159:52981:4207:553 38020:13087:3875:375 after 45899:16487:2473:395 ahlgren 31722:52803:4462:731 ahlgren\'s 19354:18721:5023:632 ... Date Added: 2009-06-07 11:40:11 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 1891 Fall, 2009 Description: 139 55143:3241:3020:1107 a 18981:36582:997:724 2493:41414:969:744 17623:9543:969:744 2438:39824:1025:744 about 7010:52589:5181:744 above 30786:9482:5292:724 adams 17152:58488:6234:1067 all 13107:15563:2687:1127 2355:31871:2189:724 always 14243:42985:... Date Added: 2009-06-07 11:40:41 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 5732 Fall, 2009 Description: - 21342:56435:816:356 a 36635:45476:434:435 12050:55881:2348:1463 16824:42410:408:415 16390:37445:2067:1622 22236:42410:408:415 a-1931c 38524:54932:2578:375 ahead 29078:43419:3063:435 allis-chalmers 30686:51035:6765:613 an 38192:42410:1046:415 13862:... Date Added: 2009-06-07 11:40:56 |
| 02recaps.txt Path: Wisconsin >> BOWL >> 9900 Fall, 2009 Description: League Name : 1999 - 2000 SSEC League Bowl101w Ver 7.2.3 League President : Dave Allen League Secretary : Becky Schaffer Associ... Date Added: 2009-06-07 11:41:40 |
| assignment12extra.pdf Path: Denison >> CS >> 110 Fall, 2009 Description: Assignment 12 Extra Credit 20 points: Write a program that allows a user to play tic tac toe with the computer, rather than a second person. Allow the player to choose a square from the grid labeled 1 9: 1 4 7 2 5 8 3 6 9 To simulate a play for the... Date Added: 2009-06-07 11:42:34 |
| 5networks.ppt Path: Calvin >> CS >> 101 Fall, 2009 Description: \"If computers get too powerful, we can organize them into a committee that will do them in.\" - Bradley\'s Bromide Keith Vander Linden, 2000 Computer Networking The History of Computer Networks Types of Networks (sections 6.2-6.5) Network Applic... Date Added: 2009-06-07 11:42:55 |
| a07-345-f08.pdf Path: Midwestern State University >> ASTR >> 345 Fall, 2009 Description: Astr 345 Assignment 7 Due before midnight Fri, Oct 17, 2008 (full credit), before midnight Fri Oct 24, 2008 (half credit) 1. Hartmann, chapter 4, problem #1, 2, 3, and 5. Notes: some reading is required for problems 1, 2, and 3. You are not given the... Date Added: 2009-06-07 11:45:55 |
| Rat_PR2.pdf Path: Wisconsin >> BME >> 300 Fall, 2008 Description: Quad Rat Vitals Monitor Progress Report #2, September 18, 2008 Client: Dr. Alex Converse Team: Jack Ho (Leader) Kuya Takami (Communications) Nate Werbeckes (BWIG) Joseph Yuen (BSAC) September 12 to September 18, 2008 Problem Statement Design and cons... Date Added: 2009-06-07 11:47:02 |
| cgnotes.pdf Path: Maryland >> A >> 607 Fall, 2009 Description: ... Date Added: 2009-06-07 11:47:44 |
| linkage.da.txt Path: Purdue >> STAT >> 598 Fall, 2008 Description: # A function to plot the DS sequence of theta in the linkage example plot.daseq = function (it, theta,.) { # initialize when it = 0 if(it=0){ x <- 0:100 y <-c(theta, rep(NA, length(x)-1) plot(x, y, xlab=\"iterate\", ylab=expressi... Date Added: 2009-06-07 11:49:04 |
| ch19.ppt Path: Ashland >> PERSONAL >> 499 Fall, 2009 Description: Component-based software engineering Ian Sommerville 2004 Software Engineering, 7th edition. Chapter 19 Slide 1 Objectives q q q q To explain that CBSE is concerned with developing standardised components and composing these into applications... Date Added: 2009-06-07 11:50:52 |
| schedule.pdf Path: Berkeley >> IDS >> 270 Fall, 2009 Description: August 22, 2001 TO: FROM: SUBJECT: Interested Students and Faculty Oliver Williamson IDS 270 - Institutional Analysis Workshop (Fall 2000) The Institutional Analysis Workshop (IDS 270) will meet on Thursdays from 4:00-6:00 p.m. in Room C325 Cheit ... Date Added: 2009-06-07 11:52:32 |
| April4_rolston.pdf Path: Eckerd >> RE >> 351 Fall, 2009 Description: Terms Genotype Refers specifically to an organism\'s specific genetic make up as coded by their DNA which makes up their genes. Allele Any number of possible different codings of DNA for the same gene Phenotype Manifestation of a physical trait. Th... Date Added: 2009-06-07 11:53:28 |
| quiz2solution.pdf Path: Wisconsin >> ME >> 361 Fall, 2008 Description: ... Date Added: 2009-06-07 11:53:57 |
| GLCAM.pdf Path: Wabash >> DOCS >> 200809 Fall, 2009 Description: Tennis Match Results Oberlin College Men\'s Tennis vs Wabash College 4/11/2009 at Crawfordsville, IN (Collett Tennis Center) Wabash College 5, Oberlin College Men\'s Tennis 1 Singles competition 1. Jay Horrey (WABM) def. Ben Godlove (OBEM) 6-3, 6-4 2. ... Date Added: 2009-06-07 11:54:38 |
| lecture6.ppt Path: University of Illinois, Urbana Champaign >> ECE >> 390 Fall, 2008 Description: Lecture 6 Stack, Procedures and Macros Dr. Dimitrios S. Nikolopoulos CSL/UIUC Outline Stack organization PUSH and POP instructions Calling procedures Macros Programming guidelines The stack Space used as temporary storage during the execution... Date Added: 2009-06-07 11:54:46 |
| alternate-index.doc Path: NJIT >> CIS >> 365 Fall, 2009 Description: New Jersey Institute of Technology - College of Computing Sciences CIS365: File Structures and Management - Professors Bieber and Egan Alternate Indexes Process/Flow: alt. key -> alt. key index/data -> primary key -> primary key index/data -> request... Date Added: 2009-06-07 11:55:45 |
| Plsc100Ch12.pdf Path: Maryland >> PLSC >> 100 Fall, 2008 Description: Graham/Graham/Wilcox Plant Biology Second Edition Chapter 12: Plant Behavior Copyright 2006 Pearson Prentice Hall, Inc. Plants respond to external signals Effects of Light on Plants Photosynthesis Photomorphogenesis Photomorphogenesis Respon... Date Added: 2009-06-07 11:56:16 |
| Wed2008PretestingwexerciseCompatibilityMode.pdf Path: USF >> DCBD >> 5584 Fall, 2009 Description: 7/23/2008 Blueprint Development of Concepts/ Pretesting P t ti Materials At Each Stage Pretesting Concepts Partially completed materials Revised products Final products Pretesting Steps 1. 2. 3. 4. Determine objectives Plan methodology Pre... Date Added: 2009-06-07 11:57:58 |
| lecture4n5.doc Path: USF >> PPE >> 4004 Fall, 2008 Description: Dispositional Approach What are \"dispositions\"? Strong, stable patterns of thinking, feeling and behaving that help explain consistency within an individual and the differences between individuals. Approaches to Examining Dispositions: Type Approach... Date Added: 2009-06-07 11:58:15 |
| Nogales-Additional-Nov19.ppt Path: Berkeley >> MCB >> 110 Fall, 2008 Description: Microtubule Functions Transport of Material within the Cell Microtubules are the freeways along which motor proteins carrying vesicles/organelles move Cell Motility Structural elements in Cillia and Flagella Cell Division Form the Mitotic Spindle ... Date Added: 2009-06-07 11:58:23 |
| Calculating Drug Dosages Notes.doc Path: Purdue >> VM >> 204 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|22 Jan 2005 01:03:59 -0000 vti_extenderversion:SR|5.0.2.6738 vti_backlinkinfo:VX|depts/vettech/resources-vm204index.htm vti_author:SR|VCS61\\amasss vti_modifiedby:SR|VCS61\\amasss vti_timecreated:TR|22 Ja... Date Added: 2009-06-07 11:58:44 |
| Lec01--MultilevelMachines.ppt Path: Augustana SD >> FACULTY >> 235 Fall, 2009 Description: Computer Organization Introduction to Multilevel Machines Summary Programs L1 vs. L2 Languages Virtual Machines Hardware vs. Software Milestones in computer architecture Assignment Programs A sequence of simple instructions describing how ... Date Added: 2009-06-07 11:59:15 |
| exam3.pdf Path: Indiana State >> CARBON >> 105 Fall, 2009 Description: ... Date Added: 2009-06-07 12:00:26 |
| 04-Economics111.ppt Path: Wisc Eau Claire >> GEOGRAPHY >> 111 Fall, 2009 Description: Economic Geography Spatial organization and distribution of economic activity Outcome of financial AND governmental decisions Highly uneven at all scales Technology and access to resources shifts economic advantages Uneven Globally (GDP Per Capi... Date Added: 2009-06-07 12:03:59 |
| C454_ExamIII.pdf Path: Wisc Eau Claire >> CHEM >> 454 Fall, 2009 Description: Name _ Chem 454, Spring 2003 - Exam III 1. Draw the structure for a triacylglycerol formed from two stearic acids (18:0) and one palmitoleic acid (16:1 cis-D9). 2. Describe how fatty acids are transported from the gut to the adipose tissue and com... Date Added: 2009-06-07 12:04:42 |
| fig5_aps.pdf Path: Allan Hancock College >> BDB >> 112 Fall, 2009 Description: ... Date Added: 2009-06-07 12:05:56 |
| Roster03-04.pdf Path: Wisc Eau Claire >> MGOLF >> 0304 Fall, 2009 Description: University of Wisconsin-Eau Claire 2003-04 Mens Golf Roster (Updated 9/05/03) Name Brian Duren Andrew Dustan Brian Giese Mike Greer Tyler Leis Grant Lissick Mason Milner Aaron Olson Derek Pirkl Cole Stark Matt Taylor Mike Turner Peter Wendt Zach Ziem... Date Added: 2009-06-07 12:07:55 |
| lecture_1_small.pdf Path: Yale >> EE >> 913 Fall, 2009 Description: EE913a: Advanced Topics in Medical Imaging and Computer Vision Instructor: Office: Phone: email: Hemant D. Tagare BML-320 737-4271 hemant.tagare@yale.edu j.yang@yale.edu Teaching Assistant: (None) JIng Yang Course web page: http:/noodle.med.yale... Date Added: 2009-06-07 12:08:11 |
| herd041.txt Path: Iowa State >> ANS >> 352 Fall, 2009 Description: Herd: 41 CALF CROP SUMMARY Herd: 41 Calf Crop: 9 Calf Crop: 9 Est... Date Added: 2009-06-07 12:20:56 |
| Introduction.pdf Path: Iowa State >> HDFS >> 227 Fall, 2009 Description: Slide 1 Slide 2 Introduction: Adolescent Development Phases of Adolescence Early Adolescence Middle Adolescence Late Adolescence McGraw-Hill Copyright 2005 The McGraw-Hill Companies, Inc. All rights reserved. McGraw-Hill Copyright 2005 The M... Date Added: 2009-06-07 12:21:03 |
| Blue Chip.xls Path: Penn State >> NJS >> 5014 Fall, 2009 Description: Blue Chip Stock Club Investment alalysis Initial Date Price Stock Symbol Acquired Shares Per Share 3M MMM 6/12/2000 394 $79.75 Caterpillar CAT 3/15/2000 750 34.25 Coca-Cola KO 8/1/2000 975 58.75 DuPont DD 9/12/2001 850 33.13 General Electric GE 12/8/... Date Added: 2009-06-07 12:22:26 |
| week03a_presentation.ppt Path: Washington >> MAT >> 109 Fall, 2009 Description: MAT 109 Week 3: 1st Lecture Measures of Spread (3-3) Chapter 3: Statistics for Describing, Exploring span of the range\" (appropriate for discre... Date Added: 2009-06-07 12:25:04 |
| whatishistory.ppt Path: Skidmore >> HI >> 202 Fall, 2009 Description: What is history? History . is a form of discourse about the past emphasizes critical analysis and interpretation of the surviving traces of the past, though historians disagree violently about how to use the evidence usually is presented in prose... Date Added: 2009-06-07 12:36:13 |
| 0000_Endorsement_Guidelines.doc Path: Ohio State >> FOD >> 0000 Fall, 2009 Description: Feedback and Endorsement Guidelines Feedback Obtaining customer feedback during the execution of a project, not waiting until the closing of a project, is vital to the success of the project. One of the best ways to keep customers involved during the... Date Added: 2009-06-07 12:37:15 |
| syllabus_461_Spring_2009.pdf Path: Washington >> CHEM >> 461 Fall, 2008 Description: Chemistry 461 Physical Chemistry Laboratory Spring Quarter 2009 Syllabus Instructor: Prof. Philip Reid, preid@chem.washington.edu, Bagley 202B, 206-543-6147 Office hours: by appointment Teaching Assistants: Teresa Bixby, bixbyt@u.washington.edu, CHB ... Date Added: 2009-06-07 12:41:21 |
| LCP_FCP_F08a_T13_V3.1.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: LCP (Life Cycle Plan) Version 3.1 Life Cycle Plan (LCP) Acme Research Engine for USC WB Archives Team #13 Team Members John Morse Nikhil Mohan Aditya Auradkar Chinmay Joshi Nishit Chokhawala Kameron Lemmons Roles Project Manager / Requirements E... Date Added: 2009-06-07 12:42:23 |
| hw4.pdf Path: Valparaiso >> ECE >> 222 Fall, 2009 Description: ECE 222 Advanced Logic Design Homework Assignment #4 Due Date: March 24, 2004 Background Reading: Chapter 15 Assignment: 15-1 a,b,e,f 15-4 a 15-5 a,b 15-6 (simulate using mentor) 15-7 (For these three problems write one entity and 15-8 three architec... Date Added: 2009-06-07 12:43:23 |
| pex1.doc Path: CSU Northridge >> COMP >> 106 Fall, 2009 Description: College of Engineering and Computer Science Computer Science Department Computer Science 106 Computing in Engineering and Science Spring 2006 Class number: 11672 Instructor: Larry Caretto First Programming Exercise Objective This exercise provides ... Date Added: 2009-06-07 12:47:50 |
| psaapgmonsessions.pdf Path: CSU Northridge >> HCGEO >> 007 Fall, 2009 Description: 83rd Annual Pacific Section AAPG - SEPM - SEG Convention: Technical Session Sumary - Monday May 4, 2009 MONDAY SALON I SALON III PUERTO ESCONDIDO Sustainable Water Resource Exploration and Development: A Return to Local Supply Sterling, J. L., and K... Date Added: 2009-06-07 12:51:19 |
| Assignment #2 TD circuits.pdf Path: Portland >> ECE >> 417 Fall, 2009 Description: ECE 417/517 Nanoelectronics Spring 2007 Problem Assignment #2 (due Wed lecture 5/9/07) For each problem below, unless otherwise indicated, assume (Esaki) tunnel diodes with I-V characteristics through the points: (0mA, 0V), peak (10mA, 50mV), forward... Date Added: 2009-06-07 12:52:01 |
| slo2.pdf Path: CSU Northridge >> RJP >> 79535 Fall, 2009 Description: Student Learning Objective 2 Theoretical Understanding Name of the Artifact Literature Review Description of the Artifact The artifact I chose for SLO 2 is the literature review assignment I did for SED 600 Research Methods. This assignment togeth... Date Added: 2009-06-07 12:52:04 |
| alex_pres.pdf Path: UCSC >> CMPS >> 290 Fall, 2009 Description: An Improved* Method for Multi View Rotation Invariant Face Detection Alex Yakushev *Theoretical estimation. New method may not actually be any better. Original Idea Due To Huang et. al. Construct a tree of possible face orientations At each nod... Date Added: 2009-06-07 12:52:30 |
| slide10.pdf Path: Texas A&M >> CS >> 420 Fall, 2009 Description: Overview Distributed representation for natural language and analogy. Pentti Kanerva. Dual role of analogy in the design of a cognitive computer. In K. Holyoak, D. Gentner, and B. Kokinov, editors, Advances in Analogy Research: Integration of Theor... Date Added: 2009-06-07 12:53:57 |
| test2sol.pdf Path: Maryland >> MATH >> 410 Fall, 2008 Description: Friday, April 17, 2009 Midterm 2 Advanced Calculus I MATH 410 Section 0201 This test has 7 question(s) on 3 page, for a total of 100 points. 10 P. 1. State each of the following: (a) First Fundamental Theorem of Calculus (b) Cauchy Mean Value Theo... Date Added: 2009-06-07 12:55:00 |
| lec32.pdf Path: Wisc La Crosse >> PHY >> 343 Fall, 2009 Description: PHY 343 - Lecture 32 As important as engine cycles are, we also need to consider their counterparts, refrigerators. We will discuss two types of refrigeration cycle; gas and vapor. Let\'s start with gas cycles. Basically, we will reverse the Brayton e... Date Added: 2009-06-07 12:55:01 |
| exam2.ps Path: Washington University in St. Louis >> CS >> 241 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: exam2.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o exam2.ps exam2.dvi %DVIPSParameters: dpi=300, compressed... Date Added: 2009-06-07 13:01:23 |
| lecture13.pdf Path: Wisc Whitewater >> ECON >> 202 Fall, 2008 Description: Economics 202 Big Concepts Fiscal Policy y Effects of Fiscal Policy on Economy Multipliers p Monetary Policy Effects of Monetary Policy on Economy Demand/Supply of Money Short Run vs. Long Run Effects: Crowding Out Note: These lecture notes a... Date Added: 2009-06-07 13:07:37 |
| asgn13.pdf Path: MTSU >> CSCI >> 3160 Spring, 2008 Description: Exercises 6.5 1. (b) 2. (b) (c) Using the macro definition for add2 given in Figure 6.27, show the sequence of statements to which each of the following macro calls expands. add2 ecx, edx Using the macro definition for swap given in Figure 6.28, show... Date Added: 2009-06-07 13:08:35 |
| syllabus.pdf Path: Washington >> MENGR >> 531 Fall, 2009 Description: ME 531: Conductive Heat Transfer Autumn 2007 Instructor: Ann Mescher Mechanical Engineering Building, Room 324 mescher@u.washington.edu, 616-8517 By appointment, homework solutions on reserve in the Eng. Library. Tuesday, Thursday: 8:30 9:50 am; MEB... Date Added: 2009-06-07 13:10:49 |
| quiz4_solutions.pdf Path: Washington >> M >> 307 Fall, 2009 Description: Math 307 I Quiz 4 - Solutions Monday, October 29, 2007 1. (1 pt. each) True or False (circle one) Suppose we have a linear homogeneous second order differential equation y + p(t)y + q(t)y = 0. a. T F ( ) If y1 and y2 are two solutions of ( ) and ... Date Added: 2009-06-07 13:10:56 |
| ME123 Project Rubric.pdf Path: Rose-Hulman >> ME >> 123 Fall, 2009 Description: ROSE-HULMAN INSTITUTE OF TECHNOLOGY Department of Mechanical Engineering ME123 CompApps I Project Grading Competition Results (20 pts) Teams\' totals for speed and accuracy are ranked within a section. (See the \"Competition Rules\" for how speed and a... Date Added: 2009-06-07 13:12:09 |
| inits2.txt Path: Carnegie Mellon >> WEEK >> 724 Fall, 2009 Description: list(mu.b=-9.67710E-01, tau.b=6.36210E+00) ... Date Added: 2009-06-07 13:12:30 |
| 050809-band-jump.pdf Path: NYU >> LMF >> 247 Fall, 2009 Description: `You\'re out there sweating, bleeding, pushing yourself past the point where you should every day.\' Jessica Clements, mellophone player Drum corps prepare for battle DRUM CORPS Continued from Page B1 best of the best.\' Many of the teams have their ... Date Added: 2009-06-07 13:12:54 |
| schedule.txt Path: Old Dominion >> CS >> 895 Fall, 2008 Description: LGA,OMA,6:19,8:13,239 OMA,LGA,6:11,8:31,249 LGA,OMA,8:04,10:59,136 OMA,LGA,7:39,10:24,219 LGA,OMA,9:31,11:43,210 OMA,LGA,9:15,12:03,99 LGA,OMA,11:07,13:24,171 OMA,LGA,11:08,13:07,175 LGA,OMA,12:31,14:02,234 OMA,LGA,12:18,14:56,172 LGA,OMA,14:05,15:47... Date Added: 2009-06-07 13:15:36 |
| 1Topics.pdf Path: Winona >> EL >> 670 Fall, 2009 Description: Master\'s Specialist Perceived Effectiveness of Leadership Styles Research Topics Leadership Style and its Effect on Change The Effects of Standards and Standardized Testing on Student Learning State and Local Response to the No Child Left Behind... Date Added: 2009-06-07 13:17:23 |
| Sampling.ppt Path: Winona >> BUS >> 220 Fall, 2009 Description: Sampling Methods and the Central Limit Theorem Chapter 8 McGraw-Hill/Irwin The McGraw-Hill Companies, Inc. 2008 GOALS Explain why a sample is the only feasible way to learn about a population. Describe methods to select a sample. Define and c... Date Added: 2009-06-07 13:17:37 |
| lab3.pdf Path: New Mexico >> ECE >> 338 Fall, 2008 Description: Fall 2006 ECE338: Lab 3 Computer Design Basics Due back: October 23rd, 2006 in class Instructions For the solutions of the next three (3) problems, you should follow the next steps: State the design specifications. Derive a primitive flow table. Red... Date Added: 2009-06-07 13:21:50 |
| StudyQuestion-Final.pdf Path: Arizona >> BIOC >> 471 Fall, 2008 Description: Bioc 471/571 - Applied Molecular Genetics Fall 2000 - Dr. Roger Miesfeld Lecture Note Study Questions for Final Exam 1. What parameter would you change first if your PCR reaction gave too many products? What would you do if the PCR reaction gave very... Date Added: 2009-06-07 13:23:05 |
| Review Problem 4 solution.pdf Path: Lehigh >> INME >> 242 Fall, 2009 Description: 4. What is the response of x to a unit impulse in u ( t ) ? (This is the impulse response, g ( t ) .) This solution can and should be found in two alternative ways, by taking the inverse Laplace transform of G ( s ) and by taking the time derivative ... Date Added: 2009-06-07 13:23:16 |
| lukoit.ppt Path: W. Florida >> CEN >> 4721 Fall, 2008 Description: Northwest Florida regional airport (VPS) http:/flyvps.com/ Aleksandras Lukoit Un-needed space Mixed content. Some text Is a link, some text does nothing. Annoying advertisement Link doesn\'t work Overall design was good but a few areas need improve... Date Added: 2009-06-07 13:24:28 |
| 14.pdf Path: W. Florida >> EVR >> 6930 Fall, 2008 Description: Land use change modelling: current practice and research priorities Peter H. Verburga,b, Paul Schota, Martin Dijsta, A. Veldkampb of Geographical Sciences, Utrecht University, Heidelberglaan 2, Postbus 80.115, 3508 TC Utrecht, The Netherlands; e-mai... Date Added: 2009-06-07 13:26:56 |
| Formula-sheet-exam-4.pdf Path: Maryland >> PHYS >> 272 Fall, 2008 Description: Formula sheet #4 - Phys 272 1 1 1 + = s s f m=- s s I = I 0 cos 2 2 2 = kr , k = r = d sin a sin = n ... Date Added: 2009-06-07 13:27:58 |
| assignment10_key.txt Path: Texas >> CS >> 352 Spring, 2002 Description: ASSIGNMENT 10 - SOLUTION KEY DUE: 04 May 2009 WEIGHT: 30 points - /* Any reasonable interpretation was accepted so long as pipeline * description was accurate given the interpretation */ (1a) - 2 pts ASSUME: (1) 15 minutes pre-bake ... Date Added: 2009-06-07 13:28:52 |
| CSD-88-452.pdf Path: Berkeley >> EECS >> 1988 Fall, 2008 Description: ... Date Added: 2009-06-07 13:42:24 |
| IntroductiontotheFMM.pdf Path: Maryland >> CMSC >> 828 Fall, 2005 Description: Introduction to the FMM Nail A. Gumerov (Lecture for CMSC 828E) Outline About the FMM Fast Matrix-Vector Multiplication Key Ideas Factorization/Expansions Sparse+Dense Low Rank Decomposition (Space partitioning) Translations Single level FMM... Date Added: 2009-06-07 13:50:27 |
| COMS3302-Ch3.doc Path: UT Arlington >> COMS >> 3302 Fall, 2008 Description: COMS 33023Putnam Communicating Interculturally Chapter 3 Intercultural Communication-different interpretation is the key-between verbal and nonverbal signals. The trends are (a) global markets and (b) diversified/ multicultural work force. Marshal... Date Added: 2009-06-07 13:52:44 |
| 103_01High.pdf Path: Rochester >> V >> 103 Fall, 2009 Description: HigH Density anD HigH tR Fuel assembly FoR Fast-ignition ineRtial ConFinement Fusion High Density and High tR Fuel Assembly for Fast-Ignition Inertial Confinement Fusion Introduction In direct-drive inertial confinement fusion,1 a cryogenic shell of... Date Added: 2009-06-07 13:53:44 |
| HMKModule2Week1.doc Path: U. Houston >> DSCI >> 5031 Fall, 2009 Description: HOMEWORK SOLUTIONS TO CHAPTER 7: MODULE 2: WEEK 1 DSCI 5031 7.21 = 50.4 = 11.8 n = 42 a) Prob( X > 52): Z = X - 52 - 50.4 = = 0.88 11.8 n 42 from Table A.5, the area for Z = 0.88 is .3106 Prob( X > 52) = .5000 - .3106 = .1894 b) Prob( X < 47... Date Added: 2009-06-07 13:54:01 |
| 1111-small.pdf Path: Trinity U >> CS >> 4320 Fall, 2009 Description: CSCI 4320 November 11, 2003 CSCI 4320 November 11, 2003 Administrivia Homework 4 due at 5pm today. Magnetic disks: Disks - Hardware Cylinder/head/sector addressing may or may not reflect physical geometry - controller should handle this. Co... Date Added: 2009-06-07 13:59:29 |
| lec17.pdf Path: UC Davis >> ECS >> 010 Fall, 2008 Description: ECS 10, Basic Concepts of Computing Spring Quarter 2009 Outline for May 8, 2009 Reading: text, 9.19.3 1. Overview of top-down design a. Sometimes called \"stepwise refinement\" b. Break problem into smaller pieces, plus the \"glue\" to hold them togeth... Date Added: 2009-06-07 13:59:49 |
| T0412.pdb_blast.txt Path: UCSC >> T >> 0412 Fall, 2009 Description: # BLASTP 2.2.17 [Aug-26-2007] # Query: T0412 # Database: /projects/compbio/data/pdb/dunbrack-pdbaa # Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score T0412 1... Date Added: 2009-06-07 14:03:16 |
| refunding_and_paper.doc Path: East Los Angeles College >> CHEM >> 0111 Fall, 2009 Description: 1) Travel fee refunding: Please send your original travel tickets / petrol receipts, with your name / other names in your car on the back, and state the starting journey place, to the Treasurer at below address arriving by latest on 10 October 2005. ... Date Added: 2009-06-07 14:11:16 |
| plssc031203rep.pdf Path: East Los Angeles College >> USERS >> 031203 Fall, 2009 Description: Joint LES/MPS Committee on Library Policy in the Sciences PLANT SCIENCES LIBRARY SUB-COMMITTEE Librarian\'s Report December 2003 Roger Mills Activities since the last meeting include: 1. Building Refurbishment of the basement rare books stack will b... Date Added: 2009-06-07 14:15:15 |
| ME123%20Project%20Rubric.pdf Path: Rose-Hulman >> ME >> 123 Fall, 2009 Description: ROSE-HULMAN INSTITUTE OF TECHNOLOGY Department of Mechanical Engineering ME123 CompApps I Project Grading Competition Results (20 pts) Teams\' totals for speed and accuracy are ranked within a section. (See the \"Competition Rules\" for how speed and a... Date Added: 2009-06-07 14:15:47 |
| manifest.txt Path: Duke >> X >> 108 Fall, 2009 Description: Main-Class: PuzzleApp ... Date Added: 2009-06-07 14:16:12 |
| problemset11.pdf Path: Texas >> EE >> 362 Fall, 2008 Description: The University of Texas at Austin Department of Electrical and Computer Engineering EE362K: Introduction to Automatic ControlSpring 2009 Problem Set Eleven C. Caramanis Due: Wednesday, May 6 2009. This problem set is intended to help in studying for... Date Added: 2009-06-07 14:27:02 |
| (2)ch1_Title_text.pdf Path: Caltech >> ETD >> 05112004 Fall, 2009 Description: Chapter 1 Introduction to DNA Recognition By Minor Groove-Binding Polyamides 2 Background and Significance The complete set of biochemical instructions required for the sustenance of life is contained within the genomes of all known organisms.1 The ... Date Added: 2009-06-07 14:27:16 |
| NetBeans3.6 Guide.pdf Path: East Los Angeles College >> CS >> 256 Fall, 2009 Description: Using NetBeans TM IDE 3.6 Feedback Your Guide to Getting Work Done in NetBeans IDE Welcome to the Using NetBeans IDE 3.6 guide. This guide is designed to give you a more detailed introduction to the IDE than available in the Getting Started tutori... Date Added: 2009-06-07 14:27:32 |
| FM_PS01a.doc Path: UNC >> ECON >> 423 Fall, 2009 Description: _ Professor Byrns ECO 423: Financial Markets Problem Set 1 Show relevant calculations in an attached Excel spreadsheet. PRINT Name The Power of Compounding [Use Excel] Apocryphal story: A medieval king, grateful for wise counsel, asked his top advis... Date Added: 2009-06-07 14:27:41 |
| 1969rcs0-274.pdf Path: Neumont >> CSC >> 1968 Fall, 2009 Description: 274 R.C.S COUR SUPREME DU CANADA 1968 CAUSEWAY SHOPPING CENTRE LTD Plaintiff AND APPELLANT THOMAS MUISE Defendant SUPREME COURT RESPONDENT OF NOVA SCOTIA ON APPEAL FROM THE APPEAL DIVISION ContractsPurported lease signed by partiesDefenda... Date Added: 2009-06-07 14:27:53 |
| groupExerciseJan30.txt Path: UNI >> FACULTY >> 053 Fall, 2009 Description: /* * Written by: Mark Jacobson on January 30th, 2002 1:30 p.m. * * Purpose: To practice techniques related to the List * * class assignment #2. * * ... Date Added: 2009-06-07 14:28:46 |
| CR.txt Path: San Diego State >> STA >> 350 Fall, 2009 Description: CR design - Ex. 8.12 (p. 417) a) stack data Data > Stack > Stack Columns. Stack the following columns: Group-I Group-II Group-III Group-IV Choose \"Column of current worksheet:\" C5 Store subscripts in: C6 Click OK You may rename C5 as discoloration ... Date Added: 2009-06-07 14:35:45 |
| dfield.pdf Path: Virginia Tech >> MATH >> 2214 Fall, 2008 Description: y 4 2 0 t -2 -4 0 0.5 1 1.5 2 4 3 2 1 0.25 0.5 0.75 1 1.25 1.5 1.75 2 -1 -2 -3 -4 ... Date Added: 2009-06-07 14:37:24 |
| P04-06.pdf Path: UGA >> PHYS >> 1112 Fall, 2008 Description: P04.06 Two charges on square; force on 3rd Two point charges q1 and q2 are fixed to opposite corners of a square. (a) If q1 = q2 , where will a third point charge experience the greater force? (b) If q1 = -q2 instead, where will a third point charge ... Date Added: 2009-06-07 14:38:33 |
| mhd_chap3.pdf Path: East Los Angeles College >> MATH >> 3456 Fall, 2009 Description: ... Date Added: 2009-06-07 14:40:57 |
| hwk6b_sp07.pdf Path: U. Houston >> ECE >> 5318 Fall, 2008 Description: ECE 5318/6352 Homework Chapter 6b Balanis, Chapter 6 Problems: 22, 23, 28, 29, 32, 33, 34, 39 Note: Skip any portions that ask you to confirm the results using the computer program. ... Date Added: 2009-06-07 14:43:11 |
| NJ.pdf Path: Harvard >> CSCIE >> 20061114 Fall, 2009 Description: United States 109th Congress, Page 1 of 1 United States 109th Congress New Jersey Official Name Andrews, Robert E. Ferguson, Mike Frelinghuysen, Rodney P. Garrett, Scott Holt, Rush D. LoBiondo, Frank A. Menendez, Robert Pallone, Frank Jr. Pascrell, ... Date Added: 2009-06-07 14:43:28 |
| ENGL102ALL.TXT Path: Sveriges lantbruksuniversitet >> ENGL >> 20031 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 102-3 ALL SECTIONS LOCATION: SFU TITLE: INTRO TO POETRY SECTION TYPE: SEC SEMESTER: 2003-1 ENROL: 206 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not... Date Added: 2009-06-07 14:44:54 |
| induction-problems.pdf Path: CSU Channel Islands >> MATH >> 145 Fall, 2009 Description: | l v p h p v d t de hg d ixepsssi5ysHqsxsyrsxs8fwuewwwre(c rhy6fHqi dh pe s 6yt o Hyhrrdqyp6 j 8 rrds6srqiiyfHrhs6srqx6 ph p d d h p te p d ph| h p | o z o `ytvh z &iqo ww w w h sqkt`sih z xprhssfrhHq2x o wh ... Date Added: 2009-06-07 14:58:11 |
| 10206SSyllabus.pdf Path: Wash & Jeff >> ECN >> 102 Fall, 2009 Description: ECN 102, Principles of Macroeconomics Spring, 2006 MWF Section 02: 9:15-10:20, BUR 311 MWF Section 03: 10:30-11:35, BUR 311 Web Address: www.washjeff.edu/users/kswint; Spring 06 Mail List addresses: ECN10201-L@washjeff.edu & ECN10202-L@washjeff.edu I... Date Added: 2009-06-07 14:59:23 |
| 0203exeptions.pdf Path: University of Louisiana at Lafayette >> CACS >> 360 Fall, 2009 Description: Exceptions (2005.01.13) Exceptions 2 Exceptions change the flow of control when an error or other important event occurs may handle in method that caused exception, may handle outside of method causing exception unhandled exception halts progra... Date Added: 2009-06-07 15:01:42 |
| 02a_objectorientation.pdf Path: University of Louisiana at Lafayette >> CACS >> 360 Fall, 2009 Description: Reviewof ObjectOrientation (2005.12.22) ObjectOrientation 2 ObjectOrientation Abstraction Encapsulation InformationHiding Inheritance Polymorphism ObjectOrientation 3 Abstraction representingthetheessentialpropertiesofareal worldobject(concepto... Date Added: 2009-06-07 15:01:59 |
| MakeUpHW.doc Path: Johns Hopkins >> HW >> 102 Fall, 2009 Description: May 6, 2009 Make Up Homework Language and Mind Due: NOON Wednesday, May 13, 2009 You may submit a hard copy to Deepti or submit via email this time: chenmain@cogsci.jhu.edu and ramadoss@cogsci.jhu.edu Q1. Reranking Constraints Recall our example tabl... Date Added: 2009-06-07 15:06:46 |
| syllabus_f08.pdf Path: UCSB >> GEOG >> 210 Fall, 2009 Description: Geography 210a Prof: David Siegel Analytical Methods in Geography Phone: x4547 Office: Ellison 6844 Email: davey@icess.ucsb.edu Office Hours: W 12:00 & Th 12:00 Website: www.icess.ucsb.edu/~davey/Geog210a Lecture: M-W-F 11:00 11:50 Ellison 262... Date Added: 2009-06-07 15:07:54 |
| 13-Cache.1p.pdf Path: UCSC >> CMPE >> 110 Winter, 2008 Description: Rel. speed: 1 registers MEMORY ADDRESS 1-2 on-chip cache data not in registers data is it here? N 2-5 off-chip cache is it here? N 10-20 main memory: real... Date Added: 2009-06-07 15:12:12 |
| stream-2.pdf Path: Duke >> X >> 196 Fall, 2009 Description: Exploiting k-Constraints to Reduce Memory Overhead in Continuous Queries over Data Streams Presented by Pallavi N. Pratapa 12-01-2003 OVERVIEW Lets start with an example Understanding the challenges involved How do they exploit the stream properties... Date Added: 2009-06-07 15:14:13 |
| 925.pdf Path: Acton School of Business >> POLI >> 502 Fall, 2009 Description: Assignment Due 9/25 Computer Assignment: Data for this assignment can be accessed through the course webpage. Download the file and input the data into Datadesk. 1. Determine the level of measurement for each of these variables from the gss96worth fi... Date Added: 2009-06-07 15:16:58 |
| ex3738.pdf Path: Berkeley >> CEE >> 120 Fall, 2009 Description: ... Date Added: 2009-06-07 15:17:39 |
| lab_sonar_04.pdf Path: Johns Hopkins >> ME >> 530420 Fall, 2009 Description: M.E. 530.420 Lab 6: Sonar Time of Flight Ranging with the Polaroid 600/6500 Ultrasonic Ranging System Louis L. Whitcomb Department of Mechanical Engineering G.W.C. Whiting School of Engineering The Johns Hopkins University office: 123 Latrobe Hall, p... Date Added: 2009-06-07 15:27:43 |
| hand21.txt Path: Cincinnati >> STAT >> 615 Fall, 2009 Description: LINEAR MODELS III HANDOUT #21 This handout will illustrate the multivariate 2-sample t-test and other tests. DATA MULTIVARIATE; DO PERSON=1 TO 8; DO DRUG=1 TO 3; IN... Date Added: 2009-06-07 15:27:49 |
| Paper11.ppt Path: Alabama Huntsville >> CS >> 585 Fall, 2008 Description: Understanding Android Security Yinshu Wu William Enck, Machigar Ongtang, and PatrickMcDaniel Pennsylvania State University Outline I. II. III. IV. V. Introduction Android Applications Security Enforcement Security Refinements Lessons in Defining P... Date Added: 2009-06-07 15:30:51 |
| lect04.ppt Path: Duke >> X >> 001 Fall, 2009 Description: Today\'s topics q Performance & Computer Architecture Notes from David A. Patterson and John L. Hennessy, Computer Organization and Design: The Hardware/Software Interface, Morgan Kaufmann, 1997. http:/computer.howstuffworks.com/pc.htm Slides fro... Date Added: 2009-06-07 15:36:28 |
| DayByDay.pdf Path: MSOE >> EE >> 2060 Fall, 2009 Description: EE-2060 - Linear Circuits: Steady-State Analysis II based on Dr. Reyer 10/26/08 FUNDAMENTALS OF ELECTRIC CIRCUITS, Alexander & Sadiku, McGraw-Hill, 3rd ed. Week/Day 1 / 1 2 3 2 / 1 2 3 3 / 1 2 3 4 / 1 2 3 5 / 1 2 3 6 / 1 2 3 7 / 1 2 3 8 / 1 2 3 9 /... Date Added: 2009-06-07 15:39:13 |
| 320-final.ppt Path: Princeton >> COS >> 320 Spring, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|01 May 2003 16:49:13 -0000 vti_title:SR|CS 320 Final Exam Details vti_syncwith_localhost\\x\\:\\courses\\archive\\spring03\\cs320/x\\:/courses/archive/ spring03/cs320:TR|01 May 2003 16:49:13 -0000 vti_author:S... Date Added: 2009-06-07 15:43:23 |
| syllabus_chem457.pdf Path: Washington >> CHEM >> 457 Fall, 2008 Description: Chemistry 457 Winter Quarter 2002, Xia, Revised CHEM 457. PHYSICAL CHEMISTRY Instructor Teaching Assistant Professor Younan Xia Bagley 202A&B xia@chem.washington.edu Office Hours: Th (11:30 - 12:30, Bagley 202A), or by e-mail appointment Eric Heatw... Date Added: 2009-06-07 15:45:16 |
| Thermal_conductivity_Resistivity.pdf Path: Air Force Academy >> ME >> 492 Fall, 2009 Description: ... Date Added: 2009-06-07 15:46:07 |
| HistoryMemory97zAHRintro.pdf Path: UCSB >> HIST >> 201 Fall, 2009 Description: ... Date Added: 2009-06-07 15:51:34 |
| Thematic Resources.doc Path: North Texas >> COURSEWEB >> 4100009 Spring, 2009 Description: Soniya Judhani CECS 4100.009 March 01, 2007 Thematic Resources 1. Internet Website- http:/passporttoknowledge.com/sun/ This website mainly deals with the Sun. It has lots of information as the sun as a star, the history of the sun, and the sun-earth... Date Added: 2009-06-07 16:03:40 |
| quiz8.pdf Path: UF >> COT >> 1096 Fall, 2009 Description: COT3100 - Fall 2001 Quiz VII 10/19/01 Name: Period: Group#: (10) I. Given the following function to calculate factorial of a number, trace the stack for the function call fact(2). Function fact(x) { if (n=0) then fact = 1 else { x = x-1 y = fact(x... Date Added: 2009-06-07 16:04:12 |
| Phase-diagrams-note-1.doc Path: Air Force Academy >> ME >> 324 Fall, 2009 Description: Phase Diagrams (See Callister Chapter 9) Issues to address: 1. When we combine two elements. what equilibrium state do we get? 2. In particular, if we specify. -a composition (e.g., wt% Cu - wt% Ni), and -a temperature (T ) then. How many phases do w... Date Added: 2009-06-07 16:04:45 |
| ESP_flowdata_COLO.txt Path: Washington >> FCST >> 040105 Fall, 2009 Description: Monthly Average ESP Streamflows (cfs) for start date: 20050301 Format: columns are sequential months starting with: 3-2005 (note, 3-2005 is first full forecast month) rows, for each location, are ordered by fcst. met. years, 1960-1999 ... Date Added: 2009-06-07 16:05:46 |
| Syllabus_for_Spanish_320_2007_Fall.pdf Path: New Mexico Junior College >> SPAN >> 320 Fall, 2009 Description: Syllabus for Spanish 320: Culture and Civilization of Spain Jamestown College 3 semester credits Fall 2007 Time: 1:00 1:50 p.m., MWF Class Room: Lyngstad 110 Office: Lyngstad 211-A Office hours: MWF 8-8:50, 11-12:50; T1-1:50 Cecil J. Roth, Jr. Assoc... Date Added: 2009-06-07 16:09:58 |
| LectureICOM6115Aug18_06v1.ppt Path: UPR Mayagüez >> ICOM >> 5047 Fall, 2009 Description: ICOM 6115: COMPUTER SYSTEMS PERFORMANCE MEASUREMENT AND EVALUATION Nayda G. Santiago August 18, 2006 Administrative Stuff Quiz 1 August 23, 2006, Wednesday WebCT if activated Article: Designing computer architecture research workloads Cesa... Date Added: 2009-06-07 16:10:03 |
| note05-10-05.pdf Path: UCSC >> EE >> 070 Fall, 2009 Description: ... Date Added: 2009-06-07 16:13:58 |
| primerMatlab40.pdf Path: Maryland >> BSCI >> 474 Fall, 2008 Description: Matlab Primer Third Edition Kermit Sigmon Department of Mathematics University of Florida Department of Mathematics University of Florida Gainesville, FL 32611 sigmon@math.ufl.edu Copyright c 1989, 1992, 1993 by Kermit Sigmon On the Third Edition T... Date Added: 2009-06-07 16:19:32 |
| target.txt Path: Washington >> HW >> 373 Fall, 2009 Description: 1.963970 2.576874 1.473351 1.966547 1.475766 1.399610 2.385552 1.759638 1.680822 2.128688 1.447944 1.753472 1.733028 1.542140 1.894154 1.438119 1.832113 1.818849 1.051960 1.741839 1.976922 1.910955 2.164172 1.217985 1.260451 1.593694 2.041874 0.85215... Date Added: 2009-06-07 16:22:43 |
| Bus189_Greensheet_Summer_2009.pdf Path: San Jose State >> BUS >> 189 Fall, 2009 Description: Bus189: Strategic Management 2009 Summer Session 6/1-7/8 MW: 18:00-21:30 Dr. William Y. Jiang (Office: BT650) Classroom: BBC320; Office Hours: MW 16:00-17:00 and by appointment Phone: 924-3551; Fax: 924-3555; Email: jiang_w@cob.sjsu.edu Course Overvi... Date Added: 2009-06-07 16:23:39 |
| hw9.soln.pdf Path: San Jose State >> MATH >> 213 Fall, 2008 Description: MATH 213, SPRING 2009 HOMEWORK 9 SOLUTIONS Chapter IV, ex. 4.4: () Suppose F (X) = Y . Let p M be arbitrary but xed and set q = F (p). Dene a curve on N by (t) = F (t (p). Then (0) = F (p) = q and since d dt t (p) = X(t (p), we have (t) = F (X(t... Date Added: 2009-06-07 16:24:17 |
| the-making-of-Bonsaimarks.txt Path: Utah >> DP >> 2623 Fall, 2009 Description: also known as, the making of http:/www.cc.utah.edu/~dp2623/Bonsaimarks.html Netscape provides some nice methods for making hierarchical bookmarks, and I encourage you to practice with em, if your Bookmarks menu drools off the bottom of the screen. ... Date Added: 2009-06-07 16:27:47 |
| 020999.pdf Path: UPenn >> V >> 990209 Fall, 2009 Description: UNIVERSITY of PENNSYLVANIA Tuesday, February 9, 1999 Volume 45 Number 20 Converting the Former G.E. Building The University has entered into an agreement with Dranoff Properties to convert the former General Electric Building at 31st and Chestnut st... Date Added: 2009-06-07 16:28:24 |
| 05MoreCountdownSp05.pdf Path: Utah >> KLM >> 3730 Fall, 2009 Description: #04b More Countdown Leader & 5 f/xs Symphony http:/www.cc.utah.edu/~klm6/3730/05MoreCountdownSP05.html Beginning Video 3730 Spring 2005 Assignment #4b More Countdown John Cage from Silence (1979, 60 minutes) by Joan Logue Superimposition\'s and ... Date Added: 2009-06-07 16:29:48 |
| test4_sol.pdf Path: Utah >> MATH >> 2270 Summer, 2008 Description: Math 2270-1 Midterm 4, April 24, 2009 Solutions Problem 1 (25 points). Calculate 1 0 A= 0 the inverse A-1 of the matrix 0 2 0 1 1 0 (using the formula involving classical adjoint!). Solution: By Sarrus rule we have The classical adjoint is det... Date Added: 2009-06-07 16:33:23 |
| hw6.pdf Path: Utah >> CS >> 5960 Fall, 2008 Description: CS5960: Nonparametric Methods Due Wed. 4/8 Homework 6: Hypothesis Testing Instructions: Be sure to electronically submit your answers in pdf format for the written part and as an R file for the coding part. You may work together and discuss the pro... Date Added: 2009-06-07 16:35:23 |
| ps3.txt Path: Utah >> CS >> 4150 Spring, 2008 Description: Problem One. (66 points) Graded by Michael Freedman (a) [8 points] 2 points per part (b) [9 points] 3 points per part (c) [12 points] 4 points for part (a) bound 4 points for part (b) algorithm 4 points for part... Date Added: 2009-06-07 16:38:38 |
| week6_09.pdf Path: UCSD >> ECE >> 107 Fall, 2008 Description: ECE 107: Electromagnetism Set 6: Magnetostatics Instructor: Prof. Eric Fullerton Department of Electrical and Computer Engineering University of California, San Diego, CA 92093 Equations of magnetostatics Magnetostatics t = = 0 two uncoupled... Date Added: 2009-06-07 16:46:32 |
| q_ber_c1365.pdf Path: Hamline >> SAVE >> 110207 Fall, 2009 Description: GREAT BERKHAMSTEAD), HERTFORDSHIRE Man in armor M.S. II London: \"B\" series St. Peter Q ber cl365 Effigy of a man in amor, cl365, inscription lost. Relaid and now mural in the nave on the pillar of St. John\'s chapel. Though small, just 29 3/4\" (75.6... Date Added: 2009-06-07 16:57:55 |
| 10700183.pdf Path: Nevada >> PUB >> 1070 Fall, 2009 Description: ... Date Added: 2009-06-07 16:58:14 |
| planthormones.pdf Path: Bryn Mawr >> BIO >> 102 Fall, 2009 Description: Plant hormones and defense 1. 2. 3. 4. 5. 6. fig 39.1 phototropism fig 39.2 experiments on phototropism picture of gibberellin-induced giant cabbages fig 39.12 statoliths trichomes milkweed herbivores ... Date Added: 2009-06-07 16:59:28 |
| BIOCHEM_LECT30.ppt Path: Wyoming >> MOLB >> 4610 Fall, 2009 Description: General Biochemistry II MOLB4610/5610 Lecture 30 Eucaryotic mRNA transcription (Lehninger pg. 979 - 990) Today\'s lecture Eucaryotic transcription RNA synthesis inhibitors RNA polymerase II Basal transcription factors Transcription initiatio... Date Added: 2009-06-07 17:02:26 |
| cpa6_soc301.doc Path: Wake Forest >> CPAS >> 301 Fall, 2009 Description: 1David Yamane Sociology 301/Religion 351 Course Preparation Assignment #6 RELIGIOUS DIVERSITY IN AMERICA Introduction: The United States is one of the most religiously diverse countries in the world, with significant numbers of Jews, Muslims, Hindus,... Date Added: 2009-06-07 17:04:32 |
| 20051118_r01c_04826.pdf Path: Stanford >> MERX >> 1031 Fall, 2009 Description: Gary M . Berne, OSB No . 77407 Email : berne ssbls.com David F. Rees, OSB No. 94513 Email: drees@ssbls .com Mark A . Friel, OSB No . 00259 Email : mfriel@ssbls .com STOLL STOLL BERNE LOKTING & SHLACHTER P .C. 209 S .W. Oak Street, Fifth Floo r Portla... Date Added: 2009-06-07 17:08:15 |
| causewaylogical.ppt Path: IUPUI >> A >> 337 Fall, 2009 Description: Mailroom 1. Recieves checks and remittance advices 2. Endorses checks 3. Annotates R/As 1 2 3 4 5 6 7 8 17 13 14 15 16 11 12 18 19 9 10 4. Prepares batch total 5. Sends batch of R/As to A/R 6. Sends batch of checks to cashier Accounts Receivable 1. E... Date Added: 2009-06-07 17:13:12 |
| child.c.txt Path: Minnesota >> CSCI >> 5103 Fall, 2008 Description: #include <stdio.h> #include <sys/types.h> #define DEBUG /* Child process executes this code */ main(int argc, char *argv[]) { printf(\"I am the child process after exec\ \"); printf(\"Number of args passed to me %d\ \", argc); { int i; for (i... Date Added: 2009-06-07 17:22:01 |
| DIDCAWMA96.pdf Path: Cal Poly >> CEENVE >> 442 Fall, 2009 Description: A165 Microwave Regeneration of Volatile Organic Compound (VOC) Adsorbents Pingkuan Di and Daniel P. Y. Chang Department of Civil and Environmental Engineering University of California, Davis Davis, California 95616 1 A165 INTRODUCTION Existing m... Date Added: 2009-06-07 17:24:23 |
| notes-gpdf-20070911.txt Path: Stanford >> SLAC >> 20070911 Fall, 2009 Description: CSC meeting 2007.9.11 * Cost projections Benchmarking of the Intel Xeon 5335 (reported at http:/www.slac.stanford.edu/~gpdf/Benchmarks/Xeon5335.html and in other fora) for BaBar applications showed that its performance was about 70% of that expecte... Date Added: 2009-06-07 17:27:12 |
| AlgebraicManipulationPracticeSolns.pdf Path: Cal Poly >> PAGES >> 350 Fall, 2009 Description: Math 350 Algebraic Manipulations Solutions to Practice Problems May 4, 2009 Algebraic Manipulation 1. Expand cos 2 x C 1 2 into cos2 2 x C 2 cos x C 1, i.e. expand the expression as if it were a polynomial in cos 2 x and do not expand the trigonom... Date Added: 2009-06-07 17:29:10 |
| cps001--privacy--no.ppt Path: Duke >> CPS >> 001 Fall, 2009 Description: PRIVACY Universities should NOT be allowed to monitor their networks for so-called \"improper activity.\" Eric Blatt, Molly Fulweiler, Evan Oxman, Damon Villaronga, http:/www.jobpostings.ca/articles/images/summer01/privacy.jpg Ownership of Network \"... Date Added: 2009-06-07 17:30:05 |
| solutions.pdf Path: Maple Springs >> MATH >> 2030 Fall, 2009 Description: ... Date Added: 2009-06-07 17:32:10 |
| s98final.ps Path: Michigan State University >> PHY >> 232 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.55a Copyright 1986, 1994 Radical Eye Software %Title: 173336438.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -q 173336438.dvi -o %DVIPSParameters: dpi=600, compress... Date Added: 2009-06-07 17:38:34 |
| pg1rational.pdf Path: MSOE >> MS >> 3812 Fall, 2009 Description: MS-3812 C+ Program #1 Simple Classes Date Assigned: Date Due: Wednesday, November 29, 2006 Wednesday, December 6, 2006 A rational number is any quantity that can be expressed as i/j where both i and j are integers. Rational addition, subtraction, mu... Date Added: 2009-06-07 17:40:03 |
| 01_information.pdf Path: Stanford >> EE >> 351 Fall, 2009 Description: EE351 - Spring 2002-2003 M. J. Narasimha Handout #1 Class Information Instructor: M.J. (Sim) Narasimha Office: Packard 321 Phone: 723-4243 Hours: After/Before class sim@nova.stanford.edu Admin: Helen Wentong Niu Office: Packard 310 Phone: 723-8121 ... Date Added: 2009-06-07 17:40:57 |
| quiz01.pdf Path: Purdue >> MA >> 153 Fall, 2009 Description: 1H u 9 X X H QH r W Q 9W u 7 IT b uP 4 AHGp u vu Q T I@ vu V yCXrei CbqP p T APA9q9 T I@ 4 C9Q T sB u 3 @ PH Q 9 P H r X 9 c u@ ITU 9GCi T PrYi UIT YVQV s Y@AHr@ r9 rt@ V !V @ 9 7 UFVw1yw03 m YVB 3 i PX D B 5 Q }~ { z | {... Date Added: 2009-06-07 17:44:55 |
| Hints for Assignment 20.doc Path: BYU >> CE >> 361 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|28 Sep 2002 05:27:05 -0000 vti_extenderversion:SR|5.0.2.4330 vti_backlinkinfo:VX|Lecture_schedule.htm Spring\\ Lecture_schedule.htm Lecture_schedule\\ trial.htm vti_title:SR|Homework #20 vti_nexttolasttim... Date Added: 2009-06-07 17:47:23 |
| 200629_r02o_020388.pdf Path: Stanford >> ILA >> 1024 Fall, 2009 Description: Case 4:02-cv-00388-FJG Document 260 Filed 02/09/2006 Page 1 of 8 IN THE UNITED STATES DISTRICT COURT WESTERN DISTRICT OF MISSOURI WESTERN DIVISION ROBERT CARPE, et al., On Behalf of Himself and All Others Similarly Situated, ) ) ) Plaintiffs, ) )... Date Added: 2009-06-07 17:47:54 |
| PDF_part1.pdf Path: Virginia Tech >> PUBS >> 490 Fall, 2009 Description: Introduction This document presents data and analysis from the 1997 Census of Agriculture for Virginia. County, Planning District (PD), and Extension District (ED) data have been compiled from selected census tables in order to present a statistical ... Date Added: 2009-06-07 18:01:24 |
| 420-538.pdf Path: Virginia Tech >> PUBS >> 420 Fall, 2009 Description: publication 420-538 Guide to Understanding and Managing Lakes: Part I (Physical Measurements) Louis A. Helfrich, Department of Fisheries and Wildlife Sciences, Virginia Tech James Parkhurst, Department of Fisheries and Wildlife Sciences, Virginia Te... Date Added: 2009-06-07 18:01:56 |
| 420-026.pdf Path: Virginia Tech >> PUBS >> 420 Fall, 2009 Description: 4-H Forestry Projects Leader\'s Guide to Tree Planting Projects 2005 Publication 420-026 Overview The Virginia Department of Forestry (DOF) and the Virginia 4-H program provide free pine seedlings and hardwood seedlings at low cost to 4-H members. T... Date Added: 2009-06-07 18:02:01 |
| 111hallam.pdf Path: UNC >> INLS >> 501 Fall, 2008 Description: Journal of the Society of Archivists, Vol. 24, No. 1, 2003 Customer Focus and Marketing in Archive Service Delivery: theory and practice1 ELIZABETH HALLAM SMITH, The National Archives 1. Introduction If asked, most archivists would say that we as a... Date Added: 2009-06-07 18:02:59 |
| 111hallam.pdf Path: UNC >> INLS >> 111 Fall, 2008 Description: Journal of the Society of Archivists, Vol. 24, No. 1, 2003 Customer Focus and Marketing in Archive Service Delivery: theory and practice1 ELIZABETH HALLAM SMITH, The National Archives 1. Introduction If asked, most archivists would say that we as a... Date Added: 2009-06-07 18:03:34 |
| Ch06p2.ppt Path: Portland >> SBA >> 351 Fall, 2009 Description: SELECTION Part 2 1 Chapter Objectives (Continued) Explain legal implications of interviewing. Explain the administration of selection tests including the advantages, potential problems, and characteristics of properly designed selection tests. ... Date Added: 2009-06-07 18:06:21 |
| Feb14-Maletic.pdf Path: Rutgers >> GRAD >> 690 Fall, 2009 Description: Mond Testing Future? Origins Review of the Sanders Modified Newtonian Dynamics as an Alternative to Dark Matter,\" ARAA, 40, 263 by Dusan Maletic Phenomenology Bizarre matter or ordinary field? Algorithm Historical issues F=(GM/R... Date Added: 2009-06-07 18:13:27 |
| pp6 Male Reproductive System.ppt Path: UF >> ANS >> 3319 Fall, 2009 Description: PP6 Male Reproductive System Structure and Function ANS 3319 Dr. Michael J. Fields University of Florida 1 Testes Seminiferous Tubules Spermatogenesis occurs 80% of testicular volume 3 miles long Empties into. Rete Testis Vas Efferens (ciliated... Date Added: 2009-06-07 18:15:11 |
| 350-112.pdf Path: Virginia Tech >> PUBS >> 350 Fall, 2009 Description: publication 350-112 discipline for young children lesson 3 Why Children Misbehave www.ext.vt.edu Produced by Communications and Marketing, College of Agriculture and Life Sciences, Virginia Polytechnic Institute and State University, 2009 Virgini... Date Added: 2009-06-07 18:16:06 |
| 422-017.pdf Path: Virginia Tech >> PUBS >> 422 Fall, 2009 Description: publication 422-017 Richard P. Marini , Extension Specialist, Horticulture, Virginia Tech Growing Pears in Virginia Introduction Pear is the second most important deciduous tree fruit after apple, and it has been grown in Europe since prehistoric... Date Added: 2009-06-07 18:17:58 |
| 242s2.pdf Path: ASU >> STAT >> 242 Fall, 2009 Description: MAT 242 Written Homework #2 1.3, 1.4 SOLUTIONS Due: February 11, 2009 Solve the following problems, showing any necessary work. If the nal answer is short, you should circle or box it. 1. Below are the row echelon forms of three matrices which repr... Date Added: 2009-06-07 18:21:31 |
| REMOVE3.txt Path: Syracuse >> CSE >> 382 Spring, 2008 Description: / remove3.cpp - Erase all the zero elements in a vector. / This is an effective method. It is / exactly what remove does. #include <vector> #include <iostream> using namespace std; void showVec(const vector<int> &v)... Date Added: 2009-06-07 18:27:33 |
| Written_2_ SWF_hall.doc Path: UF >> ANT >> 3181 Fall, 2008 Description: ANT 3181 Written Assignment # 2 Due Friday, October 12 (at start of class) WE MEET AT THE FLMNH POWELL HALL THAT DAY Length: 2 double-spaced pages maximum (12 point font) You are required to visit and critique the permanent exhibit at The Florida Mus... Date Added: 2009-06-07 18:28:14 |
| Food_and_complex_societies_Gummerman.pdf Path: UF >> ANT >> 3428 Spring, 2008 Description: Journal of Archaeological Method and Theory, VoL 4, No. 2, 1997 Food and Complex Societies George Gumerman IV 1 In complex societies individuals from distinct socia~ economic, gender, or age groups often consume different foods because of various e... Date Added: 2009-06-07 18:28:14 |
| DM-31may.pdf Path: UCSC >> AMS >> 005 Fall, 2009 Description: ... Date Added: 2009-06-07 18:32:12 |
| 1978-data.txt Path: Harvard >> P >> 040 Fall, 2009 Description: PLOT,ACPE,ACRU,ACSA,BEAL,BELE,BEPA,BEPO,CACA,CADE,CAGL,CAOV,FAGR,FRAM,PIST,POGR,PRPE,PRSE,QUAL,QUBO,SALSPP,TIAM,TSCA,ULAM B,0,493.83,0,395.06,0,197.53,197.53,0,0,0,0,0,0,1382.72,0,0,98.77,0,98.77,0,0,0,0 C,0,197.53,0,0,0,197.53,1382.72,0,0,0,0,0,0,29... Date Added: 2009-06-07 18:34:32 |
| Cope et al. 2008 Mussel Exposure Review.JNABS.27(2) 451-462.pdf Path: N.C. State >> SERVICE >> 004 Fall, 2009 Description: J. N. Am. Benthol. Soc., 2008, 27(2):451462 2008 by The North American Benthological Society DOI: 10.1899/07-094.1 Published online: 22 April 2008 Differential exposure, duration, and sensitivity of unionoidean bivalve life stages to environmental ... Date Added: 2009-06-07 18:34:33 |
| midtermReview.pdf Path: Wilfrid Laurier >> ENCM >> 467 Fall, 2009 Description: ENCM 467- Review for midterm, October 20, 2005 Question #1: Design F = AB + AC + DC in combinational CMOS logic using the least number of devices. a. b. Draw the schematic. Identify which input pattern gives you the worst and the best equivalent Pul... Date Added: 2009-06-07 18:36:08 |
| using_ml.pdf Path: Uni. Worcester >> EE >> 2311 Fall, 2009 Description: MATLAB The Language of Technical Computing Computation Visualization Programming Using MATLAB Version 5 How to Contact The MathWorks: 508-647-7000 508-647-7001 The MathWorks, Inc. 24 Prime Park Way Natick, MA 01760-1500 http:/www.mathworks.com ... Date Added: 2009-06-07 18:36:09 |
| 4001-X1-Lecture4.ppt Path: Allan Hancock College >> LEC >> 4001 Fall, 2009 Description: Lecture 4: Observing the Universe and Astronomy in Antarctica Dr Michael Burton GENS4001-X1 Observing the Universe / Antarctic Astronomy 1 The Nature of Light Light travels through space at a finite speed 300,000 kilometres per second. Wavele... Date Added: 2009-06-07 18:38:38 |
| 481week1.doc Path: WVU >> EE >> 180 Fall, 2009 Description: WEST VIRGINIA UNIVERSITY COLLEGE OF ENGINEERING AND MINERAL RESOURCES Lane Department of Computer Science and Electrical Engineering DESIGN PROJECT TEAM WEEKLY REPORT TEAM NO/TITLE Group 16: Bio-Web_DATES:_Week 16_ Member Gregory Chappell Kevin Davi... Date Added: 2009-06-07 18:39:48 |
| quiz2_sols.pdf Path: Missouri S&T >> P >> 308 Fall, 2009 Description: Physics 4222 Spring Term 2002 Quiz 2 Solutions 1. The Yukawa force. The Yukawa force is sometimes used in nuclear physics to model the interaction between nucleons due to meson exchange. The force is er/ F (r) = k 2 , r (1) where k and are both pos... Date Added: 2009-06-07 18:42:09 |
| consensus.ppt Path: CSU San Marcos >> CS >> 633 Fall, 2009 Description: Agre m nt Protocols e e Exam s ple Agre ing whe r to com it or to abort a transaction in a distribute e the m d databasem anage e syste . m nt m Agre ing on a com on clock valuein a distribute syste . e m d m I n theabse of failure or faul... Date Added: 2009-06-07 18:42:18 |
| groups.doc Path: CSU San Marcos >> ID >> 370 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_title:SR|NAME vti_cachedlinkinfo:VX| vti_cachedhastheme:BR|false vti_cachedhasborder:BR|false vti_filesize:IX|78336 vti_cacheddtm:TX|24 Feb 1998 10:47:20 -0800 vti_backlinkinfo:VX| vti_cachedhasbots:BR|false vti_extenderve... Date Added: 2009-06-07 18:42:21 |
| class19.ppt Path: Maryland >> CMSC >> 311 Fall, 2008 Description: 15-213 The course that gives CMU its Zip! Virtual Memory Oct. 29, 2002 Topics Motivations for VM Address translation Accelerating translation with TLBs class19.ppt Motivations for Virtual Memory Use Physical DRAM as a Cache for the Disk Add... Date Added: 2009-06-07 18:45:06 |
| 3281_Ch9WebLinks.pdf Path: East Los Angeles College >> CAM >> 0521612357 Fall, 2009 Description: An Introduction to Language and Linguistics Links to websites Chapter 9 Dialect Variation - Natalie Schilling-Estes American Dialect Society http:/www.americandialect.org/ Vowels of British and American English Clickable vowel charts http:/faculty.... Date Added: 2009-06-07 18:45:38 |
| thematicresources.doc Path: North Texas >> COURSEWEB >> 4100009 Spring, 2009 Description: Soniya Judhani CECS 4100.009 March 01, 2007 Thematic Resources 1. Internet Website- http:/passporttoknowledge.com/sun/ This website mainly deals with the Sun. It has lots of information as the sun as a star, the history of the sun, and the sun-earth... Date Added: 2009-06-07 18:46:48 |
| Problem Set 2 Answers.pdf Path: Maryland >> ECON >> 454 Fall, 2008 Description: ECON 454, Fall 2007 Department of Economics, University of Maryland Jessica Hennessey Problem Set #2 Question 1 Andrew, Beth and Cathy live in Lindhville. Andrew demand for bike paths, a public good, is given by s Q = 12 2P . Beth demand is Q = 18 P... Date Added: 2009-06-07 18:46:56 |
| syllabus.pdf Path: Colorado >> CVEN >> 5070 Fall, 2009 Description: CVEN 5070 THERMAL ANALYSIS OF BUILDINGS FALL 2000 SYLLABUS DESCRIPTION Lecture/discussion course on the analysis of dynamic heating and cooling requirements in buildings and building systems. The course develops the mathematical foundation for hea... Date Added: 2009-06-07 18:46:58 |
| results.txt Path: North Texas >> AWM >> 0032 Fall, 2009 Description: _<br><br>Email: jpolus@yahoo.com,br> Age: 39-45,br> Homepage url: none,br>__<br><br>Email: jpolus@yahoo.com,b... Date Added: 2009-06-07 18:46:58 |
| HerringRoyFig12Final.pdf Path: East Los Angeles College >> OPEN >> 3047 Fall, 2009 Description: Herring and Roy: Paper for Environmental Impact Assessment Review Energy per student per 10 CAT points (MJ) Transport Campus Computing Paper/print Addl. Heating TOTAL 1040 1200 70 27 43 2380 2300 1200 134 131 272 4037 152 6 58 79 24 319 118 1 166 38 ... Date Added: 2009-06-07 18:47:20 |
| p115plab10.pdf Path: Mt. Holyoke >> PHYS >> 115 Fall, 2009 Description: Physics 115 Pre-Lab Assignment Spring 2005 1. Read your lab description carefully all the way through. 2. Define random and systematic errors. Consult the handout on error analysis (you can find it on the webpage). 3. Write a Haiku about somethin... Date Added: 2009-06-07 18:48:39 |
| YOR207C.t2k.w0.5-logo.pdf Path: UCSC >> YOR >> 207 Fall, 2009 Description: 5 4 3 2 1 I L E 151 160 170 180 190 T H 6 5 4 3 2 1 F Y D I L P S T H T T T E T E XX 201 210 220 230 240 T 6 5 4 3 2 1 E T S E T S E T E T 251 260 270 280 290 H 6 5 4 3 2 1 L A T H H H L XXXXXXXXXXXX L K R G ... Date Added: 2009-06-07 18:55:06 |
| Naffziger.pdf Path: FIU >> BUSINESS >> 1660397 Fall, 2009 Description: & ENTREPRENEURSHIP: PERSON IBASED A i THEORY APPROACH I ii: iz % ! 1 1 3 Douglas Naffziger I A great deal of research has focused on the identification of who an entrepreneur is in terms of psychological characteristics, personality, and other ba... Date Added: 2009-06-07 18:56:32 |
| MSx_Aerosol_MS.pdf Path: Colorado >> CHEM >> 5181 Fall, 2008 Description: CHEM-5181 Mass Spectrometry and Chromatography Aerosol Mass Spectrometry Jose-Luis Jimenez Assistant Professor & CIRES Fellow University of Colorado at Boulder http:/cires.colorado.edu/jimenez/ams.html http:/cires.colorado.edu/jimenez/ams.html My... Date Added: 2009-06-07 19:06:53 |
| 10834.pdf Path: East Los Angeles College >> HEA >> 10834 Fall, 2009 Description: PROGRAMME DETAIL SPECIFICATION Programme Summary 1 Awarding institution 2 Teaching institution university 3a Programme accredited by: 3b Description of accreditation 4 Final award 5 Programme title 6 UCAS code 7 Subject benchmark statement 8 Educati... Date Added: 2009-06-07 19:14:13 |
| docdlaUsSYIEe.doc Path: Harvard >> GOV >> 2305 Fall, 2009 Description: Peter Geller Government 2305 6 November 2005 The duel between the new institutionalist and attitudinal approaches to Supreme Court decision-making is in some ways rather marginal. Both assume that policy preferences translate into how justices vote, ... Date Added: 2009-06-07 19:21:25 |
| HW10Timesheet.doc Path: NJIT >> CIS >> 602 Fall, 2009 Description: CIS 602 Week 11/HW 10 Time Sheet Marie J. Garlitos Date Time 14-Apr-2006 15-Apr-2006 16-Apr-2006 17-Apr-2006 10:00 PM 2:00 PM 10:00 PM 11:30 PM 12:30 PM 1:00 AM Time Sheet Task Read Ch. 10 of Textbook CH10 HW Assignment Maze Game Week 11 Slides Pla... Date Added: 2009-06-07 19:27:46 |
| c_lil-d_1491.pdf Path: Hamline >> SAVE >> 110207 Fall, 2009 Description: LILLINGSTONE DAYREL, BUCKINGHAMTHIRE I. Paul Dayrell and his wife Margaret London: M.S. I St. Nicholas C lil-d 1491 \"F\" series 1 Effigies of Paul Dayrell, Esquire, 1491, in armor, and his wife Margaret, with a two line inscription. On an altar tom... Date Added: 2009-06-07 19:28:30 |
| april06.pdf Path: North Texas >> CSCE >> 5610 Fall, 2008 Description: CSCE 4610/5610: Computer Architecture Review for Exam Instruction Level Parallelism (Chapter 2, Appendix A) Dynamic Instruction Scheduling Scoreboard Reservation Stations Multiple instruction issue Branch Prediction and speculative instruction... Date Added: 2009-06-07 19:29:05 |
| STRATEGIC MNGT CS#3 Path: St. Edwards >> CULF >> 1302 Spring, 2009 Description: Justin Gardiner Dr. Ward February 18, 2009 BUSI 4349- Spring Morgan Stanley: A Leading Global Financial Services Firm Executive Summary: After years of turmoil throughout the organization and merger with Dean Witter, Morgan Stanley has suffered, but... Date Added: 2009-06-07 19:29:40 |
| WAYNE+COUNTY+&+GOLDSBORO+RFP.doc Path: UNC >> READ >> 4849619 Fall, 2009 Description: Goldsboro/Wayne Page 1 of 9 CITY OF GOLDSBORO AND WAYNE COUNTY REQUEST FOR PROPOSAL _ _ 1. General: The City of Goldsboro and Wayne County hereby request your written proposal for a professional services contract for a countywide digital orthophoto ... Date Added: 2009-06-07 19:29:56 |
| hw6.pdf Path: UNC >> STAT >> 654 Fall, 2009 Description: Statistics 164 Homework 6 1. If X has characteristic function , find the characteristic function of Y = aX + b. 2. Show that if X and -X have the same distributions then the characteristic function of X is real-valued. 3. Find the characteristic fun... Date Added: 2009-06-07 19:31:13 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now! |
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses. |
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now! |
||
