Course Solutions And Notes - JF 2007 ARTICLE PUBLISHED 51
| NAS 204 Brozzo.pdf Path: N. Michigan >> IS >> 204 Fall, 2008 Description: NAS 204 The Native American Experience Winter 07 Tuesday Wednesday sbrozzo@nmu.edu NO calls after 10 pm 6-9:20 pm 6-9:20 pm Whitman 122 West Science 3602 Office: 3001 Hedgcock Multicultural Education & Resource Center Office phone: 227-1554 Instruct... Date Added: 2009-02-02 15:13:49 |
| MOS180.Chapter 11 Notes Path: UWO >> MOS >> 180 Winter, 2008 Description: Chapter 11 Notes Mentoring and Leadership Trait Theories of Leadership-theories that propose traits-personality, social, physical, or intellectual-differentiate leaders from non-leaders Preferred leadership traits: -universally liked attributes shoul... Date Added: 2008-04-23 16:19:48 |
| Module4Lecture8Notes Path: Berkeley >> UGBA >> 10 Spring, 2007 Description: UGBA 10 Module 4 Lecture 8 Notes 4/10 Accounting and Finance Review Questions A firm increases its inventory during a fiscal year. What results on the Statement of Cash Flows? A. Cash goes up due to operations B. Cash goes down due to operations C. ... Date Added: 2008-04-01 23:17:07 |
| 309-problem10.pdf Path: Missouri S&T >> PHYSICS >> 305 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:36 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 25 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> MATH >> 330 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> PHYSICS >> 326 Spring, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:36 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 345 Spring, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> MATH >> 383 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 35 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> MATH >> 401 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 5 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:36 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 101 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 75 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:36 |
| 309-problem10.pdf Path: Missouri S&T >> PHILOS >> 15 Fall, 2008 Description: Problems #10, Math 309, Dr. M. Bohner. Nov 18, 2002. Due Dec 2, 1:30 pm. 59. Let f : [a, b] = I R be 3 times dierentiable and suppose y (a, b) with f (y) = 0 and f (y) = 0. Assume there is > 0 such that f (x) = 0 and | (x)| 1 f whenever x I w... Date Added: 2009-01-11 18:52:35 |
| ECE 350 - Lecture 2 Complete.pdf Path: CSU Northridge >> TH >> 350 Fall, 2008 Description: ECE 350 - Lecture 2 Lecture Overview Even and Odd Functions Systems Classification of Systems System Models Operator Notation for Differential Equations Some MATLAB Plotting Help Finding the Zero-State Response for a System (Based on the Diffe... Date Added: 2009-02-02 13:51:16 |
| ps3.pdf Path: Berkeley >> ECON >> 240 Fall, 2008 Description: Problem Set #3 Economics 240B Spring 2006 Due March 8 PART I: Theoretical questions: Turn in (correct) answers to the following exercises from Ruuds text: Chapter 20: Exercises 20.3, 20.7, 20.12 Chapter 24: Exercises 24.1, 24.3, 24.6. Extra Question:... Date Added: 2009-02-18 14:30:52 |
| Introduction.ppt Path: UCF >> EEL >> 5937 Fall, 2008 Description: Multi Agent Systems -an introduction- EEL 5937 Content What is an agent? Communication Ontologies Mobility Mutability Applications EEL 5937 What is an agent? EEL 5937 Definition An autonomous agent is a system situated within and part of ... Date Added: 2009-01-10 18:10:06 |
| Problem Set 2 Solutions Path: UCLA >> ECON >> 103 Winter, 2009 Description: ... Date Added: 2009-03-20 01:05:52 |
| 001025TotalitarianChic.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Totalitarian Chic Reigns in Spotless Pyongyang October 25, 2000 Totalitarian Chic Reigns in Spotless Pyongyang By JANE PERLEZ Agence France-Presse Kindergartners and an accordion-playing teacher performed to welcome Secretary Albright to Pyongyang... Date Added: 2009-02-11 18:05:56 |
| drummond.pdf Path: Missouri (Mizzou) >> MPAC >> 99 Fall, 2008 Description: PREDICTIVE ABILITY OF NEURAL NETWORKS FOR SITE-SPECIFIC YIELD ESTIMATION* Scott T. Drummond, Computer Specialist Kenneth A. Sudduth, Agricultural Engineer USDA Agricultural Research Service Cropping Systems and Water Quality Research Unit Columbia, M... Date Added: 2009-02-17 22:44:03 |
| itm604syllabus.pdf Path: SUNY Albany >> ITM >> 604 Spring, 2009 Description: ITM 604: Data Communications, Networks, and Security University at Albany, State University of New York Spring 2008 - Syllabus Instructor Information Name: Sanjay Goel Email: goel@albany.edu Phone: 442-4925 Office Location: BA310b Office Hours: M 11:... Date Added: 2009-04-15 21:44:48 |
| Test Four Questions Path: LSU >> BIOL >> 1202 Spring, 2008 Description: Test Four Questions: Question: Blood is a type of connective tissue. True False Question: Which choice offers the best time to measure basal metabolic rate? A baby at rest prior to its first meal of the day A baby at rest that has just had its first... Date Added: 2008-04-11 07:32:44 |
| p240_ct21_f07 Path: Michigan >> PHYSICS >> 240 Fall, 2007 Description: Physics 240 Fall 2007 Lecture #21 Dr. Dave Winn 2405 Randall Lab winn@umich.edu RC circuits In an RC circuit, energy stored as charge on a capacitor is dissipated in the resistor 10F 10F 100 Q UE = 2C Q = Q0 e t - RC 2 In this circuit, the time... Date Added: 2008-04-04 14:35:00 |
| 3.2 Exponential Functions-ANSWER KEY Path: Alamo Colleges >> MATH >> 2412 Spring, 2008 Description: Name_ 3.2: Exponential Functions The exponential function with base b is defined by f(x) = bx where b > 0, b 1, and x is a real number. 1. Evaluate f(x) = 3 x at x = 4, x = -3, a... Date Added: 2008-04-13 19:52:43 |
| thesis.pdf Path: Virginia Tech >> LIB >> 01082003 Fall, 2008 Description: A Disassembly Optimization Problem by Ajay Bhootra Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of Master of Science in Industrial and Systems En... Date Added: 2009-02-18 01:12:14 |
| hw6sol.pdf Path: UCSD >> MATH >> 280c Spring, 2008 Description: Math 280C, Spring 2008 Homework 6 Solutions 1. From Problem 1 on Homework 5, we know that for each xed real , the process Ct := exp(2 t/2) cosh(Bt ) is a martingale, and clearly C0 = 1. Express Ct as a stochastic t integral 0 Hs dBs , with an explic... Date Added: 2009-01-11 21:32:19 |
| hw6sol.pdf Path: UCSD >> MATH >> 280 Fall, 2004 Description: Math 280C, Spring 2008 Homework 6 Solutions 1. From Problem 1 on Homework 5, we know that for each xed real , the process Ct := exp(2 t/2) cosh(Bt ) is a martingale, and clearly C0 = 1. Express Ct as a stochastic t integral 0 Hs dBs , with an explic... Date Added: 2009-02-18 00:33:26 |
| CIT2400.pdf Path: Pasco-Hernando Community College >> CIS >> 2350 Spring, 2008 Description: Date revised: November 2007 NASHVILLE STATE TECHNICAL COMMUNITY COLLEGE COURSE INFORMATION CIT 2400 Structural Design 3 Credits 3 Class Hours A continuation of CIT 2110. Emphasis is placed on the design and elements of wood structural elements, str... Date Added: 2009-01-12 04:02:41 |
| acty2100 ADJUSTING ENTRIES Path: Western Michigan >> ACTY >> 2100 Spring, 2006 Description: ADJUSTING ENTRIES Adjusting entries are needed to make sure that all revenue earned during a period and all expenses incurred during that period are recorded in that period regardless of when the cash is received or paid out. They are also made to m... Date Added: 2008-04-02 09:43:08 |
| PHE 118.doc Path: Palo Verde College >> ART >> 105 Fall, 2008 Description: REQUEST FOR APPROVAL OF A COURSE COURSE NAME: PHE 118 BEGINNING AEROBICS II PROGRAM: PHYSICAL EDUCATION TO BE COMPLETED BY DEAN OF THE COLLEGE: Static Identifier TOP Code # SAM Code: NEED: YES NO Meets a Unique Need X Course Duplicated X Demand/Enr... Date Added: 2009-01-11 17:26:43 |
| PHE 118.doc Path: Palo Verde College >> ART >> 125 Fall, 2008 Description: REQUEST FOR APPROVAL OF A COURSE COURSE NAME: PHE 118 BEGINNING AEROBICS II PROGRAM: PHYSICAL EDUCATION TO BE COMPLETED BY DEAN OF THE COLLEGE: Static Identifier TOP Code # SAM Code: NEED: YES NO Meets a Unique Need X Course Duplicated X Demand/Enr... Date Added: 2009-01-11 17:26:43 |
| Sampling.pdf Path: Purdue >> ABE >> 527 Fall, 2008 Description: Sampling Lecture Outline for ABE 527 1) Sampling a) Introduction i) Mechanistics ii) Heterogeneity iii) Standardizing iv) Water Quality Variables b) Sampling Frequency i) Time Series Analysis / Fourier Analysis ii) Random Sampling (Normality Assumpti... Date Added: 2009-01-09 06:31:15 |
| midterm2_s03.pdf Path: Berkeley >> EE >> 141 Fall, 2008 Description: University of California College of Engineering Department of Electrical Engineering and Computer Science Jan M. Rabaey TuTh9:30-11am EECS 141: SPRING 03MIDTERM 2 NAME Last First SID Problem 1 (12): Problem 2 (14): Problem 3 (10): Total (36) E... Date Added: 2009-04-16 01:31:52 |
| 3-Chapter3.pdf Path: Virginia Tech >> LIB >> 08122000 Fall, 2008 Description: 3. EXAMPLE OF A ROAD VEHICLE A major factor in the design of a road vehicle is the anticipated severity of the service usage. One source of severity in the usage is rough road. Vehicles moving on such roads are subjected to random loads. Under certa... Date Added: 2009-02-18 01:01:01 |
| EP 213 #7 Path: Kansas State >> PHYS >> 213 Spring, 2008 Description: Quiz 7 EPI Studio 11.30 Tues/Thur Name . Rotational systems a) For the apparatus below find the total rotational inertia about the axes of rotation. b) Using energy principles find the velocity ofm when it reaches the floor, ifit falls from dist... Date Added: 2008-04-07 09:01:07 |
| Cardiovascular Pre Lab Path: Seton Hall >> CHEM >> 1124 Fall, 2007 Description: Cardiovascular Pre-Lab Colin Van Es Biol 1201 AA Tuesday, November 13, 2007 Before reviewing the assigned website, \"The Human Heart: An Online Exploration From the Franklin Institute,\" I knew a few things about the human cardiovascular system. First,... Date Added: 2008-04-07 12:10:12 |
| Bond Chart. Path: N.C. State >> CH >> 101 Fall, 2006 Description: ... Date Added: 2008-03-20 09:04:30 |
| 36COVER and TOC.pdf Path: Ohio State >> KB >> 1811 Fall, 1925 Description: POLATA K+NIGOnaq polata k=nigopis;naq is an information bulletin devoted to ... Date Added: 2009-02-17 22:30:31 |
| 36COVER and TOC.pdf Path: Ohio State >> KB >> 24008 Fall, 2008 Description: POLATA K+NIGOnaq polata k=nigopis;naq is an information bulletin devoted to ... Date Added: 2009-02-17 22:30:31 |
| hw6.pdf Path: Caltech >> EE >> 160 Winter, 2008 Description: EE160 February 26, 2008 Handout #16 Due March 4, 2008 Homework Set #6 1. Problem 3.11(e) in Haykin. 2. Problem 3.23 in Haykin. 3. Suppose that m is a random variable uniformly distributed between A and A. Show that, for any L, the optimal L-level ... Date Added: 2009-01-10 17:52:09 |
| Managerial Accounting Path: NYU >> C10 >> 002 Fall, 2004 Description: Objective of managing Maximize value ( what are we worth today?) Value = NPV [E(future cash flow)] E= expectation, forecast, prediction Future cash flow= forward looking Worried mainly on cash flow- never know if it is going to be good or bad NPV= ne... Date Added: 2008-04-25 11:48:38 |
| New Course GER 352.pdf Path: Kentucky >> GER >> 352 Fall, 2008 Description: ... Date Added: 2009-02-03 13:54:16 |
| Team-Building & Communication Stylesworking ERII.ppt Path: Solano Community College >> BUS >> 208 Fall, 2008 Description: Team-Building & Communication Styles Employee Relations II SCC Business,Copyright Spring 2003, EMP. Get ready for a wild ride One person cant do it all in todays complex workplace. Thats why employers want and need people who can work on teams. SCC... Date Added: 2009-02-02 16:10:32 |
| final.pdf Path: Arizona >> C SC >> 545 Fall, 2008 Description: CSc 545 Final Fall 2008 Name Instructions For this nal exam, you will select three problems from the given list of seven problems. (If you do more than three problems, only three will be graded.) Each problem has equal weight. Please write your s... Date Added: 2009-01-11 19:57:59 |
| 051007failed.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Terraviva EUROPE Friday, 7 October 2005 NEPAL: ON THE ROAD TO FAILED STATE? by Marty Logan KATHMANDU (IPS) - When does a conflict become a crisis? In Nepal\'s case it could be very soon, says the United Nations. On Friday, the world body will appeal ... Date Added: 2009-02-11 18:57:40 |
| Jan24 Path: Lehigh >> CSE >> 398 Spring, 2005 Description: CSE398: Network Systems Design Instructor: Dr. Liang Cheng Department of Computer Science and Engineering P.C. Rossin College of Engineering & Applied Science Assistant Professor, Lehigh University January 24, 2005 Outline Recap Encoding, framing, e... Date Added: 2008-08-06 18:03:46 |
| Jan24 Path: Lehigh >> CSE >> 398 Spring, 2005 Description: CSE398: Network Systems Design Instructor: Dr. Liang Cheng Department of Computer Science and Engineering P.C. Rossin College of Engineering & Applied Science Assistant Professor, Lehigh University January 24, 2005 Outline Recap Encoding, framing, e... Date Added: 2008-08-06 18:03:46 |
| Jan24.pdf Path: Lehigh >> CSE >> 398 Fall, 2008 Description: CSE398: Network Systems Design Instructor: Dr. Liang Cheng Department of Computer Science and Engineering P.C. Rossin College of Engineering & Applied Science Assistant Professor, Lehigh University January 24, 2005 Outline Recap Encoding, framing, e... Date Added: 2009-02-17 23:12:50 |
| Works Cited Path: ICCC >> ENG >> Speech Spring, 2008 Description: Works Cited http:/www.netglimse.com/celebs/pages/wayne_newton/index.shtml Updated July 2005 ... Date Added: 2008-03-26 18:20:45 |
| F07MidtermAns.pdf Path: Kansas >> MATH >> 121 Fall, 2008 Description: Math 121 - Midterm Exam - 2007 Answers only, not solutions Part A - Multiple Choice Examination If f is decreasing and f is increasing on an interval (a, b) then -(E) f (x) is concave up and f is negative. d Suppose g is a dierentiable function with ... Date Added: 2009-02-17 22:41:41 |
| F07MidtermAns.pdf Path: W. Kentucky >> MATH >> 121 Fall, 2008 Description: Math 121 - Midterm Exam - 2007 Answers only, not solutions Part A - Multiple Choice Examination If f is decreasing and f is increasing on an interval (a, b) then -(E) f (x) is concave up and f is negative. d Suppose g is a dierentiable function with ... Date Added: 2009-02-17 22:41:41 |
| hw1-ans-430-s07.pdf Path: Maryland >> CMSC >> 430 Spring, 2001 Description: Here are the answers for the practice problems. I strongly suggest that you DO the problems before you look at the solutions. If you just follow along the solutions without actually doing the problem yourself, you will have problems with the midterm.... Date Added: 2009-02-18 00:27:33 |
| test3_sum06.pdf Path: Mississippi State >> ECE >> 3724 Fall, 2009 Description: MSU Net ID:_ ECE 3724 Test #3 Sumer 2006 You may use only the provided reference materials. All figures are on the last pages; questions are on pages 1-8 (four sheets, double sided). Part I: (80 pts) a. (5 pts) Write C code that configures PORTB fo... Date Added: 2009-04-15 21:22:37 |
| EE595handout.pdf Path: Washington >> POL S >> 595 Fall, 2008 Description: EE 595: Spring 2003: Information Theory (Part I) Course Pre-requisites: EE 505 and familiarity with basic concepts of probability. Course Outline: This course will serve as the first among the sequence of two courses in the area of Information Theory... Date Added: 2009-02-02 20:36:28 |
| 060911franco.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Spain: \"Law of historical memory\" continues cover-up of Franco\'s crimesWorld Socialist Web Site www.wsws.org WSWS : News & Analysis : Europe : Spain Spain: Law of historical memory continues cover-up of Francos crimes By Paul Stuart 11 September 200... Date Added: 2009-02-11 19:20:17 |
| 060911franco.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Spain: \"Law of historical memory\" continues cover-up of Franco\'s crimesWorld Socialist Web Site www.wsws.org WSWS : News & Analysis : Europe : Spain Spain: Law of historical memory continues cover-up of Francos crimes By Paul Stuart 11 September 200... Date Added: 2009-02-11 20:04:47 |
| lcpc06.pdf Path: LSU >> ECE >> 06 Fall, 1998 Description: An Eective Heuristic for Simple Oset Assignment with Variable Coalescing Hassan Salamy and J. Ramanujam Department of Electrical and Computer Engineering and Center for Computation and Technology Louisiana State University, Baton Rouge, LA 70803, USA... Date Added: 2009-02-06 19:38:03 |
| 14_InstSolManual_PDF_Part9 Path: Pitt. State >> PHYS >> 114 Spring, 2008 Description: Temperature and Heat 14-9 Solve: (a) H 5 kA TH 2 TC 5 1 3.0 W / m # K 2 1 1.0 m 2 2 1 0.025 K / m 2 5 0.075 J / s L Q 5 Ht 5 1 0.075 J / s 2 1 8.64 3 104 s 2 5 6480 J (b) Heat is radiated away into space at the same rate as heat reaches the surfa... Date Added: 2009-03-06 15:38:02 |
| 106.pdf Path: BYU >> EXSC >> 106 Fall, 2008 Description: 11/2004 Ex Sc 106BADMINTON Instructor: Office: Ext: Office Hours: COURSE OBJECTIVES At the conclusion of the semester, students w ill: Demonstrate proper technique in the skills and strategies listed below. Demonstrate knowledge and understandi... Date Added: 2009-02-02 13:40:42 |
| Econ182_Probset1 Path: Berkeley >> ECON >> 182 Spring, 2008 Description: UNIVERSITY OF CALIFORNIA - Berkeley Department of Economics Econ 182 International Monetary Economics Prof. Kasa Spring 2008 PROBLEM SET 1 (Due February 21) Questions 1-3. Answer True, False, or Uncertain. Briefly explain your answer. No credit wi... Date Added: 2008-04-02 08:24:39 |
| ANT 102.doc Path: Palo Verde College >> ANT >> 102 Fall, 2008 Description: Palo Verde College One College Drive, Blythe, CA 92225 (760) 921-5500 COURSE OUTLINE Latest Revision: 10/17/02 Board Approval: 11/26/02 P al o V er d e C o l l eg e 1. Completed by the Course Initiator: Greg Nall Subject Area and Course Number: AN... Date Added: 2009-02-02 15:22:51 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ARCH >> 220 Spring, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ADAP >> 100 Spring, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> BCST >> 240 Spring, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ARCH >> 230 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ADAP >> 110 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ARCH >> 666 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ADAP >> 130 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> BCST >> 210 Spring, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ADAP >> 140 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> BCST >> 220 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> ARCH >> 210 Fall, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| SkylineUCTable.pdf Path: College of the San Mateo >> BCST >> 230 Spring, 2008 Description: Skyline College Transfers to The University of California 1989/90 - 2007/08 UC Campus 89/90 90/91 91/92 92/93 93/94 94/95 95/96 96/97 97/98 98/99 99/00 00/01 01/02 02/03 03/04 04/05 05/06 06/07 07/08 Grand Total % Grand Total Davis 7 10 8 11 13 16 25... Date Added: 2009-01-09 07:45:27 |
| HLTH 1023.002-Case Study - Patterns in Contemporary.pdf Path: Prairie View A & M >> SPAN >> 1023 Fall, 2008 Description: Case Study - \"Patterns in Contemporary.\" Case Study Analysis Element . Levels of Performance . 1. <span style=\"font-size: 12pt; fontfamily: Times New Roman\">Student used grammatically correct sentences.</span> _Target(3) <span style=\"fo... Date Added: 2009-02-02 15:42:11 |
| jones.pdf Path: UF >> EUH >> 3122 Summer, 2008 Description: ... Date Added: 2009-01-10 18:29:04 |
| jones.pdf Path: UF >> EUH >> 3182 Spring, 2008 Description: ... Date Added: 2009-01-10 18:29:07 |
| jones.pdf Path: UF >> EUH >> 4185 Spring, 2008 Description: ... Date Added: 2009-01-10 18:29:10 |
| jones.pdf Path: UF >> MEM >> 3003 Fall, 2008 Description: ... Date Added: 2009-01-10 03:40:02 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 359 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:42 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 229 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:41 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 247 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:41 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 266 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:41 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 277 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:42 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 331 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:42 |
| BilerKarchWoyczynski.pdf Path: Case Western Reserve University >> LAWS >> 219 Fall, 2008 Description: FokkerPlanck equations and conservation laws involving Lvy diusion generators e Miniproc. 2nd Levy Conference on Stochastic Processes and Appl., MaPhySto, Aarhus University, (2002) 64-69. Piotr BILER, Grzegorz KARCH and Wojbor A. WOYCZYNSKI P.B. and... Date Added: 2009-01-09 07:41:41 |
| transition.pdf Path: George Mason >> MATH >> 111 Fall, 2008 Description: ... Date Added: 2009-04-16 01:15:18 |
| HS 44 Outline FA01.doc Path: Fresno City College >> HS >> 44 Spring, 2008 Description: FRESNO CITY COLLEGE COURSE OUTLINE OF RECORD Course Subject and Number Human Services 44 _ _ Course Title Drug Use: Physical and Psychological Effects_ Catalog Description: Prerequisite: Corequisite: Advisory: [X] no change [ ] revised/clarified [ ] ... Date Added: 2009-02-02 14:14:17 |
| MDTransferAppealProcess.pdf Path: Maryland >> MS >> 07 Fall, 2008 Description: http:/www.dsd.state.md.us/comar/13b/13b.06.01.09.htm 13B.06.01.09 .09 Appeal Process. A. Notice of Denial of Transfer Credit by a Receiving Institution. (1) Except as provided in A(2) of this regulation, a receiving institution shall inform a trans... Date Added: 2009-02-18 00:24:52 |
| Darnall.pdf Path: NMSU >> WRRI >> 34 Fall, 2008 Description: ... Date Added: 2009-02-11 16:22:08 |
| PSY71 - Mental State Exam Path: Tufts >> PSYCH >> 71 Spring, 2008 Description: Mental State Examination Psy 71 and Psy 181 Mental State Examination: Overview Appearance and Behavior Speech (rate, tone, volume) Mood: objective (affect); subjective Thought: form; content Abnormal Perceptions Cognitive function Insight Me... Date Added: 2008-03-26 16:51:14 |
| 10HarvJLTech369.pdf Path: Harvard >> V >> 10 Fall, 2009 Description: Harvard Journal of Law PROPERTY RIGHTS AND THE OWNERSHIP OF HUMAN BIOLOGICAL MATERIALS By E. Richard Gold. 1 Washington, D.C.: Georgetown University Press. 1996. Pp. 240. $49.95 (hard). Biot... Date Added: 2009-04-16 00:29:41 |
| Chap7_10-09-07 Path: Penn State >> PSYCH >> 221 Fall, 2007 Description: Chapter 7 Attitudes - Lecture Notes for 10/9/07 Early Research on Attitudes 1 Attitudes (pg. 191) Evaluations of people, objects, and ideas Yale Attitude Change Approach - 1950\'s Yale Attitude Change Approach (pg. 199) The study of the conditi... Date Added: 2008-05-04 17:11:14 |
| projcap01_1ss.pdf Path: LSU >> LTRC >> 01 Fall, 2008 Description: Research Project 01-1SS Capsule Technology Transfer Program LTRC June 2001 Louisiana Traffic Sign Management: An Inventory System Starting date: Duration: Completion date: Funding: 1/30/01 17 months 6/30/02 FHWA Problem Currently, the Louisiana D... Date Added: 2009-02-06 19:38:53 |
| 030312crbord.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: From: Crossborder UPDATER [americas@irc-online.org] Sent: Wednesday, March 12, 2003 9:40 PM To: Americas Subject: [americas] Trade, PPP, Hometown Associations ~ CROSSBORDER UPDATER | March 12, 2003 Vol. 1, No. 2 contents: The Americas This Week: Init... Date Added: 2009-02-11 18:27:31 |
| 060227merger2.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Top unions in France opposed to merger plan - Print Version - International Herald Tribune Top unions in France opposed to merger plan Bloomberg News MONDAY, FEBRUARY 27, 2006 PARIS French unions said on Monday that they opposed the merger of Suez an... Date Added: 2009-02-11 17:29:27 |
| 060227merger2.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Top unions in France opposed to merger plan - Print Version - International Herald Tribune Top unions in France opposed to merger plan Bloomberg News MONDAY, FEBRUARY 27, 2006 PARIS French unions said on Monday that they opposed the merger of Suez an... Date Added: 2009-02-11 17:53:05 |
| Final.F06 Path: Concordia Canada >> COMM >> 217 Fall, 2007 Description: CONCORDIA UNIVERSITY DEPARTMENT OF ACCOUNTANCY FINANCIAL ACCOUNTING COMM 217 ALL SECTIONS FINAL TERM EXAMINATION Fall 2006 Duration: 3 hours Instructions: 1. This examination paper consists of 8 pages including this page. Please make sure your pape... Date Added: 2008-04-17 15:49:51 |
| 1667.pdf Path: Minnesota >> IMA >> 99 Fall, 2008 Description: | pH|H pIyHeHt epH|Y y!H0CarHDiC eei p0ay He$ eer ppAy H p~R rX$ e| $ \' H 6y |y ~|p y \'y C$ Hpe XaX |y v $y He XC HXuXC e tp pC D e ... Date Added: 2009-02-17 20:52:27 |
| 1276.pdf Path: Minnesota >> IMA >> 1994 Fall, 2008 Description: ... Date Added: 2009-02-17 21:12:52 |
| rosen_IEEE.pdf Path: UCSD >> SIO >> 225 Fall, 2008 Description: Synthetic Aperture Radar Interferometry PAUL A. ROSEN, SCOTT HENSLEY, IAN R. JOUGHIN, MEMBER, IEEE, FUK K. LI, FELLOW, IEEE, SREN N. MADSEN, SENIOR MEMBER, IEEE, ERNESTO RODRGUEZ, AND RICHARD M. GOLDSTEIN Invited Paper Synthetic aperture radar inter... Date Added: 2009-01-12 05:46:15 |
| phy380m_lecture_13.pdf Path: Caribbean >> PHY >> 380 Fall, 2008 Description: ... Date Added: 2009-02-17 18:15:59 |
| phy380m_lecture_13.pdf Path: Texas >> PHY >> 380 Fall, 2008 Description: ... Date Added: 2009-02-17 18:15:59 |
| BIOL R107 Delete.pdf Path: Oxnard College >> IDS >> R107 Spring, 2008 Description: COURSE OUTLINE COVER SHEET OXNARD COLLEGE CURRICULUM COMMITTEE 1. COURSE IDENTIFICATION & CHANGE INFORMATION COURSE ID: BIOL R107 / REVISION / DELETION X/ / 1st Reading DCSL 2nd Reading Governing Board 1st CHANGE TYPE: NEW APPENDICES: PREREQUISITE ... Date Added: 2009-02-02 15:19:18 |
| Radio97Q.pdf Path: FSU >> COM >> 5331 Fall, 2008 Description: 1 1997 RADIO TAMS QUESTIONNAIRE - INTRODUCTION SCREEN #1 Hello, my name is _ and I\'m calling from the Communication Research Center at Florida State University. We are conducting a telephone survey in Leon, Gadsden and Wakulla Counties to learn abou... Date Added: 2009-02-17 19:08:56 |
| Radio97Q.pdf Path: S.F. State >> COMM >> 5331 Fall, 2008 Description: 1 1997 RADIO TAMS QUESTIONNAIRE - INTRODUCTION SCREEN #1 Hello, my name is _ and I\'m calling from the Communication Research Center at Florida State University. We are conducting a telephone survey in Leon, Gadsden and Wakulla Counties to learn abou... Date Added: 2009-02-17 19:08:57 |
| ROE_Project.pdf Path: UNC Charlotte >> ACCT >> 6299 Fall, 2008 Description: ACCT 6299 ROE Project 1. Convert the financial statement information as presented into the standardized financial statements that are used in eVal for both FY2004 (the year ended 1/1/05) and FY2003 (the year that ended 1/3/04). Present your work in a... Date Added: 2009-02-02 19:54:48 |
| Orgo 2 Report 1 Path: Kentucky >> BIO >> 152 Fall, 2008 Description: TA: Eric Wallase Name: Travis McMaine Drawer #: U7C Date: 4/5/08 Course Expt. # Unknown # : Che 233-002 : Compound 1 :1 1. Preliminary Tests a. Physical State: Homogenous Liquid (Non-viscous) b. Color: Colorless c. Odor: Strong d. Boiling Point: I... Date Added: 2008-04-23 11:12:35 |
| SP_06_Schedule(rev1).doc Path: Delaware >> ACCT >> 801 Fall, 2008 Description: ACCT 801 Schedule Date Feb 7 Feb 14 Topic Introduction Overview MCS Environment Reading for Class Review Material Nature of MCS Case 1-1 Nucor (A) Case 1-2 Walmart Jones Effective Feb. 1, 2006 Assignment Due Survey (ANTHONY Ch 1) Discuss only Discu... Date Added: 2009-01-10 02:44:46 |
| 060413elect.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Leader in Hungary willing to step aside - Print Version - International Herald Tribune Leader in Hungary willing to step aside By Judy Dempsey International Herald Tribune THURSDAY, APRIL 13, 2006 BUDAPEST Viktor Orban, the charismatic leader of the ... Date Added: 2009-02-11 19:48:45 |
| 060413elect.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Leader in Hungary willing to step aside - Print Version - International Herald Tribune Leader in Hungary willing to step aside By Judy Dempsey International Herald Tribune THURSDAY, APRIL 13, 2006 BUDAPEST Viktor Orban, the charismatic leader of the ... Date Added: 2009-02-11 19:30:53 |
| 2008_schlumberger-364-464.pdf Path: Texas >> PGE >> 364 Fall, 2008 Description: INFORMATION SESSION Schlumberger 364/464 Design Project Wed, April 9, 2008 6-8 pm, RLM 5.104 Food and beverages provided A 2-semester Multidisciplinary Senior Design Sequence Fall 2008: EE 364D Introduction to Engineering Design (This will be a se... Date Added: 2009-02-03 14:17:09 |
| chen_denovo.pdf Path: UCSD >> CSE >> 182 Fall, 2008 Description: Journal of Computational Biology, 8(3): 325-337, 2001 A Dynamic Programming Approach to De Novo Peptide Sequencing via Tandem Mass Spectrometry Ting Chen Department of Genetics Harvard Medical School Boston, MA 02115, USA Ming-Yang Kao Department o... Date Added: 2009-01-11 21:34:50 |
| ece645_lecture6.pdf Path: George Mason >> ECE >> 645 Fall, 2008 Description: Lecture 6: Multi-Operand Addition ECE 645Computer Arithmetic 3/5/08 ECE 645 Computer Arithmetic Lecture Roadmap Multi-Operand Addition Adder Trees Carry-Save Adders and Carry-Save Adder Trees Wallace and Dadda Trees 5:3 Counter and Generalize... Date Added: 2009-04-16 01:28:28 |
| Syllabus Path: Colorado >> EBIO >> 1210 Fall, 2008 Description: EBIO 1210 General Biology Lecture Schedule Fall 2008 Lectures held in Muenzinger MUEN E050; Tuesday (T) 881 (both at 12:30-1:45 pm) Professors: Dr. Barbara Demmig-Adams (first hal... Date Added: 2008-10-08 16:04:20 |
| Lecture2.pdf Path: Berkeley >> MCB >> 150 Fall, 2009 Description: Administrative issues: Recommended text: Goldsby/Kuby Immunology, 6th edition (Note that Innate Immunity is not adequately covered in the 5th edition.) Discussion sections start next week. The journal article Akira et al, and the first problem set wi... Date Added: 2009-04-16 01:56:31 |
| Lecture2.pdf Path: Berkeley >> MCB >> 2 Fall, 2009 Description: Administrative issues: Recommended text: Goldsby/Kuby Immunology, 6th edition (Note that Innate Immunity is not adequately covered in the 5th edition.) Discussion sections start next week. The journal article Akira et al, and the first problem set wi... Date Added: 2009-04-16 01:56:31 |
| 2385.100.ps Path: Hawaii >> SOEST >> 2385 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207379397.0388276 Float: 2385 Profile: 100 Location: 30.1N 140.2E Date: 10/12... Date Added: 2009-02-17 20:04:56 |
| w51m_0.25_hcn10.pdf Path: Arizona >> AS >> 12 Fall, 2008 Description: ... Date Added: 2009-02-17 23:22:09 |
| w51m_0.25_hcn10.pdf Path: McGill >> AS >> 12 Fall, 2008 Description: ... Date Added: 2009-02-17 23:22:09 |
| 33829.pdf Path: Mich Tech >> SS >> 5200 Spring, 2008 Description: December 2003 NREL/SR-500-33829 Bird Risk Behaviors and Fatalities at the Altamont Pass Wind Resource Area Period of Performance: March 1998December 2000 C.G. Thelander, K.S. Smallwood, and L. Rugge BioResource Consultants Ojai, California Nati... Date Added: 2009-01-09 03:09:18 |
| 411.pdf Path: Ohio State >> ANTHROP >> 411 Fall, 2008 Description: THIS IS AN EXAMPLE OF A SYLLABUS PREVIOUSLY USED IN THIS COURSE. IT IS INTENDED ONLY TO GIVE YOU AN IDEA OF WHAT TO EXPECT. THE ACTUAL SYLLABUS USED IN THE COURSE MAY BE SLIGHTLY DIFFERENT. HUMAN ECOLOCICAL ADAPTATIONS Anthropology 411 Spring, 1998 M... Date Added: 2009-02-02 15:15:22 |
| ME 416.pdf Path: Clemson >> M E >> 416 Fall, 2008 Description: ME 416 - Control of Mechanical Systems Catalog Data: ME 416: Control of Mechanical Systems. 3(3,0). Physical modeling and feedback principles are presented for control of mechanical systems. Transient response, root locus and frequency response princ... Date Added: 2009-02-02 13:54:58 |
| Ch17-20 transcription Path: Clarkson >> BIO >> Gen Bio Spring, 2008 Description: What we will cover: 1. How was one gene associated with one polypeptide 2. How DNA code is turned into protein seque 3. The genetic code 4. How DNA is transcribed 1. How was one gene associated with one polypeptide Flow of genetic information -s... Date Added: 2008-04-07 18:53:57 |
| baumrindpaper.pdf Path: San Jose State >> SE >> 155 Fall, 2008 Description: DOES CAUSALLY RELEVANT RESEARCH SUPPORT A BLANKET INJUNCTION AGAINST DISCIPLINARY SPANKING BY PARENTS? Diana Baumrind, Ph.D. Institute of Human Development University of California, Berkeley, California Invited Address at the 109th Annual Convention ... Date Added: 2009-01-12 04:15:57 |
| Aug30 Path: Lehigh >> CSE >> 404 Fall, 2007 Description: CSE/ECE404: Computer Networks Instructor: Dr. Liang Cheng Department of Computer Science and Engineering P.C. Rossin College of Engineering & Applied Science Lehigh University August 30, 2007 Outline Recap Network design requirements Network archit... Date Added: 2008-08-06 17:29:50 |
| Aug30 Path: Lehigh >> CSE >> 404 Fall, 2007 Description: CSE/ECE404: Computer Networks Instructor: Dr. Liang Cheng Department of Computer Science and Engineering P.C. Rossin College of Engineering & Applied Science Lehigh University August 30, 2007 Outline Recap Network design requirements Network archit... Date Added: 2008-08-06 17:29:50 |
| Background of the Assailant- John Hinckley Jr. Path: Missouri S&T >> HIST >> 176 Fall, 2007 Description: ... Date Added: 2008-04-17 22:39:34 |
| final topics.pdf Path: UCLA >> CHEM >> C160a Fall, 2008 Description: midterm topics 12/6/07 10:36:01 AM Topic Part 1 conditional probability rearrangement, union, chain rules joint and marginal probabilities independence, conditional independence Bayes law inference \"recipe\" posterior probability calculation summing... Date Added: 2009-01-11 20:32:27 |
| 550u02s1.pdf Path: Rutgers >> 642 >> 550 Fall, 2008 Description: Math 642:550 Summer 2002 MTTh 6:158:45 PM Hill 525 Prof. Bumby Supplement on Intersection of Subspaces The rst motivation for introducing matrices is to organize the work of solving a system of linear equations. The equation is written in the form M... Date Added: 2009-01-10 00:02:47 |
| Reading 1 Path: Bryant >> GLOB >> 241 Fall, 2007 Description: ... Date Added: 2008-04-21 13:45:56 |
| Rhetorical Analysis of a Written Text Path: Iowa State >> ENGL >> 250 Fall, 2007 Description: Rachel Johnson English 105, Section HN 8 March 2007 Stripped of Dignity Imagine being strip searched in an airport. Now imaging that the reason you had to experience such a humiliating act was because of the color of your skin. In \"Stripped of More t... Date Added: 2008-03-26 19:35:02 |
| lecture10.pdf Path: UCSD >> MATH >> 250a Fall, 2008 Description: ... Date Added: 2009-01-10 18:03:02 |
| lecture10.pdf Path: UCSD >> MATH >> 10 Fall, 1920 Description: ... Date Added: 2009-02-17 18:18:43 |
| 152.pdf Path: Michigan >> UKRAINE >> 152 Fall, 2008 Description: Hall Effect T h r u s t e r with an A1N discharge channel IEPC-2005-152 Presented at the 29 tt~ I n t e r n a t i o n a l Electric Propulsion Conference, P r i n c e t o n University October 31 N o v e m b e r ~, 2005 S. Barral* I n s t i t u t e of... Date Added: 2009-02-02 19:45:48 |
| 12-10-07 Path: Berkeley >> HISTORY OF >> 11 Fall, 2007 Description: Strada 3:30-5:00 Bring 2 blue books to exam Check announcement on bspace Exam 12:30 on Saturday ... Date Added: 2008-05-17 11:32:44 |
| page4.pdf Path: Ohio State >> B >> 512 Fall, 2009 Description: Pesticide Dilution Table (Amount of pesticide formulation for each gallon of water) Pesticide Formulation .0313% 0.0625% Percentage of Actual Chemical Wanted 0.125% 0.25% 0.5% Wettable Powder (WP) 7 tbsp. 1 cup 12 tsp. 8 tbsp. 8 tsp. 5 tbsp. 6 tsp. 4... Date Added: 2009-04-16 01:06:07 |
| Davis2005GlobEcol.pdf Path: Berkeley >> INTEGBI >> 166 Spring, 2008 Description: Global Ecology and Biogeography, (Global Ecol. Biogeogr.) (2005) 14, 479490 Blackwell Publishing, Ltd. RESEARCH PAPER Mammalian beta diversity in the Great Basin, western USA: palaeontological data suggest deep origin of modern macroecological stru... Date Added: 2009-01-11 20:22:21 |
| 510_evaluation.ppt Path: N. Illinois >> ETT >> 401a Fall, 2008 Description: Evaluating your Instructional Design Project Why evaluate? Better meet your goals Improve efficiency Improve effectiveness Improve learner attitude Provide better resources to learners Improve rate of adoption Some questions to ask while eval... Date Added: 2009-01-09 05:18:36 |
| 510_evaluation.ppt Path: N. Illinois >> ETT >> 501 Fall, 2008 Description: Evaluating your Instructional Design Project Why evaluate? Better meet your goals Improve efficiency Improve effectiveness Improve learner attitude Provide better resources to learners Improve rate of adoption Some questions to ask while eval... Date Added: 2009-01-09 05:18:47 |
| 510_evaluation.ppt Path: N. Illinois >> ETT >> 510 Fall, 2008 Description: Evaluating your Instructional Design Project Why evaluate? Better meet your goals Improve efficiency Improve effectiveness Improve learner attitude Provide better resources to learners Improve rate of adoption Some questions to ask while eval... Date Added: 2009-01-09 05:18:47 |
| 510_evaluation.ppt Path: N. Illinois >> ETT >> 641 Fall, 2008 Description: Evaluating your Instructional Design Project Why evaluate? Better meet your goals Improve efficiency Improve effectiveness Improve learner attitude Provide better resources to learners Improve rate of adoption Some questions to ask while eval... Date Added: 2009-01-09 05:19:01 |
| Chapter 10 Path: Alabama >> NHM >> 101 Spring, 2008 Description: The Water-Soluble Vitamins B Vitamins and Vitamin C NHM 101 The Vitamins Vitamins vs carbohydrates, fats, and proteins Structure Function Food contents The Vitamins Bioavailability Precursors Organic nature Solubility Toxicity The Vitamins Thiami... Date Added: 2008-04-20 22:40:51 |
| Solutions Exam 2 Review Path: Baylor >> QBA >> 2302 Spring, 2008 Description: ... Date Added: 2008-04-30 00:18:29 |
| celestail guides for astron lab Path: UT Arlington >> PHYS >> 1445 Spring, 2007 Description: 1445 Celestial Guides Celestial Sphere: An imaginary rotating sphere of \"gigantic radius\", concentric and coaxial with the Earth. All objects in the sky can be thought of as lying upon the sphere Celestial Equator: A great circle on the imaginary cel... Date Added: 2008-04-14 18:55:36 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> P H >> 899 Fall, 2008 Description: ... Date Added: 2009-01-12 04:14:27 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> P H >> 722 Fall, 2008 Description: ... Date Added: 2009-01-09 10:21:03 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> MALAS >> 600a Fall, 2008 Description: ... Date Added: 2009-01-11 19:38:28 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> MGT >> 356 Fall, 2008 Description: ... Date Added: 2009-01-09 07:00:42 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> MGT >> 740 Fall, 2008 Description: ... Date Added: 2009-01-11 19:38:41 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> MGT >> 496 Fall, 2008 Description: ... Date Added: 2009-01-09 10:20:32 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> ECON >> 740 Fall, 2008 Description: ... Date Added: 2009-01-11 20:56:40 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> MGT >> 729 Fall, 2008 Description: ... Date Added: 2009-01-09 10:20:32 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> P H >> 664 Fall, 2008 Description: ... Date Added: 2009-01-12 04:14:27 |
| rprnts.bondagechocolate.pdf Path: San Diego State >> MGT >> 722 Fall, 2008 Description: ... Date Added: 2009-01-09 10:21:02 |
| Note 11.pdf Path: Alabama >> EC >> 671 Fall, 2008 Description: ... Date Added: 2009-01-12 04:21:39 |
| Note 11.pdf Path: Alabama >> EC >> 309 Spring, 2008 Description: ... Date Added: 2009-01-09 07:29:24 |
| Note 11.pdf Path: Alabama >> CH >> 570 Fall, 2008 Description: ... Date Added: 2009-01-12 04:21:11 |
| Note 11.pdf Path: Alabama >> EC >> 670 Spring, 2008 Description: ... Date Added: 2009-01-12 04:21:32 |
| CSE399b-12-feature.ppt Path: UPenn >> CSE >> 399 Fall, 2008 Description: Image Features slides from A. Efros, Steve Seitz and Rick Szeliski Todays lecture Feature detectors scale invariant Harris corners Feature descriptors patches, oriented patches Reading : Multi-image Matching using Multi-scale image patches, C... Date Added: 2009-04-15 20:45:13 |
| exp-3.pdf Path: BYU >> CHEM >> 464 Fall, 2008 Description: ... Date Added: 2009-02-02 13:39:50 |
| exp-3.pdf Path: BYU >> CHEM >> 3 Fall, 2008 Description: ... Date Added: 2009-02-11 21:33:05 |
| exp-3.pdf Path: BYU >> CHEM >> 464 Fall, 2008 Description: ... Date Added: 2009-02-11 21:33:06 |
| schedule.pdf Path: UC Irvine >> EEE >> 14330 Winter, 2008 Description: BME233 (W2008): Dynamic Systems in Biology and MedicineTentative Schedule This is a tentative schedule for BME233 (Dynamic Systems in Biology and Medicine). The schedule may change as the course develops. Week 1. 1. Introduction and course advertise... Date Added: 2009-02-06 18:47:41 |
| 031013busines2.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Prague Business Journal - Article Last updated: 17th Oct 2003, 9:17 Banking Politics Industry Telecom Communications Real Estate Law A... Date Added: 2009-02-11 19:52:49 |
| p55a.pdf Path: SUNY Stony Brook >> PHY >> 501 Fall, 2008 Description: ... Date Added: 2009-01-11 19:45:52 |
| communicationba.pdf Path: UCM >> X >> 65070 Fall, 2008 Description: UCM Communication Major, B.A. Degree Students who hold an Associate of Arts Degree from SFCC or have met the Missouri 42-hour General Education Core requirements are considered to have fulfilled all UCM General Education requirements, except: Person... Date Added: 2009-02-06 20:06:06 |
| techsumm292.pdf Path: LSU >> LTRC >> 292 Fall, 2008 Description: ... Date Added: 2009-02-06 19:38:38 |
| VWF-2.pdf Path: San Jose State >> EE >> 222 Fall, 2008 Description: VWF Interactive Tools Users Manual, Volume 2 SILVACO International 4701 Patrick Henry Drive, Bldg. #2 Santa Clara, CA 94054 Telephone (408) 567-1000 FAX: (408) 496-6080 November, 1998 VWF Interactive Tools Users Manual, Volume 2 Copyright 1998 SIL... Date Added: 2009-01-09 07:07:37 |
| hw8soln Path: Michigan >> BIOMEDE >> 311 Winter, 2006 Description: BME 499/311 Solutions to HW #8 ... Date Added: 2008-04-30 11:13:09 |
| 2377.075.ps Path: Hawaii >> SOEST >> 2377 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1207377017.0388276 Float: 2377 Profile: 075 Location: 29.7N 153.0E Date: 06/19... Date Added: 2009-02-17 20:21:17 |
| Human Nutrition Lecture 1 Path: Stanford >> HUMBIO >> 130 Spring, 2008 Description: Human Nutrition Lecture 1 cgardner@stanford.edu 725-2751 What should we eat? Science (and politics, journalism, culture) Under- vs. Over-nutrition -scurvy -iodine deficiency leads to goiter -energy malnutrition marasmus -xeropthalmia (blindness due t... Date Added: 2008-05-08 11:59:04 |
| hw10_322_06_soln.pdf Path: Eastern Oregon >> PHYS >> 322 Fall, 2008 Description: PHYS 322 Exercise Set #10 Solutions 1 1. Suppose N distinguishable atoms are distributed over two energy levels, E1 = 0 and E2 = . (A) Show that the energy of the system is given by ES = N e/kT 1 + e/kT (B) Show that the specic heat due to the s... Date Added: 2009-02-18 14:03:10 |
| The best way to an.doc Path: Cincinnati >> COMM >> 171 Winter, 2008 Description: The best way to an A Find out what the instructor wants and then give it to him! When you take a job, what is the first thing that happens? You find out what is expected of you! If you do what is expected, all is well; if not, fired! The same is tru... Date Added: 2009-01-10 02:35:46 |
| The best way to an.doc Path: Cincinnati >> COMM >> 300 Spring, 2008 Description: The best way to an A Find out what the instructor wants and then give it to him! When you take a job, what is the first thing that happens? You find out what is expected of you! If you do what is expected, all is well; if not, fired! The same is tru... Date Added: 2009-01-10 02:35:47 |
| uresources.pdf Path: SUNY Cortland >> UNDERGRAD >> 200506 Fall, 2008 Description: Campus Resources/ Student Support Academic Support and Achievement Program The Academic Support and Achievement Program (ASAP) helps students learn how they learn best. ASAP staff provides academic support to students of all ability and achievement ... Date Added: 2009-02-17 23:45:27 |
| Syllabus EXP 3082-Spring 2004.pdf Path: W. Florida >> EXP >> 3082 Fall, 2008 Description: EXPERIMENTAL PSYCHOLOGY EXP 3082 - Spring 2004 Dr. Jay E. Gould SYLLABUS TABLE OF CONTENTS Page Instructor and Class Data Required Books Prerequisite Student-Learning Outcome Objectives Mechanism Evaluation Additional Recommended Readings Oath of E... Date Added: 2009-02-02 20:39:19 |
| PhotoLitho.pdf Path: Iowa State >> STAT >> 496 Fall, 2008 Description: JMP Output for Photolithography Experiment Response Thickness - Full Factorial Model (no center points) Summary of Fit RSquare RSquare Adj Root Mean Square Error Mean of Response Observations (or Sum Wgts) Analysis of Variance Source Model Error C. T... Date Added: 2009-01-11 16:20:48 |
| L2_maple.pdf Path: Rutgers >> 090 >> 101 Fall, 2008 Description: 9 7 $4 2 1 0 ( @8653\')\'%#! u q d c W q u x u i x q Y Yd W c u ad y u s q u U s Y u d x y W q R x Y i x q j$eXeGb{XbwpbetwvteXej$hXeu gX$rXbY 6 V Us xa Wq X4$`(X `T(Xev$x rXbej$hXb$v$ev$hbb}Tgjb`Xe(jj u WR W q u i x q Y... Date Added: 2009-01-11 18:01:05 |
| L2_maple.pdf Path: Rutgers >> 090 >> 276 Fall, 2008 Description: 9 7 $4 2 1 0 ( @8653\')\'%#! u q d c W q u x u i x q Y Yd W c u ad y u s q u U s Y u d x y W q R x Y i x q j$eXeGb{XbwpbetwvteXej$hXeu gX$rXbY 6 V Us xa Wq X4$`(X `T(Xev$x rXbej$hXb$v$ev$hbb}Tgjb`Xe(jj u WR W q u i x q Y... Date Added: 2009-01-12 04:11:46 |
| CWAA02-2.pdf Path: Wisconsin Milwaukee >> A >> 02 Fall, 2009 Description: Medical And Surgical Treatment Of Arthritis Gerald J. Broock M.D. CWA gbroock@cox.net Feb 7, 2004 Alternative Medicine Alternative Medicine Complementary Approaches May Ease symptoms Improve outlook and attitude Nutritional research is still in i... Date Added: 2009-04-15 22:22:14 |
| Thesis.pdf Path: Virginia Tech >> LIB >> 09242004 Fall, 2008 Description: Reproductive performance of Holstein cows treated with prostaglandin F2, gonadotropin releasing hormone, and recombinant bovine Somatotropin Charles Benjamin Pickin Thesis submitted to the Faculty of the Virginia Polytechnic Institute and State Uni... Date Added: 2009-02-18 01:12:30 |
| LAJ34,2004.2.39.pdf Path: Wichita State >> NURS >> 786 Fall, 2008 Description: PAGE 2 VOLUME 34, 2004 ON DOIT SURVIVRE (ONE MUST SURVIVE): THE ROTATING SAVINGS AND CREDIT ASSOCIATION AS AN ECONOMIC STRATEGY FOR THE WOMEN OF TSKINKUP QUARTER IN DSCHANG, CAMEROON Abigail Dumes Department of Anthropology Washington University in... Date Added: 2009-02-02 21:08:03 |
| March2001.doc Path: Iowa State >> MIS >> 440x Fall, 2008 Description: COLLEGE OF BUSINESS ONLINE The College of Business Newsletter Iowa State University March 1, 2001 Number 59 NEW BUILDING UPDATE Since approval of the schematic design in December 2000, ZGF architects have been busy with design development phase of... Date Added: 2009-01-09 15:13:25 |
| March2001.doc Path: Iowa State >> SCM >> 524x Fall, 2008 Description: COLLEGE OF BUSINESS ONLINE The College of Business Newsletter Iowa State University March 1, 2001 Number 59 NEW BUILDING UPDATE Since approval of the schematic design in December 2000, ZGF architects have been busy with design development phase of... Date Added: 2009-01-09 15:13:25 |
| 220F05_hw03 Path: Maryland >> ENES >> 220 Spring, 2008 Description: Problem C.18: Problem C.23: Problem C.23 - Alternate Method: Problem C.27: Problem C.27 - Alternate Method: Problem C.34: Problem C.34 - Alternate Method: Problem C.25: Problem C.25 - Alternate Method: Problem C.26: Problem C.26: (con\'t) P... Date Added: 2008-04-17 20:25:34 |
| 06 stand tests 11-25-06.doc Path: Illinois State >> HIS >> 478 Fall, 2008 Description: 1 STANDARDIZED TESTS 2 3 4RATIONALE 5 Most educators agree that few decisions should be based solely on the results of a 6single test, but most educators also agree that the results of some tests play an important 7role in deciding on curricular and ... Date Added: 2009-02-02 14:30:05 |
| Elinor P. Schroeder, On Beyond Drug Testing - Employer Monitoring and the Quest for the Perfect Work Path: Kansas >> LAW >> 869 Spring, 2008 Description: HeinOnline - 36 U. Kan. L. Rev. 869 1987-1988 HeinOnline - 36 U. Kan. L. Rev. 870 1987-1988 HeinOnline - 36 U. Kan. L. Rev. 871 1987-1988 HeinOnline - 36 U. Kan. L. Rev. 872 1987-1988 HeinOnline - 36 U. Kan. L. Rev. 873 1987-1988 HeinOnline - 36... Date Added: 2009-02-02 19:22:03 |
| MIS 333K Computer System Utilization in Business (Byars) (2).pdf Path: Texas >> MIS >> 333k Fall, 2008 Description: MIS 333K - Computer System Utilization in Business (Web design using ASP.NET) TTh 9:30-11:00 UTC 1.146 Instructor: Office: E-mail: Course website: Teaching Assistant: Office: E-mail: Rick Byars GSB 4.126A rbyars@mail.utexas.edu UTs Blackboard at htt... Date Added: 2009-02-03 14:15:03 |
| channellJGR1999.pdf Path: UF >> GLY >> 6424 Fall, 2008 Description: ... Date Added: 2009-01-11 22:50:37 |
| Ex14 Lab Physics 1 for Engineers Path: Northeastern >> PHY >> 152 Spring, 2008 Description: Experiment 14 Maxwell\'s Wheel Introduction In this experiment, we will use Maxwell\'s Wheel, two sets of brass knobs, two standing support rods, Vernier Caliper, string, stop watch, and a scale. In investigation one, we will first measure the dimens... Date Added: 2008-04-16 15:32:40 |
| M100_HW_NE_9.3 Path: LA Tech >> MATH >> 101 Spring, 2008 Description: Math 100 HW 9.3 ... Date Added: 2008-04-24 01:52:16 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 419a Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 215r Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 462 Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> MUSIC >> 251 Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 419b Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 285 Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 565r Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> MUSIC >> 256 Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> FLANG >> 102r Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 351 Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 652r Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> MUSIC >> 257 Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> FLANG >> 201r Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 384r Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 655r Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> MUSIC >> 351 Fall, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> FLANG >> 202r Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 387 Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> TMA >> 187 Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-09 18:53:50 |
| Alumni_Updates_2008_Resume_Oxborrow.doc Path: BYU >> HFL >> 380 Winter, 2008 Description: 209 Court Dr.* Washington, Illinois 61571 * cell (309) 472-5975 * anna_oxborrow@yahoo.com EDUCATION: Brigham Young University, Provo UT Bachelor of Arts, December 2001 Illinois Central College, East Peoria, IL Associate of Arts and Science, May 1997 ... Date Added: 2009-01-11 04:54:25 |
| Notes26Meta.pdf Path: Arkansas >> PHIL >> 4603 Fall, 2008 Description: PHIL 4603: Metaphysics Prof. Funkhouser Davidson, Causal Relations Question: What is the logical form of singular causal statements like: The ood caused the famine . . . ? (428) I. Davidson thinks that causes are events, rather than something corr... Date Added: 2009-01-11 20:01:43 |
| CIEP401-Kennedy-1086.pdf Path: Loyola Chicago >> WWW1 >> 1 Fall, 2008 Description: Page 1 Syllabus CIEP 401: The Exceptional Child Loyola University Chicago School of Education Fall Semester, 2008 Instructor: Adam S. Kennedy Office hours: by appointment on Wednesdays and Thursdays (LT1063) Phone: 312-915-6857 630-886-9989 (cell) ... Date Added: 2009-02-11 20:59:37 |
| CIEP401-Kennedy-1086.pdf Path: Loyola Chicago >> WWW >> 1 Fall, 2008 Description: Page 1 Syllabus CIEP 401: The Exceptional Child Loyola University Chicago School of Education Fall Semester, 2008 Instructor: Adam S. Kennedy Office hours: by appointment on Wednesdays and Thursdays (LT1063) Phone: 312-915-6857 630-886-9989 (cell) ... Date Added: 2009-02-11 20:59:37 |
| 4607-l1.ppt Path: Georgia Tech >> ECE >> 4607 Fall, 2008 Description: ECE 4607: Mobile & Wireless Networks Raghupathy Sivakumar http:/www.ece.gatech.edu/research/GNAN http:/www.ece.gatech.edu/~siva/ECE4607 Guest Lectures Professor Sivakumar traveling for a lecture at the WISARD (Wireless Systems: Advanced Research an... Date Added: 2009-02-02 21:31:41 |
| Log#1 European Thinkers Path: Philadelphia >> EDU >> 201 Fall, 2007 Description: Log #1 Influence of European Thinkers Group Members: Andrea Sutton Marie Belcombe Ruth Taylor Jamilla Meekins Shaunie Gocking -Identify key ideas of each of the Europeans thinkers and how their ideas still appear still in current American education.... Date Added: 2008-06-17 21:44:44 |
| Chapter 14 Practice Problems Path: Texas A&M >> BICH >> 411 Spring, 2008 Description: BICH 411 Chapter 14 Practice Problems Compiled by Dr. L Mullins Jan 2006 Biochemistry 411 Chapter 14 Key These are problems that have been given as homework, quiz and exam questions. All answers should be correct, but there is always a possibility th... Date Added: 2008-03-30 23:29:07 |
| 010602imports.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: WSJ.com July 3, 2001 Business and Finance - Asia Malaysia\'s Trade Surplus Increases As Imports Outpace Exports\' Fall Dow Jones Newswires KUALA LUMPUR, Malaysia - Malaysia\'s preliminary May trade surplus increased 13.4% on year to 4.7 billion ringgit ... Date Added: 2009-02-11 20:30:37 |
| Structure.questions_IX_answer Path: RPI >> MTLE >> 2100 Spring, 2008 Description: MTLE-2100 Structure of Engineering Materials, Question IX-Answer Slope = - Q/k, = [-10 - (-7.4)]/[1.4x10-3 - 1.1x10-3] - 2.6/0.3x10-3 = - 8.67x103 K, k = 13.81 x 10-24 J/K 3 3 Q = 8.67 x10 x k = 8.67 x 10 x 13.81 x 10-24 J = 119.7 x 10-21 J = 1.2 x ... Date Added: 2008-04-29 06:47:35 |
| Intro.pdf Path: Southern Methodist >> PHYS >> 6351 Fall, 2008 Description: ... Date Added: 2009-01-09 15:24:17 |
| Intro.pdf Path: Southern Methodist >> PHYS >> 3374 Fall, 2008 Description: ... Date Added: 2009-01-09 15:24:17 |
| 13.Atmo.Circulation.pt2.web.f06.pdf Path: Arizona >> NATS >> 101 Fall, 2006 Description: Topic # 13 Atmospheric Circulation (continued) How the Energy Balance Drives It and How It Results in Global Climate Patterns p 77-83 in Class Notes The Earth [as viewed from space] . . . has the organized, selfcontained look of a live creature, fu... Date Added: 2009-02-04 13:48:06 |
| Ross11.pdf Path: SUNY Stony Brook >> AMS >> 311 Fall, 2008 Description: AMS 311, Spring Semester, 2004 Binomial Distribution B(n,p) Counts number of successes in n total trials. The trials are independent and homogeneous. Let X be a binomially distributed random variable for n trials and probability of success p. Probabi... Date Added: 2009-01-11 18:18:20 |
| nov 14 2007 Path: Carleton CA >> HIST >> 1000 Spring, 2008 Description: Nts get notes from Kristina (haloween) Nov 14 2007 - social democrats key to the Weimar republic. - Centre party the catholic party (one of a few) party that german catholics rallied to - Left communists, right the nazi\'s - Impossible to not rela... Date Added: 2008-05-17 11:06:31 |
| PS09.pdf Path: Arizona >> EEB >> 320 Fall, 2008 Description: Genetics 320, Problem Set 9 (10 points) Due Wes, 23 November at 11 am 1 (2 points): Consider a cross between an M2 M3 father and a M2 M4 mother. In the offspring, the marker genotype is scored, along with nose length and the following data are observ... Date Added: 2009-02-04 13:41:40 |
| Physics_7A_-_Fall_2002_-_Dalven_-_Final Path: Berkeley >> PHY >> 7A Spring, 2008 Description: ... Date Added: 2008-04-01 20:28:23 |
| 14example12.pdf Path: Rutgers >> PART >> 1 Fall, 2008 Description: ... Date Added: 2009-02-04 14:53:26 |
| 1BMC-710-Section-1.doc Path: Wisconsin >> AN SCI >> 710 Fall, 2008 Description: BMC710/Biochem875 ExploringBiochemicalFunctionsofMacromolecules Sessions1and2:Developingacriticalattitudetowardsstructuraldata derivedfromXraycrystallographicinvestigations. Therearetwosessions.Session1willbemostlydidacticwhereasSession2willbemore in... Date Added: 2009-02-03 14:23:43 |
| abstract-deals.pdf Path: UCLA >> ANDERSON >> 1962 Fall, 2008 Description: IS FACULTY RESEARCH & Publications Digital Deals: Strategies for Selecting and Structuring Partnerships GEORGE T. GEIS and GEORGE S. GEIS A B S T R A C T Digital Deals explains and analyzes the ... Date Added: 2009-02-11 22:00:01 |
| Lecture4 Path: Sonoma >> GEOG 203 >> 203 Spring, 2008 Description: Geodemography Cultural Geography: Week 3 The Human Mosaic Chapter 7 (pgs. 213-238) 1. Introduction: a. Definitions: Geo-demo-graphy: earth-people-writing. Studying the geographic distribution of people on the earth and the factors associated with the... Date Added: 2008-04-18 02:11:34 |
| honors.pdf Path: CSU Fresno >> GME >> 193 Fall, 2008 Description: Smittcamp Family Honors College What is an honors program? Simply put, it is a program of educational opportunity for outstanding students. It takes the form of specially structured academic offerings designed to engage students more comprehensively ... Date Added: 2009-01-11 22:10:18 |
| honors.pdf Path: CSU Fresno >> PLANT >> 194 Fall, 2008 Description: Smittcamp Family Honors College What is an honors program? Simply put, it is a program of educational opportunity for outstanding students. It takes the form of specially structured academic offerings designed to engage students more comprehensively ... Date Added: 2009-01-11 22:10:18 |
| cv_roney_7_06.pdf Path: UCF >> CRW >> 4224 Fall, 2008 Description: LISA C. RONEY 2005 Howard Drive Winter Park, FL 32789 407-647-7464 lcroney@pegasus.cc.ucf.edu FACULTY POSITIONS Assistant Professor (tenure-track), Department of English, University of Central Florida, Orlando, FL, since August 2003. Responsible ... Date Added: 2009-01-10 02:31:19 |
| cv_roney_7_06.pdf Path: UCF >> ENC >> 1101h Fall, 2008 Description: LISA C. RONEY 2005 Howard Drive Winter Park, FL 32789 407-647-7464 lcroney@pegasus.cc.ucf.edu FACULTY POSITIONS Assistant Professor (tenure-track), Department of English, University of Central Florida, Orlando, FL, since August 2003. Responsible ... Date Added: 2009-01-10 02:31:19 |
| cv_roney_7_06.pdf Path: UCF >> CRW >> 3211 Fall, 2008 Description: LISA C. RONEY 2005 Howard Drive Winter Park, FL 32789 407-647-7464 lcroney@pegasus.cc.ucf.edu FACULTY POSITIONS Assistant Professor (tenure-track), Department of English, University of Central Florida, Orlando, FL, since August 2003. Responsible ... Date Added: 2009-01-10 02:31:19 |
| pil4.pdf Path: Maryland >> ENTMCLASSE >> 4 Fall, 2008 Description: Check out the Pesticide Education and Assessment Program web site at http:/pesticide.umd.edu Pesticide Information Telephone Numbers Pesticide Information Leaflet No. 4 / < \" !5 !5 ( / ;11; 5 Pesticide users, consumers, and others have questions ab... Date Added: 2009-02-06 19:15:07 |
| SM 10 CS 2193.doc Path: Arkansas State >> CS >> 2193 Fall, 2008 Description: Revised 9/25/2006 Code # Bulletin Change Transmittal Form Undergraduate Curriculum Council - Print 1 copy for signatures and save 1 electronic copy. Graduate Council - 14 copies plus 1 original Bulletin Change Please attach a copy of all catalogue p... Date Added: 2009-02-02 21:19:08 |
| ADRA2B.faNeg.doc Path: UCSD >> ELCAPITAN >> 2 Fall, 2008 Description: >ref|NT_026970.9|Hs2_27130:c1460717-1450452 Homo sapiens chromosome 2 genomic contig AGCAGGGCAGGAGGTGCCTGGGGGAGTGCTGTCGAATCTGGAGGGGAGCCACACGTGTAGAGGAAGAGGA AGGATCCCCGGACTGAGCTGGGTTGCTGCATTTAGAGCAGCATTTCTTAATTTCAGCGTTGCAGCATTTT GTACCTGGTAATTCTTTATTGTG... Date Added: 2009-02-17 18:31:26 |
| Lab2 Path: Tennessee >> ECE >> 255 Spring, 2008 Description: Design of 4-bit Adder Using Schematic Capture Lab: Two Chavez_ Design of 4-bit Adder Using Schematic Capture Objectives: Design the circuit diagram for a 1-bit full adder using schematic editor and generate a graphical symbol. Using this new symbol... Date Added: 2008-09-18 00:53:08 |
| 040919singh.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Yahoo! News - Manmohan Singh to carry economic reforms message to U.S. News Home - Help Manmohan Singh to carry economic reforms message to U.S. Sun Sep 19, 6:40 AM ET NEW DELHI (Reuters) - The left-leaning Indian government will persist with econom... Date Added: 2009-02-11 19:12:03 |
| homework7.pdf Path: Ohio State >> STAT >> 528 Summer, 2008 Description: Stat 528 (Autumn 2008) Kaizar Homework 7 Due at the beginning of class, Wednesday, November 26. To receive credit please follow the instructions given in the syllabus. All numbered problems are from the course textbook. Aim of Homework: To consider ... Date Added: 2009-01-10 18:16:15 |
| gfmins5_3_05.pdf Path: Fairfield >> FACULTY >> 0405 Fall, 2008 Description: FAIRFIELD UNIVERSITY General Faculty Meeting May 3, 2005 Minutes of Meeting [Approved by the General Faculty on September 16, 2005] Proxies were held by: Robbin Crabtree for Meredith Wallace for Susan Rakowitz for Christopher Huntley for James Simon ... Date Added: 2009-02-11 17:02:51 |
| MH-16-pp-SN-WW-II-East-Med-Fronts-1942-44.ppt Path: Campbell >> H >> 310 Fall, 2009 Description: MH-16: Eastern Mediterranean Fronts Strategic Overview: Nazis running out of gas in Europe by 1942 Still Germany remains a very capable enemy Very strong on active defense as newly arrived US troops would learned Contin... Date Added: 2009-04-16 00:09:47 |
| ppt_04 Path: Cornell >> PHIL >> 1101 Spring, 2006 Description: The Problem of Evil February 1 2006 Evil and Contradictions Is the following set of beliefs contradictory? 1. God is all powerful and all knowing 2. God is wholly good 3. Evil exists It doesn\'t appear contradictory on its own, but maybe adding ext... Date Added: 2008-02-19 22:01:38 |
| GRC 18 Revised Course Proposal SP09.doc Path: Fresno City College >> GRC >> 18 Spring, 2008 Description: FRESNO CITY COLLEGE REVISED COURSE PROPOSAL Date: 1. 2. Term for implementation: Fall Summer TYPE OF REVISION (mark all that apply): $ Title $ Description $ Subject Name Course Number Prerequisite/Corequisite/Advisory Units Hours No. of Weeks $ Texts... Date Added: 2009-02-02 14:13:19 |
| LEAFSProgress-TrAC-1998.pdf Path: UConn >> CHEM >> 336 Spring, 2008 Description: 532 trends in analytical chemistry, vol. 17, nos. 8+9, 1998 [ 44 ] G.R. Long, S.E. Bialkowski, Anal. Chem. 56 ( 1984 ) 2806. [ 45 ] S.E. Bialkowski, G.R. Long, Anal. Chem. 59 ( 1987 ) 873. [ 46 ] X.R. Zu, J.M. Harris, J. Phys. Chem. 93 ( 1989 ) 75.... Date Added: 2009-01-10 18:11:10 |
| LEAFSProgress-TrAC-1998.pdf Path: UConn >> CHEM >> 340 Fall, 2008 Description: 532 trends in analytical chemistry, vol. 17, nos. 8+9, 1998 [ 44 ] G.R. Long, S.E. Bialkowski, Anal. Chem. 56 ( 1984 ) 2806. [ 45 ] S.E. Bialkowski, G.R. Long, Anal. Chem. 59 ( 1987 ) 873. [ 46 ] X.R. Zu, J.M. Harris, J. Phys. Chem. 93 ( 1989 ) 75.... Date Added: 2009-01-10 18:11:10 |
| 061202pipel.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Plan for South American Pipeline Has Ambitions Beyond Gas - New York Times December 2, 2006 Plan for South American Pipeline Has Ambitions Beyond Gas By JENS ERIK GOULD GIRIA, Venezuela President Hugo Chvez is not modest about his energy plan... Date Added: 2009-02-11 20:01:31 |
| 061202pipel.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Plan for South American Pipeline Has Ambitions Beyond Gas - New York Times December 2, 2006 Plan for South American Pipeline Has Ambitions Beyond Gas By JENS ERIK GOULD GIRIA, Venezuela President Hugo Chvez is not modest about his energy plan... Date Added: 2009-02-11 20:11:43 |
| 01invGuid.pdf Path: Chester >> ECO >> 343 Fall, 2008 Description: Investment Guide for Southeast Europe Croatia I. Country information Croatia borders four countries - Bosnia and Herzegovina to the South, Slovenia to the North, Hungary to the Northeast, and Yugoslavia to the Southeast. There are three distinct reg... Date Added: 2009-02-11 19:03:54 |
| 19_GeneticsFinalized Path: San Diego State >> BIOL >> 100 Winter, 2007 Description: Genetics Genetics has a pronounced effect on all aspects of our biology. The advancements in this area have produced new approaches towards understanding normal and diseased states in all living tissue. Genetics Genetics: the molecular basis of wh... Date Added: 2008-04-21 20:08:59 |
| Chapter 23 Path: UMBC >> BIOL >> 100 Fall, 2007 Description: Please, Turn Your Cell Phones OFF Now. Thanks! Things to keep in mind. Cell Phone Policy Laptop Policy Name Signs Drop with a W deadline today Study Questions posted under Course DocumentsHandouts, Notes, Study Questions, etc. Chapter 43 Wh... Date Added: 2008-04-07 13:25:40 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 3400 Spring, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:23 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2135 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2003 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E63 >> 2140 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:23 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2138 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2006 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E63 >> 2300 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:23 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2139 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2085 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 1995 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-02-02 15:00:54 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 1085 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2145 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2086 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 1086 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2300 Spring, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2132 Fall, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| E10.1995.Fa05.pdf Path: NYU >> E10 >> 2002 Spring, 2008 Description: E10.1995 INTRODUCTION TO BIOSTATISTICS FALL 2005 Professor: Phone: E-Mail: Office Hours: Office: Class Hours: Text: Robert Norman, Ph.D. Leave message at 995-4700 (Mailbox 90851) robert.norman@nyu.edu (best method of contact) By Appointment Kimball... Date Added: 2009-01-09 04:31:22 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 150l Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 449 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 110h Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 213 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 593 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:48:32 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 140 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 410l Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 493j Spring, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-11 17:00:31 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 200h Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 491 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 120 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 213l Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 493b Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-11 17:00:30 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 150 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 443l Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 493n Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-11 17:00:31 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 101h Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 210h Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 493m Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:48:32 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 121 Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:46:59 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 300l Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-09 04:47:00 |
| Zhang_AE_part3.supplementary.528CMAQHS.pdf Path: N.C. State >> MEA >> 493e Fall, 2008 Description: * Supplementary Data to be published Online for the paper entitled: A Comprehensive Performance Evaluation of MM5-CMAQ For the Summer 1999 Southern Oxidants Study Episode, Part III. Diagnostic and Mechanistic Evaluations Yang Zhang* and Ping Liu, N... Date Added: 2009-01-11 17:00:31 |
| 04_CV_Membrane_Potentials Path: UCSB >> MCDB >> 101 Spring, 2008 Description: Which cell have resting potentials? All cells Ionic Basis of Resting Potential Cl-) leak channels and have a negative resting potential Most c... Date Added: 2008-04-07 12:14:37 |
| 01SurveyMD.pdf Path: USC >> CS >> 653 Fall, 2008 Description: Molecular Dynamics I: Principles Basics of the molecular-dynamics (MD) method1-3 are described, along with corresponding data structures in program, md.c. Newtons Second Law of Motion TRAJECTORY, COORDINATE, AND ACCELERATION Physical system = a set... Date Added: 2009-02-18 01:55:38 |
| Chapter 7 Vocabulary Path: UT Dallas >> GOVT >> 2301 Fall, 2007 Description: Chapter 7 Vocabulary Equal time rule- the requirement that broadcasters provide candidates for the same political office equal opportunities to communicate their messages to the public Right of rebuttal- a Federal Communications Commission (FCC) regu... Date Added: 2008-04-30 10:40:04 |
| Chapter 4 Path: University of Dayton >> SOC >> 101 Spring, 2008 Description: Biology Chapter 4 Biology is the scientific study of life. Biology examines the structure, function, growth, origin, evolution, and distribution of living things. It classifies and describes organisms, their functions, how species come into existence... Date Added: 2008-04-18 06:32:06 |
| hw3s Path: Penn State >> ECON >> 333 Fall, 2008 Description: ECON333 ECON 333 SPRING 2008 Assignment 2 Answer Key Assignment 2 Prepared by Lu Pan 1. The World Trade Organization. (Use the WTO web-page to answer the questions below: http:/www.wto.org/) (15 points) ANSWER: a) How many members does the WTO h... Date Added: 2008-09-22 10:26:45 |
| Solution Midterm 3.pdf Path: UCF >> EEL >> 3470 Fall, 2008 Description: ... Date Added: 2009-01-11 22:01:00 |
| 04-EnergyBalance Path: UCSB >> ESM >> 236 Spring, 2008 Description: 3/25/2008 Components of the energy balance ESM 236: The Mountain Snowpack Energy and Mass Balance of the Snowpack Net radiation: solar and thermal infrared Sensible: H = a C p K h (T - Ta ) RN = S (1 - ) + F - T 4 (T in K) Latent: L = a ( v ... Date Added: 2008-08-06 12:33:24 |
| hw2-soln.pdf Path: Rutgers >> 198 >> 516 Fall, 2008 Description: R cR hR R RTR hR R S k ia hghaTV 5 w 5 w isYvt ` isYvt ` p 5 w isYvt ` isYvt ` w isYvt ` 0v U R g kdcE m g i Y r pcpg m ii vhvg r pcpg m as i {rvXiTV r pcpg m Td r pcpg m i r pcpg i m Td i pcpg m Tdr i as pcpg {rvX5irV m Td... Date Added: 2009-01-09 06:56:39 |
| Problem set 4 questions Path: Binghamton >> BIOL >> 311 Spring, 2009 Description: CELL BIOLOGY PROBLEM SET 4 1. What are the similarities and differences between a cell strain and a cell line? What are the pros and cons of these two types of cell cultures? Cell Strain o Usually best option o Human cells but maybe Animal (no FDA... Date Added: 2009-04-13 19:21:56 |
| detlef1.ps Path: Rutgers >> CS >> 538 Fall, 2000 Description: Notes for CS538 Lecture on 2/1/00 Detlef Ronneburger June 8, 2000 Nondeterministic Time Hierarchy Theorem As mentioned in the previous lecture it is not possible to use a straight forward diagonalization to separate nondeterministic time classes fo... Date Added: 2009-02-11 20:54:57 |
| ps5macro2sp06 Path: Texas >> ECON >> 387 Spring, 2008 Description: Econ 387L: Macro II Spring 2006, University of Texas Instructor: Dean Corbae Problem Set #5- Due 2/21/06 This problem set introduces you to estimating a subset of the deep parameters of the structural model via the simulated method of moments. The si... Date Added: 2008-08-06 09:57:22 |
| ps5macro2sp06 Path: Texas >> ECON >> 387 Spring, 2008 Description: Econ 387L: Macro II Spring 2006, University of Texas Instructor: Dean Corbae Problem Set #5- Due 2/21/06 This problem set introduces you to estimating a subset of the deep parameters of the structural model via the simulated method of moments. The si... Date Added: 2008-08-06 09:57:22 |
| PurimLiminality.pdf Path: NYU >> HEBREWJUDA >> 2597 Fall, 2008 Description: Purim, Liminality, and Communitas Author(s): Jeffrey Rubenstein Source: AJS Review, Vol. 17, No. 2, (Autumn, 1992), pp. 247-277 Published by: Cambridge University Press on behalf of the Association for Jewish Studies Stable URL: http:/www.jstor.org/s... Date Added: 2009-02-06 19:43:06 |
| 050114forc.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Economist.com | Country Briefings: Norway Forecast Jan 14th 2005 From the Economist Intelligence Unit Source: Country Forecast Country Forecast Norway Sub price: US $970.00 Single issue: US $525.00 Five-year political, policy and economic forecast f... Date Added: 2009-02-11 20:22:54 |
| 4764.pdf Path: USF >> USFWEB >> 2 Fall, 2009 Description: USF Job Class Description JOB CODE: 4764 JOB TITLE: Alumni Program Specialist PAY PLAN: 23 CAREER BAND: C FLSA: Non-exempt CBU: 31 Effective 03/28/2006 Job Title: Alumni Program Specialist Job Summary This position provides administrative support ... Date Added: 2009-04-16 00:45:49 |
| 050929probe.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Czech premier agrees to Unipetrol privatisation probe - Forbes.com Investment Newsletters Investment Newsletters Polls Discussions Premium Tools Premium Tools Special Reports Special Reports Video Audio Commerce ... Date Added: 2009-02-11 19:13:20 |
| RosterForm.pdf Path: Mississippi State >> MAGNOLIA >> 2009 Fall, 2009 Description: ACIS BASKETBALL REGIONAL CHAMPIONSHIPS March 6 March 8, 2009 Mississippi State University ENTRY FORM Team Name: _ Divisions (Circle): MENS WOMENS Institution: __ Team Captain _ Phone: _ Address _ Email: _ OFFICIAL TEAM ROSTER Credit Hours Enrolled ... Date Added: 2009-04-15 21:31:01 |
| E93-1065.pdf Path: UPenn >> E >> 93 Fall, 2009 Description: INSYST: An Automatic Inserter System for Hierarchical Lexica M a r c Light Sabine Reinhard Marie Boyle-Hinrichs Universit~t Tubingen, Seminar ftir Sprachwissenschaft Kleine Wilhelmstr. 113, D-7400 Ttibingen {light, reinhard,meb }@arbuclde.sns.neuphil... Date Added: 2009-04-15 21:11:17 |
| acknowledge.pdf Path: Virginia Tech >> LIB >> 102098 Fall, 2008 Description: ACKNOWLEDGEMENTS This dissertation begins a life-long journey. Initially, I thank Professor Richard Burian and Professor Gary Downey for allowing STS to grow and prosper at Virginia Tech. To the members of my committee I thank: Professor Burt Moyer ... Date Added: 2009-02-18 00:51:12 |
| Assignment 5.pdf Path: Wisc Eau Claire >> CHEM >> 103 Fall, 2008 Description: Chemistry 103 MULTIPLE CHOICE QUESTIONS Assignment No. 5 Ionic Compounds Select the one best answer for each question. Summer 2008 A. Which of the following statements is true? (1) (2) (3) (4) Group 15 atoms tend to gain three electrons to form 3 ... Date Added: 2009-02-06 20:20:20 |
| br96.pdf Path: UC Davis >> BR >> 96 Fall, 2008 Description: Appears in Advances in Cryptology Eurocrypt 96 Proceedings, Lecture Notes in Computer Science Vol. 1070, U. Maurer ed., Springer-Verlag, 1996. The Exact Security of Digital Signatures How to Sign with RSA and Rabin Mihir Bellare Phillip Rogawayy Ma... Date Added: 2009-02-06 18:07:46 |
| 551.pdf Path: University of Illinois, Urbana Champaign >> STAT >> 551 Fall, 2008 Description: Course Schedule - Spring 2005 Statistics 551 Theory of Probability I Credit: 4 hours. (STAT 451) Same as MATH 561. See MATH 561. CRN 38175 Type lecturediscussion Section G1 Time 03:00 PM - 03:50 PM Days MWF Location room 347 Altgeld Hall Instr... Date Added: 2009-02-02 18:45:51 |
| 61-65. Charged Conductor Problem Path: Rhode Island >> PHYS >> 204 Spring, 2008 Description: Charged Conductor Problem (1) Consider a metal cube with a charge 2C on it positioned inside a cubic metal shell with a charge -1C on it. Find the charge Qint on the interior surface and the charge Qext on the exterior surface of the shell. -1C 2C... Date Added: 2008-04-30 10:31:20 |
| 0FinancialAid.pdf Path: Syracuse >> LAW >> 820 Fall, 2008 Description: Financial Aid Application Instructions The financial aid application is a separate procedure that should be undertaken simultaneously with the admissions application process. Do not wait for an admission decision to apply for financial aid. The Prio... Date Added: 2009-01-10 01:02:08 |
| 0FinancialAid.pdf Path: Syracuse >> NEW >> 630 Summer, 2008 Description: Financial Aid Application Instructions The financial aid application is a separate procedure that should be undertaken simultaneously with the admissions application process. Do not wait for an admission decision to apply for financial aid. The Prio... Date Added: 2009-01-10 01:02:25 |
| 0FinancialAid.pdf Path: Syracuse >> PHI >> 594 Spring, 2008 Description: Financial Aid Application Instructions The financial aid application is a separate procedure that should be undertaken simultaneously with the admissions application process. Do not wait for an admission decision to apply for financial aid. The Prio... Date Added: 2009-01-11 21:07:20 |
| Slides-32.pdf Path: Arizona >> A ME >> 520 Fall, 2008 Description: CSc 520 Principles of Programming Languages 32 : Control Structures Coroutines Christian Collberg collberg+520@gmail.com Department of Computer Science University of Arizona Copyright c 2008 Christian Collberg 520 Spring 2008 32 [1] Coroutines... Date Added: 2009-02-02 16:24:50 |
| chapter_7.pdf Path: Dallas >> EE >> 6325 Fall, 2008 Description: Chapter 7 Performing Transient Analysis Star-Hspice transient analysis computes the circuit solution as a function of time over a time range specified in the .TRAN statement. This chapter covers the following topics: s Understanding the Simulation Fl... Date Added: 2009-02-18 02:22:11 |
| hw07 Path: N.C. State >> MAE >> 310 Fall, 2006 Description: NCSU MAE310 HOMEWORK #7 Provide a clear concise solution for each of the following conductive heat transfer problem using finite difference methods. One end of a stainless steel (AISI 316) rod of diameter 10 mm and length 0.16 m is inserted into a... Date Added: 2008-08-01 16:43:31 |
| ch. 3 Path: Grand Valley State >> CHM >> 231 Winter, 2008 Description: Chapter 3: An Introduction to Organic Compounds Functional groups Nomenclature Physical properties Functional Groups Organizational tools >25 million known compounds with unique properties Similar structure leads to similar properties 15-20 functio... Date Added: 2008-04-07 16:50:00 |
| 202L24.pdf Path: Delaware >> PHYS >> 202 Fall, 2008 Description: classic experiment showing a current in a coil when a magnet is moved into and out of a coil. LENZS LAW The induced emf resulting from a changing magnetic flux has a polarity that leads to an induced current whose direction is such that the induced m... Date Added: 2009-01-12 06:13:19 |
| 24512-turilli.pdf Path: Illinois State >> SED >> 24512 Fall, 2008 Description: 1 Illinois State University Department of Special Education 591 SED 245.12Section 1-Fall 2007 4 Semester Hours Laurie Turilli Office: DeGarmo 544 Phone: Office: 438-2456 Home: 662-4121 E-Mail: lkturilli@yahoo.com Office hours: Mon. & Wed. 11:00-12:... Date Added: 2009-02-02 14:29:42 |
| McClendonNeedsAssessment.xls Path: UGA >> ARCHES >> 6259 Fall, 2008 Description: \"Acceptable\" AASL Competencies Relevant to This Course EDIT 6259, Summer 2006 Name: Competency Confidence Level: 1-5 What I know now What I need to know Access to information: Candidates identify barriers to equitable access to resources and servic... Date Added: 2009-02-18 13:53:00 |
| Utton Center Project references updated September 2005-Converted Annotated Style.pdf Path: New Mexico >> CE >> 372 Fall, 2008 Description: Interstate Water Compacts: A Bibliography, by George William Sherk, D.Sc., J.D., September, 2005 (1921). Brief of Law of Interstate Compacts, Submitted by Delph E. Carpenter to the Judiciary Committee, U.S. House of Representatives, 67th Congress, 1... Date Added: 2009-02-02 19:53:47 |
| 11Arev8new.pdf Path: UCSC >> AMS >> 11a Fall, 2008 Description: UCSC ECON/AMS 11A Review Questions 8 Applied Optimization Comment: In every problem that you claim to nd the absolute minimum or maximum value of the function in question, you must justify this claim. 1. Farmer Jones wants to build a 4800 square f... Date Added: 2009-02-02 17:41:51 |
| lecture10_fp_2.pdf Path: George Mason >> ECE >> 699 Fall, 2008 Description: Lecture 10 Floating-point representations Methods of representing real numbers (1) 1. Fixed-point number system 100101010 1111010 limited range and/or limited precision results must be scaled 100101010.1111010 2. Rational number system difficul... Date Added: 2009-04-16 01:19:50 |
| crsc-tr01-26.pdf Path: N.C. State >> CRSC >> 01 Fall, 2008 Description: ... Date Added: 2009-02-04 14:42:49 |
| carillon.pdf Path: South Plains College >> HUDV >> 1100 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> GOVT >> 2301 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> HUMA >> 2319 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> GOVT >> 2302 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> PSYC >> 2319 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> VNSG >> 1122 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> RSPT >> 1429 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> HITT >> 1305 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> SOCI >> 2320 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| carillon.pdf Path: South Plains College >> SPCH >> 1321 Fall, 2008 Description: Revised 2/06 South Plains College - Reese Vocational Nursing Program Carillon Location: 1717 Norfolk Phone number: Main number 281-6000 Call the assigned floor if you are going to be absent. 1 North 281-6120 1 South 281-6126 2 North 281-6212 2 South... Date Added: 2009-01-09 07:14:45 |
| ICCMinutes10-5-07.doc Path: Las Positas College >> ART >> 5 Fall, 2008 Description: THE INTER-CLUB COUNCIL OF LAS POSITAS COLLEGE ICC MEETING MINUTES FRIDAY, OCTOBER 5, 2007 LAS POSITAS COLLEGE 3000 CAMPUS HILL DRIVE LIVERMORE, CA 94551 I. II. III. IV. V. VI. VII. VIII. IX. Call to Orderpage 2 Roll Callpage 2 Adoption of the Agenda.... Date Added: 2009-02-02 14:43:40 |
| openceremonies.pdf Path: Texas A&M >> PERF >> 327 Fall, 2008 Description: Official FFA Ceremonies - Opening Ceremony Official FFA ceremonies are a source of pride, identity and tradition among FFA members and chapters. Ceremonies emphasize the purpose of meetings, the duties of officers and the significance of recognition... Date Added: 2009-02-03 13:25:05 |
| openceremonies.pdf Path: N.C. State >> AEE >> 303 Fall, 2008 Description: Official FFA Ceremonies - Opening Ceremony Official FFA ceremonies are a source of pride, identity and tradition among FFA members and chapters. Ceremonies emphasize the purpose of meetings, the duties of officers and the significance of recognition... Date Added: 2009-01-10 17:17:26 |
| openceremonies.pdf Path: N.C. State >> AEE >> 503 Fall, 2008 Description: Official FFA Ceremonies - Opening Ceremony Official FFA ceremonies are a source of pride, identity and tradition among FFA members and chapters. Ceremonies emphasize the purpose of meetings, the duties of officers and the significance of recognition... Date Added: 2009-01-10 17:17:26 |
| Chapter 6 Power Point Path: ASU >> CIS >> 105 Fall, 2007 Description: System Unit System Board Microprocessor Memory System Clock Expansion Slots/Cards Bus Lines Ports and Power Supply System Unit System unit (system cabinet or chassis) contains electronic components. Four basic types are: Desktop Notebook Tablet PC H... Date Added: 2008-04-03 10:04:44 |
| upper.pdf Path: ASU >> PT >> 3 Fall, 2009 Description: Unit of Practice (UOP) UOP Title: Research Around the World Author: Teena Lugo-Flesher and Lisa Flanagan (ASUW Student) School/District: DVUSD Time Frame: at least 50-55 minutes a day, 4-5 days a week, allow 2-4 weeks for completion Subject: _ Any Su... Date Added: 2009-04-15 21:54:39 |
| BSN_DNP_FNP_Handout_2008.pdf Path: Arizona >> NURSING >> 2008 Fall, 2008 Description: DOCTOR OF NURSING PRACTICE BSN-DNP FAMILY NURSE PRACTITIONER NURS 922 Practice Inquiry (9 credits) Minor (9 credits) General Information At the University of Arizona, you can earn a Doctor of Nursing Practice (DNP) degree that includes preparation a... Date Added: 2009-02-04 13:45:48 |
| AptApp.xls Path: N. Georgia >> MGMT >> 4668 Fall, 2008 Description: Code 229 94 43 79 134 179 87 120 246 25 15 131 172 95 121 77 60 174 84 31 19 74 57 104 24 Price 90300 384000 157500 676200 165000 300000 108750 276538 420000 950000 560000 268000 290000 173200 323650 162500 353500 134400 187000 155700 93600 110000 5... Date Added: 2009-01-09 05:24:34 |
| AptApp.xls Path: N. Georgia >> MGMT >> 4655 Summer, 2008 Description: Code 229 94 43 79 134 179 87 120 246 25 15 131 172 95 121 77 60 174 84 31 19 74 57 104 24 Price 90300 384000 157500 676200 165000 300000 108750 276538 420000 950000 560000 268000 290000 173200 323650 162500 353500 134400 187000 155700 93600 110000 5... Date Added: 2009-01-09 20:32:25 |
| AptApp.xls Path: N. Georgia >> BUSA >> 3120 Spring, 2008 Description: Code 229 94 43 79 134 179 87 120 246 25 15 131 172 95 121 77 60 174 84 31 19 74 57 104 24 Price 90300 384000 157500 676200 165000 300000 108750 276538 420000 950000 560000 268000 290000 173200 323650 162500 353500 134400 187000 155700 93600 110000 5... Date Added: 2009-01-11 20:46:46 |
| AptApp.xls Path: N. Georgia >> MGMT >> 3699 Fall, 2008 Description: Code 229 94 43 79 134 179 87 120 246 25 15 131 172 95 121 77 60 174 84 31 19 74 57 104 24 Price 90300 384000 157500 676200 165000 300000 108750 276538 420000 950000 560000 268000 290000 173200 323650 162500 353500 134400 187000 155700 93600 110000 5... Date Added: 2009-01-09 05:23:46 |
| 040517economy.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Budapest Business Journal - Article Last updated: 21st May 2004, 7:54 Banking Telecom Exchanges Real Estate Retail ... Date Added: 2009-02-11 20:03:34 |
| CMGT265 - Mechanical Tour Assignment Path: C. Washington >> CMGT >> 265 Fall, 2007 Description: October 27, 2007 CMGT 265 \"Mechanical construction means the installation, replacement, or repair of plumbing, heating, air conditioning, process piping, refrigeration, lighting protection equipment, or electrical components, fixtures or devices of a... Date Added: 2008-04-11 23:09:37 |
| hw3sol.pdf Path: SUNY Stony Brook >> ESE >> 503 Fall, 2008 Description: | | 3 j b l | bW wj | l l bW %uh wj f j l ! Gff fry % e l l j yf%i v TUvx f g v GCi jy2 f y Uv)x yE d@%l %x!Ux U j y v tsq 2xwu#rp ! ~ CP P #us}... Date Added: 2009-01-11 18:20:13 |
| kahn_ruse_in_toyland Path: Dickinson >> POLYSCI >> 255 Spring, 2008 Description: ... Date Added: 2008-04-09 17:40:30 |
| Soln08042 Path: Toledo >> CIVE >> 1150 Spring, 2008 Description: COSMOS: Complete Online Solutions Manual Organization System Chapter 8, Solution 42. FBD pulley: Note that SA = tan -1 SA = tan -1 ( 0.5 ) = 26.565 < 30, Cable is needed to keep A from sliding downward. Fy = 0: 2T - WB = 0, T = WB , 2 WB = 2T ... Date Added: 2008-05-14 16:46:36 |
| Lec12.pdf Path: Delaware >> PHYS >> 133 Fall, 2008 Description: Written HW#3 correction do 4-60 instead of 4-58 if already did 4-58, can turn in today otherwise, corrected HW#3 now due Wed. Mid-Term #1 coming up in 2 weeks. Wed. Oct. 15 I will be away Mon. 15 Key equations: speed; Kep... Date Added: 2009-01-10 03:34:58 |
| 3_Mendelian.Genetics.doc Path: MSCD >> BIO >> 3600 Fall, 2008 Description: Mendelian Genetics: Patterns of Inheritance BIO 3600 Genetics Dr G Cornwall A Bit on Gregor Mendel Born to a poor farming family in what is now part of Czech Republic Attended Augustinian monastery (1843) Became an excellent teacher Further study at... Date Added: 2009-01-09 02:50:35 |
| 040924EU.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Running Out of Reasons to Say \"No\" to Turkey Economy Environment Gender Globalization Health Labor Politics Science Terrorism Society & Culture Trade Global Africa Americas Asia-Pacific Central Asia Europe Middle East South ... Date Added: 2009-02-11 19:40:57 |
| Lecture12.txt Path: NMSU >> ASTR >> 110 Fall, 2008 Description: Lecture: Interstellar Medium (ISM) and Stellar Birth Chapter 10 THE INTERSTELLAR MEDIUM Section 10-1 - Read pp 218-222 (stop at \"Interstellar Absorption Lines\") - Read p 223 (\"Clouds and What\'s in Between\") - Study Figures 10-1, 10-2, 10-5 - Study pp... Date Added: 2009-02-11 16:19:44 |
| introduction.pdf Path: Utah State >> ENGL >> 4420 Spring, 2008 Description: Cognitive Psychology What happens when people think? Memory and cognition Thinking about Thinking Be aware of the thoughts that pass through your mind as you consider these questions. How many hands did Aristotle have? What is 723 divided by 6... Date Added: 2009-02-02 20:48:28 |
| mobile-refs.pdf Path: Cornell >> VIVO >> 23967 Fall, 2008 Description: h )2) p3Wy10)(\' d1pPU{v%999W#{v{!dvUP)uWW\"1v91pPU{v99d\" vY9Dwu{Ud{v{D1 1\"9D{RP9Y{vd9d{19R{v1d9uudD{Uv 9{hus{R9{W9\'1h{1{Rdy9vu9{R)9{u{\"{v{19W ... Date Added: 2009-02-17 22:09:30 |
| midterm_review_StudyGuide Path: Cornell >> AEM >> 3200 Fall, 2007 Description: AEM 320; NBA 560 Business Law I Fall, 2006 Midterm Review Questions Torts Review Problems 1. Paul owns a dirt bike, a type of motorcycle designed to be ridden on trails and in fields. He has been riding dirt bikes with his friends for years just for ... Date Added: 2009-02-20 00:51:03 |
| ch12 Path: UOIT >> ENGR >> 3350 Spring, 2008 Description: T W E L V E Design via State Space SOLUTION TO CASE STUDY CHALLENGE Antenna Control: Design of Controller and Observer a. We first draw the signal-flow diagram of the plant using the physical variables of the system as state variables. Writing the ... Date Added: 2008-10-01 17:54:45 |
| ch12 Path: Michigan State University >> MECH >> COntrol Sy Spring, 2008 Description: T W E L V E Design via State Space SOLUTION TO CASE STUDY CHALLENGE Antenna Control: Design of Controller and Observer a. We first draw the signal-flow diagram of the plant using the physical variables of the system as state variables. Writing the ... Date Added: 2008-04-04 07:34:51 |
| ch12 Path: Drexel >> MEM >> 255 Summer, 2008 Description: T W E L V E Design via State Space SOLUTION TO CASE STUDY CHALLENGE Antenna Control: Design of Controller and Observer a. We first draw the signal-flow diagram of the plant using the physical variables of the system as state variables. Writing the ... Date Added: 2008-06-29 09:05:36 |
| mt1comments Path: Berkeley >> MATH >> 105 Spring, 2004 Description: Mathematics 105, Spring 2004 - Midterm Exam #1 Comments (1b) Give an example of a function f : R3 R1 such that f is not differentiable at a = (0, 0, 0), but all partial derivatives Di f (a) do exist. Comment: A common answer was f (x, y, z) = xyz/ x... Date Added: 2008-05-07 10:40:05 |
| mt1comments.pdf Path: Berkeley >> MATH >> 105 Fall, 2008 Description: Mathematics 105, Spring 2004 - Midterm Exam #1 Comments (1b) Give an example of a function f : R3 R1 such that f is not differentiable at a = (0, 0, 0), but all partial derivatives Di f (a) do exist. Comment: A common answer was f (x, y, z) = xyz/ x... Date Added: 2009-01-10 01:22:47 |
| MathSched.pdf Path: Spokane Falls Community College >> PHOTO >> 102 Fall, 2008 Description: MATH - Tutoring Schedule A.M. [Bldg 24, Rm 329] P.M. Fall Quarter 2008 Time 7:00 7:30 8:00 8:30 MON TUE WED THU FRI 90 - 99, 108 90 - 99, 108 90 - 99, 108 90 - 99 90 - 99 9:00 9:30 10:00 10:30 11:00 11:30 12:00 12:30 1:00 1:30 2:00 2:30 3:00 3:3... Date Added: 2009-01-11 19:44:55 |
| MathSched.pdf Path: Spokane Falls Community College >> FRNCH >> 203 Spring, 2008 Description: MATH - Tutoring Schedule A.M. [Bldg 24, Rm 329] P.M. Fall Quarter 2008 Time 7:00 7:30 8:00 8:30 MON TUE WED THU FRI 90 - 99, 108 90 - 99, 108 90 - 99, 108 90 - 99 90 - 99 9:00 9:30 10:00 10:30 11:00 11:30 12:00 12:30 1:00 1:30 2:00 2:30 3:00 3:3... Date Added: 2009-01-11 19:44:55 |
| 15_SharedMemoryArch.pdf Path: Denison >> CS >> 400 Fall, 2009 Description: Shared Memory Multiprocessors Thomas C. Bressoud CS 400 Topics The Cache Coherence Problem Snoopy Coherence Protocols The Cache Coherence Problem P1 u=? $ u:5 4 $ P2 u=? 5 $ u:5 P3 u=7 3 1 u:5 Memory 2 I/O devices 2 CS 400 F04 A Coherent Memo... Date Added: 2009-04-15 22:16:39 |
| Solution7_2Up.pdf Path: Wisconsin Milwaukee >> EE >> 701 Fall, 2009 Description: EE/ME 701: Advanced Linear Systems Luke has a large correction in an email Solution 7 EE/ME 701: Advanced Linear Systems Solution 7 1 SVD Expansion Equation (8) of the lecture notes asserts that A = U V T = i=1ui i vT i where p = min (n, m) is th... Date Added: 2009-04-16 00:54:16 |
| fal08_6210.pdf Path: Minnesota >> SPH >> 08 Fall, 2008 Description: PubH 6210 Public Health Medicine Seminar Course Syllabus Fall Semester 2008 Credits: Meeting Time: Meeting Place: Instructor: Office Address: MMC 197 420 Delaware St. SE Minneapolis, MN 55455 Office Phone: Fax: E-mail: Office Hours: 612-626-0605 612-... Date Added: 2009-02-17 20:32:11 |
| FM02-006.pdf Path: Caltech >> PH >> 006 Winter, 2008 Description: THE DEVELOPMENT OF A PULSE DETONATION ENGINE SIMULATOR FACILITY S.I. Jackson and J.E. Shepherd Graduate Aeronautical Laboratories, California Institute of Technology, Pasadena, CA 91125 GALCIT Report FM 2002.006 This work was carried out under P.O.... Date Added: 2009-02-02 13:45:25 |
| CE4620 Handout Incipient Motion.pdf Path: Mich Tech >> CE >> 4620 Fall, 2008 Description: ... Date Added: 2009-01-11 20:43:39 |
| l10 Path: Purdue >> STAT >> 350 Fall, 2008 Description: STAT 350 Fall 2008 DUE: Friday, December 12th @ 4:30 p.m. Lab #10 Solution For her senior thesis, an undergraduate in biology wanted to study the effect of crowding (population density) on fecundity (egg production) using Tribolium (flour) beetles... Date Added: 2009-02-23 04:44:15 |
| Reverse%20Engineering Path: UIllinois >> GE >> 101 Fall, 2008 Description: Reverse Engineering GE101 Engineering Graphics and Design Zen and the Art of Motorcycle Maintenance . . . just stare at the machine. There is nothing wrong with that, Just live with it for a while. Watch it the way you watch a line when fishing and ... Date Added: 2009-03-02 22:37:49 |
| G41.1060Spring08.pdf Path: NYU >> ENGLISH >> 5881 Fall, 2008 Description: G41.1060 Introductory Old English Spring 2008 Instructor: Hal Momma Class hours: Monday, 3:30-5:30 p.m. Office: 13 University Place, Room 221; (212) 998-8813; hal.momma@nyu.edu Required Text: t.b.a. Description: This course is designed for students ... Date Added: 2009-02-06 19:50:10 |
| tips_3.pdf Path: SFASU >> BIO >> 571 Spring, 2008 Description: LAUNCHING YOUNG READERS TIPSFirst Graders for parents of Give your child lots of opportunities to read aloud. Inspire your young reader to practice every day! The tips below offer some fun ways you can help your child become a happy and confident re... Date Added: 2009-01-09 07:19:33 |
| tips_3.pdf Path: SFASU >> ELE >> 578 Summer, 2008 Description: LAUNCHING YOUNG READERS TIPSFirst Graders for parents of Give your child lots of opportunities to read aloud. Inspire your young reader to practice every day! The tips below offer some fun ways you can help your child become a happy and confident re... Date Added: 2009-01-09 07:19:33 |
| tips_3.pdf Path: SFASU >> SED >> 578 Summer, 2008 Description: LAUNCHING YOUNG READERS TIPSFirst Graders for parents of Give your child lots of opportunities to read aloud. Inspire your young reader to practice every day! The tips below offer some fun ways you can help your child become a happy and confident re... Date Added: 2009-01-09 07:19:33 |
| tips_3.pdf Path: SFASU >> BIO >> 512 Fall, 2008 Description: LAUNCHING YOUNG READERS TIPSFirst Graders for parents of Give your child lots of opportunities to read aloud. Inspire your young reader to practice every day! The tips below offer some fun ways you can help your child become a happy and confident re... Date Added: 2009-01-09 07:19:33 |
| psalm23.ppt Path: Allegheny >> CS >> 23 Fall, 2008 Description: A Different Look at Psalm 23 This an eye opener; probably we never thought nor looked at this Psalm in this way, even though we say it over and over again. The Lord is my Shepherd That\'s Relationship! I shall not want That\'s Supply! He maketh me ... Date Added: 2009-02-06 20:19:16 |
| 125.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 125 Fall, 2008 Description: Course Schedule - Summer 2005 Mathematics 125 Elementary Linear Algebra Credit: 3 hours. (MATH 125) Basic concepts and techniques of linear algebra; includes systems of linear equations, matrices, determinants, vectors in n-space, and eigenvectors, t... Date Added: 2009-02-02 18:15:10 |
| Callaham et al SBB 2003.pdf Path: Kansas State >> BIOL >> 698 Fall, 2008 Description: Soil Biology & Biochemistry 35 (2003) 10791093 www.elsevier.com/locate/soilbio Macroinvertebrates in North American tallgrass prairie soils: effects of re, mowing, and fertilization on density and biomass M.A. Callaham Jr.a,*, J.M. Blaira, T.C. Todd... Date Added: 2009-01-09 08:05:22 |
| 031024trichet.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: WSJ.com - Trichet Favors Free Markets October 24, 2003 EUROPEAN BUSINESS NEWS Trichet Favors Free Markets New ECB Chief Sees Bank\'s Goal As Fighting Inflation By PIERRE BRIANCON DOW JONES NEWSWIRES PARIS - Jean-Claude Trichet would have preferred not... Date Added: 2009-02-11 17:24:11 |
| book8_2.pdf Path: Rutgers >> 198 >> 507 Fall, 2008 Description: 196 CHAPTER 7. PERTURBATION THEORY Fi for which [Fi , Fj ] = 0, and the Fi are independent, so the dFi are linearly independent at each point M. We will assume the rst of these is the Hamiltonian. As each of the Fi is a conserved quantity, the mo... Date Added: 2009-02-02 15:53:34 |
| WPR III Solutions Path: West Point >> CH >> 383 Fall, 2008 Description: CADET _ _ _ _ _ _SECTIONIHR TIME OF DEPARTURE _ DEPARTMENT OF CHEMISTRY & LIFE SCIENCE CH383, AY 08-1 WPR III, AlC Hour 20 November 2007 McMurry, Organic Chemistry, Chapters 7-9, Experiment 5 120 minutes t h ed. INSTRUCTIONS 1. Do not mark on... Date Added: 2008-04-15 17:47:17 |
| References Path: Colorado State >> HDFS >> 217 302 32 Spring, 2008 Description: The Roles of Play1 References Broadhead, P. (2006). Developing an understanding of young children\'s learning through play: The place of observation, interaction and reflection. British educational research journal, 32, 191-207. Carrick, N., Quas, J.... Date Added: 2008-04-20 20:55:22 |
| basics-R.pdf Path: Wisconsin >> STAT >> 571 Fall, 2008 Description: R Help Basics Fall 2003 This document will describe some of the basic functionality of R. Usually, you interact with R through a command-line interface you type in a command and R responds. Once you have mastered a few commands, the command-line ... Date Added: 2009-02-17 15:56:03 |
| basics-R.pdf Path: SJR CC >> STAT >> 571 Fall, 2008 Description: R Help Basics Fall 2003 This document will describe some of the basic functionality of R. Usually, you interact with R through a command-line interface you type in a command and R responds. Once you have mastered a few commands, the command-line ... Date Added: 2009-02-17 15:56:03 |
| basics-R.pdf Path: Wisconsin >> STAT >> 371 Fall, 2002 Description: R Help Basics Fall 2003 This document will describe some of the basic functionality of R. Usually, you interact with R through a command-line interface you type in a command and R responds. Once you have mastered a few commands, the command-line ... Date Added: 2009-02-17 15:56:55 |
| basics-R.pdf Path: SJR CC >> STAT >> 371 Fall, 2002 Description: R Help Basics Fall 2003 This document will describe some of the basic functionality of R. Usually, you interact with R through a command-line interface you type in a command and R responds. Once you have mastered a few commands, the command-line ... Date Added: 2009-02-17 15:56:55 |
| KlemensPTL2008.pdf Path: UCSD >> EMERALD >> 2008 Fall, 2008 Description: 258 IEEE PHOTONICS TECHNOLOGY LETTERS, VOL. 20, NO. 4, FEBRUARY 15, 2008 Optimization-Based Analysis of Modulation Instability in Resonant Cavities Guy Klemens, Member, IEEE, and Yeshaiahu Fainman, Fellow, IEEE AbstractWe present an optimization-ba... Date Added: 2009-02-06 18:54:27 |
| pontius_etal_2007_taluc.pdf Path: Pasco-Hernando Community College >> OCE >> 2001t Fall, 2008 Description: Lessons and challenges in land change modeling as revealed by map comparisons 1 Lessons and challenges in land change modeling as revealed by map comparisons Authors Robert Gilmore Pontius Jr1, Jean-Christophe Castella2, Ton de Nijs3, Zengqiang Dua... Date Added: 2009-01-09 09:36:29 |
| symbols.pdf Path: N.C. State >> ST >> 810a Fall, 2008 Description: AP 0Q A k j06e65 i i 1P 5Q k d5 eQ0 i jd ad0a e506Qdi 5 jk R he)eji k f g (A\" 0 1% a) ~ )o)0Q (~( )o)0Q (~( ~60Q ( 60Q ( ~P # ... Date Added: 2009-01-09 20:25:15 |
| symbols.pdf Path: N.C. State >> MA >> 810c Fall, 2008 Description: AP 0Q A k j06e65 i i 1P 5Q k d5 eQ0 i jd ad0a e506Qdi 5 jk R he)eji k f g (A\" 0 1% a) ~ )o)0Q (~( )o)0Q (~( ~60Q ( 60Q ( ~P # ... Date Added: 2009-01-12 05:11:43 |
| symbols.pdf Path: N.C. State >> ST >> 810c Spring, 2008 Description: AP 0Q A k j06e65 i i 1P 5Q k d5 eQ0 i jd ad0a e506Qdi 5 jk R he)eji k f g (A\" 0 1% a) ~ )o)0Q (~( )o)0Q (~( ~60Q ( 60Q ( ~P # ... Date Added: 2009-01-12 05:11:43 |
| symbols.pdf Path: N.C. State >> ST >> 810 Fall, 2008 Description: AP 0Q A k j06e65 i i 1P 5Q k d5 eQ0 i jd ad0a e506Qdi 5 jk R he)eji k f g (A\" 0 1% a) ~ )o)0Q (~( )o)0Q (~( ~60Q ( 60Q ( ~P # ... Date Added: 2009-02-04 14:41:22 |
| Proof 2 Path: Texas A&M >> PHIL >> 240 Spring, 2008 Description: Proof for [(F->G)->F)} ->F 1) 2) 3) 4) 5) 6) 7) 8) 9) F->G->F Assume ~F Assume ~(F->G) 1,2 MT ~(~F v G) 3, MI ~F . ~G 4, Dem ~F 5, Simp ~F . ~F 2,6 Conj F 2-7 RAA [(F->G)->F] -> F 1-8 CP ... Date Added: 2008-04-01 16:33:13 |
| Homework 19 Path: UIllinois >> ECON >> 203 Spring, 2008 Description: Graded Homework 19 You have submitted this Homework 2 times (including this time). You may submit this Homework a total of 40 times and receive full credit. This homework deals with the adjusted R-squared statistic and its relationship with (\'regular... Date Added: 2008-04-07 13:55:35 |
| Day06.pdf Path: HWS >> MATH >> 100 Fall, 2009 Description: Math 100 Homework: Day 6 Practice Come see me if you need help. The Math Intern is available for help Monday: 2 to 4 PM, 6 to 8 PM, Tuesday: 2 to 4 PM, 6 to 10 PM, Wednesday: 3 to 7 PM, Thursday: 2 to 5 PM, 6:30 to 10:30 PM Friday: 1:30 to 4 PM, Sund... Date Added: 2009-04-15 21:39:31 |
| HW_3 solutions Path: UCSB >> CHEM >> 124 Winter, 2008 Description: ... Date Added: 2008-08-06 15:55:45 |
| mccarthy.pdf Path: Harvey Mudd College >> CS >> 121 Fall, 2000 Description: McCarthys Transformation McCarthys Transformation: Imperative Programs to Functional Programs ! Every imperative program can be transformed into an equivalent functional program: ! The state of an imperative program consists of a set of binding of ... Date Added: 2009-02-06 18:55:04 |
| ch04_summary Path: Delaware >> LING >> 101 Fall, 2008 Description: Chapter 4: The Structure of Language Goals: To be familiar with the basic concepts of Syntax (in boldface throughout this page) To be familiar with the uses of Syntax: what can we do with Syntax? To be familiar with the PS rules and transformatio... Date Added: 2009-04-13 04:48:48 |
| hw5-solutions.doc Path: UF >> EIN >> 4354 Fall, 2008 Description: ... Date Added: 2009-01-11 22:45:44 |
| 1340HLabPacket01.docx Path: Southern Methodist >> CSE >> 1340 Fall, 2008 Description: CSE 1340 HONORS FALL 2008 DUE: SUBMITTED TO BLACKBOARD BY 10:00 P.M FRIDAY 9/5/08 L A B PAC K E T 1 G U I S In this assignment, you will gain more familiarity with GUIs. You will complete exercises 2.12 (p. 42), 2.15 (p.46), and 3.14 (p. 65). GET... Date Added: 2009-01-11 18:15:55 |
| 5-2005stat.pdf Path: UCLA >> LINGUISTIC >> 2 Fall, 2008 Description: Statistics Marcus Kracht Assignments, Part 5. Fall 2005 Ex 5.1 Let P be a Laplace space with 3 elements. Dene the following random variable: X(0) = 2, X(1) = 3 and X(2) = 5. Let us take a sample X1 , X2 , X3 . Now consider the following statistic: ... Date Added: 2009-02-06 18:01:35 |
| PLSC301.doc Path: Loyola Chicago >> CORE >> 1 Fall, 2008 Description: PLSC 301: Political Justice Professor Robert Mayer Fall 2005 COURSE DESCRIPTION Are racial quotas fair? How about transfer payments to the poor? Are preemptive military strikes wrong? In this course we search for answers to these and other questions... Date Added: 2009-02-17 23:58:47 |
| 051014yuan.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: Double-edged sword of the rising yuan - Print Version - International Herald Tribune Double-edged sword of the rising yuan By David Barboza The New York Times FRIDAY, OCTOBER 14, 2005 SHANGHAI At Parlex\'s factory here in the western part of this city... Date Added: 2009-02-11 17:28:57 |
| 286.doc Path: N. Arizona >> EGR >> 286 Fall, 2008 Description: Northern Arizona University - College of Engineering Environmental Engineering EGR 286 ENGINEERING DESIGN: THE PROCESS COURSE SYLLABUS Spring 2007, 3 Credit Hours Instructor: Bridget N. Bero, Civil and Env... Date Added: 2009-02-02 15:12:21 |
| 001103RemakingEU.txt Path: Chester >> ECO >> 343 Fall, 2008 Description: In Remaking the EU, All That\'s Certain Is Tension Front Page International Finance Opinion Letters Travel Traveler Update People Sports To see an image of today\'s front page download This File Bureaus Columnists Features Money Report TribTech Fashio... Date Added: 2009-02-11 17:55:58 |
| slac-pub-12346.pdf Path: UCLA >> PBPL >> 731 Fall, 2008 Description: SLAC-PUB-12346 February 2007 Experimental characterization of the transverse phase space of a 60-MeV electron beam through a compressor chicane F. Zhou,1,* A. Kabel,2 J. Rosenzweig,1 R. Agustsson,1 G. Andonian,1 D. Cline,1 A. Murokh,1 and V. Yakimen... Date Added: 2009-02-06 17:59:19 |
| bestavros.pdf Path: U. Houston >> ACCT >> 7360 Fall, 2008 Description: . Client-Server Computing WWW Traffic Reduction and Load Balancing through Server-Based Caching Azer Bestavros Boston University This caching protocol exploits the geographic and temporal locality of reference exhibited in client-access patterns. ... Date Added: 2009-02-03 13:45:18 |
| Feedlot Price $1.82 per month.pdf Path: UCSB >> ENV S >> 175 Fall, 2008 Description: ... Date Added: 2009-01-11 21:53:14 |
| 31295012207188.pdf Path: Texas Tech >> ETD >> 01292009 Fall, 2009 Description: MINIMAL MODELING OF MULTI-POINT CONTACT WITH FRICTION FOR A DEXTEROUS MANIPULATOR by ANGELA L. NUGENT, B.S.M.E. A THESIS IN MECHANICAL ENGINEERING Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements f... Date Added: 2009-04-15 20:19:52 |
| IntelligentSystems2009Section2.pdf Path: Dallas >> CS >> 6373 Fall, 2008 Description: Intelligent Systems CS 6373 Lecture Set 2 Description Logic Professor Dan Moldovan Spring 2009 2009 Dan I. Moldovan, Human Language Technology Research Institute, The University of Texas at Dallas Outline Why Description Logic A Semantic Network ... Date Added: 2009-02-18 02:20:17 |
| BASS_sec2_tMLE.ppt Path: Berkeley >> STAT >> 210b Spring, 2008 Description: Targeted MLE for Variable Importance and Causal Effect with Clinical Trial and Observational Data Mark van der Laan works.bepress.com/mark_van_der_laan Division of Biostatistics, University of California, Berkeley Outline Standard approaches... Date Added: 2009-01-10 01:28:10 |
| 550 Course Handout, Sp 2008.pdf Path: Purdue >> A&D >> 550 Spring, 2008 Description: A&D 550 Research Methods in Art and Design (3 credit hours) Instructor: Dr. Robert Sabol Office: Pao Hall 2169 Phone: 494-3058, or 496-2957 E-Mail: bobsabol@purdue.edu Office Hours: Tuesday, Thursday, 2:30 p.m. 3:20p.m., 5:30 p.m. 5:55 p.m. or by a... Date Added: 2009-02-02 15:42:27 |
| 131-kieserman-07faex01 Path: Wisconsin >> MATH >> 131 Fall, 2007 Description: ... Date Added: 2008-08-08 15:40:53 |
| 050217oceans.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: Scientists Find Dramatic Changes in Southern Ocean, Fear Climate Link Published on Thursday, February 17, 2005 by Agence France Presse Scientists Find Dramatic Changes in Southern Ocean, Fear Climate Link HOBART, AUSTRALIA - Scientists have discovere... Date Added: 2009-02-11 17:29:11 |
| APMEX Summary Report.pdf Path: UCSD >> WWW-C4 >> 2004 Fall, 2008 Description: V. Ramanathan Chief Scientist, APMEX Campaign of ABC Hanimaadhoo Village Maldives November 11, 2004 Subject: Summary Report of the APMEX campaign Dear Colleagues, The APMEX campaign completed its aircraft campaign on Nov 10th and its special observat... Date Added: 2009-02-06 18:54:41 |
| pt3.pdf Path: N.C. State >> MA >> 437 Spring, 2008 Description: North Carolina State University Department of Mathematics MA 405001, Practice Test 3 1. Is the map L : R2 R3 given by L(x) = (x1 , x2 , x2 + x2 )T a linear transforma2 1 tion? Justify your answer. 2. Let L : R3 R3 be the linear map given by L(x) ... Date Added: 2009-01-09 04:44:31 |
| pt3.pdf Path: N.C. State >> AS >> 421 Fall, 2008 Description: North Carolina State University Department of Mathematics MA 405001, Practice Test 3 1. Is the map L : R2 R3 given by L(x) = (x1 , x2 , x2 + x2 )T a linear transforma2 1 tion? Justify your answer. 2. Let L : R3 R3 be the linear map given by L(x) ... Date Added: 2009-01-09 04:42:53 |
| pt3.pdf Path: N.C. State >> MA >> 421 Summer, 2008 Description: North Carolina State University Department of Mathematics MA 405001, Practice Test 3 1. Is the map L : R2 R3 given by L(x) = (x1 , x2 , x2 + x2 )T a linear transforma2 1 tion? Justify your answer. 2. Let L : R3 R3 be the linear map given by L(x) ... Date Added: 2009-01-09 04:42:53 |
| Chap-1a-handout.pdf Path: U. Memphis >> COMP >> 8120 Spring, 2008 Description: Chapter 1: Classical Cryptography COMP 7120-8120 Lih-Yuan Deng lihdeng@memphis.edu Introduction: Some Simple Cryptosystems Shift Cipher Substitution Cipher Affine Cipher Vigenere Cipher Hill Cipher Permutation Cipher Stream Cipher Cryptanalysis Cyp... Date Added: 2009-02-02 19:34:32 |
| BIO 320 Lecture10_2009 Path: Texas >> BIO 320 >> 50160 Spring, 2009 Description: BIO320CELLBIOLOGYSpring2009 A.DeLozanne&T.OHalloran Lecture10 IntracellularCompartmentsandNuclearTransport Reading:Alberts,5thEd.Pages695712thefollowingsections: TheCompartmentalizationofCells AllEukaryoticcellshavethesamebasicsetof Evolutionar... Date Added: 2009-04-12 12:35:39 |
| 1733.161.ps Path: Hawaii >> SOEST >> 1733 Fall, 2008 Description: Insitu Temperature (C) -5 0 200 400 0 5 10 15 20 25 30 33 Salinity (PSU) 30 20 10 0 Insitu Temperature (C) 34 35 36 Pressure (decibar) 600 800 1000 1200 1400 1600 33.0 1209505900.0388276 Float: 1733 Profile: 161 Location: 30.8N 178.5E Date: 08/27... Date Added: 2009-02-17 20:23:10 |
| intr_ada.doc Path: Scranton >> KOSMAHLE >> 452 Fall, 2009 Description: PT452/453/552 - Industrial Physical Therapy - Dr. Kosmahl INTRODUCTION TO INDUSTRIAL PHYSICAL THERAPY AND THE AMERICANS WITH DISABILITIES ACT I. INDUSTRIAL PT OVERVIEW A. Purposes 1. 2. B. Players 1. 2. 3. 4. 5. 6. 7. 8. 9. II. worker PT OT psycholog... Date Added: 2009-04-15 19:53:14 |
| profumo.pdf Path: Concordia Chicago >> IMPACT >> 2008 Fall, 2009 Description: Stefano Profumo UC Santa Cruz Santa Cruz Institute for Particle Physics T.A.S.C. [Theoretical Astrophysics, Santa Cruz] Fundamental Physics with GeV Gamma Rays Based on: Kamionkowski SP, 0808.2641 (JCAP in pr... Date Added: 2009-04-15 22:00:44 |
| June Key Path: UBC >> CHEM >> 110 Spring, 2008 Description: English 12 June 2003 Provincial Examination ANSWER KEY / SCORING GUIDE Topics: 1. 2. 3. Editing and Proofreading Skills Interpretation of Literature Original Composition Multiple Choice Q 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. K B C B C D C... Date Added: 2008-05-27 21:45:37 |
| 113-rosay-06fa02-v2-key Path: Wisconsin >> MATH >> 113 Spring, 2007 Description: ... Date Added: 2008-08-08 14:59:18 |
| prm 380 study guide Path: ASU >> PRM >> 380 Spring, 2008 Description: Animism- belief that animals have souls/ that all parts of nature are of value and are important. St francis preached to all gods creatures because they are all important Ambivalence- feeling two ways about one thing, so you might want to keep cars f... Date Added: 2008-09-18 13:10:53 |
| test 5 Path: UGA >> CBIO >> 2210 Spring, 2007 Description: 1.Regulating Stroke Volume -CO is controlled by the regulation of HR and SV. If CO is controlled then BP is controlled. a. Three Factors Determine Stroke Volume 1. Preload -determines the stretching of cardiac muscle which determines the volume of bl... Date Added: 2008-03-20 14:45:05 |
| tlee485_weeklyEval.doc Path: N. Illinois >> TLEE >> 461 Fall, 2008 Description: TLEE 485 NIU Student Teacher Weekly Evaluation Student Name_ District_ A Community of Learners Please rate the student teacher on the competencies below using the following indicators: NA for Not Applicable, U for Unsatisfactory, D/C for Developing w... Date Added: 2009-01-09 05:20:22 |
| tlee485_weeklyEval.doc Path: N. Illinois >> TLEE >> 485 Fall, 2008 Description: TLEE 485 NIU Student Teacher Weekly Evaluation Student Name_ District_ A Community of Learners Please rate the student teacher on the competencies below using the following indicators: NA for Not Applicable, U for Unsatisfactory, D/C for Developing w... Date Added: 2009-01-09 05:20:22 |
| tlee485_weeklyEval.doc Path: N. Illinois >> TLEE >> 586 Spring, 2008 Description: TLEE 485 NIU Student Teacher Weekly Evaluation Student Name_ District_ A Community of Learners Please rate the student teacher on the competencies below using the following indicators: NA for Not Applicable, U for Unsatisfactory, D/C for Developing w... Date Added: 2009-01-09 05:20:22 |
| tlee485_weeklyEval.doc Path: N. Illinois >> TLEE >> 382 Fall, 2008 Description: TLEE 485 NIU Student Teacher Weekly Evaluation Student Name_ District_ A Community of Learners Please rate the student teacher on the competencies below using the following indicators: NA for Not Applicable, U for Unsatisfactory, D/C for Developing w... Date Added: 2009-01-09 05:20:22 |
| tlee485_weeklyEval.doc Path: N. Illinois >> TLEE >> 383 Fall, 2008 Description: TLEE 485 NIU Student Teacher Weekly Evaluation Student Name_ District_ A Community of Learners Please rate the student teacher on the competencies below using the following indicators: NA for Not Applicable, U for Unsatisfactory, D/C for Developing w... Date Added: 2009-01-09 05:20:22 |
| EXED 431 2005 Syllabus.doc Path: Western Kentucky University >> EXED >> 431 Fall, 2008 Description: Course Title: Language Intervention: Strategies and Materials Course Prefix and Number: EXED 431 Course Discipline: Exceptional Education, Learning and Behavior Disorders, P-12 Instructor\'s Name: Dr. Janice Ferguson Semester and Year: Fall, 2005 Inst... Date Added: 2009-02-02 21:05:32 |
| 101 regular syllabus08Fdoc.pdf Path: Delaware >> MALS >> 621 Fall, 2008 Description: 1 INTRODUCTION TO CULTURAL ANTHROPOLOGY Anthropology 101-012 Fall 2008 Course Description Anthropology 101-011 is a rigorous, introductory course in cultural anthropology. The three major themes of the course are: 1) how cultural anthropologists do ... Date Added: 2009-01-10 03:26:40 |
| 01_mehler.pdf Path: N.C. State >> ENG >> 463 Fall, 2008 Description: Text Linkage in the Wiki Medium A Comparative Study Alexander Mehler Department of Computational Linguistics & Text Technology Bielefeld University Bielefeld, Germany Alexander.Mehler@uni-bielefeld.de Abstract We analyze four different types of doc... Date Added: 2009-01-11 17:01:58 |
| 01_mehler.pdf Path: N.C. State >> FOR >> 304 Spring, 2008 Description: Text Linkage in the Wiki Medium A Comparative Study Alexander Mehler Department of Computational Linguistics & Text Technology Bielefeld University Bielefeld, Germany Alexander.Mehler@uni-bielefeld.de Abstract We analyze four different types of doc... Date Added: 2009-01-09 04:42:47 |
| 01_mehler.pdf Path: N.C. State >> EDP >> 304 Summer, 2008 Description: Text Linkage in the Wiki Medium A Comparative Study Alexander Mehler Department of Computational Linguistics & Text Technology Bielefeld University Bielefeld, Germany Alexander.Mehler@uni-bielefeld.de Abstract We analyze four different types of doc... Date Added: 2009-01-09 04:42:47 |
| 01_mehler.pdf Path: N.C. State >> ARE >> 304 Fall, 2008 Description: Text Linkage in the Wiki Medium A Comparative Study Alexander Mehler Department of Computational Linguistics & Text Technology Bielefeld University Bielefeld, Germany Alexander.Mehler@uni-bielefeld.de Abstract We analyze four different types of doc... Date Added: 2009-01-09 04:42:47 |
| Conger.txt Path: Wisconsin Milwaukee >> PSY >> 514 Fall, 2009 Description: Conger, R., and Killeen, P. (1974). Use of concurrent operants in small group research. Pacific Sociological Review, 17, 399-416. Groups of 4 college students served as subjects. The subjects sat around a table and had a 30 min discussion about d... Date Added: 2009-04-16 00:30:29 |
| ALB - 14 Path: Yale >> HUMS >> 255 Spring, 2008 Description: Art, Love, and Beauty 14 3/4/08 Harries 1 14. The Beautiful and the Sacred 1 In my last lecture I spoke of the tension between the selfsufficiency demanded of the work of art by Schopenhauer\'s aesthetic approach and the edification that he looks... Date Added: 2008-04-12 21:48:28 |
| hgEd578SyllSum08.pdf Path: Iowa State >> HG ED >> 591 Fall, 2008 Description: Iowa State University Department of Educational Leadership and Policy Studies College of Human Sciences Hg Ed 578 - Students in American Higher Education N221 Lagomarcino Hall Summer 2008 Instructor Daniel C. Robinson, Ph.D. University Professor/Prof... Date Added: 2009-01-09 02:05:18 |
| 415_2003_Quiz2.pdf Path: Rutgers >> 332 >> 415 Fall, 2008 Description: 332:416 Introduction to Automatic Control - Quiz 2, 10/29/2003 Problem 1: a. State the denition of root locus for a closed loop system; b. State at least ve rules which help in sketching the root locus; c. Sketch the root locus for 1. 2. Problem 2: ... Date Added: 2009-02-02 15:54:47 |
| ac_1_tech_sched.pdf Path: Goucher >> X >> 17833 Fall, 2008 Description: TECHNICAL REHEARSAL SCHEDULE ADJUDICATION CONCERT #1 Wednesday, March 12th, 1:00pm - 5:00pm Kraushaar Auditorium Please note that each school will have 15 minutes on-stage tech time for each work to review cues. This time limit will be strictly enfor... Date Added: 2009-02-11 21:41:04 |
| ac_1_tech_sched.pdf Path: Goucher >> X >> 17834 Fall, 2008 Description: TECHNICAL REHEARSAL SCHEDULE ADJUDICATION CONCERT #1 Wednesday, March 12th, 1:00pm - 5:00pm Kraushaar Auditorium Please note that each school will have 15 minutes on-stage tech time for each work to review cues. This time limit will be strictly enfor... Date Added: 2009-02-11 21:41:41 |
| Chapter3.doc Path: Georgia Perimeter >> CSCI >> 1301 Fall, 2008 Description: Chapter 3 Assignment Cover Sheet Name _ Date _ Section _ Lab Assignments Lab 3.1 Examining Objects and Reference Variables, and Using the Predefined Class Math and the pow Method Lab 3.2 Using the String class Lab 3.3 Using Dialog Boxes for Input and... Date Added: 2009-01-11 04:59:35 |
| ecommerce.xls Path: UMass Dartmouth >> CIS >> 110 Fall, 2008 Description: Estimated Total Quarterly Sales, Retail and E-Commerce Retail Sales Year Quarter 2000 Q1 Q2 Q3 Q4 2001 Q1 Q2 Q3 Q4 2002 Q1 Q2 Q3 Q4 2003 Q1 Q2 Q3 Q4 2004 Q1 Q2 Q3 Q4 2005 Q1 Q2 Q3 Q4 2006 Q1 Q2 Q3 Q4 Total E-Commerce Sales Sales 715102 5772 775364 62... Date Added: 2009-02-11 21:09:50 |
| ecommerce.xls Path: UMass Dartmouth >> CIS >> 3 Fall, 2008 Description: Estimated Total Quarterly Sales, Retail and E-Commerce Retail Sales Year Quarter 2000 Q1 Q2 Q3 Q4 2001 Q1 Q2 Q3 Q4 2002 Q1 Q2 Q3 Q4 2003 Q1 Q2 Q3 Q4 2004 Q1 Q2 Q3 Q4 2005 Q1 Q2 Q3 Q4 2006 Q1 Q2 Q3 Q4 Total E-Commerce Sales Sales 715102 5772 775364 62... Date Added: 2009-02-11 21:09:50 |
| ethbibspring2003.pdf Path: Wisconsin >> SOC >> 220 Fall, 2008 Description: RESEARCH GUIDE FOR MEMORIAL LIBRARY: SOCIOLOGY 220, \"ETHNIC MOVEMENTS IN THE UNITED STATES I. MADCAT Suggested SUBJECT HEADINGS for searching in MadCat (choose Subject under Basic Search) pluralism (social sciences) united states minorities united s... Date Added: 2009-02-17 15:52:35 |
| ethbibspring2003.pdf Path: SJR CC >> SOC >> 220 Fall, 2008 Description: RESEARCH GUIDE FOR MEMORIAL LIBRARY: SOCIOLOGY 220, \"ETHNIC MOVEMENTS IN THE UNITED STATES I. MADCAT Suggested SUBJECT HEADINGS for searching in MadCat (choose Subject under Basic Search) pluralism (social sciences) united states minorities united s... Date Added: 2009-02-17 15:52:35 |
| 7-23-08 Path: UGA >> POLS >> 1101 Summer, 2008 Description: I. II. III. IV. V. Bill through the Senate A. 100 Senators vs. 435 House members B. Senate, hearings happen in committee; house happens in sub-committee C. Senate does not have committee with same function as Rules Committee D. UCA Unanimous Co... Date Added: 2008-07-25 13:45:13 |
| sample-exam-2.pdf Path: UCSD >> BIBC >> 102 Fall, 2008 Description: ... Date Added: 2009-01-10 01:40:22 |
| Chapter 9 Guided Notes Path: Ohio State >> PSYCHOLGOY >> 340 Spring, 2009 Description: Psychology 340 WI09 Chapter 9 Guided Notes 1. Language Communication of thoughts and feelings through a shared system of arbitrary signals, such as voice sounds, gestures, or written symbols 2. Fundamentals of Language a. Phonology b. Morphology... Date Added: 2009-04-04 00:32:36 |
| assignment9.pdf Path: George Mason >> ASTR >> 764 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| assignment9.pdf Path: George Mason >> ASTR >> 765 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| assignment9.pdf Path: George Mason >> ASTR >> 766 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| assignment9.pdf Path: George Mason >> CSI >> 764 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| assignment9.pdf Path: George Mason >> CSI >> 765 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| assignment9.pdf Path: George Mason >> ASTR >> 428 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| assignment9.pdf Path: George Mason >> CSI >> 766 Fall, 2008 Description: ... Date Added: 2009-01-09 07:57:00 |
| 10.1.1.59.8479.pdf Path: Arizona >> CS >> 652 Spring, 2009 Description: Power Management and Dynamic Voltage Scaling: Myths and Facts David Snowdon, Sergio Ruocco and Gernot Heiser National ICT Australia and School of Computer Science and Engineering University of NSW, Sydney 2052, Australia Firstname.Lastname@nicta.com.... Date Added: 2009-04-15 23:00:28 |
| Dickey3DVirtualWorlds.pdf Path: East Carolina >> PHYS >> 1090 Fall, 2008 Description: 3D Virtual Worlds: An Emerging Technology for Traditional and Distance Learning Michele D. Dickey Miami University Abstract Three-dimensional virtual worlds are an emerging medium currently being used as both an extension of traditional classroom env... Date Added: 2009-01-10 02:55:26 |
| Dickey3DVirtualWorlds.pdf Path: East Carolina >> ART >> 3951 Fall, 2008 Description: 3D Virtual Worlds: An Emerging Technology for Traditional and Distance Learning Michele D. Dickey Miami University Abstract Three-dimensional virtual worlds are an emerging medium currently being used as both an extension of traditional classroom env... Date Added: 2009-01-10 02:55:26 |
| Dickey3DVirtualWorlds.pdf Path: East Carolina >> ART >> 2301 Spring, 2008 Description: 3D Virtual Worlds: An Emerging Technology for Traditional and Distance Learning Michele D. Dickey Miami University Abstract Three-dimensional virtual worlds are an emerging medium currently being used as both an extension of traditional classroom env... Date Added: 2009-01-10 02:55:26 |
| lec8s04.pdf Path: UCSD >> MATH >> 8 Fall, 1920 Description: ... Date Added: 2009-02-17 18:18:57 |
| MultipleChoiceQuestions.pdf Path: UConn >> EEB >> 349 Fall, 2008 Description: Multiple choice questions: In these questions there is a variable number of correct answers, with a range of possibilities from a single answer correct to all answers correct. In each case you will be expected to circle all of the correct answers and... Date Added: 2009-01-10 02:43:16 |
| chapter3.doc Path: Texas A&M >> SPAN >> 302 Fall, 2008 Description: Page 1 of 9 Chapter 3: Association: Contingency, Correlation, and Regression Section 3.1: How Can We Explore the Association between Two Categorical Variables? The response variable is the outcome variable on which comparisons are made. The explanato... Date Added: 2009-02-03 13:29:00 |
| 350.pdf Path: University of Illinois, Urbana Champaign >> SOC >> 350 Fall, 2008 Description: Course Schedule - Spring 2007 Sociology 350 Technology and Society Credit: 3 hours. Examines the social and cultural origins of modern technology and technological innovation; the effects of technology and its change on society. Topics include the im... Date Added: 2009-02-02 18:41:46 |
| Soc 573 Organ Donation.ppt Path: Purdue >> SOC >> 573 Fall, 2008 Description: SOC 573 Organ Donation James G. Anderson, Ph.D. Purdue University Organ Donations In the U.S. 2 million persons die each year. 25,000 are suitable for organ donation Only one out of six donate organs 57,000 people in the U.S. are on the waiting l... Date Added: 2009-02-02 15:50:27 |
| sept 2 Path: USC >> CLAS >> 280g Fall, 2007 Description: Kevin Teng Classic Mythology September 2, 2005 Tablet of Destinies: where the gods wrote down everything that would happen MAPS ON HANDOUT: notice how powerful Hatti became. They were the Hurians but were eventually taken over by the Hittites The sto... Date Added: 2007-09-22 14:41:35 |
| CS105(3) Path: George Mason >> CS >> 105 Spring, 2008 Description: Homework 3 CS105 The purpose of this homework is to acquaint you with legal research on the internet. [Note: In HW#1 we provided the URL\'s, so we can\'t really call that research or google research.] You are to use the Lexis-Nexis legal research data ... Date Added: 2008-04-07 15:44:43 |
| Quiz-7 Path: VCU >> PHYS >> 320 Spring, 2008 Description: Quiz #7: Solid-state Physics April 14, 2008 Problem 1 SOLUTIONS GaN is a semiconductor with the band gap Eg = 3.5 eV. Will it be n- or p-type after doping with Mg? Explain why. Draw a band diagram for this case and for T = 300 K with appropriate la... Date Added: 2008-04-22 21:41:25 |
| CONTENTS.pdf Path: Virginia Tech >> LIB >> 61097 Fall, 2008 Description: Abs-Tracked. This thesis attempts to problematize and rethink the inter-related construction of the categories of environment and fitness. It argues that environments are materially and discursively constructed through the mutually constitutive mobil... Date Added: 2009-02-18 01:09:18 |
| EESrpt298.pdf Path: Kansas State >> NE >> 998 Fall, 2008 Description: NOTES ON NEUTRON DEPTH PROFILING by J.K. Shultis Department of Mechanical and Nuclear Engineering Kansas State University Manhatta, Kansas 55606 published as Report 298 ENGINEERING EXPERIMENT STATION College of Engineering Kansas State University ... Date Added: 2009-01-09 02:21:19 |
| Ch10s Path: CSU Fresno >> ECE >> 138 Spring, 2008 Description: Chapter 10 Problem Solutions 10.1 a. I1 = I 2 = 0 - 2V - V - R1 + R2 2V + I 2 R2 = VBE + I C R3 R2 2V + ( -2V - V - ) = VBE + IC R3 R1 + R2 R2 - 2V - ( 2V + V ) - VBE R1 + R2 V = VBE and R1 = R2 IC = 1 R3 IC = 1 1 - 2V - ( 2V + V ) ... Date Added: 2008-02-10 16:53:03 |
| sio223sp1.pdf Path: UCSD >> PART >> 2 Fall, 2008 Description: Chapter SP-1 Discrete-Time Fourier Theory 1. Introduction We now turn from Fourier theory to the subject of digital signal processing; though as we will see, much of what has been covered in the Fourier theory discussion will be used here. However, ... Date Added: 2009-02-18 00:39:01 |
| sio223sp1.pdf Path: UCSD >> PART >> 223 Fall, 2008 Description: Chapter SP-1 Discrete-Time Fourier Theory 1. Introduction We now turn from Fourier theory to the subject of digital signal processing; though as we will see, much of what has been covered in the Fourier theory discussion will be used here. However, ... Date Added: 2009-02-18 00:39:01 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 2511 Spring, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 1115 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 4991 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:16 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 1001 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 3183 Spring, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:16 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 3073 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 2513 Spring, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 1123 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 2111 Spring, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 3243 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:16 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 3103 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 2521 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:16 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 1124 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 2113 Spring, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 3323 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:16 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 3163 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> PHYS >> 2523 Spring, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:16 |
| orionPHYS-2111-002-FALL-2008-REVISED.pdf Path: Prairie View A & M >> MATH >> 2024 Fall, 2008 Description: PHYS 2111 GENERAL PHYSICS LAB I Fall Semester 2008 Section PHYS-2111-001, W 2:00 PM to 4:50 PM; New Science Building Room 307 Associate Professor Office Tel: 936-261-3137 Dr. ORION CIFTJA New Sci. Bldg. 330F E-mail: ogciftja@pvamu.edu Office Hour... Date Added: 2009-01-09 06:29:15 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
