Course Solutions And Notes - CW_fa_08 Study Guide 46
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> MUSC >> 3230 Fall, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> SPAN >> 4510 Fall, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> PADM >> 6000 Fall, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> SPAN >> 4410 Spring, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-10 00:58:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> COMM >> 3460 Fall, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> ART >> 3210 Fall, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> PE >> 2920 Fall, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| engl2010emSampleAEssay2Fall08.pdf Path: Southern Utah >> ART >> 3230 Spring, 2008 Description: Professor McNicoll English 20 10 5 December 2002 The Grizzly Horizon The 16.1 million acre Selway-Bitterroot Ecosystem of central Idaho and adjacent western Montana is the largest chunk wilderness habitat in the Rocky Mountains south of Canada (Griz... Date Added: 2009-01-12 05:29:56 |
| hayashiexcerpt.pdf Path: Columbia >> MEDIA >> 2727 Fall, 2008 Description: Columbia University Press Publishers Since 1893 New York Chichester, West Sussex Ukigumo Shinchosha, 1951 Translation Lane Dunlop, 2006 This edition Columbia University Press, 2006 All rights reserved Japanese Studies Series This book is published... Date Added: 2009-02-06 17:54:21 |
| puk2_9.doc Path: Sierra >> BIOSCI >> 4 Fall, 2008 Description: PUK2-#9 CGGCAGGCTTAACACATGCAAGTCGAGCGAGACCTTCGGGTCTAGCGGCGGA CGGGTGAGTAACGCGTGGGAACGTGCCCTTCTCTACGGAATAGCCCCGGGAA ACTGGGAGTAATACCGTATACGCCCTTTGGGGGAAAGATTTATCGGAGAAGGA TCGGCCCGCGTTGGATTAGGTAGTTGGTGGGGTAATGGCCCACCAAGCCGACG ATCCATAGCTGGTTTGAGAGGATGATCA... Date Added: 2009-01-10 00:18:34 |
| puk2_9.doc Path: Sierra >> BIOSCI >> 1 Fall, 2008 Description: PUK2-#9 CGGCAGGCTTAACACATGCAAGTCGAGCGAGACCTTCGGGTCTAGCGGCGGA CGGGTGAGTAACGCGTGGGAACGTGCCCTTCTCTACGGAATAGCCCCGGGAA ACTGGGAGTAATACCGTATACGCCCTTTGGGGGAAAGATTTATCGGAGAAGGA TCGGCCCGCGTTGGATTAGGTAGTTGGTGGGGTAATGGCCCACCAAGCCGACG ATCCATAGCTGGTTTGAGAGGATGATCA... Date Added: 2009-01-10 00:18:34 |
| puk2_9.doc Path: Sierra >> BIOSCI >> 2 Fall, 2008 Description: PUK2-#9 CGGCAGGCTTAACACATGCAAGTCGAGCGAGACCTTCGGGTCTAGCGGCGGA CGGGTGAGTAACGCGTGGGAACGTGCCCTTCTCTACGGAATAGCCCCGGGAA ACTGGGAGTAATACCGTATACGCCCTTTGGGGGAAAGATTTATCGGAGAAGGA TCGGCCCGCGTTGGATTAGGTAGTTGGTGGGGTAATGGCCCACCAAGCCGACG ATCCATAGCTGGTTTGAGAGGATGATCA... Date Added: 2009-01-10 00:18:34 |
| 02-approaches-out.pdf Path: Colorado State >> CIVE >> 724 Spring, 2008 Description: Development Issues & Approaches CIVE 525 Water Engineering For International Development Jeffrey D. Niemann Colorado State University Origins of the Problem What underlying factors cause the lack of access to adequate water and sanitation systems... Date Added: 2009-01-09 07:50:30 |
| ColumbiaBeowulf.ppt Path: UCSB >> CMPSC >> 240a Fall, 2008 Description: Parallel Computing Today Columbia, NASAAmesResearchCenter LabBeowulfcluster 1 ... Date Added: 2009-01-11 21:42:42 |
| japanese internment_draft 2 Path: UMass Boston >> AMST >> 110 Spring, 2008 Description: Dimas, Peter 1 Peter Dimas 8 March 2008 English 102-Lawrence Japanese-American Internment In the past century, there have been many occurrences of racism. There was the Apartheid in South Africa, and also genocide in Rwanda. The holocaust, caused by... Date Added: 2008-04-20 08:23:37 |
| 1103 Lab.pdf Path: Texas El Paso >> GEOL >> 1103 Fall, 2008 Description: GEOL 1101 Laboratory for Physical Geology, Fall 2006 *Lab Manual:* Laboratory Manual for GEOL 1101 by A. D. Feig, available in the UTEP Library Copy Center or downloadable from the course WebCT space. *Course Description: *Laboratory to accompany (GE... Date Added: 2009-02-03 14:20:17 |
| Literary Design Path: USC >> CTCS >> 190 Fall, 2006 Description: Literary Design Casper with Edwards pgs. 31-64 Poetics Aristotle, 350 BC - Structure of the plot using poetry as example - Three differences which distinguish artistic imitation: medium, the objects, the manner or mode of imitation The imitation is p... Date Added: 2008-04-20 14:37:37 |
| civpro.11.ppt Path: Catholic >> FACULTY >> 01 Fall, 2008 Description: CIVIL PROCEDURE CLASS 11 Professor Fischer Columbus School of Law The Catholic University of America WRAP-UP OF LAST CLASS We learned about the signature and certification requirements under FRCP 11(a) and 11(b) What Will We Do Today? Discuss Rule ... Date Added: 2009-02-06 19:55:31 |
| PLSC 540 - Ohren.pdf Path: E. Michigan >> PLSC >> 540 Fall, 2008 Description: EASTERN MICHIGAN UNIVERSITY DEPARTMENT OF POLITICAL SCIENCE INTRODUCTION TO GOVERNMENT BUDGETING PLSC 540, WINTER 2004 Dr. Joe Ohren 601J Pray-Harrold 487-2522; 487-3113; 487-0243; Office Hours: M-W 9 a.m.-Noon M 6:00 - 7:00 p.m. Joseph.Ohren@emich... Date Added: 2009-02-02 21:24:01 |
| HIST 322.pdf Path: S.E. Louisiana >> IT >> 322 Fall, 2008 Description: HISTORY 322 (A LOUISIANA HISTORY PRACTICUM) THE COURSE: A readings and discussion-based seminar-format practicum class focused on enhancing content knowledge and presentation skills necessary to effectively teach Louisiana History. Complemented with ... Date Added: 2009-02-02 16:11:17 |
| agenda4a.xls Path: Shepherd >> BOGWEB >> 04 Fall, 2008 Description: Shepherd Unversity Statement of Net Assets As of March 31, 2004 (Dollars in Thousands) 3/31/2004 ASSETS Current assets: Cash and cash equivalents Appropriations due from Primary Government Accounts receivable net Grants and contracts recieivable, net... Date Added: 2009-02-17 23:00:54 |
| ECE433_class18 slide Path: New Mexico >> ECE >> 433 Fall, 2007 Description: Announcements ECE/CS 433 Introduction to Computer Graphics Class 18 October 23, 2007 Homework 3 is due Sunday Pradeep Sen Advanced Graphics Lab ECE/CS 433 Introduction to Computer Graphics Pradeep Sen Class 23 October 23, 2007 ECE/CS 433 Intro... Date Added: 2008-01-30 15:14:04 |
| William Gibson - Neuromancer Path: RIT >> COLA >> Arts of Ex Winter, 2007 Description: William Gibson. Neuromancer Dedication: for Deb who made it possible with love PART ONE. CHIBA CITY BLUES The sky above the port was the color of television, tuned to a dead channel. \"It\'s not like I\'m using,\" Case heard someone say, as he shouldere... Date Added: 2008-04-17 16:48:54 |
| e220c_S05_ps2.pdf Path: Berkeley >> E >> 220 Fall, 2008 Description: Dept. of Economics UC Berkeley Professor B. H. Hall Spring 2005 ECONOMICS 220C Problem Set No. 2 (due Monday, March 28) On the homepage for this course you will find two data files containing the raw data used by Porter in the cartel stability pape... Date Added: 2009-02-17 17:43:24 |
| m2360_f06_st2.pdf Path: Texas Tech >> M >> 2360 Fall, 2009 Description: Math 2360 Fall 2006 , Sample Test # 2, Name 1. Determine whether the subset {(x1 , x2 )T : x1 + x2 = 0} forms a subspace of R2 Take u = ANSWER: x1 y , v = 1 with x1 + x2 = 0, y1 + y2 = 0. Then x2 y2 x1 y x1 + y1 u+v = + 1 = , and (x1 +y1 )+(x2 +y2 ) ... Date Added: 2009-04-15 20:20:23 |
| Wood-etal.1997.JWRPM.123,239-245.pdf Path: Washington >> HIST >> 245 Winter, 2008 Description: ... Date Added: 2009-02-02 20:37:56 |
| 202L8.pdf Path: Delaware >> PHYS >> 202 Fall, 2008 Description: The Last Wave LONGITUDINAL STANDING WAVES For a gas in a cylindrical tube open at both ends, the natural frequencies of vibration are Tube open at both ends where v is the speed of sound in the gas and L is the length of the tube. For a gas in a cyl... Date Added: 2009-01-11 22:38:36 |
| MARK3375SyllabusF06.pdf Path: Texas Pan American >> MARK >> 3375 Summer, 2008 Description: Syllabus MARK 3375 Retailing Management Fall 2006 12:45 01:35 MWF - BA INSTRUCTOR: Wm. W. Thompson, PhD OFFICE: BA 120C OFFICE HOURS: 9:00 - 10:35 & 1:45 2:35 MW PHONE: 381-2827 or 797-1166 (Home) E-MAIL: wwthompson@panam.edu TEXT: Retailing, Patr... Date Added: 2009-02-02 20:19:20 |
| Psychology_101_Prelim_1999 Path: Cornell >> PSYCH >> 101 Fall, 1998 Description: Psychology 101 Prelim 1, Fall 1999 completed Total score: 46 out of 50, 92% 1. Monica has just learned that her neighbor Natalie was involved in an automobile accident at a nearby intersection. The tendency to make the fundamental attribution error ... Date Added: 2008-09-28 23:39:38 |
| Lecture07.ppt Path: Rutgers >> 148 >> 550 Spring, 2008 Description: Processing Tabular Data (MS Excel); Relational databases (basic idea) Week 7 Information Technologies 17:610:550:01 - Fall 2008 - Announcements Assignment 2 due today before this class Quiz grades next week Assignment 3 is out Agenda Proce... Date Added: 2009-02-02 15:52:29 |
| Lecture07.ppt Path: Rutgers >> 610 >> 550 Fall, 2008 Description: Processing Tabular Data (MS Excel); Relational databases (basic idea) Week 7 Information Technologies 17:610:550:01 - Fall 2008 - Announcements Assignment 2 due today before this class Quiz grades next week Assignment 3 is out Agenda Proce... Date Added: 2009-01-09 06:51:54 |
| Chapter 4 Solutions V4 Path: Phoenix >> FIN >> FIN/554 Summer, 2006 Description: Chapter 4: Net Present Value 4.1 a. b. c. Future Value Future Value Future Value = C0 (1+r)T = $1,000 (1.05)10 = $1,628.89 = $1,000 (1.07)10 = $1,967.15 = $1,000 (1.05)20 = $2,653.30 d. Because interest compounds on interest already earned, the int... Date Added: 2009-04-04 13:16:40 |
| FR 4154 AUT06 RE7 BR.doc Path: Virginia Tech >> FIN >> 4154 Fall, 2008 Description: Carl Lyon FR 4154 le 2 novembre 2006 RDACTION no 7 : Texte dinformation BROUILLON Le secret du vin Imaginez. Vous vous trouvez dans l\'alle du vin au supermarch. Vous voulez choisir le vin parfait, mais vous ne pouvez pas du tout dcider parmi les cen... Date Added: 2009-02-02 20:54:28 |
| Ch04 Path: GA Southern >> HLTH >> 2120 Spring, 2008 Description: Chapter 4 Body Systems OBJECTIVE 1: IDENTIFY THE FIVE BODY CAVITIES AND THE MAJOR STRUCTURES IN EACH CAVITY. Class: Interpret, Difficulty: Easy 1. The body cavity that contains the lungs is the- a. Spinal cavity. b. Thoracic cavity. c. Cranial cavity... Date Added: 2008-06-28 13:41:56 |
| biol1201 Third_Exam_Study_Guide Path: LSU >> BIOL >> 1201 Spring, 2008 Description: Examination 3 Study Guide Thursday April 3 at 6:00 PM in Campbell Auditorium Bring a number 2 pencil and your ID. 53 questions the exam is worth 106 points Make sure you can do the genetics problems found under \"Assignments\" on Blackboard! The mate... Date Added: 2008-04-10 12:29:59 |
| umdlsbe09.pdf Path: Minnesota >> CATALOGS >> 09 Fall, 2008 Description: Labovitz School of Business and Economics Labovitz School of Business and Economics Labovitz School of Business and Economics (LSBE) This is the Labovitz School of Business and Economics section of the 2007-2009 Duluth Catalog for the University of... Date Added: 2009-02-17 20:49:22 |
| Solutions to Chapter 9, 36 Ma382 Path: SDSMT >> MATH >> 382 Spring, 2007 Description: ... Date Added: 2008-01-22 17:24:43 |
| middle_school_rubric.doc Path: UCM >> X >> 77581 Fall, 2008 Description: Middle School Student Teacher Evaluation Rubric - 1 - Standard Curriculum; Learners and Learning Not Observed Not Observed Middle School Philosophies: Development ally Responsive Not Observed Curriculum and Assessment Not Observed Does not me... Date Added: 2009-02-06 20:06:24 |
| Alismataceae.pdf Path: Iowa State >> BIOL >> 366 Spring, 2008 Description: ALISMATALES Alismataceae Water Plantain Family Aquatic and marshy herbs with basal leaves Flowers usually whorled, perianth in distinct calyx and corolla Genus to Know: Sagittaria Ovary position: superior Number of stamen: 6, 9 or many Fruit type: ... Date Added: 2009-01-12 03:26:19 |
| wildswams2 Path: Penn State >> HD FS >> 239 Spring, 2008 Description: Kaitlin Martin During chapter three and four Chang\'s mother began school at the age of seven. The education was strictly ruled by the Japanese. Japanese was made the primary language, instead of Chinese, in school. Almost all of the teachers were Jap... Date Added: 2008-03-18 09:11:01 |
| resume2003.pdf Path: Arizona >> ENGR >> 196 Fall, 2008 Description: Current Address 910 Ease 5th Street Tucson, Arizona 85705 (520) 555-1212 OBJECTIVE Stephanie Care Email scare@hotmail.com Cellular (520) 555-1212 Permanent Address 700 North 20th Avenue Phoenix, Arizona 85021 (602) 555-1212 To obtain a full-time... Date Added: 2009-02-04 13:53:51 |
| resume2003.pdf Path: Arizona >> ENGR >> 196a Fall, 2008 Description: Current Address 910 Ease 5th Street Tucson, Arizona 85705 (520) 555-1212 OBJECTIVE Stephanie Care Email scare@hotmail.com Cellular (520) 555-1212 Permanent Address 700 North 20th Avenue Phoenix, Arizona 85021 (602) 555-1212 To obtain a full-time... Date Added: 2009-01-11 19:59:43 |
| hw7-sol.pdf Path: Purdue >> CS >> 526 Fall, 2008 Description: 26.9.9 Solution: 26.9.9.a The purpose of using TCP intercept of the CISCO router is to protect the destination host from being flooded. The SYN flooding from the attackers will be intercepted by the router and will never reach the destination host. I... Date Added: 2009-01-11 17:58:00 |
| hw7-sol.pdf Path: Purdue >> C S >> 526 Fall, 2008 Description: 26.9.9 Solution: 26.9.9.a The purpose of using TCP intercept of the CISCO router is to protect the destination host from being flooded. The SYN flooding from the attackers will be intercepted by the router and will never reach the destination host. I... Date Added: 2009-01-11 17:58:00 |
| 07Deltas_Turbidites.pdf Path: Uni. Bradford >> MAC >> 01 Fall, 2008 Description: 42 Lecture 7: Deltas Prothero and Schwab Chapter 9: 169-180 I. Delta: an accumulation of sediment that forms when a sediment-charged river meets a standing body of water. Coarsest stuff is dumped by river mouth, fines a carried further away. Original... Date Added: 2009-02-18 02:07:22 |
| 07Deltas_Turbidites.pdf Path: Uni. Bradford >> MAC >> 1020 Fall, 2008 Description: 42 Lecture 7: Deltas Prothero and Schwab Chapter 9: 169-180 I. Delta: an accumulation of sediment that forms when a sediment-charged river meets a standing body of water. Coarsest stuff is dumped by river mouth, fines a carried further away. Original... Date Added: 2009-02-18 02:07:22 |
| 07Deltas_Turbidites.pdf Path: Pittsburgh >> MAC >> 01 Fall, 2008 Description: 42 Lecture 7: Deltas Prothero and Schwab Chapter 9: 169-180 I. Delta: an accumulation of sediment that forms when a sediment-charged river meets a standing body of water. Coarsest stuff is dumped by river mouth, fines a carried further away. Original... Date Added: 2009-02-18 02:07:22 |
| 07Deltas_Turbidites.pdf Path: Pittsburgh >> MAC >> 1020 Fall, 2008 Description: 42 Lecture 7: Deltas Prothero and Schwab Chapter 9: 169-180 I. Delta: an accumulation of sediment that forms when a sediment-charged river meets a standing body of water. Coarsest stuff is dumped by river mouth, fines a carried further away. Original... Date Added: 2009-02-18 02:07:22 |
| ON (15) 433-446.pdf Path: Purdue >> AT >> 433 Fall, 2008 Description: ORNITOLOGIA NEOTROPICAL _ Volume 15 2004 No. 4 _ ORNITOLOGIA NEOTROPICAL 15: 433445, 2004 The Neotropical Ornithological Society ELEVATIONAL MOVEMENTS OF LARGE FRUGIVOROUS BIRDS AND TEMPORAL VARIATION IN ABUNDANCE OF FRUITS ALONG AN ELEVATIONAL GRA... Date Added: 2009-02-02 15:44:35 |
| heizer8_ch11final.ppt Path: University of Hawaii - Hilo >> MGT >> 341 Fall, 2008 Description: Operations Management Chapter 11 Supply-Chain Management PowerPoint presentation to accompany Heizer/Render Principles of Operations Management, 6e Operations Management, 8e 2006 Prentice 2006 Prentice Hall, Inc. Hall, Inc. 11 1 The Strategic Imp... Date Added: 2009-01-10 18:37:58 |
| heizer8_ch11final.ppt Path: University of Hawaii - Hilo >> COM >> 361 Fall, 2008 Description: Operations Management Chapter 11 Supply-Chain Management PowerPoint presentation to accompany Heizer/Render Principles of Operations Management, 6e Operations Management, 8e 2006 Prentice 2006 Prentice Hall, Inc. Hall, Inc. 11 1 The Strategic Imp... Date Added: 2009-01-10 18:37:58 |
| heizer8_ch11final.ppt Path: University of Hawaii - Hilo >> QBA >> 361 Fall, 2008 Description: Operations Management Chapter 11 Supply-Chain Management PowerPoint presentation to accompany Heizer/Render Principles of Operations Management, 6e Operations Management, 8e 2006 Prentice 2006 Prentice Hall, Inc. Hall, Inc. 11 1 The Strategic Imp... Date Added: 2009-01-10 18:37:58 |
| p4617chap6.ps Path: ETSU >> PHYS >> 4617 Fall, 2008 Description: Physics 4617/5617: Quantum Physics Course Lecture Notes Dr. Donald G. Luttermoser East Tennessee State University Edition 5.1 Abstract These class notes are designed for use of the instructor and students of the course Physics 4617/5617: Quantum ... Date Added: 2009-02-17 23:43:19 |
| 19-model-checking.pdf Path: Wisconsin Milwaukee >> CSCI >> 780 Fall, 2009 Description: Outline CSci 780 Advanced Software Engineering Background: Model Checking Event-Driven Systems SCR CTL Model Checking SCR Specifications Case Studies Evaluation and Conclusion Discussion State-Based Model Checking of Event-Driven System Requ... Date Added: 2009-04-15 22:19:34 |
| Cavit1.ps Path: Minnesota >> AEM >> 1 Fall, 2008 Description: Cavitation and the state of stress in a owing liquid Daniel D. Joseph University of Minnesota Dept. of Aerospace Engineering & Mechanics 110 Union St. Minneapolis, MN 55455 December, 1997 The problem of the inception of cavitation is formulated in te... Date Added: 2009-02-17 21:17:17 |
| sol-hw-1.pdf Path: UCSD >> CS >> 101 Winter, 1998 Description: ... Date Added: 2009-02-06 18:42:55 |
| class12_learning2 Path: Texas >> PSY >> 301 Summer, 2006 Description: Introduction to Psychology Class 12: Learning 2 Myers: 224-255 July 5, 2006 Writing Assignments Speaking of media effects. - A much-more-than-a-million dollar \"fantasy\" bra - Tyra Banks gives her \"successor\" baby wings - Medical dramas and plastic... Date Added: 2008-08-12 11:14:29 |
| CLASS11.pdf Path: Santa Clara >> ENGR >> 019 Fall, 2009 Description: Genetic Engineering: Germ-Line Therapy Improving Nature or Uncorking the Genie? Introduction Genetic engineering is the artificial manipulation, modification and recombination of DNA or other nucleic acid molecules in order to modify an organism or... Date Added: 2009-04-15 20:18:06 |
| 303_090208.pdf Path: Maryland >> EE >> 303 Spring, 2006 Description: EE 303 Tu 09/02/08 ... Date Added: 2009-02-06 19:16:41 |
| rfc1123.txt Path: UCSD >> POPMAIL >> 1123 Fall, 2008 Description: Network Working Group Internet Engineering Task Force Request for Comments: 1123 R. Braden, Editor October 1989 Requirements for... Date Added: 2009-02-17 18:24:09 |
| Forman_Labor.pdf Path: George Mason >> SPAN >> 001 Fall, 2008 Description: GEORGE MASON UNIVERSITY SCHOOL OF LAW LABOR LAW 256 SPRING 2004 GENERAL INFORMATION Mr. Stephen Forman A. COURSE OBJECTIVE I believe that labor law is one of the most exciting, dynamic and interesting fields of legal practice. My objective is to con... Date Added: 2009-01-11 04:57:43 |
| soln9a Path: Cornell >> ECE >> 3200 Spring, 2006 Description: ECE320 Solution Notes 9 Cornell University Spring 2006 T.L.Fine 1. Recall the Bernoulli process of Section 3.6 in which the outcome space X = {0, 1} and the probability of a sequence of binary-valued random variables is given by P (X1 = x1 , . . . ... Date Added: 2007-09-25 18:55:39 |
| mathis_front.pdf Path: WVU >> FRCH >> 535 Fall, 2008 Description: The Relationship of Leadership Frame Use of Departmental Chairs to Faculty Job Satisfaction as Perceived by Selected Departmental Faculty Members Saralyn Grenga Mathis, B.S., M.S. Dissertation submitted to the College of Human Resources and Educati... Date Added: 2009-02-03 14:41:09 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 5 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 101 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 75 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 15 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHYSICS >> 305 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 25 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> MATH >> 330 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHYSICS >> 326 Spring, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 345 Spring, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> MATH >> 383 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> PHILOS >> 35 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| ind.pdf Path: Missouri S&T >> MATH >> 401 Fall, 2008 Description: # P C e @ H ) 0 0 %IEtsG614n S%FF % \"% H P RFmIq 4!4%F4E%C h q6b64s46 # H 5 # C @ ) @ P P H 0 h g f h g iteki # P 44R C e d A@ gfbB8 s C A@ 3DB8 xvA ywTu C @ H ) d q S4SlgEq ... Date Added: 2009-01-12 14:40:06 |
| HW3SOLNS Path: Linn Tech >> MATH >> 383 Spring, 2009 Description: ... Date Added: 2009-03-31 05:54:21 |
| VCSELlayers.pdf Path: Rutgers >> 332 >> 468 Spring, 2008 Description: ... Date Added: 2009-01-11 19:33:33 |
| PeachCare_Items.pdf Path: UGA >> SRC >> 2007 Fall, 2008 Description: Healthcare Georgia Foundation 2007 Peachcare for Kids Survey Survey Items Q27.1 Have you ever heard of the Childrens Health Insurance Program, also known as PeachCare for Kids in Georgia? 1. 2. Yes No 7. Refused 8. Dont Know 9. Not Ascertained Peac... Date Added: 2009-02-18 13:53:07 |
| PeachCare_Items.pdf Path: UGA >> ORS >> 2007 Fall, 2008 Description: Healthcare Georgia Foundation 2007 Peachcare for Kids Survey Survey Items Q27.1 Have you ever heard of the Childrens Health Insurance Program, also known as PeachCare for Kids in Georgia? 1. 2. Yes No 7. Refused 8. Dont Know 9. Not Ascertained Peac... Date Added: 2009-02-18 13:54:01 |
| HIEU1552006.pdf Path: UCSD >> HIEU >> 1552006 Fall, 2008 Description: UNIVERSITY OF CALIFORNIA, SAN DIEGO Department of History HIEU 155 Fall Quarter, 2006 MODERN AUSTRIA Warren Lecture Hall, 2111, Tuesday and Thursday 9:30 am-10:50 am OFFICE HOURS: Tuesday and Wednesday, 2-3 pm, HSS 6012 HIEU 155 is an upper division ... Date Added: 2009-02-17 18:30:57 |
| Gantt_Chart.pdf Path: Ohio State >> PLANIT >> 2004 Fall, 2009 Description: End User Access Assessment Work Plan Gantt Chart Task 1000 Create Inventory of Existing End User Access Extensions 2000 Research Direction of Other Organizations and Market Trends 3000 Identify Opportunities and Quantify Benefits 4000 Conduct Technol... Date Added: 2009-04-16 01:23:29 |
| 2391.070.ps Path: Hawaii >> SOEST >> 2391 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207381208.0388276 Float: 2391 Profile: 070 Location: 34.4N 153.7E Date: 05/21... Date Added: 2009-02-17 20:04:23 |
| Bubinas_ChicagoSchool.pdf Path: SUNY Albany >> AANT >> 664 Fall, 2009 Description: Chicago Area Research Sites Gandhi Margh g ch i L ake M i an Douglas and Grand Blvd. Little Village Southwest Side Bridgeview N Introduction Introduction: Revisiting The City: the social production of urban space in Chicago KATHLEEN BUBINAS... Date Added: 2009-04-15 21:48:58 |
| solution13.pdf Path: Purdue >> MATH >> 13 Fall, 2000 Description: PROBLEM OF THE WEEK Solution of Problem No. 13 (Spring 2005 Series) Problem: Show that the circumference of any rhombus (diamond) circumscribed about a given ellipse is no smaller that the circumference of the circumscribed rectangle about the same e... Date Added: 2009-02-06 18:28:30 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 101 Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-11 20:45:22 |
| Extrusion Testing Form.pdf Path: N. Illinois >> ELE >> 215 Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-09 20:26:35 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 351 Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-11 20:45:55 |
| Extrusion Testing Form.pdf Path: N. Illinois >> ELE >> 215s Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-09 20:26:35 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 470 Spring, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-12 03:53:18 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 350 Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-09 20:26:35 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 481 Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-12 03:53:18 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 390 Spring, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-09 20:26:35 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 482 Fall, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-12 03:53:18 |
| Extrusion Testing Form.pdf Path: N. Illinois >> MEE >> 340 Spring, 2008 Description: Extrusion Testing Data: Name: _ NOTE: Date:_ Actual extrusion data (*for SET Value): Ser.No. # Time A/PM P1 psi P2 psi P3 psi Motor %load SCR TU Pull TU cm/sec KTRON kg/hr 1 2 N2 Vac. Tmelt o C Tvac o C Tspry o C NOTE in H2O 1 2 3 4 5 6 7 ... Date Added: 2009-01-09 20:29:47 |
| hw2.pdf Path: UPenn >> CSE >> 331 Fall, 2009 Description: CSE331: Introduction to Networks and Security Fall 2002 Homework 2 Due: Sept. 20, 2002 What to turn in: In addition to hard copy solutions to the problems below, please be sure your work has your name, e-mail address, and the number of hours you sp... Date Added: 2009-04-15 20:47:57 |
| 2370.237.ps Path: Hawaii >> SOEST >> 2370 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1220044275.0388276 Float: 2370 Profile: 237 Location: 39.3N 162.1E Date: 08/23... Date Added: 2009-02-17 20:02:38 |
| eecs 163l.pdf Path: UC Irvine >> EECS >> 163l Fall, 2008 Description: EECS 163L POWER SYSTEMS LABORATORY (Elective for EE) Catalog Data: EECS 163L Power Systems Laboratory (Credit Units: 1) Experiments and field trips relevant to studies in power systems. Corequisite: EECS163. Formerly ECE163L. (Design units: 0) Glover... Date Added: 2009-02-02 17:15:10 |
| who.ppt Path: Texas Tech >> ENGLISH >> 3365 Fall, 2009 Description: That, Which, and Who Thumb Rule (AKA That vs. Which) Hanginwithmehere. Thatandwhichareusedtointroduce phrases. Therearetwokindsofphrasesyouneedto knowabout.Seethenextslide. Restrictive Phrases Arestrictivephraserestrictsthemeaningof thesentenceitis... Date Added: 2009-04-15 20:08:10 |
| Lecture01.ppt Path: UCSB >> CLASS >> 234 Spring, 2008 Description: Geography 176B: Technical Issues in GIS Lectures 2 per week Labs: 6, with extensive support material www.geog.ucsb.edu/~ta176/g176b/home.html Use of the Star lab Can also use ArcGIS educational license Text: Paul A. Longley, Michael F. Goodchild... Date Added: 2009-01-10 18:05:13 |
| Lecture01.ppt Path: UCSB >> GEOG >> 99 Winter, 2008 Description: Geography 176B: Technical Issues in GIS Lectures 2 per week Labs: 6, with extensive support material www.geog.ucsb.edu/~ta176/g176b/home.html Use of the Star lab Can also use ArcGIS educational license Text: Paul A. Longley, Michael F. Goodchild... Date Added: 2009-01-10 18:05:13 |
| Lac_0701_Jan_2007_0-12m_Tw_Tair_wind.pdf Path: Lehigh >> BRH >> 0 Fall, 2008 Description: L. Lacawac hourly temperatures Complete ice cover on 1Feb07 suggested by T0.1m indifference to wind) Tair, Tw0.1m, Tw0.5m, Tw1m, Tw2m, Tw3m, Tw4m, Tw5m, Tw6m, Tw8m, Tw10, Tw11.5 (on bottom) TW0.1m TW0.5m TW1m TW2m TW3m 8 7 W... Date Added: 2009-04-15 19:52:42 |
| 060210mladic.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Serbia Promises Mladic Action Plan Front Page Radio B92 Live Set language About us News B92 Internet CD Releases Concerts Conference Documents Interviews Links Music Opinions Photo Gallery Rex Specials Statements Serbia Promises Mladic Action Plan ... Date Added: 2009-02-11 20:14:44 |
| 060210mladic.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Serbia Promises Mladic Action Plan Front Page Radio B92 Live Set language About us News B92 Internet CD Releases Concerts Conference Documents Interviews Links Music Opinions Photo Gallery Rex Specials Statements Serbia Promises Mladic Action Plan ... Date Added: 2009-02-11 20:15:49 |
| The Source Term.pdf Path: University of Illinois, Urbana Champaign >> CSE >> 462 Fall, 2008 Description: Chapter 7 THE SOURCE TERM M.Ragheb 9/16/2007 7.1 INTRODUCTION The source term designates the radioactive releases from reactor accidents. These include both groups of short lived and long lived isotopes, each group possessing different health haza... Date Added: 2009-02-02 18:34:09 |
| 76_11_bin_packing.pdf Path: UCSD >> MATH >> 175 Winter, 2008 Description: ... Date Added: 2009-01-11 21:31:07 |
| FT-NMR_Standard_Index Path: UC Davis >> CHE >> 118B Winter, 2009 Description: Aldrich FT-NMR 18K Standard Library Catalog # 29,284-2 34,700-0 34,407-9 34,409-5 36,843-1 30,579-0 85,108-6 H5,420-4 85,079-9 85,287-2 29,405-5 23,766-3 23,238-6 30,365-8 18,900-6 18,817-4 37,466-0 85,881-1 85,665-7 85,827-7 85,116-7 28,526-9 86,165... Date Added: 2009-02-21 23:58:26 |
| GEO_202_2005_Syllabus.pdf Path: Oregon State >> GEO >> 432 Fall, 2008 Description: Geo202 Earth System Science Syllabus Winter 2005 Instructor Stephen Lancaster Office: Wlkn 202D E-mail: lancasts@geo.oregonstate.edu ph: 737-9258 Office Hours M 1:00-1:50, W 12:00-12:50; other times by appt. Textbook The Blue Planet An Introductio... Date Added: 2009-01-12 14:36:12 |
| GEO_202_2005_Syllabus.pdf Path: Oregon State >> GEO >> 532 Fall, 2008 Description: Geo202 Earth System Science Syllabus Winter 2005 Instructor Stephen Lancaster Office: Wlkn 202D E-mail: lancasts@geo.oregonstate.edu ph: 737-9258 Office Hours M 1:00-1:50, W 12:00-12:50; other times by appt. Textbook The Blue Planet An Introductio... Date Added: 2009-01-12 14:36:12 |
| GEO_202_2005_Syllabus.pdf Path: Oregon State >> GEO >> 582 Fall, 2008 Description: Geo202 Earth System Science Syllabus Winter 2005 Instructor Stephen Lancaster Office: Wlkn 202D E-mail: lancasts@geo.oregonstate.edu ph: 737-9258 Office Hours M 1:00-1:50, W 12:00-12:50; other times by appt. Textbook The Blue Planet An Introductio... Date Added: 2009-01-12 14:36:12 |
| GEO_202_2005_Syllabus.pdf Path: Oregon State >> GEO >> 202 Winter, 2008 Description: Geo202 Earth System Science Syllabus Winter 2005 Instructor Stephen Lancaster Office: Wlkn 202D E-mail: lancasts@geo.oregonstate.edu ph: 737-9258 Office Hours M 1:00-1:50, W 12:00-12:50; other times by appt. Textbook The Blue Planet An Introductio... Date Added: 2009-01-12 14:36:11 |
| GEO_202_2005_Syllabus.pdf Path: Oregon State >> GEO >> 309 Fall, 2008 Description: Geo202 Earth System Science Syllabus Winter 2005 Instructor Stephen Lancaster Office: Wlkn 202D E-mail: lancasts@geo.oregonstate.edu ph: 737-9258 Office Hours M 1:00-1:50, W 12:00-12:50; other times by appt. Textbook The Blue Planet An Introductio... Date Added: 2009-01-12 14:36:11 |
| GEO_202_2005_Syllabus.pdf Path: Oregon State >> GEO >> 322 Fall, 2008 Description: Geo202 Earth System Science Syllabus Winter 2005 Instructor Stephen Lancaster Office: Wlkn 202D E-mail: lancasts@geo.oregonstate.edu ph: 737-9258 Office Hours M 1:00-1:50, W 12:00-12:50; other times by appt. Textbook The Blue Planet An Introductio... Date Added: 2009-01-12 14:36:12 |
| sample_resume_1.pdf Path: SUNY Stony Brook >> ECO >> 800 Fall, 2008 Description: SUN YANG Campus Address: Dreiser 518B Stony Brook, NY 11790 (516) 216-9999 syang@ic.sunysb.edu Permanent Address: 1950 Liberty Avenue Brooklyn, NY 11220 (718) 345-0001 www.ug.cs.sunysb.edu/-yangs OBJECTIVE: EDUCATION: Software Engineer B.S. in Comp... Date Added: 2009-01-12 05:30:36 |
| sample_resume_1.pdf Path: SUNY Stony Brook >> ARS >> 800 Fall, 2008 Description: SUN YANG Campus Address: Dreiser 518B Stony Brook, NY 11790 (516) 216-9999 syang@ic.sunysb.edu Permanent Address: 1950 Liberty Avenue Brooklyn, NY 11220 (718) 345-0001 www.ug.cs.sunysb.edu/-yangs OBJECTIVE: EDUCATION: Software Engineer B.S. in Comp... Date Added: 2009-01-12 05:30:36 |
| sample_resume_1.pdf Path: SUNY Stony Brook >> ECO >> 605 Fall, 2008 Description: SUN YANG Campus Address: Dreiser 518B Stony Brook, NY 11790 (516) 216-9999 syang@ic.sunysb.edu Permanent Address: 1950 Liberty Avenue Brooklyn, NY 11220 (718) 345-0001 www.ug.cs.sunysb.edu/-yangs OBJECTIVE: EDUCATION: Software Engineer B.S. in Comp... Date Added: 2009-01-12 05:30:36 |
| 81_02_monochromatic_lines.pdf Path: UCSD >> MATH >> 175 Winter, 2008 Description: ... Date Added: 2009-01-10 01:48:12 |
| TRF6901 DataSheet - slws110c.pdf Path: Iowa State >> E E >> 423 Spring, 2008 Description: TRF6901 SINGLE-CHIP RF TRANSCEIVER SLWS110C SEPTEMBER 2001 REVISED MARCH 2002 D Single-Chip RF Transceiver for 868-MHz D D D D D D and 915-MHz Industrial, Scientific, and Medical (ISM) Bands 1.8-V to 3.6-V Operation 860-MHz to 930-MHz Operation Lo... Date Added: 2009-01-09 02:11:16 |
| 060719rosneft.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Rosneft off to slow start - Print Version - International Herald Tribune Rosneft off to slow start Reuters THURSDAY, JULY 20, 2006 LONDON Shares of the Russian oil company Rosneft dipped slightly below their issue price in their first day of uncondit... Date Added: 2009-02-11 20:22:15 |
| 060719rosneft.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Rosneft off to slow start - Print Version - International Herald Tribune Rosneft off to slow start Reuters THURSDAY, JULY 20, 2006 LONDON Shares of the Russian oil company Rosneft dipped slightly below their issue price in their first day of uncondit... Date Added: 2009-02-11 20:25:51 |
| Min_AppComputerSci.pdf Path: Keene State >> SPED >> 465 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:53 |
| Min_AppComputerSci.pdf Path: Keene State >> PSYC >> 470 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:52 |
| Min_AppComputerSci.pdf Path: Keene State >> PPS >> 0708 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-02-18 01:40:05 |
| Min_AppComputerSci.pdf Path: Keene State >> PSYC >> 496 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:52 |
| Min_AppComputerSci.pdf Path: Keene State >> PSYC >> 499 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:52 |
| Min_AppComputerSci.pdf Path: Keene State >> ESEC >> 465 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:52 |
| Min_AppComputerSci.pdf Path: Keene State >> SPED >> 401 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:53 |
| Min_AppComputerSci.pdf Path: Keene State >> PE >> 150 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:52 |
| Min_AppComputerSci.pdf Path: Keene State >> SPED >> 460 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:53 |
| Min_AppComputerSci.pdf Path: Keene State >> PE >> 460 Fall, 2008 Description: 20072008Catalog APPLIEDCOMPUTERSCIENCEMinor KEENESTATECOLLEGE Note:Foradvisingsupportonly. Seecatalogforfulldegreerequirements. ID#: Name: MINORREQUIREMENTS:28credits ProgrammingCore(12credits) CS140ComputerProgrammingI CS185ComputerProgram... Date Added: 2009-01-09 02:21:52 |
| venn.pdf Path: ASU >> PT >> 3 Fall, 2009 Description: To Table of Contents Author of Activity: Caroline Arnott Curriculum Unit Title: Transportation Activity Title: Fiction vs. Non-fiction Venn Diagram Integrated subjects: Language Arts, Technology, Science Childrens ages/grades: Seven to eight years of... Date Added: 2009-04-15 21:54:55 |
| 510.pdf Path: University of Illinois, Urbana Champaign >> HRE >> 510 Spring, 2008 Description: Course Schedule - Fall 2005 Human Resource Education 510 Expertise and Its Development Credit: 4 hours. (HRE 485) Covers developments in cognitive- based research as they relate to the design and implementation of technical instruction. Through readi... Date Added: 2009-02-02 18:04:38 |
| LuceNarens_JMP_1983.pdf Path: UC Irvine >> ARIS >> 1983 Fall, 2008 Description: JOURNAL OF MATHEMATICAL PSYCHOLOGY 27, 44-85 (1983) Symmetry, Scale Types, and Generalizations of Classical Physical Measurement R. DUNCAN LUCE Harvard University AND LOUIS NARENS University of California, Irvine A review is presented of a numb... Date Added: 2009-02-06 18:47:58 |
| LuceNarens_JMP_1983.pdf Path: UC Irvine >> SS >> 1983 Fall, 2008 Description: JOURNAL OF MATHEMATICAL PSYCHOLOGY 27, 44-85 (1983) Symmetry, Scale Types, and Generalizations of Classical Physical Measurement R. DUNCAN LUCE Harvard University AND LOUIS NARENS University of California, Irvine A review is presented of a numb... Date Added: 2009-02-06 18:47:58 |
| FSM 160 Revised Course Proposal FA07.doc Path: Fresno City College >> FSM >> 160 Fall, 2008 Description: FRESNO CITY COLLEGE REVISED COURSE PROPOSAL Date: 1. 2. Term for implementation: Fall 2007 8/15/06 Spring Summer TYPE OF REVISION (mark all that apply): Subject Name Course Number Title Description Prerequisite/Corequisite/Advisory Units Hours No. o... Date Added: 2009-02-02 14:12:57 |
| form3.624.3.pdf Path: Tulane >> MATH >> 624 Fall, 2008 Description: FORMULA 3.624.3 /4 0 cosn1/2 2x 2n dx = 2n+1 2n+1 x cos 2 n 1 ... Date Added: 2009-02-02 16:21:42 |
| 31295019601789.pdf Path: Texas Tech >> ETD >> 07012008 Fall, 2009 Description: LOT-TO-LOT ANALYSIS OF SEMICONDUCTOR PARAMETER PREDICTORS by KELLY DeSHIELDS, B.S.E.E. A THESIS IN ELECTRICAL ENGINEERING Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfllment of the Requirements for the Degree of MASTER OF... Date Added: 2009-04-15 20:17:56 |
| galo96t.pdf Path: UPenn >> SOC >> 796 Spring, 2009 Description: ... Date Added: 2009-04-15 21:11:38 |
| Counter-attitudinal Persuasive Speech Path: Valencia >> SPC >> 1600 Spring, 2008 Description: Counter-attitudinal Speech Assignment The purposes of this assignment are: 1. To experience public speaking after several weeks of theoretical discussion and reading regarding communication skills; 2. Observe your ability to apply persuasive theory ... Date Added: 2008-04-14 15:59:53 |
| Chapter7 Review Questions Path: Rutgers >> CELL BIO & >> 245 Spring, 2008 Description: Review Questions Chapter 7 From Textbook 1. Are the dorsal root ganglia in the central or peripheral nervous system? 2. Is the myelin sheath of optic nerve axons provided by Schwann cells or oligodendroglia? Why? 3. Imagine that you are a neurosurgeo... Date Added: 2008-04-03 16:29:00 |
| exam1.pdf Path: UF >> PHY >> 2060 Fall, 2008 Description: PHY 2060 Spring 2007 Exam 1 DO NOT TURN THE PAGE UNTIL INSTRUCTED TO DO SO Instructions: Attempt all ten questions, each of which carries a maximum of 10 points. Write your solution below each question, continuing on on additional paper if necessary... Date Added: 2009-01-10 18:20:33 |
| US_States.pdf Path: Missouri (Mizzou) >> PL >> 2 Fall, 2008 Description: Public Law Population Trend Report US_States -TotalGeographic Area Year Alabama (01) 2000 1 -Over 18Percent 100.0% 1.7% 71.1 - 72.0% 70.3 - 71.0% 26.0 - 26.3% 0.7 - 0.9% 0.5 - 1.0% 0.0 - 0.1% 0.7 - 0.9% 1.0% 100.0% 0.6% 73.6% 73.3% 25.3% 0.5% 0.4% ... Date Added: 2009-02-17 22:46:12 |
| US_States.pdf Path: Missouri (Mizzou) >> PL >> 94 Fall, 2008 Description: Public Law Population Trend Report US_States -TotalGeographic Area Year Alabama (01) 2000 1 -Over 18Percent 100.0% 1.7% 71.1 - 72.0% 70.3 - 71.0% 26.0 - 26.3% 0.7 - 0.9% 0.5 - 1.0% 0.0 - 0.1% 0.7 - 0.9% 1.0% 100.0% 0.6% 73.6% 73.3% 25.3% 0.5% 0.4% ... Date Added: 2009-02-17 22:46:12 |
| list_of_tables.pdf Path: Virginia Tech >> LIB >> 101198 Fall, 2008 Description: List of Tables 2.1 3.1 3.2 4.1 4.2 4.3 4.4 6.1 Abscissae and weight coefficients of the Gaussian quadrature formula Hercules AS4/3502 graphite/epoxy lamina material properties Near optimum feasible designs along with their failure load Cure kinetic p... Date Added: 2009-02-18 01:13:43 |
| 551.2c.doc Path: Wisconsin Milwaukee >> MATH >> 551 Fall, 2008 Description: 44 C. Closure and Convergence Definition. Let X be a topological space with topology t. Hence, the open subsets of X are the elements of t. A subset C of X is closed if its complement X C is open. Observation. Let X be a topological space and let U ... Date Added: 2009-04-16 00:35:28 |
| facid1.txt Path: Arizona >> BIOC >> 462 Fall, 2008 Description: zap background [0,0,0] load 18-0.pdb set ambient 20 set specular on moveTo 1 -999 29 16 174.9 105 spacefill on ... Date Added: 2009-04-15 22:58:55 |
| Chapter 18 Path: USC >> BUAD 304 >> BUAD 304 Fall, 2008 Description: Chapter 18: Human Resource Policies and Practices Selection Practices Initial Selection Goal: use for preliminary cuts to decide if basic qualifications are met I.e. application forms, background checks Substantive Selection Goal: Determine the... Date Added: 2008-12-10 23:39:43 |
| Homer Part 6 Fall o5 HW7.pdf Path: Illinois State >> GEO >> 444 Fall, 2008 Description: GEO 440 Homework 7 Homer Hazardous Waste Site VI: Chemical Assessment Due: November 26 Overview: We will we be continuing the series of exercises that walk you through the modeling process. The overall exercise examines a hazardous waste site and the... Date Added: 2009-01-09 01:51:49 |
| Organ Histo Lab Practical 1 Path: Palmer Chiropractic >> ORGAN HIST >> 201 Spring, 2008 Description: Organ Histology Lab Practical 1 Notes From Review: will not be asked to identify slides unless specified use Sharon Freedman\'s website for slides w3.palmer.edu/freedman know: general tissue specific layers specific cells example wording of q... Date Added: 2008-04-07 13:01:28 |
| 202.PubPrivSectors.doc Path: Old Dominion >> ECON >> 456 Fall, 2008 Description: A CLOSER LOOK AT THE U.S. ECONOMY: PRIVATE AND PUBLIC SECTORS, DISTRIBUTION OF INCOME The Distribution of Income There are more than 105 million households in the U.S. Who are they? 89% native born (2000) 52% of foreign born are from Latin America 82... Date Added: 2009-01-09 05:55:51 |
| Lect14.CommEcol.08.abrev.pdf Path: N. Illinois >> BIOS >> 316 Fall, 2008 Description: Community Ecology Community may be defined as association of interacting populations at same place and time spatial delineation has tended to emphasize sharp boundaries or limits to the communitywith or without verifying presence and importance of ... Date Added: 2009-01-09 05:16:44 |
| Lect14.CommEcol.08.abrev.pdf Path: N. Illinois >> BIOS >> 316s Fall, 2008 Description: Community Ecology Community may be defined as association of interacting populations at same place and time spatial delineation has tended to emphasize sharp boundaries or limits to the communitywith or without verifying presence and importance of ... Date Added: 2009-01-09 05:16:44 |
| 060728strike2.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / Lex - Indian outsourcingSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.com LexSubscription pageCloseIndian outsourcing Published: July 28 2006 13:20 | Last updated: July 28 2006 13:20 Fridays strike by bank wo... Date Added: 2009-02-11 19:30:18 |
| 060728strike2.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / Lex - Indian outsourcingSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.com LexSubscription pageCloseIndian outsourcing Published: July 28 2006 13:20 | Last updated: July 28 2006 13:20 Fridays strike by bank wo... Date Added: 2009-02-11 20:02:13 |
| annualrpt07-08.pdf Path: Marywood >> WWW >> 2 Fall, 2008 Description: Marywood University ANNUAL REPORT of THE PRESIDENT 2006-2007 Above all, let it be our study to serve God ST. ALPHONSUS LIGUORI Celebrate This moment contains all moments. ~ C.S. Lewis Being open to new challengesexploring the latest academic resea... Date Added: 2009-02-11 21:02:23 |
| Chapter 11 Path: Washington >> PSYCH >> 101 Spring, 2008 Description: Chapter 11 ... Date Added: 2008-04-07 09:36:25 |
| 050527andijan.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: From: gw@guardian.co.uk Sent: Wednesday, December 14, 2005 10:42 PM To: Bove, Roger Even Subject: Majordomo file: list \'guardian-weekly\' file \'gw-features/2005.5.29/15.1.txt\' -War on terror just a convenient excuse / Karimov picked the wrong scapegoa... Date Added: 2009-02-11 19:21:45 |
| FTFS Chap14 P090 Path: UF >> EML >> 3007 Spring, 2008 Description: Chapter 14 Flow in Pipes Review Problems 14-90 A compressor takes in air at a specified rate at the outdoor conditions. The useful power used by the compressor to overcome the frictional losses in the duct is to be determined. Assumptions 1 The flow ... Date Added: 2008-04-18 17:56:19 |
| RELG361-Paper2 Path: McGill >> RELG >> 361 Spring, 2008 Description: RELG 361- PAPER #2 March 13th, 2008 Michael Roskies 260193197 While objective psychology and psychoanalysis both have foundations in the analysis of human behavior to reveal the mechanisms behind the \"unconscious\", their approaches and the resultin... Date Added: 2008-04-07 15:37:09 |
| Heat Budget Questions Path: UGA >> MARS >> 1010L Fall, 2008 Description: MARS 1010 - Solar input, heat budget, and climate Dr. Yager Read Chapter 7 in Sverdrup and Armbrust 1. Describe the layers of the Earth\'s atmosphere and explain why it has the temperature profile that it does. See pg 178 chart. Outer spacemesopauses... Date Added: 2008-04-13 16:28:40 |
| verilog12up.pdf Path: N.C. State >> ECE >> 520 Fall, 2008 Description: ECE 520 Class Notes Introduction to Design With Verilog Dr. Paul D. Franzon Outline 1. HDL-based Design Flow 2. Introduction to the Verilog Hardware Description Language 3. A complete example: count.v Design Verification Synthesis References 1. Qui... Date Added: 2009-01-09 04:50:07 |
| KeyFinal2007.doc Path: Purdue >> AGEC >> 424 Fall, 2008 Description: ... Date Added: 2009-01-09 06:32:29 |
| completemanual.pdf Path: Auburn >> PHYS >> 1000 Fall, 2008 Description: Laboratory Manual PHYS 1000 \"Dave Letterman Physics\" Academic Year 2003-04 by Chad L. Rodekohr Michael J. Bozack Department of Physics Auburn University Auburn, AL 36849 1 A Note to the Reader The Lab Manual complements and extends physics concepts... Date Added: 2009-01-09 18:34:48 |
| evaluation_sheet.pdf Path: N. Illinois >> ETT >> 401a Fall, 2008 Description: TL 6440 Product Evaluation Identification Sheet What What are the specific issues/tasks you are going to evaluate? Why Why is it important to evaluate the issues/tasks? When When are you going to evaluate the issues/tasks? How What are the data co... Date Added: 2009-01-09 05:18:40 |
| evaluation_sheet.pdf Path: N. Illinois >> ETT >> 641 Fall, 2008 Description: TL 6440 Product Evaluation Identification Sheet What What are the specific issues/tasks you are going to evaluate? Why Why is it important to evaluate the issues/tasks? When When are you going to evaluate the issues/tasks? How What are the data co... Date Added: 2009-01-09 05:19:07 |
| evaluation_sheet.pdf Path: N. Illinois >> ETT >> 501 Fall, 2008 Description: TL 6440 Product Evaluation Identification Sheet What What are the specific issues/tasks you are going to evaluate? Why Why is it important to evaluate the issues/tasks? When When are you going to evaluate the issues/tasks? How What are the data co... Date Added: 2009-01-11 17:07:58 |
| evaluation_sheet.pdf Path: N. Illinois >> ETT >> 510 Fall, 2008 Description: TL 6440 Product Evaluation Identification Sheet What What are the specific issues/tasks you are going to evaluate? Why Why is it important to evaluate the issues/tasks? When When are you going to evaluate the issues/tasks? How What are the data co... Date Added: 2009-01-11 17:07:58 |
| observation1 Path: Belmont >> AET >> 1380 Spring, 2008 Description: Tyler Casey AET 1380 2-18-2008 Observation #1 Session Specifics: Date/time: Feb. 14 10pm-1am Type of session: tracking Studio: CMB Studio B Engineer: Bert Elliot Assistant Engineer: Will Presley Producer: David Sintron Song: Rock cover of Umbrella b... Date Added: 2008-04-17 16:01:05 |
| Feb 26 Lecture Path: Tampa >> HIS >> HIS/WST 21 Spring, 2008 Description: Sanjay Subrahmanyam \"Holding the World in Balance: The Connected Histories of the Iberian Overseas Empires\" - American Historical Review Dec. 2006 New England: Intro: Spanish empire was land based, the Portuguese empire was maritime and based in trad... Date Added: 2008-04-22 18:47:42 |
| math241hw5supp.pdf Path: UPenn >> MATH >> 241 Fall, 2008 Description: Math 241, Spring 2005 Homework #5 Supplementary problems 1. Use the superposition principle to solve the Laplace equation 2u 2u + =0 x2 y 2 with boundary data u (0, y) = 2y, x u (1, y) = 1, x u(x, 0) = 2x, u(x, 1) = 1. 2. Using the Maple command plo... Date Added: 2009-04-15 20:49:10 |
| Homework2.pdf Path: UC Davis >> PHY >> 252b Fall, 2008 Description: Homework #2 - Statistics and Data Analysis - Probability Distributions 1. A certain isotope has an lifetime of 1 year. If you have 1 mole of this isotope, what is the activity of the sample, in counts per second? 2. If you have beam collisions at a... Date Added: 2009-01-09 19:35:20 |
| probs2.pdf Path: Arizona >> MATH >> 124 Fall, 2008 Description: 1. Chapter Review Chapter 2: 3,5,23,25,36 2. Chapter Review Chapter 3: 3,5,7,22,25,34,60,61,62,63,77,80,81,82 3. Check your understanding Chapter 2: 10,11,12,15,17,22,23 4. Check your understanding Chapter 3: 1,2,6,7,11 5. Consider the following tabl... Date Added: 2009-04-15 23:08:14 |
| becker.pdf Path: Lehigh >> V >> 15 Fall, 2009 Description: The Problem of Underachievement in the French Educational System Lara Becker Introduction Education is the process of developing knowledge, mind, and character of an individual or population by formal schooling, teaching, and application. Education ... Date Added: 2009-04-15 19:39:01 |
| 3takehome072a.doc Path: Chester >> ECO >> 252 Fall, 2008 Description: 3takehome072a 11/27/07 Data Sets for Problem 1 The numbers that are common to all data sets appear below. The sums, sums of squares and sums of cross products for these 16 observations are given below. You will need to modify every one. Show your wor... Date Added: 2009-02-11 17:18:42 |
| Attach 4 - CERJ Rpt 03-04.pdf Path: UC Davis >> ACADEMICSE >> 102804 Fall, 2008 Description: 31 August 2004 To: Representative Assembly Davis Division Annual Report of the Committee on Elections Rules and Jurisdiction 2003-04 The workload of the Committee on Elections, Rules, and Jurisdiction, which over the past three years has become incre... Date Added: 2009-02-06 18:16:26 |
| Attach 4 - CERJ Rpt 03-04.pdf Path: UC Davis >> MRAK >> 102804 Fall, 2008 Description: 31 August 2004 To: Representative Assembly Davis Division Annual Report of the Committee on Elections Rules and Jurisdiction 2003-04 The workload of the Committee on Elections, Rules, and Jurisdiction, which over the past three years has become incre... Date Added: 2009-02-06 18:24:06 |
| 7-FractEvolIgRx.pdf Path: JMU >> GSCI >> 102 Fall, 2008 Description: Light colored and coarse Dark colored and fine Granite Basalt What Do We Need to Explain About Igneous Rocks? Light colored and coarse Dark colored and fine Granite Basalt Well, for a start, why the great differences between two rocks like the... Date Added: 2009-01-09 02:14:05 |
| 7-FractEvolIgRx.pdf Path: JMU >> GGEOL >> 102 Fall, 2008 Description: Light colored and coarse Dark colored and fine Granite Basalt What Do We Need to Explain About Igneous Rocks? Light colored and coarse Dark colored and fine Granite Basalt Well, for a start, why the great differences between two rocks like the... Date Added: 2009-01-09 02:14:05 |
| Lab2.pdf Path: Purdue >> STAT >> 503 Fall, 2008 Description: Please circle your section number Stat 503 Computer Lab 2 1 2 3 4 Name: Module 5 Calculate Pr( -1.3 < Z < 2.1) (Remember that Z refers to a standard normal random variable). Suppose Y has mean 4.5 and SD 2.0. Calculate Pr(4.2 < Y < 4.9). Calc... Date Added: 2009-01-09 06:50:33 |
| pgf_introduction.pdf Path: Cornell >> PAGES >> 248 Fall, 2008 Description: ... Date Added: 2009-02-18 02:13:57 |
| ReaderApplication2008.pdf Path: UC Davis >> PHYSICS >> 2008 Fall, 2008 Description: UNIVERSITY OF CALIFORNIA, DAVIS DEPARTMENT OF PHYSICS APPLICATION FOR READERSHIP Name_ Local Address_ Student ID Number_ Major_ __ Class Level_ Phone Number_ Email_ Physics/Astronomy classes that I have completed that have prepared me for reading: ... Date Added: 2009-02-06 18:19:27 |
| Final A.pdf Path: Texas Brownsville >> ECON >> 6351 Fall, 2008 Description: ECON 6351 Economics Seminar Applied Econometrics Summer II, 2007 Final Exam Answer Key 1. a. The sample regression function using RATS output: log( psoda ) = 1.4633 + 0.0728 prpblck + 0.1369 log(income) + 0.3804 prppov b. Interpretation of the es... Date Added: 2009-02-02 20:18:28 |
| 17homework14 Path: Texas >> PHY >> 303K Fall, 2003 Description: Husain, Zeena Homework 14 Due: Dec 2 2003, 4:00 am Inst: H L Berk This print-out should have 16 questions, check that it is complete. Multiple-choice questions may continue on the next column or page: nd all choices before making your selection. T... Date Added: 2009-01-27 20:34:58 |
| handout3.pdf Path: Berkeley >> IB >> 153 Fall, 2004 Description: IB 153 Demography and Life Histories I 9/12/2006 Definitions of demographic terms and symbols [Notation and definitions vary from text to text well follow those used in BTH] Cohort a group of individuals that were born at the same time x = age, a... Date Added: 2009-02-18 14:20:53 |
| extra credit 2 Path: Delaware >> FASHION >> FASH 101 Spring, 2008 Description: FABRIC: THE ESSENTIAL QUALITY INDICATOR lot added, \"twisted legs\" can result. Similarly, 5-: compensate for the natural torque of some Biting from the circular knitting process to Ft in the finished garment (see Figure 7-5). shrinkage, both torque an... Date Added: 2008-04-11 10:34:38 |
| STUDENTS136Ch11Seniority.pdf Path: UCSD >> ECON >> 136 Spring, 2008 Description: Chapter Ch t 11 Seniority-Based S i it B d Incentive Systems Julian Betts, Economics 136 Note: Skip appendix Main Questions 1) When people unlikely to get promoted, what are alternatives to provide motivation? 2) What about pay raises as experience ... Date Added: 2009-01-11 21:38:31 |
| conclude.pdf Path: Berkeley >> SUNSITE >> 64 Fall, 2009 Description: 64-bit Solaris 6. Status and Conclusions Sun Proprietary: Need-To-Know 77 3499 microsystems Status s s ~600 3rd party vendors participated in Beta Large number of 3rd party vendors working on 64-bit ports Working with vendors to verify 32-bit... Date Added: 2009-04-16 01:52:11 |
| maxflow.pdf Path: Alaska Anch >> CS >> A351 Fall, 2008 Description: Maximum Flow Chapter 26 Flow Graph A common scenario is to use a graph to represent a flow network and use it to answer questions about material flows Flow is the rate that material moves through the network Each directed edge is a conduit for th... Date Added: 2009-01-11 21:14:10 |
| epic99t.ps Path: Cornell >> EPIC >> 99 Fall, 2008 Description: \' EPIC\'99 8 April 1999 Indiana University Cyclotron Facility $ Results from ZEUS and H1 on Di ractive Processes Workshop on Physics with an Electron/Polarized-Ion Collider & J. A. Crittenden Physics Institute University of Bonn % \' Integrate... Date Added: 2009-02-18 02:14:14 |
| poisson.pdf Path: Duke >> MATH >> 135 Summer, 2008 Description: The Poisson Distribution. Suppose R is a region in Rn . Let L be the family of Legesgue measurable subsets of R with nite narea. Suppose for each A in L there is a random variable NA with the following properties: (i) The range of NA is a is a subset... Date Added: 2009-01-10 18:12:46 |
| CWAP5.pdf Path: Maryland >> EFC >> 5 Fall, 2008 Description: ... Date Added: 2009-02-06 19:24:15 |
| 040204goldenSh.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Institute for War and Peace Reporting Vacancies Vacancies Internships Internships Reporting Reporting Research Training Mentor Programme Mentor Programme Safety Security Current Programmes Current Programmes... Date Added: 2009-02-11 18:36:40 |
| nanochemFall07_syll.pdf Path: Utah State >> PHYS >> 3500 Fall, 2008 Description: Nanochemistry (Chem 3750-001/PHY3500-003) Fall 2007 WF, 3:00-4:15, Eng-202 Instructor: Dr. Tapas Kar, Chemistry Building 279 797-7230, tapas.kar@usu.edu This course will cover a range of topics in current nanochemistry (see below). The course will ... Date Added: 2009-02-02 20:48:02 |
| ECEN 5363 Supplemental Homework1.doc Path: Oklahoma State >> ECEN >> 5363 Fall, 2008 Description: ECEN 5363 Supplemental Homework # 1 Using the transistor data provided on the web page (Transistor data) using your knowledge of transistor behavior in the saturation region determines the following SPCICE model parameters; Lambda, VT0, and KP for th... Date Added: 2009-02-03 13:19:29 |
| 10SRS.pdf Path: Scranton >> KOSMAHLE >> 378 Fall, 2009 Description: ... Date Added: 2009-04-15 19:53:13 |
| Sheet 2.doc Path: Dakota Wesleyan >> MATH >> 115 Fall, 2008 Description: MTH 115 Problem Sheet 2 1. The following histogram shows the frequencies of various scores received by students on a 10-point quiz in Psychology 121. 6 5 4 Frequencies 3 2 1 0 3 4 5 Scores 6 7 8 9 10 1a. Make a frequency table for the scores. 1b.... Date Added: 2009-03-19 00:13:27 |
| umi-umd-5556.pdf Path: Maryland >> TOMOS >> 8505 Fall, 2008 Description: ABSTRACT Title of Document: POPULATION POLICY AND HUMAN CAPITAL ACCUMULATION IN CHINA Xiaoyu Wu, Ph.D., 2008 Directed By: Professor Seth Sanders, Department of Economics China, the most populous country in the world, has had high economic growth... Date Added: 2009-02-06 19:32:45 |
| umi-umd-5556.pdf Path: Maryland >> LIB >> 8505 Fall, 2008 Description: ABSTRACT Title of Document: POPULATION POLICY AND HUMAN CAPITAL ACCUMULATION IN CHINA Xiaoyu Wu, Ph.D., 2008 Directed By: Professor Seth Sanders, Department of Economics China, the most populous country in the world, has had high economic growth... Date Added: 2009-02-06 19:18:13 |
| umi-umd-5556.pdf Path: Maryland >> TOMOS >> 1903 Fall, 1920 Description: ABSTRACT Title of Document: POPULATION POLICY AND HUMAN CAPITAL ACCUMULATION IN CHINA Xiaoyu Wu, Ph.D., 2008 Directed By: Professor Seth Sanders, Department of Economics China, the most populous country in the world, has had high economic growth... Date Added: 2009-02-06 19:32:45 |
| umi-umd-5556.pdf Path: Maryland >> LIB >> 1903 Fall, 1920 Description: ABSTRACT Title of Document: POPULATION POLICY AND HUMAN CAPITAL ACCUMULATION IN CHINA Xiaoyu Wu, Ph.D., 2008 Directed By: Professor Seth Sanders, Department of Economics China, the most populous country in the world, has had high economic growth... Date Added: 2009-02-06 19:18:13 |
| LPgraph.ppt Path: Southern Methodist >> EMIS >> 8374 Spring, 2008 Description: SMU EMIS 8374 LP Solutions The Graphical Method prepared by Imran Ismail updated 19 January 2006 1 Consider the following LP Maximize X + 2Y Subject to: X+Y4 X - 2Y 2 -2X + Y 2 X, Y 0 This problem is in two dimensions and can be solved graphica... Date Added: 2009-01-09 07:13:39 |
| EDFA 615F Educational Policy and Decision Making Fall 2003.pdf Path: Purdue >> MGMT >> 615f Spring, 2008 Description: ... Date Added: 2009-02-02 15:46:36 |
| Programming Assignment03.pdf Path: Hawaii >> ICS >> 491 Fall, 2008 Description: Programming Assignment Write a program to do the sequence of two motions that would fit in an area no larger than 4 feet by 4 feet. 1) With MSRS using the LegoNxt in simulation. Send code on Tuesday by 6pm. (1/4 of Assignment3). 2) With the LegoNxt M... Date Added: 2009-02-17 19:16:10 |
| 040922rail.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / World / International economy - Europe\'s old freight trains find rivals put new habits on track Wednesday Sep 22 2004 . All times are London time. Roger Bove Edit Profile Take a Tour Log out HomeWorldUSUKEuropeAsia-PacificMiddle East & Af... Date Added: 2009-02-11 18:32:59 |
| PHY303LEXAM1 Path: Texas >> PHY303L >> 303L Spring, 2009 Description: Version 109 Exam 01 Chiu (58295) This print-out should have 16 questions. Multiple-choice questions may continue on the next column or page nd all choices before answering. 001 10.0 points Two uncharged metal balls, Z and X, stand on insulating g... Date Added: 2009-04-13 05:06:56 |
| Gas Path: Bellevue College >> UNKNOWN >> 110 Fall, 2008 Description: Gas Molecular Structure Molar Mass Flammability Chemical Reactivity Air Nitrogen Oxygen Argon Carbon Dioxide Helium Methane Propane Hydrogen ... Date Added: 2008-04-08 01:36:28 |
| lecture12.pdf Path: Pittsburgh >> TELCOM >> 2120 Spring, 2008 Description: TELCOM 2120 Single Markovian Queue Instructor: Anotai Srikitja Department of Information Science and Telecommunications University of Pittsburgh Stochastic Processes ? A stochastic process is a mathematical model for describing an empirical proces... Date Added: 2009-02-02 20:09:20 |
| AudreyWeek6A-06.ppt Path: Wisconsin >> GENETICS >> 6 Fall, 2008 Description: Last time: - Microarray overview - Assessing quality of microarray replicates - Identifying differentially expressed genes from replicates Parametric: - t-test (are the means of 2 samples different?) - ANOVA (are the means of 2 or more samples differ... Date Added: 2009-03-19 00:00:08 |
| AudreyWeek6A-06.ppt Path: Wisconsin >> SKOP >> 6 Fall, 2008 Description: Last time: - Microarray overview - Assessing quality of microarray replicates - Identifying differentially expressed genes from replicates Parametric: - t-test (are the means of 2 samples different?) - ANOVA (are the means of 2 or more samples differ... Date Added: 2009-03-19 00:00:08 |
| AudreyWeek6A-06.ppt Path: Wisconsin >> AUDREYWEEK >> 6 Fall, 2009 Description: Last time: - Microarray overview - Assessing quality of microarray replicates - Identifying differentially expressed genes from replicates Parametric: - t-test (are the means of 2 samples different?) - ANOVA (are the means of 2 or more samples differ... Date Added: 2009-03-19 00:00:08 |
| AudreyWeek6A-06.ppt Path: SJR CC >> GENETICS >> 6 Fall, 2008 Description: Last time: - Microarray overview - Assessing quality of microarray replicates - Identifying differentially expressed genes from replicates Parametric: - t-test (are the means of 2 samples different?) - ANOVA (are the means of 2 or more samples differ... Date Added: 2009-03-19 00:00:08 |
| AudreyWeek6A-06.ppt Path: SJR CC >> SKOP >> 6 Fall, 2008 Description: Last time: - Microarray overview - Assessing quality of microarray replicates - Identifying differentially expressed genes from replicates Parametric: - t-test (are the means of 2 samples different?) - ANOVA (are the means of 2 or more samples differ... Date Added: 2009-03-19 00:00:08 |
| interviewsposted.pdf Path: San Jose State >> CS >> 240 Fall, 2008 Description: Rudy Rucker, All the Interviews, Updated November 12, 2008 All the Interviews by Rudy Rucker Last updated: November 12, 2008 Word count: 67194. Questions: 1 through 278 All the Interviews is my compilation in chronological order of all of the inter... Date Added: 2009-01-11 20:58:00 |
| interviewsposted.pdf Path: San Jose State >> CS >> 116b Spring, 2008 Description: Rudy Rucker, All the Interviews, Updated November 12, 2008 All the Interviews by Rudy Rucker Last updated: November 12, 2008 Word count: 67194. Questions: 1 through 278 All the Interviews is my compilation in chronological order of all of the inter... Date Added: 2009-01-10 00:10:59 |
| interviewsposted.pdf Path: San Jose State >> CS >> 134 Spring, 2008 Description: Rudy Rucker, All the Interviews, Updated November 12, 2008 All the Interviews by Rudy Rucker Last updated: November 12, 2008 Word count: 67194. Questions: 1 through 278 All the Interviews is my compilation in chronological order of all of the inter... Date Added: 2009-01-11 18:10:47 |
| interviewsposted.pdf Path: San Jose State >> CS >> 156 Spring, 2008 Description: Rudy Rucker, All the Interviews, Updated November 12, 2008 All the Interviews by Rudy Rucker Last updated: November 12, 2008 Word count: 67194. Questions: 1 through 278 All the Interviews is my compilation in chronological order of all of the inter... Date Added: 2009-01-11 18:10:48 |
| AS150 3-12-08 Path: Berkeley >> ASIAN STUD >> 150 Spring, 2008 Description: International Norms Sending Countries 3/12/2008 AS150 \"Migration and Multiculturalism in Asia\" Asian Values Singapore, Malaysia, China Asia: Collective over individual rights, social order, strong government, economic development first Universal ... Date Added: 2008-06-08 20:47:35 |
| Chapter9-SNMP.ppt Path: Georgia Tech >> MGT >> 3076 Fall, 2008 Description: Chapter 9 Network Management A note on the use of these ppt slides: Were making these slides freely available to all (faculty, students, readers). Theyre in PowerPoint form so you can add, modify, and delete slides (including this one) and slide con... Date Added: 2009-02-02 21:30:44 |
| Syllabus math 112 Path: Western Washington >> MATH >> 112 Spring, 2008 Description: Math 112 Fall 2008 Functions and Algebraic Methods Instructor: Eric Kean Office: Bond Hall 182 Phone: 650-4271 E-Mail: Eric.Kean@wwu.edu Office Hours: Monday,Thursday 1:00-1:50pm Tuesday, Wednesday 12:00-12:50pm Text: Functions and Algebraic Method... Date Added: 2008-10-03 12:11:33 |
| FloridaPoliticsTest1Review Spring 2008 Path: USF >> POS >> 3404 Spring, 2008 Description: STUDY GUIDE TEST 1 FLORIDA POLITICS (2 books) Questions From: Florida\'s Politics: Ten Media Markets, One Powerful State Chapter 1 What is a media market? (3) What is the urban-rural split? (5) What are the rural media markets? (5) What are some of... Date Added: 2008-04-20 21:06:08 |
| FBI47_002279_DOJFBI002277.pdf Path: UC Davis >> HUMANRIGHT >> 47 Fall, 2008 Description: ... Date Added: 2009-02-06 18:10:16 |
| MATH 1780 Lecture Notes Chapter 3 Section 5 and 6 Path: North Texas >> MATH >> 1780 Fall, 2008 Description: As before, in the Binomial Distribution, we will be tossing a coin repeatedly. However this time, we will not be tossing it only n times. We are going to be tossing it an undetermined number of times. This time, we have an infinite sequence of ... Date Added: 2008-09-30 22:36:33 |
| Hirsch.pdf Path: IPFW >> COM >> 491 Fall, 2008 Description: From: 126 . ON RECORD Frith, S. & Goodwin, A. (1990). On record: Rock, pop, the written word. New York: Pantheon Books. -~- from organization theory to study the interrelation between music produe, rion and the promotion of pop via the mass media-a... Date Added: 2009-01-09 01:54:46 |
| Hirsch.pdf Path: IPFW >> COM >> 531 Fall, 2008 Description: From: 126 . ON RECORD Frith, S. & Goodwin, A. (1990). On record: Rock, pop, the written word. New York: Pantheon Books. -~- from organization theory to study the interrelation between music produe, rion and the promotion of pop via the mass media-a... Date Added: 2009-01-09 01:54:46 |
| Missing Work Summary.doc Path: Auburn >> CHEN >> 2610 Fall, 2008 Description: Missing Work Summary Name F88G N99L L14B D00O D77E J16C N14T R91B K19W B30R L39U C90W X97D Z39X Z65B D11O M93I M97D Q24J (Lab6 not shown) HW0 HW1 HW2 HW2a HW3 GWE CGS WSG L ab1 L ab2 L ab3 HW4 L ab4 L ab5 L ab7 P1 P2 P3 Proj1 X X X X X X X X X X X ... Date Added: 2009-01-09 18:22:34 |
| Missing Work Summary.doc Path: Auburn >> CHEN >> 3600 Fall, 2008 Description: Missing Work Summary Name F88G N99L L14B D00O D77E J16C N14T R91B K19W B30R L39U C90W X97D Z39X Z65B D11O M93I M97D Q24J (Lab6 not shown) HW0 HW1 HW2 HW2a HW3 GWE CGS WSG L ab1 L ab2 L ab3 HW4 L ab4 L ab5 L ab7 P1 P2 P3 Proj1 X X X X X X X X X X X ... Date Added: 2009-01-09 18:22:34 |
| SampleProposalB.doc Path: Texas Tech >> TC >> 2311 Fall, 2009 Description: Warning: Do not use this document as a cutand paste template. If you do, you will receive an \"F.\" Do not reuse the wording or \"styles\" from this document. If you do, you will receive an \"F.\" If you need help changing styles or inserting a ... Date Added: 2009-04-15 20:07:27 |
| Annotated Bibliography Path: Westfield State >> ENGL >> 101 Fall, 2007 Description: Lea Marie Sullivan Professor Jennifer Dorfield English Composition I 9/25/07 Sullivan 1 Annotated Bibliography Working Thesis: Legalized gambling is a problem in our society because it causes criminal activity, produces social problems, and creates... Date Added: 2008-04-29 22:29:21 |
| chem ch 3 notes Path: KCTCS >> CHEM >> 201 Spring, 2007 Description: January 23 *uesday, January 22, 2008 10:10 3M Chapter 3 Page 1 January 25 6r7day, January 25, 2008 8:05 AM Chapter 3 Page 2 Chapter 3 Page 3 January 28 Monday, January 28, 2008 8:07 AM Chapter 3 Page 4 Chapter 3 Page 5 ... Date Added: 2008-10-29 23:53:27 |
| Week 2 Lecture Outlines (chemistry) Path: Portland CC >> BIO 231 >> 21888 Spring, 2008 Description: 1 CHERISE LUCAS John Martin T-R 1pm-2:20pm Lecture Biology 231 Human Anatomy and Physiology Week 2 Lecture Outline Chemistry I General Chemistry I. Basic concepts A. Elements =Substance that cannot be broken down into simpler substances by normal r... Date Added: 2008-04-18 16:15:07 |
| Notes 2-28 Path: UNC Greensboro >> PSC >> 100 Spring, 2008 Description: American Politics Notes: February 28th, 2008 Presidential Activities (7) 1) Crisis Management: Things that are relatively unforeseen for the moment (Military or Terrorist Action, Natural Disaster, etc.) The United States is willing to help out any na... Date Added: 2008-04-11 10:35:16 |
| Flank6.txt Path: BYU >> RV >> 0040 Fall, 2009 Description: GCGCGGAACGCCCCGGCGCCTGACGCCCCGGTCCTGTATCCTAAATCAAATATCCNATAAGCAGTGTCTGTTATAACAAA AAATCGATTTAATAGACACACCAACAGCATGGTTTTTATGTGTGCGATAATTTATAATATTTCGGACAGGACTCTAGCCA AAGATTGGGGGAGCAGCAACAGGTTCTCACCGGCGCCAGCACCCGCACCGATCGCGTCGCCGATTCCGGTCGGAGCACCC GGGTCCA... Date Added: 2009-04-16 00:01:10 |
| Mach_Ormsby.pdf Path: Princeton >> LIBWEB2 >> 2 Fall, 2008 Description: ... Date Added: 2009-02-11 21:04:25 |
| 060927climate.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: FT.com / World / Europe - Switzerland knocks US off top spot in competitiveness leagueSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.comWORLD EuropeCloseSwitzerland knocks US off top spot in competitiveness league By C... Date Added: 2009-02-11 19:10:37 |
| 060927climate.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: FT.com / World / Europe - Switzerland knocks US off top spot in competitiveness leagueSkip to main content, accesskey \'s\' Homepage, accesskey \'1\' Financial Times FT.comWORLD EuropeCloseSwitzerland knocks US off top spot in competitiveness league By C... Date Added: 2009-02-11 19:29:45 |
| Econ_11_Chapter_04 Path: UCLA >> ECON >> 11 Winter, 2008 Description: ... Date Added: 2009-03-25 11:34:47 |
| Chapter 14 - DfT.ppt Path: Texas A&M >> PERF >> 489 Fall, 2008 Description: Chapter 14 - Mixed-Signal Design for Test Topics Advantages / Disadvantages of DfT Overview of digital DfT (scan, BIST, etc.) Mixed Signal DfT (IEEE 1149.4, ad hoc techniques) Design margin and robust circuits IDDQ testing Digital testing and... Date Added: 2009-02-03 13:25:06 |
| 4100.form.doc Path: Kennesaw >> CHEM >> 4100 Fall, 2008 Description: GEOG 4100: Directed Applied Research Registration Form Dear Student (Colleague): The Department of Geography and Anthropology is pleased to hear of your interest in taking a directed applied research course. This undergraduate research experience has... Date Added: 2009-02-02 21:35:08 |
| 423.pdf Path: University of Illinois, Urbana Champaign >> NPRE >> 423 Fall, 2008 Description: Course Schedule - Fall 2008 Nuclear, Plasma, and Radiological Engineering 423 Plasma Laboratory credit: 2 hours. Laboratory experiments relating to plasma engineering and fusion energy will be conducted in small groups. Topics in ultra-high vacuum te... Date Added: 2009-02-02 18:22:58 |
| GSAR08.pdf Path: Virginia Tech >> AOE >> 08 Fall, 2008 Description: Graduate Student Activity Report 2008 Instructions The Graduate Program Committee reviews the progress of all graduate students each spring. Stipend levels, continuation of support, admission to and status in the Ph.D. program, and various awards al... Date Added: 2009-02-17 18:39:34 |
| mid08.pdf Path: SUNY Stony Brook >> AMS >> 540 Fall, 2008 Description: AMS 540 / MBA 540 (Fall, 2008) Estie Arkin Linear Programming - Midterm Do all problems. Write your answers on the exam. You are permitted to use the text, your notes and any material handed out in class. The exam time is 1 hour and 20 minutes. GOO... Date Added: 2009-01-12 04:18:11 |
| mid08.pdf Path: SUNY Stony Brook >> MBA >> 540 Fall, 2008 Description: AMS 540 / MBA 540 (Fall, 2008) Estie Arkin Linear Programming - Midterm Do all problems. Write your answers on the exam. You are permitted to use the text, your notes and any material handed out in class. The exam time is 1 hour and 20 minutes. GOO... Date Added: 2009-01-12 04:18:11 |
| Com S 280 - Algorithms, Integers, Matrices Path: Cornell >> CS >> 2800 Fall, 2007 Description: Algorithms, Integers, Matrices Definitions o algorithm: a finite set of precise instructions for performing computation or solving a problem o searching algorithm: the problem of locating an element in a list o linear search algorithm: a procedure fo... Date Added: 2008-04-14 19:51:09 |
| mid1s07ps.pdf Path: UCSD >> MATH >> 102 Fall, 2008 Description: ... Date Added: 2009-01-12 05:42:33 |
| 548.pdf Path: University of Illinois, Urbana Champaign >> LIS >> 548 Spring, 2008 Description: Course Schedule - Spring 2007 Library and Information Science 548 Library Buildings Credit: 2 or 4 hours. Studies the library\'s physical plant in the light of changing concepts and patterns of library service; analyzes present-day library buildings (... Date Added: 2009-02-02 18:14:28 |
| ICADL-Bangkok-Keynote-2005.ppt Path: Arizona >> MIS >> 596a Fall, 2008 Description: DigitalLibraryDevelopmentintheAsia Pacific DigitalLibraryFutureResearch CaseStudyinInternationalDiseaseSurveillance HsinchunChen,Ph.D. , McClellandProfessor, Acknowledgement: *NSF DLI1, DLI2, NSDL *NIH, NLM, NCI *NSF DG, DOJ, DOD, DHS Director,Ar... Date Added: 2009-01-09 15:47:58 |
| ja035166p.pdf Path: Earlham >> JA >> 035166 Fall, 2008 Description: Published on Web 06/20/2003 Four-Coordinate, Planar Ru(II). A Triplet State as a Response to a 14-Valence Electron Configuration Lori A. Watson, Oleg V. Ozerov, Maren Pink, and Kenneth G. Caulton* Department of Chemistry and Molecular Structure Cent... Date Added: 2009-02-11 21:28:03 |
| marysamouelian.pdf Path: UNC >> ENVR >> 470 Fall, 2008 Description: Mary E. Samouelian. Embracing Web 2.0: Archives and the Newest Generation of Web Applications. A Masters Paper for the M.S. in L.S degree. April, 2008. 66 pages. Advisor: Christopher Lee Recently archival professionals have undertaken projects to co... Date Added: 2009-02-03 14:05:12 |
| MGMT_3330_Insley_Text_Chap_09_Revised_2008 Path: North Texas >> MGMT >> 3330 Spring, 2008 Description: MGMT 3330 Communicating in Business Lecture notes for chapter 9. Composing Letters and Memos Business Letters and Memos Chapter 9 2008. Model created by S.M. Sexton 2006 2006 2 Formality Audience analysis will dictate the formality of the ... Date Added: 2008-04-22 11:29:24 |
| Math 092-3327 S07.doc Path: Spokane Falls Community College >> MATH >> 092 Fall, 2008 Description: 1 Mathematics 092 Elementary Algebra II 5 credits Computing, Math and Sciences Division Spring Quarter 2007 Course 3327 MW 06:00pm 09:00pm Bldg 18-209 Instructor: Pietro Paparella Email: pietrop@spokanefalls.edu Office: 18-212G Phone: 533-3248 Of... Date Added: 2009-02-02 16:15:14 |
| Lecture25.pdf Path: UF >> EEL >> 5225 Fall, 2008 Description: EEL5225: Principles of MEMS Transducers (Fall 2003) Instructor: Dr. Hui-Kai Xie (hkx@ufl.edu) MEMS Displays Last lecture Nonlinear dynamics Packaging Today: Electrostatic Projection Display Two Basic Approaches Reflective Diffractive Focus on refl... Date Added: 2009-01-10 18:22:58 |
| 05 Inheritance of Single Gene Differences Path: Clarkson >> BY >> 214 Spring, 2007 Description: Intellectual property and the human genome Critics describe the growth in gene sequence patents as an intellectual property (IP) \"land grab\" over a finite number of human genes. Overly broad patents might block research Physical mapping of patent act... Date Added: 2008-04-23 14:34:09 |
| GRN 644 - New Course.pdf Path: Kentucky >> ME >> 644 Fall, 2008 Description: APPLICATION FOR NEW COURSE 1. Submitted by College of Public Health Gerontology Date Department/Division offering course 2. Proposed designation and Bulletin description of this course a. Prefix and Number GRN 644 b. Title* Demography and Aging *NO... Date Added: 2009-02-03 13:52:17 |
| prepspice.txt Path: Rice >> ELEC >> 422 Fall, 1997 Description: VLSI Design Tools Manual PSPICE(1.VLSI) NAME pspice - prepare an input file for the Spice circuit simulator SYNOPSIS pspice [-rm] [-nos2s] [-d defsfile] [-c configfile] [-e expfile] basename DESCRIPTION Pspice is a shell script for preparing Spice ... Date Added: 2009-02-06 20:11:44 |
| prepspice.txt Path: Rice >> ECE >> 422 Fall, 1997 Description: VLSI Design Tools Manual PSPICE(1.VLSI) NAME pspice - prepare an input file for the Spice circuit simulator SYNOPSIS pspice [-rm] [-nos2s] [-d defsfile] [-c configfile] [-e expfile] basename DESCRIPTION Pspice is a shell script for preparing Spice ... Date Added: 2009-02-06 20:12:47 |
| exam3a.ph6414fall08.key.pdf Path: Minnesota >> BIOSTAT >> 3 Spring, 2007 Description: ... Date Added: 2009-02-17 21:05:48 |
| jstor.pdf Path: UNC >> LIB >> 2 Fall, 2008 Description: EndNote and JSTOR Before you begin exporting JSTOR records, you will have to install the JSTOR filter so that EndNote will be able to read the references correctly. To download the JSTOR filter, go to http:/www.jstor.org/help/endnote_filters.html. Yo... Date Added: 2009-02-18 01:48:31 |
| More Hormones Path: UNC >> BIOL >> 455 Spring, 2008 Description: Steroid Hormones All derived from cholesterol Intermediate steps in going to hormones Depending on conditions from intermediate can go various ways to diff final products *Many steroids are intermediates to other steroids Mostly produced in gonads ->... Date Added: 2008-04-05 06:19:31 |
| Responses Path: Michigan >> HIST >> 443 Winter, 2008 Description: Response 1: One of the most impressive things I noticed in the readings was about the millet system. Of the stereotypes today, many Americans see the Muslim religion as intolerant and hostile. For example, many see Jihad as \"holy war\" as the only def... Date Added: 2008-04-11 21:10:23 |
| FIRT 1307 FIRE PREVENTION CODES and INSPECTIONS.pdf Path: Austin CC >> COMM >> 1307 Fall, 2008 Description: Fire Protection Technology (COURSE MASTER SYLLABUS) FIRT-1307 FIRE PREVENTION CODES and INSPECTIONS COURSEDESCRIPTION Studyoflocalbuildingandfirepreventioncodes. REQUIREDTEXTS/MATERIALS CurrenteditionofFirePrevention,InspectionandCodeEnforcementby... Date Added: 2009-02-02 21:20:50 |
| 208.pdf Path: Minnesota >> TECHTALK >> 2 Fall, 2008 Description: Tech Talk TV Show TVs/Video Cameras Episode View of scattered pixels on a TV screen. The voices of a woman and man are heard. Woman: Now what did you do to it? Man: I didnt touch it. Woman: Check the rabbit ears. Are the rabbit ears connected? Man: ... Date Added: 2009-02-17 20:56:30 |
| 2382.016.ps Path: Hawaii >> SOEST >> 2382 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207378473.0388276 Float: 2382 Profile: 016 Location: 33.9N 143.4E Date: 08/31... Date Added: 2009-02-17 20:20:58 |
| auctions_ii.pdf Path: UCLA >> ECON >> 504 Fall, 2008 Description: Econ 504 (2008) Microeconomics II Haluk Ergin Weber (1982) Aside: Aliation For any z = (z1, . . . , zn), z = (z1, . . . , zn) Rn, dene zz zz = (max{z1, z1}, . . . , max{zn, zn}) = (min{z1... Date Added: 2009-03-19 00:12:14 |
| ch4 price ld calls.xls Path: Illinois State >> ECO >> 439 Fall, 2008 Description: Year Average Revenue per Minute for Interstate and International calls Restated in 2003 Dollars 1984 $0.57 1985 $0.53 1986 $0.47 1987 $0.40 1988 $0.36 1989 $0.32 1990 $0.28 1991 $0.27 1992 $0.25 1993 $0.25 1994 $0.22 1995 $0.20 1996 $0.19 1997 $0.17... Date Added: 2009-01-09 01:49:05 |
| ex02_014 Path: UNC >> STOR >> 155 Fall, 2008 Description: country female male Algeria 60 78 Bangladesh 31 50 Egypt 46 68 Iran 71 85 Jordan 86 96 Kazakhstan 99 100 Lebanon 82 95 Libya 71 92 Malaysia 85 92 Morocco 38 68 SaudiArabia 70 84 Syria 63 89 Tajikistan 99 100 Tunisia 63 83 Turkey 78 94 Uzbekistan 99 1... Date Added: 2008-12-02 13:01:08 |
| feb7 Path: Wisconsin Colleges >> PSYCH >> 101 Spring, 2008 Description: Talking about the Brain The Limbic System-linked to memories, emotions and drives; associated with emotions such as fear and aggression and drives such as those for food and sex; includes the hippocampus, amygdala, and hypothalamus Hippocampus-helps ... Date Added: 2008-04-21 07:39:21 |
| Pooled_statAB_results_fall2004.xls Path: BYU >> CHEM >> 729r Fall, 2008 Description: Chem 223 Class Results for Titration of HCl with Various Indicators, F (Each line summarizes results from one student) Indicator bromocresolgreen bromocresolgreen bromocresolgreen bromocresolgreen bromothymolblue bromothymolblue bromothymolblue eryth... Date Added: 2009-01-09 18:48:57 |
| part5.doc Path: IPFW >> CS >> 306 Fall, 2008 Description: Understanding and Selecting a Database Activity Monitoring Solution: Part 5, Advanced Features Filed under Data Security, Database, Geek, Tools by rmogull | 0 comments Were going to be finishing the series off this week, in large part so I can get ... Date Added: 2009-01-11 16:13:39 |
| Ch.3 Reaction Paper Path: Mount Ida >> PS >> 101 Spring, 2008 Description: Melissa Fuller PS101 A February 7, 2008 Brain cells communicate by means of neurons. There are three types of neurons; they are motor, sensory, and interneurons. Neurons can be found in glial cells which provide nourishment, insulation, damage repair... Date Added: 2008-04-16 14:30:27 |
| quiz2.pdf Path: Wisconsin >> CS >> 302 Fall, 2008 Description: CS 302 Spring 2001, All Lectures 2001 James D. Skrentny CS302: Self Check Quiz 2 name:_ Part I True or False For these questions, is the statement true or false? Assume the statements are about the Java programming language. 1.) The result of an ... Date Added: 2009-02-17 15:54:46 |
| quiz2.pdf Path: SJR CC >> CS >> 302 Fall, 2008 Description: CS 302 Spring 2001, All Lectures 2001 James D. Skrentny CS302: Self Check Quiz 2 name:_ Part I True or False For these questions, is the statement true or false? Assume the statements are about the Java programming language. 1.) The result of an ... Date Added: 2009-02-17 15:54:46 |
| OH8_Cltr.pdf Path: Pittsburgh >> PACWCBT >> 3 Fall, 2008 Description: Culture Culture represents the vast structure of behaviors, ideas, attitudes, values, habits, beliefs, customs, language, rituals, ceremonies and practices peculiar to a particular group of people, and it provides them with: 1) a general design for ... Date Added: 2009-02-18 02:06:02 |
| OH8_Cltr.pdf Path: Uni. Bradford >> PACWCBT >> 3 Fall, 2008 Description: Culture Culture represents the vast structure of behaviors, ideas, attitudes, values, habits, beliefs, customs, language, rituals, ceremonies and practices peculiar to a particular group of people, and it provides them with: 1) a general design for ... Date Added: 2009-02-18 02:06:03 |
| 99-4528_1.pdf Path: Wisconsin >> ECON >> 412 Fall, 2008 Description: 1999 2000 LEGISLATURE LRB4528/1 RAC:wlj:hmh 1999 SENATE BILL 412 February 23, 2000 Introduced by Senator WIRCH, cosponsored by Representative VRAKAS. Referred to Economic Development, Housing and Government Operations. 1 2 3 4 5 AN ACT to repe... Date Added: 2009-02-03 14:29:49 |
| PeaseThesis.pdf Path: Virginia Tech >> LIB >> 06162000 Fall, 2008 Description: Novel approaches to evaluate osteoarthritis in the rabbit lateral meniscectomy model by Anthony Paul Pease, DVM Thesis presented to the Faculty of the Virginia Polytechnical Institute and State University in partial fulfillment of the requirements f... Date Added: 2009-02-18 01:06:49 |
| 211Quiz4P2 Path: University of Maine >> ECE >> 211 Spring, 2007 Description: ... Date Added: 2008-04-19 10:43:30 |
| Using_t_PDF_to_estimate_mean Path: Penn State >> ME >> 345 Spring, 2008 Description: Example - Using the Student\'s t Distribution to Estimate a Mean Value and Confidence Interval J. M. Cimbala, September 2006 i 1 2 3 4 5 x 312.2 320.6 315.5 314.1 319.6 Column1 Mean Standard Error Median Mode Standard Deviation Sample Variance Kurtos... Date Added: 2008-07-23 11:09:04 |
| midterm06.pdf Path: UCSD >> ESYS >> 103 Fall, 2008 Description: Gille-MAE 124/ESYS 103 (Spring 2006) 1 Midterm Thursday, May 11, in class, open note. 1. [25 points] Briey dene the following terms: a. b. c. d. e. Sustainable development; The triple bottom line; Carrying capacity; Ecological footprint; Design fo... Date Added: 2009-01-11 21:29:14 |
| midterm06.pdf Path: UCSD >> MAE >> 1 Fall, 2008 Description: Gille-MAE 124/ESYS 103 (Spring 2006) 1 Midterm Thursday, May 11, in class, open note. 1. [25 points] Briey dene the following terms: a. b. c. d. e. Sustainable development; The triple bottom line; Carrying capacity; Ecological footprint; Design fo... Date Added: 2009-01-12 05:41:54 |
| midterm06.pdf Path: UCSD >> MAE >> 124 Fall, 2008 Description: Gille-MAE 124/ESYS 103 (Spring 2006) 1 Midterm Thursday, May 11, in class, open note. 1. [25 points] Briey dene the following terms: a. b. c. d. e. Sustainable development; The triple bottom line; Carrying capacity; Ecological footprint; Design fo... Date Added: 2009-01-10 18:02:33 |
| midterm06.pdf Path: UCSD >> MAE >> 285 Fall, 2008 Description: Gille-MAE 124/ESYS 103 (Spring 2006) 1 Midterm Thursday, May 11, in class, open note. 1. [25 points] Briey dene the following terms: a. b. c. d. e. Sustainable development; The triple bottom line; Carrying capacity; Ecological footprint; Design fo... Date Added: 2009-01-10 18:02:33 |
| ModifiedThesis.pdf Path: Virginia Tech >> LIB >> 01192007 Fall, 2008 Description: A DIGITAL LIBRARY SUCCESS MODEL FOR COMPUTER SCIENCE STUDENT USE OF A META-SEARCH SYSTEM Vikram Raj Vidya Sagar Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for ... Date Added: 2009-02-18 00:42:43 |
| Quiz2.pdf Path: Rutgers >> STAT >> 590 Fall, 2008 Description: Take Home Quiz #2 Statistics 590 Fall 2005 This assignment is due at the end of class on December 5. If you need to drop it off earlier, you can leave the quiz at the Statistics Department mailboxes, 5th oor of the Hill Center, or after hours you ca... Date Added: 2009-02-04 14:51:45 |
| lecture10outline.pdf Path: Coastal Carolina University >> BIOL >> 370l Fall, 2008 Description: Biodiversity Lecture outline How do we measure diversity? Evolutionary considerations Current factors affecting diversity Invasions Extinctions Value of biodiversity How do we measure diversity? Species richness- the number of species Evenness- how w... Date Added: 2009-01-12 04:23:55 |
| lecture10outline.pdf Path: Coastal Carolina University >> BIOL >> 481 Fall, 2008 Description: Biodiversity Lecture outline How do we measure diversity? Evolutionary considerations Current factors affecting diversity Invasions Extinctions Value of biodiversity How do we measure diversity? Species richness- the number of species Evenness- how w... Date Added: 2009-01-12 04:23:55 |
| lecture10outline.pdf Path: Coastal Carolina University >> BIOL >> 481l Fall, 2008 Description: Biodiversity Lecture outline How do we measure diversity? Evolutionary considerations Current factors affecting diversity Invasions Extinctions Value of biodiversity How do we measure diversity? Species richness- the number of species Evenness- how w... Date Added: 2009-01-12 04:23:55 |
| lecture10outline.pdf Path: Coastal Carolina University >> BIOL >> 581 Fall, 2008 Description: Biodiversity Lecture outline How do we measure diversity? Evolutionary considerations Current factors affecting diversity Invasions Extinctions Value of biodiversity How do we measure diversity? Species richness- the number of species Evenness- how w... Date Added: 2009-01-12 04:23:55 |
| hw19 Path: Arkansas >> PHYS >> 2074 Spring, 2008 Description: Solution for Homework 19 RL Circuits Solution to Homework Problem 19.1(Current in an L-R Circuit) Problem: After the switch in the circuit in the figure is closed Select One of the Following: (a) The current in the circuit is zero at one time constan... Date Added: 2008-04-19 17:46:44 |
| talia.pdf Path: Princeton >> REU >> 2008 Fall, 2008 Description: The Investigation of Extensional Rheology using the Sentmanat Extensional Rheometer(SER) Jordan Talia - University of Michigan Professor Rick Register, Andy Marencic, Robert C. Scogna Princeton University Goals Calculate extensional rheology proper... Date Added: 2009-02-11 21:03:21 |
| Grover-Kopec.pdf Path: Arizona >> CPASW >> 2006 Fall, 2009 Description: Tailored Climate Information Resources for Malaria Control in Africa Emily Grover-Kopec International Research Institute for Climate and Society NOAA Climate Prediction Applications Science Workshop Tucson, Arizona March 21-24, 2006 Malaria in Afr... Date Added: 2009-04-15 23:05:06 |
| Health Final Exam Path: Baylor >> HED >> 1145 Spring, 2008 Description: Final Exam Review: There will be 61 questions. Possible questions include T/F, matching, and multiple choice. The final will not be cumulative. It will only consist of the material that I post on this review sheet. Know the following definitions: car... Date Added: 2008-04-15 21:57:22 |
| shooting an elephant Path: U. Houston >> ENGL >> 1303 Spring, 2007 Description: Casey Gonzales February 7, 2006 English 1303 Solak 9-10am Shooting an Elephant Orwell\'s moral conflict stems from his position as the despised Imperialist in the British colonized country of India. Ironically, however, Orwell claims that during his t... Date Added: 2008-04-08 00:10:01 |
| eeewaterfullreport.pdf Path: Duke >> ENVIRON >> 357l Fall, 2008 Description: A SILENT TSUNAMI THE URGENT NEED FOR CLEAN WATER AND SANITATION This report is available on line at: www.aspeninstitute.org/EEE/water and www.env.duke.edu/institute/water For additional copies of this report, please contact: The Aspen Institute Publ... Date Added: 2009-01-10 02:54:06 |
| 308exam1.doc Path: Winona >> COURSE1 >> 1 Fall, 2008 Description: First Exam Cell Biology 308 Name_ Covers Chap 4, 5, 6 This exam has 30 multiple choice questions worth 1 point each and 2 problems, each worth 10 points. 1 Why are cells small? A) Small cells have a more favorable surface area to volume ratio. B) T... Date Added: 2009-02-17 23:02:22 |
| 1733.276.ps Path: Hawaii >> SOEST >> 1733 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1209506042.0388276 Float: 1733 Profile: 276 Location: 24.3N 159.9E Date: 03/29... Date Added: 2009-02-17 19:59:21 |
| ceodminutes12-6-04.pdf Path: Virginia Tech >> MULTICULTU >> 12 Fall, 2008 Description: Commission on Equal Opportunity and Diversity Monday, December 6, 2004 Minutes Present: Edd Sewell, Pat Hyer, Marilyn Kershaw, Devi Gnyawali, Linda Woodard, Jeff Mann, Laura Hickerson, Ben Dixon, Ray Plaza, Jean Brickey, Susan Willis-Walton, Michael ... Date Added: 2009-02-17 18:41:46 |
| research paper outline Path: UMBC >> ENGL >> 100 A Spring, 2008 Description: Professor Kidd English 100 A 3 December 2007 Research Paper Outline I. Introduction A. Introduction to file sharing. B. Thesis- While some musicians object to the concept of file sharing, the greater majority praise its benefits, as documented thro... Date Added: 2008-04-20 17:18:11 |
| Paulyetal2004.pdf Path: Texas >> BIO >> 2004 Fall, 2008 Description: Evolution, 58(11), 2004, pp. 25172535 THE HISTORY OF A NEARCTIC COLONIZATION: MOLECULAR PHYLOGENETICS AND BIOGEOGRAPHY OF THE NEARCTIC TOADS (BUFO) GREGORY B. PAULY,1,2 DAVID M. HILLIS,3 1 Section AND DAVID C. CANNATELLA1 of Integrative Biology a... Date Added: 2009-02-17 18:15:48 |
| Paulyetal2004.pdf Path: Caribbean >> BIO >> 2004 Fall, 2008 Description: Evolution, 58(11), 2004, pp. 25172535 THE HISTORY OF A NEARCTIC COLONIZATION: MOLECULAR PHYLOGENETICS AND BIOGEOGRAPHY OF THE NEARCTIC TOADS (BUFO) GREGORY B. PAULY,1,2 DAVID M. HILLIS,3 1 Section AND DAVID C. CANNATELLA1 of Integrative Biology a... Date Added: 2009-02-17 18:15:48 |
| Paulyetal2004.pdf Path: Texas >> ZO >> 2004 Fall, 2008 Description: Evolution, 58(11), 2004, pp. 25172535 THE HISTORY OF A NEARCTIC COLONIZATION: MOLECULAR PHYLOGENETICS AND BIOGEOGRAPHY OF THE NEARCTIC TOADS (BUFO) GREGORY B. PAULY,1,2 DAVID M. HILLIS,3 1 Section AND DAVID C. CANNATELLA1 of Integrative Biology a... Date Added: 2009-02-17 18:11:44 |
| Paulyetal2004.pdf Path: Caribbean >> ZO >> 2004 Fall, 2008 Description: Evolution, 58(11), 2004, pp. 25172535 THE HISTORY OF A NEARCTIC COLONIZATION: MOLECULAR PHYLOGENETICS AND BIOGEOGRAPHY OF THE NEARCTIC TOADS (BUFO) GREGORY B. PAULY,1,2 DAVID M. HILLIS,3 1 Section AND DAVID C. CANNATELLA1 of Integrative Biology a... Date Added: 2009-02-17 18:11:44 |
| javaProject2 Path: RIC >> CS >> 221 Spring, 2008 Description: import java.io.*; import java.util.*; public class Project2 { public static void main(String[] s) throws FileNotFoundException { Scanner in = null; PrintWriter out = null; String name; final int STUDENTS = 6; final int GRADES = 3; int[][] array = new... Date Added: 2008-04-17 09:29:08 |
| 040810timeline.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: BBC NEWS | World | Europe | Country profiles | Timeline: Moldova Timeline: Moldova A chronology of key events: 14-15th centuries - Principality of Moldova stretches roughly between Carpathian mountains and Dniester river. DIVIDED NATION Protesters ca... Date Added: 2009-02-11 19:33:52 |
| 060302sakhalin.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Energy Projects Attracting Foreign Banks to Sakhalin Business / Oil Ideas Nightlife Travel Guide Stock Market Latest Wires Forum Services Jobs & Careers Real Estate Classifieds Conferences Photob... Date Added: 2009-02-11 20:21:32 |
| 060302sakhalin.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Energy Projects Attracting Foreign Banks to Sakhalin Business / Oil Ideas Nightlife Travel Guide Stock Market Latest Wires Forum Services Jobs & Careers Real Estate Classifieds Conferences Photob... Date Added: 2009-02-11 20:25:09 |
| lect07.pdf Path: Maryland >> ASTR >> 07 Fall, 2008 Description: Lecture 7: Special Relativity I Einsteins postulates Time dilation Length contraction New velocity addition law Sidney Harris Please start reading Chapter 7 of the text 9/16/08 1 Einstein enters the picture Albert Einstein (1879-1955) Three paper... Date Added: 2009-02-06 19:08:25 |
| lect07.pdf Path: Maryland >> ASTR >> 340 Fall, 2008 Description: Lecture 7: Special Relativity I Einsteins postulates Time dilation Length contraction New velocity addition law Sidney Harris Please start reading Chapter 7 of the text 9/16/08 1 Einstein enters the picture Albert Einstein (1879-1955) Three paper... Date Added: 2009-02-06 19:08:25 |
| EE357 Lecture 8 Path: USC >> EE >> 357 Fall, 2008 Description: Recap:Branch Instructions Operation: (PC) + disp. PC Branches allow us to jump backward or forward Dont forget the extended word for forward branches! Extended word must be added if displacement does not fit in the byte inside the instruction wor... Date Added: 2009-04-11 13:04:49 |
| Session16 Path: USC >> BUAD >> 311 Spring, 2008 Description: Operations Management Session 16: Simulation Session 16 Operations Management 1 Class Objectives Generate random numbers. Develop confidence intervals. Simulate an M/M/1 queue. Simulate a call center. The idea is to first set up a simulation... Date Added: 2008-05-08 22:49:20 |
| sols26.pdf Path: Maryland >> MATH >> 406 Fall, 2008 Description: SOLUTIONS: PROBLEM SET 26 FROM SECTION 11.3 2. 15 n = 1 for n 1, 7, 11, 17 (mod 60). 4. This is immediate from the multiplication rule, the -1 rule and the 2-rule. 1 ... Date Added: 2009-02-06 19:09:59 |
| Eph 5,18b.pdf Path: Catholic >> TRS >> 2 Fall, 2008 Description: Ephesians 5:18b: But Be Filled in the Spirit John Paul Heil Published in Catholic Biblical Quarterly 69 (2007) 506-16 The clause in Eph 5:18b has been predominately translated ^ ` \' but be filled with the Spirit to convey that the Spirit is the c... Date Added: 2009-02-06 19:55:04 |
| Slides.pdf Path: UCSD >> CHEM >> 6c Fall, 2008 Description: Chapter 17 Nuclear Chemistry Nuclear Decay Nuclear Radiation Nuclear Energy 1 Nuclear Decay History 2 Henri Becquerel stored uranium oxide in a drawer with photographic plates. The uranium oxide darkened the plates therefore the uranium oxide... Date Added: 2009-01-10 01:51:37 |
| hw_03_Problem_05_post Path: Penn State >> ME >> 521 Fall, 2007 Description: Homework Set 3, Problem 5, Fall 2006 J. M. Cimbala time 8:00 8:05 8:10 8:15 8:20 8:25 8:30 8:35 8:40 8:45 8:50 8:55 9:00 9:05 9:10 9:15 9:20 9:25 9:30 9:35 9:40 9:45 9:50 9:55 10:00 10:05 10:10 10:15 10:20 10:25 10:30 10:35 10:40 10:45 10:50 10:55 1... Date Added: 2008-07-23 11:15:46 |
| Chapter 6.ppt Path: Illinois State >> MQM >> 328 Fall, 2008 Description: MQM 328 E & The Arts The Price Variable Price Composed of Product price Related expenses Effort expended Effort Expended Objective Time traveled Duration of event Psychological effort Social risk of being identified with a certain group ... Date Added: 2009-02-02 14:27:37 |
| MOSFET_lec19-5.pdf Path: Berkeley >> EE >> 130 Fall, 2007 Description: EECS130 Integrated Circuit Devices Professor Ali Javey 11/01/2007 MOSFETs Lecture 5 Announcements HW7 set is due now HW8 is assigned, but will not be collected/graded. MOSFET Technology Scaling Technology Scaling Small is Beautiful YEAR Technology... Date Added: 2009-04-16 01:46:24 |
| E-111.pdf Path: Purdue >> ABE >> 285 Fall, 2008 Description: Purdue extension Landscape & Ornamentals Department of Entomology E-111-W FUNGUS GNATS AND SHORE FLIES Raymond A. Cloyd, Extension Entomologist, University of Illinois and Clifford S. Sadof, Extension Entomologists Fungus gnat and shore fly adul... Date Added: 2009-01-12 04:07:50 |
| E-111.pdf Path: Purdue >> ENTM >> 111 Fall, 2008 Description: Purdue extension Landscape & Ornamentals Department of Entomology E-111-W FUNGUS GNATS AND SHORE FLIES Raymond A. Cloyd, Extension Entomologist, University of Illinois and Clifford S. Sadof, Extension Entomologists Fungus gnat and shore fly adul... Date Added: 2009-02-02 15:49:42 |
| RightHand.pdf Path: UC Davis >> MATH >> 21 Fall, 2008 Description: ... Date Added: 2009-02-17 17:27:22 |
| RightHand.pdf Path: Presidio School of Management >> MATH >> 21 Fall, 2008 Description: ... Date Added: 2009-02-17 17:27:22 |
| hw6.pdf Path: UCSD >> CSE >> 200 Fall, 2008 Description: CSE200: Computability and Complexity Fall 2008, Homework 6 Instructor: Daniele Micciancio Due Tuesday November 18, 2008 Problem 1: Log-space, Polylog-space (a) Recall the WHILE language we were using in the rst homeworks. The input to any WHILE prog... Date Added: 2009-01-11 21:34:56 |
| 42801084.pdf Path: Illinois State >> THE >> 464 Fall, 2008 Description: EAF 428.01 FOUNDATIONS OF STUDENT AFFAIRS PROGRAMS Fall, 2008 Tuesdays, 5:30pm8:20pm 104 Schroeder Hall Instructor Dr. Brent Paterson 301 Hovey Hall 438-5451 bgpater@ilstu.edu Office hours by appointment Required books (available at campus bookstores... Date Added: 2009-01-09 01:52:09 |
| 42801084.pdf Path: Illinois State >> THE >> 228 Summer, 2008 Description: EAF 428.01 FOUNDATIONS OF STUDENT AFFAIRS PROGRAMS Fall, 2008 Tuesdays, 5:30pm8:20pm 104 Schroeder Hall Instructor Dr. Brent Paterson 301 Hovey Hall 438-5451 bgpater@ilstu.edu Office hours by appointment Required books (available at campus bookstores... Date Added: 2009-01-09 01:52:09 |
| AK2_230 Path: Rochester >> ECO >> 230 Spring, 2008 Description: ECO 230 Economic Statistics Answer Key to Homework #2 Marianna Kudlyak Spring 2007 Total points: 10. Graded exercises: Ex.1 (2 points), Ex.4 (2 points), Ex. 6 (2 points), and Ex. 7 (2 points). 0.5 points were added for the presence of each of the r... Date Added: 2008-06-09 17:40:28 |
| Tech memo1 -- null corrector.pdf Path: Arizona >> OPTI >> 421 Fall, 2008 Description: Null corrector for 1-m /3.5 primary Optical design and analysis J. H. Burge University of Arizona (602) 621-8182 November 15, 1997 Introduction This report gives the optical design and analysis of a two-element Offner-type null corrector for a 1-m p... Date Added: 2009-01-09 15:50:38 |
| 070716EAfrica.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Energy Central News Today\'s News Sponsor The Future of Outsourcing at Utilities is now available from Sierra Energy Group. This comprehensive study provides a \"strategic snapshot\" on the issues that are driving and impacting how utilities are utilizi... Date Added: 2009-02-11 17:41:05 |
| The Bitter Pill (A) Path: Delaware >> BUAD >> 110 Fall, 2007 Description: Vioxx Patients 0-6 months Reduced Polps in Colon Pain reduced Range of motion increased Sleep well Numbness Nausea Dizziness Headaches Cardiac incidents Intestinal bleeding Stomach ulcers Non Vioxx Patients Reduced Polps in Colon Pain reduced Range o... Date Added: 2008-04-07 15:51:15 |
| RhythmArtLevine.pdf Path: Tarleton >> MUSC >> 486 Spring, 2008 Description: Samba Clave - mainly U.S.-style bossa nova; #1 is standard, #2-5 are possible variants - \"3-2\" direction Tamborim pattern, either played in either 5-4 or 4-5 direction . . C . . l . . . j l C / l= 1 2 4 ... Date Added: 2009-01-11 18:23:25 |
| RhythmArtLevine.pdf Path: Tarleton >> MUSC >> 122 Fall, 2008 Description: Samba Clave - mainly U.S.-style bossa nova; #1 is standard, #2-5 are possible variants - \"3-2\" direction Tamborim pattern, either played in either 5-4 or 4-5 direction . . C . . l . . . j l C / l= 1 2 4 ... Date Added: 2009-01-09 07:24:38 |
| RhythmArtLevine.pdf Path: Tarleton >> HIST >> 413 Fall, 2008 Description: Samba Clave - mainly U.S.-style bossa nova; #1 is standard, #2-5 are possible variants - \"3-2\" direction Tamborim pattern, either played in either 5-4 or 4-5 direction . . C . . l . . . j l C / l= 1 2 4 ... Date Added: 2009-01-11 18:22:47 |
| lab 4 data Path: Cal Poly Pomona >> PHY >> 131L Winter, 2007 Description: Slope (m1 - m2)g 3.6 8.92 23.02 36.37 50.97 57.91 76.32 91.15 106.71 7.84 11.76 31.36 50.96 70.56 90.16 109.76 129.36 148.96 slope = 1.410595 Acceleration vs. Net Force 160 140 120 Net Force: (m1 - m2)g 100 80 60 40 20 0 0 20 40 60 ... Date Added: 2008-03-10 22:02:16 |
| Lecture14_goldenage Path: UCLA >> ECON >> 183 Winter, 2009 Description: Lecture 14: Golden age of productivity Electricity as a general purpose technology for illumination and automation. Diffuses from 1900-1920. Electricity increases TFP but with a lag. Required complementary capital investments. Analogy with comput... Date Added: 2009-04-13 17:17:18 |
| Cultural Studies and Research.doc Path: Purdue >> ENGL >> 680t Fall, 2008 Description: Cultural / Critical Studies and Research for English 106 Purpose: The purpose of this assignment is two-fold: 1) to help you develop a critical perspective on the sources you will use for your inquiry and problem-solution papers; 2) to help you devel... Date Added: 2009-01-11 20:52:43 |
| Cultural Studies and Research.doc Path: Purdue >> ENGL >> 505b Spring, 2008 Description: Cultural / Critical Studies and Research for English 106 Purpose: The purpose of this assignment is two-fold: 1) to help you develop a critical perspective on the sources you will use for your inquiry and problem-solution papers; 2) to help you devel... Date Added: 2009-01-11 20:52:43 |
| Cultural Studies and Research.doc Path: Purdue >> ENGL >> 505m Fall, 2008 Description: Cultural / Critical Studies and Research for English 106 Purpose: The purpose of this assignment is two-fold: 1) to help you develop a critical perspective on the sources you will use for your inquiry and problem-solution papers; 2) to help you devel... Date Added: 2009-01-11 20:52:43 |
| Cultural Studies and Research.doc Path: Purdue >> ENGL >> 680a Fall, 2008 Description: Cultural / Critical Studies and Research for English 106 Purpose: The purpose of this assignment is two-fold: 1) to help you develop a critical perspective on the sources you will use for your inquiry and problem-solution papers; 2) to help you devel... Date Added: 2009-01-11 20:52:43 |
| Corp Raid Path: East Carolina >> ENG >> 2420 Spring, 2008 Description: Corporate Raiding Business Ethics Notes, February 21, 2007 Strategy Seize control, or threaten to seize control, of a corporation by purchasing more than 50% of its shares Once a shareholder owns over 50% of shares, he can handpick the members of t... Date Added: 2008-04-06 22:17:49 |
| KNR 279.FIM.MDS.IRF.2007.ppt Path: Illinois State >> KNR >> 279 Spring, 2008 Description: Interdisciplinary Assessments KNR 279 burlingame email All of health care is computerizing its documentation systems which has allowed the calculations of outcomes on a system wide (national) basis. If recreational therapists do not start filling ... Date Added: 2009-02-02 14:27:07 |
| Midterm_2.pdf Path: Berkeley >> MATH >> 110 Summer, 2008 Description: Math 110 Second Midterm NAME (1 pt): TA (1 pt): Name of Neighbor to your left (1 pt): 14 Nov 2005 Name of Neighbor to your right (1 pt): Instructions: You are allowed to use 1 sheet (8 1/2 by 11 inches, both sides) of notes. Otherwise this is a c... Date Added: 2009-01-11 20:05:28 |
| 6920.pdf Path: UCSD >> CPE >> 002 Fall, 2008 Description: Institute for Financial Management and Research Centre for Micro Finance Working Paper Series No.22 January 2008 Linking Financial Inclusion with Social Security Schemes Anant Jayant Natu Dr. Aashish Bansal Amrita Kurian Gurinder Pal Singh Khurana Ta... Date Added: 2009-02-06 18:42:58 |
| ch04.ppt Path: Idaho >> CH >> 04 Fall, 2008 Description: Click your mouse anywhere on the screen to advance the text in each slide. After the starburst appears, click a blue triangle to move to the next slide or previous slide. Business Law and the Legal Environment for a New Century Alternate Edition 4 ... Date Added: 2009-02-06 20:41:06 |
| Topic5ForLoops_4Up.pdf Path: Texas >> CS >> 305 Fall, 2009 Description: Topic 5 for Loops Always to see the general in the particular is the very foundation of genius. -Arthur Schopenhauer What we will do today Explain and look at the syntax and examples of for loops Based on slides for Building Java Programs by Reges... Date Added: 2009-03-19 00:16:04 |
| Topic5ForLoops_4Up.pdf Path: Caribbean >> CS >> 305 Fall, 2008 Description: Topic 5 for Loops Always to see the general in the particular is the very foundation of genius. -Arthur Schopenhauer What we will do today Explain and look at the syntax and examples of for loops Based on slides for Building Java Programs by Reges... Date Added: 2009-03-19 00:16:04 |
| BEL Outline Fall 2007 Path: Georgetown >> LAW >> BEL Fall, 2007 Description: BEL Outline Fall 2007 I. Introduction a. Hurley v. Eddingfield i. Doctor is not required to enter into a contract to aid an individual even if that individual has previously relied on the doctor for medical services and no other medical services are ... Date Added: 2008-04-30 06:14:13 |
| Wk 3 Assignment Path: Massasoit >> PSYCH >> 101 Spring, 2008 Description: Week Three Assignment There are many various parts of a neuron. A neuron is a type of brain cell, with two specialized extensions. One receives electronic signals, the other transmits them. The first part of the neuron is the cell body, or soma. This... Date Added: 2008-04-09 13:05:24 |
| Single-cycle.pdf Path: SUNY Stony Brook >> CSE >> 320 Fall, 2008 Description: ... Date Added: 2009-01-11 18:19:01 |
| nauen_in_press.pdf Path: Harvard >> TWAS >> 0202 Fall, 2009 Description: 25 How Can Collaborative Research be More Useful to Fisheries Management in Developing Countries? C. E. Nauen Abstract Most fisheries management schemes in industrialised and developing countries have not delivered sustainability, the goal usually pu... Date Added: 2009-04-16 00:25:25 |
| Ch. 14 outline.doc Path: Navarro College >> BIOL >> 1322 Spring, 2008 Description: Chapter 14 Outline I. Fitness A. B. Definition of Fitness Benefits of Fitness 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. C. D. Restful sleep Nutritional health Optimal body composition Optimal bone density Resistance to colds and other infectious d... Date Added: 2009-01-09 04:23:14 |
| Ch. 14 outline.doc Path: Navarro College >> BIOL >> 2402 Spring, 2008 Description: Chapter 14 Outline I. Fitness A. B. Definition of Fitness Benefits of Fitness 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. C. D. Restful sleep Nutritional health Optimal body composition Optimal bone density Resistance to colds and other infectious d... Date Added: 2009-01-09 04:23:14 |
| Ch. 14 outline.doc Path: Navarro College >> BIOL >> 2404 Fall, 2008 Description: Chapter 14 Outline I. Fitness A. B. Definition of Fitness Benefits of Fitness 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. C. D. Restful sleep Nutritional health Optimal body composition Optimal bone density Resistance to colds and other infectious d... Date Added: 2009-01-09 04:23:14 |
| Ch. 14 outline.doc Path: Navarro College >> BIOL >> 2420 Fall, 2008 Description: Chapter 14 Outline I. Fitness A. B. Definition of Fitness Benefits of Fitness 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. C. D. Restful sleep Nutritional health Optimal body composition Optimal bone density Resistance to colds and other infectious d... Date Added: 2009-01-09 04:23:15 |
| linthurst_reduit.pdf Path: UF >> STA >> 6207 Spring, 2008 Description: Case Study: Spartina Biomass (Data from Dr. Rick Linthurst, Ph.D. thesis, NCSU, 1979) Spartina alterniora: a marsh grass that grows in the Cape Fear Estuary of North Carolina Data from random sampling, stratied according to two factors: (Note: We wi... Date Added: 2009-01-10 18:32:42 |
| WA-050001.pdf Path: Martin Luther >> PNN >> 05 Fall, 2008 Description: RELY Herbicide For Stand Suppression of Kentucky Bluegrass Grown for Seed and Weeds During a Fallow Year. EPA Reg. No. 264-652 EPA SLN. No. WA-050001 Bayer CropScience LP P.O. Box 12014 2 T.W. Alexander Drive Research Triangle Park, North Carolina 2... Date Added: 2009-02-18 13:35:46 |
| WA-050001.pdf Path: Washington State >> PNN >> 05 Fall, 2008 Description: RELY Herbicide For Stand Suppression of Kentucky Bluegrass Grown for Seed and Weeds During a Fallow Year. EPA Reg. No. 264-652 EPA SLN. No. WA-050001 Bayer CropScience LP P.O. Box 12014 2 T.W. Alexander Drive Research Triangle Park, North Carolina 2... Date Added: 2009-02-18 13:35:46 |
| CaoGro2005SpatVis.pdf Path: BU >> CAS EI >> 503 Fall, 2008 Description: A Laminar Cortical Model of Stereopsis and 3D Surface Perception: Closure and da Vinci Stereopsis Yongqiang Cao and Stephen Grossberg1 Department of Cognitive and Neural Systems and Center for Adaptive Systems Boston University 677 Beacon Street, Bos... Date Added: 2009-01-11 22:09:25 |
| ProductSpecDraft.pdf Path: Mississippi State >> TEAM >> 2 Fall, 2009 Description: SECON 2008 LUNaR Application: LUNaR is an autonomous robot designed to compete in the SECON 2008 competition. The robot will be placed in a multi terrain arena where it will search multi-terrain for colored wooden blocks. LUNaR will search for the bl... Date Added: 2009-04-15 21:34:55 |
| EET 3120.pdf Path: MSCD >> EET >> 3120 Fall, 2008 Description: METROPOLRAN STATE COLLEGE o DENVER f Office o Academic Affairs f FWGULAR COURSE SYLLABUS School of: Professional Studies Department: Engineering Technolorn CTP Code: Professional Studies Prefix & Course Number: EET 3120 Crosslisted With*: Course T... Date Added: 2009-02-02 14:48:05 |
| ITB5234-4TAB.pdf Path: FSU >> PURCHASING >> 5234 Fall, 2008 Description: ... Date Added: 2009-02-17 18:58:11 |
| ITB5234-4TAB.pdf Path: S.F. State >> PURCHASING >> 5234 Fall, 2008 Description: ... Date Added: 2009-02-17 18:58:11 |
| cs250.pdf Path: Purdue >> CS >> 250 Fall, 2008 Description: CS250: Computer Architecture Catalog Description Concepts of computer system organization and programming. Instruction and data representations. Addressing modes. Fundamentals of assembly language. The organization and the operation of the central p... Date Added: 2009-02-17 17:25:23 |
| sReateguitypeImageProcessBookCover.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: Type & Image Project 4 : Process Book Process Book Sisanie Reategui Typography II : Art 342a May 11, 2007 ... Date Added: 2009-02-02 16:02:41 |
| yuhe-ams03.ppt Path: Rutgers >> AMS >> 2003 Fall, 2008 Description: A Programmable Routing Framework for Autonomic Sensor Networks Yu He, Cauligi S. Raghavendra, Steven Berson, Robert Braden Information Sciences Institute, University of Southern California Marina del Rey, CA USA AMS 2003, Seattle, U.S.A., June 25, 20... Date Added: 2009-03-19 00:00:40 |
| blowup.pdf Path: DeAnza College >> CAOS >> 106 Spring, 2008 Description: p sv v ~ pw y xv y t vw wo p uo$lyzufeco us e~frp2y7@wlfuorsg@P@eursrwPf5HyI FprxG 9FH@Ap!t)( rElDy0 A(u~A1lf@30)(\' ld x { C o B Q 6 4 2 1 ! % # ! 1w VTb@ef22}5$TXVTR@Pursy USQ yw{o xa`YW USQ yw ... Date Added: 2009-01-09 07:55:42 |
| blowup.pdf Path: DeAnza College >> CAOS >> 176 Summer, 2008 Description: p sv v ~ pw y xv y t vw wo p uo$lyzufeco us e~frp2y7@wlfuorsg@P@eursrwPf5HyI FprxG 9FH@Ap!t)( rElDy0 A(u~A1lf@30)(\' ld x { C o B Q 6 4 2 1 ! % # ! 1w VTb@ef22}5$TXVTR@Pursy USQ yw{o xa`YW USQ yw ... Date Added: 2009-01-09 07:55:42 |
| CrossSectionsPlayDohActivity.pdf Path: N. Arizona >> MAT >> 401 Fall, 2008 Description: MAT 155 Activity Cross-Sections of Polyhedra (Section 8.1) Materials: You will the power solids in the back of the room, play-doh, and dental floss Grouping: Work in pairs *Look on pg. 385 & 386 to review types of 2-dimensional figures before starti... Date Added: 2009-01-11 17:04:01 |
| 27cmy.ppt Path: Illinois Tech >> CM >> 10 Fall, 2008 Description: Summary of final results from MICE note: MICE Scintillating Fibre Tracker Prototype - First progress report - M.Yoshida (Osaka Univ.) for the SciFi working group contents of the note Describe the techniques to build SciFi tracker Demonstrate... Date Added: 2009-02-17 23:24:30 |
| 427.pdf Path: University of Illinois, Urbana Champaign >> ENGL >> 427 Spring, 2008 Description: ... Date Added: 2009-02-02 18:40:54 |
| graduate_bulletin_1998-1999_page_87-106.pdf Path: Southern Miss. >> HPR >> 106 Fall, 2008 Description: (F) 87-106 Health &Human Sc 6/30/1998 4:40 PM Page 87 College of Health and Human Sciences Graduate Degrees 1998-1999 Department Major Degree Masters Level School of Family and Consumer Sciences Early Intervention Master of Science Family and Co... Date Added: 2009-02-02 20:15:48 |
| intro Path: Colorado >> MGMT >> 4070 Spring, 2008 Description: B. When working Internationally the following 4 themes should be considered: 1. Inclusiveness: Decisions; especially ones involving folks from around the worlds should be collaborative in nature. 2. Communication: Written communication is critical wh... Date Added: 2008-05-04 11:38:47 |
| dp101193.pdf Path: Wisconsin >> IRP >> 1993 Fall, 2008 Description: University of Wisconsin-Madison Institute for Research on Poverty Discussion Papers THE IMPACT OF AFDC ON YOUNG WOMEN\'S CHILDBEARING Institute for Research on Poverty Discussion Paper no. 1011-93 The Impact of AFDC on Young Women\'s Childbearing D... Date Added: 2009-02-11 16:30:49 |
| chapter_7.pdf Path: Marshall >> IT >> 211 Spring, 2008 Description: Chapter 7 Homework Problems 12, 14, 18, 21, 23, 26, 29, 32, 33, 38, 41, 43, 50, 54, 57, 60, 61, 63, 65, 69, 74, 78. ... Date Added: 2009-01-09 02:48:44 |
| jmlr05.pdf Path: Texas >> HERCULES >> 05 Fall, 2008 Description: Journal of Machine Learning Research 6 (2005) 148 Submitted 10/03; Revised 2/05; Published ?/? Clustering with Bregman Divergences Arindam Banerjee Dept of Electrical & Computer Engineering University of Texas at Austin Austin, TX 78712, USA. aban... Date Added: 2009-02-11 22:29:11 |
| banerjee05b.pdf Path: Texas >> LANS >> 05 Fall, 2005 Description: Journal of Machine Learning Research 6 (2005) 148 Submitted 10/03; Revised 2/05; Published ?/? Clustering with Bregman Divergences Arindam Banerjee Dept of Electrical & Computer Engineering University of Texas at Austin Austin, TX 78712, USA. aban... Date Added: 2009-02-11 22:29:16 |
| Chaps 2 3 Journals Path: Berkeley >> GER >> German 1E Fall, 2007 Description: German 1E, Section 1 October 3, 2007 Kapitel 2 Journal Guten Tag. Meine Name ist Alex. Ich wohne in Berkeley, Kalifornia. Ich habe eine Wohnung. Mein Wohnung ist nicht so gro. Die Miete ist niedrig, $1,200. Ich habe nicht Mbel. Ich habe ein Bett, ein... Date Added: 2008-09-10 03:09:25 |
| Critical Thinking 4.1 Path: UCF >> POS >> 2041h Spring, 2008 Description: POS Critical Thinking 4.1 1. 4/8/2008 Jose Alvarez a. In 2000: 18% In 2004: 20% b. In 2000: 59% In 2004: 80% c. In 2000: 11% In 2004: 28% d. In 2000: 62% In 2004: 80% e. The economy only seems to be getting worse under the Bush administration; the... Date Added: 2008-04-07 11:37:58 |
| JHT04-published-paper.pdf Path: Mich Tech >> MEEM >> 5210 Fall, 2008 Description: Q. Liang X. Wang A. Narain Mem. ASME e-mail: narain@mtu.edu Department of Mechanical EngineeringEngineering Mechanics, Michigan Technological University, Houghton, MI 49931 Effects of Gravity, Shear and Surface Tension in Internal Condensing Flows: ... Date Added: 2009-01-09 08:14:28 |
| JHT04-published-paper.pdf Path: Mich Tech >> MEEM >> 5230 Fall, 2008 Description: Q. Liang X. Wang A. Narain Mem. ASME e-mail: narain@mtu.edu Department of Mechanical EngineeringEngineering Mechanics, Michigan Technological University, Houghton, MI 49931 Effects of Gravity, Shear and Surface Tension in Internal Condensing Flows: ... Date Added: 2009-01-09 08:14:28 |
| JHT04-published-paper.pdf Path: Mich Tech >> PH >> 2010 Fall, 2008 Description: Q. Liang X. Wang A. Narain Mem. ASME e-mail: narain@mtu.edu Department of Mechanical EngineeringEngineering Mechanics, Michigan Technological University, Houghton, MI 49931 Effects of Gravity, Shear and Surface Tension in Internal Condensing Flows: ... Date Added: 2009-01-09 08:14:28 |
| JHT04-published-paper.pdf Path: Mich Tech >> PH >> 5210 Fall, 2008 Description: Q. Liang X. Wang A. Narain Mem. ASME e-mail: narain@mtu.edu Department of Mechanical EngineeringEngineering Mechanics, Michigan Technological University, Houghton, MI 49931 Effects of Gravity, Shear and Surface Tension in Internal Condensing Flows: ... Date Added: 2009-01-09 08:14:28 |
| durability_HW.pdf Path: Berkeley >> CIV ENG >> 241 Fall, 2008 Description: University of California at Berkeley Department of Civil Engineering Instructor: P.J.M. Monteiro HOMEWORK 1) What do you understand by the term durability? Compared to other considerations, how much importance should be given to durability in the d... Date Added: 2009-02-02 17:01:09 |
| majumdar-577.01.pdf Path: SHSU >> HIS >> 577 Fall, 2008 Description: Sam Houston State University Department of Political Science Course Syllabus (577:01, CID 4786) The Scope and Methods of Political Science Fall 2008 Dr. Rina Majumdar Office: 315L Academic Building 1 Phone: (936) 294 4757 Home: (281) 261-2514 E-mai... Date Added: 2009-02-03 13:20:35 |
| supervisor_qualifications_form.doc Path: Old Dominion >> HMSV >> 468 Summer, 2008 Description: SUPERVISOR QUALIFICATIONS FORM Old Dominion University Human Services Program INFORMATION Name of Intern Student _ Name of Internship Supervisor_ Name of Agency _ Agency Address _ _ Zip _ E-mail Address of Supervisor __ Agency Telephone Number ( ) _... Date Added: 2009-01-11 17:23:59 |
| Chap_21_5ed.ppt Path: Texas Tech >> HIST >> 5331 Fall, 2008 Description: Bank Management, 5th edition. Management Timothy W. Koch and S. Scott MacDonald Copyright 2003 by South-Western, a division of Thomson Learning GLOBAL BANKING ACTIVITIES Chapter 21 Global banking business One clear trend in the evolution of finan... Date Added: 2009-02-03 13:36:06 |
| wm6006.pdf Path: Missouri (Mizzou) >> WM >> 6006 Fall, 2008 Description: PRODUCT INFORMATION Identifying product hazards - Material Safety Data Sheets GUIDE SHEET -PUBLISHED BY UNIVERSITY EXTENSION u A Material Safety Data Sheet (MSDS) lists the ingredients in a hazardous product, the hazards to safety and health, an... Date Added: 2009-02-17 22:46:30 |
| 1422.pdf Path: USF >> USFWEB >> 2 Fall, 2009 Description: USF Job Class Description JOB CODE: 1422 JOB TITLE: Copy Editor PAY PLAN: 23 CAREER BAND: C FLSA: Non-Exempt CBU : 31 Effective 04/20/2007 Job Title: Copy Editor Job Summary The Copy Editors primary job function is to coordinate publication effort... Date Added: 2009-04-16 00:50:56 |
| handout3004.pdf Path: Arizona >> MATH >> 110 Fall, 2008 Description: ... Date Added: 2009-04-15 22:51:36 |
| c14s1 Path: Purdue >> MA >> 161, 162, Spring, 2008 Description: Stewart Calculus ET 5e 0534393217;14. Partial Derivatives; 14.1 Functions of Several Variables 1. (a) From Table 1, f ( 15,40)= 27 , which means that if the temperature is 15 C and the wind speed is 40 km / h, then the air would feel equivalent to a... Date Added: 2008-04-20 06:53:32 |
| c14s1 Path: Alabama Huntsville >> MA >> 201 Spring, 2008 Description: Stewart Calculus ET 5e 0534393217;14. Partial Derivatives; 14.1 Functions of Several Variables 1. (a) From Table 1, f ( 15,40)= 27 , which means that if the temperature is 15 C and the wind speed is 40 km / h, then the air would feel equivalent to a... Date Added: 2008-05-30 08:41:12 |
| c14s1 Path: Rutgers >> MATH >> 251 Spring, 2008 Description: Stewart Calculus ET 5e 0534393217;14. Partial Derivatives; 14.1 Functions of Several Variables 1. (a) From Table 1, f ( 15,40)= 27 , which means that if the temperature is 15 C and the wind speed is 40 km / h, then the air would feel equivalent to a... Date Added: 2008-04-03 07:23:15 |
| c14s1 Path: TN Tech >> MATH >> Cal I- Cal Spring, 2008 Description: Stewart Calculus ET 5e 0534393217;14. Partial Derivatives; 14.1 Functions of Several Variables 1. (a) From Table 1, f ( 15,40)= 27 , which means that if the temperature is 15 C and the wind speed is 40 km / h, then the air would feel equivalent to a... Date Added: 2008-04-08 11:22:34 |
| hw02 Path: Columbia >> MECE >> 1001 Fall, 2008 Description: MECE E1001 Homework Set #2 Due Date: September 24, 2007 In addition to the problem below, solve problems 4.3, 4.7, 4.10, 4.11, and 4.14 from the textbook beginning on page 122 of your text. 1. The figure below shows a mounting post onto which three c... Date Added: 2008-10-24 00:51:32 |
| Queitsch_etal02.pdf Path: Berkeley >> IB >> 160 Fall, 2008 Description: articles Hsp90 as a capacitor of phenotypic variation Christine Queitsch*, Todd A. Sangster & Susan Lindquist* * Department of Molecular Genetics and Cell Biology, and Committee on Genetics, Howard Hughes Medical Institute, University of Chicago, C... Date Added: 2009-02-17 17:58:33 |
| infiltrate5.ppt Path: Purdue >> ABE >> 527 Fall, 2008 Description: fo =rate fc ... Date Added: 2009-01-09 06:31:13 |
| pop quiz 1 - key Path: Berkeley >> CHEM >> 112B Spring, 2009 Description: ... Date Added: 2009-04-02 22:07:45 |
| Falling From Grace Essay Path: Northeastern >> CHM >> 211 Fall, 2007 Description: Michael Chelala Peoples and Cultures SOA U101 Professor Toth Falling from Grace Essay In American society there are three main socioeconomic classes, the upper class, the middle class, and the lower class. These three classes all share a common view... Date Added: 2008-04-07 09:08:42 |
| p21qz8.doc Path: Santa Monica >> PHYSCS >> 21 Fall, 2008 Description: Physics 1 - Quiz #8 Fall 2004 SHOW ALL YOUR WORK AND REASONING 1. If the Moon was moved to an elliptical orbit about the Earth with closest approach the same as it is now, but going out to three times the distance, how much longer would it take to o... Date Added: 2009-01-09 10:28:44 |
| exemplary_lab.pdf Path: Rice >> PHYS >> 111 Fall, 2008 Description: Sample Lab Report This is an example of a well-written report from thePHYS 111 or 112 lab. As explained in the lab manual, it contains only the significant details of the experiment, the analysis and some conclusions. Particularly pertinent features ... Date Added: 2009-02-06 20:14:44 |
| 452.pdf Path: University of Illinois, Urbana Champaign >> CPSC >> 452 Fall, 2008 Description: Course Schedule - Fall 2005 Crop Sciences 452 Genetics of Higher Organisms Credit: 3 hours. (CPSC 315) Selected contemporary topics in genetics are covered with examples primarily from plants, humans, and animals. Topics include nature of genes and g... Date Added: 2009-02-02 18:30:36 |
| 434 New Course Proposal 11 03.doc Path: Wisconsin >> M H R >> 434 Fall, 2008 Description: ... Date Added: 2009-02-03 14:26:14 |
| 1737.062.ps Path: Hawaii >> SOEST >> 1737 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207372256.0388276 Float: 1737 Profile: 062 Location: 35.1N 159.5E Date: 04/23... Date Added: 2009-02-17 19:55:45 |
| wentworth4.ppt Path: UNC >> BIO >> 2008 Fall, 2008 Description: Level-2 & Level-3 Procedures and Techniques CVS-EEP Vegetation Monitoring Workshop June 18, 2008 Tom Wentworth NC State University CAROLINA VEGETATION SURVEY Credits! All photos by Carol Ann McCormick from the Herbarium, UNC-Chapel Hill. And.sta... Date Added: 2009-02-18 01:47:56 |
| 067Exam3bsoln Path: Colorado >> MATH >> 1081 Spring, 2008 Description: EXAM 3 Section November 9, 2006 NAME: Make sure to read the question carefully and answer the question that is asked. Show ALL relevant work so that partial credit may be given and indicate where the solution is. Lack of sufficient work may result... Date Added: 2008-05-03 01:45:50 |
| lecture1.ps Path: Johns Hopkins >> APL >> 201 Fall, 2008 Description: CHAPTER 1 Welcome to Java 605.201: Introduction to Programming Using Java Paul McNamee Introduction to Course Introductions Motivation and Course Objectives Syllabus / Topics Grading Policy Assignments Exams Ethics The best way to contact me ... Date Added: 2009-02-11 16:56:54 |
| hacon.pdf Path: Rice >> MATH >> 1 Fall, 2004 Description: FINITE GENERATION OF CANONICAL RINGS Let X PN be a smooth algebraic variety i.e. a sub-manifold de ned C by homogeneous polynomials P1; :; Pt 2 C z0 ; :; zN ]. TX denotes the _ tangent bundle to X and !X = dimX(TX ) is the canonical bundle of 0 (! m ... Date Added: 2009-02-06 20:14:16 |
| MMC4640 - Interview Transcribed Path: FAU >> MMC >> 4640 Summer, 2007 Description: Interview Transcribed 1. Q: How well do you trust mainstream media sources as dependable outlets of information, particularly regarding the war in Iraq? A: I don\'t trust them. Q: Why not? A: Because when you have five major corporations owning most o... Date Added: 2008-05-08 13:50:43 |
| 2008Quiz7key.pdf Path: Charleston Law >> CHEMISTRY >> 112 Fall, 2008 Description: Quiz 4 2008 Chemistry 112 1. For the reaction CO(g) + NO2(g) CO2(g) + NO(g) find the orders with respect to CO and NO2 and write a rate law that reflects these results. The following data should be useful: Experiment 1 2 3 4 5 [CO]o in moles 5.1 10-... Date Added: 2009-02-17 23:20:44 |
| 2008Quiz7key.pdf Path: Washington and Lee >> CHEMISTRY >> 112 Fall, 2008 Description: Quiz 4 2008 Chemistry 112 1. For the reaction CO(g) + NO2(g) CO2(g) + NO(g) find the orders with respect to CO and NO2 and write a rate law that reflects these results. The following data should be useful: Experiment 1 2 3 4 5 [CO]o in moles 5.1 10-... Date Added: 2009-02-17 23:20:44 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> HIST >> 254b Fall, 2008 Description: ... Date Added: 2009-01-12 05:46:53 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 254a Winter, 2008 Description: ... Date Added: 2009-01-10 02:13:47 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 250 Spring, 2008 Description: ... Date Added: 2009-01-12 05:46:53 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 252b Spring, 2008 Description: ... Date Added: 2009-01-10 02:14:53 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 1 Spring, 2008 Description: ... Date Added: 2009-01-10 02:10:54 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 254b Fall, 2008 Description: ... Date Added: 2009-01-10 02:14:53 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 154 Fall, 2008 Description: ... Date Added: 2009-01-10 02:13:18 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 257a Fall, 2008 Description: ... Date Added: 2009-01-11 21:49:51 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 254c Fall, 2008 Description: ... Date Added: 2009-01-10 02:13:18 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ME >> 252a Winter, 2008 Description: ... Date Added: 2009-01-11 21:51:09 |
| parh88-asilo-zero-sign-gsd.pdf Path: UCSB >> ECE >> 199 Fall, 2008 Description: ... Date Added: 2009-01-10 02:13:47 |
| 321_Example_Midterm.pdf Path: George Mason >> CHEM >> 321 Fall, 2008 Description: GMU, CHEM 321 Initial _ 1 GEORGE MASON UNIVERSITY CHEMISTRY DEPARTMENT CHEM 321 - MIDTERM EXAM FALL 2003 TIME 12:30 - 1:20 NAME _ Honor code pledges: On my honor, I have neither given nor received aids in this examination Signed _ Show complete... Date Added: 2009-04-16 01:19:46 |
| BedSt2_35 Path: USF >> EGN >> 3311 Spring, 2008 Description: Problem 2.35 The magnitude of the position vector rBA from point B to point A is 6 m and the magnitude of the position vector rCA from point C to point A is 4 m. What are the components of rBA ? y 3m B C x Solution: The coordinates are: A xA , yA , ... Date Added: 2008-04-08 19:15:24 |
| BedSt2_35 Path: SUNY Buffalo >> EAS >> 207 Spring, 2008 Description: Problem 2.35 The magnitude of the position vector rBA from point B to point A is 6 m and the magnitude of the position vector rCA from point C to point A is 4 m. What are the components of rBA ? y 3m B C x Solution: The coordinates are: A xA , yA , ... Date Added: 2008-04-09 18:16:54 |
| BedSt2_35 Path: Washington >> A A >> 210 Spring, 2008 Description: Problem 2.35 The magnitude of the position vector rBA from point B to point A is 6 m and the magnitude of the position vector rCA from point C to point A is 4 m. What are the components of rBA ? y 3m B C x Solution: The coordinates are: A xA , yA , ... Date Added: 2008-04-16 18:27:20 |
| 129a-syll-s08.pdf Path: San Jose State >> MATH >> 129a Fall, 2008 Description: SJSU - Syllabus - Spring 2008 - Keep this! Course: Hall 320 Math 129A Linear Algebra, Sec. 2 (Code 25195): MWF 12:30-1:20, in MacQuarrie Instructor: Jane M. Day Ofce: MacQuarrie Hall 317 Phone: 408-924-5119 Web: http:/www. math.sjsu.edu/~day/ Ofc... Date Added: 2009-02-02 16:05:38 |
| 274.pdf Path: UC Davis >> MGT >> 274 Fall, 2008 Description: ... Date Added: 2009-02-02 17:10:09 |
| 2-3,2-4 Notes.pdf Path: South Plains College >> MATH >> 1350 Fall, 2008 Description: Math 1350 2-3, 2-4 Addition, Subtraction, Multiplication, and Division of Whole Numbers Natural numbers: N = {1, 2,3, 4,} Whole numbers: W = {0,1, 2,3, 4,} Closure: A set is closed under addition if adding in 2 elements in the set results in an eleme... Date Added: 2009-01-09 07:15:20 |
| 2.1 Path: Texas >> MATH >> M316K Spring, 2009 Description: M316K (need to write in set builder notation) Section 2.1 In mathematics, we use set language in may situations. Many mathematical concepts and operations are defined in set language, and set language is often useful when we are talking about mathema... Date Added: 2009-02-21 21:55:07 |
| L22.pdf Path: California State University, Monterey Bay >> CS >> 450 Fall, 2009 Description: Assignments Assignment 5: Results by Thursday. Assignment 6: Collected-Thank you. Assignment 7: Due Tuesday 3rd May @ 4:30pm Four questions: Question 1 (or 2) 40% (40% extra credit if you do both) Question 3 20% Question 4 20% Question 5 20% ... Date Added: 2009-04-15 19:32:32 |
| CSD 462 SYL Sp 08.doc Path: Western Washington >> CSD >> 462 Fall, 2008 Description: Western Washington University Department of Communication Sciences and Disorders CSD 462 AUDIOMETRIC TESTING - Spring 2008 (MTWF 10:00-10:50 a.m. ES410) Laboratory and Clinical Observation/Testing Times as assigned INSTRUCTOR: PHONE: Rieko Darling... Date Added: 2009-02-02 21:06:47 |
| 202thorp001.pdf Path: BYU >> REL C >> 352 Fall, 2008 Description: Brigham Young University Department of History Section 001 Malcolm R. Thorp 309 KMB (Tel:422-3234) Fall, 2004 Civilization 202: The World Since l500 Introduction: This course is concerned with the concept of what it is to be human, which is a histo... Date Added: 2009-01-11 04:53:45 |
| 202thorp001.pdf Path: BYU >> HIST >> 368 Winter, 2008 Description: Brigham Young University Department of History Section 001 Malcolm R. Thorp 309 KMB (Tel:422-3234) Fall, 2004 Civilization 202: The World Since l500 Introduction: This course is concerned with the concept of what it is to be human, which is a histo... Date Added: 2009-01-11 04:53:45 |
| Proposal for Paper Path: Wisconsin >> SOC >> 210 Fall, 2005 Description: Megan Barlow March 6, 2005 Sociology 210 TA: Matt Nichter Discussion Section 302 Question: How would school vouchers help or hurt our education systems? o Liberalism Resurgent: a Response to the Right, Myth: Vouchers will improve our Schools, Fact: V... Date Added: 2008-03-27 19:42:22 |
| lecture05-scheduling.pdf Path: Rochester >> CSC >> 256 Fall, 2009 Description: Operating Systems 2/2/2004 Recap of the Last Class CPU Scheduling n Process q q q Process concept OS data structure for a process Operations on processes Thread concept Compared with process n n n Thread q q CS 256/456 Dept. of Computer Scie... Date Added: 2009-04-15 22:28:41 |
| HW_2_soln Path: UCLA >> CH ENGR >> 100 Fall, 2007 Description: ... Date Added: 2008-04-05 01:47:50 |
| The Synthesis of Alkenes Path: Pittsburgh >> CHEM >> 0330 Fall, 2007 Description: The Synthesis of Alkenes: The Dehydration of Cyclohexanol Jacob Rietschy Chemistry 330 Nate Ware Introduction: Cyclohexene was synthesized from cyclohexanol. This was done using dehydration. The cyclohexene was tested for the presence of a carbon-ca... Date Added: 2008-04-09 07:36:34 |
| appl_spa.pdf Path: N.C. State >> SERVICE004 >> 004 Fall, 2008 Description: Cmo Los Pesticidas Pueden Entrar En Su Cuerpo? Los pesticidas se usan en varias formas: polvos, lquidos, grnulos, aerosoles y gases (fumigantes). En cuanto los pesticidas se aplican, los residuos se pueden encontrar en la tierra, en plantas, en produ... Date Added: 2009-02-17 22:59:31 |
| ADMN 5053-Admin5053- Research Paper over Special Programs.pdf Path: Prairie View A & M >> ADMN >> 5053 Fall, 2008 Description: Admin5053- Research Paper over Special Programs Based upon your assigned research topic, describe how you would managed and implement this special program on your campus as an administrator. Element . Levels of Performance . 1. Demonstrateen... Date Added: 2009-02-02 15:41:50 |
| day6.xls Path: Dakota State >> COURSES >> 02 Fall, 2002 Description: Dakota State University Fall 2002 $tock Market Contest Day 6 October 21, 2002 All contestants started with $10,000. Cash dividends are not considered. A commission of $10 is charged on each trade. Portfolios can have only from two to four common stoc... Date Added: 2009-02-06 20:56:12 |
| 1-Raptus Presentation.ppt Path: Washington >> LAW A >> 515 Fall, 2008 Description: Raptus By Spencer Todd Hirsch The Meanings of a Word Raptuswasthetermforasingular medievalcrime,withmultiple meanings. Itsignifiedeitherrapeorabduction, andwithintherealmofChaucers socialdilemma,themeaningis unclear. Itsuseasalabelforakidnapping,... Date Added: 2009-02-02 20:28:53 |
| Psych37Sum08Syllabus Path: Saddleback >> PSYC >> 37 Summer, 2008 Description: SYLLABUS Abnormal Behavior (Psych 37), Distance Education Course (INTERNET) Saddleback College, Mission Viejo CA Ticket # 80255 and 13590 Instructor: Dr. Amira A. Rezec, Ph.D. Office: Village Building 07 Email: arezec@saddleback.edu Voicemail: 949-5... Date Added: 2009-04-14 21:26:03 |
| Exam_2-Chem35-2007 Path: Brown >> CHEM >> 35 Spring, 2007 Description: Name_ SISD_ Chemistry 35 Exam 2 - April 9, 2007 Put your name and SISD number on EVERY PAGE of the exam. Write all answers on the exam. There are several blank pages at the end of the exam for you to use as scratch paper. 1. (14 points)_ 2. (14 po... Date Added: 2008-04-29 11:27:46 |
| latemedievalengland.pdf Path: St. Xavier >> RN >> 1 Fall, 2009 Description: Part 7: Late Medieval England Reading 7.1 The Life of a Society: 15th Century England From C. S. L. Davies, Peace, Print and Protestantism, 14501558 (1976) Economy and Social Structure England was rather off the beaten track for fifteenth-century tou... Date Added: 2009-04-16 00:04:34 |
| announcement-1822-5246.pdf Path: Colorado >> ARTS >> 5246 Fall, 2008 Description: SEpTEmbER 14oCTobER 6, 2007 ecoarts ECoaRTS CalEndaR of EvEnTS Join us for EcoArts 07an extraordinary array of exhibits, performances, talks, tours, feasts, fairs, films, and more brought to you by more than 25 major science, environmental, arts, i... Date Added: 2009-02-03 13:37:32 |
| eet 3524.doc Path: Oklahoma State >> EET >> 3524 Fall, 2008 Description: HOMEWORK LOG EET 3524 Advanced Logic Circuits Professor Ellis Nuckolls Date Logged In Time Logged In 8:14 am 1:12 pm 9:21 am 9:54 am 12:59 pm 9:58 am 11:58 am Delivery Mode Rec. Fax Fax Fax Std Mail Fax Std Mail Fax Logged By Students Name Item Date ... Date Added: 2009-02-03 13:19:58 |
| BASC_201_-_Lecture_18_(Mar_13_-_Prof._Lefebvre) Path: McGill >> BASC >> 201 Winter, 2008 Description: 18 8 Thursday, March 13, 2008 (BASC 201: Lecture 18) Prof. Lefebvre MARCH 13, 2008 Prof. Lefebvre Thursday, March 13, 2008 (BASC 201: Lecture 18) Prof. Lefebvre A few things from last lecture: - Brain size is proportional to body size, but not 1... Date Added: 2008-04-29 22:11:46 |
| sql.pdf Path: Berkeley >> COMPSCI >> 186 Fall, 2008 Description: $ % *\' -./ * !\" ) ) !# !) # + , ) + ,0 # \" # ! \"#$ % ( *+,+-) ( . /0 $ 222 222 & 4 ! * ,$ /$ ! 23 ... Date Added: 2009-01-11 21:19:55 |
| sql.pdf Path: Berkeley >> CS >> 186 Fall, 2009 Description: $ % *\' -./ * !\" ) ) !# !) # + , ) + ,0 # \" # ! \"#$ % ( *+,+-) ( . /0 $ 222 222 & 4 ! * ,$ /$ ! 23 ... Date Added: 2009-04-16 01:45:30 |
| spreadsheet.pdf Path: Truman State >> CHEM >> 222 Fall, 2008 Description: Spreadsheets and Laboratory Data Analysis: Excel 2003 Version (Excel 2007 is only slightly different) Spreadsheets are computer programs that allow the user to enter and manipulate numbers. They are capable of performing a wide variety of calculation... Date Added: 2009-02-11 21:08:03 |
| Session 8 Toyota Production System Path: Washington University in St. Louis >> OSCM >> 356 Spring, 2008 Description: OSCM356 Operations Management Session 8 Toyota Production System Fuqiang Zhang Olin Business School Washington University in St. Louis Spring 2008 Session outline Toyota Production System Just-in-Time Jidoka Toyota Motor Manufacturing Case Pr... Date Added: 2008-04-15 20:17:43 |
| CAP2008_01lg.pdf Path: Cornell >> ARMY >> 2008 Fall, 2008 Description: ... Date Added: 2009-02-17 22:14:25 |
| syllabus235.pdf Path: JMU >> MATH >> 245 Spring, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:34 |
| syllabus235.pdf Path: JMU >> MATH >> 305 Fall, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:34 |
| syllabus235.pdf Path: JMU >> MATH >> 431 Fall, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:35 |
| syllabus235.pdf Path: JMU >> MATH >> 475 Fall, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:35 |
| syllabus235.pdf Path: JMU >> MATH >> 108 Fall, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:34 |
| syllabus235.pdf Path: JMU >> MATH >> 501 Fall, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:35 |
| syllabus235.pdf Path: JMU >> MATH >> 207 Fall, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:34 |
| syllabus235.pdf Path: JMU >> MATH >> 520 Summer, 2008 Description: Syllabus for Math 235, Calculus I, Fall 2005 Instructor: Dr. Elizabeth Arnold e-mail: arnoldea@math.jmu.edu Phone: 568-6532 URL: www.math.jmu.edu/arnoldea Oce: Burruss 116 Oce Hours: M,W 2:15-3:15pm, T 1:45-2:45pm and by appointment. COURSE DESCRIPTI... Date Added: 2009-01-12 03:28:35 |
| 02Green.ppt Path: Illinois Tech >> CM >> 12 Fall, 2008 Description: ProgressontheMICE CoolingChannelMagnets MichaelA.Green LawrenceBerkeleyNationalLaboratory 28June2005 1 3DViewoftheMICECoolingChannel CouplingMagnetCryostat AFCModule RFCCModule CourtesyofS.YangOxfordUniversity 2 ThreeQuarterSectionViewofthe MI... Date Added: 2009-02-17 23:23:30 |
| idce367fall2008syllabus01.doc Path: Pasco-Hernando Community College >> OCE >> 2001t Fall, 2008 Description: DESCRIPTION This course investigates the quantitative and qualitative uses of computerbased models to guide policy in human & environment systems. Students learn to think with a systems perspective while translating their own conceptual models into m... Date Added: 2009-01-11 19:17:04 |
| Chap006.ppt Path: SIU Edwardsville >> ECON >> 450 Fall, 2008 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-01-09 10:29:24 |
| Chap006.ppt Path: SIU Edwardsville >> MBA >> 532 Summer, 2008 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-01-09 07:11:22 |
| Chap006.ppt Path: SIU Edwardsville >> FIN >> 532 Fall, 2008 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-01-09 07:11:22 |
| Chap006.ppt Path: SIU Edwardsville >> FIN >> 450 Fall, 2008 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-01-09 07:11:41 |
| Chap006.ppt Path: SIU Edwardsville >> FIN >> 515 Fall, 2008 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-01-09 07:11:41 |
| Chap006.ppt Path: SIU Edwardsville >> ECON >> 111 Summer, 2008 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-01-09 10:29:24 |
| 11-15-06 Path: Georgia Tech >> HPS >> 1040 Fall, 2006 Description: Cancer Abnormal, uncontrolled cell growth. Leading cause of death in U.S. in people under 85 years of age. Overall, #2 cause of death. Largely preventable30% of cancer is related to smoking 30%- poor diet, obesity and 4%- inactivity Oncologist- docto... Date Added: 2008-04-09 15:35:00 |
| Chapter 07a Path: Saginaw Valley >> PHY >> 111 Winter, 2007 Description: Chapter 7A Chapters 7 and 8 deal with rotational motion, and with objects traveling in circular paths. 1 Chapter 7A Angular Displacement ( An object\'s angular displacement ( ) is the angle through which it rotates during some time interval. ) T... Date Added: 2008-04-28 19:23:23 |
| feedbackamp.pdf Path: Berkeley >> EE >> 217 Spring, 2009 Description: Design and Analysis of Microwave Feedback Amplifiers Gang Zhou and Lizhen Zheng Department of Electrical Engineering and Computer Sciences, University of California, Berkeley, CA 94720 Abstract-We have studied the basic theory of feedback amplifiers... Date Added: 2009-04-16 02:05:46 |
| feedbackamp.pdf Path: Berkeley >> EE >> 99 Spring, 2009 Description: Design and Analysis of Microwave Feedback Amplifiers Gang Zhou and Lizhen Zheng Department of Electrical Engineering and Computer Sciences, University of California, Berkeley, CA 94720 Abstract-We have studied the basic theory of feedback amplifiers... Date Added: 2009-04-16 02:05:46 |
| Session 10 Waiting Line Models II Path: Washington University in St. Louis >> OSCM >> 356 Spring, 2008 Description: OSCM356 Operations Management Session 10 Waiting Line Models II (Queuing Analysis II) Fuqiang Zhang Olin Business School Washington University in St. Louis Spring 2008 Session Outline Applications of queuing models Analyzing queuing models using ... Date Added: 2008-04-15 20:17:45 |
| stat401ch16_01.pdf Path: Idaho >> STAT >> 401 Summer, 2008 Description: Analysis of covariance Covariate (in this context): essentially a quantitative blocking variable, usually not under control of the investigator. Examples: temperature, humidity, pre-test score, height, etc. Adjusting for covariate might reveal signif... Date Added: 2009-02-06 20:44:35 |
| Know Before You Go.pdf Path: Michigan State University >> UGS >> 102 Fall, 2008 Description: KnowBeforeYouGo:4TipsforParentsandStudents FreshmanSeminarsAbroad 1.WhatshouldIpack? Manyprogramsincludepackingguidelinesforstudents.Werecommendthatyoufollowthesetips,asmost studentsseverelyoverpack.Overpackingcanleadtofinesattheairport,somakesureth... Date Added: 2009-01-09 02:55:04 |
| section2.xls Path: Clemson >> I E >> 185 Summer, 2008 Description: 1998 Criteria for Accreditation Section II: Institutional Purpose Subsection Must Statement Must have a clearly defined purpose or mission statement appropriate to collegiate education as well as to its own specific educational role. This statement m... Date Added: 2009-01-09 07:42:31 |
| section2.xls Path: Clemson >> CO-OP >> 888 Summer, 2008 Description: 1998 Criteria for Accreditation Section II: Institutional Purpose Subsection Must Statement Must have a clearly defined purpose or mission statement appropriate to collegiate education as well as to its own specific educational role. This statement m... Date Added: 2009-01-09 07:42:31 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 2 Fall, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:45 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 7 Fall, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:46 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 24 Fall, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:45 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 3 Summer, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:46 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 4 Summer, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:46 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 132 Fall, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:45 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 5 Fall, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:46 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 148 Spring, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:45 |
| 132papertopics2.doc Path: Berkeley >> PHILOS >> 6 Fall, 2008 Description: L&S 160, Philosophy 132, Fall 2006 Professor Searle Second Paper topics Papers are due Thursday, October 26 in class. Maximum 3 pages. 1. In his article Mental Events, Davidson claims that mental states have causal powers and that there are no psycho... Date Added: 2009-01-09 19:24:46 |
| Lect_13b.pdf Path: Rochester >> AST >> 111 Fall, 2009 Description: Today in Astronomy 111: asteroids and meteorites Classification of asteroids by composition The interiors of asteroids Special features Asteroids with moons Hirayama families and collisional fragmentation Near-Earth-orbiters Meteorites Compositio... Date Added: 2009-04-15 22:26:52 |
| L08_handout1.doc Path: N.C. State >> AEE >> 424 Fall, 2008 Description: Handout 1 Basic Principles to Prevent Back Pain Injury 1. Avoid lifting when possible by pushing, pulling, rolling or sliding. 2. Use mechanical aids hand trucks carts winches forklifts etc.) 2. Request help from others when necessary. 3. Lift ... Date Added: 2009-01-09 04:42:18 |
| RHM.pdf Path: Michigan State University >> SOC >> 131 Fall, 2008 Description: Hausdor Measure of the Sample Paths of Gaussian Random Fields Yimin Xiao June 26, 1995 Running head: Xiao, Hausdor Measure of Certain Gaussian Fields AMS Classication numbers: Primary 60G15, 60G17. Key words: Hausdor measure, Gaussian random elds, ... Date Added: 2009-01-11 18:49:59 |
| RHM.pdf Path: Michigan State University >> STT >> 866 Spring, 2008 Description: Hausdor Measure of the Sample Paths of Gaussian Random Fields Yimin Xiao June 26, 1995 Running head: Xiao, Hausdor Measure of Certain Gaussian Fields AMS Classication numbers: Primary 60G15, 60G17. Key words: Hausdor measure, Gaussian random elds, ... Date Added: 2009-01-11 18:49:59 |
| RHM.pdf Path: Michigan State University >> ES >> 324 Spring, 2008 Description: Hausdor Measure of the Sample Paths of Gaussian Random Fields Yimin Xiao June 26, 1995 Running head: Xiao, Hausdor Measure of Certain Gaussian Fields AMS Classication numbers: Primary 60G15, 60G17. Key words: Hausdor measure, Gaussian random elds, ... Date Added: 2009-01-11 18:49:59 |
| Absolutism notes Path: Wyoming >> HIST >> 1120 Spring, 2008 Description: Western Civilization II I. II. III. IV. V. VI. Absolutism a. He who gave kings to men wished them to be respected as His lieutenants, reserving to Himself alone the right to examine their conduct.\" -Louis XIV Absolutism as Theory and Practice-... Date Added: 2008-03-31 10:50:32 |
| 030810rice.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Who Said Anything About Rice? Free Trade Is About Cars and PlayStations August 10, 2003 EDITORIAL OBSERVER Who Said Anything About Rice? Free Trade Is About Cars and PlayStations By ANDRS MARTINEZ SUKIDATE, Japan All of the 250 or so members of the ... Date Added: 2009-02-11 18:33:56 |
| 460.pdf Path: Maryland >> EDHD >> 460 Fall, 2008 Description: EDHD 460 Sec 0101 | Spring 2005 Syllabus | Page 1 EDHD 460 Educational Psychology Section 0101 Spring 2005 Mon & Wed 2-3:15 EDU 3315 (Benjamin Building) Instructor: Office: Office Phone: Office Hours: Email: Undergrad TA: Email: Michelle Riconsc... Date Added: 2009-02-03 13:58:53 |
| 4500Nquadrant Path: Georgia Tech >> ECE >> 4500 Spring, 2008 Description: ... Date Added: 2008-04-29 09:59:13 |
| chap 1 Path: Minnesota >> MGMT >> 3001 Spring, 2008 Description: Management the effective and efficient attainment of organizational goals through planning, organizing, leading, and controlling organizational resources organization a goal-directed and deliberately structured social entity organizational effectiv... Date Added: 2008-04-07 11:34:39 |
| 02a-ObservingSky.pdf Path: Delaware >> PHYS >> 133 Fall, 2008 Description: Student Manual Observing the Sky UDVersion 1.0 Observing the Sky Student Manual (at the University of Delaware) One of the main telescopes at the Gemini Observatory in Chile. Department of Physics and Astronomy University of Delaware Newark, DE ... Date Added: 2009-01-10 03:34:54 |
| sn74als169b.pdf Path: Southern Methodist >> EE >> 2181 Fall, 2008 Description: SN54ALS169B, SN54AS169A, SN74ALS169B, SN74AS169A SYNCHRONOUS 4 BIT UP/DOWN BINARY COUNTERS SDAS125B MARCH 1984 REVISED DECEMBER 1994 Fully Synchronous Operation for Counting and Programming Internal Carry Look-Ahead Circuitry for Fast Counti... Date Added: 2009-01-12 04:51:42 |
| Domenech.4post.doc Path: George Mason >> HHS >> 270 Spring, 2008 Description: 1 Straw Men, Fibs, and Other Academic Sins By Lloyd Cohen* Superintendent Domenechs rhetorical technique can be summarized as: (1) ignore my arguments and evidence; (2) create a straw man; (3) throw a dollop of irrelevant and deceptive statistics at ... Date Added: 2009-01-11 18:41:04 |
| Chapter4_Igneous Rocks Textures Path: UAB >> CIVIL >> CE 200 Fall, 2007 Description: Igneous Rocks and Textures Chapter 4 Born from Molten Magma Rock Types Igneous Rocks formed from the solidification of a molten liquid when it cools Sedimentary Rocks formed from consolidated sediments, cementation, or precipitated from solutio... Date Added: 2008-04-28 15:11:54 |
| 12correlation.stud08 Path: UVA >> PSYCH >> 305 Fall, 2008 Description: Psych 305 Week 7 Correlation (and implications for your survey project) Before coming to this class, you should know what a z-score is, what it means, and how to compute it. That is an important foundation for what we will do in this lecture. At t... Date Added: 2008-09-25 05:31:36 |
| 2394.002.ps Path: Hawaii >> SOEST >> 2394 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207382085.0388276 Float: 2394 Profile: 002 Location: 38.0N 147.6E Date: 07/14... Date Added: 2009-02-17 20:16:17 |
| Exam 2 key Path: Texas >> CH >> 310M Spring, 2009 Description: Bocknack CH 310M/318M Fall 2008 MIDTERM EXAM #2 ANSWER KEY The deadline to submit regrade requests (for Part II only) is: TUESDAY, NOVEMBER 4 @ 3:00 p.m. To submit a regrade request for Part II, please follow the instructions provided in the Regra... Date Added: 2009-02-07 20:07:53 |
| S07 exam 3 Path: Texas >> CH >> 302 Spring, 2009 Description: Version 001 Exam 3 David Laude (53015) This print-out should have 30 questions. Multiple-choice questions may continue on the next column or page nd all choices before answering. V1:1, V2:1, V3:1, V4:1, V5:2. Please make sure you write your versio... Date Added: 2009-03-25 16:22:56 |
| EDHE 6790 (VTEL) - APP.pdf Path: North Texas >> EDHE >> 6790 Fall, 2008 Description: ... Date Added: 2009-02-03 14:09:06 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
