Course Solutions And Notes - hw4 4c
| AppC_ThmlPropsFoods_R06Ch09_I-P.pdf Path: UMKC >> ME >> 5699 Fall, 2009 Description: Thermal Properties of Foods Table 3 Unfrozen Composition Data, Initial Freezing Point, and Specific Heats of Foods* Moisture Content, Protein, Fat, % % % xf xp xwo 84.94 78.01 92.40 90.27 70.24 87.58 90.69 86.00 92.15 87.79 91.91 88.00 94.64 90.55 75... Date Added: 2009-06-06 01:53:44 |
| session18_asc.txt Path: UMKC >> ECE >> 5590 Fall, 2009 Description: -6.649200 -2.917583 0.087166 2.940674 -3.759715 0.236544 -1.134339 4.552220 0.118192 -3.666493 -2.475781 2.391653 0.133068 -2.267275 -19.684763 -0.804597 -2.721901 -1.052531 -4.032344 -1.032560 0.489609 -2.102127 -2.003123 -0.420690 -11.313564 -5.500... Date Added: 2009-06-06 01:56:52 |
| session15_asc.txt Path: UMKC >> ECE >> 5590 Fall, 2009 Description: 6.410362 4.147073 49.209361 0.968017 -20.243104 4.617331 52.864175 0.954267 6.633116 8.096142 4.419327 0.913016 37.727910 5.912603 6.030856 2.670297 51.915409 51.590903 52.668922 7.386629 8.071391 5.483596 10.488684 17.704810 -2.345791 -1.735280 50.5... Date Added: 2009-06-06 01:57:00 |
| session24_asc.txt Path: UMKC >> ECE >> 5590 Fall, 2009 Description: -0.060501 1.534527 49.011358 -4.248824 14.402002 2.109287 52.762423 -0.390507 -4.237824 -0.393257 1.845282 2.873800 49.962874 -3.258807 -0.739763 -1.124770 51.959409 51.786156 52.569920 -14.864010 -12.842725 -12.069961 -24.225174 -42.727498 1.322773 ... Date Added: 2009-06-06 01:57:34 |
| Biochem_651_Spectroscopy.pdf Path: Wisconsin >> BIOCHEM >> 651 Fall, 2008 Description: ... Date Added: 2009-06-06 01:58:03 |
| plageo147.5.txt Path: Michigan >> GEO >> 147 Fall, 2009 Description: NCOMPY=29 NSTEPS=5 # COM (NS rates(1 2 3 4) #cust(1 2 3 4) $forward $income $outBank $loss(1 2 3 4) $new) . 1 TJB 5 194 169 219 249 244 198 145 141 1036427 147662 100000 19000 0 40000 3000 1022089 2 NGB 5 200 188 166 200 226 95 407 208 1030858 1722... Date Added: 2009-06-06 01:59:20 |
| eQuestTrainingWorkbook.pdf Path: UMKC >> ME >> 5699 Fall, 2009 Description: Energy Simulation Training for Design & Construction Professionals September 2004 Acknowledgements The creation of eQUEST, which contains DOE-2.2 as its simulation engine, has been a team effort. It is not possible to acknowledge all the contributi... Date Added: 2009-06-06 01:59:59 |
| displaytracks.txt Path: St. Norbert >> CS >> 460 Fall, 2009 Description: # duplicate ids will add to a segmented track piece. # # # id startx starty endx endy simlength # 1-4 are the outer loop 1 20 190 20 150 840 1 20 150 60 60 0 1 60 60 150 20 0 1 150 20 450 20 0 ... Date Added: 2009-06-06 02:00:16 |
| riprap design.xls Path: UMKC >> CE >> 411 Fall, 2009 Description: Riprap Design D50 = KuCVa3 / davg0.5 K11.5 D50 = C= Va = davg = K1 = Ku = median particle size, ft correction for specific gravity and stability factor avg. velocity in the main channel, fps avg. flow depth in the main flow channel, ft bank angle cor... Date Added: 2009-06-06 02:00:24 |
| Chapter10a_P9826_Band.pdf Path: UWO >> P >> 9826 Fall, 2009 Description: Band Structures: Bulk, Film, Surface and Their Measurements for Physics 9826 Surface Science Heng-Yong Nie (hnie@uwo.ca) March 17, 2009 P&A 213E Atomic orbital Band Formation When two atoms are brought together, their atomic orbitals split into ... Date Added: 2009-06-06 02:01:34 |
| info_Paper_Guidelines-Grads.pdf Path: Washington >> CHEM >> 419 Spring, 2008 Description: Chemistry 419 Midterm Paper* (Grad students) Your paper should include references, figures, and Tables (if needed). It should be ~fifteen pages in length, including references and figures, and be approximately in the format of a journal review articl... Date Added: 2009-06-06 02:01:35 |
| worksheet-C.pdf Path: Los Angeles Southwest College >> M >> 172 Fall, 2009 Description: Math 172 LINEAR GROWTH (m = slope, P0 = initial value) Worksheet C Type Linear Model Explicit Solution continuous dP =m dt P (n) = P (n - 1) + m P = mt + P0 discrete P = mt + P0 EXPONENTIAL GROWTH (r = growth rate, P0 = initial value) Ty... Date Added: 2009-06-06 02:02:02 |
| q8.pdf Path: Los Angeles Southwest College >> M >> 122 Fall, 2009 Description: x 9 6 f(x) 3 -4 -3 -2 -1 0 -3 -6 x 1 2 3 4 5 6 ... Date Added: 2009-06-06 02:02:53 |
| lecture04.ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 102 Fall, 2008 Description: Physics 102: Lecture 04 Capacitors *C o * R m pat e * N pl ace i bi l i t y * i C o of f i c m en t w i t h l i ck e h o t eac ol d e er p u r t h er s r l e od a oi n n ex ct u r en t s: y tw n ot eek ot es l i st ed yet ; no abs en c e ex cu ses ... Date Added: 2009-06-06 02:04:28 |
| info424_P2_NAK.doc Path: Washington >> INFO >> 424 Fall, 2008 Description: Nak-hyun Kim Info 424 P2 Project name: Analyzing Basketball Statistics <Winning percentage and total number of games of coaches during their career> Phil Larry Neil Herb Vince Bill Morris Jackson Brown Cohalan Brown Boryla Fitch McHone 0 20 40 60 ... Date Added: 2009-06-06 02:04:48 |
| EmbHWUpdate.pdf Path: Washington >> EE >> 472 Fall, 2009 Description: EE472 Embedded Hardware Update 5Dec2005 Blake Hannaford Embedded Board Overview New TERN Products PC104 MiniITX Intel StarGate TERN 2005 \"MiniDrive88\" 40Mhz 188 CPU 512K SRAM/EPROM 32 Digital I/O with highcurrent drivers RS232 Read t... Date Added: 2009-06-06 02:06:04 |
| cal151.pdf Path: Arkansas Tech >> MATH >> 2934 Fall, 2008 Description: Arkansas Tech University MATH 2934: Calculus III Dr. Marcel B. Finan 92 Local Extrema for Functions in Two Variables Just like functions of a single variable, functions of several variables can have local and global extrema i.e. local and global m... Date Added: 2009-06-06 02:06:20 |
| Exam01_p1.pdf Path: LSU >> ASTR >> 1102 Fall, 2008 Description: ASTR1102-002 Potentially useful facts and mathematical relations: A. A star at a distance of 1 parsec (1 pc = 3.26 light-years) exhibits a parallax of 1 arcsecond. That is, p = 1 arcsec d = 1 pc. More generally, if \"p\" is measured in arcseconds, then... Date Added: 2009-06-06 02:06:30 |
| Lecture04.pdf Path: UPR Mayagüez >> ECE >> 5026 Fall, 2009 Description: ICOM 5026-080: Computer Networks Chapter 4: The Medium Access Control Sublayer By Dr. Yi Qian Department of Electronic and Computer Engineering Fall 2006 UPRM Outline The channel allocation problem Multiple access protocols Ethernet Wireles... Date Added: 2009-06-06 02:07:58 |
| 18.pdf Path: Washington >> QSCI >> 483 Fall, 2009 Description: Lecture 18: Remedial Measures and Transformations So far we have discussed the assessment of possible violations of assumptions. Our next step is how to take corrective measures. You should consider regression analysis as an iterative process; the un... Date Added: 2009-06-06 02:08:02 |
| sample problem.xls Path: Boise State >> MATH >> 124 Fall, 2008 Description: raw data sorted 1000 650 700 600 900 1000 750 1100 800 1050 800 950 900 1000 900 750 850 850 950 650 975.000 875.000 750.000 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 1100 1050 1000 1000 1000 950 950 900 900 900 850 850 800 800 750 75... Date Added: 2009-06-06 02:09:26 |
| 12 Graph Theory B.pdf Path: Boise State >> MATH >> 124 Fall, 2008 Description: V. Adamchik 1 Graph Theory Victor Adamchik Fall of 2005 Plan 1. Graph Isomorphism 2. Graph Enumeration 3. Planar Graphs Graphs Isomorphism There are different ways to draw the same graph. Consiser the following two graphs. You probably feel that ... Date Added: 2009-06-06 02:11:03 |
| LN-17.pdf Path: Boise State >> MATH >> 124 Fall, 2008 Description: Lecture 17 February 16, 2007 Sung Y. Song IOWA STATE UNIVERSITY CprE/InfAs/Math 533 CRYPTOGRAPHY L-17: Finite Fields 1 Fields A field is a set in which all basic four operations can be freely performed. Examples: Q, R, C: rational, real, complex... Date Added: 2009-06-06 02:12:00 |
| HW7.pdf Path: UCSD >> BE >> 112 Fall, 2008 Description: Feb 26th BE112A Biomechanics Winter Quarter, 2006 ASSIGNMENT 7: Vessel Mechanics Assigned problems to be submitted by: Thursday Mar 9th (beginning of class) Assigned Problems 1. Blood vessels have residual strain such that when cut radially, they ... Date Added: 2009-06-06 02:12:21 |
| Week9.1_SQL_part_I.pdf Path: Cuyamaca College >> CS >> 3753 Fall, 2009 Description: SQL Chapter 8 3753 X1 1 Outline SQL (history) Data types Schemas Views DDLs & DMLs Examples 3753 X1 2 SQL History 1973 - systems developed to test the relational model System R developed by IBM Ingres (Stonebraker) 3753 X1 3 SEQUEL ... Date Added: 2009-06-06 02:12:45 |
| IRC 402.1.1 Nail sizes.doc Path: Penn State >> AAA >> 5030 Fall, 2009 Description: 402.1.1 Fasteners. Fasteners used below grade to attach plywood to the exterior side of exterior basement or crawlspace wall studs, or fasteners used in knee wall construction, shall be of Type 304 or 316 stainless steel. Fasteners used above grade t... Date Added: 2009-06-06 02:14:45 |
| akkineni.pdf Path: University of Illinois, Urbana Champaign >> ESSAYS >> 569 Fall, 2009 Description: Quantum Phase Transitions of Correlated Electrons in Two Dimensions: Connections to Cuprate Superconductivity Vamsi Akkineni Department of Physics, University of Illinois at Urbana-Champaign ABSTRACT The physics of the two dimensional electron gas i... Date Added: 2009-06-06 02:14:48 |
| problem_set_Homework_2.pdf Path: Washington >> CHEM >> 321 Fall, 2008 Description: CHEM 321 Homework #2 (Winter 2004) Problem #1 A pH measurement, repeated five times, gave the following values: 5.42, 5.45, 5.46, 5.40, 5.46. Calculate the mean and the standard deviation. Problem #2 A given sample containing sodium carbonates requ... Date Added: 2009-06-06 02:14:55 |
| brochure.pdf Path: Allan Hancock College >> HUMANITIES >> 310397 Fall, 2009 Description: postgraduate faculty of HuMaNItIes Urban Design Graduate Certificate Graduate Diploma Master of Urban Design curtIN KEY COURSE FACTS Degree: GradCertUrbanDes(Curtin) GradDipUrbanDes(Curtin) MUrbDes(Curtin) This course offers postgraduate tr... Date Added: 2009-06-06 02:15:04 |
| HW11.pdf Path: UMBC >> PHYS >> 424 Spring, 2008 Description: ... Date Added: 2009-06-06 02:15:50 |
| CWR4306_Packet_08_student.pdf Path: UF >> CWR >> 4306 Fall, 2008 Description: CWR 4306 Lecture 8 CWR 4306 Urban Stormwater System Design Lecture Packet 8: Stormwater detention/retention Course website: http:/www.ce.ufl.edu/~markn/CWR4306 1 Stormwater detention Topics covered in this lecture Overview of stormwater detenti... Date Added: 2009-06-06 02:16:15 |
| MA_1352_S09_MID_3_PROB.pdf Path: Texas Tech >> M >> 1352 Fall, 2009 Description: MATH 1352: CALCULUS II Section 030 MID SEMESTER EXAM III 1 hour 20 minutes All calculations have to be from ground up. Show all work for full credit. The use of calculators, textbooks, class notes or mutual consultation is not allowed. Answers ... Date Added: 2009-06-06 02:16:28 |
| Genome555-Outline.pdf Path: Washington >> GENOME >> 555 Winter, 2008 Description: Genome 555 Protein Technologies Instructor: Michael J. MacCoss, Ph.D. Office: Foege S113B Phone: 206-616-7451 E-Mail: maccoss@u.washington.edu http:/proteome.gs.washington.edu/classes/Genome555/ Class Schedule: Feb 12, 2008: Introduction, protein ba... Date Added: 2009-06-06 02:16:33 |
| lab5-5-2.pdf Path: CSU Fullerton >> MOD >> 312 Fall, 2009 Description: Lab 5.5.2: Challenge Spanning Tree Protocol Topology Diagram Addressing Table Device (Hostname) S1 S2 S3 PC1 PC2 PC3 Interface VLAN 99 VLAN 99 VLAN 99 NIC NIC NIC IP Address 172.17.99.11 172.17.99.12 172.17.99.13 172.17.10.21 172.17.20.22 172.17.30.... Date Added: 2009-06-06 02:16:48 |
| 3124_09_25.pdf Path: SPSU >> IT >> 3124 Fall, 2009 Description: One Model of Computing IT 3124 Hardware and Software Concepts September 25 Input-Output Image copyright John Wiley and Sons Copyright 2005 by Bob Brown I-O Speed Considerations CPU operates at speeds much faster than the fastest I/O device Devic... Date Added: 2009-06-06 02:23:04 |
| 3123_04_02.pdf Path: SPSU >> IT >> 3123 Fall, 2009 Description: Magnetic (Hard) Disks IT 3123 Hardware and Software Concepts October 31 Operating System Internals Notice: This session is being recorded. Copyright 2005 by Bob Brown OS Internals Process Scheduling CPU Scheduling Memory Management Virtual St... Date Added: 2009-06-06 02:24:12 |
| 4823_02_23.pdf Path: SPSU >> IT >> 4823 Fall, 2009 Description: About Your Exam Grades I have corrected the mistake. Sorry! IT 4823 Information Security Administration February 22 Remote Access Copyright 2006 by Bob Brown The Process Identification: Who are you? Authentication: Prove it! Something you know ... Date Added: 2009-06-06 02:24:26 |
| YGL041C.t2k.w0.5-logo.pdf Path: UCSC >> YGL >> 041 Fall, 2009 Description: YGL041C.t2k w0.5 2 1 M L V I 1 10 20 30 40 H 2 1 E H H ILL L I P LYLL I I F F F YV L L L H ELLHL R R N N V V V V XXXXXX XXX X X XX XX X X I I V V Y T I V S Y X I V Q S X XXX F L X I V XX 70 Y I I V V X X XXXXXXXXXXXXXXXXXXXXXXX... Date Added: 2009-06-06 02:27:15 |
| winn.pdf Path: UGA >> EDIT >> 6100 Fall, 2008 Description: Educational Background w Bachelor\'s Modern Languages Oxford University w Master\'s Comparative Literature Indiana University Dr. William Winn w Ph.D. Instructional Technology Indiana University EDIT 6100 March 4, 2002 Faculty Positions Un... Date Added: 2009-06-06 02:28:31 |
| Sources--Books, Activities.pdf Path: Weber >> EDUC >> 3280 Fall, 2008 Description: SOURCES FOR GREAT BOOKS TO USE IN YOUR TEACHING Lending Library back of rm. 330 (anyone can let you in if there\'s not a class in rm. 330) Binders and folders of annotated bibliographies (including NCSS Notable Social Studies Trade Books for Young ... Date Added: 2009-06-06 02:29:05 |
| slider2-solution-complex-page1.doc Path: Maryville MO >> MCE >> 302 Spring, 2009 Description: ... Date Added: 2009-06-06 02:29:19 |
| Biotech, GR& TK (Kongolo Oct 23).ppt Path: East Los Angeles College >> WEB >> 008 Fall, 2009 Description: BIOTECHNOLOGY, GENETIC RESOURCES AND TRADITIONAL KNOWLEDGE Why Protect TK? TK and IP International Instruments New Mechanism of Protection Why Protect TK? to safeguard against third party claims of IP rights over TK subject matter, to protect ... Date Added: 2009-06-06 02:30:12 |
| source_info.txt Path: Washington >> V >> 1040 Fall, 2009 Description: Source ID Source Name counts 1000 CrNeutron 49658 ... Date Added: 2009-06-06 02:31:58 |
| submit.txt Path: Washington >> V >> 1374 Fall, 2009 Description: executable = neutron_1374.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\ eutron\\v12r4\\jobs1000-1863/1374 pr... Date Added: 2009-06-06 02:32:04 |
| source_info.txt Path: Washington >> V >> 1053 Fall, 2009 Description: Source ID Source Name counts 1000 CrNeutron 26951 ... Date Added: 2009-06-06 02:32:26 |
| error.txt Path: Washington >> V >> 1396 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Sep 16 12:53:01 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Sep 16 13:19:59 2007 ( 1618 s elapsed) ... Date Added: 2009-06-06 02:32:58 |
| source_info.txt Path: Washington >> V >> 1056 Fall, 2009 Description: Source ID Source Name counts 1000 CrNeutron 28219 ... Date Added: 2009-06-06 02:33:19 |
| log.txt Path: Washington >> V >> 1420 Fall, 2009 Description: 000 (4826.000.000) 09/16 10:24:16 Job submitted from host: <128.95.94.28:1063> . 001 (4826.000.000) 09/16 12:50:42 Job executing on host: <172.25.101.165:1062> . 004 (4826.000.000) 09/16 12:51:16 Job was evicted. (0) Job terminated and was requeued ... Date Added: 2009-06-06 02:34:54 |
| error.txt Path: Washington >> V >> 1470 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Sep 16 13:02:46 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Sep 16 13:09:49 2007 ( 423 s elapsed) ... Date Added: 2009-06-06 02:37:22 |
| submit.txt Path: Washington >> V >> 1397 Fall, 2009 Description: executable = neutron_1397.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\ eutron\\v12r4\\jobs1000-1863/1397 pr... Date Added: 2009-06-06 02:40:26 |
| output.txt Path: Washington >> V >> 2379 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS2 - local directory - Volume in drive C has no label. Volume Serial Number is EE42-0B89 Directory of C:\\condor\\execute\\dir_3752 10/08/2007 10:15 PM <DIR> . 10/08/2007 10:15 PM <D... Date Added: 2009-06-06 02:43:08 |
| submit.txt Path: Washington >> V >> 2410 Fall, 2009 Description: executable = neutron_2410.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\ eutron\\v12r12\\jobs2000-2863/2410 p... Date Added: 2009-06-06 02:45:36 |
| output.txt Path: Washington >> V >> 2206 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-195QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2536 10/08/2007 06:23 PM <DIR> . 10/08/2007 06:23 ... Date Added: 2009-06-06 02:48:09 |
| error.txt Path: Washington >> V >> 2180 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Oct 08 17:14:25 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Oct 08 18:08:23 2007 ( 3238 s elapsed) ... Date Added: 2009-06-06 02:48:56 |
| error.txt Path: Washington >> V >> 2122 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Oct 08 15:33:12 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Oct 08 16:34:42 2007 ( 3690 s elapsed) ... Date Added: 2009-06-06 02:49:45 |
| log.txt Path: Washington >> V >> 2418 Fall, 2009 Description: 000 (23256.000.000) 10/08 11:21:51 Job submitted from host: <128.95.94.28:3153> . 001 (23256.000.000) 10/08 22:33:00 Job executing on host: <172.25.101.48:1055> . 006 (23256.000.000) 10/08 22:53:09 Image size of job updated: 273488 . 005 (23256.000.0... Date Added: 2009-06-06 02:51:22 |
| source_info.txt Path: Washington >> V >> 2440 Fall, 2009 Description: Source ID Source Name counts 1000 CrNeutron 338409 ... Date Added: 2009-06-06 02:51:55 |
| Spring09_Midterm2Solutions.doc Path: UGA >> MSIT >> 3000 Fall, 2008 Description: Spring 2009 Midterm 2 Solutions 1 Spring 2009 Midterm 2 Solutions 2 Spring 2009 Midterm 2 Solutions 3 Spring 2009 Midterm 2 Solutions 4 Spring 2009 Midterm 2 Solutions 5 Spring 2009 Midterm 2 Solutions 6 Spring 2009 Midterm 2 Solutions 7... Date Added: 2009-06-06 02:52:24 |
| exam3psf08_2210.pdf Path: Utah >> MATH >> 2210 Fall, 2008 Description: Calculus III, Math 2210-90, Fall 2008, Bob Palais Practice Exam 3 Solutions, Chapter 13 Multiple Integrals Show all your work on the exam for full credit. You may use graphing (or regular) calculators. 1. (Integration in the plane, 20 points) Use pol... Date Added: 2009-06-06 02:54:32 |
| CapBud Class Handout.doc Path: UNC Wilmington >> FIN >> 335 Fall, 2009 Description: FIN335 I. COMPUTING THE DEPRECIATION SCHEDULE Installed Cost: $ 250,000 YEAR 1 2 3 4 Capital Budgeting Problem 12-10 M-ACRS Category: 3 years BV Table 1 DEPRECIATION SCHEDULE FOR NEW MACHINE ACRS% COST ADC ACDEP 0.33 250000 0.45 250000 0.15 250000... Date Added: 2009-06-06 02:56:40 |
| session3_asc.txt Path: UMKC >> ECE >> 5590 Fall, 2009 Description: 47.584083 -2.728048 48.376097 -8.049391 -3.135055 -0.088002 50.292880 -13.032478 -6.470863 -1.515277 -1.256772 -1.941534 47.661084 -8.115392 52.336166 -3.327558 49.539367 52.127162 52.083161 -14.385502 -12.674972 -11.486951 -23.386409 51.841157 39.96... Date Added: 2009-06-06 02:57:15 |
| callno.pdf Path: Kansas State >> BIOL >> 823 Fall, 2008 Description: GENERAL BIOLOGY JOURNALS AT K-STATE Fourth Floor Ethology BF1.Z4 Stack D Nature Q1.N2 Behaviour BF671.B4 (1959-) Science Q1.S352 J Amer Stat Ass HA1.A6 Proc Nat Acad Sci Q11.N26 Phil Trans Royal Soc Lond Q41.L82 Proc R Soc Lon B Q41.L7 GENERAL... Date Added: 2009-06-06 02:57:57 |
| Roanoke+Daily+Herald+2-18-09.doc Path: UNC >> READ >> 4993873 Fall, 2009 Description: Pool stays at Lake Gaston by Della Batts, Daily Herald Staff Writer Published/Last Modified on Wednesday, February 18, 2009 12:58 PM CST Print this story | Email this story | Post A Comment | Bookmark & Share LAKE GASTON - Lake Gaston homeowner Leigh... Date Added: 2009-06-06 02:58:05 |
| euler.xls Path: W. Carolina >> MATH >> 320 Fall, 2008 Description: Euler\'s method k 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 t_k 0 0.25 0.5 0.75 1 1.25 1.5 1.75 2 2.25 2.5 2.75 3 3.25 3.5 3.75 4 4.25 4.5 4.75 5 Find a soln to y\'=t-y^2 on [0,5] with step size 0.25 y_k 0.2 0.19 0.24 0.35 0.51 0.69 0.89 1.... Date Added: 2009-06-06 02:58:30 |
| B8.pdf Path: Laurentian >> CHEM >> 2200 Fall, 2009 Description: ... Date Added: 2009-06-06 02:58:56 |
| 589bReserveList.pdf Path: UVA >> ANTH >> 589 Summer, 2008 Description: Spatial Data Analysis in Archaeology Anthropology 589b Fraser D. Neiman Updated: 1.20.07 University of Virginia Spring 2007 Reserve Reading at Clemons Bailey, Trevor C. and Anthony C. Gatrell 1995 Interactive Spatial Data Analysis. Prentice Hall, Ha... Date Added: 2009-06-06 02:59:23 |
| 3010 Positive law and natural law - some thoughts..doc Path: Laurentian >> MGT >> 200901 Fall, 2009 Description: Natural Law and Positive Law some thoughts In his work The Leviathan, 17th Century English philosopher, Thomas Hobbes saw positive law as preferable to naked force. In principle, Hobbes saw even arbitrary laws created by the Sovereign as preferable ... Date Added: 2009-06-06 03:00:17 |
| ArtMuseumER.pdf Path: Allan Hancock College >> INFS >> 7007 Fall, 2009 Description: ... Date Added: 2009-06-06 03:00:46 |
| HW-09.pdf Path: USC >> ARCH >> 213 Fall, 2009 Description: Assignments Student Name:. 66 Compute reactions, bending, shear, , bending and shear stress, and draw V, M, and diagrams for: a) L=24\', P=20 k, W14x61 b) L=30\', P=30 k, W18x86 c) L=36\', P=36 k, W21x111 P/2 eq P eq P eq P/2 a Ra b L c d ... Date Added: 2009-06-06 03:00:48 |
| ages4.xls Path: Mich Tech >> GE >> 3320 Fall, 2008 Description: Sheet1 The DOL Geologic Ages of Earth History http:/www.dinosauria.com copyright 1995, 1997 Jeff Poling Table is read bottom to top: lower boundaries for Ages are given. Red areas denote when dinosaurs, excluding neornithine dinosaurs, existed Ma =... Date Added: 2009-06-06 03:01:36 |
| default.pdf Path: E. Kentucky >> PSY >> 862 Spring, 2008 Description: 1/9/2009 Structural Equation Modeling Definition A statistical technique for testing and estimating causal relationships using a combination of statistical data and qualitative causal assumptions SEM vs. _ Very similar procedure EXCEPT Structural ... Date Added: 2009-06-06 03:03:28 |
| YHR165W-A.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YHR >> 165 Fall, 2009 Description: YHR165W-A.t2k EBGHTL 3 2 1 CC X C E TTTCC X T T G E E T E E C X X X X X E T TCC C T T H H X X X X H X C CXXXXXXGXXTCX CT T G E E E E X X X X X X X X X X E H H E H E H H E E TC T X TTTTTTTT CCCCCCCC C H H H X X X X E H H G E E E... Date Added: 2009-06-06 03:04:54 |
| gate_current_models.pdf Path: ASU >> EEE >> 531 Fall, 2009 Description: EEE 533: Semiconductor Device and Process Simulation Spring 2001 Description of Gate Current Models Instructor: Dragica Vasileska Department of Electrical Engineering Arizona State University EEE 533 Semiconductor Device and Process Simulation Some... Date Added: 2009-06-06 03:06:36 |
| Homework_6_Explained.ppt Path: ASU >> EEE >> 352 Fall, 2009 Description: Homework Explained Nonidealities of MOS Capacitors Square-Law and Bulk Charge Theory Series Resistance Effect ... Date Added: 2009-06-06 03:06:46 |
| Ex3F07.pdf Path: UMass (Amherst) >> CHEM >> 121 Fall, 2009 Description: FIRST NAME_ LAST NAME_ Exam 3, F07 PLEASE USE PENCIL ! 1. The peroxide ion has the formula O22. The superoxide ion has the formula O2. A. Sketch a correlation diagram (orbital energy diagram) for the peroxide ion. Be sure to label the yaxis and each... Date Added: 2009-06-06 03:07:05 |
| t4 Nurse_Scheduling_DSS_Version_3.xls Path: UCF >> ISM >> 6407 Fall, 2008 Description: Nurse years Shift Pay Rate 145 160 187 160 140 M/F Yellow cell values may be changed 1 2 Click computer to generate all feasible solutions for these parameter settings. Shift: Nurses Needed: 1 1 2 1 3 2 3 4 5 5 6 3 1 4 M F F M F Day Sunday Pl... Date Added: 2009-06-06 03:07:36 |
| output.txt Path: Washington >> V >> 14500 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS4 - local directory - Volume in drive C has no label. Volume Serial Number is 7833-1AB3 Directory of C:\\condor\\execute\\dir_2876 02/04/2008 06:11 AM <DIR> . 02/04/2008 06:11 AM <D... Date Added: 2009-06-06 03:08:19 |
| log.txt Path: Washington >> V >> 14500 Fall, 2009 Description: 000 (48291.000.000) 02/04 03:02:55 Job submitted from host: <128.95.94.28:1098> . 001 (48291.000.000) 02/04 05:36:58 Job executing on host: <172.25.101.93:1056> . 006 (48291.000.000) 02/04 05:57:06 Image size of job updated: 457936 . 005 (48291.000.0... Date Added: 2009-06-06 03:08:34 |
| output.txt Path: Washington >> V >> 14500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-835QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_1516 02/04/2008 05:53 AM <DIR> . 02/04/2008 05:53 ... Date Added: 2009-06-06 03:08:51 |
| submit.txt Path: Washington >> V >> 14500 Fall, 2009 Description: executable = allgamma_14886.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs14500-14999/14... Date Added: 2009-06-06 03:09:10 |
| output.txt Path: Washington >> V >> 14784 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS8 - local directory - Volume in drive C has no label. Volume Serial Number is B020-E7D5 Directory of C:\\condor\\execute\\dir_3624 02/04/2008 05:34 AM <DIR> . 02/04/2008 05:34 AM <D... Date Added: 2009-06-06 03:09:32 |
| submit.txt Path: Washington >> V >> 14500 Fall, 2009 Description: executable = allgamma_14555.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs14500-14999/14... Date Added: 2009-06-06 03:10:18 |
| submit.txt Path: Washington >> V >> 14884 Fall, 2009 Description: executable = allgamma_14884.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs14500-14999/14... Date Added: 2009-06-06 03:10:39 |
| submit.txt Path: Washington >> V >> 14988 Fall, 2009 Description: executable = allgamma_14988.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs14500-14999/14... Date Added: 2009-06-06 03:10:41 |
| output.txt Path: Washington >> V >> 14500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-2ZVSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3764 02/04/2008 05:42 AM <DIR> . 02/04/2008 05:42 ... Date Added: 2009-06-06 03:13:06 |
| output.txt Path: Washington >> V >> 14500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-32WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 3C9A-2CA7 Directory of C:\\condor\\execute\\dir_3164 02/04/2008 04:27 AM <DIR> . 02/04/2008 04:27 ... Date Added: 2009-06-06 03:13:41 |
| error.txt Path: Washington >> V >> 14668 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 04 04:23:44 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 04 05:33:38 2008 ( 4194 s elapsed) ... Date Added: 2009-06-06 03:13:52 |
| jan 28.pdf Path: Pima CC >> MAT >> 220 Fall, 2008 Description: Jan285:21PM 1 Jan285:37PM 2 Jan285:45PM 3 Jan285:53PM 4 Jan285:59PM 5 Jan286:37PM 6 Jan285:17PM 7 Jan286:06PM 8 Jan286:09PM 9 Jan286:15PM 10 Jan286:18PM 11 Jan286:22PM 12 Jan286:26PM 13 Jan286:48PM 14 Jan286:54PM 15 Jan2... Date Added: 2009-06-06 03:15:21 |
| assignment_3.doc Path: UH Clear Lake >> FINC >> 4331 Fall, 2008 Description: Assignment 3 Read the article from the ABA Banking Journal entitled \"What to do when the Boom is Over\", January 2003. You can go to www.cl.uh.edu. Click on the Library button. Click on \"Research a Topic\". Click on the letter \"L\". Choose Lexis-Nexis A... Date Added: 2009-06-06 03:16:06 |
| DESCRIPTIONS OF PROPOSED COMPETENCY AREAS.doc Path: UH Clear Lake >> HMRS >> 6733 Fall, 2008 Description: DESCRIPTIONS OF PROPOSED COMPETENCY AREAS CORE HR PROCESSES Knowledge of and demonstrated ability in the planning, implementation, and evaluation of techniques, theories, procedures, and applicable laws used in staffing and employee selection, compen... Date Added: 2009-06-06 03:16:17 |
| ComprehensiveExperiment.docx Path: UH Clear Lake >> ISAM >> 5636 Spring, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|08 Apr 2008 22:40:23 -0000 vti_extenderversion:SR|6.0.2.8161 vti_cacheddtm:TX|08 Apr 2008 22:40:23 -0000 vti_filesize:IR|46135 vti_backlinkinfo:VX| ... Date Added: 2009-06-06 03:16:36 |
| NewtonSteps.pdf Path: Bucknell >> PHYS >> 211 Fall, 2009 Description: Newton\'s Second Law: Step-by-Step Approach 1. Draw a sketch of the system. 2. Identify the forces acting on the objects, and draw force diagrams for each object in the system. These force diagrams should be separate from your original sketch. 3. r ... Date Added: 2009-06-06 03:16:49 |
| cs140.final.fall.2000.pdf Path: Stanford >> CS >> 140 Fall, 2009 Description: g u p x s FqtqFd}# x F)F~ s p x q u| u p us u u x |s s u x tt}rFtyq}Vt\')q{}qqF}vrtG us q p p x q p s u q p ps us u q p x u p p | q p q p q ps s x u x }trFfttt6}t4tt9tGVGr}q}tqVGrtr{\'}trq6r}\'td... Date Added: 2009-06-06 03:16:56 |
| mar01.pdf Path: Goucher >> CS >> 102 Fall, 2009 Description: HTML Coding, Continued Tom Kelliher, CS 102 Mar. 1, 2004 1 Administrivia Announcements Quiz on Friday. Ask questions Wednesday. Assignment Read 4.84.10. Online quiz. See class home page for four questions. From Last Time HTML coding. Outline 1.... Date Added: 2009-06-06 03:17:24 |
| hw1sol.pdf Path: San Diego State >> STA >> 702 Fall, 2009 Description: Stat 702 Dr. Fan Homework 1 Solutions Q2. (a) They all fall into the supervised learning category because they all involve a response variable. For classification, the response variable is categorical; for regression, the response variable is continu... Date Added: 2009-06-06 03:17:40 |
| HW1.pdf Path: Maple Springs >> CSE >> 3201 Fall, 2009 Description: York University Dept. of Computer Science and Engineering CSE3201 Digital Logic Design HW 1 Due Sept. 26th 2007 Form the textbook 1. 1.16 2. 1.21 3. Draw a CMOS circuit to implement the following function F=A(B+C)+DE 4. 2.8 5. 2.17 6. 2.20 ... Date Added: 2009-06-06 03:17:53 |
| Exercises3.pdf Path: Oregon >> MATH >> 252 Fall, 2008 Description: Exercise #3 for Calc II : Find the indefinite integral using whatever you have learned. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. x 2 (ln x)2 dx sin-1 x dx. 1 dx x ln x ln(ln x) sin2 x cos3 x dx. sin2 x cos4 x dx. sec2 x dx tan x dx cot... Date Added: 2009-06-06 03:18:40 |
| 081NUR300RA.pdf Path: Augsburg >> TRI >> 0809 Fall, 2009 Description: AUGSBURG COLLEGE Department of Nursing NUR 300 Q: TRENDS AND ISSUES IN NURSING Rochester Campus Fall 2008 FACULTY: Joyce Miller, RN, MA in Nursing Assistant Professor (H) 507- 282-4710 millerj2@augsburg.edu 5:45 pm to 9:15 pm, Thursday evenings, Ro... Date Added: 2009-06-06 03:18:52 |
| Lab 7 Physical factors that control microbial growth.doc Path: Arizona >> MIC >> 205 Fall, 2009 Description: Lab 7. Physical factors that control microbial growth Date: 02/18/08 Name:. Purpose: During this lab you will learn how some physical factors can influence the growth of bacteria. Bacteria can differ in their requirements for oxygen, temperature, a... Date Added: 2009-06-06 03:19:34 |
| submit.txt Path: Washington >> JOBS >> 10747 Fall, 2009 Description: executable = pass6_10747.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10500-10999/10747... Date Added: 2009-06-06 03:22:47 |
| output.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-205QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3848 02/07/2008 03:43 AM <DIR> . 02/07/2008 03:43 ... Date Added: 2009-06-06 03:23:58 |
| log.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: 000 (52944.000.000) 02/07 03:35:46 Job submitted from host: <128.95.94.28:1098> . 001 (52944.000.000) 02/07 04:21:16 Job executing on host: <172.25.101.67:1067> . 005 (52944.000.000) 02/07 04:33:48 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-06 03:24:22 |
| log.txt Path: Washington >> JOBS >> 10923 Fall, 2009 Description: 000 (52919.000.000) 02/07 03:35:21 Job submitted from host: <128.95.94.28:1098> . 001 (52919.000.000) 02/07 04:18:40 Job executing on host: <172.25.101.84:1056> . 005 (52919.000.000) 02/07 04:32:08 Job terminated. (1) Normal termination (return valu... Date Added: 2009-06-06 03:24:55 |
| submit.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: executable = pass6_10940.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10500-10999/10940... Date Added: 2009-06-06 03:26:22 |
| output.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-5Z4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3180 02/07/2008 04:19 AM <DIR> . 02/07/2008 04:19 ... Date Added: 2009-06-06 03:26:39 |
| output.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-295QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3572 02/07/2008 04:02 AM <DIR> . 02/07/2008 04:02 ... Date Added: 2009-06-06 03:26:49 |
| submit.txt Path: Washington >> JOBS >> 10500 Fall, 2009 Description: executable = pass6_10874.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs10500-10999/10874... Date Added: 2009-06-06 03:28:00 |
| 20061011_r01n_0210221.pdf Path: Stanford >> MER >> 1026 Fall, 2009 Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -X In re Merrill Lynch Co.... Date Added: 2009-06-06 03:29:23 |
| Chap17_Phys322_Lect_21_22_23.pdf Path: Iowa State >> PHYS >> 322 Fall, 2008 Description: Chapter 17: Outline Elementary Particle Physics (High Energy Physics) What do we already know? Fundamental Interactions Accelerators and Detectors 1950s: An Explosion of Particles! How to Classify ? Conservation Laws and Symmetries Bary... Date Added: 2009-06-06 03:29:28 |
| Lecture20.pdf Path: Toledo >> ENV >> 200 Fall, 2009 Description: 1 Revised Lecture Schedule Feb 26 Genetics and Conservation of Biodiversity Mar 2 Agricultural Applications of Biotech Mar 4/9 Forest Ecosystems (Draper 9) Mar 11/16 Agricultural Ecosystems (Draper 6) Mar 18/23 Ocean Ecosystems (Draper 8) Mar 25 Sub... Date Added: 2009-06-06 03:29:42 |
| Lecture7.doc Path: Toledo >> ENV >> 200 Fall, 2009 Description: In our last lecture. . . 0. Talked about \"anomalies\" 1. Research results the investigator does not expect within the extant \"paradigm.\" 2. Recall that anomalies only appear against the backdrop provided by the paradigm 3. Researchers are only capab... Date Added: 2009-06-06 03:29:47 |
| 6810-02.pdf Path: Utah >> CS >> 6810 Fall, 2008 Description: Lecture 2: Measuring Performance/Cost/Power Today\'s topics: (Sections 1.6, 1.4, 1.7, 1.8) Quantitative principles of computer design Measuring cost Real industrial examples 1 Summarizing Performance Recall discussion on AM versus GM GM: does not ... Date Added: 2009-06-06 03:30:01 |
| map-n31.pdf Path: Delaware >> HLY >> 0402 Fall, 2009 Description: n31 : z=30 m 0.4 m/s 74N -3 00 0 -3 00 0 73N 160W 158W 156W 154W 152W ... Date Added: 2009-06-06 03:30:37 |
| w12l01.pdf Path: Michigan State University >> PHY >> 231 Fall, 2008 Description: ... Date Added: 2009-06-06 03:32:26 |
| slac-pub-7963.pdf Path: Stanford >> PUBS >> 7750 Fall, 2009 Description: SLAC-PUB-7963 October 1998 Java Analysis Studio A. S. Johnson Presented at International Conference on Computing in High-Energy Physics, 8/31/989/4/98, Chicago, IL, USA Stanford Linear Accelerator Center, Stanford University, Stanford, CA 94309 W... Date Added: 2009-06-06 03:34:01 |
| Dimer signaling-Li Ma.ppt Path: Texas >> BIO >> 339 Fall, 2008 Description: A Simple Review OM CM repellent ATP Che W CM OM ADP Tumbling CW CheY P CheA P M MCP Kinase RR OM CM attractant Che W CM OM Smooth Swimming CCW CheA CheY M Macnab R. M. Annu. Rev. Microbiol. 2003 MCP A Simple Review (Cont\'d) In Salmonel... Date Added: 2009-06-06 03:35:02 |
| ex1s2_bio126L.pdf Path: Texas >> BIO >> 126 Fall, 2009 Description: BIO 126L EXAM 1, Sample 2 ... Date Added: 2009-06-06 03:35:21 |
| facs-plan.pdf Path: Southern Utah >> IR >> 0102 Fall, 2009 Description: Southern Utah University Family & Consumer Science Department Academic Outcomes Assessment Plan Academic Year 2001-2002 Expanded Statement of Institutional Purpose: Mission Statement: Education in Family and Consumer Sciences (FCS) empowers individua... Date Added: 2009-06-06 03:35:23 |
| bs01-11.pdf Path: Texas A&M >> PUBS >> 364 Fall, 2009 Description: Review of the American Farm Bureau Counter Cyclical Payment Program Briefing Paper 01-11 James W. Richardson Edward G. Smith Abner W. Womack Agricultural and Food Policy Center Department of Agricultural Economics Texas Agricultural Experiment Sta... Date Added: 2009-06-06 03:36:00 |
| CE 326 BOD lab.xls Path: Iowa State >> CE >> 326 Fall, 2009 Description: Raw Influent DO (1) DO (5) (ratio) (mg/L) (mg/L) 300/4 9.69 13.69 300/8 9.72 12.98 300/12 9.77 12.03 Final Effluent DO (1) DO (5) (ratio) (mg/L) (mg/L) 300:200 8.54 0.42 300:250 8.34 0.35 300:280 8.34 0.42 ... Date Added: 2009-06-06 03:36:42 |
| syll_rsSpr2000.doc Path: Washington >> G >> 651 Fall, 2009 Description: G651 Biostatistics Spring 2001 Department of Public Health Classroom: Nursing Building, Room 110 Section 3 Andrew Zhou RG4122 ph: 274-2696 fax:274-2678 azhou@iupui.edu Date 3/29 Topics Nonparametric tests for paired and independent two-samples ANOV... Date Added: 2009-06-06 03:38:12 |
| syllabus.pdf Path: Temple >> CIS >> 4329 Fall, 2007 Description: CIS 4329, formerly CIS 330 Network Architectures Course Description Fall 2008 1 General Information John Fiore Wachman Hall. Room 1042 jfiore@temple.edu (215)204-3357 http:/www.cis.temple.edu/~jfiore Tuesdays and Thursdays, 1:10-2:30 and by appoin... Date Added: 2009-06-06 03:39:11 |
| ECON 5333.day8.ppt Path: SHSU >> DPG >> 006 Fall, 2009 Description: CREATING VALUE and CAPTURING VALUE CREATING VALUE Value Creation (also called Value Added) Value is created anytime an action is taken for which the benefits exceed the costs, or anytime an action is \"prevented\" for which the costs exceed the bene... Date Added: 2009-06-06 03:40:05 |
| Ch 14 Cutaneous Senses_a.pdf Path: Texas A&M >> PSYC >> 320 Fall, 2008 Description: Sensation M University) The Cutaneous sensations Sensations based on the stimulation of receptors in the skin. Pressure, vibration, heating, cooling, and tis... Date Added: 2009-06-06 03:40:56 |
| Ch 15 Chemical Senses.ppt Path: Texas A&M >> PSYC >> 320 Fall, 2008 Description: Sensation M University) Main topics Olfactory system odors Neural codes Neural receptors Cortical structure Taste ch 15 1 Key terms The Olfactory... Date Added: 2009-06-06 03:40:56 |
| ch6.ps Path: Boise State >> CS >> 552 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: ch6.dvi %Pages: 37 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 595 842 %DocumentFonts: LCIRCLEW10 CMBX12 CMR10 CMSY10 CMR7 CMTI10 CMTT10 CMR5 %+ CMTT... Date Added: 2009-06-06 03:41:48 |
| ch6.ps Path: Boise State >> CS >> 453 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: ch6.dvi %Pages: 37 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 595 842 %DocumentFonts: LCIRCLEW10 CMBX12 CMR10 CMSY10 CMR7 CMTI10 CMTT10 CMR5 %+ CMTT... Date Added: 2009-06-06 03:42:02 |
| Agenda.Day15.Germany7Spring2009.doc Path: UMBC >> ACADEMIC >> 111 Fall, 2009 Description: Agenda: March 10, 2009 Summing Up: German Government and Politics 1. Introductory Functions Midterm is Thurs. Mar. 12: Purchase Green Books at Bookstore, bring them to test, name on cover only. 2. Review for Midterm: Study guide discussed; Your ... Date Added: 2009-06-06 03:42:10 |
| Unit 1 Slide 5.doc Path: JMU >> RAMON >> 574 Fall, 2009 Description: Unit 1 Slide 5 A DBMS should allow the user to Define the database; that is, the user should have the ability to choose the appropriate data structure, the data types and the data constraints. For instance, in this course we will be working with the... Date Added: 2009-06-06 03:46:18 |
| Unit 3 Lecture 1 Slide 37.doc Path: JMU >> RAMON >> 574 Fall, 2009 Description: Unit 3 Lecture 1 Slide 37 In addition to the notation indicated before, many-to-many relationships are also denoted as M:N. We read this as a M to N relationship. This type of relationship occurs very often in E-R diagrams. Notice that the relationsh... Date Added: 2009-06-06 03:46:27 |
| Unit 3 Lecture 2 Slide 7.doc Path: JMU >> RAMON >> 574 Fall, 2009 Description: Unit 3 Lecture 2 Slide 7 To resolve the N:M relationship of the previous slide, we need to find a new intersection entity and two new 1:N relationships. There will be a new relationship between the new intersection entity and the customer and product... Date Added: 2009-06-06 03:46:33 |
| Unit 3 Lecture 3 Slide 6.doc Path: JMU >> RAMON >> 574 Fall, 2009 Description: Unit 3 Lecture 3 Slide 6 To illustrate the creation of a table instance chart, let us use the E-R diagram that the current slide is showing. Notice that in this diagram there are 3 entities called item, product and order. The slide also shows the ind... Date Added: 2009-06-06 03:46:35 |
| Disc10.doc Path: Wisconsin >> ECON >> 101 Fall, 2008 Description: Econ 101: Introductory Microeconomics Discussion Section #10 Handout Fall 2008 November 13, 14 Compare and Contrast: Perfect Competition vs. Monopoly Perfect Competition firms take the price as given (no control over price) face a horizontal dema... Date Added: 2009-06-06 03:46:48 |
| Baudrillard 2008.ppt Path: East Los Angeles College >> LT >> 204 Fall, 2009 Description: Jean Baudrillard (born 29 July 1929; died 6 March 2007) One of the most important cultural thinkers of our time His background was in sociology but his work is influenced by theories from philosophy (Friedrich Nietzsche), political economy (Karl M... Date Added: 2009-06-06 03:47:23 |
| Colgate Motion.pdf Path: Penn State >> ETS >> 5048 Fall, 2009 Description: ... Date Added: 2009-06-06 03:48:45 |
| YFR034W-A.t2k.str2-logo.pdf Path: UCSC >> YFR >> 034 Fall, 2009 Description: YFR034W-A.t2k STR2 3 2 1 CC H S S X XXX HHH C HH A A XAXXXXXXXTXHX X X XH A HHHHHHHH T H H X H HHH YTST Z C A AZ H A H A CCC C SZTBTG Y Z C C H H H S C H H XXXXXXXXXXXX XHXXXXXHHHCCXXXX X X X X X X Z H C CCCCSSSCC S CS 20 T CTT XX H C ... Date Added: 2009-06-06 03:50:32 |
| Lecture 13 - Work. Kinetic energy. WKE theorem..ppt Path: University of Illinois, Urbana Champaign >> PHYS >> 221 Fall, 2009 Description: Le cture13 Work and theWork/Kine Ene The m tic rgy ore Motivation to go be yond Ne wton\'s laws N Loop theloop m g N Thenorm forcehas diffe nt dire al re ction and m agnitudeat e ry point on the ve track! m g m g N R Writing and solving Ne wton\'... Date Added: 2009-06-06 03:51:15 |
| IEEEwavelet.pdf Path: CSU San Bernardino >> CSCI >> 524 Fall, 2009 Description: ... Date Added: 2009-06-06 03:53:16 |
| ch7-4.ppt Path: Iowa State >> CS >> 352 Fall, 2009 Description: Classical Problems of Synchronization s The Bounded-Buffer Problem s The Readers-Writers Problem s The Dining-Philosophers Problem Operating System Concepts 7.1 Silberschatz, Galvin and Gagne 2002 The Bounded-Buffer Problem s Shared data semaph... Date Added: 2009-06-06 03:53:32 |
| 0905intro.ppt Path: St. Thomas >> C >> 230 Fall, 2009 Description: Today\'s Class Introductions About the Course Fundamentals Computer Program - Sequence Parts of a computer Parts of a CPU Writing a really short program Homework March 2005 R. Smith - University of St Thomas - Minnesota 1 I love program... Date Added: 2009-06-06 03:55:07 |
| 0212layers.ppt Path: St. Thomas >> C >> 370 Fall, 2009 Description: QMCS 370 - Class Today Essentials of packets Protocol stack structures ISO TCP/IP 05/21/09 R. Smith - University of St Thomas - Minnesota 1 Essentials of packets (Review) What do packets accomplish? How does this work? What errors must pa... Date Added: 2009-06-06 03:55:10 |
| main.pdf Path: Millersville >> MATH >> 211 Fall, 2009 Description: Sequences of Real Numbers MATH 211, Calculus II J. Robert Buchanan Department of Mathematics Summer 2008 J. Robert Buchanan Sequences of Real Numbers Introduction We have used sequences before in the context of finding limits of a function using... Date Added: 2009-06-06 03:56:38 |
| hw07.pdf Path: Millersville >> MATH >> 365 Fall, 2009 Description: Millersville University Name Department of Mathematics MATH 365, Ordinary Differential Equations, Homework 07 March 11, 2009 Please answer the following questions. Answers without justifying work will receive no credit. Partial credit will be given a... Date Added: 2009-06-06 03:57:42 |
| lecture.01.ppt Path: Utah State >> CS >> 5100 Fall, 2008 Description: Introduction, Planning, Jargon, and Examples CS 5100 Lecture 01 Course Assistance My office is Main 420; phone is 797-3267; Office Hours TR 9:00-10:15 and 3:00-4:15 Get in touch at Greg.Jones@usu.edu Appointments welcome; walk-ins possible Recom... Date Added: 2009-06-06 03:59:03 |
| pline.pdf Path: Université du Québec à Montréal >> C >> 1565 Fall, 2009 Description: PLINE LE JEUNE ET LES ALIMENTA ITALIAE Marie-Michelle Pag Universit Laval D\'abord dfinis par l\'Empereur Nerva, puis mis en place en 101 travers les cits d\'Italie1 ( l\'exception de Rome qui a ses frumentationes) par son successeur Trajan, les alimen... Date Added: 2009-06-06 04:01:20 |
| fs3.pdf Path: Otterbein >> PHYS >> 171 Fall, 2009 Description: Physics 171 Final Exam Formulae Fall 2007 These formulas will appear on the exam as shown, i.e., without names or explanations. It is up to you to know what they mean and when they are applicable! F = dp dt p = mv F12 = -F21 x = x^ + y^ i j ... Date Added: 2009-06-06 04:01:38 |
| denis1228.ps Path: UCLA >> DENIS >> 1228 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 360 558 720 %Title: Graphics produced by IDL %For: mcgovern@andromeda, % /home/mcgovern/public_html/bdssarchive/objects/denis1228 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Sat Sep 6 09:25:38 2003 %Document... Date Added: 2009-06-06 04:03:38 |
| session16.pdf Path: Idaho >> BAE >> 452 Spring, 2008 Description: Distributed Phase Chemical Waste Loads (pesticides) Environmental Water Quality BAE 452/552 Session 16 Distributed Chemical Loads Finding solid-phase and dissolved phase concentrations is complicated by dynamic processes (decay, decomposition and mi... Date Added: 2009-06-06 04:04:11 |
| shen_pre.ppt Path: Wisconsin >> ECE >> 734 Fall, 2000 Description: An enhanced estimation: motion and rotation estimation SHANHSIANG SHEN Motivation Video encoding methods such as H.264 and MPEG use motion estimation to increase compression rate. Paste each blocks from some reference frame to create current fra... Date Added: 2009-06-06 04:05:32 |
| HW9Sol.pdf Path: UT Arlington >> EE >> 2320 Fall, 2008 Description: ... Date Added: 2009-06-06 04:06:22 |
| MakingWeblog.doc Path: Trinity U >> CS >> 1300 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|TRINITY\\jbelisle vti_modifiedby:SR|TRINITY\\jbelisle vti_timelastmodified:TR|12 Aug 2005 20:49:47 -0000 vti_timecreated:TR|12 Aug 2005 20:49:47 -0000 vti_cacheddtm:TX|12 Aug 2005 20:49:47 -0000 vti_filesize:IR|405... Date Added: 2009-06-06 04:06:31 |
| E1v3M211Spring2008.pdf Path: Saint Louis >> M >> 211 Fall, 2009 Description: Name: Math 211 Exam 1 February 1, 2008 You must show all work to receive full credit; unjustified answers will receive LITTLE TO NO CREDIT! Making it very clear what you are doing will increase your eligibility for partial credit. ln x . 1+3 ln x ... Date Added: 2009-06-06 04:06:49 |
| takehome2hints.ps Path: UC Riverside >> M >> 205 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: takehome2hints.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -f takehome2hints %... Date Added: 2009-06-06 04:08:06 |
| algtop1figures01w09jan16.pdf Path: UC Riverside >> MATH >> 246 Fall, 2009 Description: FIGURES FOR ALGEBRAIC TOPOLOGY LECTURE NOTES I : Foundatonal and geometric background I . 2 : Barycentric coordinates and polyhedra Barycentric coordinates. In the drawing below, each of the points P, Q, R lies in the plane determined by P1, P2, and ... Date Added: 2009-06-06 04:09:28 |
| test1studyquestions.pdf Path: Kentucky >> ECO >> 401 Fall, 2008 Description: ECO 401-001 Fall 2004 Study Questions for 1st Test Review Questions and Problems from Browning and Zupan: Chapter 1: 1.5, 1.9, 1.11, 1.12, 1.13, 1.16 Chapter 2: 2.1, 2.5, 2.8, 2.9, 2.12, 2.14, 2.15, 2.19 Chapter 3: 3.1, 3.2, 3.3, 3.5, 3.8, 3.9, 3.11,... Date Added: 2009-06-06 04:11:28 |
| Chapter_7 reactions.doc Path: CSU San Marcos >> CHEM >> 201 Fall, 2009 Description: ... Date Added: 2009-06-06 04:16:56 |
| Transcript_for_Introduction.pdf Path: UNL >> TEAC >> 351 Fall, 2008 Description: Transcript for Introduction Welcome to this fall semester study of managing the learning environment. I am Professor Margaret Sievers and I will facilitate your learning experience in this course. You can read a little about me under the Staff Inform... Date Added: 2009-06-06 04:18:10 |
| fig09_65.txt Path: Los Angeles Southwest College >> CHAP >> 352 Fall, 2009 Description: *fig9_65.txt* /* 1*/ / Assign Num and compute Parent. /* 2*/ / Counter is global, and initialized to 1. /* 3*/ / Num, Visited, and Parent are all global arrays. /* 4*/ void /* 5*/ Assign_Num( Vertex V ) /* 6*/ { /* 7*/ Num[ V ] = Counter+; /* ... Date Added: 2009-06-06 04:20:57 |
| fig03_57.txt Path: Los Angeles Southwest College >> CHAP >> 352 Fall, 2009 Description: *fig3_57.txt* /* 1*/ static const Default_Size = 100; /* 2*/ template <class Element_Type> /* 3*/ class Queue /* 4*/ { /* 5*/ private: /* 6*/ unsigned int Full_Queue; /* 7*/ int Q_Front; /* 8*/ int Q_Rear; /* 9*/ int Q_Size; /*10... Date Added: 2009-06-06 04:21:04 |
| Boyle M.pdf Path: Duke >> BME >> 248 Fall, 2008 Description: Endocrinol Metab Clin N Am 33 (2004) 149162 Engineering islets: lessons from stem cells and embryonic development Michelle J. Doyle, BS, Lori Sussel, PhD* Departments of Pediatrics and Cellular and Developmental Biology, Barbara Davis Center for Chi... Date Added: 2009-06-06 04:22:00 |
| contents.pdf Path: East Los Angeles College >> NCL >> 0809 Fall, 2009 Description: CONTENTS Introduction General Information Chemistry staff Committees Personal Tutors The Bedson Building Ethics Complaints Help Financial Support Provision for Disabled Students Nu:Kem Safety Communications Essential Equipment Student Reading / Commo... Date Added: 2009-06-06 04:22:17 |
| Lecture_10_Diseases & Parasites.doc Path: Minnesota >> FW >> 5603 Fall, 2009 Description: DISEASES AND PARASITES AS AN ENVIRONMENTAL FACTOR FOR WILDLIFE What should habitat managers (as well as animal ecologists in general) know about disease and parasite occurrence in, or threats to, their subject wildlife populations? [Incidentally, you... Date Added: 2009-06-06 04:22:35 |
| 06 Agroforestry.pdf Path: UCSC >> ENVS >> 133 Winter, 2008 Description: Agroecological basis for including trees in agroecosystems Mimicking natural ecosystems Olson et al discuss this concept at length and argue for agroforestry systems as appropriate for much of the US. Identify 4 ecological principles to aid in desig... Date Added: 2009-06-06 04:23:07 |
| PAE0736.t06.bys-logo.pdf Path: UCSC >> PAE >> 0736 Fall, 2009 Description: PAE0736.t06 bys 3 2 1 1 10 20 30 40 P 3 2 1 E P H E H G E P E P H E H 51 60 70 80 G E H E H E H G H P G P H G E T Y E 90 LE K CLQLH YFKKLVKNIEIFDEVHNSK P NC D KC L I VE I G G VY F V R RV N P 50 MK K HIIIK TIPKKEEIISRDLCDCIYY ... Date Added: 2009-06-06 04:23:30 |
| PAE0301.t06.CB_burial_14_7-logo.pdf Path: UCSC >> PAE >> 0301 Fall, 2009 Description: PAE0301.t06 CB_burial_14_7 2 1 1 10 20 30 40 E F 2 1 D B A B E D B E B D E B D F D F E D F E F D E D A D F D F E B D E D B D E B 2 1 D B A B D F E B D A B D A E B E B A D F D D A B E A D E B 101 110 120 130 140 E D B 2 1... Date Added: 2009-06-06 04:24:29 |
| PAE1832.t06.o_notor-logo.pdf Path: UCSC >> PAE >> 1832 Fall, 2009 Description: PAE1832.t06 o_notor 3 2 1 1 10 20 30 40 N 3 2 1 B A P A P B A N H N G N B N B 51 60 70 80 90 N 3 2 1 H G N H N B A N H M G N 101 B N B A P A P N 110 DD V VRLKI RVKNGLCD 100 TS Y LENCD YVLKKLCEQFGGNIPASPG D GV Y YL R ... Date Added: 2009-06-06 04:25:59 |
| PAE0708.t04.alpha-logo.pdf Path: UCSC >> PAE >> 0708 Fall, 2009 Description: PAE0708.t04 alpha 2 1 10 20 30 40 H 2 1 E H B S H B S B H S B E H D H E A E H 51 60 FT L YVAYK LKEQRS S B 50 1 MK T IYAYA GFSLGIAIYFLLLAALGLR T PD I SI G E AK V N L YV I I T TV F L A ... Date Added: 2009-06-06 04:26:35 |
| Classroom Questions.doc Path: University of Illinois, Urbana Champaign >> CI >> 303 Fall, 2009 Description: Jill V. Buhay C & I 303 September 26, 2002 Guidelines for Student Questions: In order to ensure that time is not wasted in the classroom with repeat questions and discussions are worthwhile, here\'s how I would keep tabs on the types of questions aske... Date Added: 2009-06-06 04:28:47 |
| 01-Bot_calculations.xls Path: UC Davis >> ATT >> 0040 Fall, 2009 Description: Team Tech Drive Train Motors Order # Power per motor Voltage Diameter Length Gearheads Order # Reduction Max. cont. Torque Length Weight value 136207 250 24 45 ? 223084 15.00 15.00 65 620 units W V mm Battery Ratting Voltage 2600 mahr 24 volts to 1 ... Date Added: 2009-06-06 04:28:51 |
| 01-Bot_calculations.xls Path: UC Davis >> ATT >> 0603 Fall, 2009 Description: Team Tech Drive Train Motors Order # Power per motor Voltage Diameter Length Gearheads Order # Reduction Max. cont. Torque Length Weight value 136207 250 24 45 ? 223084 15.00 15.00 65 620 units W V mm Battery Ratting Voltage 2600 mahr 24 volts to 1 ... Date Added: 2009-06-06 04:28:52 |
| readme.txt Path: Texas State >> CS >> 3409 Fall, 2008 Description: 20010325 The Intro. to Computer Technology course account for CS3409 has moved! We are no longer on nyssa, the DEC Alpha mainframe of Academic Computing Services. Now we are located at on cs.ftp.swt.edu . More specifically, the URL for the course... Date Added: 2009-06-06 04:29:17 |
| hw8.pdf Path: Washington >> MENGR >> 373 Fall, 2009 Description: Ts r m g C A R R1 Vs (t) + - Black Box 1 2 A m c L R2 P(t) k ! S (t) Rf Rl A m c k ... Date Added: 2009-06-06 04:31:29 |
| NumericalIntegrationCh7.pdf Path: Cornell >> ALS >> 1413 Fall, 2009 Description: Lecture Notes Multibody Dynamics B, wb1413 A. L. Schwab & Guido M.J. Delhaes Laboratory for Engineering Mechanics Mechanical Engineering Delft University of Technolgy The Netherlands April 9, 2009 Contents 7 Numerical Integration of Ordinary Differe... Date Added: 2009-06-06 04:32:57 |
| CULVERT2-jpu.xls Path: UMKC >> CE >> 411 Fall, 2009 Description: DESIGN FILL (ft-in) 0\'-9\" HS20 MEMBER THICKNESSES TS BS TX Thick Thick. Thick A1 Size Bars c to c TOP SLAB BARS J3 Bars Size c to c A2 Size Span (S) = HT (ft) = 7 or BOTTOM SLAB BARS Bars J4 Bars c to c Size c to c 10 8 9 WALL BARS B2 Bars F G1 S... Date Added: 2009-06-06 04:33:37 |
| BTS330Tutorial2.doc Path: CSU Fullerton >> BTS >> 330 Fall, 2009 Description: BTS330 Tutorial 2 Fall 2005 1 of 5 The Zoo Project Continues In the first BTS330 tutorial you helped the Toronto Zoo with its project to track elephants. The Zoo Director has decided to go ahead with an information system that can be used for ALL z... Date Added: 2009-06-06 04:34:06 |
| jmfm_2008.pdf Path: Cornell >> MC >> 369 Fall, 2009 Description: Author\'s personal copy Available online at www.sciencedirect.com J. of Multi. Fin. Manag. 18 (2008) 346368 American Depositary Receipts: AsiaPacific evidence on convergence and dynamics Haiqiang Chen a , \"Paul\" Moon Sub Choi a, , Hyunseob Kim b b ... Date Added: 2009-06-06 04:34:34 |
| Math354_Stochastic_Processes.pdf Path: East Los Angeles College >> INFO >> 354 Fall, 2009 Description: h1hmhehc Qdtf1fefl1eEcexExlC Y d e1flCd}QfeQxff1QldffcQf1QCv UeQxfW... Date Added: 2009-06-06 04:34:42 |
| LT21.pdf Path: UMass (Amherst) >> RESE >> 212 Fall, 2009 Description: Lecture 21-212b-Monday, November 17, 2008 Announcements: 1. 2. 3. No class on Wednesday before Thanksgiving. We\'ve earned it. C10 problems: 10.14, 10.22, 10.26, 10.28, 10.32, 10.36, 10.41, 10.42, 10.54, 10.55 Print out the t-table from our Lectures S... Date Added: 2009-06-06 04:35:48 |
| l13.pdf Path: Cornell >> CS >> 314 Spring, 2008 Description: Processor Implementation Overview Start with common datapath design concepts Simple processor implementation Move to more complex implementation Finally, pipelined implementation We\'ll look at how modern hardware works: Clocking, combinat... Date Added: 2009-06-06 04:37:06 |
| WA_20090424.pdf Path: Washington >> ESS >> 200904 Fall, 2009 Description: 0 WA 2009/ 4/24 0:00:00; 1.5 - 5.0 Hz; Envelope lowpass at 0.05 Hz SNB-Z 500 -1 MCW-Z 10 -2 RPW-Z 10 -3 B001-Z 30 -4 B007-Z 20 -5 SQM-Z 80 -6 B013-Z 40 -7 HDW-Z 100 -8 GNW-Z 20 -9 CPW-Z 10 -10 B018-Z 20 -11 0 0.1 0.2 0.3 0.... Date Added: 2009-06-06 04:38:08 |
| Chapter_6_163.pdf Path: Iowa State >> CHEM >> 163 Fall, 2008 Description: Ch. 6 Ionic Bonds and Some Main-Group Chemistry Page 1 of 3 Ch. 6 Ionic Bonds and Some Main-Group Chemistry 6.1 Ions and Their Electron Configurations Recall: something stable about the electron arrangement in noble gases. Ne has filled s and p orb... Date Added: 2009-06-06 04:39:17 |
| lec26_post.pdf Path: Iowa State >> CHEM >> 177 Fall, 2008 Description: Announcements To be added Review from last time Predict products and write the chemical equation for the reaction of with water. Predict products and write the chemical equation for the reaction of with water. Reactivity trends Alkali metals.... Date Added: 2009-06-06 04:40:34 |
| Microsoft PowerPointCh3Pt1_9_15_08.pdf Path: Iowa State >> CHEM >> 155 Fall, 2008 Description: Chapter 3 Part 1 Announcements Those with a time conflict with the exam should contact me or Toni Alternate exam 4:10pm Limited Space Exam 1 in two days Review Session Wednesday during lecture Aris homework for rest of Ch2 due today Things to... Date Added: 2009-06-06 04:40:40 |
| 164Exam4S09.pdf Path: Iowa State >> CHEM >> 164 Fall, 2008 Description: SEAT NO._ PROF. JOHN VERKADE SPRING 2009 THIS EXAM CONSISTS OF 15 QUESTIONS ON 7 PAGES CHEM 164 HOUR EXAM IV APRIL 27, 2009 NAME_ RECIT. INSTR._ RECIT. SECT._ GRADING PAGE Page 2 Page 3 Page 4 Page 5 TOTAL POINTS 20 pts 30 pts 20 pts 30 pts 100 pts ... Date Added: 2009-06-06 04:41:07 |
| 2008 Fall 231_Exam1A.pdf Path: Iowa State >> CHEM >> 231 Fall, 2008 Description: Chemistry 231 Exam 1A Fall 2008 Instructor: Yan Zhao Last Name_ First Name_ Seat Number_ PRINT your name at the top of the back of the last page. Do NOT open the exam until you are instructed to do so. Check and make sure you have all the pages ... Date Added: 2009-06-06 04:41:36 |
| ProblemSet3.pdf Path: Iowa State >> CHEM >> 531 Fall, 2008 Description: ... Date Added: 2009-06-06 04:41:58 |
| e301f3t2a.pdf Path: Wofford >> ECO >> 301 Fall, 2009 Description: Eco 301 Test 2 100 points. Name_ 3 November 2003 1. a. If firms are identical and in a competitive market, where on their average cost curve do they produce (and why)? b. How does a change in the competitive market equilibrium affect an individual ... Date Added: 2009-06-06 04:43:08 |
| Cayabyab_evalue.rtf Path: San Diego State >> PROJECT >> 344 Fall, 2009 Description: BMelissa Cayabyab Project 1 Project number and name: YES Class and school information: YES Your name: YES Clear headlines: YES Text: YES Visual examples: YES Required content presented on a single HTML page: YES Color prints mounted on 16\"x20\" black ... Date Added: 2009-06-06 04:43:31 |
| exam2.pdf Path: Colorado >> AMATH >> 2360 Fall, 2008 Description: APPM 2360 Exam 2: March 2, 2005 ON THE FRONT OF YOUR BLUEBOOK write (1) your name, (2) the name of your lecture professor and time of your lecture, (3) the name of your recitation TA and the number of your recitation, and (4) a five-problem grading g... Date Added: 2009-06-06 04:45:36 |
| exam1_s.pdf Path: Colorado >> AMATH >> 2360 Fall, 2008 Description: ... Date Added: 2009-06-06 04:45:39 |
| final_s.pdf Path: Colorado >> AMATH >> 2360 Fall, 2008 Description: ... Date Added: 2009-06-06 04:45:41 |
| hw14_expected.txt Path: Wyoming >> CS >> 4780 Fall, 2009 Description: # declaration_type (At (Fun (\"A\", Num 1), Fun (\"B\", Num 1), (Fun (\"C\", Num 2) (TA []); - : type_assignment = TA [(\"B\", Intexp); (\"C\", Intexp); (\"A\", Intexp)] # declaration_type (At (Fun (\"A\", Plus (Id(\"B\"),Id(\"C\") ), Fun (\"B\", Num 1), (Fu... Date Added: 2009-06-06 04:49:48 |
| lec14-09.pdf Path: WVU >> GEOL >> 554 Fall, 2008 Description: Environmental and Exploration Geophysics II Static Anomalies Velocity Pitfall/Interpretation tom.h.wilson tom.wilson@mail.wvu.edu Department of Geology and Geography West Virginia University Morgantown, WV Tom Wilson, Department of Geology and Geogr... Date Added: 2009-06-06 04:51:23 |
| notes4_11.pdf Path: Stanford >> POLISCI >> 181 Fall, 2009 Description: Last Class Schattschneider Scope. Interest groups v. parties. Cleavages. Downsian Logic Blacks Median Voter Theorem. Reasons to doubt? Collective Action Black\' Median Voter Theorem s If voter\' have single-peaked preferences, s then the id... Date Added: 2009-06-06 04:51:38 |
| twh.pdf Path: UMBC >> M >> 301 Fall, 2009 Description: B ` B ` X#b` %b#DB a A 1 7 4 ` B @ ` B ` D#` ab%bB B A 1 7 4 V B ` B ` ` B @ ` ` B ` B B ` ` V a Y#` %b` \' a 1 7 4 B ` B @ ` o t p o m u p r y w z t v o t n t y w p ~ o m t s m y o n m l e h QaD{#XDp... Date Added: 2009-06-06 04:52:27 |
| graph1.xls Path: Grand Valley State >> EGR >> 345 Fall, 2008 Description: Figure#1 6.89 lbs. Deflectin 6.0 inches 2.8 2.6 2.4 2.2 Voltage (V) Row 1 2 1.8 1.6 1.4 6 16 26 36 46 56 66 76 86 96 106 116 126 136 146 156 166 176 186 196 206 216 226 236 246 256 1 11 21 31 41 51 61 71 81 91 101 111 121 131 141 151 161 171 18... Date Added: 2009-06-06 04:52:36 |
| T0263.t04.CB_burial_14_7-logo.pdf Path: UCSC >> T >> 0263 Fall, 2009 Description: T0263.t04 CB_burial_14_7 2 1 A B B A CCA C CE B FFFFEF D FE C F E D GE C CD E B C DA B B D D D B C E E E E E CCCACD A D CED E C D B C D D G E EDECEAACCD F D F D C CEDCADC A D D D XXXXEGDXXBDDCDXCCDXACBXDDXFDDXDCDAXXEXXXXXEDDDDDXX X X X F F G X X X ... Date Added: 2009-06-06 04:53:48 |
| CS-KEY-PARTB-AUG06.pdf Path: UCF >> CH >> 629133 Fall, 2009 Description: Computer Science Foundation Exam August , 2006 Computer Science Section 1B Name: SSN: Q1 Q2 Q3 Q4 Q5 Total KNW CMP,ANL ANL DSN KNW,DSN KEY You have to do all the 5 problems in this section of the exam. Partial credit cannot be given unless all w... Date Added: 2009-06-06 04:54:33 |
| LeftMonmouth.xls Path: Princeton >> ORF >> 467 Fall, 2008 Description: Name S99 S98 S97 S96 S95 S94 S93 S92 S91 S90 S9 S89 S88 S87 S86 S85 S84 S83 S82 S81 S80 S8 S79 S78 S77 S76 S75 S74 S73 S72 S71 S70 S7 S69 S68 S67 S66 S65 S64 S63 S62 S61 S60 S6 S59 S58 S57 S56 S55 S54 S53 S52 Type Stations Stations Stations Stations... Date Added: 2009-06-06 04:56:45 |
| substitution-4.pdf Path: Binghamton >> M >> 371 Fall, 2009 Description: Substitution Sheet Problem 4 Keith Jones Solve ydx = 2(x + y)dy using the substitution y = ux. uxdx udx 2 (u - 2u - 2u)dx -2u2 - u dx 2u + 2 dx x = 2(x + ux)(xdu + udx) = 2(u + 1)xdu + 2(u + 1)udx = (2u + 2)xdu = xdu = -2 u+1 2u2 + u du P artialF... Date Added: 2009-06-06 04:56:48 |
| project2.ppt Path: UCF >> KI >> 177228 Fall, 2009 Description: Kodak (EK) Deere & Company (DE) Tektronix (TEK) By: Kimberly Thornton Intro To Computer Science Section 0033 Lab Instructor: Naveen Balla 05/21/09 1 KODAK (EK) George Eastman had put first simple camera into the hands of a world of consumers in 18... Date Added: 2009-06-06 04:56:59 |
| p1.pdf Path: Michigan >> MATH >> 592 Winter, 2008 Description: d eg o xue g hx x V9eVVBSVaggvyi yx(VurInB3BVuBr fgpwfEfIfvyxogVpxIfi i g g g u g i iu i x i w g o wx g i e u o gs u gf e Vu0IfexVyvf9ygmfpiygiVBvxUg0Vwfppihn e ix ox wu i q o h u o EBVyxV9IfgE yxxwaEv u g i g iu u ... Date Added: 2009-06-06 04:57:16 |
| normalex.pdf Path: San Jose State >> MATH >> 105 Fall, 2008 Description: Math 105 - The Normal Distribution 1. The resting heart rates for a sample of individuals are normally distributed with a mean of 70 and a standard deviation of 15. Use the 68-95-99.7 rule to find the percentage of heart rates in each of the followi... Date Added: 2009-06-06 04:58:58 |
| Bio 111syllabus-Fa05.TTh.pdf Path: Campbell >> BIOLOGY >> 111 Fall, 2009 Description: Biology 111: Basic Biology Fall 2005 Location: Time: Instructor: Room 147, Lundy-Fetterman School of Business TTh 2:10-3:30pm Dr. Timothy Metz Associate Professor & Chairman of Biology 204 Science Building 893-1732 893-1887 (fax) metz@campbell.edu MW... Date Added: 2009-06-06 04:59:11 |
| geneticdiseases.pdf Path: Campbell >> BIOLOGY >> 111 Fall, 2009 Description: Notes for Lab Instructors Biology 111 - Human genetics lab Introduction Fall 2004 This laboratory is designed to show students the significance of understanding genetic inheritance from a standpoint of human genetic disease. The primary activity wi... Date Added: 2009-06-06 04:59:14 |
| chap2-mobility-management.pdf Path: Virginia Tech >> CS >> 6204 Spring, 2007 Description: Lecture 1: Mobility Management in Mobile Wireless Systems Ing-Ray Chen CS 6204 Mobile Computing Virginia Tech Fall 2005 Mobility Management Location Management Search: find a mobile user\'s current location Update (Register): update a mobile user... Date Added: 2009-06-06 04:59:49 |
| johnson96protocols.pdf Path: Mich Tech >> CS >> 5461 Fall, 2008 Description: To appear in IEEE Personal Communications, 3(1), February 1996. Protocols for Adaptive Wireless and Mobile Networking DAVID B. JOHNSON AND DAVID A. MALTZ Computer Science Department Carnegie Mellon University 5000 Forbes Avenue Pittsburgh, PA 15213-... Date Added: 2009-06-06 05:01:25 |
| StromatolitesThruTime.pdf Path: Washington University in St. Louis >> CLASSWORK >> 480 Fall, 2009 Description: ... Date Added: 2009-06-06 05:04:23 |
| CE 321 PRE momentum.doc Path: Michigan State University >> CE >> 321 Spring, 2008 Description: CE 321 PRE-LAB QUESTIONS LABORATORY #4 LINEAR MOMENTUM NOTE: These questions will be due before class begins on the day of the specified lab. 5 points will be deducted from your grade for this lab if these are not turned in on time and with average ... Date Added: 2009-06-06 05:04:26 |
| Law-InfoSec.ppt Path: University of Louisville >> CIS >> 480 Fall, 2008 Description: Laws governing Information Security 1 Laws governing Information Security Computer Security Act Communications Assistance to Law Enforcement Act Computer Fraud and Abuse Act PDD 63 EO 13231 2 Computer Security Act Passed in 1987. Official de... Date Added: 2009-06-06 05:06:54 |
| 081b-final-exam-results-public.pdf Path: UWO >> MATH >> 081 Fall, 2009 Description: Sheet1 1933 8208 1627 3147 7438 2619 6099 7223 693 2781 2976 8035 996 1090 1757 2176 2641 5060 6711 6978 9266 319 408 779 1479 1719 1926 3479 5510 6432 6482 6745 6778 7638 8743 9651 2234 2289 2821 3652 4274 5005 5690 9591 9610 9330 81 43 46 64 70 41 ... Date Added: 2009-06-06 05:08:39 |
| 16 Horizontal Alignment.ppt Path: Iowa State >> CE >> 453 Fall, 2009 Description: Horizontal Alignment CE 453 Lecture 16 1 Objectives 1. Identify curve types and curve components 2. Learn basics of curve design See: http:/www.fhwa.dot.gov/environment/flex/ch (Chapter 5 from FHWA\'s Flexibility in Highway Design) 2 Horizontal Al... Date Added: 2009-06-06 05:10:57 |
| 14 Capacity Analysis.ppt Path: Iowa State >> CE >> 453 Fall, 2009 Description: C apacity Analysis C 453 Le E cture#15 1 Objectives Re w LOSde vie finition and de rm te inants De capacity and re to \"ide capacitie fine late al\" s Re w calculating capacity using HC proce s for vie M dure basic fre way se e ction Focus on re ... Date Added: 2009-06-06 05:10:57 |
| ctrl.txt Path: UC Riverside >> CS >> 120 Fall, 2009 Description: - andy chou - controller library IEEE; use IEEE.std_logic_1164.all; use IEEE.std_logic_arith.all; entity ctrl is - you will need to add more - ports here as design grows port ( rst : in STD_LOGIC; ... Date Added: 2009-06-06 05:11:59 |
| list1.ps Path: Carnegie Mellon >> STAT >> 707 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.96 Copyright 2005 Radical Eye Software %Title: list1.dvi %CreationDate: Wed Oct 8 15:22:43 2008 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMSY10 CMR10 CMMI10 CMR8 CMMI8 %DocumentPaperSi... Date Added: 2009-06-06 05:12:23 |
| polm308d.ps Path: East Los Angeles College >> MATH >> 308 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.85 Copyright 1999 Radical Eye Software %Title: polm308d.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips p... Date Added: 2009-06-06 05:13:05 |
| 1.txt Path: Carnegie Mellon >> DISK >> 31005086 Fall, 2009 Description: 31005086... Date Added: 2009-06-06 05:13:49 |
| 00000011.pdf Path: Carnegie Mellon >> TERA >> 05102060 Fall, 2009 Description: ... Date Added: 2009-06-06 05:14:09 |
| 00000011.pdf Path: Carnegie Mellon >> DISK >> 05102060 Fall, 2009 Description: ... Date Added: 2009-06-06 05:14:09 |
| 00000008.pdf Path: Carnegie Mellon >> DISK >> 05101898 Fall, 2009 Description: ... Date Added: 2009-06-06 05:16:30 |
| 00000151.pdf Path: Carnegie Mellon >> DISK >> 31004112 Fall, 2009 Description: ... Date Added: 2009-06-06 05:17:25 |
| 00000151.pdf Path: Carnegie Mellon >> TERA >> 31004112 Fall, 2009 Description: ... Date Added: 2009-06-06 05:17:25 |
| 00000171.pdf Path: Carnegie Mellon >> TERA >> 31004112 Fall, 2009 Description: ... Date Added: 2009-06-06 05:17:31 |
| 00000171.pdf Path: Carnegie Mellon >> DISK >> 31004112 Fall, 2009 Description: ... Date Added: 2009-06-06 05:17:31 |
| 00000363.pdf Path: Carnegie Mellon >> TERA >> 31004112 Fall, 2009 Description: ... Date Added: 2009-06-06 05:18:26 |
| 00000363.pdf Path: Carnegie Mellon >> DISK >> 31004112 Fall, 2009 Description: ... Date Added: 2009-06-06 05:18:26 |
| 00000048.pdf Path: Carnegie Mellon >> DISK >> 05102292 Fall, 2009 Description: ... Date Added: 2009-06-06 05:18:43 |
| 00000048.pdf Path: Carnegie Mellon >> TERA >> 05102292 Fall, 2009 Description: ... Date Added: 2009-06-06 05:18:43 |
| 00000023.pdf Path: Carnegie Mellon >> TERA >> 05102642 Fall, 2009 Description: ... Date Added: 2009-06-06 05:19:29 |
| 00000023.pdf Path: Carnegie Mellon >> DISK >> 05102642 Fall, 2009 Description: ... Date Added: 2009-06-06 05:19:29 |
| 00000054.pdf Path: Carnegie Mellon >> TERA >> 05101875 Fall, 2009 Description: ... Date Added: 2009-06-06 05:20:14 |
| 00000054.pdf Path: Carnegie Mellon >> DISK >> 05101875 Fall, 2009 Description: ... Date Added: 2009-06-06 05:20:14 |
| 00000009.pdf Path: Carnegie Mellon >> DISK >> 31003964 Fall, 2009 Description: ... Date Added: 2009-06-06 05:20:25 |
| 00000060.pdf Path: Carnegie Mellon >> DISK >> 05101885 Fall, 2009 Description: ... Date Added: 2009-06-06 05:21:41 |
| 00000060.pdf Path: Carnegie Mellon >> TERA >> 05101885 Fall, 2009 Description: ... Date Added: 2009-06-06 05:21:41 |
| 00000023.pdf Path: Carnegie Mellon >> TERA >> 31004069 Fall, 2009 Description: ... Date Added: 2009-06-06 05:21:53 |
| 00000023.pdf Path: Carnegie Mellon >> DISK >> 31004069 Fall, 2009 Description: ... Date Added: 2009-06-06 05:21:53 |
| 00000032.pdf Path: Carnegie Mellon >> TERA >> 31004069 Fall, 2009 Description: ... Date Added: 2009-06-06 05:21:56 |
| 00000032.pdf Path: Carnegie Mellon >> DISK >> 31004069 Fall, 2009 Description: ... Date Added: 2009-06-06 05:21:56 |
| 00000093.pdf Path: Carnegie Mellon >> DISK >> 31008086 Fall, 2009 Description: ... Date Added: 2009-06-06 05:22:46 |
| 00000025.pdf Path: Carnegie Mellon >> TERA >> 31004506 Fall, 2009 Description: ... Date Added: 2009-06-06 05:24:36 |
| 00000025.pdf Path: Carnegie Mellon >> DISK >> 31004506 Fall, 2009 Description: ... Date Added: 2009-06-06 05:24:36 |
| 00000028.pdf Path: Carnegie Mellon >> TERA >> 31004506 Fall, 2009 Description: ... Date Added: 2009-06-06 05:24:37 |
| 00000028.pdf Path: Carnegie Mellon >> DISK >> 31004506 Fall, 2009 Description: ... Date Added: 2009-06-06 05:24:37 |
| 00000070.pdf Path: Carnegie Mellon >> DISK >> 31004506 Fall, 2009 Description: ... Date Added: 2009-06-06 05:24:49 |
| 00000070.pdf Path: Carnegie Mellon >> TERA >> 31004506 Fall, 2009 Description: ... Date Added: 2009-06-06 05:24:49 |
| 00000073.pdf Path: Carnegie Mellon >> DISK >> 31004512 Fall, 2009 Description: ... Date Added: 2009-06-06 05:27:27 |
| L19.pdf Path: Duke >> CPS >> 130 Fall, 2009 Description: Lecture 19: Basic Graph Algorithms (CLRS B.4-B.5, 22.1-22.4) June 17th, 2002 1 Graph Problems You should already know about graphs Today we will quickly review basic definitions and a few fundamental graph algorithms. 1.1 Definitions A graph... Date Added: 2009-06-06 05:28:24 |
| 00000004.pdf Path: Carnegie Mellon >> DISK >> 05102353 Fall, 2009 Description: ... Date Added: 2009-06-06 05:29:01 |
| 00000360.pdf Path: Carnegie Mellon >> DISK >> 31006081 Fall, 2009 Description: ... Date Added: 2009-06-06 05:32:18 |
| 00000017.pdf Path: Carnegie Mellon >> DISK >> 05102553 Fall, 2009 Description: ... Date Added: 2009-06-06 05:34:59 |
| 00000030.pdf Path: Carnegie Mellon >> DISK >> 05102553 Fall, 2009 Description: ... Date Added: 2009-06-06 05:35:00 |
| 00000194.pdf Path: Carnegie Mellon >> DISK >> 31003691 Fall, 2009 Description: ... Date Added: 2009-06-06 05:35:48 |
| 00000058.pdf Path: Carnegie Mellon >> DISK >> 05103006 Fall, 2009 Description: ... Date Added: 2009-06-06 05:37:04 |
| 00000059.pdf Path: Carnegie Mellon >> TERA >> 05102800 Fall, 2009 Description: ... Date Added: 2009-06-06 05:37:39 |
| 00000059.pdf Path: Carnegie Mellon >> DISK >> 05102800 Fall, 2009 Description: ... Date Added: 2009-06-06 05:37:40 |
| 00000097.pdf Path: Carnegie Mellon >> TERA >> 31004504 Fall, 2009 Description: ... Date Added: 2009-06-06 05:38:10 |
| 00000097.pdf Path: Carnegie Mellon >> DISK >> 31004504 Fall, 2009 Description: ... Date Added: 2009-06-06 05:38:10 |
| 00000038.pdf Path: Carnegie Mellon >> DISK >> 05101909 Fall, 2009 Description: ... Date Added: 2009-06-06 05:38:41 |
| 00000006.pdf Path: Carnegie Mellon >> DISK >> 05102550 Fall, 2009 Description: ... Date Added: 2009-06-06 05:38:56 |
| 00000022.pdf Path: Carnegie Mellon >> DISK >> 05102635 Fall, 2009 Description: ... Date Added: 2009-06-06 05:39:04 |
| 00000122.pdf Path: Carnegie Mellon >> DISK >> 31008087 Fall, 2009 Description: ... Date Added: 2009-06-06 05:39:45 |
| 00000241.pdf Path: Carnegie Mellon >> DISK >> 31006056 Fall, 2009 Description: ... Date Added: 2009-06-06 05:44:32 |
| 00000444.pdf Path: Carnegie Mellon >> DISK >> 31006056 Fall, 2009 Description: ... Date Added: 2009-06-06 05:45:09 |
| 00000121.pdf Path: Carnegie Mellon >> DISK >> 31005783 Fall, 2009 Description: ... Date Added: 2009-06-06 05:46:04 |
| 00000169.pdf Path: Carnegie Mellon >> DISK >> 31005783 Fall, 2009 Description: ... Date Added: 2009-06-06 05:46:13 |
| 00000073.pdf Path: Carnegie Mellon >> DISK >> 31004070 Fall, 2009 Description: ... Date Added: 2009-06-06 05:47:48 |
| 00000102.pdf Path: Carnegie Mellon >> DISK >> 31004070 Fall, 2009 Description: ... Date Added: 2009-06-06 05:47:54 |
| 00000286.pdf Path: Carnegie Mellon >> DISK >> 31006255 Fall, 2009 Description: ... Date Added: 2009-06-06 05:51:27 |
| 00000309.pdf Path: Carnegie Mellon >> DISK >> 31006255 Fall, 2009 Description: ... Date Added: 2009-06-06 05:51:31 |
| 00000172.pdf Path: Carnegie Mellon >> DISK >> 31005140 Fall, 2009 Description: ... Date Added: 2009-06-06 05:52:30 |
| 00000369.pdf Path: Carnegie Mellon >> DISK >> 31005140 Fall, 2009 Description: ... Date Added: 2009-06-06 05:53:06 |
| 00000472.pdf Path: Carnegie Mellon >> DISK >> 31005140 Fall, 2009 Description: ... Date Added: 2009-06-06 05:53:26 |
| 00000042.pdf Path: Carnegie Mellon >> DISK >> 05102594 Fall, 2009 Description: ... Date Added: 2009-06-06 05:53:39 |
| 00000117.pdf Path: Carnegie Mellon >> DISK >> 05102594 Fall, 2009 Description: ... Date Added: 2009-06-06 05:53:53 |
| 00000239.pdf Path: Carnegie Mellon >> DISK >> 05102594 Fall, 2009 Description: ... Date Added: 2009-06-06 05:54:16 |
| 00000013.pdf Path: Carnegie Mellon >> DISK >> 31006119 Fall, 2009 Description: ... Date Added: 2009-06-06 05:55:31 |
| 00000112.pdf Path: Carnegie Mellon >> DISK >> 31006119 Fall, 2009 Description: ... Date Added: 2009-06-06 16:27:21 |
| 00000325.pdf Path: Carnegie Mellon >> DISK >> 31005128 Fall, 2009 Description: ... Date Added: 2009-06-06 16:28:36 |
| 00000008.pdf Path: Carnegie Mellon >> DISK >> 31005082 Fall, 2009 Description: ... Date Added: 2009-06-06 16:29:10 |
| 00000273.pdf Path: Carnegie Mellon >> DISK >> 31004911 Fall, 2009 Description: ... Date Added: 2009-06-06 16:30:42 |
| 00000163.pdf Path: Carnegie Mellon >> DISK >> 31004873 Fall, 2009 Description: ... Date Added: 2009-06-06 16:33:03 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 05101583 Fall, 2009 Description: ... Date Added: 2009-06-06 16:34:02 |
| 00000204.pdf Path: Carnegie Mellon >> DISK >> 31004898 Fall, 2009 Description: ... Date Added: 2009-06-06 16:35:02 |
| 00000345.pdf Path: Carnegie Mellon >> DISK >> 31004898 Fall, 2009 Description: ... Date Added: 2009-06-06 16:35:29 |
| 00000018.pdf Path: Carnegie Mellon >> DISK >> 05101895 Fall, 2009 Description: ... Date Added: 2009-06-06 16:39:11 |
| 00000043.pdf Path: Carnegie Mellon >> DISK >> 05101895 Fall, 2009 Description: ... Date Added: 2009-06-06 16:39:16 |
| 00000048.pdf Path: Carnegie Mellon >> DISK >> 05102125 Fall, 2009 Description: ... Date Added: 2009-06-06 16:39:26 |
| mutant_seq_KRAS.txt Path: U. Houston >> BTECH >> 3301 Fall, 2009 Description: >mutant sequenceGGCCGCGGCGGCGGAGGCAGCAGCGGCGGCGGCAGTGGCGGCGGCGAAGGTGGCGGCGGCTCGGCCAGTACTCCCGGCCCCCGCCATTTCGGACTGGGAGCGAGCGCGGCGCAGGCACTGAAGGCGGCGGCGGGGCCAGAGGCTCAGCGGCTCCCAGGTGCGGGAGAGAGGCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTTGTGGCGTAGGCAAGAGTGC... Date Added: 2009-06-06 16:41:24 |
| 00000083.pdf Path: Carnegie Mellon >> TERA >> 31004511 Fall, 2009 Description: ... Date Added: 2009-06-06 16:42:21 |
| 00000083.pdf Path: Carnegie Mellon >> DISK >> 31004511 Fall, 2009 Description: ... Date Added: 2009-06-06 16:42:21 |
| 00000087.pdf Path: Carnegie Mellon >> TERA >> 31004511 Fall, 2009 Description: ... Date Added: 2009-06-06 16:42:22 |
| 00000087.pdf Path: Carnegie Mellon >> DISK >> 31004511 Fall, 2009 Description: ... Date Added: 2009-06-06 16:42:22 |
| 00000030.pdf Path: Carnegie Mellon >> DISK >> 05102535 Fall, 2009 Description: ... Date Added: 2009-06-06 16:42:31 |
| 00000087.pdf Path: Carnegie Mellon >> TERA >> 31005464 Fall, 2009 Description: ... Date Added: 2009-06-06 16:43:05 |
| 00000087.pdf Path: Carnegie Mellon >> DISK >> 31005464 Fall, 2009 Description: ... Date Added: 2009-06-06 16:43:05 |
| 00000015.pdf Path: Carnegie Mellon >> DISK >> 31005732 Fall, 2009 Description: ... Date Added: 2009-06-06 16:44:24 |
| marc.txt Path: Carnegie Mellon >> DISK >> 05101885 Fall, 2009 Description: 00996cam 2200277Ia 45 00010013000000030006000130050017000190080041000360400025000770430012001020700021001140720009001350820010001440860015001540490009001691000049001782450138002272600052003653000035004174900076004525000017005286500043005457000045005... Date Added: 2009-06-06 16:45:01 |
| marc.txt Path: Carnegie Mellon >> TERA >> 05101885 Fall, 2009 Description: 00996cam 2200277Ia 45 00010013000000030006000130050017000190080041000360400025000770430012001020700021001140720009001350820010001440860015001540490009001691000049001782450138002272600052003653000035004174900076004525000017005286500043005457000045005... Date Added: 2009-06-06 16:45:01 |
| SDec3.ppt Path: Cal Poly Pomona >> BHS >> 307 Fall, 2009 Description: BHS 307 Statistics for the Behavioral Sciences Chapter 27 ChiSquare Test for Qualitative Data Chi-Square (2) Test For qualitative data Tests whether observed frequencies are closely similar to hypothesized expected frequencies. Expected fr... Date Added: 2009-06-06 16:47:10 |
| exp0330a.txt Path: UNC >> GEOG >> 594 Fall, 2008 Description: Export Version 3.10 3.10-4 Started. Using Export Setup: New ESRI Shapefile The following files in T:\\liangj\\lab6 will be exported: R032911A_1.cor Reading file R032911A_1.cor File R032911A_1.cor read successfully 1 input file(s) read. 73 positi... Date Added: 2009-06-06 16:47:39 |
| Xr12-121.xls Path: Laurentian >> ECON >> 2900 Fall, 2009 Description: Sheet1 Time 3.5 4.1 3.5 3.5 3.5 4.5 3.2 3.5 3.4 3.7 3.4 4.1 3.4 3.9 3.6 3.7 3.6 3.4 3.2 3.7 3.5 3.5 3.4 3.3 3.2 3.7 2.9 4.3 3.8 3.8 3.8 4.1 3.7 4.0 3.4 3.5 4.2 4.7 3.4 3.1 4.4 3.3 4.1 3.7 3.8 4.0 3.8 3.1 3.4 4.0 3.9 3.4 Page 1 Sheet1 3.6 3.7 4.1 3.... Date Added: 2009-06-06 16:48:18 |
| sn14_1.pdf Path: U. Houston >> MATH >> 1330 Fall, 2008 Description: Math 1330 Notes Week 14 8.1: The Parabola We already know that a parabola is the graph of a quadratic function f ( x ) = ax + bx + c . But there is more to be learned about parabolas. Definition: A parabola is the set of all points equally distant ... Date Added: 2009-06-06 16:49:35 |
| are100a-material-covered-before-midterm-1.pdf Path: UC Davis >> ARE >> 100 Fall, 2009 Description: ... Date Added: 2009-06-06 16:50:03 |
| defs.pdf Path: DigiPen >> MAT >> 300 Fall, 2009 Description: MAT300 - Summer 2009 - Important Definitions and Results Part I - Polynomials and Bezier Curves Polynomials and Vector Spaces Pd is the vector space of polynomials a0 + a1 t + a2 t2 + + ad td of degree at most d. The standard basis of Pd is the ... Date Added: 2009-06-06 16:50:33 |
| B0560lemonrind_4_dem.txt Path: Washington University in St. Louis >> MER >> 0560 Fall, 2009 Description: The file B560_LemonRind_postRAT_4_dem.tif contains a linear stretch of the DEM. To reconstruct the z-axis of the DEM in units of mm, 1) multiply TIFF by 0.0261925 2) Add -6.67908 The x & y scales are 0.030 mm / pixel. Maximum value fo... Date Added: 2009-06-06 16:51:53 |
| Exp 6 calculations.pdf Path: U. Houston >> CHEM >> 111 Fall, 2009 Description: Exp 6. Gas laws CALCULATIONS A. Boyle\'s law # books volume of air 1/V 1 0 30.0 0.033 2 1 28.0 0.036 3 2 26.0 0.038 4 3 24.0 0.042 5 4 22.0 0.045 6 Relationship between # books and volume of air (see on graph, where y = 1/V, x = # books) y = 0.003... Date Added: 2009-06-06 16:54:35 |
| page39.pdf Path: U. Houston >> CHEM >> 1332 Fall, 2008 Description: ... Date Added: 2009-06-06 16:54:39 |
| resume.pdf Path: St. John Fisher >> KEEP >> 04626 Fall, 2009 Description: Cristina Vaughn Cristina Vaughn cmv04626@sjfc.edu Education: St. John Fisher College Anticipated graduation: May 2010 Double Major:Early Childhood Education/Special Education Anticipated Study Abroad: Australia 2009 Cicero-North Syracuse High... Date Added: 2009-06-06 16:54:44 |
| mat3223_20090402.pdf Path: Texas San Antonio >> MAT >> 3223 Fall, 2008 Description: ... Date Added: 2009-06-06 16:57:02 |
| AG-439-32.pdf Path: N.C. State >> AG >> 439 Fall, 2008 Description: ... Date Added: 2009-06-06 16:57:08 |
| x121aa.pdf Path: Texas >> X >> 121 Fall, 2009 Description: 1-methylnaphthalene dmso-d6 x121a Solvent: DMSO Temp. 27.0 C / 300.1 K File: 121 PULSE SEQUENCE Relax. delay 1.000 sec Pulse 42.0 degrees Acq. time 3.740 sec Width 4499.9 Hz Single scan OBSERVE H1, 299.8896528 MHz DATA PROCESSING FT size 65536 Total ... Date Added: 2009-06-06 16:57:24 |
| r111a.pdf Path: Texas >> R >> 111 Fall, 2009 Description: Methylene iodide C6D6 Shoulders r111a Solvent: Benzene Ambient temperature File: r111a PULSE SEQUENCE Relax. delay 1.000 sec Pulse 12.0 degrees Acq. time 5.978 sec Width 3784.7 Hz Single scan OBSERVE H1, 299.8882474 MHz DATA PROCESSING FT size 65536 ... Date Added: 2009-06-06 16:57:28 |
| x117ff.pdf Path: Texas >> X >> 117 Fall, 2009 Description: methyl octalindione exp6 hetcor DEC. & VT 299.891 H1 40 -10.2 nny ccw 9259 undefined undefined n 27.0 PROCESSING sb 0.032 sbs not used wtfile proc ft fn 2048 math f dfrq dn dpwr dof dm dmm dmf dseq dres homo temp werr wexp procplot wbs wnt 2D PROCESS... Date Added: 2009-06-06 16:57:46 |
| misra08rr1.pdf Path: Rochester >> AEC >> 510 Fall, 2009 Description: Referee Report for Apoorva Misra Paper Title: \"Earnings Management and Distress Pension Plan Termination\" Prepared by: Saumya Prabhat Summary The paper looks at income decreasing earning management by prior to the year in which defined benefit pensio... Date Added: 2009-06-06 17:00:05 |
| T0505.t04.n_notor-logo.pdf Path: UCSC >> T >> 0505 Fall, 2009 Description: T0505.t04 n_notor 4 3 2 1 S NA M S K Q L L A LN I D GA L L RS N G KI H QA T K D A I EY V K KK G I YV T L VT N R HF R S A Q KI A K S L K L D A K L IT H S G A Y I AE K I D A P F FE K R I S D D HT F N I V Q V LE 10 20 30 40 50 60 70 80 90 1 N 4 3 2 1 ... Date Added: 2009-06-06 17:00:11 |
| T0505.t06.CB_burial_14_7-logo.pdf Path: UCSC >> T >> 0505 Fall, 2009 Description: T0505.t06 CB_burial_14_7 3 2 1 S NA M S K Q L L A LN I D GA L L RS N G KI H QA T K D A I EY V K KK G I YV T L VT N R HF R S A Q KI A K S L K L D A K L IT H S G A Y I AE K I D A P F FE K R I S D D HT F N I V Q V LE 1 10 20 30 40 50 60 70 80 90 A B D ... Date Added: 2009-06-06 17:00:13 |
| submit.txt Path: Washington >> JOBS >> 50000 Fall, 2009 Description: executable = pass6_50016.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs50000-50099/50016... Date Added: 2009-06-06 17:01:18 |
| Intro to ANOVA.xls Path: Idaho >> PSY >> 586 Fall, 2009 Description: AVG SD Var Grand Mean 50 degrees 0 1 3 1 0 1.00 1.22 1.50 2.00 Sums of Squares 30.00 16.00 46.00 70 degrees 4 3 6 3 4 4.00 1.22 1.50 90 degrees 1 2 2 0 0 1.00 1.00 1.00 Between Within Total degrees of freedom 2 12 14 Mean Squares 15.00 1.33 F ... Date Added: 2009-06-06 17:02:34 |
| Pedigree Analysis and Advanced Mendelian Genetics.ppt Path: Southwestern >> PSY >> 497 Fall, 2009 Description: Pedigree Analysis and Genotype/ Phenotype Relationships Pedigree Analysis Although human genetic transmission follows the same rules applied to fruit flies, it is difficult to obtain controlled experimental crosses with humans. Therefore, research... Date Added: 2009-06-06 17:02:53 |
| Kitty 28July daily_evaluation.doc Path: UCSD >> WORKSHOP >> 0728 Fall, 2009 Description: Daily Evaluation Name: Kathryn Henderson (Kitty) Date: Thursday, July 28, 2005 1. What was the most interesting experience you had today? David Sandwells talk. Also talking about our lessons and getting feedback 2. What was the least interesting exp... Date Added: 2009-06-06 17:06:48 |
| Patent Introduction.ppt Path: Portland >> ME >> 493 Winter, 2008 Description: Patent Overview by Jeff Woller Why have Patents? Patents make some people rich but, does that seem like something the government should protect? Do they hinder the pace of technological developments? Patents Are Constitutionally Provided Article 1... Date Added: 2009-06-06 17:08:31 |
| YHR037W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YHR >> 037 Fall, 2009 Description: YHR037W.t2k DSSP-EHL2 2 1 CCC E E E X 1 10 20 30 40 E 2 1 H E H E T H HHH 51 C C C C CCCHHHX C C X X X X X X X HH X C C C X X X X H X X X X E C EE CC CCE C E E EE X CC CCCEX X X X E CC C CCCEECCCECCCCCCCECCCCECC CE EC H X EEE 8... Date Added: 2009-06-06 17:09:14 |
| YLR259C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YLR >> 259 Fall, 2009 Description: YLR259C.t2k CB_BURIAL_14_7 3 2 1 X A A A A F D BBB A C AADCCCCCCAA E A B A A D B B C F F C B G F DDDD D CDDDD D D D D D CDDDE GEC D D D C D B C X X X X X X X X X X X X X X XXCCCCDCCCCDXCFXXXFEDXBFECXXXXX XX ABB AAAAA XX D A A AAAAA BBBBB A B... Date Added: 2009-06-06 17:10:46 |
| YLR263W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YLR >> 263 Fall, 2009 Description: YLR263W.t2k DSSP-EHL2 2 1 CCC 1 C C C C C H H X X X X X X X X X X H H H 10 20 30 40 E 2 1 HHHH X X X H T E H H C C C X X C X E H C X EEEEEEEEEEE HHCC C C X C C H C CHHHHHEEXHXXXHHCCEXXXEXXCEXX C C C C C E E E C C C C C H H H C C C ... Date Added: 2009-06-06 17:10:47 |
| YLR262C-A.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YLR >> 262 Fall, 2009 Description: YLR262C-A.t2k DSSP-EHL2 2 1 CCCCCCCC 1 S 2 1 T E H E H E E H E H H X X X X X X X X X X X X X X X 10 20 30 40 H H T S CC 51 C E E E X X X X X X CCC C X H H X X X H CXEE X X X CCC H 60 KP LVG GGIKKSGK K T 50 HH HHHH CC H CC CCCCCCC... Date Added: 2009-06-06 17:11:08 |
| YLR227W-B.t2k.w0.5-logo.pdf Path: UCSC >> YLR >> 227 Fall, 2009 Description: X X X X V A 451 460 470 480 490 T 6 5 4 3 2 1 V I L S S E T S T S H T E T E L I V L K K G N XXXXXXXX K X D NA FVED L I K G T G DILHIKEL S L V S VTV V A M M L T M F F XXXXXXX XXXXXXVFXXXXAXXX X X X L I I V VY S K E G T T K XX... Date Added: 2009-06-06 17:11:13 |
| bao080407-12_lc.pdf Path: Texas >> PG >> 1159 Fall, 2009 Description: ... Date Added: 2009-06-06 17:13:01 |
| BinarySystemExample.pdf Path: UF >> CIS >> 3022 Fall, 2008 Description: Given this sample computer system, similar to the one discussed in lecture fill in the appropriate portions of each table. The system has a 5-bit program counter, an 8-bit Accumulator, and 32 bytes of addressable memory (we will only use 8 bytes of t... Date Added: 2009-06-06 17:14:25 |
| ECE412_class2Notes.pdf Path: New Mexico >> ECE >> 412 Fall, 2009 Description: ... Date Added: 2009-06-06 17:14:37 |
| chap4a.ps Path: New Mexico >> ECE >> 421 Fall, 2008 Description: %!PS-Adobe-3.0 %BoundingBox: (atend) %Pages: 10 0 %PageOrder: (atend) %DocumentFonts: (atend) %Creator: Frame 4.0 %DocumentData: Clean7Bit %EndComments %BeginProcSet: PStoPS 1 15 userdict begin [/showpage/erasepage/copypage]{dup where{pop dup load ty... Date Added: 2009-06-06 17:15:11 |
| 20220240100383_RC_1345_12.txt Path: East Los Angeles College >> MAN >> 2022024010 Fall, 2009 Description: #chan code gain offset innse comment 0 1000 53.7 15.3 694 unbonded 1 1000 53.2 14.0 626 unbonded 2 1000 54.1 9.8 685 unbonded 3 1000 52.9 3.3 668 unbonded 4 1000 53.4 6.8 664 unbonded 5 1000 53.3 19.6 653 unbonded 6 1000 53... Date Added: 2009-06-06 17:16:05 |
| ch10.ppt Path: CSU Chico >> CSCI >> 112 Fall, 2009 Description: Chapter 10: Trees Data Abstraction & Problem Solving with C+ FifthEdition by Frank M. Carrano Copyright 2007 Pearson Education, Inc. Publishing as Pearson Addison-Wesley. Ver. 5.0. Categories of Data-Management Operations General:Operationsthat ... Date Added: 2009-06-06 17:25:07 |
| ch10.ppt Path: CSU Chico >> WEEK >> 112 Fall, 2009 Description: Chapter 10: Trees Data Abstraction & Problem Solving with C+ FifthEdition by Frank M. Carrano Copyright 2007 Pearson Education, Inc. Publishing as Pearson Addison-Wesley. Ver. 5.0. Categories of Data-Management Operations General:Operationsthat ... Date Added: 2009-06-06 17:25:07 |
| What Is Intellectual Property.doc Path: Trinity U >> CS >> 3194 Fall, 2009 Description: What Is Intellectual Property? \"Intellectual Property\" is a generic term used to describe products of the human intellect that have economic value. Computer Software is just one of the many forms of intellectual property. Other examples include such ... Date Added: 2009-06-06 17:26:15 |
| CS7301-2-NewtonianDynamics.pdf Path: Dallas >> XXG >> 061000 Fall, 2009 Description: Newtonian Dynamics 1 Overview Mass Points Kinematics Differential equations Phase space Newton\'s laws Forces Mass Points Newtonian dynamics System of moving pass points Moving mass points Objects with mass, but without volume Mass point system for... Date Added: 2009-06-06 17:27:21 |
| CS7301-2-NewtonianDynamics.pdf Path: Dallas >> XXG >> 7301 Fall, 2009 Description: Newtonian Dynamics 1 Overview Mass Points Kinematics Differential equations Phase space Newton\'s laws Forces Mass Points Newtonian dynamics System of moving pass points Moving mass points Objects with mass, but without volume Mass point system for... Date Added: 2009-06-06 17:27:21 |
| 2007518_f01x_0700374.pdf Path: Stanford >> ALVR >> 1037 Fall, 2009 Description: Case 3 :07-cv-00374- JSW Document 45 Filed 05/18/2007 Page 1 of 1 2 3 4 5 6 7 8 LIONEL Z. GLANCY, ESQ. #134180 ANDY SOHRN, ESQ. #241388 GLANCY BINKOW & GOLDBERG LLP 1801 Avenue of the Stars, Suite 311 Los Angeles, CA 90067 Tel: (310) 201-9150 Fa... Date Added: 2009-06-06 17:27:35 |
| handout_28.ps Path: Wisconsin >> ECE >> 352 Fall, 2008 Description: %!PS-Adobe-3.0 %Title: Microsoft Word - HANDOUT.DOC %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 10/22/97 22:40:46 %BoundingBox: 19 8 593 784 %Pages: (atend) %PageOrder: PSCRIPT.DRV Version 4.0 %Requirements: %DocumentNeededFonts: (atend) %Docume... Date Added: 2009-06-06 17:28:07 |
| lec_20.ps Path: Wisconsin >> ECE >> 352 Fall, 2008 Description: %!PS-Adobe %Creator: psmulti %Pages: (atend) %EndComments %BeginPrologue %BeginDocument: /usr/common/lib/psmulti/format-standard.ps %! %BeginDocument: psmulti-standard.ps %Creator: D.Murray.Laing %EndComments % % % % % % % % % % % % % % % % % % % % %... Date Added: 2009-06-06 17:28:11 |
| submit.txt Path: Washington >> JOBS >> 100 Fall, 2009 Description: executable = run_186.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\all_gamma180_v9r7\\jobs100-199/1... Date Added: 2009-06-06 17:31:19 |
| MVA_Sensory_Deficits.ppt Path: Western Washington >> BIOL >> 349 Spring, 2008 Description: Sensory Deficits Hyposmia, High frequency hearing loss, and Bilateral left Hemianopia The Problem Ms. Windsong suffered a head injury from an MVA. She injured her right ear, her right occipital lobe, her right temporal lobe, and parts of her dience... Date Added: 2009-06-06 17:32:27 |
| Sequence Diagrams.doc Path: Regis >> CS >> 436 Fall, 2009 Description: Sequence Diagram: 1 operation User . . . Digit Digit Operation . . . Keypad Digit Digit Register Set . . . I/O Reg. Data Reg. Expression NonDigit Entered Operation Enter Operand Get Value Value Set Value . . . Digit Digit \"=\" . . . Digit Dig... Date Added: 2009-06-06 17:32:45 |
| week10cq.pdf Path: Rutgers >> PHYSICS >> 204 Fall, 2009 Description: Physics 204 Week Ten Concept Questions, Spring 2008 Note: This document consists of material copyrighted by John Wiley and Sons Chapter 28: Relativity 5. There are tables that list data for the various particles of matter that physicists have discov... Date Added: 2009-06-06 17:33:43 |
| agenda_04_21_08.pdf Path: SUNY Buffalo >> PDFS >> 0708 Fall, 2009 Description: University Undergraduate Curriculum Committee Meeting Agenda April 21st, 2008 567 Capen Hall, 3:00 p.m. Dr. Michael E. Ryan, Chair Dr. Andreas Daum, Co-Chair I. Minutes a. Minutes of the March Meeting Administrative Approvals a. PD 306 Communities... Date Added: 2009-06-06 17:34:22 |
| Minitab Assignment 5, Spring 2008.pdf Path: Austin Peay >> MATH >> 1530 Fall, 2009 Description: Minitab Assignment Five 1. First type your name in the session window. 2. You will do the case study on p. 376 using Minitab. Begin by right clicking on the link for the worksheet for Minitab assignment 5, and choosing save target as. Save the worksh... Date Added: 2009-06-06 17:35:22 |
| ps3.ps Path: Columbia >> EE >> 6930 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: ps3.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -f ps3.dvi %DVIPSParameters: dpi=300, comments removed %DVIPS... Date Added: 2009-06-06 17:35:58 |
| laurent.pdf Path: Arizona >> NRSC >> 581 Fall, 2009 Description: RESEARCH ARTICLES Oscillations and Sparsening of Odor Representations in the Mushroom Body Javier Perez-Orive,* Ofer Mazor,* Glenn C. Turner, Stijn Cassenaer, Rachel I. Wilson, Gilles Laurent In the insect olfactory system, oscillatory synchronizati... Date Added: 2009-06-06 17:36:39 |
| ps12.pdf Path: Wisconsin >> E >> 310 Fall, 2009 Description: Econ 310 Sandholm Problem Set 12 Solutions n i 1. B = x iY i x2 i i ( n ( i xi )( x i i ) i 2 Yi )= j nx j n x2 i i ( ( i xi ) x i i ) 2 Yj = j c j Yj where cj equals the expression in the parentheses. A = Y Bx = Bx + 1 jn... Date Added: 2009-06-06 17:37:43 |
| Day32.pdf Path: HWS >> MATH >> 331 Fall, 2009 Description: Math 331 Homework: Day 32 Review Section 4.1 which we should finish on Monday. Read Section 4.2 which we will begin on Monday. Among the key theorems: A sequence converges if and only if it is a Cauchy sequence. A bounded, monotone sequence converges... Date Added: 2009-06-06 17:41:27 |
| TriangleAlt.pdf Path: HWS >> MATH >> 131 Fall, 2009 Description: Integration by Triangle Substitutions The Area of a Circle So far we have used the technique of u-substitution (i.e., reversing the chain rule) and integration by parts (reversing the product rule) to extend the list of functions that we can antidier... Date Added: 2009-06-06 17:41:42 |
| Day24.pdf Path: HWS >> MATH >> 135 Fall, 2009 Description: Math 135 Homework: Day 24 Reading, Etc. Today we begin working on relations. Read Chapter 4 sections 1 through 3. Sections 2 and 3 have a lot of denitions and new terminology. Keep a list of key terms. Make sure you try the many exercises in these se... Date Added: 2009-06-06 17:42:34 |
| hw6.pdf Path: Colorado >> APPM >> 5440 Fall, 2008 Description: Homework set 6 - APPM5440 From the textbook: 2.10, 2.11, 2.12. If you have time, do 2.14. Problem: Set I = (0, 1) and let (fn ) be a sequence of continuously n=1 differentiable functions on I. Set = {fn : 1 n < }. (a) For a given n, suppose that su... Date Added: 2009-06-06 17:43:01 |
| Product_Hyperlink_Table.txt Path: Wisc Eau Claire >> CS >> 321 Fall, 2009 Description: <!DOCTYPE HTML PUBLIC \"-/W3C/DTD HTML 4.01 Transitional/EN\"> <HTML> <HEAD> <%@ page language=\"java\" contentType=\"text/html; charset=ISO-8859-1\" pageEncoding=\"ISO-8859-1\" %> <%@ page import=\"java.sql.*, java.util.*\" %> <META http-equiv=\"Content-Type\"... Date Added: 2009-06-06 17:43:02 |
| 03.12.08.pptx Path: Wisc Eau Claire >> CS >> 321 Fall, 2009 Description: Click to edit Master subtitle style 5/22/09 Or iginalS iteT emplate 5/22/09 Client Comments Add Add Add Add Music New Pages links to other pages a Luckys page 5/22/09 Navigation Bar Link 5/22/09 PageLayouthome 5/22/09 PageLayoutLuck... Date Added: 2009-06-06 17:43:09 |
| MH-02-pp-SN-War-of-American-Independence-F07-52-plus-2.ppt Path: Campbell >> H >> 310 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_author:SR|WEBSERVER\\Administrator vti_modifiedby:SR|WEBSERVER\\Administrator vti_timelastmodified:TR|14 Jul 2008 16:29:36 -0000 vti_timecreated:TR|14 Jul 2008 15:15:50 -0000 vti_title:SR|Slide 1 vti_extenderversion:SR|5.0.2... Date Added: 2009-06-06 17:43:15 |
| r40703_RPC_LST_compare.ps Path: Stanford >> MEETING >> 070109 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: plots/RPC_LST_compare.ps (Landscape A 4) %Pages: (atend) %Creator: ROOT Version 4.01/02 %CreationDate: Wed Mar 30 17:38:15 2005 %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} def /sw {s... Date Added: 2009-06-06 17:46:38 |
| teams.txt Path: Wisconsin >> CS >> 537 Spring, 2001 Description: COPING WITH HITCHHIKERS AND COUCH POTATOES ON TEAMS BY BARBARA OAKLEY You will usually find your university teammates as interested in learning as you are. Occasionally, however, you may encounter a person who creates difficulties. This hand... Date Added: 2009-06-06 17:48:14 |
| Chapter 7.ppt Path: Montana >> MB >> 105 Fall, 2009 Description: Chapter 7 Animal Biotechnology Benefits of Genetically Engineered Animals Used to develop new medical treatments Improve our food supply Enhance our understanding of biology of all animals, including humans Animal Models Animal systems are a mo... Date Added: 2009-06-06 17:49:25 |
| ECW3121 3 2006.ppt Path: Allan Hancock College >> ECW >> 3121 Fall, 2009 Description: ECW3121 International Trade and Finance Lecture 3 ECW2121 L3 - 1 Heckscher-Ohlin Comparative Advantage Stolper-Samuelson Factor Price Equalisation Rybzcynski Absolute Advantage Trade Theory Study Guide 1 Mercantilism Balance Of Payments Foreign... Date Added: 2009-06-06 17:49:36 |
| ECW3121 9 2006.ppt Path: Allan Hancock College >> ECW >> 3121 Fall, 2009 Description: ECW3121 International Trade and Finance Lecture 9 L9 - 1 International Finance L9 - 2 International Finance Foreign Exchange Markets Balance Of Payments Interest Arbitrage Finance Study Guide 3 Exchange rate theorems L9 - 3 International Fin... Date Added: 2009-06-06 17:49:38 |
| 2731L2 class.ppt Path: Allan Hancock College >> ECW >> 2731 Fall, 2009 Description: ECW2731 Week 2 Topic2 Basiceconomicsprinciples: demandandsupply ECW2731 Week 2 Structure Weeks 7-8 Competition, market structures and business decisions Week 9 Pricing strategies and practices Week 10 Business and Government. Weeks 5 - 6 Product... Date Added: 2009-06-06 17:49:43 |
| YPR159C-A.t2k.w0.5-logo.pdf Path: UCSC >> YPR >> 159 Fall, 2009 Description: YPR159C-A.t2k w0.5 1 F PL LVIY VVLLL VGVPLL LDF XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX MA TLD FTTKPLAL VIYMSVVLLLMVGV P L L FS S M L V I Y E I I V V K T T T A L L I I V V I A M F L L L V M L V V L L L I I I I I V V V I I I S L I Y I I I V V V L ... Date Added: 2009-06-06 17:51:52 |
| YPR158C-D.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YPR >> 158 Fall, 2009 Description: 3 2 1 AAA A B B BB X B BEDB D E D C D D A A A B A B BA A C C C C D F C A B C C C E A C C CCEXCX C D E B A D CXCXDCCEGCCXXXDFXCXCDCDCCEFBAXBXCBBXDDXDDCXBBABXB E E C D F D D D CBCAXXXXXXX CXCCADXDBXGDDECC D D D D A D C D D D D X X X X X X XXDX 301 ... Date Added: 2009-06-06 17:51:54 |
| DickinWk6Attendance.pdf Path: Idaho >> MATH >> 143 Fall, 2008 Description: 7t ro HtndnncL ryrb@rng (uar,lqa) O sY\'cd^ w qrat>r\\ != lx- alrz usnq ffLnvfilrnahh9 \\-, l \' V= lt-il\'% {t;!ntl WZ z hY\\8\\Kr\" nOK lxl @ 4(x\\= [ ) _X L if -creXL-L X=-2 Xr-l f b,Au (t,P-) b= tnluufrfu: (0,01 L= \\ieolu (2, { d t L-._t_._I ... Date Added: 2009-06-06 17:52:27 |
| 9262a94fJMR.pdf Path: Cal Poly >> IND >> 2801 Fall, 2009 Description: ... Date Added: 2009-06-06 17:52:54 |
| EE 434 Lect 8 Fall 2006.pdf Path: Iowa State >> EE >> 434 Fall, 2009 Description: EE 434 Lecture 8 Process Technology Diffusion Oxidation Epitaxy Polysilicon Diffusion Controlled Migration of Impurities Time and Temperature Dependent Both vertical and lateral diffusion occurs Crystal orientation affects diffusion rates in lat... Date Added: 2009-06-06 17:56:17 |
| EE 434 Lect 33 Fall 2006.pdf Path: Iowa State >> EE >> 434 Fall, 2009 Description: EE 434 Lecture 33 Logic Design Review from last time: Ask the inverter how it will interpret logic levels VIN VOUT VH=? VL=? VLARGE VH VL VH Review from last time: The two-inverter loop Y X X Y S2 often eliminated (shorted) S1 S1 Y X Y ... Date Added: 2009-06-06 17:56:20 |
| litman-regex.ppt Path: Berkeley >> IS >> 290 Spring, 2001 Description: Python for NLP Regular Expressions CS1573: AI Application Development, Spring 2003 (modified from Steven Bird\'s notes) Regular Expressions Regular expressions are a powerful string manipulation tool. Use regular expressions to: Search a string (... Date Added: 2009-06-06 17:57:19 |
| EE232-16.pdf Path: Berkeley >> EE >> 232 Fall, 2009 Description: EE 232 Lightwave Devices Lecture 16: Polarization Dependence p Reading: Chuang, Sec. 4.1-4.2, 9.5 (There is also a good discussion in Coldren, Appendix 8 and 10) Instructor: Ming C. Wu University of California Berkeley California, Electrical Engineer... Date Added: 2009-06-06 17:58:07 |
| Software Architecture.ppt Path: Syracuse >> CSE >> 681 Fall, 2008 Description: SoftwareArchitecture JimFawcett CSE691/791SoftwareModelingandAnalysis Fall2001 Definitions Anarchitectureisthesetofsignificantdecisionsaboutthe organizationofasoftwaresystem,theselectionofthestructural elementsandtheirinterfacestogetherwiththeirbe... Date Added: 2009-06-06 17:58:16 |
| Statement-Non-filing-Student.pdf Path: Mich Tech >> PDFS >> 0809 Fall, 2009 Description: Student (and Spouse) Statement of Non-filing of 2007 Federal Tax Return and 2007 Calendar Year Income (SNFS07) I (we) have not filed and are not required to file a 2007 Federal Tax Return (Form 1040, 1040A, 1040EZ). I (we) certify that the income inf... Date Added: 2009-06-06 17:58:38 |
| ISM 101_Cianca_SemAbstract_050307.pdf Path: UCSC >> ISM >> 101 Winter, 2008 Description: ISM 101, Spring 2007 05/03/07 Aligning IT to the Institution\'s Business Needs Mark Cianca Director Portfolio Management Group Information Technology Services, UC Santa Cruz mcianca@ucsc.edu Abstract: Managing IT projects to success is often a difficu... Date Added: 2009-06-06 17:59:15 |
| NotesCH11 09.pdf Path: Arizona >> RNR >> 613 Fall, 2008 Description: 108 ENTO/ RNR 613 Multiple regression - Model Checking and Refinement Least squares regression analysis is not resistant to outliers. A few observations that lie away from the multivariate average (of the Xs and Ys) can strongly influence the outcome... Date Added: 2009-06-06 17:59:23 |
| PRR_IOC_S08b_T11_V1.0.doc Path: USC >> CSCI >> 577 Fall, 2009 Description: Peer Review Report Version 1.0 Peer Review Report (PRR) BID Review System Team #11 Yuwei Jiang Divyanka Aswani Priyanka Seernam Mithila Rao Velishala Kalyani Soniminde Julie Payne Keith Culling Project Manager System Architect Quality Focal Point... Date Added: 2009-06-06 18:01:18 |
| ta02_001.xls Path: Ill. Chicago >> IDS >> 570 Fall, 2008 Description: SOURCE: Moore McCabe, IPS3, Table 2.1, p. 112 Corn yield (bu/acre), planting density, and year Data: corn yield in bu/acre Plants per acre 12000 16000 20000 24000 28000 Mean 1956 150.1 166.9 165.3 * * 160.8 1958 113.0 120.7 130.1 134.7 * 124.6 1... Date Added: 2009-06-06 18:01:48 |
| daily.xls Path: Ill. Chicago >> IDS >> 594 Fall, 2008 Description: University of Illinois at Chicago / College of Business Administration / Department of Information & Decision Sciences IDS 596 Professor Video series Independent Study in IDS - Statistics for Management Stan Sclove slsclove@uic.edu www.uic.edu/~sls... Date Added: 2009-06-06 18:01:56 |
| daily.xls Path: Ill. Chicago >> IDS >> 570 Fall, 2008 Description: University of Illinois at Chicago / College of Business Administration / Department of Information & Decision Sciences IDS 596 Professor Video series Independent Study in IDS - Statistics for Management Stan Sclove slsclove@uic.edu www.uic.edu/~sls... Date Added: 2009-06-06 18:01:56 |
| 563.12.3 MPEG-4_IPMP_Basics _NoAudio.ppt Path: University of Illinois, Urbana Champaign >> CS >> 598 Fall, 2008 Description: 563.12.3 Digital Rights Management Presented by: Kasem Kharbat DRM Group: Archana Dutta, Haoweng Huang, Dmitry Mogilevsky, Kasem Kharbat University of Illinois Spring 2006 Overview What is MPEG-4 ? What goals does MPEG-4 achieve ? What is... Date Added: 2009-06-06 18:02:26 |
| conceptmap.pdf Path: Minnesota >> SEED >> 4101 Fall, 2009 Description: FIRST DAYS OF SCHOOL CONCEPT MAP CHECKLIST Create a concept map that brings together in a graphic organizer the information you gleaned from observing the beginning of the school year. This assignment is intended to help you determine and use in your... Date Added: 2009-06-06 18:02:30 |
| 200742_r02x_010988.pdf Path: Stanford >> ORCL >> 1017 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 LATHAM & WATKINS LLP Peter A. Wald (SBN 85705) Michele F. Kyrouz (SBN 168004) Matthew D. Harrison (SBN 210981) 505 Montgomery Street, Suite 2000 San Francisco, CA 94111-2562 Telephone: (415) 391-0600 Facs... Date Added: 2009-06-06 18:03:51 |
| ShupeFlyer2copy.pdf Path: LSU >> NR >> 57029 Fall, 2009 Description: ... Date Added: 2009-06-06 18:04:32 |
| Intro_353.ppt Path: University of Hawaii - Hilo >> ITM >> 353 Fall, 2009 Description: Introduction to ITM353 Prof. Port Key Ideas Many failed systems were abandoned because analysts tried to build wonderful systems without understanding the organization and stakeholders. The primarily goal of IS is to create value for the org... Date Added: 2009-06-06 18:05:33 |
| Joshua Howell - Thesis Proposal - Fall 2008.pdf Path: Boston Architectural >> TS >> 7505 Fall, 2009 Description: Page | 1 The Right to Assemble Thesis Student: Thesis Director: Thesis Advisor: Thesis Representative: Joshua F. Howell Ian F. Taberner Jason Boyer, AIA The Boston Architectural College Thesis Proposal December 04, 20 Thesis Proposal 3 4 5 ... Date Added: 2009-06-06 18:05:38 |
| A734_reipurth.ppt Path: University of Hawaii - Hilo >> A >> 740 Fall, 2009 Description: The Formation of Single and Multiple Stars Bo Reipurth Institute for Astronomy Astrobiology Seminar University of Hawaii Manoa 20 September 2004 Overview The Formation of Binary and Multiple Stars High Velocity Jets Disk Accretion Events Clus... Date Added: 2009-06-06 18:06:15 |
| line3_shot15_andy.txt Path: Washington University in St. Louis >> EPSC >> 454 Fall, 2009 Description: Andy 3 15 1 0 2 12.1 3 23.3 4 0 5 30.3 6 32.8 7 33.5 8 36.5 9 38.3 10 37.8 11 38.1 12 38.7 13 39.7 14 41.5 15 42.6 16 44.9 17 45.3 18 47.4 19 ... Date Added: 2009-06-06 18:06:50 |
| UG_week12_2009b.pdf Path: Washington University in St. Louis >> EPSC >> 210 Fall, 2009 Description: Today Sex and speciation Sexual selection Evolution of primates and the human lineage Pattern of eukaryotic evolution is called \"punctuated equilibrium\" (Stephen J. Gould) Time Equilibrium = species shuffling its deck, narrow range of variation... Date Added: 2009-06-06 18:07:06 |
| StromatolitesThruTime.pdf Path: Washington University in St. Louis >> EPSC >> 480 Fall, 2009 Description: ... Date Added: 2009-06-06 18:07:25 |
| test1-sol.pdf Path: CSU Fresno >> MATH >> 145 Fall, 2009 Description: y z y z z z y e x w A Q~ h{ XySFyh{ %y ) y VhXe&e z hS x1 g )e %|e hhe G | pe @ y Q Fy%y z Vqx y C% f pe Vqx #x2{ e qx pe1 y C (%z y # y { y Q| z y y g { z 1 yhX{Xyhtz fx2 y Fyh)fx# e ... Date Added: 2009-06-06 18:09:04 |
| Diagram-3.pdf Path: Boston Architectural >> AR >> 501 Spring, 2009 Description: ... Date Added: 2009-06-06 18:09:19 |
| sequence-demo.ps Path: Los Angeles Southwest College >> MATH >> 142 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: Maple V Session %Creator: Maple V irisVxm %DocumentFonts: Helvetica-Bold Times-Roman %Pages: (atend) %EndComments /fsf % stk: size font { findfont exch scalefont setfont } def /sepline % stk: x y { gsave newpath moveto 1 setlin... Date Added: 2009-06-06 18:10:01 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 05101689 Fall, 2009 Description: ... Date Added: 2009-06-06 18:10:33 |
| 00000006.pdf Path: Carnegie Mellon >> DISK >> 05101221 Fall, 2009 Description: ... Date Added: 2009-06-06 18:12:09 |
| 00000019.pdf Path: Carnegie Mellon >> TERA >> 05101219 Fall, 2009 Description: ... Date Added: 2009-06-06 18:12:31 |
| 00000019.pdf Path: Carnegie Mellon >> DISK >> 05101219 Fall, 2009 Description: ... Date Added: 2009-06-06 18:12:32 |
| 00000052.pdf Path: Carnegie Mellon >> TERA >> 05101219 Fall, 2009 Description: ... Date Added: 2009-06-06 18:12:41 |
| 00000052.pdf Path: Carnegie Mellon >> DISK >> 05101219 Fall, 2009 Description: ... Date Added: 2009-06-06 18:12:41 |
| 00000055.pdf Path: Carnegie Mellon >> TERA >> 05101362 Fall, 2009 Description: ... Date Added: 2009-06-06 18:13:06 |
| 00000055.pdf Path: Carnegie Mellon >> DISK >> 05101362 Fall, 2009 Description: ... Date Added: 2009-06-06 18:13:06 |
| Chap11.ppt Path: Wisc Whitewater >> MGMT >> 471 Fall, 2009 Description: Spreadsheet Modeling & Decision Analysis A Practical Introduction to Management Science 4th edition Cliff T. Ragsdale Chapter 11 Time Series Analysis 11-2 Introduction to Time Series Analysis A timeseries is a set of observations on a quanti... Date Added: 2009-06-06 18:13:35 |
| 00000012.pdf Path: Carnegie Mellon >> TERA >> 05102135 Fall, 2009 Description: ... Date Added: 2009-06-06 18:15:29 |
| 00000012.pdf Path: Carnegie Mellon >> DISK >> 05102135 Fall, 2009 Description: ... Date Added: 2009-06-06 18:15:29 |
| 00000089.pdf Path: Carnegie Mellon >> TERA >> 05101685 Fall, 2009 Description: ... Date Added: 2009-06-06 18:16:16 |
| 00000089.pdf Path: Carnegie Mellon >> DISK >> 05101685 Fall, 2009 Description: ... Date Added: 2009-06-06 18:16:17 |
| 00000029.pdf Path: Carnegie Mellon >> DISK >> 05101684 Fall, 2009 Description: ... Date Added: 2009-06-06 18:16:54 |
| 00000029.pdf Path: Carnegie Mellon >> TERA >> 05101684 Fall, 2009 Description: ... Date Added: 2009-06-06 18:16:54 |
| 00000016.pdf Path: Carnegie Mellon >> TERA >> 05101291 Fall, 2009 Description: ... Date Added: 2009-06-06 18:17:50 |
| 00000016.pdf Path: Carnegie Mellon >> DISK >> 05101291 Fall, 2009 Description: ... Date Added: 2009-06-06 18:17:50 |
| 00000007.pdf Path: Carnegie Mellon >> DISK >> 05102140 Fall, 2009 Description: ... Date Added: 2009-06-06 18:17:53 |
| 00000017.pdf Path: Carnegie Mellon >> DISK >> 05101197 Fall, 2009 Description: ... Date Added: 2009-06-06 18:18:22 |
| 00000103.pdf Path: Carnegie Mellon >> DISK >> 05101197 Fall, 2009 Description: ... Date Added: 2009-06-06 18:18:38 |
| 00000166.pdf Path: Carnegie Mellon >> DISK >> 05101197 Fall, 2009 Description: ... Date Added: 2009-06-06 18:18:51 |
| 00000353.pdf Path: Carnegie Mellon >> DISK >> 05101197 Fall, 2009 Description: ... Date Added: 2009-06-06 18:19:26 |
| 00000049.pdf Path: Carnegie Mellon >> TERA >> 05102142 Fall, 2009 Description: ... Date Added: 2009-06-06 18:20:11 |
| 00000049.pdf Path: Carnegie Mellon >> DISK >> 05102142 Fall, 2009 Description: ... Date Added: 2009-06-06 18:20:11 |
| 00000074.pdf Path: Carnegie Mellon >> TERA >> 05102142 Fall, 2009 Description: ... Date Added: 2009-06-06 18:20:18 |
| 00000074.pdf Path: Carnegie Mellon >> DISK >> 05102142 Fall, 2009 Description: ... Date Added: 2009-06-06 18:20:18 |
| slac-pub-0772.pdf Path: Stanford >> PUBS >> 0750 Fall, 2009 Description: I SLAC-PUB-772 WW August 1970 COMPTON SCATTERING FROM HYDROGEN BETWEEN 5 AND 17 GEV* R. L. Anderson, D, Gustavson, J. Johnson, I. Overman, D. Ritson and B. H. Wiik Stanford Linear Accelerator Center Stanford University, Stanford, California 94305 R.... Date Added: 2009-06-06 18:21:50 |
| slac-pub-0820.pdf Path: Stanford >> PUBS >> 0750 Fall, 2009 Description: SLAC-PUB-82 0 October 1970 (TH) and (EXP) / A POSSIBLE EXPLANATION OF THE INELASTIC FOR THE RAPID APPROACH TO \"UNIVERSALITY\" ELECTRON SCATTERING STRUCTURE FUNCTIONS* Ashok suri Stanford Linear Accelerator Center Stanford University, Stanford, Califor... Date Added: 2009-06-06 18:21:58 |
| intro2.pdf Path: Middlebury >> F >> 0218 Fall, 2009 Description: ... Date Added: 2009-06-06 18:23:01 |
| Reviewtopics-Summary.pdf Path: Midwestern State University >> ECONS >> 101 Fall, 2009 Description: REVIEW TOPICS FOR MIDTERM #1 ECONS 101 FELIX MUNOZ 1. Opportunity cost and Production possibility frontier (PPF). What is the relationship between the slope of the PPF and the opportunity cost of producing an additional unit of a good? 2. How can w... Date Added: 2009-06-06 18:24:55 |
| Lec19molecularstructurelec92009forwebpage.ppt Path: Cal Poly Pomona >> FJG >> 04747 Fall, 2009 Description: Fred J. Grieman Benzene Molecular Orbital Theory Delocalized MO\'s Molecular Motion, Energy hybridization? sp2 Bond Angle = ? 120o Delocali... Date Added: 2009-06-06 18:25:11 |
| stackloss-pair.ps Path: Duke >> STA >> 244 Spring, 2008 Description: %!PS-Adobe-3.0 %DocumentNeededResources: font Helvetica %+ font Helvetica-Bold %+ font Helvetica-Oblique %+ font Helvetica-BoldOblique %+ font Symbol %DocumentMedia: letter 612 792 0 () () %Title: R Graphics Output %Creator: R Software %Pages: (atend... Date Added: 2009-06-06 18:26:42 |
| Chapters_4_and_5.pdf Path: FIU >> ETD >> 0302107 Fall, 2009 Description: CHAPTER IV METHODOLOGY 4.1 Field Methods and Data Collection Techniques A review of the literature on the geology of the area was carried out in order to determine both the principal structural characteristics and the position of the stratigraphic... Date Added: 2009-06-06 18:28:13 |
| 120sec6_1and6_2wsSP09.pdf Path: Illinois State >> MAT >> 120 Fall, 2008 Description: Math 120 SP09 Sections 6.1 Cardinality Consider three sets A, B, and C given by A = {1, 2, 3}, B = {1, 2, 3, 4, 5}, and C = {3, 2, 1}. 1. Fill in the blanks with one of the following symbols: = (Some may hav... Date Added: 2009-06-06 18:31:01 |
| fs.ps Path: Cornell >> CS >> 212 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips 5.66 (MiKTeX 1.07) Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: X:\\Courses\\212\\f98\\exams\\fs.dvi %CreationDate: Wed Dec 16 03:34:26 1998 %Pages: 12 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndCom... Date Added: 2009-06-06 18:31:47 |
| System Models.ppt Path: NJIT >> CIS >> 633 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>InternalError</Code><Message>We encountered an internal error. Please try again.</Message><RequestId>DFF6D0AF6B0C3496</RequestId><HostId>0eqbTKIhEovByxCXN+Dl F2HysAvhRGUs90HeyqzW+vqMBN7QaOmPvCcnJMte... Date Added: 2009-06-06 18:38:17 |
| 04110507.pdf Path: Wisconsin >> SH >> 041105 Fall, 2009 Description: ... Date Added: 2009-06-06 18:39:01 |
| output.txt Path: Washington >> V >> 14000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-C2WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3140 12/05/2007 10:12 AM <DIR> . 12/05/2007 10:12 ... Date Added: 2009-06-06 18:39:07 |
| output.txt Path: Washington >> V >> 14000 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-9Y4QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2276 12/05/2007 08:57 AM <DIR> . 12/05/2007 08:57 ... Date Added: 2009-06-06 18:39:25 |
| error.txt Path: Washington >> V >> 14000 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Dec 05 09:55:13 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Dec 05 11:06:58 2007 ( 4305 s elapsed) ... Date Added: 2009-06-06 18:39:33 |
| 4thEdCh7.pdf Path: SMU - Cox School of Business >> PHYSICS >> 3344 Fall, 2009 Description: ... Date Added: 2009-06-06 18:39:43 |
| log.txt Path: Washington >> V >> 14000 Fall, 2009 Description: 000 (29085.000.000) 12/05 07:29:32 Job submitted from host: <128.95.94.28:4757> . 001 (29085.000.000) 12/05 12:16:26 Job executing on host: <172.25.101.166:1093> . 006 (29085.000.000) 12/05 12:36:34 Image size of job updated: 467260 . 006 (29085.000.... Date Added: 2009-06-06 18:40:09 |
| jnrl201_newcrs.pdf Path: E. Michigan >> PROPOSALS >> 0708 Fall, 2009 Description: Request for New Course EASTERN MICHIGAN UNIVERSITY DIVISION OF ACADEMIC AFFAIRS REQUEST FOR NEW COURSE DEPARTMENT: ENGLISH LANGUAGE AND LITERATURE DEPARTMENT CONTACT: LOLITA CUMMINGS CARSON COLLEGE: ARTS AND SCIENCES CONTACT PHONE: 7-0147 CONTACT E... Date Added: 2009-06-06 18:41:17 |
| WGST202_newcrs.pdf Path: E. Michigan >> PROPOSALS >> 0607 Fall, 2009 Description: Request for New Course EASTERN MICHIGAN UNIVERSITY DIVISION OF ACADEMIC AFFAIRS REQUEST FOR NEW COURSE DEPARTMENT: WGST: WOMEN\'S AND GENDER STUDIES DEPARTMENT CONTACT: DR. CAROL HADDAD COLLEGE: CAS CONTACT PHONE: 487-3173 CONTACT EMAIL: CHADDAD@EMI... Date Added: 2009-06-06 18:41:39 |
| biol588_newcrs.pdf Path: E. Michigan >> PROPOSALS >> 0809 Fall, 2009 Description: Request for New Course EASTERN MICHIGAN UNIVERSITY DIVISION OF ACADEMIC AFFAIRS REQUEST FOR NEW COURSE DEPARTMENT: BIOLOGY DEPARTMENT CONTACT: CARA SHILLINGTON COLLEGE: ARTS AND SCIENCES CONTACT PHONE: 7-4433 CONTACT EMAIL: CSHILLING@EMICH.EDU A. ... Date Added: 2009-06-06 18:41:46 |
| syllabus.pdf Path: Cal Poly Pomona >> STA >> 120 Fall, 2009 Description: STA 120 Statistics with Applications Spring 2009 1 Technical Information Statistics 120, Statistics with Applications, meets three times a week. We will meet every Monday, Wednesday, and Friday from 9:15 AM to 10:20 AM in room 3-1616. Professor: P... Date Added: 2009-06-06 18:43:14 |
| MERVYN’S.ppt Path: Oregon State >> BA >> 495 Fall, 2008 Description: MERVYN\'S Scott and Miguel History Founded in 1949 by Mervyn Morris Headquartered in Hayward, CA (Bay Area) Emphasis on family Strategy Mid-tier neighborhood department store \"Trend-right\" fashions Home Decor National and private label Fi... Date Added: 2009-06-06 18:44:54 |
| hw7.pdf Path: Arizona >> CE >> 467 Fall, 2009 Description: CE 467 / 567 Highway Safety and Operations Homework 7 Due by the end of the day, Wednesday, December 6, 2006 Two passenger cars were involved in what appears to have been an angle crash at an intersection. Passenger car A was making a left turn, east... Date Added: 2009-06-06 18:46:42 |
| Exam1.pdf Path: Colorado >> AMATH >> 1350 Fall, 2006 Description: APPM 1350 EXAM #1 Fall 2004 ON THE FRONT OF YOUR BLUEBOOK write: (1) your name, (2) your student ID number, (3) lecture section (4) your instructor\'s name, and (5) a grading table. You must work all of the problems on the exam. Show ALL of your wo... Date Added: 2009-06-06 18:49:17 |
| SampleExamFromM214.pdf Path: Wisconsin Milwaukee >> CLASS >> 307 Fall, 2009 Description: Math 214, Hour Exam 2, Fall, 2000 page 1 Name 1. Precisely sate the following denitions and theorems. a) The Well Ordering Axiom: page 2 page 3 b) the greatest common divisor of two positive integers a and b: c) The division algorithm for positive ... Date Added: 2009-06-06 18:49:45 |
| ASample214Exam.pdf Path: Wisconsin Milwaukee >> CLASS >> 307 Fall, 2009 Description: Math 214, Hour Exam 2, Fall, 2000 page 1 Name 1. Precisely sate the following denitions and theorems. a) The Well Ordering Axiom: page 2 page 3 b) the greatest common divisor of two positive integers a and b: c) The division algorithm for positive ... Date Added: 2009-06-06 18:49:51 |
| CalcApp1.pdf Path: Midwestern State University >> ECONS >> 432 Fall, 2009 Description: ... Date Added: 2009-06-06 18:51:00 |
| Submission Memo sample.doc Path: Western Washington >> STEVENS >> 101 Fall, 2009 Description: Sample English 101 Submission Memo Name: Instructor: Paper: Date: How does this paper meet the goals of the assignment (as you understand them)? Here you convey your understanding of the task you\'ve been given and explain how this paper attempts to m... Date Added: 2009-06-06 18:51:13 |
| Hill, Why We are Here.doc Path: Western Washington >> STEVENS >> 401 Fall, 2009 Description: Hill 1 Heather Hill Eng. 401 6/8/06 Why We Are Here \"It is a truth universally acknowledged, that a single man in possession of a good fortune, must be in want of a wife\" (Austen 1). That sentence is the first line of my favorite book, Jane Austen... Date Added: 2009-06-06 18:51:54 |
| 09 30 16 Quarry Tile.doc Path: Penn State >> BNM >> 5016 Fall, 2009 Description: SECTION 09 30 16 QUARRY TILE PART 1 GENERAL 1.01 RELATED WORK SPECIFIED ELSEWHERE A. 1.02 Ceramic Tile: Section 09 31 00. REFERENCES A. B. Tile Manufacturing Standard: Comply with the requirements of ANSI A 137.1 - 1980. Installation Standards: Comp... Date Added: 2009-06-06 18:54:02 |
| Lect05.pdf Path: Wisconsin >> PHYS >> 104 Fall, 2008 Description: Resistors in Series One wire: Effectively adding the lengths Since R L add resistance R = R 2R 9/23/05 U. Wisconsin, Physics 104, Fall 2002 1 Resistors in Series One wire: If charge goes through one resistor, it must go through other. I... Date Added: 2009-06-06 18:54:07 |
| 2320Lecture15.ppt Path: Laurentian >> PSYC >> 2320 Fall, 2009 Description: Today: Finish Gregory Discussion, finish stereograms Tuesday: Start colour vision Thursday: Finish colour vision - Read LAND for Thursday Muller - Lyer Illusion Muller-Lyer Illusion What theory does Gregory take up? Muller-Lyer Illusion What the... Date Added: 2009-06-06 18:56:38 |
| sy26_apr23_09.pdf Path: Wisconsin >> PHYSICS >> 207 Fall, 2008 Description: Physics 207 Lecture 26 Lecture 26 Goals: Chapter 18 Understand the molecular basis for pressure and the idealgas law. Predict the molar specific heats of gases and solids. Understand how heat is transferred via molecular collisions and how thermal... Date Added: 2009-06-06 18:56:51 |
| veto_0.15mip_veto_side_3_B.ps Path: Stanford >> EXP >> 060809 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: vetoOut/veto_0.15mip_veto_side_3_B.ps: vetoOut/veto_0.15mip_veto_side_3_B %Creator: ROOT Version 5.10/00 %CreationDate: Tue Sep 12 11:44:10 2006 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def ... Date Added: 2009-06-06 18:57:33 |
| veto_0.30mip_veto_side_1_A.ps Path: Stanford >> EXP >> 060701 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: vetoOut/veto_0.30mip_veto_side_1_A.ps: vetoOut/veto_0.30mip_veto_side_1_A %Creator: ROOT Version 5.10/00 %CreationDate: Mon Sep 11 17:14:10 2006 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def ... Date Added: 2009-06-06 18:58:21 |
| veto_1.00mip_veto_side_3_A.ps Path: Stanford >> EXP >> 060817 Fall, 2009 Description: %!PS-Adobe-2.0 %Title: vetoOut/veto_1.00mip_veto_side_3_A.ps: vetoOut/veto_1.00mip_veto_side_3_A %Creator: ROOT Version 5.10/00 %CreationDate: Mon Sep 11 16:28:03 2006 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def ... Date Added: 2009-06-06 18:59:20 |
| AcdMip_gain.txt Path: Stanford >> EXP >> 135005432 Fall, 2009 Description: #SYSTEM = acdCalib #instrument= LAT #timestamp = Wed Jan 18 17:07:39 2006 #calibType = ACD_ElecGain #fmtVersion = v1r0p0 #startTime = 135005432:1 #stopTime = 135005432:445117 #triggers = 403648/445117 #source = 0 #mode = 0 #START TILE PMT PEAK WIDTH ... Date Added: 2009-06-06 18:59:28 |
| AcdMip_gain.txt Path: Stanford >> EXP >> 135005486 Fall, 2009 Description: #SYSTEM = acdCalib #instrument= LAT #timestamp = Wed Jan 18 17:19:16 2006 #calibType = ACD_ElecGain #fmtVersion = v1r0p0 #startTime = 135005486:1 #stopTime = 135005486:438804 #triggers = 397682/438804 #source = 0 #mode = 0 #START TILE PMT PEAK WIDTH ... Date Added: 2009-06-06 18:59:44 |
| 111808Section21.pdf Path: E. Michigan >> MEETING >> 111808 Fall, 2009 Description: BOARD OF REGENTS EASTERN MICHIGAN UNIVERSITY RECOMMENDATION BUDGET ADJUSTMENT SECTION: 21 DATE: Nov. 18, 2008 ACTION REQUESTED It is recommended that the Board of Regents grant authority to President Susan W. Martin to take such action necessary to... Date Added: 2009-06-06 19:00:01 |
| 00000016.pdf Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009 Description: ... Date Added: 2009-06-06 19:03:50 |
| 00000152.pdf Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009 Description: ... Date Added: 2009-06-06 19:04:16 |
| 00000179.pdf Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009 Description: ... Date Added: 2009-06-06 19:04:22 |
| 00000405.pdf Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009 Description: ... Date Added: 2009-06-06 19:05:05 |
| 00000470.pdf Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009 Description: ... Date Added: 2009-06-06 19:05:18 |
| 00000034.pdf Path: Carnegie Mellon >> TERA >> 31003878 Fall, 2009 Description: ... Date Added: 2009-06-06 19:06:02 |
| 00000034.pdf Path: Carnegie Mellon >> DISK >> 31003878 Fall, 2009 Description: ... Date Added: 2009-06-06 19:06:03 |
| 00000050.pdf Path: Carnegie Mellon >> DISK >> 31003471 Fall, 2009 Description: ... Date Added: 2009-06-06 19:06:40 |
| 00000080.pdf Path: Carnegie Mellon >> DISK >> 31003471 Fall, 2009 Description: ... Date Added: 2009-06-06 19:06:46 |
| 00000096.pdf Path: Carnegie Mellon >> DISK >> 31004639 Fall, 2009 Description: ... Date Added: 2009-06-06 19:08:27 |
| 00000352.pdf Path: Carnegie Mellon >> DISK >> 31004639 Fall, 2009 Description: ... Date Added: 2009-06-06 19:09:31 |
| 00000430.pdf Path: Carnegie Mellon >> DISK >> 31004639 Fall, 2009 Description: ... Date Added: 2009-06-06 19:09:56 |
| 00000030.pdf Path: Carnegie Mellon >> TERA >> 05103079 Fall, 2009 Description: ... Date Added: 2009-06-06 19:13:55 |
| 00000030.pdf Path: Carnegie Mellon >> DISK >> 05103079 Fall, 2009 Description: ... Date Added: 2009-06-06 19:13:56 |
| 00000068.pdf Path: Carnegie Mellon >> DISK >> 31003475 Fall, 2009 Description: ... Date Added: 2009-06-06 19:15:15 |
| 00000098.pdf Path: Carnegie Mellon >> DISK >> 31003475 Fall, 2009 Description: ... Date Added: 2009-06-06 19:15:22 |
| 00000057.pdf Path: Carnegie Mellon >> DISK >> 31004004 Fall, 2009 Description: ... Date Added: 2009-06-06 19:16:02 |
| 00000337.pdf Path: Carnegie Mellon >> DISK >> 31004302 Fall, 2009 Description: ... Date Added: 2009-06-06 19:19:42 |
| 2009-0223asol.pdf Path: UConn >> MATH >> 1132 Fall, 2009 Description: Mathematics 1132 Professor Alan H. Stein February 23, 2009 SOLUTIONS 1. Consider the function f (x) = x ln x. Analyze monotonicity and concavity, nd and identify all local extrema and points of inection. Sketch its graph. You may use the fact lim x... Date Added: 2009-06-06 19:20:25 |
| 00000125.pdf Path: Carnegie Mellon >> TERA >> 31004642 Fall, 2009 Description: ... Date Added: 2009-06-06 19:20:44 |
| 00000125.pdf Path: Carnegie Mellon >> DISK >> 31004642 Fall, 2009 Description: ... Date Added: 2009-06-06 19:20:44 |
| 00000429.pdf Path: Carnegie Mellon >> TERA >> 31004642 Fall, 2009 Description: ... Date Added: 2009-06-06 19:22:15 |
| 00000429.pdf Path: Carnegie Mellon >> DISK >> 31004642 Fall, 2009 Description: ... Date Added: 2009-06-06 19:22:16 |
| 00000274.pdf Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009 Description: ... Date Added: 2009-06-06 19:23:21 |
| 00000346.pdf Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009 Description: ... Date Added: 2009-06-06 19:23:34 |
| 00000400.pdf Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009 Description: ... Date Added: 2009-06-06 19:23:44 |
| 00000053.pdf Path: Carnegie Mellon >> TERA >> 31004229 Fall, 2009 Description: ... Date Added: 2009-06-06 19:24:19 |
| 00000053.pdf Path: Carnegie Mellon >> DISK >> 31004229 Fall, 2009 Description: ... Date Added: 2009-06-06 19:24:19 |
| 00000228.pdf Path: Carnegie Mellon >> DISK >> 31003468 Fall, 2009 Description: ... Date Added: 2009-06-06 19:25:55 |
| 00000281.pdf Path: Carnegie Mellon >> DISK >> 31003468 Fall, 2009 Description: ... Date Added: 2009-06-06 19:26:05 |
| 00000168.pdf Path: Carnegie Mellon >> TERA >> 31004613 Fall, 2009 Description: ... Date Added: 2009-06-06 19:27:05 |
| 00000168.pdf Path: Carnegie Mellon >> DISK >> 31004613 Fall, 2009 Description: ... Date Added: 2009-06-06 19:27:06 |
| 00000218.pdf Path: Carnegie Mellon >> TERA >> 31004613 Fall, 2009 Description: ... Date Added: 2009-06-06 19:27:20 |
| 00000218.pdf Path: Carnegie Mellon >> DISK >> 31004613 Fall, 2009 Description: ... Date Added: 2009-06-06 19:27:20 |
| 00000020.pdf Path: Carnegie Mellon >> DISK >> 31004072 Fall, 2009 Description: ... Date Added: 2009-06-06 19:27:51 |
| 00000059.pdf Path: Carnegie Mellon >> DISK >> 31004072 Fall, 2009 Description: ... Date Added: 2009-06-06 19:27:58 |
| 00000215.pdf Path: Carnegie Mellon >> DISK >> 31004072 Fall, 2009 Description: ... Date Added: 2009-06-06 19:28:30 |
| 00000353.pdf Path: Carnegie Mellon >> DISK >> 31004072 Fall, 2009 Description: ... Date Added: 2009-06-06 19:28:58 |
| 00000149.pdf Path: Carnegie Mellon >> DISK >> 31004572 Fall, 2009 Description: ... Date Added: 2009-06-06 19:29:32 |
| 00000310.pdf Path: Carnegie Mellon >> DISK >> 31004572 Fall, 2009 Description: ... Date Added: 2009-06-06 19:30:02 |
| 00000108.pdf Path: Carnegie Mellon >> DISK >> 31004073 Fall, 2009 Description: ... Date Added: 2009-06-06 19:30:24 |
| 00000097.pdf Path: Carnegie Mellon >> DISK >> 31004574 Fall, 2009 Description: ... Date Added: 2009-06-06 19:31:48 |
| 00000097.pdf Path: Carnegie Mellon >> TERA >> 31004574 Fall, 2009 Description: ... Date Added: 2009-06-06 19:31:48 |
| 00000062.pdf Path: Carnegie Mellon >> DISK >> 31004573 Fall, 2009 Description: ... Date Added: 2009-06-06 19:34:12 |
| 00000168.pdf Path: Carnegie Mellon >> DISK >> 31004573 Fall, 2009 Description: ... Date Added: 2009-06-06 19:34:32 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
![]() |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
![]() |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
![]() |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||


