Course Solutions And Notes - binzleygrading2007 46
| hw5.txt Path: UC Riverside >> CS >> 010 Fall, 2008 Description: Homework 5 UCR CS10: Introduction to Computer Science Spring Quarter 2004, Lecturer: Kris Miller Due Wednesday, May 12 before 8:00pm by web turnin. - Turnin: Turnin this assignment to the folder, hw5, using the electronic turnin linked to from the... Date Added: 2009-06-03 15:53:46 |
| SSRD_LCO_F06a_T06_V01.6.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: System and Software Requirements Definition (SSRD) USC Diploma Tracking/Database System Team 6 Fall 2006 Nakul Datar Imane Idbihi Joshua Garcia Shradha Sharma Deepa Datta Rucha Desai Aditya Devdhar Kipton Nolder Charanya Ram Kumar Pro... Date Added: 2009-06-03 15:54:42 |
| CMN_09_24_F08a_T03.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: PROJECT #3 Proyecto Pastoral Website-Database system CLIENT MEETING NOTES WEEK : 09/17/2008 - 09/24/2008 The primary task identified last week was to collect as much information from our client about their organization and about their current website... Date Added: 2009-06-03 15:56:08 |
| tepperman.ppt Path: USC >> CS >> 599 Fall, 2008 Description: Grounding and Repair Joe Tepperman CS 599 Dialogue Modeling Fall 2005 Grounding Establishing mutual belief Collaborative More than one active participant Acknowledgement Necessary for: Dialogue flow, theorem proving, etc. User modeling Rep... Date Added: 2009-06-03 15:56:23 |
| ec-06.ppt Path: USC >> CSCI >> 577 Fall, 2009 Description: University of Southern California Center for Systems and Software Engineering Simplifiers & Complicators and MBASE Barry Boehm CS 577a, Fall 2008 September 8, 2008 University of Southern California Center for Systems and Software Engineering The... Date Added: 2009-06-03 15:57:16 |
| UI_Prototype_F05a_T19_v3.1.ppt Path: USC >> CSCI >> 577 Fall, 2009 Description: Before Installation Double click on the eBay Notification System installer icon to begin the installation process. Installer Screen Installing eBay Notification System Self Installation Complete! < Back Finish Cancel The install wizard will... Date Added: 2009-06-03 15:57:23 |
| FRD_LCO_F05a_T05_V3.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Feasibility Rationale Description (FRD) Data Mining PubMed Results TEAM 5 TEAM MEMBERS PROJECT MANAGER: CONCEPT ENGINEER: REQUIREMENTS ANALYST: ARCHITECT: LIFE CYCLE PLANNER: PROTOTYPE DEVELOPER: IV V: Srikanth Ranganamyna Dinesh Siddhar... Date Added: 2009-06-03 15:57:31 |
| WikiWinWinII.ppt Path: USC >> CSCI >> 577 Fall, 2009 Description: WikiWinWin Tutorial II Di Wu USC CSSE September 2007 Outline Importance Role Tool Practice WinWin Negotiation Matters Goals Requirements Design, Architecture Development, Test Product delivery Shaper\'s role Leader of negotiation Work closely wi... Date Added: 2009-06-03 15:57:36 |
| Presentation11-2.ppt Path: USC >> EASC >> 150 Fall, 2009 Description: April 8. Courtship and Gender Relations in Contemporary Korea: The Empowered Female and Creative Modification of Tradition A. Contemporary S. Korea as seen in \"My Sassy Girl\" B. The Ever-changing Place of Females 1. Popular culture depictions: role ... Date Added: 2009-06-03 15:58:22 |
| Presentation11-2.ppt Path: USC >> EASC >> 11 Fall, 2009 Description: April 8. Courtship and Gender Relations in Contemporary Korea: The Empowered Female and Creative Modification of Tradition A. Contemporary S. Korea as seen in \"My Sassy Girl\" B. The Ever-changing Place of Females 1. Popular culture depictions: role ... Date Added: 2009-06-03 15:58:22 |
| lect3_2.doc Path: USC >> COMM >> 301 Fall, 2009 Description: COMM 301L: Empirical Research in Communication Introduction to SPSS This is an introduction to the main statistical software program you will be using: SPSS (Statistical Package for Social Sciences). The main aim of this lesson is to acquaint you wi... Date Added: 2009-06-03 15:58:24 |
| lect16.ppt Path: UMKC >> CS >> 551 Fall, 2009 Description: CS551 Object Oriented Middleware (V) Advanced Communication between Distributed Objects(Chap. 7 of EDO) Yugi Lee STB #555 (816) 235-5932 yugi@cstp.umkc.edu www.cstp.umkc.edu/~yugi 1 CS551 - Lecture 16 Motivation The requests we have seen have tw... Date Added: 2009-06-03 15:58:49 |
| final_hmwk4.doc Path: UMKC >> CS >> 451 Fall, 2009 Description: Homework 4: Detailed Design Documents Analyses MaMTeP has chosen to do this assignment as a group project. Each member thoroughly analyzed one or more of the team sites according to the following report criteria: 1. Does the application design adhere... Date Added: 2009-06-03 15:58:54 |
| S11.doc Path: UMKC >> ECE >> 376 Fall, 2009 Description: ECE376 Homework #11 SOLUTIONS Fall, 2004 Due Wednesday, October 6 1 Chapter 13, Solution 38. Zin = Zp + ZL/n2, n = v2/v1 = 230/2300 = 0.1 v2 = 230 V, s2 = v2I2* I2* = s2/v2 = 17.391 53.13 or I2 = 17.391 53.13 A ZL = v2/I2 = 230 0/17.391 53.13 = 1... Date Added: 2009-06-03 15:58:57 |
| NRES322-12.ppt Path: Nevada >> ERS >> 322 Fall, 2009 Description: Chapter 12: Soil Fertility Management Homework: 4, 10, 12 Also add this question: Why is nitrogen fertilization more problematic than for most fertilizers? Include in your answer a short discussion of why ionic forms of N in the soil (NH4+ and NO3-)... Date Added: 2009-06-03 15:59:40 |
| day2final.ppt Path: UNC >> COMP >> 290 Fall, 2008 Description: Mobile computing: Data infrastructure Dorian Miller Comp 290-40 Fall 01 1 Big picture Infostations/Caches & Proxies Services Powerful Gb memory High end CPU High bandwidth Unreliable Recurring CS topics Indirection Caching Hierarchy Mobile device... Date Added: 2009-06-03 16:01:41 |
| 01-algo.ppt Path: UNC >> COMP >> 122 Fall, 2008 Description: What is an Algorithm? (And how do we analyze one?) COMP 122, Spring 04 Algorithms Informally, A tool for solving a well-specified computational problem. Input Algorithm Output Example: sorting input: A sequence of numbers. output: An ordered ... Date Added: 2009-06-03 16:02:03 |
| orders.txt Path: UNC >> INLS >> 461 Fall, 2008 Description: OrderID OrderDate Customer ISBN DateShipped Quantity 1 8/6/2007 37 0-451-52497-7 8/22/2007 5 2 9/3/2007 80 0-451-52753-4 8/22/2007 1 3 9/3/2007 15 0-14-009438-5 9/5/2007 2 4 9/10/2007 63 0-452-26957-1 9/14/2007 3 5 9/22/2007 70 0-451-52830-1 11/26/2... Date Added: 2009-06-03 16:02:25 |
| bsneish_lab3.doc Path: UNC >> GEOG >> 491 Fall, 2008 Description: Brad Neish Lab 3 10-20-08 (Question 1) Which two zip codes are within the 60% service areas of four hospitals? 28227 and 28212 (Question 2) COVI60 is another 60% service tabulation. Compare the two choropleth maps. What simple answer explains the dif... Date Added: 2009-06-03 16:02:57 |
| Assignment-3.doc Path: UNC >> INLS >> 157 Fall, 2008 Description: Assignment 3 INLS 157 1) Ramakrishnan Chapter 20, exercises 20.2.1, 20.2.3, 2) Ramakrishnan Chapter 20, exercise 20.6 3) Indexing a) Load into your database (db1_*) the following database dump. It was created using mysqldump (see manual). You can loa... Date Added: 2009-06-03 16:03:20 |
| Stat31FinalSolution.doc Path: UNC >> STOR >> 155 Fall, 2008 Description: Page 1 of 7 Statistics 31, Section 1, Final Examination Tuesday, May 10, 2005 Name: _Solution_ Pledge: I have neither given nor received aid on this examination. Signature: __ Instructions: Do not do any actual numerical calculations. Answers in a fo... Date Added: 2009-06-03 16:05:20 |
| Lab5Objectives.TXT Path: UNC >> MATH >> 006 Fall, 2009 Description: Sheet1 Lab5 Objectives In order to obtain points for this lab you must: (1) Modify the collision rule routine to represent collisions with a circle. Show an example computation. (2) Modify the collision rule routine to represent collisions with a squ... Date Added: 2009-06-03 16:05:58 |
| ttests.ppt Path: Kentucky >> STA >> 570 Fall, 2008 Description: T-tests STA 570 001-002 Spring 2008 Review We are currently interested in estimated the mean of a population measurement that is continuous, such as heights, blood pressures, or even a construct such as \"extrovertedness\" from a survey instrument,... Date Added: 2009-06-03 16:07:27 |
| HW6Solution.doc Path: Cal Poly Pomona >> EGR >> 573 Fall, 2009 Description: Solution to HW 6 on Chapter 7, EGR 573 Section 1, page 364, problem 2 The product structure diagram gives: a. The relationship of the end item and lower level components and subassemblies. b. The multiplier that gives the number of each component req... Date Added: 2009-06-03 16:09:02 |
| inclass_turbulence.ppt Path: Delaware >> CIEG >> 305 Winter, 2008 Description: CIEG 305 IN CLASS EXERCISE ON REYNOLDS NUMBER Determine the Reynolds Number for these common flow types. Air duct (1ft by 2 ft), V=3 ft/s, kinematic viscosity = 1.6 x 10-4 ft2/s Re 20,000 Water pipe (d= 1ft), V=5 ft/s, kinematic viscosity = 1.2 x... Date Added: 2009-06-03 16:10:30 |
| utilrfp.doc Path: Southern Oregon >> UTIL >> 98 Fall, 2009 Description: Using Technology for the Improvement of Learning, 1998 PROPOSAL COVER SHEET This initiative is to provide support for major improvements in instruction through use of technology. Individual faculty, groups of faculty and/or staff within a department,... Date Added: 2009-06-03 16:12:38 |
| CONVERSION.doc Path: CSU Bakersfield >> EMIRANDA >> 316 Fall, 2009 Description: CONVERSION OF UNITS IN AVALANCHE WORK A paper on basic math for converting units. If you\'re into converting numbers.you\'ll want to click to: Centre for Innovation in Mathematics Teaching It has the most extensive listing of conversion math we\'ve been... Date Added: 2009-06-03 16:13:14 |
| CONVERSION.doc Path: CSU Bakersfield >> EMIRANDA >> 3 Fall, 2009 Description: CONVERSION OF UNITS IN AVALANCHE WORK A paper on basic math for converting units. If you\'re into converting numbers.you\'ll want to click to: Centre for Innovation in Mathematics Teaching It has the most extensive listing of conversion math we\'ve been... Date Added: 2009-06-03 16:13:14 |
| HW2.doc Path: CSU Sacramento >> HW >> 2 Fall, 2009 Description: Fall 1998 CALIFORNIA STATE UNIVERSITY, SACRAMENTO School of Business Administration MIS 1A - Microcomputer Hardware and Software Homework # 2 - Due Next Tuesday Turn in a floppy disk containing your work to me next week. 1. Open Netscape Navigator an... Date Added: 2009-06-03 16:14:25 |
| ch06.ppt Path: UNC Greensboro >> MAN >> 6511 Fall, 2009 Description: Process Capacity Chapter 6 Redesigning a Process Through Capacity Change Define scope 2 Identify opportunity 1 Document process 3 Implement changes 6 Redesign Process (Capacity change) 5 Figure 6.1 Evaluate performance 4 Capacity Bottl... Date Added: 2009-06-03 16:14:57 |
| scd15t_53m.txt Path: New Hampshire >> DEP >> 15 Fall, 2009 Description: Deployment Number 15 - 15-Dec-2005 to 20-Feb-2006 Open Ocean Aquaculture Site, Environmental Monitoring Buoy Location: 42 deg 56.48 m N x 070 deg 37.82 m W Sensor: Sea-Bird SBE-37 Seacat Serial Number 4527 Water Depth: 53.5 at time of deployment Sens... Date Added: 2009-06-03 16:17:19 |
| Chap006.ppt Path: SIU Edwardsville >> ECO >> 302 Fall, 2009 Description: CHAPTER 6 Building Blocks of the Flexible-Price Model 6-1 Copyright 2002 by The McGraw-Hill Companies, Inc. All rights reserved. Questions What is a full-employment analysis? What keeps the economy at full employment when wages and prices are f... Date Added: 2009-06-03 16:17:39 |
| ReactionPaper4_000.doc Path: Kentucky >> SNOAR >> 2 Fall, 2009 Description: Reaction Paper #4 : Campaign Effectiveness COM571 Dr. Seth Noar Purpose: The purpose of this assignment is to get you thinking about and reacting to the readings on campaign effectiveness, so that you might become more \"enlightened\" on the to... Date Added: 2009-06-03 16:18:24 |
| modern_visual_art.doc Path: UNC >> IDS >> 30 Fall, 2009 Description: 5/20/2004_Gatti European Foundations of Modernism Artists are going to start questioning \"reality\" and reacting against Romanticism Realism *Gustave Courbet, The Stonebreakers, 1849 Gustave Courbet, Studio of A Painter: A Real Allegory Summarizing S... Date Added: 2009-06-03 16:19:27 |
| UseCalculusToExploreOneOverOneMinusP.doc Path: LSU >> MSWEB >> 4 Fall, 2009 Description: Use Calculus to explore (1-p)-1 It was shown that n = (1 - p)-1. Usually, we think about large values of p. This problem concerns small values of p and is just an exercise to remind you how we derive some limiting forms of important equations. Use ca... Date Added: 2009-06-03 16:21:30 |
| Class21.ppt Path: Alabama Huntsville >> CHE >> 448 Fall, 2009 Description: CHE 448 Chemical Engineering Design Spring 2006 Class Nr 20 Thursday, March 30, 2006 We are not in Kansas Dorothy! Announcement! Tuesday April 4: Mr. Garnett on Human Errors in Design Thursday April 6: Second Midterm Stream split... Date Added: 2009-06-03 16:23:32 |
| ToolsOverview_BrianScriber.ppt Path: Colorado >> SYST >> 4080 Fall, 2008 Description: Project Management Tools Brian Scriber Project Management Agenda: 1 hour of Tools Quick Background Why One Tool Won\'t Fill the Toolbox Tools to Explore Scrum (overview) XPlanner (demo/walkthrough) Bugzilla (demo/walkthrough) Microsoft Project... Date Added: 2009-06-03 16:24:24 |
| argento.doc Path: UMBC >> TM >> 06 Fall, 2009 Description: 4636719c3aa86fe2a4b33ff6931972d247f2fe52.doc 5/15/2009 Zoe Argento Liu Trademarks Paper Outline: Thesis: Genericide should be a limitation on the right of publicity Introduction o Concrete example: Celebrities are creatures of the public, created by... Date Added: 2009-06-03 16:24:42 |
| CCISD.doc Path: Michigan Flint >> SECURE >> 2 Fall, 2009 Description: Student Teaching Opportunities with Clear Creek ISD League City, Texas for the 2007-08 school year After completion of Student Teaching Starting Salary - $ 40,500 Bachelor, $41,500 Master Clear Creek ISD is the only large school district in Texas se... Date Added: 2009-06-03 16:25:46 |
| equationsInput5.txt Path: Roanoke >> CPSC >> 270 Spring, 2009 Description: 10 -3 0 0 0 0 0 0 0 0 0 9 0 0 0 0 0 1 3 7 1 -4 2 2 3 0 0 0 0 0 0 0 0 -5 0 0 0 0 0 4 15 -2 1 0 -4 3 6 5 0 0 0 0 0 0 0 -2 0 0 0 0 0 3 6 5 0 0 -2 4 15 -2 1 0 0 0 0 0 0 -4 0 0 0 0 0 2 3 0 0 0 -5 1 3 7 1 -4 0 0 0 0 0 2 0 0 0 0 0 -3 0 0 0 0 9 ... Date Added: 2009-06-03 16:25:55 |
| hw4_solution.doc Path: Loyola Chicago >> STAT >> 337 Spring, 2009 Description: Stat/Biol 337 Quantitative Bioinformatics Homework 4 Due 2:30pm Thursday 2/12/2009 You should always put maximum effort into the writing up your answers. Answers will be graded on the quality of the presentation as well as on correctness. Problem 1 (... Date Added: 2009-06-03 16:26:41 |
| choped.txt Path: Truman State >> CS >> 180 Fall, 2009 Description: abatement abbreviate abdicate abdominal abduction abernathy aberrate abetting abhorrent abhorring abjection ablution abnormal abolishment abolitionist abominate aborigine abortive aboveboard abovementioned abramson abrasive abreaction abscissa absent... Date Added: 2009-06-03 16:26:46 |
| Parino.doc Path: TN Tech >> TESI >> 2005 Fall, 2009 Description: Margo Parino Cement and Concrete Engineering Massachusetts Standards: 1. Appropriate materials, tools, and machines enable us to solve problems, invent and construct. 2. Ideas can be communicated through engineering drawings, written reports, and pic... Date Added: 2009-06-03 16:27:24 |
| bd0201.txt Path: Cedarville >> E >> 2002 Fall, 2009 Description: -8.000000E-003,-2.000000E-001 -7.980000E-003,-2.000000E-001 -7.960000E-003,-2.000000E-001 -7.940000E-003,-2.000000E-001 -7.920000E-003,-2.000000E-001 -7.900000E-003,-2.000000E-001 -7.880000E-003,-2.000000E-001 -7.860000E-003,-2.000000E-001 -7.840000E... Date Added: 2009-06-03 16:30:30 |
| avgsum.bas.txt Path: St. Rose >> ACADEMIC >> 2 Fall, 2009 Description: 5 HOME 10 REM * CALC AVG AND SUM 20 PRINT \"ENTER THREE INTEGERS\" 30 INPUT A 40 INPUT B 50 INPUT C 60 LET SM = A + B + C 70 LET AV = SM / 3 80 PRINT \"SUM IS: \"; SM 90 PRINT \"AVG IS: \"; AV 100 END... Date Added: 2009-06-03 16:31:10 |
| loc_mgmt-620.ppt Path: SUNY Buffalo >> CSE >> 2003 Fall, 2009 Description: Scalable Location Management for Large Mobile Ad hoc Networks Sumesh J. Philip Contents Wireless Ad hoc networks Scalable Location Update based Routing SLALoM Scalable Location Management Grid Location Service Hierarchical Grid Location Mana... Date Added: 2009-06-03 16:32:19 |
| loc_mgmt-620.ppt Path: SUNY Buffalo >> CSE >> 620 Fall, 2009 Description: Scalable Location Management for Large Mobile Ad hoc Networks Sumesh J. Philip Contents Wireless Ad hoc networks Scalable Location Update based Routing SLALoM Scalable Location Management Grid Location Service Hierarchical Grid Location Mana... Date Added: 2009-06-03 16:32:19 |
| LessonPlanPracticumfall2004edit_001.doc Path: Minnesota >> ELED >> 1010 Fall, 2009 Description: LEARNER SENSITIVE MODEL: COLLABORATION, TECHNOLOGY, DIVERSITY, REFLECTION, EMPOWERED ELED 1010 Fall 2004 JDIETRIC 8181 THINKING FROM \"BEHIND THE DESK\" LESSON PLAN FORMAT FOR TEACHING IN THE CLASSROOM Typed: (1) copy for classroom teacher, (2) UMD... Date Added: 2009-06-03 16:35:58 |
| Lecture_11_Fall_2007.ppt Path: Minnesota >> CSCI >> 4061 Fall, 2008 Description: IPC & Sockets Lecture #11 CSCI 4061 Fall 2007 Interprocess Communications How can we send data back and forth between processes CSCI 4061 Fall 2007 Pipes Oldest form of communication 2 limitations half duplex between parent/child processes ... Date Added: 2009-06-03 16:36:30 |
| Ranger_Challenge_2008_SqAsCr_FitTo_Win_MOI.doc Path: U. Memphis >> CAS >> 2 Fall, 2009 Description: ATOE-E SUBJECT: Memorandum of Instruction (MOI) for the Victory Brigade Ranger Challenge Competition SY 08/09 Enclosure 8: Squad Assault Course (Fit To Win) 1. Task. Execute the \"Fit-To-Win\" Endurance Course 2. Conditions. Given a course lay-out com... Date Added: 2009-06-03 16:37:29 |
| Lecture3Jan23energy.ppt Path: N. Arizona >> BIO >> 4262006 Fall, 2009 Description: fromlast tim . e Pre ssure= force a /are Two m pre ajor ssure in plants. s 1. Thepositivepre ssure(turgor) insideliving ce and that\'s re lls quire for ce and tissue d ll growth. 2. Thene gativepre ssure(te nsion) that e xists in thece of thexyle of ... Date Added: 2009-06-03 16:37:59 |
| Module3Section2.ppt Path: N. Arizona >> CH >> 244 Fall, 2009 Description: Polynomial Functions of Higher Degree Written by Clinton Henry Table of Contents Graphs of Polynomial Functions The Leading Coefficient Test Zeros of Polynomial Functions The Intermediate Value Theorem The End Graphs of Polynomial Functions We... Date Added: 2009-06-03 16:38:15 |
| Presentation_Comments.doc Path: Minnesota >> ECE >> 3611 Fall, 2009 Description: Background: LEDs Operate as 12-24v Systems Low shock/fire hazard Voltage of Doorbell LEDs Don\'t emit Ultraviolet Light. So while incandescent lamps dissipate heat by radiation, LEDs dissipate heat by conduction. Which could lead to problems in future... Date Added: 2009-06-03 16:42:07 |
| intro_edtech.ppt Path: Winthrop >> PRESENTATI >> 07 Fall, 2009 Description: EDUC 275 August 28, 2007 Getting Started: Review readings from last night to prepare for five question quiz. AGENDA: 1. Quiz on readings. 2. Discuss \"Educational Technology.\" 3. Work on digital storytelling. Defining and Synthesizing Educational ... Date Added: 2009-06-03 16:42:38 |
| slides02.ppt Path: Winthrop >> CSCI >> 151 Fall, 2008 Description: Chapter 2 Data and Expressions Data and Expressions Let\'s explore some other fundamental programming concepts Chapter 2 focuses on: character strings primitive data the declaration and use of variables expressions and operator precedence d... Date Added: 2009-06-03 16:42:43 |
| Dandamudi_Pt5.doc Path: Auburn >> E >> 6200 Fall, 2009 Description: ELEC 5200/6200 Computer Architecture and Design PRADEEP DANDAMUDI Final Report Through the design process, we developed an adept understanding of the multicycle datapath and how it is supposed to perform, as well as a better grasp on the interact... Date Added: 2009-06-03 16:43:41 |
| E6200syl_prn.doc Path: Auburn >> E >> 6200 Fall, 2009 Description: ELEC 5200-001/ELEC 6200-001 COMPUTER ARCHITECTURE AND DESIGN Fall Semester, 2007, MWF 11AM, BROUN 306 2006 Catalog Data: ELEC 5200/6200. COMPUTER ARCHITECTURE AND DESIGN (3) LEC. 3. Pr., ELEC 4200. Structural organization and hardware design of digit... Date Added: 2009-06-03 16:44:49 |
| p12519020218.txt Path: Auburn >> DIGDATA >> 1902 Fall, 2009 Description: 125 The estimated balance which will be to the credit of the college at that date is a very conservative estimate. It probably will exceed the amount estimated by several hundred dollars. At their request, I submit communications from several profe... Date Added: 2009-06-03 16:45:04 |
| G020169-00_partA.ppt Path: Caltech >> REVIEW >> 1 Fall, 2009 Description: Conceptual Design Review: Initial LIGO Seismic Isolation System Upgrade Introduction Dennis Coyne April 12, 2002 LIGO-G020169-00-M 1 Problem q Ground motion at LLO with the initial LIGO seismic isolation system makes it impossible to hold the int... Date Added: 2009-06-03 16:45:06 |
| G010286-00.ppt Path: Caltech >> G >> 010286 Fall, 2009 Description: E3/E4 PEM Correlations, Part I Michael Landry LIGO Hanford Observatory Detector Characterization Session N. Christensen, P. Fritschel, M. Ito, S. Klimenko, S. Marka, S. Mohanty, A. Ottewill, R. Rahkola, R. Schofield, J. Sylvestre LIGO-G010286-00-H ... Date Added: 2009-06-03 16:46:12 |
| IntroMicroEcon.doc Path: Iowa State >> EE >> 590 Fall, 2009 Description: A Very Brief Microeconomics Overview 1.0 The electric market debate is not over A story recently appeared in the business section of the Dallas-Fort Worth Star-Telegram Newspaper [1]. IN MY OPINION * Texas is getting a lot more energy efficient, a pu... Date Added: 2009-06-03 16:46:16 |
| Lecture5.ppt Path: Iowa State >> CPRE >> 585 Fall, 2009 Description: Lecture 5 Scoreboarding: Enforce Register Data Dependence Scoreboard design, big example Revised from D. Patterson s1998 1 From MIPS pipeline to Scoreboard Outoforder execution divides ID stage: 1.Issue-decode instructions, check for structur... Date Added: 2009-06-03 16:46:56 |
| E080092-00.doc Path: Caltech >> E >> 080092 Fall, 2009 Description: DCC Number: E08009200X Date Prepared: 2-29-2008 Originator Tom Evans Ken Mason Cognizant Engineer Ext./Phone# (509)372-8116 Project Enhanced LIGO SEI HAM Account Number Dwg/Part Number Rev Part Description / Material 3/8-24 x 2\" SHCS Ag plated wit... Date Added: 2009-06-03 16:46:57 |
| Introductiontoamphibiansandreptiles.ppt Path: Iowa State >> AE >> 362 Fall, 2009 Description: Amphibian and Reptile Classification Kingdom = Animalia Phylum = Chordata Subphylum = Vertebrata Class = Amphibia Order = Caudata Family = Ambystomatidae Genus = Ambystoma Species = Ambystoma tigrinum (with example) http:/fwie.fw.vt.edu/VHS/ Refere... Date Added: 2009-06-03 16:47:08 |
| lecture12-CV.ppt Path: Caltech >> BI >> 145 Fall, 2009 Description: Introduction to Cardiovascular Physiology Jim Pierce Bi 145a Lecture 12, 20089 Cardiovascular System Our Goals: Anatomy and Core Principles Embryology Cardiac Electrophysiology Cardiac Mechanical Function Vascular Function Integrated Pictur... Date Added: 2009-06-03 16:48:09 |
| Word.02.ppt Path: SUNY Oneonta >> CSCI >> 100 Fall, 2008 Description: Word Tutorial 2 Editing and Formatting a Document FIRST COURSE Objectives Check spelling and grammar Select and delete text Move text within a document Find and replace text XP New Perspectives on Microsoft Office 2007: Windows XP Edition 2 ... Date Added: 2009-06-03 16:49:13 |
| l20_nov08.txt Path: New Mexico >> CS >> 351 Fall, 2009 Description: - administrivia - midpoint surveys still outstanding - have 1 so far - this is your chance to influence the direction of the class - Q3 next time: threads - P3 handed out next time - P3 is a group project: please pick your groups, o... Date Added: 2009-06-03 16:49:18 |
| l20_nov08.txt Path: New Mexico >> CS >> 20 Fall, 2009 Description: - administrivia - midpoint surveys still outstanding - have 1 so far - this is your chance to influence the direction of the class - Q3 next time: threads - P3 handed out next time - P3 is a group project: please pick your groups, o... Date Added: 2009-06-03 16:49:18 |
| Southern_and_Eastern_Hudson_Bay_Attributes.txt Path: New Hampshire >> V >> 4 Fall, 2009 Description: \"PointID\" \"Code\" \"Name\" \"Lat\" \"Long\" \"X_Ease\" \"Y_Ease\" \"DArea\" \"DArea_effective\" \"Hydrozone\" \"Gauge_altitude\" \"DistanceToOutlet\" \"MinOfYear\" \"MaxOfYear\" \"CountOfYear\" \"PercentOfCoverage\" \"PercentOfCoverageByMonth\" \"Notes\" 2783 \"04AA001\" \"HAYES RIVER ... Date Added: 2009-06-03 16:50:35 |
| n341ArraysJournal.txt Path: IUPUI >> N >> 341 Fall, 2009 Description: Davis Mayanja Lab 4: Arrays Preliminary Lab Journal Entry * What problem(s) are you going to solve? I\'m going to use multidimentional arrays to hold scores of a golf game * What are the conditions and other information given in... Date Added: 2009-06-03 16:50:42 |
| 2--is-it-a-poem.doc Path: UVA >> MODULE >> 2 Fall, 2009 Description: Exercise: Is It a POEM? Is it Patient-Oriented Evidence that Matters? A. Did the authors study an outcome that patients would care about? (Be careful to avoid results that require extrapolation to an outcome that truly matters to patients) B. Is th... Date Added: 2009-06-03 16:51:01 |
| lecture2.ppt Path: UVA >> CS >> 200 Fall, 2009 Description: Lecture 2: Formal Systems and Languages MU! CS200: Computer Science University of Virginia Computer Science David Evans http:/www.cs.virginia.edu/evans Menu Questions from Lecture 1 Notes Course Expectations Formal Systems MIU-system Langua... Date Added: 2009-06-03 16:51:56 |
| PoMTechnho07.doc Path: UVA >> POM >> 1 Fall, 2009 Description: Practice of Medicine: Shared Meaning - Techniques as Tools 13 and 20 August 2007 Christine M. Peterson, M.D. Objectives: After attending these two sessions and completing the associated reading 1. Students will be able to name the two purposes of th... Date Added: 2009-06-03 16:52:16 |
| readme.txt Path: BU >> G >> 2 Fall, 2009 Description: a) in each run, divide 22us to 10 time bins b) in each time bin, get mean value from amp distribution <amp>_bin_i = mean value or mean from gaussian fit c) in each time bin, make ratio of <amp>_bin_i_tile to <amp>_bin_i_Ref = ratio_bin_i_ref c... Date Added: 2009-06-03 16:53:36 |
| appendices.doc Path: CSU Sacramento >> IMET >> 5 Fall, 2009 Description: Appendix A Grammar Quiz Results Appendix B Survey Results Survey Results Q1: Do you feel that going through the Grammar WebQuest prepared you to better understand grammar and written conventions? Q2: I feel comfortable using the computer application... Date Added: 2009-06-03 16:56:31 |
| 31851.ppt Path: Pittsburgh >> SUPER >> 7 Fall, 2009 Description: Themes that Cut Across Disciplines: Quality Control and Research Methods Faina Linkov, PhD Research Assistant Professor University of Pittsburgh Cancer Institute The journey of quality control in the Supercourse The journey of a thousand miles start... Date Added: 2009-06-03 16:57:01 |
| HW.2.doc Path: Georgia Tech >> AE >> 3021 Fall, 2008 Description: AE 3021 Homework Set #2 Due September 29, 2005 Do problems 2, 3, 4, 5, 6, 8 in Anderson\'s Fundamentals of Aerodynamics (Chapter 11, pages 636-637). Ans: 11.2 11.3 11.4 11.5 11.6 11.7 11.8 0.938 a) -0.663 b) -0.7063 c) -0.7763 0.74 0.805 -1.53 Yo... Date Added: 2009-06-03 16:58:54 |
| 2_172.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper #: 143 Title: Cooperating reliable Multi-cast protocol with Local recovery Problems addressed: The CRMP has been developed to support real-time multi-cast data on the internet on the MBONE networks that work above the IP layer. This paper pre... Date Added: 2009-06-03 16:58:56 |
| 2_172.txt Path: Georgia Tech >> CS >> 2004 Fall, 2009 Description: Paper #: 143 Title: Cooperating reliable Multi-cast protocol with Local recovery Problems addressed: The CRMP has been developed to support real-time multi-cast data on the internet on the MBONE networks that work above the IP layer. This paper pre... Date Added: 2009-06-03 16:58:56 |
| 2021.ppt Path: Pittsburgh >> SUPER >> 7 Fall, 2009 Description: Harmonization of Standards for Assistive Technology (AT) Rory A. Cooper, Ph.D. Departments of Rehabilitation Science & Technology, and Bioengineering University of Pittsburgh Division of Physical Medicine and Rehabilitation UPMC Health System Human E... Date Added: 2009-06-03 16:59:42 |
| Quiz5.doc Path: Berkeley >> CS >> 150 Fall, 1996 Description: University of California at Berkeley College of Engineering Department of Electrical Engineering and Computer Science EECS 150 Spring 2001 R. H. Katz Homework Quiz # 5 (2 March) Name: _ Consider a D-type storage element implemented in five different... Date Added: 2009-06-03 17:03:09 |
| UAV-0-stdtlm20040108_154501.txt Path: Santa Clara >> COEN >> 194 Fall, 2009 Description: 15:45:1 0.000000E 0.000000N 0 0 0 0, 0, 0, 0 0 0 0 0 0 0 15:45:1 76.168166W 39.466666N 128 0 0 0, 0, 0, 0 0 133 580 576 7 0 15:45:1 76.168166W 39.466666N 128 0 0 0, 0, 0, 0 0 133 580 576 7 0 15:45:1 76.168166W 39.466666N 128 0 0 0, 0, 0, 0 0 ... Date Added: 2009-06-03 17:04:12 |
| 050196.TXT Path: UPenn >> COMM >> 575 Fall, 2009 Description: Sheet1 Unofficial Summary of the Rush Limbaugh Show for Wednesday, May 1, 1996 by John Switzer This unofficial summary is copyright (c) 1996 by John Switzer (jswitzer@limbaugh.com). All Rights Reserved. These summaries are distributed on CompuServe ... Date Added: 2009-06-03 17:04:28 |
| King_t4_SlickSampleAnalysis.ppt Path: East Los Angeles College >> NOC >> 0802 Fall, 2009 Description: Analysis of Naturally Forming Slicks from the Black Sea in the Ukraine - using Langmuir isotherms and ellipsometry Slick Collection From Katsivelli near Sevastapol in the Ukraine From the 3rd to 6th October 2007 From over the side of... Date Added: 2009-06-03 17:06:42 |
| 2008-222Objectives-Weeks78.ppt Path: UMBC >> COSC >> 222 Fall, 2009 Description: Week 7 Stacks, Queues, Linked Lists Objectives: Define Abstract Data Type (ADT) and Interface. Specify the functions of the Stack and Queue ADTs. Give examples of stacks and queues in computer systems. Solve problems using stacks. Describe how... Date Added: 2009-06-03 17:07:26 |
| CS109Obj-Weeks4to6-2008.ppt Path: UMBC >> COSC >> 109 Fall, 2009 Description: Lecture Objectives - Week 4 Discuss how the shell treats the special characters: $, \\, *, ?, `, \"., `, ;, `, |, <, >, <space>, <CR> Decode the shell command line. Use shell variables. String commands together to make complex commands. Disc... Date Added: 2009-06-03 17:07:28 |
| Outline-files.txt Path: UCF >> COMS >> 641 Fall, 2009 Description: CS 641 Lecture -*- Outline -*- meeting 1 * state-transformers * variables * reasoning ... Date Added: 2009-06-03 19:24:13 |
| 14NovGuide.doc Path: Minnesota >> PHELP >> 008 Fall, 2009 Description: HIST 3381 Fall 2005 READING GUIDE FOR -MONDAY, 14 NOVEMBER - Mae Ngai, \"The Architecture of Race in American Immigration Law: A Reexamination of the Immigration Act of 1924,\" Journal of American History 86, no. 1 (1999): 6792. Note: Please re... Date Added: 2009-06-03 19:32:23 |
| MATE2411_T6.ppt Path: Allan Hancock College >> ME >> 211 Fall, 2009 Description: MATE 2411 - Tutorial Dr. Hong Yang Room 2.18 email: hyang@mech.uwa.edu.au Phone: 6488 3064 Wednesday: Thursday: 1:00 1:45 pm 10:00 10:45 am 1:00 1:45 pm MATE 2411 - Tutorial 6. Fracture Ductile - extensive plastic deformation in the vicinity of... Date Added: 2009-06-03 19:35:07 |
| MATE2411_T6.ppt Path: Allan Hancock College >> ME >> 100 Fall, 2009 Description: MATE 2411 - Tutorial Dr. Hong Yang Room 2.18 email: hyang@mech.uwa.edu.au Phone: 6488 3064 Wednesday: Thursday: 1:00 1:45 pm 10:00 10:45 am 1:00 1:45 pm MATE 2411 - Tutorial 6. Fracture Ductile - extensive plastic deformation in the vicinity of... Date Added: 2009-06-03 19:35:22 |
| General_Staff_Advertising_Template.doc Path: Allan Hancock College >> HR >> 17990 Fall, 2009 Description: GENERAL STAFF ADVERTISING TEMPLATE [TITLE] [SCHOOL/ADMIN DEPARTMENT] [Full time/Part time] [Fixed Term/Ongoing appointment] Closing Date: [.] [Blurb about School if required] [TEXT/ROLE STATEMENT] We are seeking a person with: [ ] [ ] Contact... Date Added: 2009-06-03 19:39:06 |
| lect39.ppt Path: ECCD >> CHEM >> 1000 Fall, 2009 Description: Lecture 39 Electrochemistry III Review Shorthand cell notation Reduction potentials Standard cell potential Go = -nFEcello Most cells are not at standard conditions! Qualitatively - use Le Chatelier\'s principle e.g. 2 Al + 3 Mn+2 h 2 Al+3 + 3 Mn ... Date Added: 2009-06-03 19:49:16 |
| ch02.ppt Path: MO Valley >> CS >> 170 Fall, 2009 Description: A First Book of ANSI C Fourth Edition Chapter 2 Getting Started in C Programming Objectives Introduction to C Programming Programming Style Data Types Arithmetic Operations A First Book of ANSI C, Fourth Edition 2 Objectives (continued) Var... Date Added: 2009-06-03 19:51:52 |
| EuropeClimate.ppt Path: McGill >> ATOC >> 530 Fall, 2009 Description: Is the Gulf Stream responsible for Europe\'s mild winters? By R. Seager et Al . Q.J.R.Meteorol.Soc. (2002), 128 th Presenter: Rabah Aider , November, 19 2006 Summary . Ocean heat transport ( O.H.T) has a minor effect on the difference between ... Date Added: 2009-06-03 19:52:40 |
| grades1-2005.txt Path: McGill >> CS >> 644 Fall, 2009 Description: (columns are last 3 digits of ID, q1,q2,q3,q4 and total/100) 086 25 20 6 18 69 091 25 22 21 11 79 126 25 26 13 14 78 148 25 23 10 18 76 219 24 22 13 8 67 250 20 25 10 13 68 260 18 10 10 13 51 295 25 22 13 11 71 322 20 22 13 0 55 551 5 10 12 6 33 61... Date Added: 2009-06-03 19:53:21 |
| 08_14_15.html.ppt Path: Columbia >> C >> 3045 Fall, 2009 Description: 8.14 Sulfonate Esters as Substrates in Nucleophilic Substitution Leaving Groups we have seen numerous examples of nucleophilic substitution in which X in RX is a halogen halogen is not the only possible leaving group though Other RX compounds O ROS... Date Added: 2009-06-03 19:55:06 |
| makemodel.doc Path: East Los Angeles College >> KU >> 12492 Fall, 2009 Description: Car producers The following table lists information about cars it lists the Model name of cars along with who manufactures it (the Make). Make Peugeot Renault Peugeot Volvo Peugeot BMW BMW BMW BMW Mazda Mazda Peugeot Peugeot Volvo Volvo Audi Audi Ro... Date Added: 2009-06-03 19:55:35 |
| t-night1-css.txt Path: East Los Angeles College >> AJBCS >> 124 Fall, 2009 Description: SYNOPSIS { display: block} TITLE { display: block; font-weight: bold; font-size:large; text-align:center } ACT {display: block} SCENE {display: block}... Date Added: 2009-06-03 19:57:24 |
| t-night1-css.txt Path: East Los Angeles College >> LECTURE >> 124 Fall, 2009 Description: SYNOPSIS { display: block} TITLE { display: block; font-weight: bold; font-size:large; text-align:center } ACT {display: block} SCENE {display: block}... Date Added: 2009-06-03 19:57:24 |
| ppt19.ppt Path: Laurentian >> MGT >> 200603 Fall, 2009 Description: INTERMEDIATE ACCOUNTING Seventh Canadian Edition KIESO, WEYGANDT, WARFIELD, YOUNG, WIECEK Prepared by: Gabriela H. Schneider, CMA Northern Alberta Institute of Technology CHAPTER 19 Income Taxes Learning Objectives 1. Explain the difference betwe... Date Added: 2009-06-03 20:00:56 |
| Ch04.ppt Path: Laurentian >> MGT >> 2100 Fall, 2009 Description: CHAPTER 4 Accrual Accounting Concepts Time Period Assumption Divides the economic life of a business into artificial time periods Interim period (month, quarter) Year (fiscal, calendar) WHY? To provide immediate feedback on how the business ... Date Added: 2009-06-03 20:01:07 |
| ch03.ppt Path: Laurentian >> CPSC >> 200303 Fall, 2009 Description: Chapter 3: Efficiency of Algorithms Quality attributes for algorithms Correctness: Maintainability It should do things right No flaws in design of the algorithm If we discover it is incorrect, efforts for modifying and/or extending it mus... Date Added: 2009-06-03 20:02:45 |
| 3680Lecture24.ppt Path: Laurentian >> LECTURE >> 200801 Fall, 2009 Description: Model of Memory Atkinson & Shifrin ATTENTION Sensory Signals Sensory Memory Short-Term Memory Long-Term Memory RETRIEVAL REHEARSAL Long-term Memory How long is it? - persists indefinitely (from seconds to decades) - persists without active rehears... Date Added: 2009-06-03 20:04:09 |
| 3680Lecture24.ppt Path: Laurentian >> NEUR >> 200801 Fall, 2009 Description: Model of Memory Atkinson & Shifrin ATTENTION Sensory Signals Sensory Memory Short-Term Memory Long-Term Memory RETRIEVAL REHEARSAL Long-term Memory How long is it? - persists indefinitely (from seconds to decades) - persists without active rehears... Date Added: 2009-06-03 20:04:09 |
| clustering1.ppt Path: Virgin Islands >> SENG >> 474 Fall, 2009 Description: What is Cluster Analysis? Finding groups of objects such that the objects in a group will be similar (or related) to one another and different from (or unrelated to) the objects in other groups Intracluster distances are minimized Intercluster di... Date Added: 2009-06-03 20:06:40 |
| pbl1.doc Path: Virgin Islands >> CSC >> 100 Fall, 2009 Description: Student # _ Problem Based Learning Exercise 1: Calculations Determining the correct course percentage. Due: Wednesday January 9th, 2008, in class PBL Details: This is your first problem based learning exercise of the term. The PBL\'s are opportunitie... Date Added: 2009-06-03 20:07:05 |
| ch07lect1.ppt Path: East Los Angeles College >> CS >> 223 Fall, 2009 Description: System Design: addressing design goals Book: chapter 7 Overview System Design I (previous lecture) 0. Overview of System Design 1. Design Goals 2. Subsystem Decomposition System Design II 3. Concurrency 4. Hardware/Software Mapping 5. Persistent Da... Date Added: 2009-06-03 20:08:34 |
| Introduction.ppt Path: East Los Angeles College >> CS >> 411 Fall, 2009 Description: CS 411: Dynamic Web-Based Systems Dr. Alexandra I. Cristea http:/www.dcs.warwick.ac.uk/~acristea/ Lecturers Alexandra I. Cristea Guest lecturers Seminar lecturers 2 Schedule Usual: Wed 10-11am, CS104 Thu 4-6pm, CS104 Exceptions: Others: T... Date Added: 2009-06-03 20:08:41 |
| Applic-for-Review-Form_seng310_2003.doc Path: Virgin Islands >> SENG >> 310 Fall, 2009 Description: UNIVERSITY OF VICTORIA OFFICE OF THE VICE-PRESIDENT, RESEARCH HUMAN RESEARCH ETHICS COMMITTEE Instructions: Application for Ethical Review of Human Research 1. Use the Ethics Applications Guidelines to complete this form. The Guidelines and all ot... Date Added: 2009-06-03 20:09:31 |
| Chap19sm.doc Path: W. Alabama >> AFM >> 372 Fall, 2009 Description: Chapter 19: Dividends and Other Payouts 19.1 February 16: Declaration date the board of directors declares a dividend payment that will be made on March 14. February 24: Exdividend date the shares trade ex dividend on and after this date. Sellers b... Date Added: 2009-06-03 20:11:34 |
| Introduction.ppt Path: W. Alabama >> CS >> 858 Fall, 2009 Description: CS 858 Hot Topics in Computer and Communications Security Winter 2009 Introduction Overview Goals Organization Survey of Topics Urs Hengartner CS 858 HoTCCS 2 Goals Research wise Introduce current research problems in computer ... Date Added: 2009-06-03 20:12:36 |
| final_2004_figures.ppt Path: W. Alabama >> EARTH >> 437 Fall, 2009 Description: Question 1-c Question 1-e Question 1-d N S Question 1-f heated zone Question 1-i W = 2Z Z W max Point (r, ) B r us, adi angle, r r A min pi R Conditions for the Problem: max/ min = 1.5 pi = 0.8 min Question 4 h A H B 400 m sea... Date Added: 2009-06-03 20:13:04 |
| ex16_3.txt Path: UPenn >> VHM >> 802 Fall, 2009 Description: Solution file for exercise 16.6.3 in RC - Data: measurements of serum calcium levels in 20 dogs over 3 days after injection of parathyroid extract, in one of 2 doses and one of 2 preparations, totalling 4 treatment combinations. Notation: y_i = s... Date Added: 2009-06-03 20:15:05 |
| Cholinergic.ppt Path: W. Alabama >> CHEM >> 434 Fall, 2009 Description: Ne rv A cholinergic synapse ef ib e r( Choline ax on Na+, Cl) Action potential Acetyl-CoA Acetyl-Choline Ca + + Ca + + Acetyl-Choline A cholinergic synapse (2): Rapid transmitter inactivation by cholinesterase Choline Action potential Acetyl... Date Added: 2009-06-03 20:16:08 |
| mrnotes1.doc Path: East Los Angeles College >> PX >> 119 Fall, 2009 Description: University of Warwick, Department of Physics PX 119 Matter: some associated notes Introduction to Gases Liquids and Solids This course is principally concerned with matter made up from atoms (and molecules). At time of writing most of the confirmed ... Date Added: 2009-06-03 20:16:22 |
| wave_particle.ppt Path: W. Alabama >> CHEM >> 120 Fall, 2009 Description: The Double Slit Experiment Particles vs Waves Particles Waves Light as a Wave Interference of Light Waves Electrons as Waves Davison and Germer (1927) Interference of Electron Waves Light and Electrons as Particles and Waves ~1900 Light is a ... Date Added: 2009-06-03 20:16:50 |
| H35_o.sas.txt Path: McGill >> ENQ >> 10194 Fall, 2009 Description: FILE PUT @ 1 AM58_RNO Z06. @ ... Date Added: 2009-06-03 20:17:05 |
| reels-body-bof.txt Path: Université du Québec à Montréal >> INFO >> 5170 Fall, 2009 Description: procedure getCoefficient( Reel r, int i, Reel r1, Reel r2 ) { int expMinR1 = max( 0, i-nbChiffres(r2)+1 ); int expMaxR1 = min( i, nbChiffres(r1)-1 ); assert( expMinR1 <= expMaxR1, \"expMinR1 doit etre <= expMaxR1?\" ); r^.chiffr... Date Added: 2009-06-03 20:17:49 |
| hs12_2.txt Path: UPenn >> VHM >> 802 Fall, 2009 Description: Solution file for additional exercise 12.2 - (see additional exercise 12.1 for discussion of model, design and notation) MTB > WOpen \"C:\\DATA.AVC\\teaching\\vhm802\9P\\hs12_2.dat\"; SUBC> FType; SUBC> Text; SUBC> VNames; SUBC> None; SUBC> ... Date Added: 2009-06-03 20:18:21 |
| lecture4.ppt Path: W. Alabama >> BIOL >> 240 Fall, 2009 Description: Lecture 4 4.10 Bacterial Cell Surface Structures 4.11 Cell Inclusions 4.12 Gas Vesicles 4.13 Endospores 4.14 Flagella and Motility 4.15 Gliding Motility 4.16 Cell Motion as a Beavioral Response: Chemotaxis and Phototaxis the flagellum: filame... Date Added: 2009-06-03 20:18:50 |
| 1976rcs1-555.doc Path: Neumont >> EN >> 1974 Fall, 2009 Description: Supreme Court of Canada Burton Parsons Chemicals, Inc. v. Hewlett-Packard (Canada) Ltd., [1976] 1 S.C.R. 555 Date: 1974-12-19 Burton Parsons Chemicals, Inc. and Burton Parsons and Company of Canada, Limited (Plaintiffs) Appellants; and Hewlett-Packar... Date Added: 2009-06-03 20:20:00 |
| 1976rcs1-555.doc Path: Neumont >> CSC >> 1974 Fall, 2009 Description: Supreme Court of Canada Burton Parsons Chemicals, Inc. v. Hewlett-Packard (Canada) Ltd., [1976] 1 S.C.R. 555 Date: 1974-12-19 Burton Parsons Chemicals, Inc. and Burton Parsons and Company of Canada, Limited (Plaintiffs) Appellants; and Hewlett-Packar... Date Added: 2009-06-03 20:20:00 |
| abstract.txt Path: Allan Hancock College >> CCP >> 062 Fall, 2009 Description: Castro062 -+ No -+ Poster -+ Physics of Semiconductors -+ Calculation of the ralaxation times spectrum in chalcogenide glasses -+ A new algorithm for the calculation of the relaxation time distribution function (RTDF) in chalcogenide glasses is propo... Date Added: 2009-06-03 20:20:23 |
| BUS435E01.TXT Path: Sveriges lantbruksuniversitet >> BUS >> 20013 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: BUS 435-3 E01 LOCATION: SFU TITLE: MGMT OF INTL FIRMS SECTION TYPE: SEM SEMESTER: 2001-3 ENROL: 22 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown s... Date Added: 2009-06-03 20:22:42 |
| mixturemodel.txt Path: Toledo >> STA >> 410 Fall, 2009 Description: # Annotated R session to illustrate fitting a mixture of 2 normals, # following Chapter 18 of the text > library(MASS) > data(geyser) > attach(geyser) # first we plot the data and a density estimate > truehist(waiting,xlim=c(35,115),ymax=0.04,h=5... Date Added: 2009-06-03 20:22:52 |
| salesAR1.txt Path: W. Alabama >> STAT >> 443 Fall, 2009 Description: # * Sales Example (Ch.6 ) * mypath <-\"C:\\MyDocuments\\\"; data.file <- \"sales.y\"; sales.y <-scan(paste(mypath,data.file,sep=\"); sales.ts <-ts(scan(paste(mypath,data.file,sep=\"); sales1.t <- c(1:length(sales.ts) # * Plot * ts.plot(sales.ts,xla... Date Added: 2009-06-03 20:22:59 |
| 4210-02.ppt Path: Laurentian >> MGT >> 200401 Fall, 2009 Description: ADVERTISING and Promotions Management May 16, 2009 Advertising 1 The Importance of Positioning Market Analysis Positioning Strategy Product Price Placement Promotion Competitor Analysis May 16, 2009 Advertising 2 May 16, 2009 Advertising 3 ... Date Added: 2009-06-03 20:24:08 |
| mirrorDiagonal.txt Path: UWO >> CS >> 1026 Fall, 2009 Description: /* * Method to do diagonal mirroring * bottom left to top right */ public void mirrorDiagonalBottomLeft() { Pixel leftPixel = null; Pixel rightPixel = null; / loop through the columns for (int x = 0; x < this.getWidth(); x+) { / lo... Date Added: 2009-06-03 20:25:14 |
| cs026_4.ppt Path: UWO >> CS >> 026 Fall, 2009 Description: Introduction to Programming Notes adapted from Introduction to Computing and Programming with Java: A Multimedia Approach by M. Guzdial and B. Ericson, and instructor materials prepared by B. Ericson. Learning Goals Class and object methods Creat... Date Added: 2009-06-03 20:25:15 |
| Appaduri2001.doc Path: UWO >> GEOG >> 9322 Fall, 2009 Description: Grassroots Globalization and the Research Imagination Arjun Appadurai G Anxieties of t h e Global lobalization is certainly a source of anxiety in the U.S. academic world. And the sources of this anxiety are many: Social scientists (especially eco... Date Added: 2009-06-03 20:26:11 |
| cs641_19.ppt Path: UWO >> CS >> 641 Fall, 2009 Description: Technical Issues: Artificial Intelligence Technical Issues: Artificial Intelligence Artificial intelligence can mean a variety of different things in different contexts. By purist definitions, a game would possess artificial intelligenc... Date Added: 2009-06-03 20:26:55 |
| accab2007379.txt Path: Allan Hancock College >> ACCAB >> 2007379 Fall, 2009 Description: 2004-2005-2006-2007 THE PARLIAMENT OF THE COMMONWEALTH OF AUSTRALIA SENATE AUSTRALIAN CRIME COMMISSION AMENDMENT BILL 2007 EXPLANATORY MEMORANDUM (Circulated by a... Date Added: 2009-06-03 20:27:24 |
| ENGL336D01.TXT Path: Sveriges lantbruksuniversitet >> ENGL >> 19982 Fall, 2009 Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: ENGL 336-4 D01 TITLE: LIT OF TRANSITION SEMESTER: 1998-2 LOCATION: SFU SECTION TYPE: LEC ENROL: 12 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown ... Date Added: 2009-06-03 20:28:12 |
| quizf03closed.doc Path: Virgin Islands >> LAW >> 319 Fall, 2009 Description: UNIVERSITY OF VICTORIA FACULTY OF LAW LAW 319 - TRUSTS FALL 2003 MID-TERM TEST CLOSED BOOK PART Professor Gillen DATE: TIME: PLACE: Wednesday, October 29, 2003 3:30 p.m. - 3:50 p.m. Room 158 This exam consists of 2 pages. Please check to be sure th... Date Added: 2009-06-03 20:28:23 |
| ititwtb2008548.txt Path: Allan Hancock College >> ITITWTB >> 2008548 Fall, 2009 Description: 2008 The Parliament of the Commonwealth of Australia HOUSE OF REPRESENTATIVES Presented and read a first time Income Tax (Managed Investment Trust Withholding Tax) Bill 2008 No. , 2008 (Treasury) A Bill for an Act to impose inc... Date Added: 2009-06-03 20:31:18 |
| v04-n083.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca on behalf of Cdn-Firearms Digest [owner-cdn-firearms-digest@sfn.saskatoon.sk.ca] Sent: Tuesday, 04 September, 2001 20:15 To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Di... Date Added: 2009-06-03 20:31:22 |
| v04-n083.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca on behalf of Cdn-Firearms Digest [owner-cdn-firearms-digest@sfn.saskatoon.sk.ca] Sent: Tuesday, 04 September, 2001 20:15 To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Di... Date Added: 2009-06-03 20:31:22 |
| v02n501.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From - Mon Jul 20 20:30:44 1998 Received: from broadway.sfn.saskatoon.sk.ca (majordomo@broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id HAA07325; Sun, 19 Jul 1998 07:57:20 -0600 (CST) Received: (from maj... Date Added: 2009-06-03 20:32:02 |
| v02n501.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From - Mon Jul 20 20:30:44 1998 Received: from broadway.sfn.saskatoon.sk.ca (majordomo@broadway.sfn.saskatoon.sk.ca [198.169.128.1]) by skatter.USask.Ca (8.8.5/8.8.5) with ESMTP id HAA07325; Sun, 19 Jul 1998 07:57:20 -0600 (CST) Received: (from maj... Date Added: 2009-06-03 20:32:02 |
| TranscriplationCh17.doc Path: Laurentian >> BIOL >> 1010 Fall, 2009 Description: Campbell ... Date Added: 2009-06-03 20:32:52 |
| v03-n885.txt Path: Air Force Academy >> STA >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca on behalf of Cdn-Firearms Digest [owner-cdn-firearms-digest@sfn.saskatoon.sk.ca] Sent: Friday, 06 July, 2001 21:06 To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Digest V... Date Added: 2009-06-03 20:33:34 |
| civl5258_2007_information.doc Path: Allan Hancock College >> CIVL >> 5258 Fall, 2009 Description: School of Civil Engineering CIVL5262 Structural Steel Connections: Semester 1, 2007 Unit of Study Information Sheet General Information Course Coordinator & Lecturer: Additional Lecturer: Lectures: Course web site: Course Context This course aims to ... Date Added: 2009-06-03 20:37:42 |
| FOBCT306Tut_Lab1.doc Path: Allan Hancock College >> COIS >> 11011 Fall, 2009 Description: #8AG#FOBCT306Tut_Lab1.doc#]#t#UI\'_D#2!#KL+$ # tc?#9gD#.: 8#3\"+#vqwQwg#! :d{SN#znw{[U9N=#H!r#%!#5i#Td#W#%PBUOJW7/X2# AA#Z7#! D~lM@=#i#kX>#P- M# ~#a%qr~h86[f#QZ@C#rLDvTV#u!# ~[.rj|jO#55#2S#xBBWVDca1Y5 XkP\"?Sy<.pb$k#d*m#r| #_ta]#Uy#d bw A{X#... Date Added: 2009-06-03 20:38:13 |
| pilnr19991999n267592.txt Path: Allan Hancock College >> PILNR >> 19991999 Fall, 2009 Description: PRIMARY INDUSTRIES (EXCISE) LEVIES (MACADAMIA NUT) REGULATIONS 1999 1999 NO. 267 PRIMARY INDUSTRIES (EXCISE) LEVIES (MACADAMIA NUT) REGULATIONS 1999 1999 NO. 267 - TABLE OF PROVISIONS 1. Name of Regulations 2. Commencement 3. Definitions... Date Added: 2009-06-03 20:38:53 |
| ceab12000350_3.txt Path: Allan Hancock College >> CEAB >> 12000350 Fall, 2009 Description: _ COMMONWEALTH ELECTORAL AMENDMENT BILL (NO. 1) 2000 1998-1999-2000 THE PARLIAMENT OF THE COMMONWEALTH OF AUSTRALIA SENATE COMMONWEALTH ELECTORAL A... Date Added: 2009-06-03 20:39:14 |
| tpab2002284.txt Path: Allan Hancock College >> TPAB >> 2002284 Fall, 2009 Description: Western Australia Tree Plantation Agreements Bill 2002 CONTENTS Part 1 - Preliminary 1. Short title 2 2. Commencement... Date Added: 2009-06-03 20:39:58 |
| Tutorial-1-Fe-C.doc Path: Allan Hancock College >> FEM >> 301 Fall, 2009 Description: School of Mechanical Engineering Fundamentals of Engineering Materials Tutorial 1: Fe-C System 1. 2. Compute the mass fractions of proeutectoid ferrite and pearlite that form in an iron - carbon alloy containing 0.35 wt% C. Using the isothermal trans... Date Added: 2009-06-03 20:40:27 |
| week8.doc Path: Allan Hancock College >> ARTS >> 2034 Fall, 2009 Description: The Sweep of Economic Growth 1790 1793 1810 1812 1813 1816 1823 1824 1825 1833 1834 First mill opens in Rhode Island Cotton gin invented First steamboat on the Ohio River First shoe factory opens in Massachusetts First cotton textile factory in Walth... Date Added: 2009-06-03 20:41:16 |
| dar200312003n311405.txt Path: Allan Hancock College >> DAR >> 200312003 Fall, 2009 Description: DEFENCE (INQUIRY) AMENDMENT REGULATIONS 2003 (NO. 1) 2003 NO. 311 DEFENCE (INQUIRY) AMENDMENT REGULATIONS 2003 (NO. 1) 2003 NO. 311 - TABLE OF PROVISIONS 1. Name of Regulations 2. Commencement 3. Amendment of Defence (Inquiry) Regulation... Date Added: 2009-06-03 20:44:43 |
| laab2004264.txt Path: Allan Hancock College >> LAAB >> 2004264 Fall, 2009 Description: Land Acquisition Amendment Bill 2004 EXPLANATORY NOTES GENERAL OUTLINE Short Title The short title of the Bill is the Land Acquisition Amendment Act 2004. Objectives The primary policy objectives of... Date Added: 2009-06-03 20:44:51 |
| 032050pathoT13S.doc Path: Allan Hancock College >> NUR >> 2040 Fall, 2009 Description: T13.1 NUR2050 MEDICAL SURGICAL NURSING 4, PATHO TUTE, WEEK 13 REPRODUCTIVE PATHOPHYSIOLOGY 1. What is the clinical significance of the disorders apparent in these two sections through the prostate gland? 2. What is this organ, what is wrong with it... Date Added: 2009-06-03 20:44:56 |
| pilaccar20065n194o2006775.txt Path: Allan Hancock College >> PILACCAR >> 20065 Fall, 2009 Description: [pic] Primary Industries Levies and Charges Collection Amendment Regulations 2006 (No. 5)1 Select Legislative Instrument 2006 No. 194 I, PHILIP MICHAEL JEFFERY, Governor-General of the Commonwealth of Australia, acting with t... Date Added: 2009-06-03 20:45:26 |
| gna1966158.txt Path: Allan Hancock College >> GNA >> 1966158 Fall, 2009 Description: GEOGRAPHICAL NAMES ACT 1966 - As at 13 December 2007 - Act 13 of 1966 TABLE OF PROVISIONS TABLE OF PROVISIONS 1. Name of Act and commencement 2. Definitions 3. Geographical Names Board 4. Secretary and officers 5. Powers a... Date Added: 2009-06-03 20:47:00 |
| ioppab2002512.txt Path: Allan Hancock College >> IOPPAB >> 2002512 Fall, 2009 Description: IRON ORE PROCESSING (MINERALOGY PTY. LTD.) AGREEMENT BILL 2002 COMMITTEE NOTES *HQHUDO 2XWOLQH This Act ratifies the Iron Ore Processing (Mineralogy Pty. Ltd.) Agreement which was executed by the S... Date Added: 2009-06-03 20:47:28 |
| NervousSystemII.ppt Path: Allan Hancock College >> NSC >> 2180 Fall, 2009 Description: Nervous System II Objectives 1. Appreciate that specific area\'s of the cerebral cortex have specific functions (M p436) 1. Appreciate how sensory and motor information is `mapped\' onto the sensory and motor cortex (M p436-439) 1. Appreciate the role... Date Added: 2009-06-03 20:50:28 |
| test4.txt Path: Allan Hancock College >> COMP >> 2160 Fall, 2009 Description: insert 100insert 99insert 98insert 97insert 96insert 95insert 94insert 93insert 92insert 91insert 90insert 89insert 88insert 87insert 86insert 85insert 84insert 83insert 82insert 81insert 80insert 79insert 78insert 77insert 76insert 75insert 74insert... Date Added: 2009-06-03 20:51:58 |
| WeeklyOverviewSD1.doc Path: Allan Hancock College >> HIT >> 1051 Fall, 2009 Description: CHIT1051 Weekly Outline SD1. Weekly Outline: This is a DRAFT outline and subject to change during the semester. Week 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 Lecture Naming conventions Intro to subject Overview of analysis an... Date Added: 2009-06-03 20:52:15 |
| SD_presentation.ppt Path: Purdue >> ECE >> 477 Fall, 2008 Description: Team 3 (MIDI-phone) Humphrey\'s Treasure Chest Software Design Presentation Roy Scheck Tony Liechty Charles Lan Steve Kingsley Development Status Flow charts complete Analyzing DSP programming references Current step: Heart beat Small programs u... Date Added: 2009-06-03 20:53:27 |
| PS3_201_ans.doc Path: Cal Poly Pomona >> EC >> 201 Fall, 2009 Description: PS #3 Outlines of Suggested Answers 1) True or False: i. F; ii. T; iii. F; iv. F; v. F; vi. T Cal Poly Pomona, EC 201 Bruce Brown 2) a) %Px = -.50 (50% reduction); %QxD = +.33 (33% increase); Price Elasticity of Demand = .67 b) - Ordinary way of c... Date Added: 2009-06-03 20:53:30 |
| 03.ppt Path: FIU >> GLY >> 5826 Fall, 2008 Description: Ground Water Basics continued Soil Moisture Regimes Aridic arid climate, usually dry, irrigation required for crop production. Ustic-semiarid climate, rainfall during a growing season. Xeric-semiarid climate, Mediterranean climate, cool, mo... Date Added: 2009-06-03 20:55:31 |
| IE416-quiz-win03.doc Path: Cal Poly Pomona >> IE >> 416 Fall, 2009 Description: IE 416 Last name: Quiz First name: Date: 1-13-03 1- Did you have a chance to watch Video 1, which is Tape 1 on Chapters 1 to 3 and Tape 2 on Chapter 4? If not explain why. 2- Which version did you watch? Video from Reserve Lib . On Internet from ... Date Added: 2009-06-03 20:55:48 |
| asgn2.txt Path: UNC >> INLS >> 161 Fall, 2009 Description: Anne Bauers Assignment 3 Assignment description: Write a program that reads a first name and a last name from the user as two separate inputs and concatenates the first name and last name, separating them by a space. Display in a message dialog t... Date Added: 2009-06-03 20:55:53 |
| hnd11-2.doc Path: San Jose State >> EDIT >> 241 Fall, 2008 Description: Gender and Equity Issues Directions: Research gender and equity issues which impact teaching and learning with technology. Identify at least three gender/equity issues, which are impediments to students learning. How can you as a classroom teach... Date Added: 2009-06-03 20:56:05 |
| 5paragraphessay.doc Path: CSU Northridge >> TCB >> 69252 Fall, 2009 Description: The Five Paragraphs of a Basic Essay It is important to learn the components of each paragraph in the standard essay. EXPOSITORY Paragraph #1 This is your introduction. Begin with a good \"grabber.\" Restate the topic and define it. State ... Date Added: 2009-06-03 20:57:15 |
| protocol3.doc Path: CSU Northridge >> LL >> 656883 Fall, 2009 Description: BIO 572L Wednesday, 9/13/2006 Protocol 3: DNA Agarose Gel Electrophoresis 1. Equilibrate a water bath at about 50 oC. 1. Make 400 ml of 1 X TAE buffer by diluting 10 ml TAE with 490 ml deionized water. 2. Measure 50 ml of 1 X TAE buffer and pour it... Date Added: 2009-06-03 20:57:45 |
| enc1-05022008.doc Path: East Los Angeles College >> IEE >> 05022008 Fall, 2009 Description: IEE Interim Strategy Board Proposed Terms of Reference Primary purpose: To oversee the direction, monitor the performance and add value to the work of the Institute for Effective Education To provide input into the strategic plan, developed by ... Date Added: 2009-06-03 21:02:28 |
| Solutions.doc Path: East Los Angeles College >> U >> 0769008 Fall, 2009 Description: Robert Evans : U0769008 Submit by 18th April 2008, 5pm Modern Database Applications : XML Assignment Question 1 solution: <!DOCTYPE Emp [ <!ELEMENT Emp (ename, (children)*, skills)> <!ELEMENT ename (#PCDATA)> <!ELEMENT children (name, Birthday)... Date Added: 2009-06-03 21:06:17 |
| DSC01771.txt Path: East Los Angeles College >> PSY >> 223 Fall, 2009 Description: [WinPhoto] Version=1.5.1 [Global] Date=2005-08-25 Time=21:58:59 Camera=CYBERSHOT CameraManufacturer=SONY Description= Photographer=George Lovell Orientation=0 [FromJPEG] InputEquipmentModel=CYBERSHOT InputEquipmentManufacturer=SONY FNumber=2.8 Expo... Date Added: 2009-06-03 21:06:38 |
| 0912.txt Path: Virginia Tech >> CS >> 4804 Fall, 2003 Description: Sep 12, 2003 - - SAT problems - one of the first problems shown to be NP-complete - symbols, clauses, and CNF - most CSPs can be formulated as SAT! How? - Examples of CNF SAT problems - (x1 OR x2) AND (x2 OR x3) ... Date Added: 2009-06-03 21:07:04 |
| session_5.doc Path: East Los Angeles College >> ME >> 917 Fall, 2009 Description: Community Gynaecology and Reproductive Health Care / Sexual and Reproductive Health Care Reproductive Health in the Community Module 2 Reading for Session 5 NCC-WCH. Fertility assessment and treatment for people with fertility problems. London: RCOG,... Date Added: 2009-06-03 21:08:05 |
| prog_july_07.doc Path: East Los Angeles College >> ME >> 932 Fall, 2009 Description: Hypertension & Nephropathy Module Room B053, Medical School Building, Gibbet Hill Campus Timetable DAY THREE Tuesday 3rd July 2007 09301100 11001130 11301300 13001400 14001445 14451500 15001700 Trial evidence for BP lowering (MRC to ASCOT) Break T... Date Added: 2009-06-03 21:08:09 |
| BE211_05-06.doc Path: East Los Angeles College >> BE >> 211 Fall, 2009 Description: BE211 Property Law s School of the Environment Semester 2 Examinations 2006 BE211/BF211 PROPERTY LAW Time Allowed : THREE hours. Answer FOUR questions. Each question carries equal marks. Wednesday 31 May 2006, 15:00 17:00 hours Page 1 of 2 BE... Date Added: 2009-06-03 21:08:56 |
| DSCN4914.txt Path: East Los Angeles College >> PSY >> 223 Fall, 2009 Description: [WinPhoto] Version=1.5.1 [Global] Date=2005-05-12 Time=17:16:31 Camera=E5700 CameraManufacturer=NIKON [FromJPEG] InputEquipmentModel=E5700 InputEquipmentManufacturer=NIKON Software=E5700v1.1 FNumber=7.4 ExposureTime=0.00694444444444444 DateTimeOrig... Date Added: 2009-06-03 21:09:06 |
| CE00819.Geometry.2DAffineTransformations.ppt Path: East Los Angeles College >> CE >> 00819 Fall, 2009 Description: 1 2 Dimensional Affine Transformations Including Homogeneous Coordinates and Vectors PJWainwright: CE00819.Geometry.2DCentralAffineTransformations 1 What is an Affine Transformation An affine transformation transforms geometrical objects such ... Date Added: 2009-06-03 21:09:51 |
| Ramesh.ppt Path: ASU >> CSE >> 520 Fall, 2008 Description: Enforcing Performance Isolation Across Virtual Machines in Xen Authors: Diwakar Gupta, Ludmila Cherkasova, Rob Gardner, and Amin Vahdat Middleware 2006, LNCS 4290, pp. 342-362, 2006 Presenter: Venkatraghavan Ramesh Agenda Motivation XenMo... Date Added: 2009-06-03 21:12:07 |
| lec15-Ch3-ILP-Limits.ppt Path: ASU >> CSE >> 420 Fall, 2008 Description: CSE 420/598 Computer Architecture Lec 15 Chapter 3 - ILP - Limits Sandeep K. S. Gupta School of Computing and Informatics Arizona State University Based on Slides by David Patterson Midterm Feedback? Take home part ? 10% of the take-home midter... Date Added: 2009-06-03 21:12:17 |
| C04e01dt1.txt Path: Wisconsin >> PSY >> 710 Fall, 2009 Description: 1 3 3 18 0 50 51876 2 5 6 3 0 26 54511 3 13 3 2 0 50 53425 4 17 8 17 1 34 61863 5 20 9 11 0 41 52926 6 33 6 6 1 37 47034 7 35 16 38 1 48 66432 8 36 10 48 1 56 61100 9 38 2 9 1 19 41934 10 40 5 22 1 29 47454 ... Date Added: 2009-06-03 21:12:26 |
| mth5098resume.doc Path: Penn State >> MTH >> 5098 Fall, 2009 Description: Campus Address 825 Beaver Hall University, PA 16802 (814) 862-4407 Permanent Address 59 Rockwood Avenue Oil City, PA 16301 (814) 676-2336 Matthew T. Heath mth5098@psu.edu OBJECTIVE EDUCATION To obtain an aerospace engineering internship or co-op ... Date Added: 2009-06-03 21:13:39 |
| lecture26.PPT Path: Toledo >> MIE >> 240 Fall, 2009 Description: Lecture 26: Anthropometry Readings: Chapanis (1996), chapter 5, pages 158-170. 09/10/99 Goals l l Introduce basic information about size and shape that is useful to designers in designing products, workspaces, and workstations. Show how informati... Date Added: 2009-06-03 21:13:41 |
| 3TaxaNoMCK81Invariants.txt Path: SHSU >> LDG >> 005 Fall, 2009 Description: ring rQ = 0,(q1,q2,q3,q4,q5,q6,q7,q8,q9,q10,q11,q12,q13,q14,q15,q16),dp; ideal Invariants = q1*q8*q15-q3*q5*q16, q4*q6*q15-q2*q7*q16, q7*q12*q14-q8*q10*q15, q1*q12*q14-q2*q9*q16, q5*q11*q14-q6*q9*q15, q4*q11*q14-q3*q10*q16, q6*q12*q13-q5*q10*q16, q... Date Added: 2009-06-03 21:16:39 |
| test1.doc Path: University of Hawaii - Hilo >> PHYS >> 151 Fall, 2009 Description: PHYS 151 Do all problems you feel confident with first, then go back to the ones you think you need more time with (i.e. don\'t get stuck in one problem forever!) Have fun! and show me your Best work! 26 points to be added to the take home exam part ... Date Added: 2009-06-03 21:16:50 |
| ch3.ppt Path: BU >> CS >> 101 Fall, 2009 Description: Chapter 3: Computer Hardware Components: CPU, Memory, and I/O What is the typical configuration of a computer sold today? The Computer Continuum 1-1 Computer Hardware Components s In this chapter: How did the computer become known as the stored-... Date Added: 2009-06-03 21:17:15 |
| memory1-spring08.ppt Path: Duke >> CPS >> 110 Fall, 2009 Description: CPS110: Intro to memory February 14, 2008 Landon Cox Operating systems Applications OS Hardware Remember what a process is Thread Stream of execution (unit of concurrency) Project 1, first month of class Memory space that threads use (unit of dat... Date Added: 2009-06-03 21:19:49 |
| Homework1Review.ppt Path: Portland >> CS >> 410 Winter, 2008 Description: Agenda News! (1 min) Homework 1 (10 min) Hand back SQ 2 (1 min) Intro to Biological Sequences Homework 1 There were lots of good ideas: Userdefined Types Vector(float, float) Userdefined functions Views CloseEnough(t1, t2, epsilon) I... Date Added: 2009-06-03 21:21:48 |
| quiz05.sp01.txt Path: N.C. State >> ST >> 512 Fall, 2008 Description: Quiz 5, St 512, Spring 2001 Dickey For any models with random effects, assume the summing to 0 restrictions as was done in the book, notes, and lecture. Question 1. Here is a table of all 12 observations from an experiment with factorial treatments i... Date Added: 2009-06-03 21:21:58 |
| hist427f07.doc Path: CSU Fullerton >> HIST >> 427 Fall, 2009 Description: Nancy Fitch Fall 2007 Section #1 Schedule #: 18076 T 4:00-6:45 H121 Office: H820M Office Phone: 714-278-2964 Office Hours: TTh 12-2, and by appointment Email: nfitch@fullerton.edu HISTORY 427 ENLIGHTENMENT AND REVOLUTION *[NOTE 1: THIS CLASS WILL US... Date Added: 2009-06-03 21:22:43 |
| ch3-2.ppt Path: Alabama >> CS >> 438 Spring, 2008 Description: Re w of Last Le vie cture What doe UDP do? s What arem ultiple xing and de ultiple m xing ? How doe TC and UDP diffe in m s P r ultiple xing and de ultiple m xing ? What is conne ctionle se ss rviceand conne ction-orie d se s? nte rvice Thesizeo... Date Added: 2009-06-03 21:23:53 |
| EC-7-COCOMO_for_Decisions.ppt Path: USC >> CS >> 510 Fall, 2009 Description: USC C S E University of Southern California Center for Software Engineering Using COCOMO for Software Decisions - from COCOMO II Book, Section 2.6, 6.5 Barry Boehm, USC Sept. 2005 USC C S E University of Southern California Center for Softwa... Date Added: 2009-06-03 21:23:56 |
| ShotgunData.txt Path: Texas A&M >> SSLSNAP >> 663 Fall, 2009 Description: y x lead 5 100 216 10 80 17 10 100 552 10 120 18 15 100 1973 20 60 16 20 80 75 20 100 1650 20 120 62 20 140 18 25 100 3015 30 80 392 30 100 2600 35 100 1669 40 100 1121 45 100 824 50 60 124 50 80 517 50 100 1526 50 120 952 50 140 298 55 100 1336 60 1... Date Added: 2009-06-03 21:25:51 |
| HarrisJenny_WR_06_20030120.doc Path: Rose-Hulman >> CS >> 414 Fall, 2009 Description: Individual Weekly Report Form Jenny Harris Time Period: 1/13/03 - 1/20/02 The information given on this form represents my work on the project and is true to the best of my knowledge. Tasks completed: Completed use cases Attended meeting Total time... Date Added: 2009-06-03 21:27:17 |
| 06s02Assignment02.doc Path: UNC >> COMP >> 321 Fall, 2008 Description: COMP 321, Spring 2006 Assignment 2 for Friday, January 27, 2006 Study: McKeachie: Chapters 5 (Discussion), 16 (Peer learning), 17 (Problem-based) In 10th edition (copies in the reading room) 12 Laboratory 13 Experimental 15 Project \"For your conside... Date Added: 2009-06-03 21:28:26 |
| 4340-energy3.ppt Path: N.E. Illinois >> UX >> 4340 Fall, 2009 Description: Bioenergetics Adaptations Adaptations Chapter 21 pp 427-431 Anaerobic Training Improving ATPPC system short highintensity intervals power exercises rest interval; 34x longer than interval. Why? Result: increase PC stores and increase enzyme ac... Date Added: 2009-06-03 21:32:28 |
| psab2004339.txt Path: Allan Hancock College >> PSAB >> 2004339 Fall, 2009 Description: Western Australia Professional Standards Amendment Bill 2004 CONTENTS 1. Short title 1 2. Commencement 2 3. The Act amende... Date Added: 2009-06-03 21:32:38 |
| 226_120091_1007927_R.doc Path: University of Illinois, Urbana Champaign >> FSDB >> 226 Fall, 2009 Description: University of Illinois at Urbana-Champaign College of Business Department of Finance FINANCE 524 MERGERS, ACQUISITIONS, AND CORPORATE RESTRUCTURINGS SPRING 2009 Professor David A. Lins Office: Phone: Home Phone: E-mail: Office Hours: 452 Wohlers H... Date Added: 2009-06-03 21:33:50 |
| ch02.ppt Path: UMBC >> CMSC >> 421 Fall, 1999 Description: Chapter 2: Computer-System Structures s 2.1 Computer System Operation s 2.5 Hardware Protection s 2.6 Network Structure Computer-System Architecture Computer-System Operation s I/O devices and the CPU can execute concurrently. s Each device contr... Date Added: 2009-06-03 21:34:14 |
| Classes3.ppt Path: UMBC >> CS >> 202 Fall, 1997 Description: CMSC 202 Java Classes and Objects 3rd Lecture Object Creation Revisited In earlier demo code, we wrote statements such as Date3 myDate = new Date3( ); with the comment that we were creating a new Date3 object. The expression new Date3( ) is an invoc... Date Added: 2009-06-03 21:34:21 |
| paa1989189.txt Path: Allan Hancock College >> PAA >> 1989189 Fall, 2009 Description: PATENTS AMENDMENT ACT 1989 NO. 96, 1989 PATENTS AMENDMENT ACT 1989 NO. 96, 1989 - TABLE OF PROVISIONS 1. Short title etc. 2. Commencement 3. Interpretation 4. Duration of patent of addition 5. Validity of patent of addition 6. 7. Exte... Date Added: 2009-06-03 21:34:48 |
| Homework_11.doc Path: Utah >> CV >> 1000 Fall, 2009 Description: ENVIRONMENTAL ENGINEERING DESIGN PROBLEM Grit Removal You are to determine the maximum velocity that the grit chamber described below can experience and still remove 100 % of the design particle contained in the wastewater. The particle must reach ... Date Added: 2009-06-03 21:34:59 |
| lecture22_shaders.ppt Path: San Jose State >> CS >> 116 Fall, 2009 Description: Vertex and Pixel Programs Soon Tee Teoh CS 116B Remember the Graphics Pipeline? Geometric Operations Transform vertices and normals by modelview matrix Per-Vertex Operations Automatic Texture Coordinates Lighting Primitive Assembly Special Clip... Date Added: 2009-06-03 21:35:10 |
| ReliefNurseryF08ProjDef.doc Path: Texas >> MIS >> 374 Fall, 2008 Description: Project Definition Getting Started with an Office Network, Website Design, and Donor Management System Relief Nursery of Central Texas is a new organization to open its doors within the following months. As so, Relief Nursery of Central Texas does no... Date Added: 2009-06-03 21:35:17 |
| ReliefNurseryF08ProjDef.doc Path: Texas >> D >> 374 Fall, 2009 Description: Project Definition Getting Started with an Office Network, Website Design, and Donor Management System Relief Nursery of Central Texas is a new organization to open its doors within the following months. As so, Relief Nursery of Central Texas does no... Date Added: 2009-06-03 21:35:17 |
| UnixViExercise.doc Path: CSU Long Beach >> CECS >> 326 Fall, 2008 Description: CECS 326 Operating Systems Below are some commonly used UNIX commands and their sample use. Try them out, and understand what happens when each executes. Look up the man page (by using the man command) for each command and learn the details. man ls ... Date Added: 2009-06-03 21:35:19 |
| quiz3spring2008answersmondaywednesdayv1.doc Path: Wisconsin >> ECON >> 302 Fall, 2008 Description: Economics 302 Name _ Spring 2008 Monday/Wednesday Lecture Answers to Third Quiz* Student ID Number _ The following quiz is worth a total of 2.5 points. Mark your answer clearly and distinctly: illegibly marked answers will be counted as wrong answers... Date Added: 2009-06-03 21:36:15 |
| afa3200716o2007399.txt Path: Allan Hancock College >> AFA >> 3200716 Fall, 2009 Description: Western Australia Appropriation (Consolidated Fund) Act (No. 3) 2007 Western Australia Appropriation (Consolidated Fund) Act (No. 3) 2007 CONTENTS 1.... Date Added: 2009-06-03 21:36:39 |
| RELEASE_LIABILITY.doc Path: Colorado State >> NR >> 495 Summer, 2008 Description: READ THIS DOCUMENT COMPLETELY BEFORE SIGNING. ITS EFFECT IS TO RELEASE COLORADO STATE UNIVERSITY, ITS GOVERNING BOARD, AND THE STATE OF COLORADO FROM ANY LIABILITY RESULTING FROM YOUR PARTICIPATION IN THE ACTIVITIES DESCRIBED BELOW, AND TO WAIVE ALL ... Date Added: 2009-06-03 21:39:05 |
| 226_120091_1007927_R.doc Path: University of Illinois, Urbana Champaign >> BUSINESS >> 226 Fall, 2009 Description: University of Illinois at Urbana-Champaign College of Business Department of Finance FINANCE 524 MERGERS, ACQUISITIONS, AND CORPORATE RESTRUCTURINGS SPRING 2009 Professor David A. Lins Office: Phone: Home Phone: E-mail: Office Hours: 452 Wohlers H... Date Added: 2009-06-03 21:39:11 |
| Clark_BSC108_fall_2008_syllabus.doc Path: Alabama >> BSC >> 108 Fall, 2008 Description: BSC 108-002, Non-majors Biology I Studio Format Studio Location: Biology 402 Class: Instructor: Office hours: Office Location: Telephone: E-mail: Textbook: Tuesday 10:00-11:50, Thursday 10:00-11:50 and Thursday 1:00-1:50 Dr. John L. Clark M from 1:00... Date Added: 2009-06-03 21:39:54 |
| Jackson_FAQ.doc Path: Princeton >> CLASS >> 1965 Fall, 2009 Description: Class of 1965 Jackson Hole Mini-Reunion Frequently Asked Questions HOW DO I GET TO JACKSON? Jackson Hole airport is served by several airlines with a number of daily flights. The fares can be high and the flights are often fully booked during the s... Date Added: 2009-06-03 21:41:38 |
| BUS-K212-Syllabus.doc Path: IPFW >> K >> 212 Fall, 2009 Description: SCHOOL OF BUSINESS & MANAGEMENT SCIENCES Spring 2005 BUS-K212 Introduction to Data Base Management Saturday 9:00 AM 11:50 AM Tuesday Thursday 6:00 p. m. - 7:15:00 p.m. Neff B41 INSTRUCTOR: OFFICE HOURS: Jacques Chansavang By appointment only. Compu... Date Added: 2009-06-03 21:41:58 |
| homewrk_Mod_1.doc Path: UNL >> IMSE >> 321 Spring, 2008 Description: HOMEWORK PROBLEMS FOR MODULE 1 Lessons Lesson 1 Section 1.1 Section 1.2 Section 1.3 Section 1.4 Lesson 2 Section 2.1 Section 2.2 Section 2.3 Section 2.4 Section 2.5 Lesson 3 Section 3.1 Section 3.2 Section 3.3 Section 3.4 Section 3.5 Section 3.6 1, 3... Date Added: 2009-06-03 21:42:17 |
| homewrk_Mod_1.doc Path: UNL >> MODULE >> 321 Fall, 2009 Description: HOMEWORK PROBLEMS FOR MODULE 1 Lessons Lesson 1 Section 1.1 Section 1.2 Section 1.3 Section 1.4 Lesson 2 Section 2.1 Section 2.2 Section 2.3 Section 2.4 Section 2.5 Lesson 3 Section 3.1 Section 3.2 Section 3.3 Section 3.4 Section 3.5 Section 3.6 1, 3... Date Added: 2009-06-03 21:42:17 |
| History.txt Path: FIU >> TKING >> 003 Fall, 2009 Description: Davis and Larson. Annual Report Information 1/15/2006 Sunrise Fund History - Stewart Carson Daily Values: 2003-2005 = Date High Low Close Open 20030102 26.39 24.88 24.9 25.92... Date Added: 2009-06-03 21:44:10 |
| Lecture02-2004.ppt Path: UF >> AEB >> 6182 Fall, 2008 Description: Von NeumannMorgenstern Lecture II Utility and different views of risk Knightian Frank Knight Von Neumann Morgenstern Risk known probabilities of events Uncertainty unknown or unknowable probabilities Axiomatic treatment Consumers m... Date Added: 2009-06-03 21:45:05 |
| lecture12.ppt Path: Texas A&M >> ECE >> 468 Fall, 2009 Description: ELEN 468 Advanced Logic Design Lecture 12 Synthesis of Combinational Logic II ELEN 468 Lecture 12 1 Verilog Code Styles One behavior or functionality can be described with Verilog in different styles Different styled Verilog code may generate... Date Added: 2009-06-03 21:46:33 |
| lec6-oct8.ppt Path: Sonoma >> CES >> 510 Fall, 2009 Description: Chapter 5 Collocations Original source: L. Venkata Subramaniam January 15, 2002 What is a Collocation? A COLLOCATION is an expression consisting of two or more words that correspond to some conventional way of saying thing... Date Added: 2009-06-03 21:47:35 |
| 01-algo.ppt Path: UNC >> COMP >> 550 Fall, 2008 Description: What is an Algorithm? (And how do we analyze one?) COMP 122, Spring 04 Algorithms Informally, A tool for solving a well-specified computational problem. Input Algorithm Output Example: sorting input: A sequence of numbers. output: An ordered ... Date Added: 2009-06-03 21:48:49 |
| PS272_0302.ppt Path: Colby >> PS >> 272 Fall, 2009 Description: YoungHelmholtz (and Newton and Maxwell) Tri-chromatic Theory Young: 3 specialized cones each acts as a channel responsive to specific spectral composition. 100 % o f Ma x. Ab s o rp tio n 0 4 0 0 5 0 0 6 0 0 Wa ve le ng th What is th... Date Added: 2009-06-03 21:49:07 |
| 2105+CUST.+SER+REP.doc Path: UNC >> READ >> 4922192 Fall, 2009 Description: CUSTOMER SERVICE REPRESENTATIVE - 2105 GENERAL DEFINITION AND CONDITIONS OF WORK: Performs intermediate skilled clerical work collecting revenues and assisting customers; does related work as required. Work is performed under regular supervision. Thi... Date Added: 2009-06-03 21:50:47 |
| HW5.doc Path: Berkeley >> CS >> 150 Fall, 1996 Description: University of California at Berkeley College of Engineering Department of Electrical Engineering and Computer Science EECS 150 Spring 2001 R. H. Katz Problem Set # 5 (Assigned 22 February, Due 2 March) 1. In lecture, we presented an R-S latch based ... Date Added: 2009-06-03 21:53:01 |
| chapter8.ppt Path: Laurentian >> C >> 1047 Fall, 2009 Description: Intro to Computer Science I Chapter 8 Array Data Types Processing Collections of Objects 1 Where do arrays arise? Representation of a mathematical sequence x1 , x2 , , xn such as or x0 , x1 , , xn x is called a sub... Date Added: 2009-06-03 21:54:32 |
| cs2200pres06a_bitwise.ppt Path: Georgia Tech >> CS >> 2200 Fall, 2008 Description: CS 2200 Presentation 6a Bitwise Operations Questions? Bitwise Ops Can only be applied to integral operands that is, char, short, int and long (signed or unsigned) > ~ Bitwise AND Bitwise OR Bitwise XOR Shift Left Shift Right 1\'s Compleme... Date Added: 2009-06-03 21:56:18 |
| FIN 3312 Syllabus - Spring 2008.doc Path: Texas A&M University, Corpus Christi >> FINA >> 3312 Fall, 2008 Description: Texas A Institutions Instructor: Dr. H. Swint Friday, CFP Office:Driftwood Room 201 C Phone: (361) 825-2498 Fax: (361) 825-560... Date Added: 2009-06-03 21:56:21 |
| Obstemp-semi.doc Path: Augustana >> AS >> 315 Fall, 2009 Description: Observing Template Naked Eye Observations Object: Location: Date and Time: Notes: Object: Location: Date and Time: Notes: ... Date Added: 2009-06-03 21:57:06 |
| STT_STD_hw.ppt Path: Ole Miss >> ELE >> 335 Fall, 2008 Description: Recommended STT, STD Homework 1. (15 points) A) How many flip-flops are needed to build this machine? B) How many bits are needed for the input? C) How many bits are needed for the output? D) Beginning in the \"Red\" state, for the given input sequence... Date Added: 2009-06-03 21:57:10 |
| hw8.ps Path: Bergen CC >> CS >> 191 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw8.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman CMEX10 Symbol CMR10 CMSY10 Times-Italic %+ CMMI10 %DocumentPaperSizes: Lett... Date Added: 2009-06-03 21:57:36 |
| hw8.ps Path: Berkeley >> CS >> 191 Spring, 2005 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: hw8.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman CMEX10 Symbol CMR10 CMSY10 Times-Italic %+ CMMI10 %DocumentPaperSizes: Lett... Date Added: 2009-06-03 21:57:36 |
| lecture1.ps Path: Bergen CC >> CS >> 191 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: lecture1.dvi %CreationDate: Thu Sep 04 17:33:50 2003 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMDUNH10 Times-Roman Symbol CMR10 Times-It... Date Added: 2009-06-03 21:58:25 |
| lecture1.ps Path: Berkeley >> CS >> 191 Spring, 2005 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: lecture1.dvi %CreationDate: Thu Sep 04 17:33:50 2003 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMDUNH10 Times-Roman Symbol CMR10 Times-It... Date Added: 2009-06-03 21:58:25 |
| lesson07.ppt Path: University of San Francisco >> CS >> 686 Fall, 2008 Description: Linux game programming An introduction to the use of interval timers and asynchronous input notifications Our prior animation demo We achieved the illusion of \"smooth\" and \"flicker-free\" animation, by synchronizing drawing-operations with Vertical ... Date Added: 2009-06-03 21:59:59 |
| WS4.doc Path: Oregon State >> CH >> 130 Spring, 2008 Description: Chemistry 130 Worksheet 4 1. Oregon State University Dr. Richard Nafshun ChemSkills provides the following list of derivatives of benzene in Section 12.4: What is the systematic name of the following compound? What is the chemical formula? What i... Date Added: 2009-06-03 22:00:49 |
| resume.doc Path: Penn State >> CBM >> 160 Fall, 2009 Description: Christopher B. Mitchell Cbm@psu.edu Permanent Address: 8650 Rugby St. Philadelphia, PA, 19150 (215) 206-3947 Objective: An internship in the summer of 2009. Campus Address: 207 Pennypacker Hall Education: Major: Engineering Science The Pennsylvania ... Date Added: 2009-06-03 22:00:55 |
| lecture_chp11_1.doc Path: UCF >> STA >> 4163 Fall, 2008 Description: Lecture & Examples Topic 1: Fitting Probabilistic Model with the Least Squares Approach Sometimes, we are interested to study the relationship among several variables. One of these variables is called dependent variable and the rest of the variables ... Date Added: 2009-06-03 22:04:23 |
| MGT464Chapter1-Rob.ppt Path: New Mexico >> MGT >> 464 Fall, 2009 Description: MGT 464 Human Resource Management (from a strategic perspective) SPEAK UP! SHOW UP! Respect others opinions Learn something and. .HAVE FUN! Pick Your Candy For every picked tell us one of your nicknames For every picked tell us about an emba... Date Added: 2009-06-03 22:04:57 |
| a03_information.doc Path: Bowling Green >> A >> 264 Fall, 2009 Description: ASSIGNMENT #3: INFORMATION MANAGER DUE: January 27, 2009 VALUE: 25 points Your name: Blake Barringer_ kktc264_ TCOM 264 Kling Spring 2009 Page 1 of 3 PREP YOUR DISK & ASSIGNMENT OVERVIEW (2 points) 1. 2. Create a folder on your disk named a03_info... Date Added: 2009-06-03 22:08:36 |
| lonetree.doc Path: Iowa State >> PUBLIC >> 0526 Fall, 2009 Description: Lone Tree Reporter, IA 05-24-06 Nicer places to walk a top priority for Lone Tree residents By: Ray Weikal Lone Tree residents apparently like to take walks and want to make their strolls even more enjoyable with some local improvements. Lone Tree is... Date Added: 2009-06-03 22:10:41 |
| lonetree.doc Path: Iowa State >> MR >> 0526 Fall, 2009 Description: Lone Tree Reporter, IA 05-24-06 Nicer places to walk a top priority for Lone Tree residents By: Ray Weikal Lone Tree residents apparently like to take walks and want to make their strolls even more enjoyable with some local improvements. Lone Tree is... Date Added: 2009-06-03 22:10:41 |
| tristate.doc Path: Iowa State >> MR >> 0728 Fall, 2009 Description: Telegraph Herald July 10, 2006 Monday Tri-state farmers closer to herbicide OK The weed-killer atrazine could be re-instated by August EMILY KLEIN The U.S. Environmental Protection Agency recently reported that the popular herbicide atrazine, often u... Date Added: 2009-06-03 22:11:15 |
| tristate.doc Path: Iowa State >> PUBLIC >> 0728 Fall, 2009 Description: Telegraph Herald July 10, 2006 Monday Tri-state farmers closer to herbicide OK The weed-killer atrazine could be re-instated by August EMILY KLEIN The U.S. Environmental Protection Agency recently reported that the popular herbicide atrazine, often u... Date Added: 2009-06-03 22:11:15 |
| Ch14_student.ppt Path: Penn State >> MET >> 210 Fall, 2009 Description: Chapter 14 Bearings /www2.chicago-rawhide.com www.traxxas.com www.continentalconveyor.com Bearings Function: Carry load in one or several directions while allowing frictionless motion in other directions Fatigue = F(Pressure, Velocity) 3 main ty... Date Added: 2009-06-03 22:11:27 |
| quiz3-fall2002-sol.1p.ps Path: UCSC >> CMPE >> 110 Winter, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: quiz3-fall2002-sol.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o quiz3-fall20... Date Added: 2009-06-03 22:12:41 |
| hwk-3.doc Path: Southern Oregon >> CHE >> 5480 Fall, 2009 Description: ASSIGNMENT 3 All Groups: 1) 2) 3) 4) 5) CHE 5480 Propose a set of equations that will constitute a cash flow model for your current problem. Due: Wed. March 12. Solve the two problems sequentially. Operations/Design Planning and Budgeting. Due: Wed... Date Added: 2009-06-03 22:13:25 |
| lamp_flicker_1761082.txt Path: Stanford >> CPT >> 20080910 Fall, 2009 Description: Front camera flicker: 0.00081871708 818.71708 ppm Side camera flicker: 0.0017578437 1757.8437 ppm Correlation: 0.33802792 Noise in ratio: 0.0016690515 Front shutter noise: 4.0005953e-06 ... Date Added: 2009-06-03 22:14:35 |
| 22.Law&Ethics.ppt Path: SMU - Cox School of Business >> CCJN >> 2380 Fall, 2009 Description: Legal and Ethical Issues Overview Issues of responsibility for libel, obscenity and indecency Aspects of copyright Issues involved in user agreement contracts Legal and ethical issues of linking Ethics of writing blogs Libel Libel-... Date Added: 2009-06-03 22:17:39 |
| Project 1.doc Path: Penn State >> NXK >> 927 Fall, 2009 Description: Project 1: Compiling Base Data for a Conservation GIS This project involved the digitizing of data for a hypothetical conservation GIS. Features to be digitized included line, point, and polygon features (the XY coordinates from a text file were also... Date Added: 2009-06-03 22:17:45 |
| culg.txt Path: Montana >> PHYSICS >> 000728 Fall, 2009 Description: From owner-clg-presto@ips.gov.au Tue Jul 25 11:57:01 2000 Received: from isass6.solar.isas.ac.jp by isass1.solar.isas.ac.jp (8.8.7/1.1.20.3/28Jan00-0534AM) id LAA0000023002; Tue, 25 Jul 2000 11:57:00 +0900 (JST) Received: from ipso.ips.gov.au (ipso.... Date Added: 2009-06-03 22:19:44 |
| MATLABPrimer.pdf Path: Clarkson >> AE >> 430 Fall, 2009 Description: MATLAB Primer Third Edition Kermit Sigmon Department of Mathematics University of Florida Department of Mathematics University of Florida Gainesville, FL 32611 sigmon@math.ufl.edu Copyright c 1989, 1992, 1993 by Kermit Sigmon On the Third Edition... Date Added: 2009-06-03 22:20:15 |
| MATLABPrimer.pdf Path: Clarkson >> AE >> 429 Fall, 2009 Description: MATLAB Primer Third Edition Kermit Sigmon Department of Mathematics University of Florida Department of Mathematics University of Florida Gainesville, FL 32611 sigmon@math.ufl.edu Copyright c 1989, 1992, 1993 by Kermit Sigmon On the Third Edition... Date Added: 2009-06-03 22:20:15 |
| 437_EXAM1_KEY_sp2009-POST.doc Path: Arizona >> ECOL >> 437 Fall, 2008 Description: ... Date Added: 2009-06-03 22:20:20 |
| 11.ps Path: UPenn >> CIS >> 673 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: 11.dvi %Pages: 22 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: /pkg/teTeX/bin/dvips.real 11.dvi %DVIPS... Date Added: 2009-06-03 22:23:10 |
| Intel-RB.ppt Path: Oregon State >> ENGR >> 407 Fall, 2008 Description: Intel My 1st MECOP Internship Experience Ryan Bakker Job Characteristics Job Description Web Developer responsible for the creation, management, and testing of new/existing features and data pertaining to the ARK product database Organizational Str... Date Added: 2009-06-03 22:24:05 |
| Team5_oil.xlsx Path: Arizona >> MATH >> 115 Fall, 2009 Description: TEAM AUCTION DATA: Assignment Records have been kept on 20 oil leases for tracts that are very similar to those on which your team will be bidding. This historical lease data is exactly the same as that used in the Class Project. The eventual proven ... Date Added: 2009-06-03 22:24:13 |
| UNCC-IESLecture06 - C Review and Dissection IV.ppt Path: UNC Charlotte >> ECGR >> 4101 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|22 Jan 2007 18:36:56 -0000 vti_extenderversion:SR|12.0.0.6211 vti_author:SR|MOSAIC\\jmconrad vti_modifiedby:SR|CONRADUNCCLAPTO\\Robot vti_timecreated:TR|16 Sep 2004 20:52:11 -0000 vti_title:SR|Embedded Sy... Date Added: 2009-06-03 22:25:21 |
| hw5_lb_6050.doc Path: RPI >> BUSHL >> 6050 Fall, 2009 Description: Larry Bush email: bushl2@rpi.edu, Lawrence_Bush@dps.state.ny.us Student ID: 660 220 742 Home Work 5 - Computability and Complexity (CSCI-6050) Instructor: Prof. Goldberg November 30, 2001 Problem 1 : regular language? NO. If A <m B and B is a regu... Date Added: 2009-06-03 22:25:50 |
| 18_Pangaea.ppt Path: CSU San Marcos >> ES >> 100 Fall, 2009 Description: Breakup of Pangaea ... Date Added: 2009-06-03 22:26:26 |
| ANOVA - Example - Reading Midterm - Blank.doc Path: N. Arizona >> EPS >> 625 Fall, 2008 Description: EPS 625 INTERMEDIATE STATISTICS ONE-WAY ANALYSIS OF VARIANCE EXAMPLE 1 Use the ANOVA Example 1 data from the Web site and the following scenario: You are to investigate whether students\' scores on a reading midterm examination differ as a function... Date Added: 2009-06-03 22:27:34 |
| Service+Notes+for+week+of+Oct.+6.doc Path: UNC >> READ >> 4830994 Fall, 2009 Description: Service Notes for Week of Oct. 6: Monday, Wednesday, Thursday, Saturday: Haunted House Building Help the Raleigh Jaycee\'s build their annual Haunted House to support local Trianglearea charities (including the Duke Burn Center, Goodfellows, a progr... Date Added: 2009-06-03 22:42:33 |
| Asn 4.doc Path: Michigan >> MATH >> 462 Fall, 2008 Description: Math 462/562 - Assignment 4 Due: One week after the talk. This is worth 10 points. You may only do this once for credit. Please work by yourself. See me if you need help. Assignment: Go to a talk that involves applied mathematics and write a summary... Date Added: 2009-06-03 22:43:05 |
| hw-ans7.xls Path: UNC >> CHAPT >> 210 Spring, 2009 Description: HW chapter 7 answers question 1 1,2,4-tri Chlorobenzene 1,2,4TCB has a logKiow = 4.06 from new book page 1201 appendix C assume Kihex,w for hexane is the same as for hexadecane (Kihexdecane,w) in your book (this is an assumption, but is reasonable b... Date Added: 2009-06-03 22:44:40 |
| notes.doc Path: CSU LA >> CS >> 242 Fall, 2009 Description: Henry Gaw 7/16/07 CS 242 Typecasting Int I = (int) `q\'; Printf (\"%d\", i); ASCII Review: ARRAYS Char charr[15]; Int I; For (i=0; i <15; i+){ /charr[i] } Int arr2d[10][20]; Arr2d[0][16]=3; this is an indicator of what the value at that point in memo... Date Added: 2009-06-03 22:47:15 |
| doc3.txt Path: University of Iowa >> ASS >> 230 Fall, 2009 Description: <DOC> <DOCNO> AP890101-0012 </DOCNO> <FILEID>AP-NR-01-01-89 1130EST</FILEID> <FIRST>r i AM-SriLanka 01-01 0500</FIRST> <SECOND>AM-Sri Lanka,0513</SECOND> <BYLINE>Associated Press Writer</BYLINE> <DATELINE>COLOMBO, Sri Lanka (AP) </DATELINE> <TEXT... Date Added: 2009-06-03 22:47:43 |
| HIST382midterm.doc Path: Delaware >> HIST >> 382 Fall, 2008 Description: HIST 382 Midterm 7 takehome essay due at 4:00 on Tuesday, April Document analysis, 19 c. medicine: th TW Rosenberg essay. pp. 108113 [skip the last pg. of this excerpt, 114] Warner essay, pp. 216219 [this is half of the excerpt provided i... Date Added: 2009-06-03 22:48:01 |
| math1313T2.xls Path: U. Houston >> M >> 200803 Fall, 2009 Description: Login Name First Name Last Name PS ID Section No EffieJane Effie Ministerio 846646 23990 cyskelly Yushan Chen 864951 23986 hellokitty17Jasmine Lynch 861759 23986 jcfredet Jacqueline Fredette 831552 23986 gesukville William Holden 831286 23992 htownsd... Date Added: 2009-06-03 22:48:29 |
| 06_chap15_part2.ppt Path: MD University College >> CSMN >> 662 Fall, 2009 Description: Nested Loop T1 11111 55555 33333 44444 | | | | T2 aaa ddd ccc ggg 55555 11111 55555 33333 6-1 SORT-MERGE Sorted First T1 11111 | 33333 | 44444 | 55555 | T2 ddd ggg aaa ccc 11111 33333 55555 55555 6-2 Join One factor that makes differe... Date Added: 2009-06-03 22:51:50 |
| Lange-LLL-05.doc Path: Rose-Hulman >> CE >> 489 Fall, 2009 Description: Jason Lange CM 1150 CE 489 Civil Engineering Design and Synthesis Life Long Learning Assignment Significant changes that have occurred in civil engineering over the last 10 to 20 years Environmental Engineering o Low Impact Design o LEED o Sustaina... Date Added: 2009-06-03 22:54:07 |
| eqn_sheet2.doc Path: Rose-Hulman >> ECE >> 300 Fall, 2009 Description: Name _ CM_ Some Potentially Useful Relationships E a = lim Ta -T x ( t ) T 2 a dt = T - x ( t ) 2 dt Pa = lim Ta 2 1 x ( t ) dt 2T - T e jx = cos ( x ) + jsin ( x ) cos ( x ) = 1 jx - jx +e e 2 j = -1 sin ( x ) = 1 jx - jx -e e ... Date Added: 2009-06-03 22:54:10 |
| Jar.ppt Path: Weber >> CS >> 3230 Fall, 2008 Description: JAR Files Objectives: 1. Archiving and Packaging Java Code 2. The jar Program JAR Files b JAR file archives provide packaging for Application, Applets, & JavaBeans b Multiple classes can be packaged in JAR files b JAR Files with HTML b Manifest fil... Date Added: 2009-06-03 22:54:23 |
| exam.ps Path: Allan Hancock College >> COMP >> 315 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: exam.dvi %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Times-Roman Courier Times-Bold Times-Italic CMSY10 %DocumentPaperSizes: a4 %EndComment... Date Added: 2009-06-03 22:55:22 |
| PPCh03ho.ppt Path: N. Arizona >> FIN >> 311 Fall, 2008 Description: Ch 3 Learning Goals The effect of depreciation on cash flows Calculate depreciation using MACRS Financial planning process Preparation and use of the cash budget Preparation and use of pro forma statements 1 Profits are import... Date Added: 2009-06-03 22:58:07 |
| 341-skiplist-review-module.ps Path: UMBC >> CS >> 341 Spring, 1999 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: 341-skiplist-review-module.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o 341-... Date Added: 2009-06-03 22:58:36 |
| Exam2Pr1.txt Path: UF >> EML >> 5215 Fall, 2008 Description: % Exam 2, Problem 1 % Inertia properties problem DEGREES ON OVERWRITE ON %AUTOEPSILON 1E-14 BODIES T % T1> TO THE RIGHT, T2> UPWARD, AND T3> = T1> X T2> FRAMES S CONSTANTS A,B,D,THETA POINTS O,P,Q,R MASS T=M I11=M*B^2/18 I22=M*A^2/18 I33=I11+I22 I12=... Date Added: 2009-06-03 22:59:16 |
| Ch. 8 & 9.ppt Path: Kentucky >> CE >> 599 Fall, 2008 Description: CH. 8 RAILROAD OPERATION Average Situation Contract Rates Paperwork Path (EDI) Demurrage Bill of Lading Open Order Waybill Interchange Destination Switching Intra-plant Intra-terminal Inter-terminal Switching charges / Interline ... Date Added: 2009-06-03 23:01:07 |
| probablilty.ppt Path: UF >> PSB >> 6088 Fall, 2009 Description: Determinacy in Behavioral Neuroscience Kandel, E.R., Schwartz, J.H. qualia?\" Daniel Dennett ident... Date Added: 2009-06-03 23:01:31 |
| SomeClarifications.doc Path: UF >> CIS >> 3022 Fall, 2008 Description: Some Clarifications Question 7.1.5: For this question, you may answer in two ways: 1) Create a class IntegerArguments. The class will receive an unspecified number of integers from the user one by one. The user will be asked to enter another integer ... Date Added: 2009-06-03 23:01:31 |
| MNQ (Pension SFAS158) WP Solutions for Students.xls Path: Idaho >> ACCT >> 414 Spring, 2008 Description: Pension Worksheet SFAS NO. 158 1 Income Stmt Pension Expense 2 BS 3 4 5 Accounts on Employer\'s Books Other comprehensive income stmt Transition (Gain)/Loss Net actuarial (gain)/loss Prior Service Cost 6 BS 8 Not on Books Memorandum Amounts Proje... Date Added: 2009-06-03 23:04:38 |
| lec16seq.ps Path: UCSD >> CSE >> 231 Spring, 2002 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: lec16seq.dvi %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips lec16seq -o %DVIPSParameters... Date Added: 2009-06-03 23:08:10 |
| hw2sol.ps Path: UCSD >> CSE >> 105 Fall, 2001 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: hw2sol.dvi %CreationDate: Fri Feb 14 21:01:59 2003 %Pages: 6 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMBX10 CMR10 CMBX12 CMMI10 CMSY10 CMTT10 CMM... Date Added: 2009-06-03 23:08:28 |
| hwk4.ps Path: UCSD >> CSE >> 101 Winter, 1998 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: hwk5.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips hwk5.dvi %DVIPSParameters: dpi=6... Date Added: 2009-06-03 23:09:14 |
| 04TCP.ppt Path: UMass Lowell >> CS >> 113 Fall, 2009 Description: Network Components Visible Host Router Link Invisible Protocols Applications What is a protocol ? From diplomacy A set of rules governing relationship Example \"what\'s the time?\" \"I have a question\" . specific msgs sent . specific acti... Date Added: 2009-06-03 23:09:27 |
| Week5b.ppt Path: USC >> CS >> 589 Fall, 2008 Description: Strategic Directions in RealTime and Embedded Systems - JOHN A. STANKOVIC ET AL. Presented at USC by Mr. Mike Wakerly Mr. Suhas R. Mehta Saturday, May 16, 2009 Copyright 20032004 CSCI 589 @ USC (Fall 2003) 1 Strategic Directions in RealTime and... Date Added: 2009-06-03 23:10:56 |
| 374.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Wed Oct 29 13:49:23 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.4 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:12:03 |
| 223.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Sat Oct 4 20:24:53 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.3 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-03 23:13:03 |
| Fall05Syllabus.doc Path: Clemson >> CU >> 101 Fall, 2008 Description: 101, University Success Skills (Freshman Seminar) Syllabus and Guidelines Fall 2005 Instructor: Dr. Wesley Burnett Office: 271 Lehotsky Hall Phone: 656-5357 or leave message 656-3400 E-mail: karlosk@clemson.edu Office Hours: T-Th 8:30-10:30 and by ap... Date Added: 2009-06-03 23:13:29 |
| Basketball.ppt Path: N. Georgia >> KDYOUN >> 0013 Fall, 2009 Description: By: Krystyn Young Object of the game 2 teams of 5 players Points Rules Gender Differences Running Jumping Throwing Catching Guarding Blocking Quickness Rebounding Passing Ball Handling Shooting Rebounding Balance Elbow Eyes F... Date Added: 2009-06-03 23:13:59 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 1185 Fall, 2009 Description: \" 27992:16313:737:295 27912:17747:757:309 27872:10505:797:309 \"book 28391:46085:4665:787 \' 38479:16580:378:168 28451:29490:199:295 \' 27892:11981:797:281 27952:19210:757:281 * 27972:29504:199:281 , 38539:22543:219:309 - 36206:18043:398:98 40792:20940:... Date Added: 2009-06-03 23:14:56 |
| Persona.txt Path: InterAmerican Aguadilla >> COMP >> 3976 Fall, 2009 Description: /* * Persona.java * * Created on August 20, 2007, 3:09 PM * * To change this template, choose Tools | Template Manager * and open the template in the editor. */ package miaplicacion; /* * * @author jarodriguez */ public class Persona { ... Date Added: 2009-06-03 23:16:35 |
| 06AllMySonstopics.doc Path: Middlebury >> WRPR >> 0202 Fall, 2009 Description: WRPR0202 M.E. Bertolini All My Sons Spring 2006 Using one of the topics below, write a well-organized, well-argued three to five-page paper on Arthur Miller\'s All My Sons Your paper should have a coherent thesis statement that you support with spe... Date Added: 2009-06-03 23:17:43 |
| Aug25.ppt Path: New Mexico >> CS >> 500 Spring, 2008 Description: #E#1#1#P#(#(#y#[# # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # # ## # # # # # # # # # # # # # # # # # # # # # # #G#5 #M #`#M ... Date Added: 2009-06-03 23:17:46 |
| IEEE2-DLNET.ppt Path: Virginia Tech >> PD >> 002000 Fall, 2009 Description: [Image by NASA] Preventing, Managing, and Resolving Ethical Dilemmas in the 21st Century An IEEE DVP Presentation to Delaware Section IEEE by Sam Biondo, Sc.D 2001 Samuel J. Biondo All rights reserved This Presentation Can Be Found On: http:/www... Date Added: 2009-06-03 23:19:33 |
| IEEE2-DLNET.ppt Path: Virginia Tech >> DISK >> 002000 Fall, 2009 Description: [Image by NASA] Preventing, Managing, and Resolving Ethical Dilemmas in the 21st Century An IEEE DVP Presentation to Delaware Section IEEE by Sam Biondo, Sc.D 2001 Samuel J. Biondo All rights reserved This Presentation Can Be Found On: http:/www... Date Added: 2009-06-03 23:19:33 |
| sodium.doc Path: Iowa State >> PUBLIC >> 1123 Fall, 2009 Description: CNNMoney.com 11-21-07 CONSUMER WATCH: Do You Know What Was Pumped In Your Turkey Before You Stuffed It? WASHINGTON (Dow Jones) - This Thanksgiving millions of Americans will give thanks for. sodium phosphates? How about being grateful for modified fo... Date Added: 2009-06-03 23:21:44 |
| sodium.doc Path: Iowa State >> MR >> 1123 Fall, 2009 Description: CNNMoney.com 11-21-07 CONSUMER WATCH: Do You Know What Was Pumped In Your Turkey Before You Stuffed It? WASHINGTON (Dow Jones) - This Thanksgiving millions of Americans will give thanks for. sodium phosphates? How about being grateful for modified fo... Date Added: 2009-06-03 23:21:44 |
| F13.041.txt Path: Stanford >> YJM >> 789 Fall, 2009 Description: >F13.041 repeat_region no description available Chr13 complement(372696.378621) tgttggaataaaaatccactatcgtctatcaactaatagttatattatca atatattatcatatacggtgttaagatgatgacataagttatgagaagct gtcatcgatgttagaggaagctgaaacgcaaggattgataatgtaatagg atcaatgaatataaac... Date Added: 2009-06-03 23:22:04 |
| status.txt Path: San Jose State >> NAM >> 215 Fall, 2009 Description: 06Z NAM215 f00 products completed Sun Apr 26 09:20:09 UTC 06Z NAM215 f03 products completed Sun Apr 26 09:20:16 UTC 06Z NAM215 f06 products completed Sun Apr 26 09:20:23 UTC 06Z NAM215 f09 products completed Sun Apr 26 09:20:30 UTC 06Z NAM215 f12 pro... Date Added: 2009-06-03 23:22:40 |
| 1STLAW3_01.doc Path: Frostburg >> P >> 263 Fall, 2009 Description: Name_ Partners_ _ Work in Cyclic Processes In this exercise, you\'ll be asked to draw lines on the PV diagram shown below. P P1 P2 V V1 V2 I. A gas is initially in a state described by (V1, P1, T1). It expands at constant pressure P1 to a new vol... Date Added: 2009-06-03 23:22:51 |
| 417midterm.doc Path: Old Dominion >> CS >> 417 Fall, 2008 Description: CS 417 Midterm Exam This is open book, open notes but you are not allowed to discuss your solutions in anyway with anyone other than the instructor or the TA. The ODU Honor Code will be strictly enforced for this examination. Be warned, the departmen... Date Added: 2009-06-03 23:23:21 |
| a05354_slide_3_of_14.ps Path: Minnesota >> A >> 05354 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.521a Copyright 1986, 1993 Radical Eye Software %Title: slides_dpf_1996.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Symbol %EndComments %DVIPSCommandLine: dvips -o... Date Added: 2009-06-03 23:24:27 |
| CS361_Lecture14.ppt Path: Drexel >> CS >> 361 Fall, 2009 Description: CS361 - Lecture 14 Message Passing: RPC/Rendezvous Bruce Char William M. Mongan Message passing We\'ve explored ways of synchronizing concurrent threads operating in the same address space. For different address spaces, we need something else. Di... Date Added: 2009-06-03 23:28:07 |
| COSI118_Part.doc Path: LeMoyne-Owen >> COSI >> 118 Fall, 2009 Description: LEMOYNE-OWEN COLLEGE DIVISION OF NATURAL AND MATHEMTICAL SCIENCES Syllabus for COSI 118 INTRODUCTION TO MICROCOMPUTERS Spring Semester, 2008 Text: Microsoft Office 2003: Introductory Concepts and Techniques, Premium Edition Shelly Cashman Vermaat (IS... Date Added: 2009-06-03 23:29:25 |
| Instruction.docx Path: LeMoyne-Owen >> COSI >> 118 Fall, 2009 Description: (Type Your Own Last Name Here) 1 PE TH I S PAGE. (Type Your Name Here) I nseranging brCI IeaderON ea H t Page indenther eAr FOOTNOTE I NDENT FI FOOTNOTE RST eak HTATI L NE L D I NSERT FROM BI L I OGRAPH Y L I ST Dr. Chu COSI 118 (Insert Today\'s Date... Date Added: 2009-06-03 23:29:31 |
| kp0.5.xls Path: Santa Clara >> COEN >> 194 Fall, 2009 Description: Sheet1 0 1.85 1.85 1.85 1.84 1.84 1.84 1.84 1.84 1.85 1.84 1.85 1.85 1.85 1.85 1.85 1.85 1.85 1.85 1.85 1.85 1.84 1.84 1.84 1.84 1.84 1.84 1.84 1.85 1.84 1.85 1.85 1.85 1.85 1.85 1.85 1.84 1.84 1.84 1.84 1.84 1.85 1.85 1.85 1.84 1.84 1.85 1.84 1.84 1... Date Added: 2009-06-03 23:30:04 |
| Syllabus_Spr_2006.doc Path: Valdosta >> MATH >> 5164 Fall, 2008 Description: MATH 5164 T 17:00 19:45; NH 2104 Understanding Algebra for P-5 Teachers Spring 2006 Instructor Office Phone Email Office Hours Options : Dr. Peggy L. Moch : Nevins Hall 1181 : 333-5785 : plmoch@valdosta.edu (best way to contact me) : MTWR 14:00 15:... Date Added: 2009-06-03 23:32:09 |
| ch-tr.txt Path: U. Houston >> CS >> 4368 Fall, 2009 Description: 12 TR01 BK - - - - - - - - - - - - - - WR - - - - WK - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - TR02 - - - - - - BK - - - - - - - - WR - WK - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - ... Date Added: 2009-06-03 23:32:19 |
| 341-skiplist-review-module.ps Path: UMBC >> CSEE >> 341 Fall, 1999 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: 341-skiplist-review-module.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o 341-... Date Added: 2009-06-03 23:34:42 |
| 341-skiplist-review-module.ps Path: UMBC >> EXAMS >> 341 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: 341-skiplist-review-module.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o 341-... Date Added: 2009-06-03 23:34:42 |
| NCLC348Article Presentations.doc Path: George Mason >> NCLC >> 348 Fall, 2008 Description: NCLC 348: Reading/Viewing Presentations Introduction This collaborative learning assignment asks you and your group members to become the \"experts\" in the readings/viewings for the day and to teac... Date Added: 2009-06-03 23:34:57 |
| comm analysis.doc Path: Wartburg >> BA >> 325 Fall, 2009 Description: TO: Gloria Campbell FROM: Amanda Hewitt DATE: January 29, 2008 SUBJECT: Interview with Financial Representative Darrell Hendrickson After speaking with Darrell Hendrickson, a Financial Representative at Merrill Lynch, I learned a lot about communicat... Date Added: 2009-06-03 23:36:56 |
| projectreferences.doc Path: Michigan State University >> ME >> 426 Spring, 2008 Description: 1. Liu, D.,\"Characterization of Impact Properties and Damage Process of Glass/Epoxy Composite Laminates,\" Journal of Composite Materials, 38(16), 1425-1142, 2004 2. Baker, A. et al, Composite Materials for Aircraft Structures: Second Edition, Chapter... Date Added: 2009-06-03 23:38:30 |
| lab3HWform.DOC Path: CSU Fresno >> MATH >> 150 Fall, 2009 Description: Calculus I, Drs. Nogin and Wyels, Fall `06 names Lab 3 Problems The directions are in your Maple lab. Refer to them repeatedly! Do not print more than 3 pages. 1. The Buellton trip b) arrived in Oxnard: c) distance from CSUCI to Buellton: d), e), f... Date Added: 2009-06-03 23:38:50 |
| 04 004.xls Path: East Los Angeles College >> UKHR >> 0405 Fall, 2009 Description: Table 4 Measures of employment and unemployment in the UK Thousands 1979 + + + = + = Employees Selfemployed Training programmes Unpaid family workers Total in employment ILO unemployed Total economically active Economically inactive Claimant unemploy... Date Added: 2009-06-03 23:39:26 |
| vanceboro.wsrp.doc Path: UNC >> READ >> 4694761 Fall, 2009 Description: TOWN OF VANCEBORO WATER SHORTAGE RESPONSE PLAN ORDINANCE An ordinance authorizing the declaration of water shortage; establishing procedures and measures for the essential conservation of water resources; and prescribing certain penalties. Be It Ena... Date Added: 2009-06-03 23:43:36 |
| Do+you+give+staff+recommendations.doc Path: UNC >> READ >> 3733570 Fall, 2009 Description: On requests for COAs, do you make a staff recommendation as part of a staff report (either written and/or verbally at the hearing) to the commission I usually give a verbal staff recommendation to the Commission. Stephanie Scott-Sims Planner I City ... Date Added: 2009-06-03 23:44:26 |
| revch4f2004_pt_1.doc Path: Butler >> EC >> 354 Fall, 2009 Description: EC 354 Intermediate Microeconomics Review Questions from Ch. 4-Part I Robert S. Main 1. Derive the demand curve for good X for the case where I = $80 and P Y = $8. Find the points on the demand for X corresponding to PX = $10 and PX = $5. 10 5 ... Date Added: 2009-06-03 23:46:00 |
| HCAD 5220 Homework 1.doc Path: Trinity U >> HCAD >> 5320 Fall, 2009 Description: HCAD 5220 Fall 2008 Ed Schumacher Homework 1 1. The file Denial Sample.xls contains information from a sample of denied charges for a particular hospital. Construct descriptive statistics for the variable Total Charges. Provide an interpretation. 2.... Date Added: 2009-06-03 23:47:29 |
| other.txt Path: Eastern Washington University >> CSCD >> 326 Fall, 2009 Description: /* * This should be a detailed description of the class. * * @author Your Name * @see \"replace\" */ ... Date Added: 2009-06-03 23:47:37 |
| DemoSort.txt Path: Eastern Washington University >> CSCD >> 300 Winter, 2008 Description: /* * Program to demonstrate sorting behaviors. * * @author Timothy Rolfe */ import java.util.Arrays; import java.util.Scanner; import java.util.Random; import java.io.*; public class DemoSort { static private final boolean DEBUG = true; /... Date Added: 2009-06-03 23:47:47 |
| edit.TXT Path: UPenn >> SYS >> 502 Fall, 2009 Description: Column 1 Column 2 1 6.3 1 4.3 1 0.001 1 12 2 1.8 2 42 3 0.001 3 0.001 4 0.001 4 0.86 5 0.001 6 0.47 6 11 7 0.18 7 5.8 7 0.001 8 0.001 8 0.001 8 0.69 8 0.69 9 0.62 10 3.2 11 3.6 11 130 12 1.4 13 1.8 14 0.61 14 0.6 15 0.72 15 0.64 15 10 16 2.9 16 2.7 1... Date Added: 2009-06-03 23:47:49 |
| ped-rel-panel-narayanan.ppt Path: UCSD >> VLSICAD >> 200303 Fall, 2009 Description: PED Roadmapping Issues Vijaykrishnan Narayanan Dept. of CSE Penn State University GSRC Workshop, March 20-21, 2003 Why PED-Robustness Roadmap? speed/area area power speed speed/power/reliability speed/power low power reliable ultralow power 1970... Date Added: 2009-06-03 23:56:40 |
| ME 371 Outline.doc Path: Michigan State University >> EGR >> 9707 Fall, 2009 Description: Course alpha, number, title Required or elective Course (catalog) description Prerequisite(s) Textbook(s) and/or other required material Class/Lab schedule: Topics covered ME 371 Mechanical Design I Required Analysis of displacement, velocity and ac... Date Added: 2009-06-03 23:57:05 |
| as3.doc Path: UC Riverside >> CS >> 010 Fall, 2008 Description: CS 10 - Assignment 3 Due Friday, February 2 Write a program to determine if the digits in a positive number less than 1000 are all odd, all even, or mixed odd and even. Your program should prompt the user to input an integer less than 1000. Output ea... Date Added: 2009-06-03 23:58:22 |
| inlec_5_4.txt Path: UC Riverside >> CS >> 010 Fall, 2008 Description: Write an expression that returns a random number between -5 and 5 inclusive. solution: rand() % 11 - 5 explanation: The expression (rand() % 11) returns a random number between and including 0 and 10. Subtract 5 from this range and you get a r... Date Added: 2009-06-03 23:58:40 |
| 09-Cost Analysis HW.doc Path: Texas A&M >> ENTC >> 429 Fall, 2008 Description: 429 Homework Name _ 12. a) Refer to the first table on page 276 (3e) or page 287 (6e). What is the cumulative budgeted cost at the end of week 6? b) Refer to the second table on page 276 (3e) or page 287 (6e). What is the cumulative actual cost ... Date Added: 2009-06-03 23:59:11 |
| 690f057.ppt Path: Maryland >> UMIACS >> 690 Fall, 2003 Description: Databases Week 7 LBSC 690 Information Technology Agenda Questions Relational database design Microsoft Access Databases Database Collection of data, organized to support access Models some aspects of reality DataBase Management System (DBMS... Date Added: 2009-06-03 23:59:59 |
| lx865f04-8-neurons.ppt Path: BU >> LX >> 865 Fall, 2009 Description: GRS LX 865 Topics in Linguistics Week 8. Neurons and impoverished stimuli Rules and brains (Generative) linguistics has traditionally been done in term of symbolic rules. S NP VP V[past] V + ed / d / t But people studying neurophysiology compla... Date Added: 2009-06-04 00:00:18 |
| geog135- Regulations of Carbon Trading.ppt Path: UCSB >> GEOG >> 135 Fall, 2009 Description: Regulations of Carbon Trading R.J. Van Sant Steve Zhao 8-16-05 Summary Country Categories (Annex I, Annex II, Non-Annex I) CDM, Clean Development Mechanism Distribution of AAU\'s Current and proposed regulations Country Categories Annex I A de... Date Added: 2009-06-04 00:00:53 |
| Assignment 1_PSOV.doc Path: Oregon State >> BA >> 471 Fall, 2008 Description: Assignment 1 BA471 Summer 2005: Based on a Mini-Case on Pollution Solutions of Vermont (PSOV) Adapted from: Information Technology and Management by Thompson and Cats-Baril Due Date: (Wednesday) June 29, 2005 Mini-Case on PSOV: The Industry The haz... Date Added: 2009-06-04 00:01:08 |
| irm10.doc Path: Oregon State >> BA >> 469 Fall, 2008 Description: CHAPTER 10 Corporate Strategy: Diversification, Acquisitions, and Internal New Ventures 0SYNOPSIS OF CHAPTER This chapter continues the discussion of corporate strategy that was begun in Chapter 9. Diversification into more than one business is the ... Date Added: 2009-06-04 00:01:11 |
| BA 352 lecture ch2.ppt Path: Oregon State >> BA >> 352 Fall, 2008 Description: Chapter Two Cultivating Organizational Culture and Ethical Behavior 2-1a Chapter Two Outline Foundation of Organizational Culture Foundation of Organizational Culture Layers of Organizational Culture Four Functions of Organizational Culture Type... Date Added: 2009-06-04 00:01:17 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 289 Fall, 2009 Description: \"i 5194,25386,1877,1584 :-%* 17277,34516,853,6483 caren 37611,33322,2303,7036 heft 44316,33364,2261,5267 ... Date Added: 2009-06-04 00:01:51 |
| license.txt Path: Texas >> ISCHOOL >> 2081 Fall, 2009 Description: License granted by Janice Carter (jc5767a@yahoo.com) on 2006-04-26T14:20:10Z (GMT): NOTE: PLACE YOUR OWN LICENSE HERE This sample license is provided for informational purposes only. NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting thi... Date Added: 2009-06-04 00:03:01 |
| license.txt Path: Texas >> ISCHOOL >> 5315 Fall, 2009 Description: License granted by Janice Carter (jc5767a@yahoo.com) on 2006-04-26T14:20:10Z (GMT): NOTE: PLACE YOUR OWN LICENSE HERE This sample license is provided for informational purposes only. NON-EXCLUSIVE DISTRIBUTION LICENSE By signing and submitting thi... Date Added: 2009-06-04 00:03:02 |
| Answer of Assignment Path: Seneca >> BUSINESS >> AIT 707 Winter, 2009 Description: Answer for Question 1 1). Prepare Jean Incs consolidated Balance Sheet on the date of acquisition using the Proprietary Theory. Calculation of Purchase Discrepancy (proprietary theory) Cost of 90 percent investment in John Inc. Sharehoulders\' equity... Date Added: 2009-06-04 09:16:55 |
| dynamic-prog-practice.ps Path: Washington University in St. Louis >> CS >> 441 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: dynamic-prog-practice.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o dynamic-prog-practice %+ dynamic-prog-pr... Date Added: 2009-06-04 13:14:17 |
| se386Gradebook2005spr04_01.xls Path: Wisc Platteville >> SE >> 386 Spring, 2009 Description: SE386 4163 2234 6382 4167 3839 4147 1509 6068 88 433 5439 2792 500 2103 2947 7947 5298 7647 1123 Software Maintenance Lab01 Lab02 Lab03 Lab04 19 19.2 19.5 24.4 18.9 19.2 19.5 24.6 18.9 19.2 19.5 24.6 19 17.8 17.6 23.8 19 17.8 17.6 23.8 18.9 19.2 19.... Date Added: 2009-06-04 13:15:31 |
| 2004-9-03Republicans Try to Expand Appeal to Religious Voters.txt Path: Western Kentucky University >> TXT >> 102 Fall, 2009 Description: Republicans Try to Expand Appeal to Religious Voters September 3, 2004 By DAVID D. KIRKPATRICK and MICHAEL SLACKMAN The Republicans used their convention to court deeply religious voters among two different, traditionally Democratic groups, Roman... Date Added: 2009-06-04 13:19:05 |
| #02_SPAWAR_Nxt_Robots_&_Machine_Learning.doc Path: UCSD >> ECE >> 191 Fall, 2004 Description: ECE191 W 2007 Student Project #2 Title: Nxt Robots and Their Applications in Machine Learning Sponsoring Group: SPAWAR (SSC San Diego) Mentor: Anjum Gupta 858-337-2018 Gupta@spawar.navy.mil Introduction: Our work will involve implementing and experi... Date Added: 2009-06-04 13:21:54 |
| 0919.txt Path: Virginia Tech >> CS >> 5604 Fall, 1995 Description: Daily summary 9/19 Chris Ye Today we discussed the unit SS part B in class. Mainly, we concentrated on \"Shift-Or\" operation. The \"Shift-Or\" operation represents the position of a entry which occurs in the pattern. Also we started the ... Date Added: 2009-06-04 13:23:09 |
| Demo10.ps Path: Neumont >> IFT >> 1571 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: R:/BOULO/COURS/IFT1571/Demo2003a/Demo10.dvi %CreationDate: Fri Nov 14 12:20:44 2003 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMBX10 CMR10... Date Added: 2009-06-04 13:23:20 |
| ee331a3s.ps Path: Mich Tech >> EE >> 331 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 Copyright 1986-91 Radical Eye Software %Title: ee331a3s.dvi %Pages: 2 1 %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: tex.pro /TeXDict 200 dict def TeXDict begin /N /def load def /B{bind def}N /S /exch load... Date Added: 2009-06-04 13:24:25 |
| q33.txt Path: Carleton >> BIO >> 125 Fall, 2009 Description: Q 33 Study the structural basis of antibody function.... Date Added: 2009-06-04 13:24:56 |
| bx-update.ppt Path: UCSD >> VLSICAD >> 200303 Fall, 2009 Description: GSRC bX update March 2003 Aaron Ng, Marius Eriksen and Igor Markov University of Michigan DUSD(Labs) Outline x x x x x Motivation, issues in benchmarking bX in the picture Sample application: Evaluation of tools Future focus Contact info, links ... Date Added: 2009-06-04 13:26:49 |
| words2.txt Path: Wisconsin Milwaukee >> LIB >> 1257 Fall, 2009 Description: \"saj^der 24783,47268,433,10637 \'^sais\'de 21792,13308,402,10795 1858 48645,52242,821,2608 ; 61554,24075,1022,427 ^kimk 39851,3780,1859,9828 a 17249,30443,759,967 a 21117,32178,759,967 according 26290,52257,588,5622 act 33464,52180,604,2091 allowed 191... Date Added: 2009-06-04 13:27:03 |
| key5.doc Path: Clarkson >> CM >> 241 Fall, 2009 Description: CM241-01 1. CH3 H H CH3 a H CH3 H H3C Hour Exam II Key 10/26/2002 CH3 H H CH3 b H H3C H H CH3 CH3 c H H3C H3C H d CH3 H H H CH3 H H H3C H H H3C CH3 e H3C CH3 f a) b) c) d) e) f) 0.9 (kcal/mol) 0.9 (kcal/mol) 0.9 + 0.9 = 1.8 (kcal/mol) 1... Date Added: 2009-06-04 13:27:14 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2848 Fall, 2009 Description: ! 20294:40982:443:1074 \" 5450:40956:1196:419 5051:15984:1240:445 21667:47349:1196:471 5051:18054:1373:445 5228:24343:1196:419 21357:41034:1107:419 5317:34745:1240:419 5051:20124:1373:471 \"n 5272:53297:5804:1231 &the 12008:15984:6026:1126 *ha 2791:325... Date Added: 2009-06-04 13:27:19 |
| SPAN606-29-PolLing2.ppt Path: Tulane >> SPAN >> 606 Fall, 2009 Description: Polticas lingsticas Da 27 Bilingismo hispnico SPAN 606 Harry Howard Tulane University Administracin No hay nada nuevo. 17/05/09 SPAN 606 - Harry Howard - Tulane University 2 Polticas lingsticas 2 Siguan 14 Zentella, A. C. (1997). The Hispanoph... Date Added: 2009-06-04 13:34:14 |
| ch08 - Arrays.ppt Path: SIU Edwardsville >> CMIS >> 142 Summer, 2008 Description: Objectives 1. 2. 3. 4. 5. 6. 7. 8. 9. Set up and use a control array. Code selection logic use a Select Case statement. Establish an array of variables and refer to individual elements in the array with variable subscripts. Use the For Each.Next stat... Date Added: 2009-06-04 13:34:30 |
| ethno2.doc Path: Bowling Green >> R >> 012671 Fall, 2009 Description: Roderick O. Nixon April 10, 2003 English 3090 \"Home away from Home\" In my ethnography study, I chose a West African family from Gambia. I chose this family through a co-worker named of Suw Jaetah. Suw\'s humble, and his nationality is not American. C... Date Added: 2009-06-04 13:36:07 |
| Apr18.doc Path: UMass Lowell >> FACULTY >> 475 Fall, 2009 Description: For Thursday: read 8.3 Section 8.2: Stirling numbers Fix a non-negative integer p. One basis for the space of polynomials of degree p is the \"monomial basis\" {n^0, n^1, n^2, ., n^p}; another basis is {(n choose 0), (n choose 1), ., (n choose p)}; an... Date Added: 2009-06-04 13:36:18 |
| hum161d01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HUM 161-3 D01 LOCATION: SFU TITLE: LATIN I SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 32... Date Added: 2009-06-04 13:36:42 |
| gero300d01.txt Path: Sveriges lantbruksuniversitet >> ARTS >> 19963 Fall, 2009 Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: GERO 300-3 D01 LOCATION: DOW TITLE: INTRO TO GERONTOLOGY SECTION TYPE: LEC SEMESTER: 1996-3 ENROL: 25... Date Added: 2009-06-04 13:37:20 |
| HTML_OK.txt Path: BU >> CS >> 655 Fall, 2009 Description: No. Time Source Destination Protocol Info 16 17.527422 128.119.245.12 192.168.1.105 HTTP HTTP/1.1 200 OK (text/html) Frame 16 (489 bytes on wire, 489 bytes captured) Arrival Time: Aug... Date Added: 2009-06-04 13:37:51 |
| output.txt Path: Washington >> JOBS >> 72000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-1Z4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3308 02/17/2008 05:22 PM <DIR> . 02/17/2008 05:22 ... Date Added: 2009-06-04 13:38:28 |
| WC3.ppt Path: Maple Springs >> ATKINSON >> 1740 Fall, 2009 Description: Recap Astronomical Observations What can be observed and measured through the optical telescopes ? Why is a shirt red ? Why is it black ? Why is the sky blue ? (explain in terms of reflection/refraction) What is the origin of the black lin... Date Added: 2009-06-04 13:40:51 |
| Donnan.ppt Path: Kent State >> GEOG >> 37066 Fall, 2008 Description: Generalitat de Catalunya Introduction and History of Catalonia Current Situation Regarding Catalonian Independence Catalonia Population: 7 Million Capital: Barcelona Language: Catalan Hello: hola Good-bye: adu, adu, siau Please: si us plau ... Date Added: 2009-06-04 13:41:05 |
| oommfreadme.txt Path: Alabama >> PH >> 586 Fall, 2008 Description: README: OOMMF Object Oriented MicroMagnetic computing Framework Release 1.2a3 This file last modified on: $Date: 2002/10/29 21:31:28 $ OOMMF is a project in the Mathematical and Computational Sciences Division (MCSD) of ITL/NIST aimed at developi... Date Added: 2009-06-04 13:42:38 |
| quiz4_ans.txt Path: Binghamton >> CS >> 350 Fall, 2009 Description: 1: a) 2: Many answers possible. 3: Many answers possible. 4: Many answers possible. ... Date Added: 2009-06-04 13:43:19 |
| output.txt Path: Washington >> JOBS >> 60388 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-C2WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2760 02/13/2008 09:48 PM <DIR> . 02/13/2008 09:48 ... Date Added: 2009-06-04 13:44:50 |
| DocAnatCirculation.doc Path: Tusculum >> HOME >> 102 Fall, 2009 Description: CIRCULATORY SYSTEM I. INTRODUCTION A. Functions 1. To bring nutrients to the body cells and remove wastes a) Blood is a connective tissue that serves to connect body cells to organs that interact with the external environment (1) Blood connects body ... Date Added: 2009-06-04 13:46:41 |
| proccap.ppt Path: MO St. Louis >> PPTS >> 4326 Fall, 2009 Description: Process Control Charts Plot of Sample Data Over Time 80 Sample Value 60 40 20 0 1 5 9 13 17 Time 6-1 Upper control limit Lower control limit 21 Control Charts Process is not in control if: Sample is not between upper and lower control limits.... Date Added: 2009-06-04 13:47:14 |
| arm_hand.ppt.ppt Path: Texas State >> HPER >> 3320 Fall, 2009 Description: Quiz on Arm and Hand Muscles Directions: Please answer the questions shown in the following slides. When you have answered incorrectly, you will be taken back to the previous slide. If you answer correctly you will proceed to the next slide. Please f... Date Added: 2009-06-04 13:47:47 |
| 521.txt Path: USC >> CS >> 551 Fall, 2008 Description: Return-Path: william@bourbon.usc.edu Delivery-Date: Mon Nov 24 19:57:55 2008 X-Spam-Checker-Version: SpamAssassin 3.2.3 (2007-08-08) on merlot.usc.edu X-Spam-Level: X-Spam-Status: No, score=-2.4 required=5.0 tests=AWL,BAYES_00 autolearn=ham version... Date Added: 2009-06-04 13:49:31 |
| SSRD_IOC_S07B_T08_v5.2.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: System and Software Requirements Definition (SSRD) Student Progress Web Application Team 8 NAME Ashish Singh Ritesh Taunk Amarkanth Ranganamayna Ritesh Kothari Patrick Stevens Yue Chen Mike Oppenheim ROLE Project Manager Developer V&V Developer V... Date Added: 2009-06-04 13:49:36 |
| javagrammar.ppt Path: UConn >> CSE >> 298300 Fall, 2009 Description: http:/java.sun.com/docs/books/jls/index.html http:/java.sun.com/docs/books/jls/second_edition/html/j.title.doc.html The Java Language Grammar Contents | Prev | Next | Index CSE244 Java Language Specification Second Edition --CHAPTER 18 Syntax -Th... Date Added: 2009-06-04 13:52:57 |
| RoseRT-RTS-Eclipse.doc Path: ASU >> PUB >> 540 Fall, 2009 Description: Configuring Rose RT RTS with RSx/Eclipse 1. Setup Ensure you have the appropriate compilation tools in your PATH variable. Eclipse will also want include files for standard header files. Since we are using 2. Add the RTS project to the workspace Crea... Date Added: 2009-06-04 13:56:25 |
| vico.ppt Path: ASU >> PUBLIC >> 472 Fall, 2009 Description: Giambattista Vico 1668-1744 Giambattista Vico 1668-1744 Italian philosopher, Lawyer, historian, student of ancient Rome, rhetorician born in Naples, Italy, June 23, 1668; d. there, Jan. 22 or 23, 1744 attended a Jesuit school, and was for a t... Date Added: 2009-06-04 13:56:26 |
| lab05w96.doc Path: Grand Valley State >> ENGINEER >> 103 Fall, 2009 Description: 960731 Grand Valley State University Padnos School of Engineering EGR 103 Lab Exercise 5 The Discrete Uniform Distribution Objectives To introduce the discrete uniform probability mass distribution and describe how its mean, variance and stan... Date Added: 2009-06-04 13:56:57 |
| citepuzzle.doc Path: U. Houston >> CUIN >> 3111 Fall, 2008 Description: CITE Puzzle H B S O W C G D P O H E D I Z F I B D T G O H P L T X N Z W K H P Q H H M I B R Y L M O R U L W I E F R R I H S X A I O O C G E A C C L V T O D C V E I L Y S N G I D G P S J I L F N Q J G L E C C O R N N P J J A R J I B B I S C T C Y F F ... Date Added: 2009-06-04 13:58:20 |
| 3a.ppt Path: Portland >> CS >> 533 Winter, 2008 Description: CS533 Concepts of Operating Systems Class 3a Spin Lock Performance Introduction Shared memory multiprocessors o o Various different architectures All have hardware support for mutual exclusion Various flavors of atomic readmodify instruction ... Date Added: 2009-06-04 14:02:22 |
| 33.ppt Path: Portland >> CS >> 533 Winter, 2008 Description: CS533 Concepts of Operating Systems Class 3 Monitors Questions Which multithreaded programming problems do monitors address? Are monitors useful as a programming convention, i.e., without compiler support? o With compiler support for moni... Date Added: 2009-06-04 14:02:23 |
| Lecture_A_9_Morphisms.Homo.Iso.ppt Path: Portland >> CLASS >> 573 Fall, 2009 Description: Morphisms of State Machines Sequential Machine Theory Prof. K. J. Hintz Department of Electrical and Computer Engineering Lecture 7 Updated and adapted by Marek Perkowski Notation A relation A function + A binary operation called multiplication... Date Added: 2009-06-04 14:02:33 |
| 171.ppt Path: Portland >> CS >> 533 Winter, 2008 Description: Soft Timers : Efficient Microsecond Software Timer Support for Network Processing - Mohit Aron & Peter Druschel CS533 Winter 2007 Motivation Conventional timer facilities schedule events by hardware interrupts Interrupts and Context Switches are ... Date Added: 2009-06-04 14:02:41 |
| Royalty2002.doc Path: Texas A&M >> DOCS >> 319 Fall, 2009 Description: Royalty Pecan - Field Trip Questions HORT 319 - Temperate Fruit and Nut Production 1. Describe the site characteristics. Air drainage: Soil type and internal drainage: Water supply: Accessibility of the site: 2. What pecan varieties do they grow? Whi... Date Added: 2009-06-04 14:04:00 |
| FDOC_self_enrollment.ppt Path: Nevada >> JM >> 182 Spring, 2009 Description: Welcome to WebAssign! 1st Day of Class Spring 2009 January 13, 2009 How to Self-Enroll in WebAssign Your instructor has decided to allow students to selfenroll into this WebAssign course. Please go to the login page at https:/www.webassign.net/logi... Date Added: 2009-06-04 14:04:28 |
| LightBulbsII.doc Path: Texas A&M >> PHYS >> 205 Fall, 2008 Description: PHYS 205 Light Bulb Circuits - II Objectives: Construct combination light bulb circuits Compare brightness of bulbs within and across circuits Observe and explain changes in bulb brightness within a circuit as specified individual bulbs \"go out\" ... Date Added: 2009-06-04 14:04:41 |
| stargaradts.hughes.doc Path: SFASU >> SPE >> 516 Summer, 2008 Description: Stargardt\'s Disease Description: A rare form of macular degeneration. It is one of the most common forms of inherited juvenile macular degeneration. It begins to damage the eyes sometime between the ages of 6 and 20 but visual impairment may not show... Date Added: 2009-06-04 14:06:21 |
| log.txt Path: Washington >> V >> 16664 Fall, 2009 Description: 000 (50159.000.000) 02/05 08:52:22 Job submitted from host: <128.95.94.28:1098> . 001 (50159.000.000) 02/05 11:53:13 Job executing on host: <172.25.101.174:1075> . 006 (50159.000.000) 02/05 12:13:21 Image size of job updated: 401648 . 010 (50159.000.... Date Added: 2009-06-04 14:09:55 |
| problem34_84.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 34.84: a)Treating each of the goblet surfaces as spherical surfaces, we have to pass, from left to right, through four interfaces. For the empty goblet: n a n b nb n a 1 1.50 0.50 + = + = s1 = 12 cm s s R s1 4.00 cm 1.50 1 0.50 s 2 = 0.60 cm ... Date Added: 2009-06-04 14:11:41 |
| submit.txt Path: Washington >> V >> 11500 Fall, 2009 Description: executable = allgamma_11581.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs11500-11999/11... Date Added: 2009-06-04 14:17:06 |
| error.txt Path: Washington >> JOBS >> 10467 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 03:17:03 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 03:27:58 2008 ( 655 s elapsed) ... Date Added: 2009-06-04 14:21:06 |
| error.txt Path: Washington >> JOBS >> 10088 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 02:44:40 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 03:07:11 2008 ( 1351 s elapsed) ... Date Added: 2009-06-04 14:23:01 |
| submit.txt Path: Washington >> V >> 15382 Fall, 2009 Description: executable = allgamma_15382.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs15000-15499/15... Date Added: 2009-06-04 14:23:02 |
| error.txt Path: Washington >> JOBS >> 10398 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 03:09:01 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 03:19:47 2008 ( 646 s elapsed) ... Date Added: 2009-06-04 14:24:14 |
| output.txt Path: Washington >> JOBS >> 10000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-JZHWHB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_868 02/07/2008 02:42 AM <DIR> . 02/07/2008 02:42 A... Date Added: 2009-06-04 14:25:08 |
| ex2.doc Path: UPR Mayagüez >> INEL >> 4206 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|19 Mar 2003 13:18:30 -0000 vti_extenderversion:SR|5.0.2.3409 vti_author:SR|CHURCH\\bvelez vti_modifiedby:SR|CHURCH\\bvelez vti_timecreated:TR|19 Mar 2003 13:18:30 -0000 vti_cacheddtm:TX|19 Mar 2003 13:18:... Date Added: 2009-06-04 14:28:05 |
| lecture13.ppt Path: Berkeley >> IS >> 213 Spring, 1999 Description: SIMS 213: User Interface Design & Development Marti Hearst Tues, March 7, 2006 Today Content Layout Technique: Wireframing Graphic Design Wireframing What is the main idea? Separate content from layout and display Graphic Design: Use the page la... Date Added: 2009-06-04 14:28:17 |
| BG205-Module02-part1-script.txt Path: Colorado State >> MOD >> 205 Fall, 2009 Description: <title=\"BG205_Module02_part1\"> <!stamp=\"BG205-Module02-part1-imp.jar 691231 17:00:00\"> <s=\"Title Slide\"> <t=> <!slideid=\"393\"> <video=\"> PROFESSOR RAY HOGLER Welcome to Fundamentals of Business Law. In a second we\'re going to talk further about ri... Date Added: 2009-06-04 14:29:55 |
| rn.txt Path: CSU San Bernardino >> ETEC >> 544 Fall, 2009 Description: Richard Milhous Nixon was born in Yorba Linda, California on January 9, 1913. Nixon grew up in Whittier, California. Nixon went to Whittier College and the Duke University School of Law. He was married to Patricia Ryan in 1940. In 1942, Richard ... Date Added: 2009-06-04 14:30:11 |
| rn.txt Path: CSU San Bernardino >> WIN >> 544 Fall, 2009 Description: Richard Milhous Nixon was born in Yorba Linda, California on January 9, 1913. Nixon grew up in Whittier, California. Nixon went to Whittier College and the Duke University School of Law. He was married to Patricia Ryan in 1940. In 1942, Richard ... Date Added: 2009-06-04 14:30:11 |
| WeeklyTemplate.xls Path: Erskine >> ES >> 101 Fall, 2009 Description: <Name> Time 06:00 AM 06:30 AM 07:00 AM 07:30 AM 08:00 AM 08:30 AM 09:00 AM 09:30 AM 10:00 AM 10:30 AM 11:00 AM 11:30 AM 12:00 PM 12:30 PM 01:00 PM 01:30 PM 02:00 PM 02:30 PM 03:00 PM 03:30 PM 04:00 PM 04:30 PM 05:00 PM 05:30 PM Monday Tuesday Wednesd... Date Added: 2009-06-04 14:30:29 |
| 04_11.txt Path: Erskine >> PH >> 202 Fall, 2009 Description: <strong>These warmups refer to the homework that is due on Thursday. Again, please let me know if you are still having trouble with either of the first two. The trick on those is to make sure you are writing your answers in terms of the actual mass... Date Added: 2009-06-04 14:30:34 |
| 10_30.txt Path: Erskine >> PH >> 110 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|28 Oct 2000 20:12:05 -0000 vti_extenderversion:SR|4.0.2.2717 ... Date Added: 2009-06-04 14:30:51 |
| ref.doc Path: CSU Northridge >> VCHSC >> 006 Fall, 2009 Description: Environmental Health II Selected References -, \"Radiation health impacts studied at DOE sites,\" Environmental science and technology 30(12): 526A, 1996. -, The Role of Short-Term Tests in Evaluating Health Effects Associated With Drinking Water, Jou... Date Added: 2009-06-04 14:31:48 |
| BPds01.xls Path: Humboldt State University >> MDJ >> 365 Fall, 2009 Description: Black Phoebe Territoriality Project Team members: Date: Time: Weather: Location: Playback type (circle one): Black-Phoebe (experiment) or Red-winged Blackbird (control) Raw Data: Movement Behavior Vocal Behavior Agonistic Behavior # flights closes... Date Added: 2009-06-04 14:31:54 |
| klbasis17.txt Path: Utah >> SPIN >> 143 Fall, 2009 Description: Block 17: - 0: 0: 1 1: 0: 1 1: 1 2: 0: 1 2: 1 3: 0: 1 2: 1 3: 1 4: 0: 1 2: 1 3: 1 4: 1 5: 0: 1 2: 1 3: 1 4: 1 5: 1 6: 0: 1 2: 1 3: 1 4: 1 6: 1 7: 0: q 2: q 3: q 6: 1 7: 1 8: 0: 1 2: 1 3: 1 4: 1 5: 1 6: 1 8: 1 9: 0:... Date Added: 2009-06-04 14:33:51 |
| 3530w09gradepostsec2.xls Path: UCF >> ISM >> 3530 Fall, 2008 Description: ISM 3530.0002 - SPRING 2009 MW 12:00-1:15 BA2 103 Exam #1 Number Exam Correct 35 34 32 30 33 35 33 29 35 31 31 29 34 33 32 30 34 32 32 33 30 30 24 30 31 29 32 30 Grade 106 103 97 91 100 106 100 88 106 94 94 88 103 100 97 91 103 97 97 Here are the ex... Date Added: 2009-06-04 14:35:36 |
| error.txt Path: Washington >> V >> 11000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 10:32:44 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 11:41:35 2007 ( 4131 s elapsed) ... Date Added: 2009-06-04 14:36:38 |
| submit.txt Path: Washington >> JOBS >> 31425 Fall, 2009 Description: executable = pass6_31425.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31000-31499/31425... Date Added: 2009-06-04 14:37:48 |
| log.txt Path: Washington >> JOBS >> 31124 Fall, 2009 Description: 000 (56122.000.000) 02/10 19:08:11 Job submitted from host: <128.95.94.28:1098> . 001 (56122.000.000) 02/10 19:16:17 Job executing on host: <172.25.101.162:1060> . 006 (56122.000.000) 02/10 19:36:25 Image size of job updated: 388432 . 005 (56122.000.... Date Added: 2009-06-04 14:39:41 |
| log.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: 000 (56101.000.000) 02/10 19:08:06 Job submitted from host: <128.95.94.28:1098> . 001 (56101.000.000) 02/10 19:11:33 Job executing on host: <172.25.101.170:1059> . 006 (56101.000.000) 02/10 19:31:41 Image size of job updated: 444608 . 006 (56101.000.... Date Added: 2009-06-04 14:39:52 |
| error.txt Path: Washington >> V >> 11101 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 08:00:25 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 09:14:47 2007 ( 4462 s elapsed) ... Date Added: 2009-06-04 14:39:52 |
| error.txt Path: Washington >> JOBS >> 31000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 21:16:28 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 10 21:59:17 2008 ( 2569 s elapsed) ... Date Added: 2009-06-04 14:40:34 |
| submit.txt Path: Washington >> V >> 11000 Fall, 2009 Description: executable = allgamma_11481.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11000-11499/11... Date Added: 2009-06-04 14:42:24 |
| error.txt Path: Washington >> V >> 11000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 06:56:52 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 07:55:01 2007 ( 3489 s elapsed) ... Date Added: 2009-06-04 14:43:08 |
| particleinabox.xls Path: Illinois State >> CHE >> 362 Fall, 2008 Description: Particle in an unidimensional box length of box particle mass n 1 2 3 4 5 6 7 8 9 10 11 12 13 a 1.00E-09 m m 9.11E-31 kg E (ev) 0.38 1.51 3.39 6.03 9.43 13.57 18.47 24.13 30.54 37.70 45.62 54.29 63.71 Enter a quantum number below (between 1 and 150)... Date Added: 2009-06-04 14:51:20 |
| cs641_22.ps Path: UWO >> CS >> 641 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: xpdf/pdftops 0.90 (decryption) %Pages: 44 %EndComments %BeginProlog %BeginResource: xpdf 0.90 (decryption) /xpdf 75 dict def xpdf begin % PDF special state /pdfDictSize 14 def /pdfSetup { 2 array astore /setpagedevice where {... Date Added: 2009-06-04 14:51:54 |
| interpreter-structure.txt Path: Iowa State >> COMS >> 342 Fall, 2009 Description: CS 342 Lecture -*- Outline -*- * the LISP interpreter basically same as chapter 1 starts to make the point about solving a number of related problems with a small piece of code * rep for S-expressions note how this mimics def (page 26 vs. 38)... Date Added: 2009-06-04 14:55:15 |
| problem32_06.doc Path: Virginia Tech >> PHYS >> 2306 Spring, 2008 Description: 32.6: a) x direction. 2 2 f kc (1.38 10 4 rad m) (3.0 108 m s) b) k = = f= = = 6.59 1011 Hz. c 2 2 c)Since the magnetic field is in the + y -direction, and the wave is propagating in the x -direction, then the electric field is in the + z -dire... Date Added: 2009-06-04 14:56:01 |
| SAM-presentation.ppt Path: North-West Uni. >> ME >> 381 Fall, 2009 Description: Friction Reduction in Micro-motors using Self-Assembled Monolayers ME 395 Project Y. Zhu, J. Gregie & P. Prabhumirashi 5th June, 2000 SAM used in Micro-motors Micro-motor is operating based on the electrostatic-drive principles. It\'s composed of thr... Date Added: 2009-06-04 14:56:15 |
| output.txt Path: Washington >> V >> 17000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-715QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2736 02/06/2008 03:38 AM <DIR> . 02/06/2008 03:38 ... Date Added: 2009-06-04 14:57:04 |
| submit.txt Path: Washington >> V >> 17000 Fall, 2009 Description: executable = allgamma_17466.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs17000-17499/17... Date Added: 2009-06-04 14:58:39 |
| error.txt Path: Washington >> V >> 17000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 05 23:58:30 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 06 01:10:00 2008 ( 4290 s elapsed) ... Date Added: 2009-06-04 14:58:50 |
| output.txt Path: Washington >> V >> 17000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-9Z4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2452 02/06/2008 02:48 AM <DIR> . 02/06/2008 02:48 ... Date Added: 2009-06-04 14:59:10 |
| error.txt Path: Washington >> V >> 17000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 06 00:00:07 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 06 01:16:56 2008 ( 4609 s elapsed) ... Date Added: 2009-06-04 14:59:20 |
| log.txt Path: Washington >> V >> 17000 Fall, 2009 Description: 000 (50545.000.000) 02/05 23:53:08 Job submitted from host: <128.95.94.28:1098> . 001 (50545.000.000) 02/05 23:55:28 Job executing on host: <172.25.101.196:1055> . 006 (50545.000.000) 02/06 00:15:37 Image size of job updated: 50280 . 006 (50545.000.0... Date Added: 2009-06-04 14:59:43 |
| error.txt Path: Washington >> V >> 17000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 06 02:29:33 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 06 03:35:55 2008 ( 3982 s elapsed) ... Date Added: 2009-06-04 14:59:54 |
| log.txt Path: Washington >> V >> 17000 Fall, 2009 Description: 000 (50710.000.000) 02/05 23:54:13 Job submitted from host: <128.95.94.28:1098> . 001 (50710.000.000) 02/06 01:20:29 Job executing on host: <172.25.101.169:1062> . 006 (50710.000.000) 02/06 01:40:38 Image size of job updated: 373872 . 005 (50710.000.... Date Added: 2009-06-04 15:00:21 |
| Diner-Payroll.xls Path: Penn State >> KZM >> 133 Fall, 2009 Description: El Centro Diner Payrol Report Employee Vincent Flores Wonda Jefferson Anthony Sanchez Alexa Martin Maria Reyes Lori Romanoff Carmen Alvarez Peter Lane Claudi Moreno Wayne Vargas Totals Average Highest Lowest Depende Rate per Hours nts Hour Worked Gro... Date Added: 2009-06-04 15:00:51 |
| log.txt Path: Washington >> JOBS >> 30379 Fall, 2009 Description: 000 (55376.000.000) 02/10 07:49:40 Job submitted from host: <128.95.94.28:1098> . 001 (55376.000.000) 02/10 09:57:11 Job executing on host: <172.25.101.49:4352> . 006 (55376.000.000) 02/10 10:17:19 Image size of job updated: 448944 . 006 (55376.000.0... Date Added: 2009-06-04 15:02:52 |
| log.txt Path: Washington >> JOBS >> 30160 Fall, 2009 Description: 000 (55157.000.000) 02/10 07:48:24 Job submitted from host: <128.95.94.28:1098> . 001 (55157.000.000) 02/10 08:35:58 Job executing on host: <172.25.101.195:3627> . 006 (55157.000.000) 02/10 08:56:06 Image size of job updated: 449036 . 006 (55157.000.... Date Added: 2009-06-04 15:03:08 |
| log.txt Path: Washington >> JOBS >> 30261 Fall, 2009 Description: 000 (55258.000.000) 02/10 07:48:51 Job submitted from host: <128.95.94.28:1098> . 001 (55258.000.000) 02/10 09:15:24 Job executing on host: <172.25.101.85:1056> . 006 (55258.000.000) 02/10 09:35:32 Image size of job updated: 448916 . 006 (55258.000.0... Date Added: 2009-06-04 15:04:09 |
| submit.txt Path: Washington >> JOBS >> 30220 Fall, 2009 Description: executable = pass6_30220.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30220... Date Added: 2009-06-04 15:05:13 |
| submit.txt Path: Washington >> JOBS >> 30361 Fall, 2009 Description: executable = pass6_30361.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs30000-30499/30361... Date Added: 2009-06-04 15:06:34 |
| output.txt Path: Washington >> JOBS >> 30217 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS5 - local directory - Volume in drive C has no label. Volume Serial Number is FE9C-6B88 Directory of C:\\condor\\execute\\dir_2804 02/10/2008 08:42 AM <DIR> . 02/10/2008 08:42 AM <D... Date Added: 2009-06-04 15:06:42 |
| lepidopteralab.ppt Path: Minnesota >> ENTOMOLOGY >> 4015 Fall, 2009 Description: Introduction to Lepidoptera Dr. Vera Krischik, Department of Entomology, University of Minnesota Gypsy Moth Lymantria dispar Family Lymantriidae Introduced pest Hosts: Oak, apple, crabapple, aspen, poplar, basswood, birch, blue spruce, and over 300... Date Added: 2009-06-04 15:08:54 |
| qz1.ps Path: NJIT >> CIS >> 668 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: qz1.dvi %Pages: 5 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMCSC10 CMMI12 CMR8 CMMI8 CMSY10 %EndComments %DVIPSWebPage: (www.radicaley... Date Added: 2009-06-04 15:09:52 |
| pa1.ps Path: NJIT >> CIS >> 668 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: pa1.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR10 CMTT10 CMTI10 CMBX10 CMMI12 CMMI10 CMSY10 %EndComments %DVIPSWebPage: (www.... Date Added: 2009-06-04 15:09:53 |
| depressionculture.ppt Path: George Mason >> HIST >> 395 Fall, 2009 Description: Politics and Culture during the Great Depression Politics and Movies > Frank Capra, Meet John Doe, 1941 Politics and Movies > The Marx Brothers, Duck Soup, 1933 Politics and Radio > Orson Welles, \"War of the Worlds,\" 1938 Historical Research and ... Date Added: 2009-06-04 15:10:00 |
| MIPPeakMaximaRun0307part0.txt Path: Yale >> NOV >> 0307 Fall, 2009 Description: Run number 0307part0 Towers which were not necessarily isolated0307part0 tower 1 column 4 row 0 MIP max 7.5 mean 8.68997 RMS 4.09011 number of entries 36087 rms/mean 0.47067 tower 2 column 5 row 0 MIP max 5.5 mean 7.83686 RMS 6.52451 number of entrie... Date Added: 2009-06-04 15:10:47 |
| input1.txt Path: Maple Springs >> ITEC >> 2620 Fall, 2009 Description: f 5 5 i 10 5 i 10 7 i 10 12 i 10 1 i 10 3 p d 8 8 d 10 2 d 10 7 d 10 1 d 10 12 i 10 15 i 10 2 d 12 15 p i 5 10 i 2 10 i 4 10 i 6 10 i 8 10 i 15 10 i 14 10 i 12 10 i 18 10 i 16 10 f 1 10 f 2 8 f 2 10 f 2 12 f 3 10 p i 5 5 i 5 15 i 5 12 i 5 3 p d 4 8 d... Date Added: 2009-06-04 15:10:54 |
| 00F.ps Path: Los Angeles Southwest College >> M >> 550 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.85 Copyright 1999 Radical Eye Software %Title: 00F.dvi %Pages: 7 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips 00F -o %DVIPSParameters: dpi=1... Date Added: 2009-06-04 15:11:07 |
| Brake Parts and Wheels.doc Path: RIT >> P >> 08004 Fall, 2009 Description: Brake Caliper Brake Lever Casters Brake Cable ... Date Added: 2009-06-04 15:11:15 |
| muxtree.cc.txt Path: University of Illinois, Urbana Champaign >> ECE >> 541 Fall, 2008 Description: /* * muxtree :- a tree of multiplexers. * * Muxtree is a model that builds a simple network of ssf * entities. The topology of this model is a tree: the leaves of the * tree are traffic sources and the interior nodes (including the * root) of t... Date Added: 2009-06-04 15:11:34 |
| list6.txt Path: U. Memphis >> COMP >> 1200 Fall, 2008 Description: Test Bank Computer Confluence, 3rd Edition Chapter 6: Calculation, Visualization, and Simulation 1) The first computer spreadsheet program was developed by A) Dan Bricklin and Bob Frankston B) Steve Wozniak and Steven Jobs C) George Beekman and Thom... Date Added: 2009-06-04 15:11:47 |
| output.txt Path: Washington >> JOBS >> 80304 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-C05QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3676 02/19/2008 11:32 PM <DIR> . 02/19/2008 11:32 ... Date Added: 2009-06-04 15:12:01 |
| log.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: 000 (62463.000.000) 02/19 20:23:49 Job submitted from host: <128.95.94.28:1092> . 001 (62463.000.000) 02/19 20:28:44 Job executing on host: <172.25.101.181:1057> . 005 (62463.000.000) 02/19 20:32:00 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 15:12:31 |
| error.txt Path: Washington >> JOBS >> 80338 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 20 00:13:08 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 20 01:28:02 2008 ( 4494 s elapsed) ... Date Added: 2009-06-04 15:13:09 |
| error.txt Path: Washington >> JOBS >> 80290 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 19 23:28:09 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 20 00:42:49 2008 ( 4480 s elapsed) ... Date Added: 2009-06-04 15:14:17 |
| output.txt Path: Washington >> JOBS >> 80205 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_252 02/19/2008 10:38 PM <DIR> . 02/19/2008 10:38 P... Date Added: 2009-06-04 15:14:22 |
| factorial.ps Path: UMass (Amherst) >> CS >> 741 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: factorial.dvi %Pages: 18 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips factorial %DVIPSParamet... Date Added: 2009-06-04 15:16:01 |
| output.txt Path: Washington >> JOBS >> 80017 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-21WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2996 02/19/2008 08:47 PM <DIR> . 02/19/2008 08:47 ... Date Added: 2009-06-04 15:18:24 |
| log.txt Path: Washington >> JOBS >> 80191 Fall, 2009 Description: 000 (62574.000.000) 02/19 20:24:07 Job submitted from host: <128.95.94.28:1092> . 001 (62574.000.000) 02/19 20:35:48 Job executing on host: <172.25.101.173:1056> . 005 (62574.000.000) 02/19 20:40:00 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 15:18:25 |
| error.txt Path: Washington >> JOBS >> 80000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Tue Feb 19 22:15:43 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Tue Feb 19 23:25:31 2008 ( 4188 s elapsed) ... Date Added: 2009-06-04 15:18:30 |
| SDSposter07_text.txt Path: Ithaca College >> IC >> 030038 Fall, 2009 Description: What is Fort Hardy? Fort Hardy was a French and Indian War supply fort, constructed in 1755 by the British as part of the campaign against Crown Point. Located on the Hudson River at the mouth of Fish Creek, the fort replaced an earlier blockhouse a... Date Added: 2009-06-04 15:18:58 |
| lecture4.ps Path: CSU Channel Islands >> P >> 231 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: lecture4.dvi %Pages: 9 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips lecture4 %DVIPSParameters: d... Date Added: 2009-06-04 15:19:19 |
| AC2CH13.doc Path: Olivet Nazarene >> ACCT >> 111 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|24 Jan 2001 21:14:54 -0000 vti_extenderversion:SR|4.0.2.3406 vti_cacheddtm:TX|24 Jan 2001 21:14:54 -0000 vti_filesize:IR|26112 vti_cachedlinkinfo:VX| vti_cachedsvcrellinks:VX| vti_cachedtitle:SR|Manager... Date Added: 2009-06-04 15:19:44 |
| 08_Gantt_Rvsd.xls Path: Minnesota >> ME >> 4054 Fall, 2009 Description: Project Name: Model Airplane IC Engine based Gas Compressor Start Date: 01-21-03 Team Members: Reed Bisson, Jason Dionne, Eric Fox, Ben Kirchoff, Michael Vann ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 3... Date Added: 2009-06-04 15:20:11 |
| math3331BigO.ppt Path: UH Clear Lake >> MATH >> 3331 Fall, 2008 Description: Topics Section 9.2 Complexity of algorithms Efficiency of algorithms Growth of functions Orders of functions Big O notation, et al. f(x) is (g(x) : f is of order at most g f(x) is (g(x) : f is of order g f(x) is (g(x) : f is of order at least ... Date Added: 2009-06-04 15:20:57 |
| WLANsecurityLabDesign final.doc Path: UH Clear Lake >> CSCI >> 5931 Fall, 2008 Description: WIRELESS LAN SECURITY AND LABORATORY DESIGNS Yasir Zahur T. Andrew Yang University of Houston Clear Lake Houston, TX 77058 yang@cl.uh.edu ABSTRACT For the past couple of years, increasing number of wireless local area networks (WLANs), based on the I... Date Added: 2009-06-04 15:21:01 |
| portfolio II s12009.doc Path: Allan Hancock College >> ENG >> 1101 Fall, 2009 Description: Portfolio of Reflections Part II Due 8 May Weighting 15% This assessment is allocated 15% of the total marks for this course. This represents approximately 20 hours of individual student effort and the standard of the submission should reflect this. ... Date Added: 2009-06-04 15:21:41 |
| GAMS Reader.doc Path: W. Alabama >> CHE >> 720 Fall, 2009 Description: Environmental Economics and Natural Resources Group Hollandseweg 1 6706 KN Wageningen, the Netherlands READER GAMS for environmental economic modelling version December 2002 Rob Dellink Judit Sznyi Heleen Bartelings December 2002 CONTENTS Cont... Date Added: 2009-06-04 15:23:43 |
| P2_CMSC502.doc Path: VCU >> CMSC >> 502 Fall, 2008 Description: CMSC 502 Project 2 Note: you must provide sufficient details for your answers. If we believe that you fail to present enough information as how you come into your answer, significant point reduction should be anticipated even your answer is correct.... Date Added: 2009-06-04 15:23:52 |
| 12 Synaptic Release NMJ K11.ppt Path: Dallas >> MXA >> 049000 Fall, 2009 Description: Neuromuscular Junction Large postsynaptic cell One synapse per muscle cell Highly reliable Every pre-synaptic action potential leads to a post-synaptic action potential Chemical signaling is simple Only one type of ion channel Neuromuscular J... Date Added: 2009-06-04 15:24:35 |
| memory.ps Path: Duke >> STA >> 290 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: memory.dvi %Pages: 6 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX10 CMSY10 CMR10 CMTT10 CMR7 CMMI10 CMTI10 %EndComments %D... Date Added: 2009-06-04 15:25:27 |
| 119w07sort.xls Path: ASU >> M >> 119 Fall, 2009 Description: Mat 119 Finite Mathematics Winter 2007 Dr. Firoz Department of Mathematics and Statistics, ASU 40 40 10 T1 T2 Q1 Q2 Q3 AVG 1 1034 397 0 0 0 0 0 0 2 1288 097 0 0 0 0 0 0 3 5877 416 28 0 0 0 0 0 4 8154 083 28 30 8 7 10 8.33 5 4409 627 33 33 9.5 8 8 8.5... Date Added: 2009-06-04 15:26:29 |
| Powersim Tutorial.doc Path: Auburn >> E >> 6270 Fall, 2009 Description: ELEC 5270/6270 Low Power Design of Electronic circuits PowerSim Tutorial The PowerSim is a gate level power analysis tool. The Flow chart below summarizes the procedure to create circuit netlists and simulate it using the power analysis tool Power... Date Added: 2009-06-04 15:26:52 |
| 1.txt Path: Carnegie Mellon >> TERA >> 31003318 Fall, 2009 Description: 31003318... Date Added: 2009-06-04 15:27:27 |
| 1.txt Path: Carnegie Mellon >> DISK >> 31003318 Fall, 2009 Description: 31003318... Date Added: 2009-06-04 15:27:27 |
| account.txt Path: MSOE >> SE >> 1020 Fall, 2009 Description: 4 Cousins 383.22 Subway 1043.58 Chipotle 583.22 Panera 698.54 ... Date Added: 2009-06-04 15:28:51 |
| design_template.doc Path: Boise State >> ECE >> 473 Fall, 2008 Description: Boise State University Department of Electrical and Computer Engineering ECE 472 Power Electronics Fall 2008 Design Project Design of a DC-DC Boost Regulator Date Due: 12/10/08 Date Submitted: 12/10/08 Instructor: Dr. Said Ahmed-Zaid Group Members... Date Added: 2009-06-04 15:28:57 |
| design_template.doc Path: Boise State >> ECE >> 472 Fall, 2008 Description: Boise State University Department of Electrical and Computer Engineering ECE 472 Power Electronics Fall 2008 Design Project Design of a DC-DC Boost Regulator Date Due: 12/10/08 Date Submitted: 12/10/08 Instructor: Dr. Said Ahmed-Zaid Group Members... Date Added: 2009-06-04 15:28:58 |
| 1.txt Path: Carnegie Mellon >> TERA >> 05101595 Fall, 2009 Description: 05101595... Date Added: 2009-06-04 15:29:15 |
| 1.txt Path: Carnegie Mellon >> DISK >> 05101595 Fall, 2009 Description: 05101595... Date Added: 2009-06-04 15:29:15 |
| log.txt Path: Washington >> V >> 16684 Fall, 2009 Description: 000 (50179.000.000) 02/05 08:52:30 Job submitted from host: <128.95.94.28:1098> . 001 (50179.000.000) 02/05 12:08:37 Job executing on host: <172.25.101.44:1057> . 010 (50179.000.000) 02/05 12:25:04 Job was suspended. Number of processes actually sus... Date Added: 2009-06-04 15:29:24 |
| log.txt Path: Washington >> V >> 16635 Fall, 2009 Description: 000 (50130.000.000) 02/05 08:52:13 Job submitted from host: <128.95.94.28:1098> . 001 (50130.000.000) 02/05 11:33:17 Job executing on host: <172.25.101.162:1060> . 006 (50130.000.000) 02/05 11:53:26 Image size of job updated: 400688 . 005 (50130.000.... Date Added: 2009-06-04 15:30:46 |
| submit.txt Path: Washington >> V >> 16694 Fall, 2009 Description: executable = allgamma_16694.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:31:23 |
| submit.txt Path: Washington >> V >> 16935 Fall, 2009 Description: executable = allgamma_16935.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r9\\jobs16500-16999/16... Date Added: 2009-06-04 15:33:48 |
| PT-2-KEY.doc Path: TAMU Commerce >> M >> 351 Fall, 2009 Description: ... Date Added: 2009-06-04 15:34:04 |
| Viehland127.ps Path: Allan Hancock College >> CCP >> 127 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: (CCPsum.pdf) %Version: 1 2 %CreationDate: (D:20000717083316) %DocumentData: Clean7Bit %LanguageLevel: 2 %BoundingBox: 0 0 612 792 %Pages: 1 %DocumentProcessColors: Black %DocumentNeededResources: (atend) %DocumentSuppliedResour... Date Added: 2009-06-04 15:36:07 |
| NAKAMURA150.ps Path: Allan Hancock College >> CCP >> 150 Fall, 2009 Description: %!PS-Adobe-2.0%Creator: dvipsk 5.66a p1.3a Copyright 1996-97 ASCII Corp.(wwwptex@ascii.co.jp)% dvipsk 5.66a Copyright 1986-97 Radical Eye Software (www.radicaleye.com)%Title: PB_G3:Desktop Folder:0012.CCP2000:FDTD:fdtd.dvi% %Pages: 1%PageOrder: Ascen... Date Added: 2009-06-04 15:36:08 |
| error.txt Path: Washington >> JOBS >> 32269 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 02:24:04 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 03:06:35 2008 ( 2551 s elapsed) ... Date Added: 2009-06-04 15:40:45 |
| breedaiMar2409.txt Path: Iowa State >> ANS >> 352 Fall, 2009 Description: AI bulls selected March 24, 2009: AI ID numbers should have been 9000, not 1500. These are the same bulls, but be sure to use the 9000 AI ID. AI ID Herd Bull Lab 9001 5 214 8 9002 32 448 8 9003 39 418 8 9004 16 408 10 9005 35 441 10 9006 38 306 10 ... Date Added: 2009-06-04 15:41:07 |
| submit.txt Path: Washington >> JOBS >> 32048 Fall, 2009 Description: executable = pass6_32048.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs32000-32499/32048... Date Added: 2009-06-04 15:41:18 |
| log.txt Path: Washington >> JOBS >> 32000 Fall, 2009 Description: 000 (57178.000.000) 02/10 19:23:59 Job submitted from host: <128.95.94.28:1098> . 001 (57178.000.000) 02/11 01:47:13 Job executing on host: <172.25.101.93:1056> . 006 (57178.000.000) 02/11 02:07:21 Image size of job updated: 380288 . 005 (57178.000.0... Date Added: 2009-06-04 15:41:25 |
| template_webquest[2].doc Path: NMSU >> ELT >> 36802 Fall, 2009 Description: Beginning Letter Match Teacher Page A WebQuest for 1st Grade Language Arts Designed by Chantelle Savage Introduction | Standards | Activity | Evaluation Introduction Students will be learning how to identify words that begin with the same letter ... Date Added: 2009-06-04 15:43:42 |
| wpfuller educational portfolio.ppt Path: NMSU >> EDLT >> 3685 Fall, 2009 Description: William Fuller Elementary Education Major 12th Year Senior (sure feels that way) Coach of DT93FC Email: psychoceramic_2000 @hotmail.com My Technology Badge William Fuller B asi c 4 managi ng Fi l e M ngmnt P r obSol v 3 2 WP T ech I ntr g. E x... Date Added: 2009-06-04 15:43:54 |
| Lesson 3.doc Path: NMSU >> EDLT >> 36804 Fall, 2009 Description: Lesson Plan # 3 Date: April 13, 2006 Lesson Topic: Carnation coloring Category: Science Objective: For students to understand the process of how plants feed. Materials Required: * 3 clear glass vases * 3 white carnations. * water * food coloring (... Date Added: 2009-06-04 15:44:13 |
| Fact Sheet.doc Path: NMSU >> EDUC >> 518 Fall, 2009 Description: Los Numeros Los Dias de la Semana lunes martes miercoles jueves viernes Los Meses del Ano enero febrero marzo mayo junio julio septiembre octubre noviembre uno dos tres cuatro cinco seis siete ... Date Added: 2009-06-04 15:44:42 |
| PowerPoint_Amanda_Parrish.ppt Path: NMSU >> ELT >> 36801 Fall, 2009 Description: Amanda Parrish (505) 202-4729 mandi7@nmsu.edu Ab o ut Me I enjoy children and have always wanted to help them learn. I would like to teach first grade, because children of that age have many great ideas and fertile minds. I look forward to h... Date Added: 2009-06-04 15:44:50 |
| Technology Intergrated Math-Part I.doc Path: NMSU >> EDUC >> 518 Fall, 2009 Description: TECHNOLOGY INTERGRATED MATH PART I NAME: Step 1: Complete the following subtraction problems in pencil. Once you have completed all the problems you can move on to step 2. Step 2: Log onto the internet and go to our class website: http:/education.n... Date Added: 2009-06-04 15:45:43 |
| Interoffice Memo.doc Path: NMSU >> EDLT >> 3684 Fall, 2009 Description: Memo Date: To: 9/1/2004 Eurvine Williams Introduction Memo From: Heather Wilkerson RE: My name is Heather D. Wilkerson. You can reach me at (505)496-0989 anytime after 5:00 on Monday-Friday and all day on Saturday and Sunday. The number above is m... Date Added: 2009-06-04 15:46:20 |
| note8.ps Path: Berkeley >> CS >> 294 Fall, 1924 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: note8.dvi %CreationDate: Tue Sep 30 18:23:44 2003 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommand... Date Added: 2009-06-04 15:46:48 |
| 001016PressDigest.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Slovenia Today on Central Europe Online - Slovenia Local Press Digest - October 16 Wed, Oct 18 Prague 06:55 pm N.Y. 12:55 pm More Countries Russia China Central Europe - Croatia - Czech Rep. - Hungary - Poland -... Date Added: 2009-06-04 15:48:37 |
| 03 065.xls Path: East Los Angeles College >> UKHR >> 0304 Fall, 2009 Description: Table 65 Housing Corporation planned revenue expenditure million Item 1989/90 1990/91 1991/92 1992/93 1993/94 1994/95 1995/96 1996/97 outturn outturn outturn outturn outturn outturn outturn outturn Supported Housing Management Grant 29 39 62 9... Date Added: 2009-06-04 15:49:19 |
| Lesson 10.6.ppt Path: LeTourneau >> MATH >> 1613 Fall, 2009 Description: Conic Sections in Polar Coordinates Lesson 10.6 Definition of Parabola Set of points equal distance from a point and a line Point is the focus Line is the directrix If the ratio of the two distances is different from 1, other curves result 2... Date Added: 2009-06-04 15:50:16 |
| error.txt Path: Washington >> JOBS >> 11583 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Thu Feb 07 05:40:26 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Thu Feb 07 05:51:55 2008 ( 689 s elapsed) ... Date Added: 2009-06-04 15:50:57 |
| output.txt Path: Washington >> JOBS >> 11548 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-32WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 3C9A-2CA7 Directory of C:\\condor\\execute\\dir_992 02/07/2008 05:33 AM <DIR> . 02/07/2008 05:33 A... Date Added: 2009-06-04 15:51:05 |
| log.txt Path: Washington >> JOBS >> 11743 Fall, 2009 Description: 000 (53739.000.000) 02/07 05:33:30 Job submitted from host: <128.95.94.28:1098> . 001 (53739.000.000) 02/07 05:56:12 Job executing on host: <172.25.101.179:1066> . 005 (53739.000.000) 02/07 06:10:03 Job terminated. (1) Normal termination (return val... Date Added: 2009-06-04 15:56:30 |
| Fall 2004Exam 1.doc Path: NYIT >> CSCI >> 300 Fall, 2009 Description: CSCI300 W01 Fall 2004 Exam 1 M. Drossman Name: _ One page (up to 8.5\" X 11\", both sides) of notes is permitted. 1. [6] Describe two advantages of the database approach over the file-based approach in computer applications. (1) _ (2) _ 2. [8] List... Date Added: 2009-06-04 15:57:51 |
| Wireless communications.ppt Path: East Los Angeles College >> KU >> 17583 Fall, 2009 Description: Wireless communications Current standards IEEE 802.11a (54 Mbps) IEEE 802.11b (11 Mbps) IEEE 802.11g (54 Mbps) Network structures/architectures Infrastructure hub + clients Ad-hoc peer to peer Prototols Wireless LANs share bandwidth among ... Date Added: 2009-06-04 15:58:05 |
| toc.ps Path: Minnesota >> V >> 123 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: toc.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Bold Times-Roman Times-Italic %DocumentPaperSizes: Letter %EndComments %DVIPS... Date Added: 2009-06-04 15:58:16 |
| output.txt Path: Washington >> JOBS >> 40188 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-F2WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3316 02/11/2008 12:33 PM <DIR> . 02/11/2008 12:33 ... Date Added: 2009-06-04 15:58:49 |
| output.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-90WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2424 02/11/2008 07:17 PM <DIR> . 02/11/2008 07:17 ... Date Added: 2009-06-04 15:59:38 |
| log.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: 000 (57877.000.000) 02/11 10:26:14 Job submitted from host: <128.95.94.28:1098> . 001 (57877.000.000) 02/11 16:08:56 Job executing on host: <172.25.101.196:1055> . 006 (57877.000.000) 02/11 16:29:04 Image size of job updated: 463552 . 005 (57877.000.... Date Added: 2009-06-04 16:00:38 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 19:16:58 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 20:28:36 2008 ( 4298 s elapsed) ... Date Added: 2009-06-04 16:00:49 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 16:00:39 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 17:20:33 2008 ( 4794 s elapsed) ... Date Added: 2009-06-04 16:01:56 |
| error.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 14:42:01 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 15:56:25 2008 ( 4464 s elapsed) ... Date Added: 2009-06-04 16:02:43 |
| submit.txt Path: Washington >> JOBS >> 40000 Fall, 2009 Description: executable = pass6_40004.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs40000-40499/40004... Date Added: 2009-06-04 16:04:57 |
| prt_0240934400.pdf Path: Maryville MO >> D >> 024093 Fall, 2009 Description: Cycle 4 Advance Questionnaire - Parents Frequency Distribution Report MAPLEWOOD ELEM., NORTH KANSAS CITY 74 School District In what grade is your child? PRt1 Frequency Percent K-1 2ND 3RD 4TH 5TH 47 21 20 15 20 38.21 17.07 16.26 12.20 16.26 1 Frequ... Date Added: 2009-06-04 16:05:37 |
| rfc2105.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group Y. Rekhter Request for Comments: 2105 B. Davie Category: Informational D. Katz ... Date Added: 2009-06-04 16:08:40 |
| rfc1933.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group R. Gilligan Request for Comments: 1933 E. Nordmark Category: Standards Track Sun Microsystems, Inc. ... Date Added: 2009-06-04 16:09:48 |
| rfc3494.txt Path: Dallas >> EE >> 6345 Fall, 2008 Description: Network Working Group K. Zeilenga Request for Comments: 3494 OpenLDAP Foundation Obsoletes: 1484, 1485, 1487, 1488, 1777, March 2003 1778, 1779, 17... Date Added: 2009-06-04 16:10:04 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
