Course Solutions And Notes - 00000077 42
| 00000034.pdf Path: Carnegie Mellon >> DISK >> 05101900 Fall, 2009 Description: ... Date Added: 2009-06-02 22:55:32 |
| 00000145.pdf Path: Carnegie Mellon >> DISK >> 05101900 Fall, 2009 Description: ... Date Added: 2009-06-02 22:55:52 |
| 00000145.pdf Path: Carnegie Mellon >> TERA >> 05101900 Fall, 2009 Description: ... Date Added: 2009-06-02 22:55:52 |
| 00000033.pdf Path: Carnegie Mellon >> TERA >> 05102257 Fall, 2009 Description: ... Date Added: 2009-06-02 22:57:30 |
| 00000041.pdf Path: Carnegie Mellon >> TERA >> 31007036 Fall, 2009 Description: ... Date Added: 2009-06-02 23:03:13 |
| 00000041.pdf Path: Carnegie Mellon >> DISK >> 31007036 Fall, 2009 Description: ... Date Added: 2009-06-02 23:03:13 |
| 00000083.pdf Path: Carnegie Mellon >> TERA >> 31007036 Fall, 2009 Description: ... Date Added: 2009-06-02 23:03:25 |
| 00000083.pdf Path: Carnegie Mellon >> DISK >> 31007036 Fall, 2009 Description: ... Date Added: 2009-06-02 23:03:25 |
| 00000023.pdf Path: Carnegie Mellon >> TERA >> 05102244 Fall, 2009 Description: ... Date Added: 2009-06-02 23:04:14 |
| 00000162.pdf Path: Carnegie Mellon >> TERA >> 31003643 Fall, 2009 Description: ... Date Added: 2009-06-02 23:06:21 |
| 00000162.pdf Path: Carnegie Mellon >> DISK >> 31003643 Fall, 2009 Description: ... Date Added: 2009-06-02 23:06:21 |
| 00000014.pdf Path: Carnegie Mellon >> TERA >> 31007718 Fall, 2009 Description: ... Date Added: 2009-06-02 23:07:07 |
| 00000014.pdf Path: Carnegie Mellon >> DISK >> 31007718 Fall, 2009 Description: ... Date Added: 2009-06-02 23:07:08 |
| 00000130.pdf Path: Carnegie Mellon >> DISK >> 31007718 Fall, 2009 Description: ... Date Added: 2009-06-02 23:07:40 |
| 00000130.pdf Path: Carnegie Mellon >> TERA >> 31007718 Fall, 2009 Description: ... Date Added: 2009-06-02 23:07:40 |
| 00000209.pdf Path: Carnegie Mellon >> TERA >> 31005515 Fall, 2009 Description: ... Date Added: 2009-06-02 23:08:47 |
| 00000064.pdf Path: Carnegie Mellon >> TERA >> 31005391 Fall, 2009 Description: ... Date Added: 2009-06-02 23:10:15 |
| 00000064.pdf Path: Carnegie Mellon >> DISK >> 31005391 Fall, 2009 Description: ... Date Added: 2009-06-02 23:10:15 |
| 00000155.pdf Path: Carnegie Mellon >> TERA >> 31004378 Fall, 2009 Description: ... Date Added: 2009-06-02 23:12:11 |
| 00000310.pdf Path: Carnegie Mellon >> TERA >> 31004378 Fall, 2009 Description: ... Date Added: 2009-06-02 23:12:48 |
| 00000075.pdf Path: Carnegie Mellon >> TERA >> 31004306 Fall, 2009 Description: ... Date Added: 2009-06-02 23:13:19 |
| 00000075.pdf Path: Carnegie Mellon >> DISK >> 31004306 Fall, 2009 Description: ... Date Added: 2009-06-02 23:13:19 |
| 00000220.pdf Path: Carnegie Mellon >> TERA >> 31004306 Fall, 2009 Description: ... Date Added: 2009-06-02 23:14:17 |
| 00000220.pdf Path: Carnegie Mellon >> DISK >> 31004306 Fall, 2009 Description: ... Date Added: 2009-06-02 23:14:17 |
| 00000072.pdf Path: Carnegie Mellon >> TERA >> 05101624 Fall, 2009 Description: ... Date Added: 2009-06-02 23:16:17 |
| 00000072.pdf Path: Carnegie Mellon >> DISK >> 05101624 Fall, 2009 Description: ... Date Added: 2009-06-02 23:16:17 |
| 00000076.pdf Path: Carnegie Mellon >> TERA >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:16:58 |
| 00000076.pdf Path: Carnegie Mellon >> DISK >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:16:59 |
| 00000124.pdf Path: Carnegie Mellon >> TERA >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:17:15 |
| 00000124.pdf Path: Carnegie Mellon >> DISK >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:17:16 |
| 00000176.pdf Path: Carnegie Mellon >> DISK >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:17:30 |
| 00000176.pdf Path: Carnegie Mellon >> TERA >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:17:30 |
| 00000187.pdf Path: Carnegie Mellon >> TERA >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:17:33 |
| 00000187.pdf Path: Carnegie Mellon >> DISK >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:17:34 |
| 00000443.pdf Path: Carnegie Mellon >> DISK >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:00 |
| 00000443.pdf Path: Carnegie Mellon >> TERA >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:00 |
| 00000488.pdf Path: Carnegie Mellon >> TERA >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:13 |
| 00000488.pdf Path: Carnegie Mellon >> DISK >> 31003667 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:13 |
| 00000095.pdf Path: Carnegie Mellon >> TERA >> 31007717 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:48 |
| 00000095.pdf Path: Carnegie Mellon >> DISK >> 31007717 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:48 |
| 00000110.pdf Path: Carnegie Mellon >> TERA >> 31007717 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:52 |
| 00000110.pdf Path: Carnegie Mellon >> DISK >> 31007717 Fall, 2009 Description: ... Date Added: 2009-06-02 23:19:53 |
| 00000004.pdf Path: Carnegie Mellon >> TERA >> 31004641 Fall, 2009 Description: ... Date Added: 2009-06-02 23:20:19 |
| 00000004.pdf Path: Carnegie Mellon >> DISK >> 31004641 Fall, 2009 Description: ... Date Added: 2009-06-02 23:20:20 |
| 00000031.pdf Path: Carnegie Mellon >> TERA >> 31004960 Fall, 2009 Description: ... Date Added: 2009-06-02 23:22:59 |
| 00000057.pdf Path: Carnegie Mellon >> TERA >> 05102271 Fall, 2009 Description: ... Date Added: 2009-06-02 23:23:50 |
| 00000059.pdf Path: Carnegie Mellon >> TERA >> 05102271 Fall, 2009 Description: ... Date Added: 2009-06-02 23:23:50 |
| 00000491.pdf Path: Carnegie Mellon >> TERA >> 31004308 Fall, 2009 Description: ... Date Added: 2009-06-02 23:26:46 |
| 00000491.pdf Path: Carnegie Mellon >> DISK >> 31004308 Fall, 2009 Description: ... Date Added: 2009-06-02 23:26:46 |
| 00000037.pdf Path: Carnegie Mellon >> TERA >> 31005206 Fall, 2009 Description: ... Date Added: 2009-06-02 23:27:01 |
| 00000037.pdf Path: Carnegie Mellon >> DISK >> 31005206 Fall, 2009 Description: ... Date Added: 2009-06-02 23:27:01 |
| 00000232.pdf Path: Carnegie Mellon >> TERA >> 31005206 Fall, 2009 Description: ... Date Added: 2009-06-02 23:28:02 |
| 00000232.pdf Path: Carnegie Mellon >> DISK >> 31005206 Fall, 2009 Description: ... Date Added: 2009-06-02 23:28:02 |
| 00000002.pdf Path: Carnegie Mellon >> TERA >> 05102475 Fall, 2009 Description: ... Date Added: 2009-06-02 23:28:21 |
| 00000002.pdf Path: Carnegie Mellon >> DISK >> 05102475 Fall, 2009 Description: ... Date Added: 2009-06-02 23:28:21 |
| 00000042.pdf Path: Carnegie Mellon >> TERA >> 05102475 Fall, 2009 Description: ... Date Added: 2009-06-02 23:28:36 |
| 00000042.pdf Path: Carnegie Mellon >> DISK >> 05102475 Fall, 2009 Description: ... Date Added: 2009-06-02 23:28:36 |
| 00000022.pdf Path: Carnegie Mellon >> DISK >> 31005510 Fall, 2009 Description: ... Date Added: 2009-06-02 23:33:16 |
| 00000022.pdf Path: Carnegie Mellon >> TERA >> 31005510 Fall, 2009 Description: ... Date Added: 2009-06-02 23:33:16 |
| 00000282.pdf Path: Carnegie Mellon >> DISK >> 31005510 Fall, 2009 Description: ... Date Added: 2009-06-02 23:34:31 |
| 00000282.pdf Path: Carnegie Mellon >> TERA >> 31005510 Fall, 2009 Description: ... Date Added: 2009-06-02 23:34:31 |
| 00000007.pdf Path: Carnegie Mellon >> TERA >> 31003139 Fall, 2009 Description: ... Date Added: 2009-06-02 23:34:46 |
| 00000156.pdf Path: Carnegie Mellon >> TERA >> 31003139 Fall, 2009 Description: ... Date Added: 2009-06-02 23:35:15 |
| 00000196.pdf Path: Carnegie Mellon >> TERA >> 31003139 Fall, 2009 Description: ... Date Added: 2009-06-02 23:35:22 |
| 00000014.pdf Path: Carnegie Mellon >> TERA >> 31004309 Fall, 2009 Description: ... Date Added: 2009-06-02 23:36:23 |
| 00000099.pdf Path: Carnegie Mellon >> TERA >> 31004309 Fall, 2009 Description: ... Date Added: 2009-06-02 23:36:40 |
| 00000221.pdf Path: Carnegie Mellon >> TERA >> 31004309 Fall, 2009 Description: ... Date Added: 2009-06-02 23:37:04 |
| 00000120.pdf Path: Carnegie Mellon >> TERA >> 31003662 Fall, 2009 Description: ... Date Added: 2009-06-02 23:38:25 |
| 00000169.pdf Path: Carnegie Mellon >> TERA >> 31003662 Fall, 2009 Description: ... Date Added: 2009-06-02 23:38:34 |
| 00000090.pdf Path: Carnegie Mellon >> TERA >> 31005397 Fall, 2009 Description: ... Date Added: 2009-06-02 23:39:08 |
| 00000090.pdf Path: Carnegie Mellon >> DISK >> 31005397 Fall, 2009 Description: ... Date Added: 2009-06-02 23:39:08 |
| 00000181.pdf Path: Carnegie Mellon >> TERA >> 31005397 Fall, 2009 Description: ... Date Added: 2009-06-02 23:39:34 |
| 00000181.pdf Path: Carnegie Mellon >> DISK >> 31005397 Fall, 2009 Description: ... Date Added: 2009-06-02 23:39:34 |
| 00000380.pdf Path: Carnegie Mellon >> TERA >> 31005397 Fall, 2009 Description: ... Date Added: 2009-06-02 23:40:33 |
| 00000380.pdf Path: Carnegie Mellon >> DISK >> 31005397 Fall, 2009 Description: ... Date Added: 2009-06-02 23:40:33 |
| 00000038.pdf Path: Carnegie Mellon >> TERA >> 05102318 Fall, 2009 Description: ... Date Added: 2009-06-02 23:41:11 |
| 00000031.pdf Path: Carnegie Mellon >> TERA >> 31004961 Fall, 2009 Description: ... Date Added: 2009-06-02 23:41:20 |
| 00000029.pdf Path: Carnegie Mellon >> TERA >> 05102476 Fall, 2009 Description: ... Date Added: 2009-06-02 23:42:15 |
| 00000078.pdf Path: Carnegie Mellon >> TERA >> 31004957 Fall, 2009 Description: ... Date Added: 2009-06-02 23:42:42 |
| 00000078.pdf Path: Carnegie Mellon >> DISK >> 31004957 Fall, 2009 Description: ... Date Added: 2009-06-02 23:42:42 |
| 00000335.pdf Path: Carnegie Mellon >> DISK >> 31004957 Fall, 2009 Description: ... Date Added: 2009-06-02 23:43:57 |
| 00000335.pdf Path: Carnegie Mellon >> TERA >> 31004957 Fall, 2009 Description: ... Date Added: 2009-06-02 23:43:57 |
| 00000039.pdf Path: Carnegie Mellon >> TERA >> 31004750 Fall, 2009 Description: ... Date Added: 2009-06-02 23:47:49 |
| 00000039.pdf Path: Carnegie Mellon >> DISK >> 31004750 Fall, 2009 Description: ... Date Added: 2009-06-02 23:47:50 |
| 00000211.pdf Path: Carnegie Mellon >> TERA >> 31004838 Fall, 2009 Description: ... Date Added: 2009-06-02 23:51:33 |
| 00000356.pdf Path: Carnegie Mellon >> TERA >> 31004838 Fall, 2009 Description: ... Date Added: 2009-06-02 23:52:01 |
| 00000389.pdf Path: Carnegie Mellon >> TERA >> 31004838 Fall, 2009 Description: ... Date Added: 2009-06-02 23:52:07 |
| 00000398.pdf Path: Carnegie Mellon >> TERA >> 31004838 Fall, 2009 Description: ... Date Added: 2009-06-02 23:52:08 |
| 00000469.pdf Path: Carnegie Mellon >> TERA >> 31004838 Fall, 2009 Description: ... Date Added: 2009-06-02 23:52:23 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 05102270 Fall, 2009 Description: ... Date Added: 2009-06-02 23:52:30 |
| 00000176.pdf Path: Carnegie Mellon >> TERA >> 31003375 Fall, 2009 Description: ... Date Added: 2009-06-02 23:53:26 |
| 00000037.pdf Path: Carnegie Mellon >> TERA >> 31005505 Fall, 2009 Description: ... Date Added: 2009-06-02 23:54:09 |
| 00000037.pdf Path: Carnegie Mellon >> DISK >> 31005505 Fall, 2009 Description: ... Date Added: 2009-06-02 23:54:09 |
| 00000050.pdf Path: Carnegie Mellon >> TERA >> 31005505 Fall, 2009 Description: ... Date Added: 2009-06-02 23:54:13 |
| 00000050.pdf Path: Carnegie Mellon >> DISK >> 31005505 Fall, 2009 Description: ... Date Added: 2009-06-02 23:54:13 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 31003537 Fall, 2009 Description: ... Date Added: 2009-06-02 23:54:53 |
| 00000211.pdf Path: Carnegie Mellon >> TERA >> 31003537 Fall, 2009 Description: ... Date Added: 2009-06-02 23:55:31 |
| 00000415.pdf Path: Carnegie Mellon >> TERA >> 31003537 Fall, 2009 Description: ... Date Added: 2009-06-02 23:56:10 |
| 00000066.pdf Path: Carnegie Mellon >> TERA >> 31005049 Fall, 2009 Description: ... Date Added: 2009-06-02 23:57:11 |
| 00000377.pdf Path: Carnegie Mellon >> TERA >> 31003536 Fall, 2009 Description: ... Date Added: 2009-06-03 00:00:18 |
| 00000377.pdf Path: Carnegie Mellon >> DISK >> 31003536 Fall, 2009 Description: ... Date Added: 2009-06-03 00:00:19 |
| 00000021.pdf Path: Carnegie Mellon >> TERA >> 31005392 Fall, 2009 Description: ... Date Added: 2009-06-03 00:00:49 |
| 00000021.pdf Path: Carnegie Mellon >> DISK >> 31005392 Fall, 2009 Description: ... Date Added: 2009-06-03 00:00:49 |
| 00000120.pdf Path: Carnegie Mellon >> TERA >> 31005392 Fall, 2009 Description: ... Date Added: 2009-06-03 00:01:18 |
| 00000120.pdf Path: Carnegie Mellon >> DISK >> 31005392 Fall, 2009 Description: ... Date Added: 2009-06-03 00:01:18 |
| 00000066.pdf Path: Carnegie Mellon >> TERA >> 31005507 Fall, 2009 Description: ... Date Added: 2009-06-03 00:02:36 |
| 00000066.pdf Path: Carnegie Mellon >> DISK >> 31005507 Fall, 2009 Description: ... Date Added: 2009-06-03 00:02:36 |
| 00000168.pdf Path: Carnegie Mellon >> TERA >> 31005507 Fall, 2009 Description: ... Date Added: 2009-06-03 00:03:13 |
| 00000168.pdf Path: Carnegie Mellon >> DISK >> 31005507 Fall, 2009 Description: ... Date Added: 2009-06-03 00:03:13 |
| 00000011.pdf Path: Carnegie Mellon >> TERA >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:04:12 |
| 00000011.pdf Path: Carnegie Mellon >> DISK >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:04:12 |
| 00000097.pdf Path: Carnegie Mellon >> TERA >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:04:43 |
| 00000097.pdf Path: Carnegie Mellon >> DISK >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:04:43 |
| 00000263.pdf Path: Carnegie Mellon >> TERA >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:05:43 |
| 00000263.pdf Path: Carnegie Mellon >> DISK >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:05:43 |
| 00000295.pdf Path: Carnegie Mellon >> TERA >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:05:52 |
| 00000295.pdf Path: Carnegie Mellon >> DISK >> 31003887 Fall, 2009 Description: ... Date Added: 2009-06-03 00:05:52 |
| 00000055.pdf Path: Carnegie Mellon >> TERA >> 31006960 Fall, 2009 Description: ... Date Added: 2009-06-03 00:07:15 |
| 00000110.pdf Path: Carnegie Mellon >> TERA >> 31006960 Fall, 2009 Description: ... Date Added: 2009-06-03 00:07:28 |
| 00000110.pdf Path: Carnegie Mellon >> DISK >> 31006960 Fall, 2009 Description: ... Date Added: 2009-06-03 00:07:28 |
| 00000424.pdf Path: Carnegie Mellon >> DISK >> 31003666 Fall, 2009 Description: ... Date Added: 2009-06-03 00:09:52 |
| 00000424.pdf Path: Carnegie Mellon >> TERA >> 31003666 Fall, 2009 Description: ... Date Added: 2009-06-03 00:09:52 |
| 00000018.pdf Path: Carnegie Mellon >> TERA >> 31003139 Fall, 2009 Description: ... Date Added: 2009-06-03 00:11:19 |
| 00000158.pdf Path: Carnegie Mellon >> TERA >> 31003139 Fall, 2009 Description: ... Date Added: 2009-06-03 00:11:45 |
| 077-CJ242-Jointing-Plan.pdf Path: Iowa State >> CE >> 486 Fall, 2009 Description: ... Date Added: 2009-06-03 00:13:05 |
| syllabus.pdf Path: N. Illinois >> BIOS >> 208 Fall, 2008 Description: BIOS 208T Fundamentals of Biology I Fall 2006 Class meets: MWF, 11:00-11:50, Montgomery Auditorium Instructor Dr. Joel Stafstrom: MO 342, 753-3207; email stafstrom@niu.edu Notes on email: 1) I will discard student emails that do not contain \"BIOS 208... Date Added: 2009-06-03 00:16:06 |
| finalA2003.pdf Path: NSULA >> ECN >> 11487 Fall, 2009 Description: Universit Laval Dpartement d\'conomique Professeure: Lucie Samson ECN-11487 : Thorie macroconomique 1 Examen final Automne 2003 PARTIE I : (35 points) Dites si les noncs suivants sont VRAI, FAUX ou INCERTAIN. Justifiez vos rponses. 1. Lapproche cla... Date Added: 2009-06-03 00:18:06 |
| cycles_économiques.doc Path: NSULA >> ECN >> 66769 Fall, 2009 Description: Section 1 : Les cycles conomiques Dfinition : Variations la hausse ou la baisse de l\'activit conomique, mesures par les fluctuations du PIB rel par rapport au PIB potentiel. Description : Le comportement cyclique des principales variables macro-con... Date Added: 2009-06-03 00:18:23 |
| mdes_figs.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 512 Fall, 2008 Description: Reservation Table Cycle Decoder Read Port Ialu Wr Pt 123 -1 0 1 123412 12 X X X X AND-OR Trees (AND) (OR) (AND) rp1@-1 rp2@-1 rp3@-1 rp4@-1 wp1@1 wp2@1 Decoder1@-1 Ialu1@0 Decoder2@-1 Ialu2@0 ... Date Added: 2009-06-03 00:19:46 |
| Lesson_12_Plan.doc Path: Mercer >> ETM >> 645 Fall, 2009 Description: ETM 645-12 (Spring \'09) Lesson: Design of Experiments and Applications of Heuristics Objectives: 1. Discuss techniques and methods of evaluating heuristics using a Design of Experiments approach. 2. Review wide variety of application of heuristics ... Date Added: 2009-06-03 00:20:14 |
| 3p0to3p3.pdf Path: Sveriges lantbruksuniversitet >> ENSC >> 428 Fall, 2009 Description: ... Date Added: 2009-06-03 00:20:50 |
| m6p2.pdf Path: Sveriges lantbruksuniversitet >> ENEL >> 673 Fall, 2009 Description: ... Date Added: 2009-06-03 00:21:02 |
| saracurr.pdf Path: Bowling Green >> EDHD >> 611 Fall, 2009 Description: Little Lights Curriculum Handbook Page 1 of 20 Little Lights Daycare and Preschool Curriculum Handbook Developed and Designed by Sara Fleagle Little Lights Curriculum Handbook Page 2 of 20 Table of Contents Title..page 1 Table of Contents.page ... Date Added: 2009-06-03 00:23:05 |
| classroom_teaching.pdf Path: N.C. State >> AEE >> 535 Fall, 2008 Description: ... Date Added: 2009-06-03 00:23:45 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14189.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-03 00:24:47 |
| submit.txt Path: Washington >> V >> 14000 Fall, 2009 Description: executable = allgamma_14063.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs14000-14499/14... Date Added: 2009-06-03 00:26:33 |
| genselect.txt Path: UMBC >> CS >> 202 Fall, 1997 Description: everest% CC -c genselect.C everest% CC genmain1.C genselect.o everest% everest% a.out Sort in decreasing order: A[00] = 9 A[01] = 8 A[02] = 7 A[03] = 6 A[04] = 5 A[05] = 4 A[06] = 3 A[07] = 2 A[08] = 1 A[09] = 0 Sort in increasing order: A[00] =... Date Added: 2009-06-03 00:30:57 |
| 0220.ppt Path: Hamline >> PHYS >> 1240 Fall, 2009 Description: If you removed the eyepiece from a microscope, what would you see? (red) a magnified, inverted image of the object (pink) no clear image at all (orange) a magnified, erect image of the object (green) a demagnified, inverted image of the object ... Date Added: 2009-06-03 00:31:22 |
| Company V.pdf Path: Iowa State >> ECON >> 101 Fall, 2008 Description: Company V <Initech > Product: Organic wigs Rationale: Eliminates the use of synthetic materials that could be harmful to the environment. ... Date Added: 2009-06-03 00:33:17 |
| lecture 5 Feb21.pdf Path: UCSB >> MCDB >> 152 Fall, 2008 Description: Where has neural development been so far. .where are we.and where is it going? Fertilization -> Blastula -> Gastrula -> Neurula Neuroblast Proliferation Neuroblast Differentiation Neuroblast Migration Axon Outgrowth Mechanical Movement Precise Naviga... Date Added: 2009-06-03 00:33:56 |
| Phys3122A_Chapter6.pdf Path: Georgia Tech >> PHYS >> 3122 Fall, 2008 Description: ... Date Added: 2009-06-03 00:34:45 |
| final-exam-summer-2005.pdf Path: Alabama Huntsville >> CHE >> 344 Fall, 2009 Description: ChE 344 Summer 2005 Final Exam Open Book/Notes, Closed Neighbors. Each question 20 points, 100 points total 1. Examine the Pxy and the Txy diagrams carefully and answer the following questions (a) At a pressure of 1.0 atm and a temperature of 56o C, ... Date Added: 2009-06-03 00:35:22 |
| syllabus.pdf Path: Toledo >> ECE >> 1718 Fall, 2009 Description: ECE 1718 Special Topics in Computer Hardware Design: Modern and Emerging Architectures Instructor Greg Stean, stean@eecg.toronto.edu http:/www.eecg.toronto.edu/stean Oce: EA321 (Engineering Annex) Meetings anytime, by appointment Admin Assistant ... Date Added: 2009-06-03 00:35:32 |
| MATLAB article.pdf Path: SUNY Buffalo >> MAE >> 376 Fall, 2009 Description: ... Date Added: 2009-06-03 00:35:52 |
| mae482&582-compos market segments04.pdf Path: SUNY Buffalo >> MAE >> 482 Fall, 2009 Description: 1400 1200 Aircraft Appliance Construction Reinforced Composites Market MM LBS Sold 1000 Consumer Corrosion 800 E&E Marine 600 Transportation Other 400 200 0 1960 1965 1970 1975 1980 1985 1990 1995 2000 Source: http:/www.cfa-hq.org/ind... Date Added: 2009-06-03 00:35:53 |
| P13.56.pdf Path: SUNY Buffalo >> EAS >> 208 Fall, 2009 Description: ... Date Added: 2009-06-03 00:37:34 |
| opticalnetworks.ppt Path: Auburn >> COMP >> 8320 Fall, 2009 Description: Optical Networks Rainbow for Communications Medium Sharing Time Division Multiplexing (TDM) Division Multiplexing Frequency In the optical domain, Wavelength Division Multiplexing Time Division Multiplexing Wavelength Division Multiplexin... Date Added: 2009-06-03 00:37:58 |
| submit.txt Path: Washington >> V >> 10000 Fall, 2009 Description: executable = allgamma_10077.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs10000-10499/10... Date Added: 2009-06-03 00:38:09 |
| submit.txt Path: Washington >> V >> 10323 Fall, 2009 Description: executable = allgamma_10323.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs10000-10499/10... Date Added: 2009-06-03 00:38:31 |
| error.txt Path: Washington >> V >> 10440 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Jan 29 22:57:40 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Jan 30 00:19:48 2008 ( 4928 s elapsed) ... Date Added: 2009-06-03 00:39:41 |
| log.txt Path: Washington >> V >> 10000 Fall, 2009 Description: 000 (43414.000.000) 01/29 07:24:49 Job submitted from host: <128.95.94.28:1098> . 001 (43414.000.000) 01/29 07:53:38 Job executing on host: <172.25.101.82:1056> . 005 (43414.000.000) 01/29 08:03:38 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-03 00:39:59 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05100743 Fall, 2009 Description: 05100743... Date Added: 2009-06-03 00:43:01 |
| book.pdf Path: Carnegie Mellon >> TERA >> 05101317 Fall, 2009 Description: ... Date Added: 2009-06-03 00:43:16 |
| 00000036.pdf Path: Carnegie Mellon >> TERA >> 05101611 Fall, 2009 Description: ... Date Added: 2009-06-03 00:43:31 |
| 00000036.pdf Path: Carnegie Mellon >> DISK >> 05101611 Fall, 2009 Description: ... Date Added: 2009-06-03 00:43:31 |
| 00000129.pdf Path: Carnegie Mellon >> TERA >> 05101523 Fall, 2009 Description: ... Date Added: 2009-06-03 00:45:20 |
| 00000129.pdf Path: Carnegie Mellon >> DISK >> 05101523 Fall, 2009 Description: ... Date Added: 2009-06-03 00:45:21 |
| 00000069.pdf Path: Carnegie Mellon >> TERA >> 05100702 Fall, 2009 Description: ... Date Added: 2009-06-03 00:45:54 |
| 00000050.pdf Path: Carnegie Mellon >> TERA >> 05100917 Fall, 2009 Description: ... Date Added: 2009-06-03 00:46:07 |
| 00000046.pdf Path: Carnegie Mellon >> TERA >> 05100917 Fall, 2009 Description: ... Date Added: 2009-06-03 00:46:07 |
| 00000025.pdf Path: Carnegie Mellon >> TERA >> 05100743 Fall, 2009 Description: ... Date Added: 2009-06-03 00:49:42 |
| 00000123.pdf Path: Carnegie Mellon >> TERA >> 05100743 Fall, 2009 Description: ... Date Added: 2009-06-03 00:50:11 |
| 00000003.pdf Path: Carnegie Mellon >> TERA >> 05102451 Fall, 2009 Description: ... Date Added: 2009-06-03 00:51:21 |
| 00000003.pdf Path: Carnegie Mellon >> DISK >> 05102451 Fall, 2009 Description: ... Date Added: 2009-06-03 00:51:21 |
| 00000185.pdf Path: Carnegie Mellon >> TERA >> 05101705 Fall, 2009 Description: ... Date Added: 2009-06-03 00:55:11 |
| 00000025.pdf Path: Carnegie Mellon >> TERA >> 05100698 Fall, 2009 Description: ... Date Added: 2009-06-03 00:55:45 |
| 00000025.pdf Path: Carnegie Mellon >> DISK >> 05100698 Fall, 2009 Description: ... Date Added: 2009-06-03 00:55:45 |
| 00000028.pdf Path: Carnegie Mellon >> TERA >> 05100698 Fall, 2009 Description: ... Date Added: 2009-06-03 00:55:46 |
| 00000028.pdf Path: Carnegie Mellon >> DISK >> 05100698 Fall, 2009 Description: ... Date Added: 2009-06-03 00:55:46 |
| 00000037.pdf Path: Carnegie Mellon >> TERA >> 05100634 Fall, 2009 Description: ... Date Added: 2009-06-03 00:59:45 |
| 00000037.pdf Path: Carnegie Mellon >> DISK >> 05100634 Fall, 2009 Description: ... Date Added: 2009-06-03 00:59:45 |
| 00000148.pdf Path: Carnegie Mellon >> TERA >> 05101038 Fall, 2009 Description: ... Date Added: 2009-06-03 01:02:05 |
| 00000148.pdf Path: Carnegie Mellon >> DISK >> 05101038 Fall, 2009 Description: ... Date Added: 2009-06-03 01:02:06 |
| Exam3_Review_Sol.pdf Path: MN State >> MATH >> 262 Fall, 2009 Description: MATH 262 Exam 3 Review Sheet Solutions This review sheet is intended to remind you of the concepts that you are expected to understand for the exam. It is by no means a complete representation of what could be on the exam. You are responsible for eve... Date Added: 2009-06-03 01:06:00 |
| P1-2001.pdf Path: Allan Hancock College >> JHB >> 519 Fall, 2009 Description: I NGENIERA EN AUTOMATIZACI ON I Control Automatico 2 Primer Examen Parcial Y C ONTROL I NDUSTRIAL 17 de octubre de 2001 U NIVERSIDAD N ACIONAL DE Q UILMES Primavera 2001 Pagina 1 de 1 1. Para el sistema 0 1 0 1 x = 1 0 0 x + 0 u 0 0 1 1... Date Added: 2009-06-03 01:07:04 |
| sol13.pdf Path: Allan Hancock College >> PHYS >> 1000 Fall, 2009 Description: PHYS1000 Tutorial 13 solutions 1 Tutorial 13 Solutions 1. Two resistors, of 100 and 200 , are connected in series to a 6.0 V DC power supply. (a) Draw a circuit diagram. 100 6V 200 (b) What is the total resistance? Series circuit, so just ad... Date Added: 2009-06-03 01:08:32 |
| YIL139C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YIL >> 139 Fall, 2009 Description: YIL139C.t2k EBGHTL 3 2 1 C X HHXXXXXXXX CC T X C C 1 10 20 30 40 H 3 2 1 T E T E T C H T X HGGG T T C T H C X X X X 51 60 70 80 90 H 3 2 1 CCCCECCCE H H E H T H C E E G G E H G X X X X X X X X E T E H E H H T T 3 2 1 E ... Date Added: 2009-06-03 01:08:46 |
| hw1.pdf Path: Stanford >> CS >> 355 Fall, 2009 Description: ... Date Added: 2009-06-03 01:10:48 |
| YLR054C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YLR >> 054 Fall, 2009 Description: YLR054C.t2k CB_BURIAL_14_7 2 1 AAA X X 1 10 20 30 40 A 2 1 C B E B E F C B C C F B F E D D D D D D A X X X X X X X X E E D F D E F E A E D E A F A E F E A D A D A B D E X D F B E E C B F A D D F F C E B E D D D D D D X X X X X X X X ... Date Added: 2009-06-03 01:13:35 |
| YAR071W.t2k.w0.5-logo.pdf Path: UCSC >> YAR >> 071 Fall, 2009 Description: YAR071W.t2k w0.5 5 4 3 2 1 L L XXXXXXXXXXXXXXX L 1 10 20 30 40 H 5 4 3 2 1 XXXX K T G T S E P V S L G Y E G 51 60 70 80 90 T 5 4 3 2 1 E H XXXXXXXXXXXXXXXXXXX D K D F T L P L D N L V Y F L S Y I G F W D Q N E G X ... Date Added: 2009-06-03 01:13:52 |
| YLR169W.t2k.w0.5-logo.pdf Path: UCSC >> YLR >> 169 Fall, 2009 Description: YLR169W.t2k w0.5 2 1 M L V I I V 1 10 20 30 40 E 2 1 LLR I I V V H E E T H E H E T H E XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX Q I T A VLLI V L L V V II GPL PF I V A L Y Y F L I V S S I PFFFLPLFF V L L L Y Y Y I I I V V V ... Date Added: 2009-06-03 01:14:52 |
| YOL155C.t2k.w0.5-logo.pdf Path: UCSC >> YOL >> 155 Fall, 2009 Description: YOL155C.t2k w0.5 3 2 1 F XXXXXXXXXXX M L LLNRLN Y F F K I K D D V I I A V V I V L E A D A S I E SAV S T D NNSS A SV S GPI E L EG TL N TL E S G D V A A S XXXXXXXXXXXXXX XXXX XXXXXXXXXXXXXXXXXXX F V L F L F L L M S A Q R D L K Y G Y X I... Date Added: 2009-06-03 01:17:23 |
| YGR186W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YGR >> 186 Fall, 2009 Description: YGR186W.t2k DSSP-EHL2 2 1 CCCCCCCCCCCCCCCCC E E X X X X 1 10 20 30 40 T S 2 1 H T T T T CCCC 51 T 2 1 CC E E X X C C X X C C C H E E E CCCCCCCCCCCXXC X X X X X X X X X X X X CCCECCC CCHHHHH X X X X X X X X X HHHHHHHH X X H X C X ... Date Added: 2009-06-03 01:20:48 |
| YLR069C.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YLR >> 069 Fall, 2009 Description: YLR069C.t2k DSSP-EHL2 2 1 H H H H H X X X X CCCCCH 1 10 20 30 40 H 2 1 C X X X X X X X X X X X X T E H T E H HHHC HCHHHHCCCCCCCCCHCCXEECCCCCCECC H C C C C X X X X X HHHHHH 60 H H X CCC 70 E E X X X X X X X X X 51 80 90 T S H T ... Date Added: 2009-06-03 01:24:38 |
| basketball_doc-draft.pdf Path: Los Angeles Southwest College >> CSCE >> 740 Fall, 2009 Description: Introduction Canadian Dr. James Naismith created the game of basketball from 13 original rules and while those rules have been modified over time, the essential principles remain constant. Toronto, Canada was the site of the league\'s very first game ... Date Added: 2009-06-03 01:26:38 |
| stiffness_notes_correction.pdf Path: UMass (Amherst) >> CEE >> 331 Fall, 2009 Description: ... Date Added: 2009-06-03 01:31:43 |
| 71NpNtSm.txt Path: VCU >> BNFO >> 601 Fall, 2008 Description: 71-urt attaatttttatttaaaggaattagaatttagtatcaaaaataacaattcaatggttaaatatcaaactaatatca 71-glnA aggttaatattacctgtaatccagacgttctgtaacaaagactacaaaactgtctaatgtttagaatctacgatat 71-nirA tattaaacttacgcattaatacgagaattttgtagctacttatactattttacctgagatcccgacataacc... Date Added: 2009-06-03 01:35:25 |
| Midterm Solutions W07.pdf Path: UWO >> AS >> 327 Fall, 2009 Description: ... Date Added: 2009-06-03 01:36:00 |
| Midterm Solutions W07.pdf Path: UWO >> AS >> 3427 Fall, 2009 Description: ... Date Added: 2009-06-03 01:36:11 |
| lecture13s.pdf Path: UWO >> SS >> 4864 Fall, 2009 Description: 1 Lecture 13, Topics Review Review Discussion of Assignment 2 Statistical Monte Carlo Simulation Review Bootstrap principle Empirical CDF Fn is used for resampling (nonparameter) If X has Fn as its CDF, then P (X = Xi) = 1/n for i = 1, . . ... Date Added: 2009-06-03 01:36:32 |
| shw08.pdf Path: Midwestern State University >> ME >> 439 Spring, 2009 Description: ... Date Added: 2009-06-03 01:39:04 |
| DemoApril2.pdf Path: Cal Poly >> PAGES >> 241 Fall, 2009 Description: Math 241 Lab 1, Some 3d Plots April 2, 2009 Joe College This lab is for plotting in 3 dimensions. Exercises 37 - 40 in 13.6. 37. plot3d 3 x 2 K 5 y 2 , x =K .5, y =K .5, orientation = 54, 60 , axes = normal, 5 5 style = patchcontour y -5 5 x 00 -2... Date Added: 2009-06-03 01:39:22 |
| feb12.pdf Path: Calvin >> M >> 243 Spring, 2008 Description: Statistics Lincolns Birthday February 12, 2008 Outline 1. Task: to study a population by using a sample 2. Key terms: population, parameter, sample, statistic 3. Problem: to choose a representative sample 4. simple random samples 5. sampling error... Date Added: 2009-06-03 01:40:53 |
| typolist.txt Path: Contra Costa College >> SOEN >> 229 Fall, 2009 Description: basicperl slides.pdf p11 scaler= scalar p11 automatically do the =automatically does the p12 donot = do not p18 has 100 month\" = has 100 months\" p19 not assigned gets undef = not assigned get undef p20 $i = \"Janurary\" = $i = \"January\" ... Date Added: 2009-06-03 01:43:17 |
| objects.doc Path: Mt. Holyoke >> ASTR >> 137 Fall, 2009 Description: Name: Describe what each object looks like through a telescope. Also describe in detail what each object actually is and what you are actually seeing. 1) Orion Nebula 2) Mars 3) Moon 4) Saturn 5) Sirius 6) Polaris 7) Rigel 8) Betelgeuse 9) A... Date Added: 2009-06-03 01:44:13 |
| constellations.doc Path: Mt. Holyoke >> ASTR >> 137 Fall, 2009 Description: Name: Draw all the constellations (you may need more paper) you can see from South Hadley from 7-10 pm. Label the constellations, the stars, and their magnitudes. Circle the constellations you see in the sky the next time it is clear. (Also, draw the... Date Added: 2009-06-03 01:44:14 |
| astronomy101.10.pdf Path: Mt. Holyoke >> ASTRONOMY >> 101 Fall, 2009 Description: Astronomy 101 Monday, Wednesday, Friday 10:10 11:00 am Tom Burbine tburbine@mtholyoke.edu Exam #1 Average 83.1% (24.9 points) The scores ranged from a 47% (14) to a 100% (30) 35 30 Test S core 25 20 15 10 5 0 0 2 4 6 Homework Points 8 10 1... Date Added: 2009-06-03 01:45:28 |
| corrected helix capping slide.ppt Path: St. Francis IL >> CHEM >> 255 Fall, 2009 Description: This Slide Has Been Corrected The Phenomenon of Capping Hydrogen bond donors (NH) are unsatisfied at the Nterminus of a helix. Hydrogen bond acceptors (C=O) are unsatisfied at the C-terminus of a helix. Ser, Thr, Asn may appear and cap the C=O. ... Date Added: 2009-06-03 01:46:37 |
| 1.5.OptionsTripHiroGoto.doc Path: Charleston Law >> BU >> 443 Fall, 2009 Description: Options Trip Hiro Goto International Financial Management Dr. J. A. Schnabel Options Trip Hiro Goto Page 1 of 1 On June 20, 1988, Hiro Goto, a Japanese exporter to the U.S., was faced with the problem of hedging a receivable amounting to U$10 milli... Date Added: 2009-06-03 01:48:37 |
| sierpinski9.pdf Path: Princeton >> COS >> 126 Fall, 2008 Description: ... Date Added: 2009-06-03 01:49:11 |
| 1027.ppt Path: UMBC >> CSEE >> 621 Fall, 2009 Description: More CODA replication Replica States may be transformed by Updates Storing files on closing, creation/deletions etc. 2 Phase protocol: First each site in AVSG checks LSID and CVV of client. If they are equal to or dominate its own LSID and CVV, t... Date Added: 2009-06-03 01:55:57 |
| ExtraSol.pdf Path: IUPUI >> MATH >> 222 Fall, 2008 Description: ... Date Added: 2009-06-03 01:56:57 |
| RDBdesignNF.ppt Path: East Los Angeles College >> CS >> 319 Fall, 2009 Description: Relational Data Base Design in Practice Normal Forms More about Anomalies Multi-valued / join dependencies 04/29/09 1 CS319 Theory of Databases Database Design Concepts Review 5 Anomalies illustrated by HVFC Form of the SUPPLIER relation SAIP (SN... Date Added: 2009-06-03 02:01:25 |
| ConverterAPI.pdf Path: Illinois Tech >> CS >> 115 Fall, 2009 Description: API Liters to Gallons class Converter { Converter() Converter(double) double getLiters() double getGallons double getConvert() double getConvert(double) void setLiters(double) void display() ... Date Added: 2009-06-03 02:05:36 |
| 480920.pdf Path: Michigan State University >> LIB >> 1948 Fall, 2009 Description: 20 USGA JOURNAL:September, 1948 Notes on the Public Links Event Last issue we published an article in which Morton G. Bogue inveighed against the slow player as being golfing enemy No. 1. As a contrast, it would have pleased you to see how the cont... Date Added: 2009-06-03 02:09:46 |
| 490715.pdf Path: Michigan State University >> LIB >> 1949 Fall, 2009 Description: USGA JOURNAL: July, 1949 15 Women\'s Golf Branches Out By MISS FRANCES E. STEBBINS CHAIRMAN, USGA WOMEN\'S COMMITTEE Championship golf for women will be conducted on a much broader scale this year as a result of two innovations by the United States ... Date Added: 2009-06-03 02:09:55 |
| exp01f03.pdf Path: N. Illinois >> ELE >> 340 Spring, 2008 Description: Experiment 1 ELE 340 Spring 02 ELE 340 Electric Power System Experiment 1 AC Circuits Page 1of 2 Purpose: To evaluate the voltage and current relationships in sinusoidal ac circuits. Background: The magnitude and phase of voltages and currents in ... Date Added: 2009-06-03 02:10:46 |
| SOCSI.pdf Path: San Diego State >> IVC >> 0506 Fall, 2009 Description: Social Science SOCIAL SCIENCE MAJOR An Interdisciplinary Program Note: Courses designated by an underscore are offered on the Imperial Valley Campus. All courses are available at the San Diego campus. Refer to Curricula and Courses and University Po... Date Added: 2009-06-03 02:11:37 |
| Assigment 12.pdf Path: W. Alabama >> MATH >> 115 Fall, 2009 Description: MATH 115 - Linear Algebra for Engineers Assignment # 12 solutions Q13: Let z = 4 3 - 4i. So |z| = Thus z = 8e-i/6 . (4 3)2 + 42 = 8. Thus z = 8( 23 + 1 i). 2 1 Q19: 1 e-3i/4 = 2 (cos(-3/4) + i sin(-3/4) = - 2 2 4 - 2 i 4 Q33: 3e-4i/11 = 3e... Date Added: 2009-06-03 02:15:11 |
| E2680067fpp.xls Path: Maple Springs >> ECON >> 2680 Fall, 2009 Description: ECON2680: Fall/Winter 2006/07 Glendon College, York University Student# 3690 4461 7267 9069 9881 12525 13860 21647 29561 29974 32254 33752 36019 39847 39965 40483 42925 46034 51178 57041 57476 59844 60640 63059 69003 72211 74603 78529 78764 80389 81... Date Added: 2009-06-03 02:15:23 |
| notes-240-08-24.pdf Path: Idaho >> CS >> 240 Fall, 2008 Description: Basic Algorithms Use use and modify bits 1. Scan for first frame with u=0, m=0 2. If 1) fails look for frame with u=0, m=1, setting the use bits to 0 during scan 3. If 2) failed repeating 1) and 2) will find a replacement 1 2 Resident Set Size F... Date Added: 2009-06-03 02:17:33 |
| Softkeys Cheat Sheet .pdf Path: Western Michigan >> THEA >> 4000 Fall, 2008 Description: 500 Series Softkeys Cheat Sheet Input Tile REPATCH UNPATCH HIGH DC FULL DOWN% UP% FLASH BUMP THRU ON BACKUP AT CHAN OUTPUT ERROR LOAD LIMIT FILTER> OVER LOAD OVER HEAT TRIP DELETE LO/HI LEVEL AUDIO NEXT FX MIDI NEGATIVE STOP AFTER MAN... Date Added: 2009-06-03 02:18:33 |
| Problem_9.69.pdf Path: LSU >> ME >> 3834 Fall, 2008 Description: ME3834FluidMechanics Problem9.69 Given: RacingshellofPurduecrewsapproximatedashalfofacylinder. Find: (a) Locationoftransitioninboundarylayersonhull (b) ThicknessofTBLatrearofhull (c) Totalskinfrictiondragonhull Solution: Assumeflowbehavesasonaflat... Date Added: 2009-06-03 02:19:07 |
| CS5000_F08_07.pdf Path: Utah State >> CS >> 5000 Fall, 2008 Description: CS 6890: Lecture 7 Vladimir Kulyukin Department of Computer Science Utah State University Outline Finite Automata and Regular Expression Applications A Regular Language L = 0 | n = 2k + 1, k N . n { } A DFA 0 q0 0 q1 Java Implementation: Pa... Date Added: 2009-06-03 02:21:16 |
| sectcombtmH.pdf Path: Duke >> CPS >> 140 Fall, 2009 Description: CPS 140 - Mathematical Foundations of CS Dr. S. Rodger Section: Turing Machines - Building Blocks (handout) Combining Turing Machines We will define notation that will make it easier to look at more complicated Turing machines 1. Given Turing Machin... Date Added: 2009-06-03 02:25:00 |
| week15.pdf Path: Georgia Tech >> MATH >> 6014 Fall, 2008 Description: WEEK 15 PROBLEMS Math 6014 1. A graph is a minor of another if the first can be obtained from a subgraph of the second by contracting edges. Prove that a graph is planar if and only if it has no minor isomorphic to K 5 or K3,3 . 2. Let G be a simple ... Date Added: 2009-06-03 02:25:16 |
| 105syl.02f.pdf Path: Delaware >> GEOL >> 105 Winter, 2008 Description: GEOLOGY 105 GEOLOGICAL HAZARDS THE EARTHS IMPACT ON YOUR LIFE FALL 2002 CIVILIZATION EXISTS BY GEOLOGICAL CONSENT, SUBJECT TO CHANGE WITHOUT NOTICE. GOALS OF THIS COURSE: When you complete this course, you will be able to 1. recognize and identify... Date Added: 2009-06-03 02:26:31 |
| 131-010925.pdf Path: Harvey Mudd College >> CS >> 131 Fall, 2000 Description: Review: Syntax More Lambda Calculus: Arithmetic and Fixed Points September 25, 2001 CS 131: Programming Languages Pure lambda calculus: M,N := | | x x.M M N variables functions applications That\'s it! Review: Parenthesis Conventions Terms diffe... Date Added: 2009-06-03 02:27:37 |
| Bennettfirst.pdf Path: Arizona >> POL >> 602 Fall, 2008 Description: Article: What Political Scientists Should Know about the Survey of First-Year Students in 2000 Author: Stephen Earl Bennett, Linda L. M. Bennett Issue: Jun. 2001 Journal: PS: Political Science & Politics This journal is published by the American Pol... Date Added: 2009-06-03 02:28:52 |
| lecture12.pdf Path: Kentucky >> EE >> 422 Fall, 2009 Description: EE 422G Notes: Chapter 8 Instructor: Cheung Roadmap for Discrete-Time Signal Processing Continuous-time Signal x(t) = cos(2ft) 1 0.5 0 -0.5 -1 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 Discrete-time Signals (Section 8.1) 1 0.5 0 -0.5 -1 T T... Date Added: 2009-06-03 02:29:27 |
| discussion2.pdf Path: Kentucky >> EE >> 421 Fall, 2009 Description: ... Date Added: 2009-06-03 02:29:45 |
| lecture9.pdf Path: Kentucky >> EE >> 421 Fall, 2009 Description: ... Date Added: 2009-06-03 02:30:17 |
| 4703qv1.073.pdf Path: Arkansas >> COMP >> 4703 Fall, 2009 Description: MEEG 4703 Quiz v1.073 1. (10 points) Prove that the medians of a triangle trisect themselves. 2. (10 points) Find the shortest distance ds between the line passing through points A(0, 4, 0) and B(4, 0, 2) and the line passing through points C(0, 2, 6... Date Added: 2009-06-03 02:33:47 |
| 550.445 SP09 W1 pp03.ppt Path: Johns Hopkins >> AMS >> 445 Fall, 2009 Description: 550.445 Modeling and Analysis Securities and Markets Week of January 26, 2009 Introduction and Martingales and Measures: Foundation for Fixed Income Derivatives 1.1 Principals David R Audley, Ph.D.; Sr. Lecturer in AMS david.audley@jhu.edu Office... Date Added: 2009-06-03 02:35:12 |
| Lecture 04.ppt Path: Western Washington >> LECTURE >> 407 Winter, 2009 Description: Today\'s objectives What happens when light passes through most minerals? Why do some minerals change color when the microscope stage is rotated (without analyzer)? What causes the colors you saw when you inserted the analyzer? Why do those colors... Date Added: 2009-06-03 02:38:03 |
| chapter4.pdf Path: BYU >> STATISTICS >> 361 Fall, 2009 Description: Chapter 4 -Descriptive Tools Chapter 4 Descriptive Tools Experimental Studies Observational Studies Enumerative Studies Analytical Studies Graphical Descriptive Statistics Graphical Descriptive Statistics Line Graphs Dot Plots Histograms ... Date Added: 2009-06-03 02:39:03 |
| L15_FS.ppt Path: Portland >> CS >> 333 Winter, 2008 Description: Lecture 15 File Systems File system overview Provide non-volitale storage for programs (the O.S. being the most important!) Order of magnitude more storage than memory Abstracts storage details from user Application writers can use read, writ... Date Added: 2009-06-03 02:41:00 |
| P2210-grades.doc Path: East Carolina >> DOCS >> 2210 Fall, 2009 Description: There are no grades here. The drunken pirate misplaced them. Sorry. ... Date Added: 2009-06-03 02:41:57 |
| 090211-quiz.ps Path: Rochester >> CS >> 200 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: 090211-quiz.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMBX10 CMR10 %DocumentPaperSizes: Letter %EndComments %DVIPSWebPage: (www... Date Added: 2009-06-03 02:42:06 |
| perf-criteria.pdf Path: UT Arlington >> EE >> 5355 Fall, 2008 Description: ... Date Added: 2009-06-03 02:43:45 |
| esc-gripe.txt Path: Columbia >> CU >> 103096 Fall, 2009 Description: Title: Letter to the Editor: ESC Gripe Writer: Kristian Concepcion (kjc9@columbia.edu) Section: Editorial Photos: None Ok. Why is it that the ESC feels the need to blast AcIS at every opportunity? Now, I don\'t exactly LOVE everything AcIS... Date Added: 2009-06-03 02:44:42 |
| Solid_Modeling.pdf Path: Maryville MO >> MAE >> 4980 Fall, 2009 Description: SOLID MODELING Dr. A. Sherif El-Gizawy Mechanical and Aerospace Engineering University of Missouri - Columbia Construction Techniques in ProEngineer Features !Objects (Parts) ! Assembly Feature Based Modeling \" \" \" With Pro-E, you have the abil... Date Added: 2009-06-03 02:44:52 |
| 545-10-fp.pdf Path: Washington >> PHYS >> 545 Spring, 2008 Description: Plans for tonight, and next week Labs in Room B260, Michelson interferometer group A-L has priority tonight Thursday 5/8: Fabry-Perot interferometry (both groups) Tuesday 5/13: Exam II (material covered since last exam, in Chapters 19, plus ch... Date Added: 2009-06-03 02:45:06 |
| LeathersichJeffrey_set04.pdf Path: SUNY Geneseo >> PHYS >> 313 Fall, 2009 Description: Leathersich, Jerey M p313s09 Due Wed, Feb 25, 2009 at 10:00 Physics 313: Applied Mechanics Section 1 Set 4 CA ID 6806 PA 11. [6pt] Given F1 = 2.20kN and F2 = 2F1 ; a = 6.40m, and h = 8.10m. Determine the force in members CD, CE, and BD. ATTENTION: ... Date Added: 2009-06-03 02:45:38 |
| t1a.txt Path: Lynchburg College >> CS >> 142 Fall, 2009 Description: /player.h /class Player, for an RPG /Will Briggs /Spring 2009 #ifndef PLAYER_H #define PLAYER_H enum {MAXSTRING=100}; class Player { public: enum {MAXTREASURES = 10}; Player (char* newTitle=\", int baseHitPoints=0) { strcpy(_title, newTitle);... Date Added: 2009-06-03 02:46:42 |
| a.pdf Path: Duke >> CPS >> 149 Fall, 2009 Description: ACM Intercollegiate Programming Contest Pacific NW Region 1999 Problem A Biorhythms Some people believe that there are three cycles in a person\'s life that start the day he or she is born. These three cycles are the physical, emotional, and intellec... Date Added: 2009-06-03 02:49:42 |
| error.txt Path: Washington >> JOBS >> 11000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:08:05 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:19:21 2008 ( 676 s elapsed) ... Date Added: 2009-06-03 02:50:27 |
| log.txt Path: Washington >> JOBS >> 11455 Fall, 2009 Description: 000 (53451.000.000) 02/07 04:23:44 Job submitted from host: <128.95.94.28:1098> . 001 (53451.000.000) 02/07 05:19:50 Job executing on host: <172.25.101.164:1060> . 005 (53451.000.000) 02/07 05:33:33 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-03 02:52:19 |
| error.txt Path: Washington >> JOBS >> 11045 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 04:34:10 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 04:44:53 2008 ( 643 s elapsed) ... Date Added: 2009-06-03 02:53:06 |
| lab4.txt Path: UVA >> CS >> 494 Fall, 2008 Description: CS 494 Lab Assignment, 3/16/07 1. In censusgui.m change the 1950 population from 150.697 million to 50.697 million. This produces an extreme outlier in the data. Which models are the most affected by this outlier? Which models are leas... Date Added: 2009-06-03 02:56:12 |
| cs182-quickfacts.pdf Path: Harvey Mudd College >> CS >> 182 Spring, 2006 Description: CS 182: Operating Systems Spring 2004 Quick Facts Class Overview Course Code: Course Title: Website: or Wiki: Help Email: Professor: Prerequisite: Credit Hours: Class Meetings: CS 182 Operating Systems http:/www.cs.hmc.edu/cs182/ http:/www.cs.hmc.e... Date Added: 2009-06-03 02:56:24 |
| Lec21.ppt Path: Harvey Mudd College >> CS >> 154 Spring, 2003 Description: Cross-section Question by Scott Kim How many of these can be formed by taking a cross-section of a cube? CS 154 Today Final Lab Day Final Projects Assignment #10 A (Monday, 4/25 in class) (Friday, 4/29 in class) (due Friday, 5/6) Final Proje... Date Added: 2009-06-03 02:56:30 |
| conc.6.pdf Path: Harvey Mudd College >> CS >> 133 Spring, 2000 Description: Modeling with Sequence Diagrams Database Concurrency Control Robert M. Keller Harvey Mudd College April 2004 1 Sequence diagrams are from UML Each line in a diagram corresponds to some object, in our case Database items (relations, tuples, ) Tr... Date Added: 2009-06-03 02:57:01 |
| DRuleRep08.pdf Path: Arkansas >> FACSEN >> 041608 Fall, 2009 Description: D-Transfer Rule Report University of Arkansas Fayetteville, Arkansas March 14, 2008 On November 14, 2003, the University of Arkansas (UA) Board of Trustees approved a resolution requiring an administrative review process for requests of exceptions to... Date Added: 2009-06-03 02:58:02 |
| 3biology.pdf Path: USC >> RAPID >> 495 Fall, 2009 Description: ... Date Added: 2009-06-03 03:01:54 |
| testFf05solns.pdf Path: Kalamazoo >> MATH >> 113 Fall, 2009 Description: P (g e t5639gUo6B )#V e)#V W RQH| `oymt3qpol v u sr nm p e)#V W 5fUqQ Q| W 1Ds s h 1 i e B d # f d V # # i i! V D d d \' WV ! S I Q P E)VtEbr)#j6)#gt\"!)1$y!q6yrv0gE6x0$\"!g0yw6z\"@~)@tE66vg)#(`XU)#$TR%C%... Date Added: 2009-06-03 03:04:05 |
| Chap_9_6_hw_Set9.pdf Path: U. Memphis >> CE >> 4135 Fall, 2009 Description: CIVL 4135 HOMEWORK SET 9 1. Select the spacing of U-shaped stirrups made of No. 3 bars for the beam shown below. Use Eq. 11- of ACI 318 to obtain Vc. -5 3\" 4-#8 f c = 3, 000 psi f y = 40, 000 psi 28\" 8 - #10 - 4\" 13\" Wu = 9.0 (k/ft) 25\'- 6\" - ... Date Added: 2009-06-03 03:13:01 |
| 10 - Cement Hydration.pdf Path: U. Memphis >> CE >> 3137 Fall, 2009 Description: Cement Hydration Cement Hydration Liquid Paste Solid Initial Set Final Set CIVL 3137 41 Thixotropy thixotropy (n.) The property exhibited by certain gels of becoming fluid when stirred or shaken then returning to the semisolid state upon standi... Date Added: 2009-06-03 03:13:03 |
| Customer_Requirements_Functional_Review_2.xls Path: RIT >> P >> 08205 Fall, 2009 Description: Customer Requirements RP1 Project Family 20072 20073 RP 208 Week 3 Customer Requirement Collaboratively develop MM\'s with P08208 team will jointly produce the final products Transport 1kg payload Power motors with a PWM signal Use encoder feedbac... Date Added: 2009-06-03 03:20:31 |
| 00000024.pdf Path: Carnegie Mellon >> TERA >> 05102444 Fall, 2009 Description: ... Date Added: 2009-06-03 03:32:00 |
| 00000025.pdf Path: Carnegie Mellon >> TERA >> 05101146 Fall, 2009 Description: ... Date Added: 2009-06-03 03:33:59 |
| 00000025.pdf Path: Carnegie Mellon >> DISK >> 05101146 Fall, 2009 Description: ... Date Added: 2009-06-03 03:33:59 |
| 00000006.pdf Path: Carnegie Mellon >> TERA >> 05101681 Fall, 2009 Description: ... Date Added: 2009-06-03 03:42:56 |
| 00000006.pdf Path: Carnegie Mellon >> DISK >> 05101681 Fall, 2009 Description: ... Date Added: 2009-06-03 03:42:57 |
| 00000036.pdf Path: Carnegie Mellon >> TERA >> 05101160 Fall, 2009 Description: ... Date Added: 2009-06-03 03:49:02 |
| ContextPicture.pdf Path: Wisconsin >> PSY >> 225 Fall, 2009 Description: ... Date Added: 2009-06-03 03:49:51 |
| Lysias1BMCR.rtf Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: Bryn Mawr Classical Review 1999.10.39 M.J. Edwards, Lysias. Five Speeches. London: Bristol Classical Press, 1999. Pp. 192. ISBN 185399-447-2. 11.95. Reviewed by Debra Hamel (eponymous@dhamel.com) Edwards\' commentary on Lysias 1, 12, 19, 22, and 30 is... Date Added: 2009-06-03 03:52:10 |
| _____.doc Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: , Adv. A. certainly, in fact, confirming something, freq. in contrast with something which is not confirmed 1. really; so \' after a parenthesis; ,- ,- \' but if he is so, Id.Ap.34d; so \' . . but at all events; concessive, I grant you, \' ... Date Added: 2009-06-03 03:52:47 |
| Vocab1-6Grades.xls Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: Sheet1 Last Name, First Name (Username) | Student IDVQ01 [Pts: 100 Weight: 0% Category: Quiz]VQ02 [Pts: 100 Weight: 0% Ca Kenty, Joanna (jkenty) | 6524259510040100-80-1001010010-635Not Applicable Weiskott, Eric (eweiskott) | 680701100100401004010040... Date Added: 2009-06-03 03:55:24 |
| genitive.txt Path: Wesleyan >> GRK >> 201 Fall, 2009 Description: MC <p style=\"line-height: 200%\"><font size=\"3\">v <span style=\"background-color:yellow\"></span> , , f , x Q v p v , 7 Q P 4 : </font></p> Genitive of Possession incorrect Genitive Partitive incorrect Genitive Predicate incorrect Genitive Subject... Date Added: 2009-06-03 03:58:11 |
| han1314hw.pdf Path: Austin CC >> MTHDEPT >> 1314 Fall, 2009 Description: HOMEWORK for College Algebra, 3rd edition, by Larson, Hostetler, & Hodgkins, page 1 If you find that you need help (even changing an answer after you look it up qualifies as help) on more than 25% of these, then you probably should do more homework o... Date Added: 2009-06-03 04:05:14 |
| iw2cw3c.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: PAGER/SGML Page 1 of 4 Userid: _ Fileid: IW2CW3C.cvt Leading adjust: 5% (23-Jan-2003) Draft (Init. & date) Ok to Print Instructions for Forms W-2c and W-3c 9:01 - 23-JAN-2003 The type and rule above prints on all proofs including departmen... Date Added: 2009-06-03 04:07:02 |
| smith.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: Adam Smith and the Limits of Empiricism In the debate between rationalism and sentimentalism, one of the strongest weapons in the rationalist arsenal is the notion that some of our actions ought to be motivated by a sense of duty. The strength of thi... Date Added: 2009-06-03 04:07:04 |
| 591.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: IN THE UNITED STATES DISTRICT COURT FOR THE DISTRICT OF MARYLAND IN RE MICROSOFT CORP. ANTITRUST LITIGATION * * MDL 1332 * * OPINION This MDL proceeding encompasses private antitrust actions instituted against Microsoft Corporation by a group of con... Date Added: 2009-06-03 04:07:54 |
| RL454.pdf Path: Berkeley >> ECON >> 161 Fall, 2008 Description: 14.454 Fall 1998 Olivier Blanchard E52-373, 3-8891 Macroeconomic Theory IV. Imperfections and Macro A star denotes required reading. 1. Labor markets * Blanchard, O., Flows, Bargaining, and Unemployment, Notes, February 1998 Mortensen, D. and C. P... Date Added: 2009-06-03 04:08:35 |
| Page17.pdf Path: Idaho >> PNW >> 0346 Fall, 2009 Description: The Cost of Owning and Operating Orchard Tractor 65 HP 48\" Base FWD Cab Projected annual costs and cost per hour of use for 2000. Hours Years to of Use Trade Depreciation THII Repairs 100 15.0 2,094 2,935 18 200 15.0 2,094 2,935 70 300 15.0 2,094 2,... Date Added: 2009-06-03 04:10:16 |
| Nagel_Joane.001-02.pdf Path: Oregon >> INTL >> 447 Fall, 2008 Description: ... Date Added: 2009-06-03 04:13:24 |
| 00000023.pdf Path: Carnegie Mellon >> TERA >> 05101667 Fall, 2009 Description: ... Date Added: 2009-06-03 04:16:54 |
| 20081009-00z-925.ps Path: San Jose State >> ARCHIVE >> 925 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: %Creator: GEMPAK %EndComments %DocumentsFont:(atend) %Pages:(atend) /M {moveto} def /L {lineto} def /N {newpath} def /LW {setlinewidth} def /A {arc} def /AF {arc fill} def /MS {makefont setfont} def /FF {findfont} def /CF {curr... Date Added: 2009-06-03 04:17:50 |
| 00000017.pdf Path: Carnegie Mellon >> DISK >> 05101702 Fall, 2009 Description: ... Date Added: 2009-06-03 04:23:09 |
| 00000017.pdf Path: Carnegie Mellon >> TERA >> 05101702 Fall, 2009 Description: ... Date Added: 2009-06-03 04:23:09 |
| 00000007.pdf Path: Carnegie Mellon >> TERA >> 05101567 Fall, 2009 Description: ... Date Added: 2009-06-03 04:23:18 |
| 00000007.pdf Path: Carnegie Mellon >> DISK >> 05101567 Fall, 2009 Description: ... Date Added: 2009-06-03 04:23:19 |
| 00000015.pdf Path: Carnegie Mellon >> TERA >> 05101567 Fall, 2009 Description: ... Date Added: 2009-06-03 04:23:21 |
| 00000009.pdf Path: Carnegie Mellon >> TERA >> 05101417 Fall, 2009 Description: ... Date Added: 2009-06-03 04:23:57 |
| 28Sep06.pdf Path: Columbia >> CS >> 4156 Fall, 2009 Description: COMS W4156: Advanced Software Engineering Prof. Gail Kaiser Kaiser+4156@cs.columbia.edu http:/york.cs.columbia.edu/classes/cs4156/ 28 September 2006 Kaiser: COMS W4156 Fall 2006 1 Enterprise Java Beans (primarily EJB 1.1) continued. 28 September... Date Added: 2009-06-03 04:26:05 |
| 01b_xml.pdf Path: University of Louisiana at Lafayette >> FDD >> 207 Fall, 2009 Description: AQuickIntroductiontoXML (2008.07.15) FrankDucrest XML eXtensibleMarkupLanguage XML 2 designedasauniversaldatadescriptionmeta language likeHTML,consistsoftags usedtodescribestructureddatainplaintextto makestandardizeddatainterchangepossible toda... Date Added: 2009-06-03 04:28:01 |
| ECE1270_IntroInstr.pdf Path: Utah >> ECE >> 1270 Spring, 2008 Description: 1270 LABORATORY PROJECT NO. 1 LAB 1 Introduction Writing Tips Tips: a) b) The first sentence should give the best one line summary of the report possible. This gives the reader motivation to read the entire report. Be succinct and specific. After t... Date Added: 2009-06-03 04:29:08 |
| ECE1270_PrFinalExsolnp12.pdf Path: Utah >> ECE >> 1270 Spring, 2008 Description: ... Date Added: 2009-06-03 04:29:19 |
| swb_timeinfo.txt Path: Berkeley >> ASTRO >> 00338177 Fall, 2009 Description: #file=swbz_15-350lc.txt dt=0.02 tstart=2.260 tstop=2.980 #t90 dt90 t50 dt50 rt90 drt90 rt50 drt50 rt45 drt45 tav dtav tmax dtmax trise dtrise tfall dtfall cts cts_err pk_rate dpk_rate band 0.480 0.106 0.320 0.070 0.320 ... Date Added: 2009-06-03 04:34:06 |
| swbz_15-350lc.txt Path: Berkeley >> ASTRO >> 00176818 Fall, 2009 Description: # t-820988600.119999 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -1.480000 0.002495 0.012908 0.005411 0.012569 -0.003039 0.012000 -0.006828 0.011298 -1.340000 0.009328 0.013668 0.016747 0.01396... Date Added: 2009-06-03 04:35:05 |
| swbz_15-350lc.txt Path: Berkeley >> ASTRO >> 00106442 Fall, 2009 Description: # t-792882364.000000 [s] rate, rate_error in 15-25, 25-50, 50-100, 100-350 [keV] -35.500000 -0.002701 0.062525 0.045482 0.047069 -0.001412 0.045363 0.039394 0.048284 -35.370000 -0.001586 0.054352 -0.006776 0.05413... Date Added: 2009-06-03 04:35:50 |
| dss_radec.txt Path: Berkeley >> ASTRO >> 00020085 Fall, 2009 Description: #ra dec rmag drmag 262.590226 16.319630 20.047 0.114 262.521098 16.320233 19.824 0.092 262.447250 16.320879 20.366 0.153 262.338783 16.321671 20.369 0.145 262.235202 16.322492 19.663 0.079 262.291100 16.322163 18.369 0.025 262.258799 16.322483 19.762... Date Added: 2009-06-03 04:38:16 |
| spec_wt.txt Path: Berkeley >> ASTRO >> 00338895 Fall, 2009 Description: # tmin tmax 0.395731 6.18059 [ksec] ;instrument XRT ;exposure 86.854055 ;xunit kev ;bintype counts 0.000000 0.010000 0.000000 0.000000 0.010000 0.020000 0.000000 0.000000 0.020000 0.030000 0.000000 0.000000 0.030000 0.040000 0.000000 0... Date Added: 2009-06-03 04:38:19 |
| chem317d01.txt Path: Sveriges lantbruksuniversitet >> CHEM >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: CHEM 317-2 D01 LOCATION: SFU TITLE: ANAL.ENVIRON.CHEM. SECTION TYPE: LAB SEMESTER: 1997-1 ENROL: 4 ... Date Added: 2009-06-03 04:38:40 |
| fpa332e01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19971 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: FPA 332-3 E01 LOCATION: DOW TITLE: FILM PRODUCTION SEM. SECTION TYPE: SEM SEMESTER: 1997-1 ENROL: 18... Date Added: 2009-06-03 04:38:53 |
| log.txt Path: Washington >> V >> 13274 Fall, 2009 Description: 000 (46774.000.000) 02/01 13:47:23 Job submitted from host: <128.95.94.28:1098> . 001 (46774.000.000) 02/01 18:39:10 Job executing on host: <172.25.101.73:1057> . 006 (46774.000.000) 02/01 18:59:18 Image size of job updated: 376208 . 005 (46774.000.0... Date Added: 2009-06-03 04:41:33 |
| log.txt Path: Washington >> V >> 13000 Fall, 2009 Description: 000 (46821.000.000) 02/01 13:48:11 Job submitted from host: <128.95.94.28:1098> . 001 (46821.000.000) 02/01 18:55:41 Job executing on host: <172.25.101.43:1062> . 006 (46821.000.000) 02/01 19:15:49 Image size of job updated: 451324 . 005 (46821.000.0... Date Added: 2009-06-03 04:41:39 |
| lecture01-6.pdf Path: George Mason >> INFS >> 767 Fall, 2009 Description: THE OM-AM WAY INFS 767 Fall 2003 What? The RBAC96 Model Prof. Ravi Sandhu George Mason University Ravi Sandhu Objectives Model Architecture Mechanism How? A s s u r a n c e 4 AUTHORIZATION, TRUST AND RISK v Information LAYERS AND LAYERS v Mul... Date Added: 2009-06-03 04:43:49 |
| Week 2 Lectures.pdf Path: Virgin Islands >> PSYC >> 342 Fall, 2009 Description: 1 The Main Issues of Developmental Psychology 1. What is the basic nature of human beings? Mechanistic vs. organismic world view Controversy over the nature of change: Is any change developmental change? Organismic and mechanistic definitions of c... Date Added: 2009-06-03 04:45:47 |
| Dialect-2007-09-27.ppt Path: Tulane >> SPAN >> 427 Fall, 2009 Description: 1492; los judos y el judeoespaol Penny 6: pp. 264-290 Dialectologa Iberoamericana SPAN 427 Otoo 2007 Anuncios Pgina web permanente: http:/www.tulane. edu/~spanling/Span427/ Hay tres copias de cada libro en el Copy Center, 3146 Calhoun St., 218-594... Date Added: 2009-06-03 04:46:54 |
| L19_OS_Ch08.pdf Path: Kennesaw >> CS >> 3530 Fall, 2008 Description: Chapter 8 File Management Purpose of File Management Data should be organized in some convenient and efficient manner. In particular, users should be able to: Put data into files Find and use files that have previously been created 2 File Syste... Date Added: 2009-06-03 04:47:04 |
| 23 Impressionism.pdf Path: BYU >> MFG >> 202 Winter, 2008 Description: Impressionism and Fin de Sicle French Nationalism After the Franco-Prussian war Defeated and embarrassed Culture was a point of pride Language (how it was said just as important as what was said) Food (how it was produced and presented as impor... Date Added: 2009-06-03 04:47:31 |
| ce509_hsol37p.pdf Path: SUNY Buffalo >> CE >> 531 Fall, 2009 Description: ... Date Added: 2009-06-03 04:49:50 |
| Lect501_22.pdf Path: Penn State >> STAT >> 501 Fall, 2008 Description: ... Date Added: 2009-06-03 04:50:10 |
| 315SummarySheet.doc Path: University of Baltimore >> ECON >> 315 Fall, 2009 Description: What Have We Learned Up to Now? 1. What is Management Science? (A structured approach to problem solving) - Problem Understanding, Problem Formulation, Search for a Solution, What-if Analysis. - Modeling? (Reflection before Action) - Thinking as a Me... Date Added: 2009-06-03 04:51:27 |
| JSTeststarter.doc Path: CSU Dominguez Hills >> TBE >> 540 Spring, 2008 Description: Start Working on Your HTML Tags/JavaScript Test! Find as many answers as you can now, then watch for the rest of them. 1. The HTML used for a web page can be viewed in a browser by choosing. View, Source Save, Text Tools, Show Links 2. HTML tags. ... Date Added: 2009-06-03 04:51:57 |
| Chapter 7 - Mixtures.pdf Path: Air Force Academy >> GROUPS >> 242 Fall, 2009 Description: Chapter 7 : Simple Mixtures Using the concept of chemical potential to describe the physical properties of a mixture. Outline 1)Partial Molar Quantities 2)Thermodynamics of Mixing 3)Chemical Potentials of Solutions 4)Colligative Properties Partial ... Date Added: 2009-06-03 04:52:32 |
| Chapter 25 - Intro Kinetics Multiple Slides.pdf Path: Air Force Academy >> GROUPS >> 242 Fall, 2009 Description: Kinetics Chapter 25: The Rates of Chemical Reactions Mainly a review of first year. We look at empirical chemical kinetics and integrated rate equations. The steady-state approximation. We then focus on mechanistic details. Part 2 : Kinetics Chapte... Date Added: 2009-06-03 04:52:33 |
| 2006 Map Terms.doc Path: Minnesota >> HIST >> 1031 Fall, 2009 Description: History 1031W: Western Civilization to 1500 Fall 2006 Terms to Study for Map Exercise: 1. Jerusalem 2. Athens 3. Sparta 4. Nile 5. Euphrates 6. Crete 7. Rome 8. Hellespont 9. Carthage 10. Aegean Sea 11. Mediterranean 12. Sicily 13. Cyprus 14. Troy 15... Date Added: 2009-06-03 04:52:58 |
| 00000021.pdf Path: Carnegie Mellon >> DISK >> 31005183 Fall, 2009 Description: ... Date Added: 2009-06-03 04:54:07 |
| 00000021.pdf Path: Carnegie Mellon >> TERA >> 31005183 Fall, 2009 Description: ... Date Added: 2009-06-03 04:54:07 |
| 00000263.pdf Path: Carnegie Mellon >> TERA >> 31008399 Fall, 2009 Description: ... Date Added: 2009-06-03 04:57:02 |
| 00000316.pdf Path: Carnegie Mellon >> TERA >> 31003680 Fall, 2009 Description: ... Date Added: 2009-06-03 04:58:49 |
| 00000316.pdf Path: Carnegie Mellon >> DISK >> 31003680 Fall, 2009 Description: ... Date Added: 2009-06-03 04:58:49 |
| 00000017.pdf Path: Carnegie Mellon >> TERA >> 31007210 Fall, 2009 Description: ... Date Added: 2009-06-03 04:59:10 |
| 00000017.pdf Path: Carnegie Mellon >> DISK >> 31007210 Fall, 2009 Description: ... Date Added: 2009-06-03 04:59:11 |
| 00000033.pdf Path: Carnegie Mellon >> TERA >> 31006482 Fall, 2009 Description: ... Date Added: 2009-06-03 05:02:19 |
| 00000061.pdf Path: Carnegie Mellon >> TERA >> 31008401 Fall, 2009 Description: ... Date Added: 2009-06-03 05:05:08 |
| 00000061.pdf Path: Carnegie Mellon >> DISK >> 31008401 Fall, 2009 Description: ... Date Added: 2009-06-03 05:05:08 |
| An Internal Probe by Enron Reveals.doc Path: Ill. Chicago >> MGMT >> 495 Fall, 2008 Description: An Internal Probe by Enron Reveals Improper Transactions, Self-Dealing By REBECCA SMITH and JOHN R. EMSHWILLER Staff Reporters of THE WALL STREET JOURNAL A highly anticipated report by a special committee of Enron Corp.\'s board investigating the ene... Date Added: 2009-06-03 05:07:25 |
| GraesserSingerTrabasso.pdf Path: Ill. Chicago >> PSYCH >> 454 Fall, 2009 Description: ... Date Added: 2009-06-03 05:07:37 |
| 00000423.pdf Path: Carnegie Mellon >> TERA >> 31008401 Fall, 2009 Description: ... Date Added: 2009-06-03 05:07:44 |
| 00000423.pdf Path: Carnegie Mellon >> DISK >> 31008401 Fall, 2009 Description: ... Date Added: 2009-06-03 05:07:44 |
| 00000467.pdf Path: Carnegie Mellon >> TERA >> 31008401 Fall, 2009 Description: ... Date Added: 2009-06-03 05:07:59 |
| 00000467.pdf Path: Carnegie Mellon >> DISK >> 31008401 Fall, 2009 Description: ... Date Added: 2009-06-03 05:08:00 |
| 00000019.pdf Path: Carnegie Mellon >> TERA >> 31004894 Fall, 2009 Description: ... Date Added: 2009-06-03 05:11:01 |
| 00000025.pdf Path: Carnegie Mellon >> TERA >> 31008421 Fall, 2009 Description: ... Date Added: 2009-06-03 05:11:38 |
| 00000074.pdf Path: Carnegie Mellon >> TERA >> 31008421 Fall, 2009 Description: ... Date Added: 2009-06-03 05:11:48 |
| 00000250.pdf Path: Carnegie Mellon >> TERA >> 31008421 Fall, 2009 Description: ... Date Added: 2009-06-03 05:12:28 |
| 00000451.pdf Path: Carnegie Mellon >> TERA >> 31008421 Fall, 2009 Description: ... Date Added: 2009-06-03 05:13:09 |
| 00000118.pdf Path: Carnegie Mellon >> DISK >> 31008430 Fall, 2009 Description: ... Date Added: 2009-06-03 05:13:49 |
| 00000118.pdf Path: Carnegie Mellon >> TERA >> 31008430 Fall, 2009 Description: ... Date Added: 2009-06-03 05:13:49 |
| 00000413.pdf Path: Carnegie Mellon >> TERA >> 31008406 Fall, 2009 Description: ... Date Added: 2009-06-03 05:18:02 |
| 00000413.pdf Path: Carnegie Mellon >> DISK >> 31008406 Fall, 2009 Description: ... Date Added: 2009-06-03 05:18:02 |
| 00000021.pdf Path: Carnegie Mellon >> TERA >> 31008408 Fall, 2009 Description: ... Date Added: 2009-06-03 05:18:12 |
| 00000021.pdf Path: Carnegie Mellon >> DISK >> 31008408 Fall, 2009 Description: ... Date Added: 2009-06-03 05:18:12 |
| 00000197.pdf Path: Carnegie Mellon >> DISK >> 31008408 Fall, 2009 Description: ... Date Added: 2009-06-03 05:19:03 |
| 00000197.pdf Path: Carnegie Mellon >> TERA >> 31008408 Fall, 2009 Description: ... Date Added: 2009-06-03 05:19:03 |
| sa150d01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: SA 150-4 D01 LOCATION: SFU TITLE: INTRO TO SOCIOLOGY SECTION TYPE: LEC SEMESTER: 1998-1 ENROL: 12... Date Added: 2009-06-03 05:20:30 |
| fpa448d01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19981 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: FPA 448-3 D01 LOCATION: SFU TITLE: DIRECT.STDS-MUSIC I SECTION TYPE: SEC SEMESTER: 1998-1 ENROL: 3 ... Date Added: 2009-06-03 05:20:57 |
| 00000188.pdf Path: Carnegie Mellon >> TERA >> 31006551 Fall, 2009 Description: ... Date Added: 2009-06-03 05:24:41 |
| 00000188.pdf Path: Carnegie Mellon >> DISK >> 31006551 Fall, 2009 Description: ... Date Added: 2009-06-03 05:24:42 |
| 00000106.pdf Path: Carnegie Mellon >> TERA >> 31005685 Fall, 2009 Description: ... Date Added: 2009-06-03 05:25:53 |
| 00000034.pdf Path: Carnegie Mellon >> TERA >> 31008411 Fall, 2009 Description: ... Date Added: 2009-06-03 05:26:24 |
| 00000034.pdf Path: Carnegie Mellon >> DISK >> 31008411 Fall, 2009 Description: ... Date Added: 2009-06-03 05:26:24 |
| 00000013.pdf Path: Carnegie Mellon >> TERA >> 31005845 Fall, 2009 Description: ... Date Added: 2009-06-03 05:29:32 |
| 00000013.pdf Path: Carnegie Mellon >> DISK >> 31005845 Fall, 2009 Description: ... Date Added: 2009-06-03 05:29:32 |
| 00000141.pdf Path: Carnegie Mellon >> TERA >> 31007295 Fall, 2009 Description: ... Date Added: 2009-06-03 05:31:31 |
| 00000141.pdf Path: Carnegie Mellon >> DISK >> 31007295 Fall, 2009 Description: ... Date Added: 2009-06-03 05:31:31 |
| 24061homework11.pdf Path: Pittsburgh >> MATH >> 061 Fall, 2009 Description: Calculus III Homework 1, due 9/7/5 Question 1 Calculate the following partial derivatives: x y ln y3 x3 y3 x3 ln (sin2 (xy) x (sin2 (xy) y y x y 2 exy x y 2 exy y Question 2 Consider the conic x2 + 4y 2 4x + 4y = 20. Put the conic in sta... Date Added: 2009-06-03 05:32:50 |
| 00000117.pdf Path: Carnegie Mellon >> TERA >> 31008393 Fall, 2009 Description: ... Date Added: 2009-06-03 05:32:53 |
| 00000117.pdf Path: Carnegie Mellon >> DISK >> 31008393 Fall, 2009 Description: ... Date Added: 2009-06-03 05:32:53 |
| 00000144.pdf Path: Carnegie Mellon >> TERA >> 31007614 Fall, 2009 Description: ... Date Added: 2009-06-03 05:33:51 |
| 00000144.pdf Path: Carnegie Mellon >> DISK >> 31007614 Fall, 2009 Description: ... Date Added: 2009-06-03 05:33:51 |
| 00000229.pdf Path: Carnegie Mellon >> TERA >> 31007614 Fall, 2009 Description: ... Date Added: 2009-06-03 05:34:16 |
| 00000229.pdf Path: Carnegie Mellon >> DISK >> 31007614 Fall, 2009 Description: ... Date Added: 2009-06-03 05:34:16 |
| 00000317.pdf Path: Carnegie Mellon >> TERA >> 31007614 Fall, 2009 Description: ... Date Added: 2009-06-03 05:34:42 |
| 00000317.pdf Path: Carnegie Mellon >> DISK >> 31007614 Fall, 2009 Description: ... Date Added: 2009-06-03 05:34:43 |
| 00000269.pdf Path: Carnegie Mellon >> TERA >> 31005676 Fall, 2009 Description: ... Date Added: 2009-06-03 05:37:27 |
| 00000269.pdf Path: Carnegie Mellon >> DISK >> 31005676 Fall, 2009 Description: ... Date Added: 2009-06-03 05:37:27 |
| 00000493.pdf Path: Carnegie Mellon >> DISK >> 31005676 Fall, 2009 Description: ... Date Added: 2009-06-03 05:38:52 |
| 00000493.pdf Path: Carnegie Mellon >> TERA >> 31005676 Fall, 2009 Description: ... Date Added: 2009-06-03 05:38:52 |
| 00000127.pdf Path: Carnegie Mellon >> TERA >> 31007235 Fall, 2009 Description: ... Date Added: 2009-06-03 05:41:01 |
| 00000127.pdf Path: Carnegie Mellon >> DISK >> 31007235 Fall, 2009 Description: ... Date Added: 2009-06-03 05:41:01 |
| 00000249.pdf Path: Carnegie Mellon >> TERA >> 31004902 Fall, 2009 Description: ... Date Added: 2009-06-03 05:43:21 |
| 00000249.pdf Path: Carnegie Mellon >> DISK >> 31004902 Fall, 2009 Description: ... Date Added: 2009-06-03 05:43:21 |
| 00000038.pdf Path: Carnegie Mellon >> TERA >> 31007268 Fall, 2009 Description: ... Date Added: 2009-06-03 05:45:07 |
| 00000038.pdf Path: Carnegie Mellon >> DISK >> 31007268 Fall, 2009 Description: ... Date Added: 2009-06-03 05:45:07 |
| 00000069.pdf Path: Carnegie Mellon >> TERA >> 31007268 Fall, 2009 Description: ... Date Added: 2009-06-03 05:45:16 |
| 00000069.pdf Path: Carnegie Mellon >> DISK >> 31007268 Fall, 2009 Description: ... Date Added: 2009-06-03 05:45:16 |
| 00000316.pdf Path: Carnegie Mellon >> TERA >> 31008390 Fall, 2009 Description: ... Date Added: 2009-06-03 05:46:58 |
| 00000054.pdf Path: Carnegie Mellon >> TERA >> 31005970 Fall, 2009 Description: ... Date Added: 2009-06-03 05:50:19 |
| 00000173.pdf Path: Carnegie Mellon >> TERA >> 31005970 Fall, 2009 Description: ... Date Added: 2009-06-03 05:50:42 |
| chklst-ud1.pdf Path: Delaware >> MEEG >> 101 Fall, 2008 Description: chklst-ud1.doc Modeling Assessment Checklist Evaluation of Evaluated by: Yes No Specific Requirements s Work, Team _ Work Product Being Evaluated: UD1: UD Computing, UNIX Checklist Item 1. Were the presentation expectations met (including context... Date Added: 2009-06-03 05:52:39 |
| 00000265.pdf Path: Carnegie Mellon >> DISK >> 31005547 Fall, 2009 Description: ... Date Added: 2009-06-03 05:53:27 |
| 00000265.pdf Path: Carnegie Mellon >> TERA >> 31005547 Fall, 2009 Description: ... Date Added: 2009-06-03 05:53:27 |
| 00000432.pdf Path: Carnegie Mellon >> TERA >> 31005547 Fall, 2009 Description: ... Date Added: 2009-06-03 05:54:51 |
| 00000432.pdf Path: Carnegie Mellon >> DISK >> 31005547 Fall, 2009 Description: ... Date Added: 2009-06-03 05:54:51 |
| 00000343.pdf Path: Carnegie Mellon >> TERA >> 31003138 Fall, 2009 Description: ... Date Added: 2009-06-03 05:56:38 |
| 00000344.pdf Path: Carnegie Mellon >> TERA >> 31003138 Fall, 2009 Description: ... Date Added: 2009-06-03 05:56:38 |
| 00000488.pdf Path: Carnegie Mellon >> TERA >> 31003138 Fall, 2009 Description: ... Date Added: 2009-06-03 05:57:04 |
| 00000052.pdf Path: Carnegie Mellon >> TERA >> 31005968 Fall, 2009 Description: ... Date Added: 2009-06-03 05:58:07 |
| 00000052.pdf Path: Carnegie Mellon >> DISK >> 31005968 Fall, 2009 Description: ... Date Added: 2009-06-03 05:58:07 |
| 00000120.pdf Path: Carnegie Mellon >> TERA >> 31005968 Fall, 2009 Description: ... Date Added: 2009-06-03 05:58:25 |
| 00000120.pdf Path: Carnegie Mellon >> DISK >> 31005968 Fall, 2009 Description: ... Date Added: 2009-06-03 05:58:25 |
| 00000049.pdf Path: Carnegie Mellon >> TERA >> 31008392 Fall, 2009 Description: ... Date Added: 2009-06-03 05:59:25 |
| 00000049.pdf Path: Carnegie Mellon >> DISK >> 31008392 Fall, 2009 Description: ... Date Added: 2009-06-03 05:59:25 |
| 00000126.pdf Path: Carnegie Mellon >> DISK >> 31008392 Fall, 2009 Description: ... Date Added: 2009-06-03 05:59:46 |
| 00000126.pdf Path: Carnegie Mellon >> TERA >> 31008392 Fall, 2009 Description: ... Date Added: 2009-06-03 05:59:46 |
| 00000229.pdf Path: Carnegie Mellon >> TERA >> 31008392 Fall, 2009 Description: ... Date Added: 2009-06-03 06:00:31 |
| 00000229.pdf Path: Carnegie Mellon >> DISK >> 31008392 Fall, 2009 Description: ... Date Added: 2009-06-03 06:00:31 |
| 00000008.pdf Path: Carnegie Mellon >> TERA >> 05102150 Fall, 2009 Description: ... Date Added: 2009-06-03 06:00:35 |
| PrProbMaExpLog.pdf Path: Allan Hancock College >> PHY >> 214 Fall, 2009 Description: x e2G R DfU2x5\" aP PfP8exW 82wf eeaaaPf4 \"fR\" aD56 W RA \" aP RDPww 2 8Pw2 aPf 3 8e22Dx ... Date Added: 2009-06-03 06:01:22 |
| 00000065.pdf Path: Carnegie Mellon >> TERA >> 31007031 Fall, 2009 Description: ... Date Added: 2009-06-03 06:03:50 |
| 00000065.pdf Path: Carnegie Mellon >> DISK >> 31007031 Fall, 2009 Description: ... Date Added: 2009-06-03 06:03:50 |
| 00000084.pdf Path: Carnegie Mellon >> TERA >> 31005315 Fall, 2009 Description: ... Date Added: 2009-06-03 06:05:40 |
| 00000084.pdf Path: Carnegie Mellon >> DISK >> 31005315 Fall, 2009 Description: ... Date Added: 2009-06-03 06:05:40 |
| 00000310.pdf Path: Carnegie Mellon >> DISK >> 31005315 Fall, 2009 Description: ... Date Added: 2009-06-03 06:06:48 |
| 00000310.pdf Path: Carnegie Mellon >> TERA >> 31005315 Fall, 2009 Description: ... Date Added: 2009-06-03 06:06:48 |
| 00000048.pdf Path: Carnegie Mellon >> TERA >> 31003405 Fall, 2009 Description: ... Date Added: 2009-06-03 06:07:53 |
| 00000048.pdf Path: Carnegie Mellon >> DISK >> 31003405 Fall, 2009 Description: ... Date Added: 2009-06-03 06:07:53 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 31007231 Fall, 2009 Description: ... Date Added: 2009-06-03 06:10:44 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 31007231 Fall, 2009 Description: ... Date Added: 2009-06-03 06:10:44 |
| 00000025.pdf Path: Carnegie Mellon >> TERA >> 31007231 Fall, 2009 Description: ... Date Added: 2009-06-03 06:10:47 |
| 00000025.pdf Path: Carnegie Mellon >> DISK >> 31007231 Fall, 2009 Description: ... Date Added: 2009-06-03 06:10:47 |
| 00000086.pdf Path: Carnegie Mellon >> TERA >> 31004299 Fall, 2009 Description: ... Date Added: 2009-06-03 06:12:13 |
| 00000086.pdf Path: Carnegie Mellon >> DISK >> 31004299 Fall, 2009 Description: ... Date Added: 2009-06-03 06:12:13 |
| 00000206.pdf Path: Carnegie Mellon >> TERA >> 31004299 Fall, 2009 Description: ... Date Added: 2009-06-03 06:12:51 |
| 00000206.pdf Path: Carnegie Mellon >> DISK >> 31004299 Fall, 2009 Description: ... Date Added: 2009-06-03 06:12:51 |
| 00000335.pdf Path: Carnegie Mellon >> TERA >> 31005170 Fall, 2009 Description: ... Date Added: 2009-06-03 06:15:50 |
| 00000335.pdf Path: Carnegie Mellon >> DISK >> 31005170 Fall, 2009 Description: ... Date Added: 2009-06-03 06:15:50 |
| 00000152.pdf Path: Carnegie Mellon >> TERA >> 31007211 Fall, 2009 Description: ... Date Added: 2009-06-03 06:17:52 |
| 00000152.pdf Path: Carnegie Mellon >> DISK >> 31007211 Fall, 2009 Description: ... Date Added: 2009-06-03 06:17:52 |
| 00000158.pdf Path: Carnegie Mellon >> TERA >> 31007211 Fall, 2009 Description: ... Date Added: 2009-06-03 06:17:54 |
| 00000158.pdf Path: Carnegie Mellon >> DISK >> 31007211 Fall, 2009 Description: ... Date Added: 2009-06-03 06:17:54 |
| 00000168.pdf Path: Carnegie Mellon >> TERA >> 31007211 Fall, 2009 Description: ... Date Added: 2009-06-03 06:17:57 |
| 00000168.pdf Path: Carnegie Mellon >> DISK >> 31007211 Fall, 2009 Description: ... Date Added: 2009-06-03 06:17:57 |
| 00000118.pdf Path: Carnegie Mellon >> DISK >> 31007297 Fall, 2009 Description: ... Date Added: 2009-06-03 06:19:34 |
| 00000118.pdf Path: Carnegie Mellon >> TERA >> 31007297 Fall, 2009 Description: ... Date Added: 2009-06-03 06:19:34 |
| 00000036.pdf Path: Carnegie Mellon >> TERA >> 05101949 Fall, 2009 Description: ... Date Added: 2009-06-03 06:20:54 |
| 00000036.pdf Path: Carnegie Mellon >> DISK >> 05101949 Fall, 2009 Description: ... Date Added: 2009-06-03 06:20:54 |
| 00000033.pdf Path: Carnegie Mellon >> TERA >> 31005135 Fall, 2009 Description: ... Date Added: 2009-06-03 06:21:04 |
| 00000144.pdf Path: Carnegie Mellon >> TERA >> 31004887 Fall, 2009 Description: ... Date Added: 2009-06-03 06:21:47 |
| 00000144.pdf Path: Carnegie Mellon >> DISK >> 31004887 Fall, 2009 Description: ... Date Added: 2009-06-03 06:21:47 |
| 00000228.pdf Path: Carnegie Mellon >> TERA >> 31004887 Fall, 2009 Description: ... Date Added: 2009-06-03 06:22:12 |
| 00000228.pdf Path: Carnegie Mellon >> DISK >> 31004887 Fall, 2009 Description: ... Date Added: 2009-06-03 06:22:12 |
| 00000260.pdf Path: Carnegie Mellon >> TERA >> 31006254 Fall, 2009 Description: ... Date Added: 2009-06-03 06:23:55 |
| 00000260.pdf Path: Carnegie Mellon >> DISK >> 31006254 Fall, 2009 Description: ... Date Added: 2009-06-03 06:23:55 |
| 00000418.pdf Path: Carnegie Mellon >> TERA >> 31006254 Fall, 2009 Description: ... Date Added: 2009-06-03 06:24:38 |
| 00000418.pdf Path: Carnegie Mellon >> DISK >> 31006254 Fall, 2009 Description: ... Date Added: 2009-06-03 06:24:38 |
| 00000085.pdf Path: Carnegie Mellon >> DISK >> 31007027 Fall, 2009 Description: ... Date Added: 2009-06-03 06:26:36 |
| 00000085.pdf Path: Carnegie Mellon >> TERA >> 31007027 Fall, 2009 Description: ... Date Added: 2009-06-03 06:26:36 |
| week4.pdf Path: Sveriges lantbruksuniversitet >> PHYS >> 231 Fall, 2009 Description: ... Date Added: 2009-06-03 06:28:43 |
| 00000044.pdf Path: Carnegie Mellon >> TERA >> 31004884 Fall, 2009 Description: ... Date Added: 2009-06-03 06:28:46 |
| 00000130.pdf Path: Carnegie Mellon >> TERA >> 31004884 Fall, 2009 Description: ... Date Added: 2009-06-03 06:29:48 |
| output.txt Path: Washington >> V >> 16300 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-135QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is F8FE-2FC1 Directory of C:\\condor\\execute\\dir_3216 02/05/2008 05:37 AM <DIR> . 02/05/2008 05:37 ... Date Added: 2009-06-03 06:31:21 |
| 00000214.pdf Path: Carnegie Mellon >> TERA >> 31007234 Fall, 2009 Description: ... Date Added: 2009-06-03 06:32:16 |
| l18q2.pdf Path: ASU >> PUBLIC >> 101 Fall, 2009 Description: Our hypothetical moving positive charges go \"downhill\" as they move through a wire. Do the moving charges go faster and faster as they go \"down the hill\"? (1) Yes, they must speed up as they go \"down\" the potential \"hill\". (2) No, resistive forces qu... Date Added: 2009-06-03 06:34:51 |
| 05 Pilsudski.pdf Path: Michigan >> HISTORY >> 331 Fall, 2008 Description: Jzef Pisudski, Speech to the Representatives of the Political Parties, translated by Brian Porter from Jzef Pisudski, Pisma zbiorowe, Volume 9 (Warsaw: Instytut Jzefa Pisudski, 1937), 30-33. Translators Note: This speech was given on May 29, 1926, (i... Date Added: 2009-06-03 06:34:53 |
| sec4.1.pdf Path: Ill. Chicago >> MCS >> 451 Fall, 2009 Description: 451 F02 4.1 1 / 13 451 F02 4.1 2 / 13 5HYLHZRID)HZ7RSL.V TWe TConsider a variable v defined by int v = 23; review some concepts, dealing specifically with how they relate to C and C+. But many of the ideas carry over to other languB ages (e... Date Added: 2009-06-03 06:37:08 |
| gel219_hw2_soln.pdf Path: UC Davis >> GEL >> 219 Fall, 2009 Description: ... Date Added: 2009-06-03 06:37:50 |
| 328 chi-square table.pdf Path: Iowa State >> STAT >> 328 Fall, 2008 Description: Chi-Square Distribution (Upper Tail) Critical Values (Layout Like MMD&S Table T-20) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 .995 0.000 0.010 0.072 0.207 0.412 0.676 0.989 1.344 1.735 2.156 2.603 3.074 3.565 4.075 4.601 5.142 5.697 6.265... Date Added: 2009-06-03 06:41:07 |
| stat 328 lab 1 03.pdf Path: Iowa State >> STAT >> 328 Fall, 2008 Description: Stat 328 Lab 1 Summer 2003 In all of these problems, use JMP in any ways that you find helpful. Chapter 1 of MMDOverlay Plot\" function under th... Date Added: 2009-06-03 06:41:09 |
| me550Chapter08.pdf Path: Penn State >> ME >> 550 Fall, 2009 Description: ... Date Added: 2009-06-03 06:42:57 |
| ME522_Lecture_12.pdf Path: Penn State >> ME >> 522 Fall, 2009 Description: M E 522 Spring 2008 Professor John M. Cimbala Lecture 12 02/11/2008 Today, we will: Continue working on the example problem the Bnard instability Recall, we did steps 0 and 1, and started working on step 2. The total flow variables are: ui = ui... Date Added: 2009-06-03 06:43:39 |
| project7.pdf Path: SUNY Albany >> MATH >> 113 Fall, 2009 Description: Math 113 Project 7 Due: Monday, March 26 1. Determine if the sequence converges or diverges. If it converges, nd the limit. Hint: it may help to write out the rst few terms. (a) an = (b) an = (c) an = n+1 3n1 n 1+ n n 1+ n 2 n (d) an = cos (f) an... Date Added: 2009-06-03 06:44:17 |
| log.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: 000 (61008.000.000) 02/17 07:25:54 Job submitted from host: <128.95.94.28:1092> . 001 (61008.000.000) 02/17 07:30:20 Job executing on host: <172.25.101.183:1065> . 010 (61008.000.000) 02/17 07:39:26 Job was suspended. Number of processes actually su... Date Added: 2009-06-03 06:46:37 |
| error.txt Path: Washington >> JOBS >> 71000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 11:17:18 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 12:34:00 2008 ( 4602 s elapsed) ... Date Added: 2009-06-03 06:46:45 |
| pss4.ps Path: Princeton >> CS >> 341 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: problem_session4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f problem_sessio... Date Added: 2009-06-03 06:48:15 |
| parser.pdf Path: Princeton >> CS >> 217 Fall, 2009 Description: Princeton University COS 217: Introduction to Programming Systems Digital Circuit Simulator Parser Module Design Grammar (expressed in Backus Naur Form): element := NUMBER_TOKEN element := IDENTIFIER_TOKEN element := LEFT_PAREN_TOKEN expr RIGHT_PAREN... Date Added: 2009-06-03 06:48:33 |
| cs597b_f02_lecture05_calib.ppt Path: Princeton >> CS >> 597 Fall, 2009 Description: Calibration Camera Calibration Geometric Intrinsics: Focal length, principal point, distortion Extrinsics: Position, orientation Radiometric Mapping between pixel value and scene radiance Can be nonlinear at a pixel (gamma, etc.) Can vary be... Date Added: 2009-06-03 06:48:34 |
| 00000124.pdf Path: Carnegie Mellon >> TERA >> 31004575 Fall, 2009 Description: ... Date Added: 2009-06-03 06:50:01 |
| 00000124.pdf Path: Carnegie Mellon >> DISK >> 31004575 Fall, 2009 Description: ... Date Added: 2009-06-03 06:50:01 |
| 00000296.pdf Path: Carnegie Mellon >> TERA >> 31004575 Fall, 2009 Description: ... Date Added: 2009-06-03 06:50:49 |
| 00000296.pdf Path: Carnegie Mellon >> DISK >> 31004575 Fall, 2009 Description: ... Date Added: 2009-06-03 06:50:49 |
| 00000121.pdf Path: Carnegie Mellon >> TERA >> 31003127 Fall, 2009 Description: ... Date Added: 2009-06-03 06:51:43 |
| 00000121.pdf Path: Carnegie Mellon >> DISK >> 31003127 Fall, 2009 Description: ... Date Added: 2009-06-03 06:51:43 |
| 00000131.pdf Path: Carnegie Mellon >> TERA >> 31003127 Fall, 2009 Description: ... Date Added: 2009-06-03 06:51:46 |
| 00000131.pdf Path: Carnegie Mellon >> DISK >> 31003127 Fall, 2009 Description: ... Date Added: 2009-06-03 06:51:46 |
| 00000005.pdf Path: Carnegie Mellon >> TERA >> 05101725 Fall, 2009 Description: ... Date Added: 2009-06-03 06:53:16 |
| 00000078.pdf Path: Carnegie Mellon >> TERA >> 05102344 Fall, 2009 Description: ... Date Added: 2009-06-03 06:53:43 |
| 00000078.pdf Path: Carnegie Mellon >> DISK >> 05102344 Fall, 2009 Description: ... Date Added: 2009-06-03 06:53:43 |
| 00000063.pdf Path: Carnegie Mellon >> TERA >> 05101720 Fall, 2009 Description: ... Date Added: 2009-06-03 06:54:06 |
| 00000063.pdf Path: Carnegie Mellon >> DISK >> 05101720 Fall, 2009 Description: ... Date Added: 2009-06-03 06:54:06 |
| 00000070.pdf Path: Carnegie Mellon >> TERA >> 05102174 Fall, 2009 Description: ... Date Added: 2009-06-03 06:55:09 |
| 00000070.pdf Path: Carnegie Mellon >> DISK >> 05102174 Fall, 2009 Description: ... Date Added: 2009-06-03 06:55:09 |
| 00000027.pdf Path: Carnegie Mellon >> TERA >> 05101712 Fall, 2009 Description: ... Date Added: 2009-06-03 06:55:40 |
| 00000046.pdf Path: Carnegie Mellon >> TERA >> 05101712 Fall, 2009 Description: ... Date Added: 2009-06-03 06:55:44 |
| 00000027.pdf Path: Carnegie Mellon >> TERA >> 05101169 Fall, 2009 Description: ... Date Added: 2009-06-03 06:56:04 |
| 00000027.pdf Path: Carnegie Mellon >> DISK >> 05101169 Fall, 2009 Description: ... Date Added: 2009-06-03 06:56:04 |
| 00000170.pdf Path: Carnegie Mellon >> DISK >> 31004499 Fall, 2009 Description: ... Date Added: 2009-06-03 06:59:30 |
| 00000170.pdf Path: Carnegie Mellon >> TERA >> 31004499 Fall, 2009 Description: ... Date Added: 2009-06-03 06:59:30 |
| 00000303.pdf Path: Carnegie Mellon >> TERA >> 31004499 Fall, 2009 Description: ... Date Added: 2009-06-03 07:00:08 |
| 00000303.pdf Path: Carnegie Mellon >> DISK >> 31004499 Fall, 2009 Description: ... Date Added: 2009-06-03 07:00:08 |
| 00000174.pdf Path: Carnegie Mellon >> TERA >> 05103068 Fall, 2009 Description: ... Date Added: 2009-06-03 07:01:30 |
| 00000064.pdf Path: Carnegie Mellon >> TERA >> 31003134 Fall, 2009 Description: ... Date Added: 2009-06-03 07:02:35 |
| 00000064.pdf Path: Carnegie Mellon >> DISK >> 31003134 Fall, 2009 Description: ... Date Added: 2009-06-03 07:02:35 |
| 00000263.pdf Path: Carnegie Mellon >> TERA >> 31003134 Fall, 2009 Description: ... Date Added: 2009-06-03 07:03:29 |
| 00000263.pdf Path: Carnegie Mellon >> DISK >> 31003134 Fall, 2009 Description: ... Date Added: 2009-06-03 07:03:29 |
| book.pdf Path: Carnegie Mellon >> TERA >> 05102406 Fall, 2009 Description: ... Date Added: 2009-06-03 07:04:16 |
| 00000172.pdf Path: Carnegie Mellon >> TERA >> 31003183 Fall, 2009 Description: ... Date Added: 2009-06-03 07:05:34 |
| 00000172.pdf Path: Carnegie Mellon >> DISK >> 31003183 Fall, 2009 Description: ... Date Added: 2009-06-03 07:05:34 |
| 00000371.pdf Path: Carnegie Mellon >> TERA >> 31003183 Fall, 2009 Description: ... Date Added: 2009-06-03 07:06:31 |
| 00000371.pdf Path: Carnegie Mellon >> DISK >> 31003183 Fall, 2009 Description: ... Date Added: 2009-06-03 07:06:31 |
| 00000011.pdf Path: Carnegie Mellon >> TERA >> 05102290 Fall, 2009 Description: ... Date Added: 2009-06-03 07:10:18 |
| 00000007.pdf Path: Carnegie Mellon >> DISK >> 31004026 Fall, 2009 Description: ... Date Added: 2009-06-03 07:11:43 |
| 00000007.pdf Path: Carnegie Mellon >> TERA >> 31004026 Fall, 2009 Description: ... Date Added: 2009-06-03 07:11:43 |
| 00000124.pdf Path: Carnegie Mellon >> TERA >> 31004026 Fall, 2009 Description: ... Date Added: 2009-06-03 07:12:15 |
| 00000124.pdf Path: Carnegie Mellon >> DISK >> 31004026 Fall, 2009 Description: ... Date Added: 2009-06-03 07:12:15 |
| 00000395.pdf Path: Carnegie Mellon >> TERA >> 31004026 Fall, 2009 Description: ... Date Added: 2009-06-03 07:13:30 |
| 00000395.pdf Path: Carnegie Mellon >> DISK >> 31004026 Fall, 2009 Description: ... Date Added: 2009-06-03 07:13:30 |
| 00000312.pdf Path: Carnegie Mellon >> TERA >> 05102957 Fall, 2009 Description: ... Date Added: 2009-06-03 07:14:49 |
| 00000423.pdf Path: Carnegie Mellon >> TERA >> 31003132 Fall, 2009 Description: ... Date Added: 2009-06-03 07:16:54 |
| 00000423.pdf Path: Carnegie Mellon >> DISK >> 31003132 Fall, 2009 Description: ... Date Added: 2009-06-03 07:16:54 |
| lecture-30-class-summary-3.pdf Path: Minnesota >> CSCI >> 3081 Fall, 2009 Description: Lecture 30 - Class Summary Spring 2007 Spring 2007 CSci 3081 - Mats Heimdahl 1 Class Summary What Did We Do? Good Question Software Engineering The problems Some process Some design Some testing Some maintenance A lot of programming and C... Date Added: 2009-06-03 07:21:00 |
| AcidsandBases.pdf Path: Wright State >> CHM >> 123 Spring, 2008 Description: Aqueous Equilibria Acids and Bases David A Grossie To Review Acid: taste sour and cause dyes to change color. Bases: taste bitter and feel soapy. Definition of Acids and Bases: Arrhenius David A Grossie 2 Arrhenius Acids and Bases acids increase ... Date Added: 2009-06-03 07:21:44 |
| LSN 35.pdf Path: West Point >> MA >> 205 Fall, 2009 Description: MA205 Integral Calculus and Introduction to Differential Equations Lesson 35 - Problem Solving Lab Come to class with prepared questions and problems. 1 ... Date Added: 2009-06-03 07:22:35 |
| sol-ps1-08.ps Path: Washington >> STAT >> 581 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96 Copyright 2005 Radical Eye Software %Title: sol-ps1-08.dvi %CreationDate: Tue Sep 30 20:11:36 2008 %Pages: 9 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMMI12 CMSY10 CMMI8 CMSY8 CM... Date Added: 2009-06-03 07:26:33 |
| sec96homeworksolns.pdf Path: Kennesaw >> MATH >> 2203 Fall, 2008 Description: Answers and Solutions to Section 9.6 Homework Problems S. F. Ellermeyer 1. 3. 5. f40, 15 25. This means that when the wind has been blowing at 40 knots for 15 hours, the wave height is 25 feet. b. h f30, t gives the wave height as a function of ... Date Added: 2009-06-03 07:27:51 |
| sec102homeworksolns2008.pdf Path: Kennesaw >> MATH >> 2203 Fall, 2008 Description: Answers and Solutions to Section 10.2 Homework Problems 1, 2, 3-15 (odd) and 29-33 (odd) S. F. Ellermeyer 2. r (1) = h1; 1i r (1:1) = h1:21; 1:1i r (1:1) r (1) = h0:21; 0:1i r (1:1) r (1) = h2:1; 1i 0:1 r0 (1) = h2; 1i Since h = 0:1 is quite small ... Date Added: 2009-06-03 07:27:52 |
| a25_529.pdf Path: Kennesaw >> MATH >> 1509 Fall, 2009 Description: ! !\"# $ % ! !\" ! \" \" ... Date Added: 2009-06-03 07:28:07 |
| submit.txt Path: Washington >> V >> 12509 Fall, 2009 Description: executable = allgamma_12509.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12500-12999/12... Date Added: 2009-06-03 07:30:04 |
| Homework10_F08.pdf Path: Iowa State >> STAT >> 104 Fall, 2008 Description: Stat 104 Homework 10 To be finished by Friday, December 12, 2008 Reading: December 2 December 4 December 9 December 11 Chapter 9, Sections 1 & 2 Chapter 10 Assignment: 1. Complete the following problems from the text: 9.28a, 9.38a, 9.54, 10.4, 10... Date Added: 2009-06-03 07:31:38 |
| Homework4_S09.pdf Path: Iowa State >> STAT >> 402 Fall, 2008 Description: STATISTICS 402 - Assignment 4 Due February 11, 2009 1. For each of the following descriptions indicate what the response is, what the conditions are (i.e. factors of interest) and what the experimental material is. Then discuss whether or not the exp... Date Added: 2009-06-03 07:31:56 |
| Lecture13.pdf Path: Iowa State >> STAT >> 101 Fall, 2008 Description: Stat 101L: Lecture 13 Prediction Least squares line = 0 .217 + 0 .058 x for x = 13 y = 0 .217 + 0 .058 ( 13 ) y = 0 .97 mg y 1 Residual Tar, x = 13 mg Nicotine, y = 0.8 mg Predicted,y = 0.97 mg Residual,y y = 0.80.97 = 0.17 mg 2 Residuals Re... Date Added: 2009-06-03 07:32:04 |
| PHL111 07-04-30 Utilitarianism.ppt Path: Dubuque >> PHL >> 111 Fall, 2009 Description: Introduction to Philosophy Ethics Based on Consequences: Utilitarianism Utilitarianism Two Key Ideas: Human happiness is the ultimate moral good. Actions should be evaluated in light of their consequences. 2 \"Classical\" Utilitarians Jeremy Bent... Date Added: 2009-06-03 07:34:11 |
| cs131-lect10.pdf Path: Harvey Mudd College >> CS >> 131 Fall, 2000 Description: Computer Science 131 Programming Languages September 28, 2000 Side-Effects: Assignment Assignment A mutable (assignable) variable has two attributes a location its current contents In most languages you are familiar with, context determines whi... Date Added: 2009-06-03 07:34:27 |
| lecture-04-02.ppt Path: Berkeley >> IS >> 247 Fall, 2000 Description: SIMS 247 Lecture 20 Visualizing Text & Text Collections (cont.) April 2, 1998 Marti Hearst SIMS 247 Today Visualizing Collection Overviews (cont.) Visualizing Query Specifications Selecting Term Subsets Viewing Metadata Visualizing Retrieval ... Date Added: 2009-06-03 07:35:34 |
| 21 Thermidor.pdf Path: Washington >> HSTEU >> 422 Fall, 2008 Description: The Thermidorian Regime ends? Why the Convention turned against The coup d\'tat of 9 Thermidor (27 July 1794) Understanding the Terror three theories What was Terror? A synthetic view Disma... Date Added: 2009-06-03 07:36:03 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


