Course Solutions And Notes - kernel-smp-2.4.18-24.7.x.perfctr.2.4.5.i686.rpm 56
| hw5.xls Path: Georgia Tech >> GTG >> 937 Fall, 2009 Description: x NH3 x N2 x H2 mw NH3 mn N2 mw H2 mw prod R_bar To C_star gamma c_star Pe/Po Ae/At C_tau Ueq ge Isp tau P0 At 0.32 0.28 0.4 17 g/mol 28 g/mol 2 g/mol 14.08 g/mol 8.31 kg/kmolK 1430 *C 1703 K 48.61 KJ/Kg 1.22 1537.11 m/s 0 40 1.86 2864.51 m/s 9.81 m... Date Added: 2009-06-07 08:51:56 |
| 474-F03-grades-sec2.doc Path: CSU Long Beach >> CECS >> 474 Fall, 2008 Description: CECS 474 FALL 2003 SECTION 2 Last 4-digits of Student ID 1109 1362 3229 5131 5649 6397 7042 7082 7084 7502 7992 8328 8548 8889 9294 9967 0380 Final Exam Score 58.00 77.00 85.00 83.00 70.00 83.00 55.00 79.00 57.00 76.00 80.00 81.00 83.00 51.00 73.00 ... Date Added: 2009-06-07 08:53:49 |
| SHR_midwifery_regional_updates.pdf Path: Air Force Academy >> DOCS >> 20080924 Fall, 2009 Description: Saskatoon Health Region and Midwifery Sept 24, 2008 History Saskatoon Health Region involved in Midwifery Program development since 2006 Appointed to Provincial Transitional Council early 2007 Implementation Committees : Legislative and Regul... Date Added: 2009-06-07 08:54:11 |
| hws_2.pdf Path: Colorado State >> PH >> 245 Fall, 2008 Description: ... Date Added: 2009-06-07 08:55:31 |
| Week 05.xls Path: Allan Hancock College >> FIN >> 200740 Fall, 2009 Description: Q9-14 B 1.13 1.07 0.95 1.02 0.95 0.85 0.75 0.62 0.75 0.61 0.59 0.53 Av. Std dev CV -0.0531 -0.1121 0.0737 -0.0686 -0.1053 -0.1176 -0.1733 0.2097 -0.1867 -0.0328 -0.1017 -0.0607 0.1141 -1.8791 3.63 3.88 4.64 4.17 4.38 4.12 4.40 4.69 4.36 4.55 4.50 4.7... Date Added: 2009-06-07 08:55:34 |
| 05A & B.doc Path: Allan Hancock College >> FIN >> 200740 Fall, 2009 Description: 05A B Text reference: Chapter 11 Capital budgeting: concepts & methods. Part 1 Capital budgeting is concerned with capital expenditure. There\'s usually a limited amount of finance a... Date Added: 2009-06-07 08:55:37 |
| exam3s.pdf Path: Maryland >> MATH >> 130 Fall, 2008 Description: Math 130 Exam 3 Sample Directions: Do not simplify unless indicated. Non-graphing calculators are permitted. Show all work as appropriate for the methods taught in this course. Partial credit will be given for any work, words or ideas which are relev... Date Added: 2009-06-07 08:57:20 |
| lecture-18-2-23-6.pdf Path: Alabama >> CS >> 325 Fall, 2008 Description: Lecture 18 Today The Visual C+ environment Visual C+ environment Commercial development environment Editor, compiler, graphical interface, debugger, . Comparison to other compilers pcGrasp designed for education VC+ and Sun\'s g+ are \"commerci... Date Added: 2009-06-07 08:57:47 |
| EM_09-08-2005.pdf Path: University of South Dakota >> PHYS >> 421 Fall, 2008 Description: EM notes September 8, 2005 Integral Calculus, continued Fundamental Theorem of Divergences, continued PROBLEM 1.32 Verify the divergence theorem for the vector v = xy x +2yz y +3xz z , where the volume is cube of side length 2 and with the two op... Date Added: 2009-06-07 08:58:01 |
| c1145.pdf Path: East Los Angeles College >> TECHNOLOGY >> 0809 Fall, 2009 Description: Oxford_Brookes Course timetable - TELECOMMS YR1 (Wks H7-S2/11, 26/01/2009 - 27/04/2009) 09:00AM 10:00AM 11:00AM 12:00PM 01:00PM 02:00PM 03:00PM 04:00PM 05:00PM 06:00PM 07:00PM 08:00PM Sun Sat Fri Thu We Tue Mo Page 1, published 28/01/2009 12:... Date Added: 2009-06-07 08:58:47 |
| solution05.pdf Path: Columbia >> E >> 6316 Fall, 2009 Description: hw5 Sat Dec 11 21:20:30 2004 1 Problem 2: The logic here looks for \'01\' pattern across the output of two consecutive comparators. So if the sa mpled input is different by 1 V_LSB, it will cause a bubble error. Error in Vin = Max. Slope X Sk ew in ... Date Added: 2009-06-07 09:00:43 |
| Chap018.ppt Path: St. Francis IL >> BSAD >> 431 Fall, 2009 Description: McGrawHill/Irwin 2006 The McGrawHill Companies, Inc. All rights reserved. Part 7 SERVICE AND THE BOTTOM LINE McGrawHill/Irwin 2006 The McGrawHill Companies, Inc. All rights reserved. The Financial and Economic Impact of Service Service and P... Date Added: 2009-06-07 09:02:42 |
| BSAD332 WebSurveyor Assignment Oct 1 2007.doc Path: St. Francis IL >> BSAD >> 332 Fall, 2009 Description: BSAD 332 Marketing Research for Monday, October 1 Assignment: WebSurveyor Please create a brief questionnaire based on Case 11.1 from Chapter 11 of our text (Moe\'s Wraps and Subs). We will have some time on Monday during class to work on this but by ... Date Added: 2009-06-07 09:02:50 |
| che446_exam07-2_solution.pdf Path: UMass (Amherst) >> CHE >> 446 Fall, 2009 Description: Midterm Exam #2 ChE 446 Fall 2007 Problem 1 (100 pts). Consider the following transfer function model that describes the effect of the reflux ratio (u) on the overhead product composition (y) in a binary distillation column: 3e-2s Y (s) = G(s) = U (s... Date Added: 2009-06-07 09:05:15 |
| chapter6.ppt Path: UCCS >> CS >> 522 Fall, 2009 Description: Chapter 6 The Transport Layer The Transport Service Services Provided to the Upper Layers Transport Service Primitives Berkeley Sockets An Example of Socket Programming: An Internet File Server Services Provided to the Upper Layers The networ... Date Added: 2009-06-07 09:05:16 |
| LCP_LCA_F06a_T01_V2.0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Life Cycle Plan (LCP) California Science Center Newsletter System Team 1 Jeremy Stoller Vincent Tsan Nisarg Patel Harsh Vardhan Saboo Abhilash Augustine Jaimin Vaidya Mitesh H Shah Mustanshir Kanchwalla Miguel Collins Client System Maintainer/Web ... Date Added: 2009-06-07 09:05:18 |
| lecture1.3.ppt Path: Winthrop >> PHYS >> 201 Fall, 2008 Description: 1.7. Components of a Vector Consider the following vector, A: 1.7. Components of a Vector Consider the following vector, A: How can we replace vector A by two perpendicular components? 1.7. Components of a Vector 1.7. Components of a Vector Aadj... Date Added: 2009-06-07 09:05:29 |
| sgf.doc Path: Winthrop >> PHYS >> 211 Fall, 2008 Description: PHYS 211 MWF 9-9:50 F08 Study Guide For Final Format will be similar to Tests #1, #2, and #3; consists of multiple choice questions, regular questions, derivations, and problems. A. Materials from Test #1, #2, #3: Go over these tests. B. The equat... Date Added: 2009-06-07 09:05:49 |
| 20080902_1.pdf Path: Colorado >> LASP >> 3500 Fall, 2009 Description: Reading for this week: pp. 11-31; 40-42; 489-499 1 ATOC 3500 2 September 2008 Today: Overview of the Atmosphere Thursday: Pre-test Atmospheric Fundamentals 2 Hurricane Gustav Gustav roared from the Gulf of Mexico into southern Louisiana on Monday... Date Added: 2009-06-07 09:08:31 |
| SRF950905-12.pdf Path: Cornell >> SRF >> 950905 Fall, 2009 Description: SRF 950905-12 Presented at the International Workshop on Collective Effects and Impedance for B-Factoruies, KEK, Tsukuba, Japan, June 1995 The Interaction between a Beam and a Superconducting Cavity Module: Measurements in CESR and CESR-Phase III Go... Date Added: 2009-06-07 09:09:18 |
| 2nd_order_response.pdf Path: Texas >> ME >> 383 Fall, 2009 Description: ... Date Added: 2009-06-07 09:10:01 |
| COS280-lect-2008-04-28.pdf Path: Taylor IN >> CSE >> 280 Fall, 2009 Description: Lisp quotes while waiting \"Lisp . made me aware that software could be close to executable mathematics.\" - L. Peter Deutsch \"Will write code that writes code that writes code that writes code for money.\" - on comp.lang.lisp \"Lisp is a language for... Date Added: 2009-06-07 09:10:11 |
| Phys112Sem5_1Pres1.pdf Path: Swarthmore >> PHYS >> 112 Fall, 2009 Description: ... Date Added: 2009-06-07 09:11:19 |
| DesignII.doc Path: Mississippi State >> ECE >> 4522 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|05 Dec 2001 03:32:28 -0000 vti_extenderversion:SR|4.0.2.4022 vti_backlinkinfo:VX|archive.htm vti_nexttolasttimemodified:TR|05 Dec 2001 04:14:26 -0000 vti_title:SR|1 vti_assignedto:SR| vti_author:SR|Admi... Date Added: 2009-06-07 09:11:51 |
| output.txt Path: Washington >> JOBS >> 71725 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-715QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_520 02/17/2008 01:49 PM <DIR> . 02/17/2008 01:49 P... Date Added: 2009-06-07 09:15:16 |
| submit.txt Path: Washington >> JOBS >> 71500 Fall, 2009 Description: executable = pass6_71744.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71500-71999/71744... Date Added: 2009-06-07 09:15:23 |
| error.txt Path: Washington >> JOBS >> 71706 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 13:43:19 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 14:58:26 2008 ( 4507 s elapsed) ... Date Added: 2009-06-07 09:15:45 |
| error.txt Path: Washington >> JOBS >> 71500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 12:41:47 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 13:51:06 2008 ( 4159 s elapsed) ... Date Added: 2009-06-07 09:16:49 |
| log.txt Path: Washington >> JOBS >> 71917 Fall, 2009 Description: 000 (61800.000.000) 02/17 08:44:49 Job submitted from host: <128.95.94.28:1092> . 001 (61800.000.000) 02/17 15:22:19 Job executing on host: <172.25.101.175:1055> . 006 (61800.000.000) 02/17 15:42:27 Image size of job updated: 372648 . 005 (61800.000.... Date Added: 2009-06-07 09:17:31 |
| error.txt Path: Washington >> JOBS >> 71776 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 14:05:00 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 15:23:16 2008 ( 4696 s elapsed) ... Date Added: 2009-06-07 09:19:38 |
| error.txt Path: Washington >> JOBS >> 71500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 15:14:31 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 16:30:33 2008 ( 4562 s elapsed) ... Date Added: 2009-06-07 09:19:41 |
| 27-SHA1.ppt Path: Rose-Hulman >> CSSE >> 479 Fall, 2009 Description: DTTF/NB479: Dszquphsbqiz Announcements: 1. Day 27 HW7 due next Tuesday. 1. SHA-1 implementation has been made a bonus problem 2. Details today 2. No class tomorrow Questions? This week: Discrete Logs, Diffie-Hellman, ElGamal Hash Functions an... Date Added: 2009-06-07 09:20:53 |
| 31-DigSigs2.ppt Path: Rose-Hulman >> CSSE >> 479 Fall, 2009 Description: DTTF/NB479: Dszquphsbqiz Announcements: 1. Day 31 SHA bonus due today (emailing to me is best) Questions? This week: Birthday attacks, Digital signatures, DSA RSA Signatures Alice chooses: Sig = f(user, message) p,q, n=pq, e: gcd(n, (p-1)(... Date Added: 2009-06-07 09:20:54 |
| Butyl alcohol.pdf Path: CofC >> RM >> 205 Fall, 2009 Description: Product Information (203) 740-3471 / Emergency Assistance CHEMTREC 1-800-424-9300 or 202-483-7616 MATERIAL SAFETY DATA SHEETS Part Number/Trade Name: N Butyl alcohol This MSDS is valid for all grades that start with catalog number 331 == General Inf... Date Added: 2009-06-07 09:21:14 |
| rubybridges-lessonplan2.doc Path: University of Illinois, Urbana Champaign >> CI >> 332 Fall, 2009 Description: Ruby Bridges Purpose 1. Essential Driving Question(s) a. What does it feel like to be treated differently? b. How can you make people who are different feel more accepted? c. What is the importance of diversity in your life? 2. Enduring Understanding... Date Added: 2009-06-07 09:21:56 |
| KINE 3301 Biomech Spring 09 Grade Calculation.xls Path: UT Arlington >> KINE >> 3301 Fall, 2008 Description: Vector Lab FirstName Homer Total LastName Simpson Possible Average 100 Ben JohnsonProjectile Projectile Walk/Run Graphing Lab Lab 100 100 100 100 100 100 100 100 Vertical Computing Angular Jump Energy in Kinematic Lab Excel 100 100 100 100 Center ... Date Added: 2009-06-07 09:21:57 |
| pH.pdf Path: Wisc Stevens Point >> CHEM >> 106 Fall, 2009 Description: Chemistry 106 - Fundamental Chemistry Spring Semester 1998 - pH and Equilibrium 1. A detergent solution has a pH of 11.13 at 25 C. What is the [OH-] in the solution? 2. What is the pOH of each of the following aqueous solutions? a. 2.5 x 10-3 M NaOH ... Date Added: 2009-06-07 09:22:18 |
| vidaenmx.pdf Path: UNC >> HIST >> 606 Spring, 2009 Description: ... Date Added: 2009-06-07 09:22:35 |
| prolog2.txt Path: UCSD >> CSE >> 130 Fall, 1999 Description: = Lecture 2 = - Cuts - - Ordering clauses and goals is a way to somewhat control the search and backtracking process, but it is very limited. - There is something called a \"cut\" that prevents Prolog from backtracking. - Example: Let\'s s... Date Added: 2009-06-07 09:23:52 |
| votipka.pdf Path: Illinois Tech >> CS >> 485 Fall, 2009 Description: CS 485 Computers and Terrorism Daniel Votipka CS 485 Computer Science Department Illinois Institute of Technology Chicago, Illinois 60616 dvotipka@iit.edu Abstract This paper gives an overview of the connection between computers and terrorism. It w... Date Added: 2009-06-07 09:26:33 |
| final06sol.pdf Path: Stanford >> EE >> 392 Fall, 2009 Description: 6.451 Principles of Digital Communication II MIT, Fall 2006 Final Exam Solutions Problem F.1 (100 points) December 19, 2006 Handout #31 This problem is concerned with Euclidean-space images of codes over the quaternary field F4 . We recall that the... Date Added: 2009-06-07 09:27:35 |
| HW4key2009.pdf Path: Colorado >> GEOL >> 1020 Fall, 2008 Description: There are five questions to this homework, please see the back of this sheet for problem #5. Homework #4 Geology 1020 Section 002 Name:_KEY_ (For full credit, you must hand this in before class on Thursday & WRITE CLEARLY) 1. Which combination of... Date Added: 2009-06-07 09:27:43 |
| ENG131SampleExamquestions.doc Path: N. Colorado >> ENG >> 131 Fall, 2009 Description: Dr. Kramp Summer 2003 ENG 131 Sample Exam Questions 1. Genesis includes accounts/stories of all of the following EXCEPT: a. The creation of the world b. The Tower of Babel c. Noah and the Flood d. The First Passover e. Joseph and his brothers 2. In t... Date Added: 2009-06-07 09:28:06 |
| ArnoldPaterWilde.ppt Path: N. Colorado >> ENG >> 245 Fall, 2009 Description: CharlesBaudelaire(18211867) FounderofSymbolistmovement emphasizedbeliefincorrespondences Inherentexistenceandsystematicanalogies betweenhumanmindandouterworld Alsobetweennaturalandspiritualworld Poetryexploitedsystemofprivatesymbols togenerateric... Date Added: 2009-06-07 09:28:08 |
| ArnoldPaterWilde.ppt Path: N. Colorado >> ENG >> 345 Fall, 2009 Description: CharlesBaudelaire(18211867) FounderofSymbolistmovement emphasizedbeliefincorrespondences Inherentexistenceandsystematicanalogies betweenhumanmindandouterworld Alsobetweennaturalandspiritualworld Poetryexploitedsystemofprivatesymbols togenerateric... Date Added: 2009-06-07 09:28:08 |
| Cross & Madson (1997).pdf Path: E. Kentucky >> PSY >> 837 Summer, 2008 Description: Psychological Bulletin 1997, \\bl. 122, No. 1,5-37 Copyright 1997 by the American Psychological Association, Inc. 0033-2909/97/S3.00 Models of the Self: Self-Construals and Gender Susan E. Cross and Laura Madson Iowa State University of Science and ... Date Added: 2009-06-07 09:28:48 |
| Mirel_1998.pdf Path: Texas Tech >> ENGLISH >> 5373 Fall, 2009 Description: ... Date Added: 2009-06-07 09:29:28 |
| hw8.12.8.13.doc Path: Syracuse >> CIE >> 337 Fall, 2008 Description: ... Date Added: 2009-06-07 09:29:44 |
| Electromagnetic Example.pdf Path: W. Alabama >> ME >> 269 Fall, 2009 Description: Amirhossein Hajimiragha (Amir) ahajimir at uwaterloo.ca Problem 2: If the flux density along the left-hand leg of the magnetic circuit shown in the above figure is B A =0.5 [T], find the coil current (I). The B-H curve of the magnetic material is as... Date Added: 2009-06-07 09:29:52 |
| study guide 2009.doc Path: UF >> FOS >> 4311 Spring, 2008 Description: Sample exam 1 Food Chemistry 2007 EXAMPLE QUESTIONS (2 pt) Waters importance in food systems relates to its ability a. all of these are correct b. to affect texture c. to affect preservation d. to be a solvent e. none of these are correct (2 pt) Wa... Date Added: 2009-06-07 09:30:35 |
| Lecture 2 Chatper 4.ppt Path: UF >> FOS >> 4321 Fall, 2009 Description: Welcome Back 1 Don\'t forget your library assignment Read Chapter 1-3, 4 2 Ch. 4: Evaluation of Analytical Data 3 The administrative process R&D Manager Lab manager Mr. A Ms. B Ms. C Mr. D 4 The Analytical Process Food Sampling Instrum... Date Added: 2009-06-07 09:30:37 |
| lec16.cap_electr.doc Path: UF >> FOS >> 6355 Fall, 2009 Description: INSTRUMENTAL ANALYSIS AND SEPARATIONS CAPILLARY ELECTROPHORESIS - LECTURE 16 Electrophoresis is the movement of electrically charged particles through a media such as a buffer system caused by an electric current. An electrophoresis system consists o... Date Added: 2009-06-07 09:30:43 |
| make up quiz 3.doc Path: Washington >> FIT >> 100 Fall, 2009 Description: Teasya Kusumo Psychology 480 Make up quiz #3 The Limit of reason Humans have always tried to act in the way that is rational in their mind. What I mean by rational is that there is always cause and effect to every action that they take. And they only... Date Added: 2009-06-07 09:32:08 |
| ReferenceLetter5.pdf Path: Penn State >> TLM >> 5022 Fall, 2009 Description: ... Date Added: 2009-06-07 09:32:32 |
| Q12.doc Path: Rose-Hulman >> CSSE >> 374 Fall, 2009 Description: CSSE 374 - Software Architecture and Design - Winter 2008-9 Quiz 12 Tuesday, January 13, 2009 Name:_ Grade:_ 1. Quick survey which of the following are you considering signing up for in spring: CSSE 490-02 Topics in Computer Science Bohner MTRF/... Date Added: 2009-06-07 09:34:12 |
| OracleApplet.txt Path: Gonzaga >> CPSC >> 421 Fall, 2009 Description: <HTML> <HEAD> <TITLE>Database applet</TITLE> </HEAD> <BODY> <HR> <APPLET CODEBASE = \".\" CODE = \"OracleApplet.class\" ARCHIVE = \"classes12.zip\" NAME = \"test applet\" WIDTH = 600 HEIGHT = 400 HSPACE = 0 VSPA... Date Added: 2009-06-07 09:35:32 |
| moxey.pdf Path: Delaware >> ARTH >> 667 Fall, 2008 Description: ... Date Added: 2009-06-07 09:35:39 |
| THE EIFFEL TOWER.pdf Path: Delaware >> ARTH >> 667 Fall, 2008 Description: ... Date Added: 2009-06-07 09:35:40 |
| 20060202 MDOF and Bingol.pdf Path: Purdue >> CE >> 597 Fall, 2008 Description: ... Date Added: 2009-06-07 09:38:21 |
| probset3.ps Path: UF >> PHZ >> 7427 Spring, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.78 Copyright 1998 Radical Eye Software (www.radicaleye.com) %Title: probset3.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMR12 CMTT12 CMSY10 CMMI12 CMEX10 CMMI8 CMR8 %+ CMTI12 ... Date Added: 2009-06-07 09:39:23 |
| Lecture07.ps Path: Mich Tech >> CS >> 4431 Fall, 2008 Description: #%-12345X@PJL JOB @PJL SET RESOLUTION = 600 @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - Lecture07 %Creator: PScript5.dll Version 5.2 %CreationDate: 9/26/2002 15:43:38 %For: Administrator %Bo... Date Added: 2009-06-07 09:39:24 |
| B.ps Path: University of Hawaii - Hilo >> KA >> 9901 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: MATLAB, The Mathworks, Inc. %Title: B.ps %CreationDate: 04/09/99 10:25:04 %DocumentNeededFonts: Helvetica-Bold %+ Helvetica %DocumentProcessColors: Cyan Magenta Yellow Black %Extensions: CMYK %Pages: (atend) %BoundingBox: (at... Date Added: 2009-06-07 09:39:42 |
| beatlespresentation.ppt Path: Penn State >> HST >> 5004 Fall, 2009 Description: Hello, Goodbye From about 19641970 the Beatles were the world\'s most famous band. Since then, there have been movies, books, articles, college courses, etc. about them. The Beatles are legendary! They sold over 1 billion (1,000,000,000) CDs and vide... Date Added: 2009-06-07 09:40:22 |
| lecture27.pdf Path: Berkeley >> CS >> 164 Fall, 2008 Description: Global Optimization Lecture 27 (From notes by R. Bodik & G. Necula) 4/28/09 Prof. Hilfinger CS164 Lecture 27 1 Administrative HW #6 was posted online this evening. Version #2 of project 3 files: representation now complete, but still a bit of w... Date Added: 2009-06-07 09:41:41 |
| lecture30a.pdf Path: Berkeley >> CS >> 164 Fall, 2008 Description: Language Security Lecture 30A (from notes by G. Necula) 5/6/2009 Prof. Hilfinger CS 164 Lecture 30A 1 Lecture Outline Beyond compilers Looking at other issues in programming language design and tools C Arrays Exploiting buffer overruns Det... Date Added: 2009-06-07 09:41:42 |
| schedulepartone.pdf Path: Richmond >> M >> 231 Fall, 2008 Description: Course Schedule and Assignments Part I MATH 231 Fall 2006 Caudill Day 1 2 3 Date M 8/28 W 8/30 F 9/1 Sections To Be Covered in Class math and science regression models I regression models II Assignments Due Computer Assignment 0* HW Supplement S1 ... Date Added: 2009-06-07 09:41:53 |
| m235e2solns.pdf Path: Richmond >> M >> 235 Fall, 2009 Description: ... Date Added: 2009-06-07 09:41:55 |
| q7answers.pdf Path: Richmond >> M >> 212 Fall, 2009 Description: ... Date Added: 2009-06-07 09:42:04 |
| GT5_answers.pdf Path: Richmond >> M >> 211 Fall, 2009 Description: ... Date Added: 2009-06-07 09:42:06 |
| 9_3.ppt Path: Hope >> GERMAN >> 102 Fall, 2009 Description: Guten Tag! Mittwoch den 4.3 Hallo v.2 Moin moin! Moin! Gr Gott! Hi! Servus! Bye Auf Wiederschauen Tschssle Ade! Pfiat di! Machs gut! Wie gehts? Wie gehts? Wie geht es dir? Wie geht es Ihnen? Wie es mir geht? Es geht. Es geht so.... Date Added: 2009-06-07 09:43:02 |
| CCSI 330 HOMEWORK 04 FA 06.doc Path: DeVry Mesa >> FACULTY >> 330 Fall, 2009 Description: CCSI 330 Student Name Instructor Part Maximum Points Digital Crime: Evidence and Procedure HW 4 Section Due Date 25 points 1 25 points 2 25 points 3 25 points 4 Total 100 points Your Score Textbook Reading Assignment Read ... Date Added: 2009-06-07 09:43:52 |
| 14MassSpec.pdf Path: University of Illinois, Urbana Champaign >> GEO >> 562 Fall, 2009 Description: Mass spectrometry Reading: White #15, F&M 4.4 Also Required: Visit and study Pudue AMS lab web site: http:/www.physics.purdue.edu/primelab/ Guide Questions: What is the means used to separate isotopes in most isotope ratio mass specs? What means is u... Date Added: 2009-06-07 09:44:36 |
| M1312_ASSN_10.pdf Path: U. Houston >> MATH >> 1312 Fall, 2008 Description: Math 1312 Assignment 10 Sections 7.1-7.3, 8.1 Name: _ Grading ID: _ Find the area of each figure: 1. 7 12 2 10 10 2 12 21 1. Area = _ 2. Find the area of the parallelogram. 15 12 2. Area = _ 3. Find the area of the shaded region: 30 3. A... Date Added: 2009-06-07 09:46:40 |
| BITSC481_32.pdf Path: East Los Angeles College >> BITSC >> 481 Fall, 2009 Description: Today\'s Menu Data Link Layer Introduction and services Error detection and correction Multiple access protocols Link-layer Addressing Link Layer: Introduction Hosts and routers are nodes Communication channels that connect adjacent nodes along commu... Date Added: 2009-06-07 09:47:17 |
| 19_Bacteria.pdf Path: Washington >> BIOL >> 180 Winter, 2008 Description: Outline: Bacteria Archaea 1. 2. Defining features of these organisms Reasons to study these organisms II. Diversity of Bacteria & Archaea 1. 2. Metabolic diversity Habitat diversity III. Relevance of Bact... Date Added: 2009-06-07 09:47:37 |
| ch13.ppt Path: George Mason >> CH >> 643 Fall, 2009 Description: C ORPORATE FINANCE Fourth Edition CHAPTER 13: EFFICIENT CAPITAL MARKETS s What is an efficient market? s How is the information available to investors related to market efficiency? s What are the implications of the EMH for corporate managers? s A... Date Added: 2009-06-07 09:48:48 |
| Problems 11.xls Path: George Mason >> MBA >> 704 Fall, 2008 Description: data Variance-covariance matrix La-Z-Boy Kimball Flexsteel Leggett Miller Shaw La-Z-Boy 0.1267 0.0438 0.1971 0.0541 0.0625 0.1088 Kimball 0.0438 0.0713 0.0492 0.0068 0.0384 0.0296 Flexsteel 0.1971 0.0492 0.3667 0.0853 0.0975 0.1636 Leggett 0.0541 0.... Date Added: 2009-06-07 09:49:04 |
| my1170_lab_8.ps Path: Utah >> MATH >> 1170 Fall, 2008 Description: %!PS-Adobe-2.0 %Title: my1170_lab_8.mws - [Server 1] %Creator: Maple 8.00 SUN SPARC SOLARIS %DocumentFonts: Times-Roman Times-Bold Courier Times-Italic Symbol %Pages: 3 %EndComments /sc { setrgbcolor } def % color /stc { setrgbcolor } def % color % /... Date Added: 2009-06-07 09:49:19 |
| page 3.pdf Path: San Diego State >> DESIGN >> 240 Fall, 2009 Description: ... Date Added: 2009-06-07 09:51:37 |
| JavaHTP6e_29.ppt Path: Uni. Westminster >> CS >> 465 Fall, 2009 Description: 1 2 9 Strings, Characters and Regular Expressions 2005 Pearson Education, Inc. All rights reserved. 2 The chief defect of Henry King Was chewing little bits of string. -Hilaire Belloc Vigorous writing is concise. A sentence should contain no unne... Date Added: 2009-06-07 09:51:50 |
| Section6.2Notes.ppt Path: Fort Lewis >> CS >> 106 Fall, 2009 Description: Section 6.2 Lists and Loops Modified By: Evans Adams October 2007 6.2 Processing Lists of Data with Do Loops Display all or selected items from lists Search lists for specific items Perform calculations on the numerical entries of a list Termino... Date Added: 2009-06-07 09:54:58 |
| lecture_11.pdf Path: UCSB >> ME >> 153 Spring, 2008 Description: Modeling and Simulation S. Laguette ME 153 Spring 2009 April 29, 2009 1 4/29/09 ME153 Modeling and Simulation Role of Models in Engineering Design Mathematical Modeling Scale Models Computer Modeling FEA Rapid Prototyping 2 4/29/09 ME153 Rol... Date Added: 2009-06-07 09:55:51 |
| ME158 Intro.ppt Path: UCSB >> ME >> 158 Spring, 2008 Description: Computer Aided Manufacturing ME158 Winter 2005 What are we doing in this class? Mostly learning to program automated tools using MasterCAM Learning a bit about how automated tools work and how to operate them Two labs in the shop where you will ope... Date Added: 2009-06-07 09:56:10 |
| 07042408.pdf Path: Wisconsin >> SH >> 070424 Fall, 2009 Description: ... Date Added: 2009-06-07 09:56:30 |
| eg3.pdf Path: Western Michigan >> STAT >> 560 Fall, 2009 Description: Stat560 Example #3 conditional probability P ROBLEM 1 (3.5 ) 2160 6 5 9 8 = = 0.0660. 15 14 13 12 32760 P ROBLEM 2 (3.9 ) Denote Wi (Ri ) the event that the ball selected from urn i is white (red), i = A, B, C. Also denote E the event that th... Date Added: 2009-06-07 09:57:15 |
| d3520.pdf Path: East Los Angeles College >> L >> 211 Fall, 2009 Description: L211 Le temps de vivre 1 Envol T Thema 1 Sesion 1 Upper intermediate French 1 This publication forms part of an Open University course L211 Envol: upper intermediate French. Details of this and other Open University courses can be obtained f... Date Added: 2009-06-07 09:57:45 |
| Hints on Line Integrals.doc Path: UNC Wilmington >> M >> 261 Fall, 2009 Description: Hints on Line Itegrals r r W = F dr C Is No Yes Is C closed? No Yes No Is C closed? Yes W=0 Parametrize and Integrate rrr W = FdS R Case 1. Parametrize and Integrate r r r r a) C is a line joining A and B: Use r (t ) = A + t ( B - A) r r r b... Date Added: 2009-06-07 09:57:56 |
| FrettholdChristine_set04.pdf Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009 Description: Fretthold, Christine E p112s09 Due Wed, Feb 25, 2009 at 23:30 Physics 112: General Physics II Section 1 Set 4 CA ID 2161 PA by an outside agent to move these charges slowly and steadily until they are 38.5 cm apart? 12. [2pt] What voltage is require... Date Added: 2009-06-07 09:59:04 |
| NSA 290 FINAL PROJECT PEER EVALUATION SP 07.doc Path: DeVry Mesa >> FACULTY >> 290 Fall, 2009 Description: NSA 290 Team Name Final Project Peer Evaluation Sheet Section Project Title This sheet is to be completed by every member of your team. (I) (I) (III) Truthfully, estimate the contribution of each team member to the p... Date Added: 2009-06-07 10:00:03 |
| RSCH8110 HW6 Ch7.doc Path: UNC Charlotte >> CWANG >> 8110 Fall, 2009 Description: Homework 6 (Chapter 7) Statistics for the Behavioral Sciences Page 221 2. For a sample selected from a population with a mean of = 50 and a standard deviation of = 10: a) What is the expected value of M and the standard error of M for a sample of n... Date Added: 2009-06-07 10:01:01 |
| week 10 answer.doc Path: UNC Charlotte >> CWANG >> 6101 Fall, 2009 Description: Topic 11: Program Evaluation 1. Program evaluation. 2. Program evaluation. 3. Yes. 4. Summative. 5. Formative. (Note: Measurement of job placement would be necessary to conduct a summative evaluation.) 6. Formative. 7. Formative. 8. Formative. 9. Sum... Date Added: 2009-06-07 10:01:12 |
| week 8 answer.doc Path: UNC Charlotte >> CWANG >> 6101 Fall, 2009 Description: Topic 25: Introduction to Validity 1. Instrument. 2. Measures what it is designed to measure and accurately performs the function(s) it is purported to perform. 3. Yes. 4. Yes. 5. Reduces it. 6. Difficult. 7. Sample answer: The purpose was to measure... Date Added: 2009-06-07 10:01:12 |
| LEC-04[1].pdf Path: Allan Hancock College >> MECH >> 3400 Fall, 2009 Description: Comb. + 4-1 CHEMICAL EQUILIBRIUM -Thermodynamic relations for Systems with variable number of moles N : dU = T dS - P dV + dN dH = T dS + V dP + dN dG = -S dT + V dP + dN where U=U(S,V,N) Comb. CHEMICAL EQUILIBRIUM 1A + -B + . +C + +D + . 2 3 ... Date Added: 2009-06-07 10:01:41 |
| types1.ps Path: Syracuse >> CSE >> 607 Spring, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: types1.dvi %Pages: 13 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips -otypes1.ps types1 %DVIPSPara... Date Added: 2009-06-07 10:02:37 |
| Evening_Lecture_14.pdf Path: Rutgers >> CHEM >> 307 Fall, 2009 Description: ... Date Added: 2009-06-07 10:03:00 |
| CalcI_Ch1_s1.pdf Path: SUNY IT >> CALC >> 151 Fall, 2009 Description: ... Date Added: 2009-06-07 10:03:15 |
| edu 339 exam.pdf Path: Wisc Stevens Point >> GSNID >> 640 Fall, 2009 Description: Name:_ Ms. Snider Cold War Unit Exam Please answer TWO of the following three essay questions. If you write for all three, keep in mind that only the first two responses will be graded. 1. Explain how cause and effect relationships affected the Col... Date Added: 2009-06-07 10:03:29 |
| 3.2.2.ppt Path: University of Illinois, Urbana Champaign >> UNIT >> 248 Fall, 2009 Description: Evans & Kihlstrom subjects hypnotized and given 12 tests heading nodding eyes close hand lowering arm immobilization finger lock arm rigidity hands moving together communication inhibition fly hallucination eye catalepsy post hypnotic suggestion to ... Date Added: 2009-06-07 10:04:07 |
| BG205-Mod8-Part2-markers.txt Path: Colorado State >> BG >> 205 Fall, 2009 Description: # Impatica OnCue marker file format v1.0 00:00:00.0 $1-423_1 Fundamentals of Business Law 00:00:11.0 1 Paragraph 2, Slide 1 00:00:38.8 1 Paragraph 4, Slide 1 00:01:13.0 &1 Paragr... Date Added: 2009-06-07 10:05:29 |
| IntroSA3300.ps Path: Bowling Green >> CIS >> 3300 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - IntroSA3300.ppt %Creator: Windows NT 4.0 %CreationDate: 10:58 1/14/1999 %Pages: (atend) %BoundingBox: 16 14 597 779 %LanguageLevel: 1 %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend) %EndComm... Date Added: 2009-06-07 10:05:44 |
| Dance 2-aerobics.doc Path: Allan Hancock College >> TB >> 863 Fall, 2009 Description: PHYSICAL EDUCATION LESSON PLAN TOPIC: Dance LESSON: 2 Aerobic No. Students: 13 Date: VENUE: Outside Year Level: 3/4 Duration: 45 minutes Objectives: Students will be able to demonstrate: Motor skills such as skipping and hopping, moving their body... Date Added: 2009-06-07 10:06:49 |
| TripGeneration_ITE.pdf Path: Iowa State >> CE >> 355 Fall, 2009 Description: ... Date Added: 2009-06-07 10:09:12 |
| NumberSystems.doc Path: RIT >> CS >> 351 Fall, 2009 Description: Bit representations How many different representations can we make with n bits? Each bit could be a 0 or a 1 - two possibilities 2n possibilities with n bits We can represent 2n possibilities with n bits What are some common representations for whol... Date Added: 2009-06-07 10:09:16 |
| Grammar.pdf Path: RIT >> CS >> 450 Fall, 2009 Description: Languages What do we mean by a programming language? What are the legal programs in the language? What is the meaning of a legal program? Syntax refers to the rules that describe what is legal Semantics refers to the meaning Definitions used in def... Date Added: 2009-06-07 10:09:29 |
| Anastasio-Red-Black-Trees-2.ppt Path: RIT >> CS >> 800 Fall, 2008 Description: Red-Black Trees Bottom-Up Deletion Recall \"ordinary\" BST Delete 1. If vertex to be deleted is a leaf, just delete it. 2. If vertex to be deleted has just one child, replace it with that child 3. If vertex to be deleted has two children, replace the ... Date Added: 2009-06-07 10:09:50 |
| Matrix.ps Path: RIT >> CS >> 318 Fall, 2009 Description: #%-12345X@PJL JOB @PJL SET HOLD=OFF @PJL SET RESOLUTION = 600 @PJL SET BITSPERPIXEL = 2 @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: Microsoft Word - Matrix.doc %Creator: Pscript.dll Version 5.0 %CreationDate: 12/9... Date Added: 2009-06-07 10:09:58 |
| Anastasio-Red-Black-Trees-2.ppt Path: RIT >> CS >> 515 Fall, 2009 Description: Red-Black Trees Bottom-Up Deletion Recall \"ordinary\" BST Delete 1. If vertex to be deleted is a leaf, just delete it. 2. If vertex to be deleted has just one child, replace it with that child 3. If vertex to be deleted has two children, replace the ... Date Added: 2009-06-07 10:10:21 |
| worksheet-6.pdf Path: Colorado >> CSCI >> 3155 Fall, 2008 Description: CSCI 3155: Principles of Programming Languages Exercise sheet #6 12th June 2007 Group name: Scoping, Parameter Passing, Basics of Types This is mostly a lab exercise, using the PL Detective. Note that we have not yet made the system fully reentrant... Date Added: 2009-06-07 10:11:48 |
| IAR Embedded Workbench IDE User Guide for ARM.pdf Path: Georgia Tech >> ECE >> 3884 Fall, 2008 Description: IAR Embedded Workbench IDE User Guide for Advanced RISC Machines Ltd\'s ARM Cores COPYRIGHT NOTICE Copyright 19992008 IAR Systems AB. No part of this document may be reproduced without the prior written consent of IAR Systems AB. The software descr... Date Added: 2009-06-07 10:12:42 |
| 2472.txt Path: UNC >> DOCS >> 2472 Fall, 2009 Description: The Project Gutenberg EBook of White Lies, by Charles Reade This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg Lice... Date Added: 2009-06-07 10:14:22 |
| 24807-8.txt Path: UNC >> DOCS >> 24807 Fall, 2009 Description: The Project Gutenberg EBook of A Memory Of The Southern Seas, by Louis Becke This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Proje... Date Added: 2009-06-07 10:14:47 |
| 24076-8.txt Path: UNC >> DOCS >> 24076 Fall, 2009 Description: The Project Gutenberg eBook, Vegetable Dyes, by Ethel M. Mairet This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg... Date Added: 2009-06-07 10:14:48 |
| 24753-8.txt Path: UNC >> DOCS >> 24753 Fall, 2009 Description: The Project Gutenberg eBook, Who Are Happiest? and Other Stories, by T. S. Arthur, Illustrated by Croome This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use i... Date Added: 2009-06-07 10:15:06 |
| 24756-8.txt Path: UNC >> DOCS >> 24756 Fall, 2009 Description: The Project Gutenberg EBook of The Story of General Gordon, by Jeanie Lang This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project... Date Added: 2009-06-07 10:15:33 |
| Woodforde.pdf Path: CSU Sacramento >> HIST >> 127 Fall, 2009 Description: :j 00 -J r.s;., ~\'.J ~ ~ 5\" ~ > ;. e: MOO ~ S\' ~ rn = . 0 0 ~ . ~ 0 =d I ~ = C\" r \'0 Z ~ 5. S\' cnAI ;. ~ ;. rr; . 9 ~ s ~ ~ Ao:f, 0. 8 E: \'< ~ ~ ;\' \'; ~ e ~ ~. ~ 8 oq 3 g g- ~ . ~ ~ cnO~ E. c: a ~ ~.~=\' ~ =\' A~ no 5.6\' ;. A- ~. bJ ... Date Added: 2009-06-07 10:18:57 |
| a4.ps Path: Princeton >> CS >> 341 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: a4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMR12 CMBX10 CMTI10 CMMI10 CMEX10 CMR8 CMSY8 %+ CMMI8 CMSY10 %DocumentPaperSiz... Date Added: 2009-06-07 10:19:18 |
| LING978.pdf Path: Allan Hancock College >> LING >> 978 Fall, 2009 Description: LING978 DISCOURSE ANALYSIS UNIT GUIDE Students should read this unit outline carefully at the start of semester. It contains important information about the unit. If anything in it is unclear, please consult the Unit Convener. TEACHING STAFF Unit Co... Date Added: 2009-06-07 10:20:15 |
| TRAN 855.pdf Path: Allan Hancock College >> TRAN >> 855 Fall, 2009 Description: TRAN855 CONTRASTIVE LANGUAGE STUDIES UNIT GUIDE Students should read this unit outline carefully at the start of semester. It contains important information about the unit. If anything in it is unclear, please consult the Unit Convener. TEACHING STA... Date Added: 2009-06-07 10:20:17 |
| CNMH.pdf Path: Bridgewater State >> WIRELESS >> 0708 Fall, 2009 Description: Course Descriptions MENTAL HEALTH COUNSELING (CNMH) CNMH 534 The Professional Counselor: Standards, Ethics, and Legal Issues (3 credits) This course, which is for the graduate counseling student who intends to work in mental health or PreK-12 setting... Date Added: 2009-06-07 10:21:13 |
| CE479_HW6.pdf Path: Purdue >> CE >> 479 Fall, 2008 Description: CE479 Fall 2008 Assignment #6 25 points Due Friday 10/31/08 1. (7 points) The single story commercial building shown below uses 15/32 in. Structural I sheathing. Assume this is adequate for sheathing loads. Critical lateral forces are wu = wT = 320... Date Added: 2009-06-07 10:22:00 |
| doc1180345760.doc Path: East Los Angeles College >> CC >> 1206 Fall, 2009 Description: Analogue Crib Sheet Diode Types: Ideal Rectifying ID = for V>0 Ideal Junction Diode ID = Is(exp(qV/kT)-1) Zener Diode ID = Is(exp(qV/kT)-1) but conductive when V < Vbreakdown Schottkey ID = Is(exp(qV/kT)-1) but Is is greater Voltage Regulation Zene... Date Added: 2009-06-07 10:24:27 |
| Optics grades - 17 apr 08.doc Path: BYU >> PHY >> 471 Fall, 2009 Description: Optics grades 17 Apr 2008 curvecurrent letter grade if no E B+ B+ AAB C DB AC+ A AA C+ C+ A+ C+ A B E B C+ B+ B C+ C B C+ B fraction of total grade, weighted 0.108 0.638 0.623 0.649 0.657 0.572 0.473 0.378 0.599 0.647 0.525 0.674 0.665 0.679 0.521 ... Date Added: 2009-06-07 10:27:11 |
| lecture28.pdf Path: San Diego State >> PHYS >> 410 Fall, 2008 Description: Lecture 28 Outline - End of Chapter 3 Quiz time! Will cover the following in terms of p and H Determinate States [Section 3.2.2] Eigenfunctions of Hermitian Operators [Section 3.3.2] Generalised Statistical Interpretation [Section 3.4] Matrix Ele... Date Added: 2009-06-07 10:27:46 |
| lecture15.ps Path: San Diego State >> PHYS >> 610 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: lecture15.dvi %Pages: 16 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMSY10 CMR12 CMMI12 CMSY8 CMMI8 CMR6 CMR8 MSBM10 ... Date Added: 2009-06-07 10:27:55 |
| prob2.doc Path: ASU >> CHM >> 331 Fall, 2009 Description: Copyright, Arizona State University Alkyl Halide PROBLEMS return to General Problems page Distinguishing E1, E2, SN1 and SN2 In each case, give the major organic product of the following reaction and state whether the mechanism is likely to be SN1... Date Added: 2009-06-07 10:28:34 |
| Chapter4.doc Path: Duke >> PHY >> 037 Fall, 2009 Description: D U K E P H Y S I C S L A B O R A T O R Y 4 D C C I R C U I T S Pre-Lab Activity 1. A conductor of radius r, length l, and resistivity has resistance R. It is melted down and formed into a new conductor, also cylindrical, with the length of the ... Date Added: 2009-06-07 10:29:22 |
| public.pdf Path: Maryville MO >> JAMESM >> 050307 Winter, 2009 Description: Public Abstract First Name:Matthew Middle Name:Bert Last Name:James Adviser\'s First Name:Fu-hung Adviser\'s Last Name:Hsieh Co-Adviser\'s First Name: Co-Adviser\'s Last Name: Graduation Term:WS 2007 Department:Food Science Degree:MS Title:Physical and C... Date Added: 2009-06-07 10:30:27 |
| public.pdf Path: Maryville MO >> MATTHEWJ >> 050307 Winter, 2009 Description: Public Abstract First Name:Matthew Middle Name:Bert Last Name:James Adviser\'s First Name:Fu-hung Adviser\'s Last Name:Hsieh Co-Adviser\'s First Name: Co-Adviser\'s Last Name: Graduation Term:WS 2007 Department:Food Science Degree:MS Title:Physical and C... Date Added: 2009-06-07 10:30:30 |
| 761B-31Mar-02Apr2008SumLec.pdf Path: UWO >> SS >> 761 Winter, 2009 Description: SS761B Week of 31 March - 02 April 2008 SUMMARY OF IMPORTANT POINTS DISCUSSED IN THE LECTURE The following concepts/theories were covered/reviewed: 1. Review of the HJM Model under a risk-neutral measure Dynamics of the forward rate f (t, T ) : df... Date Added: 2009-06-07 10:30:36 |
| 1196805768-99.234.72.222.txt Path: Toledo >> PSY >> 230 Fall, 2009 Description: 10d5b174 33324543332344555433334-252344-1-224335324335243211113334254... Date Added: 2009-06-07 10:31:14 |
| 1196908636-99.229.34.215.txt Path: Toledo >> PSY >> 230 Fall, 2009 Description: 10E39467 452646343143123444322244-13313223636466545-16541423353434152... Date Added: 2009-06-07 10:31:20 |
| 1196923332-142.151.149.73.txt Path: Toledo >> PSY >> 230 Fall, 2009 Description: 11571E58 366542223224413534253113222212315646466253515531112356445153... Date Added: 2009-06-07 10:31:23 |
| IS-LM.pdf Path: Norwich >> EC >> 302 Fall, 2009 Description: EC302 Goal i.e. where are we going: policy decision(s) to solve problem of recession or inflation policy tools available to government 1. monetary policy change nominal money supply (Ms) via actions of Fed 2. fiscal policy government expenditure taxe... Date Added: 2009-06-07 10:31:30 |
| output.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-61WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2420 02/10/2008 10:02 PM <DIR> . 02/10/2008 10:02 ... Date Added: 2009-06-07 10:32:57 |
| submit.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: executable = pass6_31859.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31859... Date Added: 2009-06-07 10:33:07 |
| error.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 00:16:05 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 00:57:02 2008 ( 2457 s elapsed) ... Date Added: 2009-06-07 10:34:46 |
| submit.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: executable = pass6_31977.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31977... Date Added: 2009-06-07 10:35:23 |
| EE6325prj1.doc Path: Dallas >> EE >> 6325 Fall, 2008 Description: DESCRIPTION FOR VERILOG/VHDL PROJECT #1 Due August 31 7pm (start of class) Late Penalty: 10% per weekday (M-F) Project Introduction This project will be relatively simple, but we would like you to get a clear idea of what you would like to build for... Date Added: 2009-06-07 10:36:31 |
| SSAD_LCA_QR_F04a_T04.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: 56ce7ca1144eaedecb6b677bcfe181fc12993151.xls - Areas of Concern Log - Abhyuday Project Name: Team 4 Artifact: SSAD Module: Complete document Elaboration MBASE Phase/level: Activity: Design Exit Criteria: MBASE, LCA Review # Review Date: Review Time: ... Date Added: 2009-06-07 10:37:15 |
| f12.pdf Path: Oregon State >> ECE >> 478 Fall, 2008 Description: dtbuf E E rseed rseed E E rseed E E rseed E rbuf rbuf rbuf K[16.23] K[8.15] K[0.7] Figure 15.12 PGP Session Key and IV Generation (steps G2 through G8) ... Date Added: 2009-06-07 10:37:53 |
| harvey10.pdf Path: SUNY Buffalo >> DMS >> 434 Fall, 2009 Description: David Harvey, The Condition of Postmodernity: An Inquiry into the Conditions of Cultural Change (Oxford; Blackwell, 1989), pp. 173-188. 10 Theorizing the transition To the degree that we are witnessing a historical transition, still far from complet... Date Added: 2009-06-07 10:38:11 |
| automata09.pdf Path: Allan Hancock College >> CS >> 3153 Fall, 2009 Description: Automata Theory 101 Ralf Huuck Session 1 2008 Ralf Huuck 1 Today last time: Kripke structures / CTL Session 1 2008 Ralf Huuck 2 O ut l i ne Introduction Finite Automata -Automata Session 1 2008 Ralf Huuck 3 Introduction Session 1 2008... Date Added: 2009-06-07 10:38:51 |
| intro.pdf Path: Harvey Mudd College >> CS >> 155 Fall, 2000 Description: a long long time ago . CG an almost factual account of the history of computer graphics before buzz . before quake . before microsloth windows . before most of you were born . the world existed without computer graphics 8/20/2005 CS155 Computer Gra... Date Added: 2009-06-07 10:39:32 |
| rt4.ppt Path: Harvey Mudd College >> CS >> 155 Fall, 2000 Description: cs155 z swe dyk e ray tracing ray tracing sim ray casting ple recursive ray tracing che tricks ap optim izations global e cts ffe shadows cular re ction fle spe ission transm ray tracing l cast ray through pixe into sce ne st rse find c... Date Added: 2009-06-07 10:39:34 |
| pub81.pdf Path: Allan Hancock College >> PAGE >> 28314 Fall, 2009 Description: Crustal Rheology and its Effect on Rift Basin Styles A. P. Gartrell Tectonics Special Research Centre, School of Applied Geology, Curtin University of Technology G.P.O. Box U1987, Perth, WA 6845, Australia Abstract Rheological stratification within ... Date Added: 2009-06-07 10:40:28 |
| tecp4ch16B09.ppt Path: Maple Springs >> NATS >> 1740 Fall, 2009 Description: 16.3 Structure Formation Our Goals for Learning What is the role of dark matter in galaxy formation? What are the largest structures in the universe? Clicker Question: What is the role of dark matter in galaxy formation? Gravity of dark matter ... Date Added: 2009-06-07 10:40:30 |
| 0504_Leg_Committee_Mins.pdf Path: Allan Hancock College >> PAGE >> 112320 Fall, 2009 Description: ... Date Added: 2009-06-07 10:40:31 |
| twenty_sim_guide.pdf Path: Cleveland State >> MCE >> 503 Fall, 2009 Description: MCE 503: Modeling and Simulation of Mechatronic Systems Overview of the 20-Sim Software October 16, 2006 1 Background 20-Sim is a general purpose modeling tool. It understands bond graphs as well as conventional iconbased modeling. The package is ... Date Added: 2009-06-07 10:40:41 |
| courseinfo.pdf Path: Toledo >> DGP >> 199 Fall, 2009 Description: SCI 199Y L0161 The Impact of Society Upon Computers 2005 - 2006 The introduction of computers, new types of computers, or new software into an arena often causes dramatic changes. That is the impact of computers upon society. But there is always some... Date Added: 2009-06-07 10:40:47 |
| problem 3-ssI-07.doc Path: Laurentian >> ECON >> 1010 Fall, 2009 Description: ECONOMICS 1010 A PROBLEM # 3 J. ALLEN Given the following utility functions for an individual for three goods: Summer I, 2007 GOOD A Q 1 2 3 4 5 6 TU 21 41 59 74 85 91 MU Q 1 2 3 4 5 6 GOOD B TU 7 13 18 22 25 27 MU Q 1 2 3 4 5 6 GOOD C TU MU 23 ... Date Added: 2009-06-07 10:42:28 |
| student308.pdf Path: Maryville MO >> ARTSCI >> 308 Fall, 2009 Description: Student Directions for Room 308 Independence Hall Multimedia Classroom 9/4/04 The 22 computers are G4 Macintosh PowerPCs with CD/DVD and zip drives. There are no floppy drives. Students can also bring their work on USB drives (sometimes called pen ... Date Added: 2009-06-07 10:42:50 |
| 2005-September.txt Path: Valdosta >> MLIS >> 7100 Fall, 2008 Description: From verablair at yahoo.com Thu Sep 1 08:08:27 2005 From: verablair at yahoo.com (vera blair) Date: Thu Sep 1 08:08:37 2005 Subject: [Mlis7100] Discussion 3, Electronic Database Acquisition. Message-ID: <20050901120827.8869.qmail@web32610.mail.mud... Date Added: 2009-06-07 10:42:54 |
| TS_SPRING_07.xls Path: MIT >> UMB >> 113 Fall, 2009 Description: TUTOR SCHEDULE FOR SPRING 2007 MONDAY 8AM-9AM 9AM-10AM 10AM-11AM 11AM-12PM 12PM-1PM 1PM-2PM 2PM-3PM 3PM-4PM 4PM-5PM TA\'S Jacques Beljean Samir Laoui Fernendo Moreno Albert Kamanzi will assist in the TA tutor room periodically Samir Fernando/Jacques S... Date Added: 2009-06-07 10:45:29 |
| Practice0q.xls Path: Trinity U >> EXAM >> 5341 Fall, 2009 Description: This is an adaptation of an example starting on Page 32 of a FASB document that can be downloaded free from at http:/www. Trinity students may go to Page 36 of the document on the path J:\\courses\\acct5341\\fasb\\sfas133\\dersum22.doc The FASB document o... Date Added: 2009-06-07 10:45:35 |
| syllabus.ps Path: Kentucky >> CS >> 621 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: syllabus.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o syllabus.ps syllabus.d... Date Added: 2009-06-07 10:46:06 |
| HW2_solutions.pdf Path: Rose-Hulman >> ECE >> 370 Fall, 2009 Description: ECE370 POWER SYSTEMS I Homework Set 2 Solutions 2.1 a) b) c) A single-phase source has a terminal voltage V = 120/-150 V. It supplies a current of I = 15/450 A to an electrical load. Find the complex power supplied by the source. Determine the real ... Date Added: 2009-06-07 10:46:50 |
| LogisticRegression.pdf Path: Temple >> CIS >> 603 Fall, 2009 Description: CIS603 - Artificial Intelligence Logistic regression Vasileios Megalooikonomou (some material adopted from notes by M. Hauskrecht) CIS603 - AI Supervised learning Data: D = {d1 , d 2 ,., d n } a set of n examples d i =< x i , yi > x i is input ve... Date Added: 2009-06-07 10:47:34 |
| ws09.pdf Path: Rose-Hulman >> MA >> 371 Fall, 2009 Description: Linear Algebra I Worksheet #9 Professor Broughton Name: due Thursday, May 9 Box #: 1. Eigenvalues and diagonalization 1. Let 0 0 1 A= 0 2 0 3 0 4 Calculate the characteristic polynomial of A and then the eigenvalues of A. 2. Find a basis for ea... Date Added: 2009-06-07 10:48:34 |
| n270.ps Path: Arizona >> Q >> 0453 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:09:54 2001 %DocumentData: Clean... Date Added: 2009-06-07 10:49:18 |
| Application.ppt Path: Washington >> STUDENTS >> 510 Fall, 2009 Description: Application of IR Behavior of Journalists Journalists Face Different Information Needs Uncertainty initiates the process (Kevin) Sifting and skimming (Sara) Social networks (Gabor) Other Available Tools Numerous internet sites for journali... Date Added: 2009-06-07 10:52:53 |
| Lecture17_2009_4pp.pdf Path: Washington >> BIOC >> 441 Winter, 2008 Description: Biochemistry 441 Lecture 17 Ted Young February 18, 2009 Topics for today: DNA tertiary structure and DNA topoisomerases 1 Are we wiser than Winnie-the-Pooh, the bear of very little brain? \"When we\'ve mutated the genes and integrated the neurons and... Date Added: 2009-06-07 10:54:58 |
| 24196-8.txt Path: UNC >> DOCS >> 24196 Fall, 2009 Description: The Project Gutenberg EBook of Victory, by Lester del Rey This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg Licens... Date Added: 2009-06-07 10:56:45 |
| Parrocheetal2007.pdf Path: UCSD >> BGGN >> 238 Fall, 2009 Description: Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9 Peggy Parroche*, Fanny N. Lauw*, Nadege Goutagny*, Eicke Latz*, Brian G. Monks*, Alberto Visintin*, Kristen A. Halmen*... Date Added: 2009-06-07 10:57:11 |
| nasalslaterals.pdf Path: Washington >> L >> 453 Fall, 2009 Description: Ling 453 Wright Nasals and Laterals Nasals and Laterals Experimental Phonology 1. Damping, Bandwidth and Nasals Damped waves are not sinusiodal (ie they are complex). The greater the damping the less sinusiodal or the more complex a wave is. Unl... Date Added: 2009-06-07 10:57:11 |
| WShop3.doc Path: Allan Hancock College >> MAT >> 5101 Fall, 2009 Description: EDITH COWAN UNIVERSITY FACULTY OF COMMUNICATIONS, HEALTH AND SCIENCE SCHOOL OF ENGINEERING AND MATHEMATICS MAT5101 MULTIVARIATE STATISTICAL ANALYSIS COMPUTER LABORATORY WORKSHOP: WEEK 3 MULTIPLE LINEAR REGRESSION Peru Data A study was conducted by so... Date Added: 2009-06-07 10:58:38 |
| Phar734_2005_ExamOne.pdf Path: Oregon State >> P >> 12004 Fall, 2009 Description: .\' I -1. Pharacy 734 Exam April 15, 2005 Name 0tiT\\ Ifc.c. Choose the best answer from those provided and place it on your answer sheet (only one answer per question), At the end of the exam, in your answer sheet for grading, For matching quest... Date Added: 2009-06-07 10:59:40 |
| Cardiovascular Disease Outline - PHAR 727.doc Path: Oregon State >> P >> 12004 Fall, 2009 Description: Cardiovascular Disease Introduction: Cardiovascular Disease (CVD) is leading cause of death worldwide in men and women Largest number of clinical trials devoted to CVD, but 6th in funding by NIH Research shows CVD is a largely preventable disease ... Date Added: 2009-06-07 10:59:44 |
| streaming-evaluation.doc Path: Washington >> STUDENTS >> 560 Fall, 2009 Description: Evaluation of Streamed presentation. This evaluation is confidential Presentation Title: Presentation Author: Your name: What was the most interesting aspect of this presentation? What were the strengths? What improvements could you suggest? Were ... Date Added: 2009-06-07 11:00:00 |
| problem_set_answers_Quant15_Continued.pdf Path: Washington >> CHEM >> 321 Fall, 2008 Description: ... Date Added: 2009-06-07 11:00:19 |
| mm545051013.050800.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.822 107.842 -73.383 42.428 -70.961 42.643 4.549 -72.172 42.536 67.669 PSF BVY ... Date Added: 2009-06-07 11:00:54 |
| mm545052613.052400.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 197.902 106.805 -72.955 41.858 -71.389 43.213 15.594 -72.172 42.536 67.669 BDL CON ... Date Added: 2009-06-07 11:01:05 |
| mm545060720.060500.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 197.703 106.698 -72.526 43.686 -70.479 42.719 16.311 -71.502 43.203 3... Date Added: 2009-06-07 11:01:38 |
| mm515051514.051412.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dgfk[nmi] dduluth[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.161 106.945 -89.666 45.161 -90.882 46.73 14.603 -90.274 45.945 307.145 91.294 RRL AS... Date Added: 2009-06-07 11:02:07 |
| mm515070820.070712.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dgfk[nmi] dduluth[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.254 106.995 -91.48 46.247 -89.068 45.643 14.231 -90.274 45.945 307.145 91.294 3CU RH... Date Added: 2009-06-07 11:02:08 |
| mm545081313.081018.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.375 107.061 -72.12 45.549 -73.238 47.157 13.729 -72.679 46.353 2... Date Added: 2009-06-07 11:02:23 |
| Nat Rev Microbiol 2008 Sorek.pdf Path: Harvard >> MARCH >> 200 Fall, 2009 Description: PROGRESS CRISPR - a widespread system that provides acquired resistance against phages in bacteria and archaea Rotem Sorek, Victor Kunin and Philip Hugenholtz Makarova and colleagues15 suggested that the CRISPR system is involved in DNA repair, as ma... Date Added: 2009-06-07 11:04:33 |
| presentation.ppt Path: NYU >> JGP >> 248 Fall, 2009 Description: Interactive Clarinet Teacher A Guide Through the Fundamentals of the Clarinet and Clarinet Performance. By: Jordan Pasternak List of Objectives Important aspects of playing any instrument Airflow Embouchure Technique Equipment Reed... Date Added: 2009-06-07 11:05:25 |
| pathnames.pdf Path: Penn State >> STAT >> 481 Fall, 2009 Description: ... Date Added: 2009-06-07 11:05:37 |
| H05W-Karel-for-Windows.pdf Path: Stanford >> CS >> 106 Fall, 2009 Description: Eric Roberts and Rob Baesman CS106A Handout #5W September 24, 1999 Using Karel In Windows This handout has been adapted from the Bermuda Computing Curriculum Project here at Stanford http:/cse.stanford.edu/bermuda/ While we strongly encourage stud... Date Added: 2009-06-07 11:05:50 |
| ch05.pdf Path: CSB-SJU >> PHYS >> 365 Fall, 2009 Description: Physics 365 Homework #5 10 November 2008 5.1 Following the examples in class for strangeness: Mesons l = u, d, s li lj lk c cli c li c li j l 0 0 1 1 0 2, 1, 0, 1 0 1, 0 0, 1 1, 0, 1 Note that the c meson case is included in the li j case. c l 5.2... Date Added: 2009-06-07 11:06:47 |
| test1f97.pdf Path: Virginia Tech >> MATH >> 2224 Fall, 2008 Description: Name_ SSN_ Pledge_ Math 2224 - Test 1 I. Given f(x,y) = x3 - y 1. Sketch the level curves for z = -2, -1, 0, 1, and 2. Label each level curve. 2. At (1, 2) find the gradient of f(x,y). Sketch the gradient vector on the graph above. r r r 3. Find th... Date Added: 2009-06-07 11:07:17 |
| lab4.ps Path: Duke >> CPS >> 140 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: lab4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips lab4 %DVIPSParameters: dpi=600, ... Date Added: 2009-06-07 11:07:34 |
| Teaming Up Causes and Effects.doc Path: UMBC >> ELD >> 072 Fall, 2009 Description: Teaming Up Finding causes and effects The following words and/or phrases link causes and effects in the article Teaming Up. Find the words/phrases in the paragraphs (numbers provided) and write the cause to the left and the effect to the right. Try t... Date Added: 2009-06-07 11:07:38 |
| Outline-files.txt Path: UCF >> COMS >> 342 Fall, 2009 Description: Com S 342 meeting -*- Outline -*- for introduction meeting 1 (about 40 minutes) * preliminaries * policies * objectives ... Date Added: 2009-06-07 11:07:53 |
| homework_chapter_3.pdf Path: Washington >> CHEM >> 223 Fall, 2008 Description: Homework Chapter 3 1, 2, 3, 7, 8, 9, 11, 12, 14, 15, 19, 21, 28, 25, 28, 29, 32, 35, 42, 45, 46, 50, 52, 54, 59, 61 ... Date Added: 2009-06-07 11:11:36 |
| AbstractTool.java.txt Path: NJIT >> AC >> 268 Fall, 2009 Description: package chapter9.scribble3; public abstract class AbstractTool implements Tool { public String getName() { return name; } protected AbstractTool(ScribbleCanvas canvas, String name) { this.canvas = canvas; this.name = name; ... Date Added: 2009-06-07 11:12:41 |
| MergedLetters.doc Path: N. Georgia >> CS >> 0084 Fall, 2009 Description: February 2, 2006 Alecia Ann Hawkins 1441 Amberton Way Powder Springs, Georgia 30127 Dear Alecia, We are Excited to bring this special offer to you, Alecia. This is only for residents of Powder Springs. Do not miss out this special offer. Sincerely, ... Date Added: 2009-06-07 11:13:25 |
| natural_history.pdf Path: Lyon College >> BIO >> 280 Fall, 2009 Description: 3 II. NATURAL HISTORY AND NORTHERN ADAPTATIONS A. Biomes 1) Temperate rainforest 2) Taiga (northern boreal forest) 3) Tundra 4) Other biomes are found to the south and east (plains, deciduous forest, etc.). 5) Except for a \"belt\" of a few hundred mil... Date Added: 2009-06-07 11:14:19 |
| Exercise_6_4-11.txt Path: IUP >> MATH >> 364 Fall, 2009 Description: X 16.0 15.2 12.0 16.9 14.4 16.3 15.6 12.9 15.3 15.1 15.8 15.5 12.5 14.5 14.9 15.1 16.0 12.5 14.3 15.4 15.4 13.0 12.6 14.9 15.1 15.3 12.4 17.2 14.7 14.8... Date Added: 2009-06-07 11:15:28 |
| 00090056.pdf Path: Texas >> EE >> 380 Spring, 2000 Description: The VLDB Journal (2000) 9: 5675 The VLDB Journal c Springer-Verlag 2000 Analysis of navigation behaviour in web sites integrating multiple information systems Bettina Berendt1 , Myra Spiliopoulou2 1 2 Institute of Pedagogy and Informatics, Faculty... Date Added: 2009-06-07 11:16:21 |
| cps04(des).txt Path: UGA >> TERRY >> 4750 Fall, 2009 Description: description ahe bachelor female age... Date Added: 2009-06-07 11:17:16 |
| 348-271.pdf Path: Virginia Tech >> PUBS >> 348 Fall, 2009 Description: publication 348-271 What Should I Do if My Child Is Underweight? Elena Serrano, Extension Specialist, Department of Human Nutrition, Foods, and Exercise, Virginia Tech Kathryn Branstad, former graduate student, Virginia Tech Healthy Weights for Hea... Date Added: 2009-06-07 11:18:07 |
| N-Glycan-Paper2.pdf Path: UGA >> BCMB >> 8020 Fall, 2008 Description: Genetic remodeling of protein glycosylation in vivo induces autoimmune disease Daniel Chui*, Gayathri Sellakumar*, Ryan S. Green*, Mark Sutton-Smith, Tammie McQuistan, Kurt W. Marek*, Howard R. Morris, Anne Dell, and Jamey D. Marth* *Glycobiology Res... Date Added: 2009-06-07 11:18:27 |
| Exam03-overview.pdf Path: Millersville >> HERBARIUM >> 100 Fall, 2009 Description: BIOL 100 General Biology Dr. Hardy, Fall 2008 Exam 3 New Topics Overview Topic 12 Evolution I. Introduction A. Basic Concepts B. Some Evidence C. Brief History and Details of Evolutionary Theory 1. Lamarck 2. Darwin 3. Dobzhansky and others: the Mod... Date Added: 2009-06-07 11:19:01 |
| Guest.ppt Path: Bridgeport >> CS >> 597 Fall, 2009 Description: Connect to server. Keep sending and getting information from server LIJ Guest Interface Get Image via server Send information via server Get patients info via server Disconnect from server Save chat information as a report Display Chat info here ... Date Added: 2009-06-07 11:19:37 |
| SP09 cs188 lecture 24 -- naive bayes.ppt Path: Berkeley >> CS >> 188 Spring, 2004 Description: CS 188: Artificial Intelligence Fall 2008 Lecture 24: Nave Bayes 4/16/2008 John DeNero UC Berkeley Slides from Dan Klein Announcements Written assignment 3 due today Project 4 due next Wednesday Updated description and comments Written assign... Date Added: 2009-06-07 11:19:50 |
| SID_DCP_F08a_T07_V1.3.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Supporting Information Document (SID) Version 1.3 Supporting Information Document (SID) EZBay Team 7 Prachi Pagey Plan and Control engineer Assistant Project Manager / Prototyper Requirements Engineer Software Architect Operational Concept Engi... Date Added: 2009-06-07 11:23:06 |
| T0512.t2k.n_notor-logo.pdf Path: UCSC >> T >> 0512 Fall, 2009 Description: T0512.t2k n_notor 4 3 2 1 A SG L F I T N E G NF Q Y SN A T LS Y Y DP A TC E V E N E VF Y R AN G F KL G D VA Q S MV I R D G IG W I V V N N S H V I FA I D I N T F KE V G R I T G FT S P R Y I H FL S D E K A Y VT 1 10 20 30 40 50 60 70 80 90 N GP 4 3 2 ... Date Added: 2009-06-07 11:23:51 |
| SyllabusRevised.pdf Path: Washington >> E >> 545 Fall, 2009 Description: Law E 545: International Trade Law Spring Quarter, 2008-09 University of Washington, School of Law Seattle, WA 98195 Dongsheng Zang Assistant Professor of Law William H. Gates Hall #427 Updated: May 1, 2009 Tel: (206) 543-0830 Email: zangd@u.washingt... Date Added: 2009-06-07 11:27:38 |
| gas_effusion.pdf Path: Ill. Chicago >> CHEM >> 343 Fall, 2008 Description: ... Date Added: 2009-06-07 11:27:49 |
| Syllabus-W2009.doc Path: Washington >> CHIN >> 102 Winter, 2008 Description: Chinese 102, Winter 2009 Department of Asian Languages and Literature University of Washington Teaching Staff: Coordinator: Yu Liping / Y^ Losh Teaching Assistants: Sun-mi Kim/ Jn Losh Chia-ying Shih/ Sh losh Ying Tang/Tng losh Hongyan Zhang/Zhng los... Date Added: 2009-06-07 11:28:57 |
| Translation-L10-key.doc Path: Washington >> CHIN >> 102 Winter, 2008 Description: L10 Translation exercise-Key 1. The weather forecast on TV said that today\'s weather would be the same as yesterday\'s. It would be warm and it wouldn\'t rain. 0 G c@ @ f @ @3 E v 2. There were even more vocab items and grammar points in Lesson 10 t... Date Added: 2009-06-07 11:28:58 |
| Primary_Resume.doc Path: Michigan State University >> ADV >> 354 Fall, 2008 Description: L AH M. P UGGANAN UR 234CenterSt.#18EastLansing,MI48823 46610WestOakManorCourt,Canton,MI48187 (734)2164291puruggan@msu.eduleah.purugganan@gmail.com ProfessionalExperience CommunicationsIntern/AdvertisingCoordinator MichiganPharmacistsAssociationLans... Date Added: 2009-06-07 11:31:52 |
| PS1AK.pdf Path: UCSC >> ECON >> 100 Fall, 2009 Description: Economics 100B Intermediate Macroeconomics Kuntal Kumar Das Problem Set 1 Answer Key 1. Problem 2, Chapter 2 of Blanchard a. b. c. d. e. No change. The fish is an intermediate input, not a final good. Consumption goes up by 100$ and so does GDP. Del... Date Added: 2009-06-07 11:32:24 |
| tss4016.pdf Path: Rutgers >> FTP >> 3557 Fall, 2009 Description: CONCENTRATION, IN MILLIGRAMS PER LITER PERCENTAGE OF TIME FLOW WAS EXCEEDED 90 100 70 50 40 30 20 * No Significant relation to flow EXPLANATION Growing Season Nongrowing Season 75 50 25 10 10 7 5 4 3 2 1 1 2 5 10 20 50 100 200 400 STREAM... Date Added: 2009-06-07 11:32:46 |
| info_grades_thru_Exam_II.pdf Path: Washington >> CHEM >> 312 Fall, 2008 Description: StudentNo Quiz#1 Quiz#2 HW#1 Quiz#3 Quiz#4 HW#2 Exam#1 Quiz#5 HW #3 Quiz#6 HW#4 Quiz #7 HW#5 Exam #2 650224 8 7 17 20 5 19 80 76 420457 10 19 11 20 10 19 80 18 11.25 14 17 8 16 75 420574 6 20 20 19 12.5 19 83 9 5 19 18 18 19 92 521390 12 16 18 20 0 2... Date Added: 2009-06-07 11:32:57 |
| beginningrdgmodel.pdf Path: Appalachian State >> FACULTY >> 3900 Fall, 2009 Description: From Morris, Bloodgood, Lomax, & Perney (2003) ... Date Added: 2009-06-07 11:33:14 |
| lab1.pdf Path: Michigan State University >> WEB >> 2252 Fall, 2009 Description: Lab 2252 Characterizing the Weed Community - (Whazzup with Weeds) Karen Renner, 2001 Theme: Weeds are a component of farm field ecosystems. Weeds contribute to field diversity and interact with the crops. There are usually many weed species in a farm... Date Added: 2009-06-07 11:34:35 |
| ECE569_07F_hw2.pdf Path: Illinois Tech >> ECE >> 569 Fall, 2009 Description: ECE 569 DIGITAL SIGNAL PROCESSING II Homework Assignment #2 Due: 25 September 2007 FALL 2007 1. Design an equiripple linear-phase FIR lowpass filter to meet the following specifications: p = 0.45, 1 = 0.2, s = 0.6, 2 = 0.04. Plot the impulse respo... Date Added: 2009-06-07 11:36:11 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 2224 Fall, 2009 Description: 24 10073:6150:1423:678 ; 41062:16219:218:853 a 42102:35919:739:612 49274:19262:711:612 9909:34365:711:612 43471:13177:766:678 about 51409:20772:4434:700 all 12291:40494:1970:612 and 31590:23705:2682:678 38023:32876:2682:612 29427:32898:2627:612 53052... Date Added: 2009-06-07 11:39:11 |
| words.txt Path: Wisconsin Milwaukee >> LIB >> 5475 Fall, 2009 Description: a 38262:53158:915:552 accounting 44724:45894:5317:671 alpha 52611:45894:2620:552 36125:11054:2594:552 ann 39382:10363:1729:532 association 48566:46585:5062:532 b 24422:25384:788:552 ba 49329:4717:1500:651 33047:28227:1500:631 50041:17291:1500:651 bar... Date Added: 2009-06-07 11:41:30 |
| Assignment 2Alt.txt Path: Penn State >> TPS >> 5026 Fall, 2009 Description: Tim Shannon Oriental Rugs I have always been fascinated with oriental rugs. At my house I have factory produced oriental rugs on my rooms walls; the floor of my dorm room is covered in one; and my parents high school graduation gift to me was ... Date Added: 2009-06-07 11:41:34 |
| Eco536-100K.txt Path: Denison >> PERSONAL >> 111 Fall, 2009 Description: agcttttcattctgactgcaacgggcaatatgtctctgtgtggattaaaaaaagagtgtctgatagcagcttctgaactggttacctgccgtgagtaaattaaaattttattgacttaggtcactaaatactttaaccaatataggcatagcgcacagacagataaaaattacagagtacacaacatccatgaaacgcattagcaccaccattaccaccaccatcaccattaccacaggtaacggtgcgg... Date Added: 2009-06-07 11:42:21 |
| MyInterests.pdf Path: UCSD >> CSE >> 008 Fall, 2008 Description: The people of Israel (also called the \"Jewish People\") trace their origin to Abraham, who established the belief that there is only one God, the creator of the universe (see Old Testament). Abraham, his son Yitshak (Isaac), and grandson Jacob (Israel... Date Added: 2009-06-07 11:42:43 |
| res_time_and_carbon_cycle.pdf Path: Wisconsin >> GEOG >> 525 Fall, 2008 Description: 0.5 m of erosion in 1000 yr 0m Former land surface 0.5 m of deposition in 1000 yr 0m A Present land surface A Present land surface Former land surface B B Former lower boundary, B horizon 1.5 m Present lower boundary, active B horizon Former... Date Added: 2009-06-07 11:43:10 |
| tst1-297.doc Path: SEMO >> PH >> 109 Fall, 2009 Description: Exploring The Universe TEST # 1 Summer 97 NAME_ Please indicate the best answer to the following questions by marking your choice using the answer sheet provided. Each question is worth 2 points unless noted otherwise. There are two short answer ques... Date Added: 2009-06-07 11:46:00 |
| 09-Transportx2.pdf Path: Berkeley >> EE >> 122 Spring, 2006 Description: EE 122: Transport Protocols: UDP and TCP Computer Science Division Department of Electrical Engineering and Computer Science University of California, Berkeley, Berkeley, CA 94720-1776 EE122 F05 Todays Lecture Application Transport Network (IP) Lin... Date Added: 2009-06-07 11:47:14 |
| hw5.pdf Path: Berkeley >> HW >> 298 Fall, 2009 Description: Topics in Financial Engineering and Stochastic Control IEOR298 University of California, Berkeley Spring 2002 Homework 5 Due date: Wednesday March 12 1. Assume that the stock and bond price processes are solutions of: dS(t) = S(t) dt + dW dB(t) = rB... Date Added: 2009-06-07 11:47:48 |
| active.ppt Path: Fontbonne >> RDUPL >> 565 Fall, 2009 Description: Careers in Multimedia Rhonda Duplessis Table of Contents ultimedia includes a combination of text, audio, still images, animation, video, and interactivity content forms. Multimedia is usually recorded and played, displayed or accessed by inf... Date Added: 2009-06-07 11:49:14 |
| M050464-00.doc Path: Caltech >> M >> 050464 Fall, 2009 Description: LIGO-M050464-00-M LIGO LABORATORY COLLABORATION AGREEMENT FOR TECHNICAL AND MANAGEMENT SUPPORT Statement of Purpose This agreement is made by and between the California Institute of Technology (hereinafter Caltech); The Board of Supervisors of Louis... Date Added: 2009-06-07 11:50:58 |
| M060039-00.pdf Path: Caltech >> M >> 060039 Fall, 2009 Description: LIGO LABORATORY CALTECH, MS 18-34 PASADENA, CA 91125 TEL: 626/395-2129 FAX: 626/304-9834 LIGO-M060039-00-P Date: March 13, 2006 Refer to: LIGO-M060039-00-P To/Mail Code: Distribution From/Mail Code: P. Lindquist/18-34 Phone/FAX: 395-3193/304-9834 S... Date Added: 2009-06-07 11:51:56 |
| Meta_Inquiry.pdf Path: Berkeley >> LA >> 254 Fall, 2009 Description: Appendix A: The Management of Inquiry Once we have the five systems of inquiry that we discussed in Chapter _, they can be used to illuminate other important aspects of dealing with complex problems. For one, by showing how they all play a vital rol... Date Added: 2009-06-07 11:52:12 |
| VLR-handout.doc Path: NJIT >> CIS >> 365 Fall, 2009 Description: FD section-file RECORD CONTAINS 40 CHARACTERS. 01 section-record. 05 course-section-id PIC 05 semester PIC 05 professor PIC 05 num-credits PIC CIS365 - Professors Bieber & Egan - Variable-Length Records * section entity X(11). XXX. X(25). 9. * locat... Date Added: 2009-06-07 11:55:45 |
| Retail.pdf Path: NYU >> DJK >> 244 Fall, 2009 Description: AsiaView India\'s organized chaos Investors are hot on the trail of organized retail in India, chasing promises of 12 percent growth for the sector by 2010. But will the cultural, political and structural challenges put a cog in their plans? By Dave ... Date Added: 2009-06-07 11:57:27 |
| finalTH578.pdf Path: Illinois Tech >> MATH >> 578 Spring, 2009 Description: Math 578 Final, Spring \'09, Take-home Part 1. (5 points) Ex. 4.3 of Iserles. 2. (5 points) Multistep methods are usually implemented in `predictor-corrector\' form. That is, a preliminary calculation is carried out using an explicit method (e.g. Adam... Date Added: 2009-06-07 11:58:06 |
| 0370_mat.pdf Path: USF >> LIT >> 300 Fall, 2009 Description: Name _ Date _ \"The Good Part, That Shall Not be Taken Away\" The first line of the poem begins, \"She dwells . . .\" Who is she? Based on the information Longfellow gives through the text of the poem, write several paragraphs to describe the woman that... Date Added: 2009-06-07 11:58:21 |
| 11835.pdf Path: East Los Angeles College >> STK >> 11835 Fall, 2009 Description: PROGRAMME DETAIL SPECIFICATION Programme Summary 1 Awarding institution 2 Teaching institution university 3a Programme accredited by: 3b Description of accreditation 4 Final award 5 Programme title 6 UCAS code 7 Subject benchmark statement 8 Educati... Date Added: 2009-06-07 12:00:00 |
| 201PS62009.pdf Path: Berkeley >> ECON >> 201 Fall, 2008 Description: Economics 201b Spring 2009 Problem Set 6 Due Thursday May 7 1. Recall from your 204 notes that a set A Rn has Lebesgue measure zero if, for every > 0, there is a countable collection of rectangles I1 , I2 , . . . such that V ol(Ik ) < , and A Ik... Date Added: 2009-06-07 12:00:18 |
| scheduleE262B.pdf Path: Berkeley >> E >> 262 Fall, 2009 Description: University of California at Berkeley, Haas School of Business E262B: Internet Strategy, Spring 2000 Professor Florian Zettelmeyer 262B Course Contents Readings/Assignments Introduction 1 2 3 1/25 1/18 Course overview Internet technology Framework... Date Added: 2009-06-07 12:01:51 |
| 20_Oct09.ppt Path: Iowa State >> BCB >> 544 Fall, 2008 Description: BCB 444/544 - Introduction to Bioinformatics Lecture 20 Review: Phylogenetic Methods New: Genomic Variation #20_Oct9 BC B4 4 4 /5 4 4 F0 6 IS UDo b b s # 2 0 R e vie wP h ylo g e n e tic s &G e no m ic Va ria tio n 1 0 /9 /0 6 1 Seminars in Bioi... Date Added: 2009-06-07 12:02:53 |
| 0430-small.pdf Path: Trinity U >> CS >> 1321 Fall, 2009 Description: CSCI 1321 April 30, 2009 Administrivia Due dates for Homeworks 1 through 6 are past. Turn in as soon as you reasonably can, but no later than next Friday (May 8) at 5pm. Homework 7 (design and code) will be accepted without penalty through next ... Date Added: 2009-06-07 12:03:23 |
| poster.pdf Path: Wisc Eau Claire >> MTEN >> 0809 Fall, 2009 Description: 2009 BLUGOLD MENS TENNIS Photo By - Bill Hoepner UW-Eau Claire 2009 SCHDEULE Jan 24 Feb 1 Feb 1 Feb 7 Feb 7 Feb 8 Feb 8 Feb 13 Feb 14 Feb 14 Feb 14 Feb 20 Carleton College Cornell College Loras College St. Olaf St. Norbert Mixed Fundraiser St. Cl... Date Added: 2009-06-07 12:06:13 |
| SCSOP23HoldingFood1.pdf Path: Iowa State >> NR >> 63270 Fall, 2009 Description: School District: _ Department: _ Policy No: _ Standard Operating Procedure Holding Food Policy: All hot foods will be held hot (above 135F) and cold foods will be held cold (below 41F). Temperatures of foods will be taken routinely to ensure that pr... Date Added: 2009-06-07 12:06:18 |
| ForcedVibration.pdf Path: Tulsa >> ME >> 4024 Fall, 2009 Description: ForcedVibration.nb 1 Forced Vibration Example ME 4024: Machine Dynamics Dr. Jeremy Daily Setup and Solve Equations of Motion Clear all variables for use in this notebook In[135]:= Clear@x, x, t, m, c, k, w, wn, Fo, zeta, wOverwnD Use Mathemati... Date Added: 2009-06-07 12:08:10 |
| NewMember2.pdf Path: Iowa State >> NR >> 72192 Fall, 2009 Description: Boone County 603 Story Street Boone, IA 50036-2833 515 432-3382 FAX 515 432-3883 xboone@iastate.edu 4-H A Family Affair News for New 4-H Families To the Parents of a New 4-H Member Greetings! Issue 2 By now you and your child have had a taste of ... Date Added: 2009-06-07 12:08:24 |
| TTMG_5004_2009_Course_Outline_Stoyan_Tanev.pdf Path: ECCD >> TTMG >> 5004 Fall, 2009 Description: TTMG 5004: Management of Design Systems Spring 2009 (Research methods in Technology Management) INSTRUCTOR The instructor for the course is Dr. Stoyan Tanev. Dr. Tanev teaches in Department of Systems and Computer Engineering. His office is ME 4... Date Added: 2009-06-07 12:08:28 |
| OsceolaCoFieldFeedlotMarch2006ev.doc Path: Iowa State >> NR >> 27568 Fall, 2009 Description: Northwest Area Extension New Risk Management Tools for Cattle Feeders . 1 On-line N Rate Calculator Now Available! . . . . .2 Dairy Herd Management Meeting Highlights . . . 2 New Risk Management Tool for Cattle Feeders by Ron Hook, ISUE Farm Manageme... Date Added: 2009-06-07 12:08:36 |
| lecture5.pdf Path: CSU Channel Islands >> CS >> 153 Fall, 2009 Description: Logic Design Laboratory Prof. Tony Givargis VHDL Introduction to VHDL Hardware description language (HDL) Concurrency Timing Very high speed integrated circuits (VHSIC) HDL Department of defense, 1983 VHDL Overview Library Entity Generic Por... Date Added: 2009-06-07 12:08:50 |
| Group Exercise1.doc Path: Western Washington >> ISTM >> 201 Fall, 2009 Description: Geology 204 Group Exercise Announcements / science in the media Monday Eyes in the back of your head. Be here! Questions from before or readings? Prism & Pendulum Cavendish Sources of error prevent the work from being falsifiable (could fail not ... Date Added: 2009-06-07 12:20:59 |
| sylspr0502.doc Path: Maryland >> A >> 6665 Fall, 2009 Description: BMGT 422 AUDITING THEORY AND PRACTICE SPRING SESSION, 2003/2004(SECTION 0201) T TH 3:30 4:45 VANMUNCHING 1307 NILE J. WEBB OFFICE: VAN MUNCHING 3346 PHONE: 301-405-2216 E-Mail: nwebb@rhsmith.umd.edu OFFICE HOURS: T TH 9:15 - 10:30 (Other times by ap... Date Added: 2009-06-07 12:22:35 |
| LevyProcesses.pdf Path: Concordia Chicago >> STATISTICS >> 385 Fall, 2009 Description: LVY PROCESSES, STABLE PROCESSES, AND SUBORDINATORS STEVEN P LALLEY . 1. DEFINITIONS AND EXAMPLES Definition 1.1. A continuoustime process {X t = X (t )}t 0 with values in d (or, more generally, in an abelian topological group G ) is called a Lvy pro... Date Added: 2009-06-07 12:24:36 |
| 452hawaii-spring09.pdf Path: Washington >> COURSES >> 452 Fall, 2009 Description: Hawaiian Islands: Coastal & Marine Habitats Coral Reef Moray Eel 1, 3, 4, 5 Hawaiian name: Puhi by Lamberto R. Yaya, Jr Brandon Rogers White Tern Jenn Shibata Manta Ray Dustin Butler Scalloped Hammerhead Steindachners Moray Eel Angella Yin Monk... Date Added: 2009-06-07 12:24:51 |
| ChrissiePluemerschoolyear01.pdf Path: Iowa State >> FDFE >> 10752 Fall, 2009 Description: Chrissie Pluemer- AmeriCorps Fall 2001 School Year Placement at Jefferson Junior High As I started this year I know my hands would be full. Balancing school, being a student athletic trainer and being an AmeriCorps member at Jefferson Junior High Sch... Date Added: 2009-06-07 12:25:38 |
| cockroaches.ppt Path: Allegheny >> BIO >> 082 Spring, 2009 Description: Most people fear cockroaches The German cockroach, Blattella germanica The Oriental cockroach, Blatta orientalis The American cockroach, Periplaneta americana Brown-banded American The brown-banded cockroach, Supella supellectilium These weevi... Date Added: 2009-06-07 12:25:50 |
| reviewmt.pdf Path: UC Davis >> ECS >> 122 Fall, 2008 Description: ECS122A: Algorithm Design and Analysis Midterm Review Checklist Handout May 7, 2009 Here are a list of algorithm design and analysis techniques, algorithms, math, concepts and denitions that you should know from lecture, discussion and homework. Th... Date Added: 2009-06-07 12:26:25 |
| notes_X_ray.pdf Path: Washington >> CHEM >> 162 Fall, 2008 Description: X-Ray Crystallography 1. The forms of solid carbon Although diamonds (top left) and graphite (top right) are identical in chemical composition - being both pure carbon - X-ray crystallography revealed the arrangement of their atoms (bottom), which a... Date Added: 2009-06-07 12:29:54 |
| tc271x-tc471x-syllabus.pdf Path: Iowa State >> TC >> 271 Fall, 2009 Description: Fashion Show Production: TC 271x Instructor: - Spring 2004 J.R. Campbell Description: TC271X. Fashion Show Production. (1-1) Cr. 1 - 2. Prereq: 3 credits in TC or permission of instructor. Course must be taken for 2 credits first time, can be repea... Date Added: 2009-06-07 12:29:55 |
| BT3-9.pdf Path: Concordia Moorhead >> HOME >> 101 Fall, 2009 Description: Chapter 9 Population and Reproduction A. Population demographics population \"explosion\" Malthus and population growth factors to account for \"K\"arrying capacity Human reproduction development male anatomy/hormones female anatomy/hormones female menst... Date Added: 2009-06-07 12:31:19 |
| 138FELoc.pdf Path: Purdue >> MA >> 13800 Fall, 2009 Description: ... Date Added: 2009-06-07 12:34:39 |
| 5.pdf Path: Tulsa >> LIB >> 1918 Fall, 2009 Description: ... Date Added: 2009-06-07 12:34:53 |
| se1010-06-02.pdf Path: MSOE >> SE >> 1010 Fall, 2009 Description: Iteration Iteration In software development it is common p that certain instructions have to be executed repeatedly. p y Various means of achieving that goal while loop for loop do while do-while loop while loop while ( <boolean expression> ){ <... Date Added: 2009-06-07 12:35:41 |
| PLAAFP-1.pdf Path: Wisc Stevens Point >> EDUC >> 382 Fall, 2009 Description: *Peter was a made up student created by my professor, any other names were made up also.* PLAAFP STATEMENT Peter is a 15year old student at Andrew Jackson High School who currently is involved in the GOALS program. At birth Peter was diagnosed ... Date Added: 2009-06-07 12:39:08 |
| 202-midterm1-sol.pdf Path: Johns Hopkins >> MATH >> 202 Fall, 2009 Description: MATH 202-MIDTERM 1 SOLUTIONS Problem 1 a. S is the level set F = 0, where F : R3 R is given by F (x, y, z) = x3 - yz - y. Gradient: F (x, y, z) = (3x2 , -z - 1, -y). In particular F (P ) = F (2, 1, 7) = (12, -8, -1). The tangent plane TP (S) passes... Date Added: 2009-06-07 12:39:35 |
| LIBS150A30486622.doc Path: MD University College >> ASIA >> 2088 Fall, 2009 Description: University of Maryland University College - Asia LIBS 150: Information Literacy and Research Methods Session I, 2008/2009 Professor: David Ramsey Office: TBA Office Phone: TBA Email Address: dramsey@asia.umuc.edu Important: This is a web-enhanced cla... Date Added: 2009-06-07 12:39:47 |
| Venezuelan Oil and Politics.pdf Path: Stanford >> E >> 297 Fall, 2009 Description: Venezuelan Oil and Politics A Chance to Transform OPEC Patrick Fowler EDGE Winter 2003 As the 5th largest oil exporter in the world Venezuelas oil is exceptionally important not only to the country itself, but to the rest of the world. . As the fou... Date Added: 2009-06-07 12:40:58 |
| 4H692MPSafety.pdf Path: Iowa State >> NR >> 81450 Fall, 2009 Description: Project Objectives 4-H Youth Development To help you: practice safety in all areas of your life develop into an individual who can help your home, community, nation, and world become a safer place to live involve your entire family in becoming a... Date Added: 2009-06-07 12:41:47 |
| Personnel_Committee_Membership0809.pdf Path: CSU Northridge >> MEMO >> 200809 Fall, 2009 Description: ... Date Added: 2009-06-07 12:43:55 |
| CS-150-Spring-2008-Exam-2-Excel.pdf Path: New Mexico >> CS >> 149 Fall, 2009 Description: CS-150L Midterm Exam: Microsoft Excel Spring 2008 With the exception of a dictionary, the exam is closed book. The exam will require the use of a lab computer. Your solution must be printed on paper and turned in. The only computer applications allow... Date Added: 2009-06-07 12:44:24 |
| ch9.pdf Path: Washington >> TH >> 022 Fall, 2009 Description: 95 Chapter 9 Virtual Building Block Training Study This chapter describes an experiment, conducted to investigate the benefits of force feedback for virtual reality training. Three groups of test operators receive different levels of training before... Date Added: 2009-06-07 12:44:49 |
| howtoget.txt Path: UMass Lowell >> CS >> 6811 Fall, 2009 Description: Return-Path: robot-board@oberon.com Received: by media.mit.edu (5.57/DA1.0.4.amt) id AA07652; Thu, 3 Feb 94 13:09:18 -0500 Received: from ([127.0.0.1]) by oberon.com (4.1/SMI-4.1_Armado.MX) id AA13436; Thu, 3 Feb 94 13:03:18 EST Date: Thu, 3 Feb 9... Date Added: 2009-06-07 12:44:51 |
| hw4sol.pdf Path: UCSC >> CMPS >> 290 Fall, 2009 Description: ... Date Added: 2009-06-07 12:52:15 |
| rfc2386.txt Path: UPenn >> TCOM >> 502 Fall, 2009 Description: Network Working Group E. Crawley Request for Comments: 2386 Argon Networks Category: Informational R. Nair ... Date Added: 2009-06-07 12:53:52 |
| 2008_d3football_alleast_region.pdf Path: Curry >> NR >> 6542 Fall, 2009 Description: D3football.com 2008 All-East Region Team Boltus, Scalice, highlight 2008 D3football.com All-Region team FOR IMMEDIATE RELEASE MINNEAPOLIS Hartwick quarterback Jason Boltus was named D3football.com 2008 East Region Offensive Player of the Year and I... Date Added: 2009-06-07 12:53:56 |
| test1_key_2008.txt Path: UNC Wilmington >> CHM >> 211 Fall, 2009 Description: 1.b 2.b 3.d 4.c 5.a 6.b 7.b 8.c 9.d 10.b 11.b 12.b 13.b 14.b 15.c 16.b 17.c 18.b 19.b 20.b 21.d 22.b 23.c 24.c ... Date Added: 2009-06-07 13:02:50 |
| Calipso-Track2-07-04-curtains.pdf Path: University of Iowa >> B >> 200 Fall, 2009 Description: ... Date Added: 2009-06-07 13:03:37 |
| fall06I.pdf Path: Penn State >> MATH >> 230 Spring, 2008 Description: ... Date Added: 2009-06-07 13:04:13 |
| TriolaCh1.pdf Path: CSU Northridge >> AN >> 73773 Fall, 2009 Description: Chapter 1 Key Ideas Terms: Data (Quantitative vs. Qualitative), Discrete vs. Continuous Data, Statistics, Population, Census, Sample, Parameter, Statistic, Observational Study vs. Experiment Bias: Voluntary Response, Small Samples, Misleading Graphs/... Date Added: 2009-06-07 13:07:13 |
| 094-FCSC.pdf Path: Arizona >> SCHEDULE >> 094 Fall, 2009 Description: Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # FAMILY Consumer ... Date Added: 2009-06-07 13:07:58 |
| TopThingsMotif.pdf Path: MTSU >> FRANK >> 4290 Fall, 2009 Description: TOP 20 THINGS TO KNOW ABOUT THE MOTIF ES 1. Yamaha uses the term voice in place of the term patch. Choose a Normal Voice by selecting a Bank, Group and Number. Choose a Drum Voice by holding down the Drum Kit button before selecting a Drum Bank. 2. B... Date Added: 2009-06-07 13:08:00 |
| kugler.pdf Path: U. Memphis >> POLS >> 1501 Fall, 2008 Description: International Studies Review (2004) 6, 163179 Integrating Theory and Policy: Global Implications of the War in Iraq JACEK KUGLER Claremont Graduate University RONALD L. TAMMEN Portland State University AND BRIAN EFIRD Claremont Graduate University ... Date Added: 2009-06-07 13:08:49 |
| 16.pdf Path: Allan Hancock College >> COMP >> 8400 Fall, 2009 Description: COMP8400: Algorithms and Techniques for Data Mining Privacypreserving data mining and data sharing Lecture outline Privacy and confidentiality Realworld scenarios Reidentification Goals of privacypreserving data mining Privacypreserving dat... Date Added: 2009-06-07 13:09:42 |
| paper10.ppt Path: Old Dominion >> CS >> 775 Fall, 2008 Description: By Rajanikanth Ragula CS Login: rragula Abstract Distributed transaction systems require an atomic commitment protocol should add as little overhead as possible to avoid hampering performance. Dynamic coordinators are introduced significantly reduc... Date Added: 2009-06-07 13:10:54 |
| CW051719pg04.pdf Path: Washington >> COM >> 340 Fall, 2008 Description: ... Date Added: 2009-06-07 13:11:43 |
| interfaces.amwest.pdf Path: Washington >> MATH >> 381 Fall, 2008 Description: informs Vol. 35, No. 3, MayJune 2005, pp. 191201 issn 0092-2102 eissn 1526-551X 05 3503 0191 doi 10.1287/inte.1050.0135 2005 INFORMS America West Airlines Develops Efcient Boarding Strategies Department of Industrial Engineering, Arizona State U... Date Added: 2009-06-07 13:12:07 |
| tgrgeo44.txt Path: Michigan >> ICPSR >> 1990 Fall, 2009 Description: 0144 Rhode Island 0244001 Bristol County 0244003 Kent County 0244005 Newport County 0244007 Providence County 0244009 Washington County 034400105140Barrington town 005 03440010928... Date Added: 2009-06-07 13:12:21 |
| a12.pdf Path: California State University, Monterey Bay >> CS >> 624 Fall, 2009 Description: CS 624: Analysis of Algorithms Assignment Due: Monday, May 11, 2009 1. Exercise 1.1 in the handout. 2. Exercise 2.1 in the handout. 3. Exercise 3.2 in the handout. 4. Exercise 3.6 in the handout. ... Date Added: 2009-06-07 13:13:22 |
| educ2152z.pdf Path: Moravian >> PUBLIC >> 200670 Fall, 2009 Description: Art in the Elementary School The Syllabus for EDUC 215.2 Z Spring 2007 March 12th to April 23rd Monday Nights 6:30 to 10:00 PM http:/home.moravian.edu/users/art/membl01/ Instructor Mary Ellen B. Lehman Phone Office 610-861-1680 (art office) South Cam... Date Added: 2009-06-07 13:14:33 |
| asn-06-s.pdf Path: W. Alabama >> ECE >> 327 Fall, 2009 Description: ASN-06 Preliminaries 1 ASN-06: Functional Validation Lecture Notes Sections: 3.6 ? University of Waterloo Dept of Electrical and Computer Engineering E&CE 427 Digital Systems Engineering 2002t3Fall ASN-06: 3.6 FUNCTIONAL VALIDATION PROBLEMS 2... Date Added: 2009-06-07 13:19:15 |
| 0c_sumOfIntsWithLabel.asm.pdf Path: W. Alabama >> CS >> 241 Fall, 2009 Description: ; Sum the integers from 1 to 13. ; ; $1 . holds the constant 1. ; $2 . counts down from 13 to 0. ; $3 . where the sum is accumulated. ; ; Initialization lis $2 ; Load N (ie 13) into register 2. .word ... Date Added: 2009-06-07 13:21:09 |
| 1_sumOfIntsWithLabel.asm.pdf Path: W. Alabama >> CS >> 241 Fall, 2009 Description: ; Sum the integers from 1 to 13. ; ; $1 . holds the constant 1. ; $2 . counts down from 13 to 0. ; $3 . where the sum is accumulated. ; ; Initialization lis $2 ; Load N (ie 13) into register 2. .word ... Date Added: 2009-06-07 13:21:12 |
| final-topics.txt Path: Texas El Paso >> CS >> 3360 Fall, 2008 Description: $Id: final-topics.txt,v 1.2 2009/05/05 04:01:07 cheon Exp $ Topics for CS 3360 Final Exam This exam covers Sections 9.1-9.6 and Chapter 16 of textbook [Seb08], mid-term exam questions (and similar ones), and programming languages Prolog and... Date Added: 2009-06-07 13:22:18 |
| Ecover.pdf Path: Toledo >> CSC >> 363 Fall, 2009 Description: CSC 363 H1F Exercise # Fall 2007 Please print this cover page two-sided (the back is supposed to be upside-down), fill out both sides, and attach it to the front of your assignment. Last (Family) Name(s): First (Given) Name(s): Student Number: CD... Date Added: 2009-06-07 13:22:40 |
| 2.pdf Path: Texas >> WEB >> 452 Fall, 2009 Description: Phase-1 Oxidations: Cytochrome P-450 Prof. Patrick Davis Basic Med Chem Principles PHR 143M Fall-08 Cytochrome(s) P-450 [CYP-450] O HO O HO N N Fe N +3 Heme enzymes Enzyme family: ~50 isoforms ( Binds CO -> 450 nm Broad metabolic coverage: N ... Date Added: 2009-06-07 13:22:49 |
| Practice Final.pdf Path: Lehigh >> INME >> 242 Fall, 2009 Description: Name _ Department of Mechanical Engineering and Mechanics Lehigh University ME 242 Mechanical Engineering Systems Practice Final Exam May 01, 2003 Points total 100-problems are not weighted equally. No books or notes allowed 8 L A L P= ; P = 2 2 Q2 ... Date Added: 2009-06-07 13:23:13 |
| sp03_midterm1_soln.ps Path: Berkeley >> CS >> 152 Spring, 2008 Description: %!PS-Adobe-3.0 %Title: Microsoft Word - midterm1_soln.doc %Creator: Windows NT 4.0 %CreationDate: 17:42 10/17/2001 %Pages: (atend) %BoundingBox: 13 13 599 779 %LanguageLevel: 2 %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend) %EndComment... Date Added: 2009-06-07 13:25:41 |
| Flavors.doc Path: University of Hawaii - Hilo >> ICS >> 313 Fall, 2009 Description: Compare and Contrast What types of languages do we have? 1. Imperative (e.g. FORTRAN, C, Pascal, Java imperative statements, etc.) Computations are performed by assigning values to variables Prevalent features are variables, assignment statements, ... Date Added: 2009-06-07 13:34:30 |
| handout.job.doc Path: Berkeley >> LS >> 121 Fall, 2009 Description: Outline of Job It may help you to read with understanding the parts of the book assigned to know the design of the whole. Note that it is rather symmetrical, at least as compared to most of the other books of the Hebrew Bible. (1) At the start and th... Date Added: 2009-06-07 13:35:33 |
| jtEM07.pdf Path: Berkeley >> CS >> 270 Fall, 2002 Description: Energy Management for Wireless Sensor Networks - CS270 Project Report, Spring 2007 Xiaofan Jiang and Jay Taneja Dept. of Computer Science, University of California, Berkeley Berkeley, California 94720 {fxjiang,taneja}@cs.berkeley.edu 1 Introductio... Date Added: 2009-06-07 13:35:34 |
| ACS-1903-001.doc Path: UWI Mona >> IO >> 1903 Fall, 2009 Description: APPLIED COMPUTER SCIENCE Course Number: ACS-1903/3-001 Course Name: Programming Fundamentals I Instructor Information Instructor: Ron McFadyen Office: 3D15 Class Room & Meeting Time: 3D01, Slot 9,11:30-12:45, TTH Lab Room: 3D03 Office Hours: tba E-ma... Date Added: 2009-06-07 13:38:05 |
| bst632-spring-2009-lecture-review-02.pdf Path: UAB >> BST >> 632 Fall, 2009 Description: Review Lecture 2 for BST 632: Statistical Theory II Kui Zhang, Spring 2009 Three Chapters: Chapter 8 Hypothesis Testing Methods of Evaluating Tests Chapter 9 Interval Estimation Methods of Finding Interval Estimators Inverting a Test Statistic Piv... Date Added: 2009-06-07 13:38:07 |
| flsgpt97002_part4.pdf Path: Maryville MO >> FLSGPT >> 97002 Fall, 2009 Description: ... Date Added: 2009-06-07 13:38:49 |
| finbpr.pdf Path: Berkeley >> MATH >> 121 Fall, 2009 Description: SAMPLE FINAL EXAM MATH 121B 1. A particle slides without a friction around a vertical cylinder under the force of gravity. Set up the Lagrange equation. 2. Let a and b be two critical points of the Legendre\'s polynomial Pl (x) on interval [-1, 1]. Pr... Date Added: 2009-06-07 13:39:06 |
| lecture1.pdf Path: Berkeley >> CS >> 186 Fall, 2009 Description: Introduction to Database Systems CS186 Knowledge is of two kinds: we know a subject ourselves, or we know where we can find information upon it. - Samuel Johnson (1709-1784) What Is a DBMS? Database: a very large, integrated collection of data. M... Date Added: 2009-06-07 13:41:36 |
| what_is_big_idea.doc Path: Indiana Northwest >> E >> 328 Fall, 2009 Description: Bianchini, J.A. (1998). What the big idea? Science and Children, 63(2) 40-43. Just the Facts What is a big idea? p. 40 How are big ideas useful in science teaching? p. 40-41 Getting Ready for the Discussion Select one of the three sample units a... Date Added: 2009-06-07 13:42:32 |
| math212_spring06_hw12.pdf Path: Acton School of Business >> MATH >> 212 Fall, 2008 Description: MATH 212 Section 002: Multivariable Calculus Homework 12, due Friday 4/14 Spring 2006 1. p. 471, problems 1, 6 2. Compute the area of the surface given by (r, ) = (r cos(), sin(), ) with [0, 2 and r 1 1 r [0, 1]. Use the fact that 0 1 + x2 dx =... Date Added: 2009-06-07 13:44:24 |
| square.pdf Path: East Los Angeles College >> PHYS >> 3002 Fall, 2009 Description: d =d 100 10 1 0.1 0.01 (mb) 0.001 0.0001 1e-05 1e-06 1e-07 1e-08 SQUARE WELL DISTRIBUTION 0 5 10 15 20 25 0 () 30 35 40 45 50 ... Date Added: 2009-06-07 13:45:59 |
| chap14-slides.pdf Path: UWI Mona >> WEB >> 60330 Fall, 2009 Description: Disk Scheduling I The operating system is responsible for using hardware efficiently - for the disk drives, this means having a fast access time and disk bandwidth. I Access time has two major components Seek time is the time for the disk are to mo... Date Added: 2009-06-07 13:46:34 |
| bearings_2.pdf Path: Iowa State >> ME >> 325 Fall, 2009 Description: Important Bearing Terminology: Bearing Life Basic Static Load Rating Dynamic Load Rating Bearing Life: The amount of time a bearing will perform in a specified operation before failure. Generally, vendors and engineers talk about the L10 life. L-10 ... Date Added: 2009-06-07 13:53:00 |
| Lecture22_257.ppt Path: Berkeley >> I >> 257 Fall, 2009 Description: Future of Database Systems University of California, Berkeley School of Information Management and Systems SIMS 257: Database Management IS 257 Fall 2004 2004.11.29- SLIDE 1 Lecture Outline Review Object-Oriented Database Development Future of ... Date Added: 2009-06-07 13:53:08 |
| WomenBrett.doc Path: Oregon >> GEOG >> 610 Spring, 2008 Description: Name: _ NG Women and Population Use a dictionary to define the following terms. 1. perplex 6. sari 2. transcend 7. virility 3. impel 8. stigma 4. rhetorical 9. subsidy 5. obstetric 10. destitute 11. Even as some fear for our spec... Date Added: 2009-06-07 13:53:15 |
| gradqntch_16&14.ppt Path: U. Houston >> DSCI >> 5431 Fall, 2009 Description: Module 5: Forecasting and Decision Analysis Chapters 16 and 14 2003 Thomson/SouthWestern 1 Slide Chapter 16 Forecasting s s s s s s s Qualitative Approaches to Forecasting Quantitative Approaches to Forecasting The Components of a... Date Added: 2009-06-07 13:53:49 |
| Chapter10Old.ppt Path: U. Houston >> QUANT >> 3131 Fall, 2009 Description: Quantitative Analysis for Management Chapter 10 Transportation and Assignment Models To accompany Quantitative Analysis for Management, 7e by Render/ Stair 10-1 2000 by Prentice Hall, Inc., Upper Saddle River, N.J. 07458 Specialized Problems Tra... Date Added: 2009-06-07 13:54:28 |
| Q2Sol.pdf Path: UT Arlington >> EE >> 3308 Fall, 2008 Description: Stelmakh ... Date Added: 2009-06-07 13:54:39 |
| case_ge.pdf Path: NYU >> PAGES >> 1303 Fall, 2009 Description: Firms and Markets Mini-Case Jack Welch and General Electric Revised: August 31, 2001 Jack Welch and General Electric have garnered almost cult-like followings on Wall Street, illustrated by Welch\'s $7.1 million book deal. But what has made GE so suc... Date Added: 2009-06-07 13:56:04 |
| lecture5.pdf Path: Harvard >> LECTURE >> 124 Fall, 2009 Description: 5@A F Q@PI Htkd 8G F E DCtBtPrC$|ptp\'rkk$u! 6 s 8 @ s 8 psqp u s p { 5 jv 7 g t8 P|ptt 6 s 7 7 % # ! Th\' 5 4 3 1 r&2 0 ( ) p s { p p wu pu sp u ... Date Added: 2009-06-07 13:58:30 |
| Sec1_4a.pdf Path: Siena Heights >> MAT >> 282 Fall, 2009 Description: Chapter 1 1st Order Differential Equations Finding solutions to DE A typical DE or IVP would be difficult to solve Even a 1st order one Given a general combination of x, y, y\', it might be impossible to solve for y Sections 1.4, 1.5, 1.6 show t... Date Added: 2009-06-07 14:02:54 |
| lecture08.ppt Path: CUNY Baruch >> GTECH >> 201 Fall, 2009 Description: GTECH 201 Session 08 GPS Global Positioning Systems GPS is a Satellite Navigation System GPS was originally funded by and controlled by the U. S. military. GPS provides specially coded satellite signals that can be processed ... Date Added: 2009-06-07 14:03:38 |
| TortureIsBad05.pdf Path: Berkeley >> ISF >> 100 Fall, 2008 Description: Britain\'s top court bans \"torture evidence\" By Michael Holden Thu Dec 8, 2005 LONDON (Reuters) - Britain\'s highest court ruled on Thursday that information obtained using torture anywhere in the world was unacceptable as evidence in the British judic... Date Added: 2009-06-07 14:07:31 |
| blk_mprec_005_g08_v01.txt Path: Berkeley >> G >> 005 Fall, 2009 Description: \"060050002003004\",\"5021\",0.847968 \"060050004021002\",\"3002\",0.304659 \"060050002003016\",\"5021\",0.339247 \"060050001001030\",\"5021\",0.252079 \"060050004021003\",\"3002\",0.437906 \"060050001001030\",\"3005\",0.201825 \"060050004021004\",\"3002\",0.981454 \"06005000100... Date Added: 2009-06-07 14:08:11 |
| lecture-12.pdf Path: Caltech >> CS >> 147 Fall, 2009 Description: Lecture 12 CS 286a Page 1 CS 286a Page 2 CS 286a Page 3 CS 286a Page 4 CS 286a Page 5 CS 286a Page 6 CS 286a Page 7 CS 286a Page 8 CS 286a Page 9 CS 286a Page 10 CS 286a Page 11 ... Date Added: 2009-06-07 14:11:46 |
| foo.pdf Path: Duke >> X >> 108 Fall, 2009 Description: Printed by Owen L. Astrachan Apr 01, 03 12:13 import java.util.*; ThreadTrouble.java Page 1/2 Apr 01, 03 12:13 ThreadTrouble.java Page 2/2 /* * Silly demonstration of thread troubles. Putters add, Takers take. * In first version, nothing is syn... Date Added: 2009-06-07 14:16:18 |
| 153a5.pdf Path: Berkeley >> STAT >> 153 Fall, 2008 Description: STAT 153 Assignment 5 solutions 1. (a) Let z |z| z zz = = = = = = = x + iy (x2 + y 2 ) by denition x iy (x + iy)(x iy) x2 (iy)2 x2 + y 2 |z|2 A sketch should show z z = |z|2 on the positive real axis. (b) Let z zj = rei = rei j = rj eij z j =... Date Added: 2009-06-07 14:17:26 |
| hw6.ps Path: Maryland >> CMSC >> 311 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: hw6new.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips hw6new %DVIPSParameters: dp... Date Added: 2009-06-07 14:18:46 |
| Quiz5keyWinter.pdf Path: MSOE >> BI >> 102 Fall, 2009 Description: Quiz 5 Key BI-102, Winter \'04-\'05, Dr. C. S. Tritt Each of the following three problems is worth the same amount. Answer each question completely but succinctly. Use the amount of space provided as a guide to how detailed to make your answer. 1. With... Date Added: 2009-06-07 14:21:04 |
| ln_w2.pdf Path: ECCD >> CHAT >> 49312 Fall, 2009 Description: Chapter 2 Weeding or: how I learned the meaning of Folk Psychology Leo Ferres IIS, Carleton University lferres@ccs.carleton.ca 2. 0. Definitions: An introduction My goal in this chapter is to define the general concepts I will be working with. This ... Date Added: 2009-06-07 14:21:09 |
| educ2422y.pdf Path: Moravian >> PUBLIC >> 200670 Fall, 2009 Description: MORAVIAN COLLEGE Bethlehem, Pennsylvania 18018 INCLUDING STUDENTS WITH SPECIAL NEEDS Educ. 242.2 Spring 07 Tuesday Night 1/16/07 to 2/27/07 Mrs. Camie Modjadidi PPHAC 323 Home Phone: 610-866-8475 Office Phone: 610-861-1473 E-mail: mecam01@moravian.ed... Date Added: 2009-06-07 14:27:18 |
| gradationtext.doc Path: San Diego State >> GEOL >> 552 Fall, 2009 Description: From Chapter 4 Soil Formation and Characteristics U.S. Army (1997) Military Soils Engineering. Field Manual 5-410. On-line at http:/www.adtdl.army.mil/cgi-bin/atdl.dll/fm/5-410/toc.htm Gradation The distribution of particle sizes in a soil is known a... Date Added: 2009-06-07 14:27:39 |
| emailTestOneFall2005.txt Path: UNI >> FACULTY >> 030 Fall, 2009 Description: Date: Mon, 7 Nov 2005 12:07:38 -0600 (CST) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-030-01@uni.edu Subject: Test one on Wednesday. Hi VB students, The class web page at: http:/www.cns.uni.edu/~jacobson/c030.html ... Date Added: 2009-06-07 14:28:08 |
| groupExerciseFeb01.txt Path: UNI >> FACULTY >> 053 Fall, 2009 Description: /* * Written by: Mark Jacobson on January 30th, 2002 1:30 p.m. * * * * Revised on: February 1st to use doubles. 3.14 and -42.5 * * aren\'t ... Date Added: 2009-06-07 14:28:46 |
| grayscale.pdf Path: San Diego State >> GEOG >> 381 Fall, 2008 Description: ... Date Added: 2009-06-07 14:29:12 |
| ex02-flat-recursion.txt Path: Iowa State >> COMS >> 342 Fall, 2009 Description: Com S 342 - Principles of Programming Languages EXERCISE 02: FLAT RECURSION WITH CONDITIONALS (File $Date: 2004/01/26 17:58:22 $) The purpose of this exercise is for you to learn some basic ideas about flat recursion over l... Date Added: 2009-06-07 14:30:05 |
| 090221_130708.txt Path: East Los Angeles College >> OP >> 130708 Fall, 2009 Description: Point,Lambda,OHSig,OHA,OHB/X,HO2Sig,HO2A,HO2B/X,RCSig,RCA,RCB/X,OHPD,HO2PD,RefPD,InletPT,PMT1V,PMT1A,PMT2V,PMT2A,PMT3V,PMT3A,MFC1,MFC2,MFC3,DetP,RefP,Pitot,NOValveState,Mode,Date,Time 1,461.986,16,16,0,5,5,0,6906,6908,2,8.09,2.67,1.27,0.03,2787.80,78... Date Added: 2009-06-07 14:33:49 |
| Lecture30_a660_20090513.ppt.pdf Path: San Diego State >> ASTRO >> 660 Fall, 2009 Description: Lecture 30 Galaxy luminosity function. Galaxy evolution. Galaxy clustering. Morphology-Density Relation An empirical relationship found to exist between the morphological types (Hubble types) of galaxies and the environments in which they are locate... Date Added: 2009-06-07 14:34:08 |
| syllabus.pdf Path: Washington >> CHEM >> 142 Fall, 2008 Description: ... Date Added: 2009-06-07 14:38:00 |
| FinishingSysQuestionnaire.doc Path: Juniata >> IT >> 110 Fall, 2008 Description: FINISHING SYSTEM QUESTIONNAIRE GENERAL COMPANY: _ _ ADDRESS: PHONE: FAX: _ _ _ __ PROJECT TIMETABLE: _ _ _ FUNDING: DATE: _ r APPROVED r NOT APPROVED CONTACTS: __ BUDGET: _ _ _ PROJECT CONCERNS (RATE 1-4, 1 HIGHEST): _ FINISHING COSTS _ INCREAS... Date Added: 2009-06-07 14:44:17 |
| Prob4.pdf Path: UC Davis >> YCLEPT >> 242 Fall, 2009 Description: d n f r xuv h j n vh h h j d jw i jh iw ih i redkmjIQw ggdQqQeljXwqQelg7l pehwtmwtQkQpf elt`Ftgedgupqew tQgoQtUx Qw e\'j`epheljd erphoi7Qel\'wggQd j n j x ih i n r d f j vh i s ihh h n h j h d d 2 | z eQgdQQwehQtQmld k kwQe... Date Added: 2009-06-07 14:44:52 |
| problem_set_Homework_2.pdf Path: Washington >> CHEM >> 460 Fall, 2008 Description: ... Date Added: 2009-06-07 14:45:51 |
| prc6-sol.pdf Path: San Diego State >> CHEM >> 410 Fall, 2009 Description: Chem 410B Practice 6 Solutions Spring 2009 1. We mix 978 ml of solvent A with 22 ml of solute B, and end up with a saturated solution that occupies 998 ml. If I want to force some of B to separate fropm the solution, should I raise or lower the pr... Date Added: 2009-06-07 14:46:47 |
| 22.pdf Path: Berkeley >> M >> 104 Fall, 2009 Description: Applications of Integration Adrian Down 16779577 July 28, 2005 1 Sequences of integrable functions Theorem: if (fn ) is a sequence of functions that are integrable on [a, b], and (fn ) converges to f on [a, b], then f is integrable on [a, b] and b... Date Added: 2009-06-07 14:50:11 |
| AC.pdf Path: San Diego State >> IVC >> 0001 Fall, 2009 Description: 2000-2001 FALL SEMESTER 2000 August 1 (Tues.) Academic Calendar December 21 (Thurs.) December 21-27 (Thurs.-Wed.) December 28 (Thurs.) December 28 (Thurs.) December 28 (Thurs.) January 1 (Mon.) Winter recess begins. Holiday-Winter recess. Staff holi... Date Added: 2009-06-07 14:52:02 |
| ReactionPaper4.pdf Path: U. Houston >> EPSY >> 6340 Fall, 2008 Description: Reaction Paper 4: Rojewski Schell (1994) make use of a 1 number of developmentalist and constructivist strategies, including the ideas that learning should be tailored to t... Date Added: 2009-06-07 14:59:21 |
| Oral-pres-viewer.doc Path: UT Chattanooga >> ENGR >> 329 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|10 Sep 2003 16:29:18 -0000 vti_extenderversion:SR|5.0.2.6738 vti_cacheddtm:TX|10 Sep 2003 16:29:18 -0000 vti_filesize:IR|19968 vti_cachedtitle:SR| vti_title:SR| vti_assignedto:SR| vti_approvallevel:SR| ... Date Added: 2009-06-07 14:59:33 |
| T0358.t2k.n_notor2-logo.pdf Path: UCSC >> T >> 0358 Fall, 2009 Description: T0358.t2k n_notor2 3 2 1 NNN X X X N G N S N N X X X X X X X X 10 20 30 40 N 3 2 1 H N B N S N B N G N B BB A A NPNNNS P P S S NA B X X X X XX N 51 60 70 N H N 80 RA WNF EPDAGEGL NRYIRTSGIRTDTA T R L EH H H HH H NN X ... Date Added: 2009-06-07 14:59:37 |
| 08_sockets.pdf Path: University of Louisiana at Lafayette >> CACS >> 360 Fall, 2009 Description: Using Sockets (2005.12.26) I. Sockets Using Sockets 2 Sockets link is bidirectional link usually in the form of a client / server pair example: normal http port is 80 http:/www.yahoo.com is sent by the client browser as http:/www.yahoo.com:8... Date Added: 2009-06-07 15:02:03 |
| gc.pdf Path: Maryland >> CMSC >> 828 Fall, 2005 Description: gc0 GARBAGE COLLECTION METHODS Hanan Samet Computer Science Department and Center for Automation Research and Institute for Advanced Computer Studies University of Maryland College Park, Maryland 20742 e-mail: hjs@umiacs.umd.edu Copyright 1997 Ha... Date Added: 2009-06-07 15:02:49 |
| L-13.ps Path: Duke >> X >> 230 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: Book.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o Book.ps Book.dvi %DVIPSPar... Date Added: 2009-06-07 15:14:21 |
| test.txt Path: Duke >> X >> 100 Fall, 2009 Description: this is a test file there is nothing more to it thank you ... Date Added: 2009-06-07 15:14:32 |
| team03.pdf Path: Duke >> X >> 108 Fall, 2009 Description: Printed by Robert C. Duvall Oct 07, 03 12:55 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 README Page 1/1 cs33 pgi hyperwag CPS108 Oct 6, 2003 We worked on this project a total of about 11 hours / team member. We only implemented the wagalang a... Date Added: 2009-06-07 15:14:43 |
| CAMPBELL_-_Multiple_intelligences_in_the_classroom.pdf Path: McGill >> ARCHIVE >> 973 Fall, 2009 Description: Bruce Campbell - Multiple Intelligences In The Classroom Page 1 of7 \\\'illCi\'lfM to the back issue library of Context Institute\'s aW3rd,winning journal A Quarterly Of Humane Sustainable Culture <:{ Home I l\\.O(1Ut CJ I Bilck IS,\\4c LL\'jting I Aoo\\4... Date Added: 2009-06-07 15:16:44 |
| PracticeFinal100BW08.pdf Path: UCSB >> PHYS >> 100 Fall, 2009 Description: Practice Final Exam Note From Prof M.: The rules stated below will also hold for the actual final exam. [GIRV 2129, Friday, March 21, 12-3 pm]. Attempting the problems on this practice exam will give you a good idea of how prepared you are for the ac... Date Added: 2009-06-07 15:22:24 |
| HW2.doc Path: UCSB >> CHEMEE >> 124 Fall, 2009 Description: HW #2 As disused in class, safety lessons can be categorized in three broad classes as follows: 1. Ethical and Oversight 2. Procedural / \"System\'s\" (component interactions including human factors) behavior context 3. Technical / \"Physics\" (thermoc... Date Added: 2009-06-07 15:23:50 |
| DESCRIPTION.doc Path: Middlebury >> S >> 0500 Fall, 2009 Description: DESCRIPTION: Monday and Wednesday Holly Allen 2:353:50 PM ADK219 Bi Hall 148 2042; 5452567 Office hrs: M12, F 23:30 (before 9:30 PM) or by appoint... Date Added: 2009-06-07 15:27:21 |
| MajorChecklist.pdf Path: NYU >> AS >> 3810 Fall, 2009 Description: New York University Center for European and Mediterranean Studies Undergraduate Major Checklist The undergraduate major in European Studies requires a total of 10 courses. All requirements are courses beyond the introductory course level. Two (2) cou... Date Added: 2009-06-07 15:29:19 |
| 115hmwk2.pdf Path: UCSB >> GORDON >> 115 Fall, 2009 Description: Linguistics 115 Spring 2006 Homework # 2: Pacific Coast Athabaskan (Due Thursday, April 27) Consider the following data from six Pacific Coast Athabaskan languages spoken/formerly spoken in northern California and southern Oregon and answer the ques... Date Added: 2009-06-07 15:29:56 |
| Exporatorium Forum.pdf Path: DePaul >> IS >> 375 Fall, 2009 Description: PROBLEM SOLVE OVERHEAR INTERACT REFLECT REMEMBER ANALYZE OBSERVE CONNECT COMMUNICATE RECORD ENLIGHTEN MANIPULATE EXPERIMENT ASSOCIATE EXPLORE PROBE EXTRAPOLATE INTENSIFY INTEGRATE NOTICE EXPERIMENT SOCIALIZE WONDER IDENTIFY Electronic Guidebook F... Date Added: 2009-06-07 15:30:29 |
| CompSci6-070417hand.pdf Path: Duke >> X >> 006 Fall, 2009 Description: CompSci 6 Programming Design and Analysis April 17, 2007 Prof. Rodger Announcements No Reading for next time, more on Maps No Reading Quiz for next time Final Exam Monday, April 30, 2-5pm Last Time Recursive Art Two ways to draw art recursive... Date Added: 2009-06-07 15:37:14 |
| fa08L25.txt Path: UF >> CISE >> 3023 Fall, 2009 Description: /* Project 2 - we already have Card, Hand - class Deck properties: Stack cards, int numberOfCards methods: shuffle, draw, deal, sort, search - class Driver properties: Deck deck, Hand hands[] user menu: sort, search, shuffle... Date Added: 2009-06-07 15:38:02 |
| index.pdf Path: Temple >> MATH >> 013 Fall, 2009 Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Summer1 2007 Course Syllabus Course: Mathematics 1021.013. Course Title: Math 1021 College Algebra. Time: Monday through Friday, 9 am to 10:35 am. Place: Barton Hall Clas... Date Added: 2009-06-07 15:41:19 |
| Wk 13 Ray Tracing.pdf Path: Utah >> CS >> 5600 Spring, 2008 Description: Ray Tracing Thanks to UDel and MIT Outline Recursive rays Reflection Refraction 1 Ray Tracing Model: Perceived color at point p is an additive combination of local illumination (e.g., Phong), reflection, and refraction effects Compute reflect... Date Added: 2009-06-07 15:43:31 |
| ProfPracPrimary_120.pdf Path: Allan Hancock College >> DOCS >> 12009 Fall, 2009 Description: Office of Teaching and Learning School: Regional, Remote and E-Learning: Centre for Regional Education In Partnership with: School of Education Professional Practice in Primary Education 120 Unit Outline Semester 1, 2009 ADMINISTRATIVE INFORMATION U... Date Added: 2009-06-07 15:43:56 |
| Syraiders2.ppt Path: UF >> CEN >> 8686 Fall, 2009 Description: Database Group Adam Bellaire Joe Bruno Brien Hackney Mohamedali Patel Stories Completed The first story was split into two stories 1. Create dummy table and populate it with 2 or 3 tuples Test table was created and connected to the CM (connection... Date Added: 2009-06-07 15:44:00 |
| binomial.pdf Path: Allan Hancock College >> ICS >> 106 Fall, 2009 Description: Binomial Coefficients William Chen We briefly make some remarks on a problem that we have considered in the \"cat\" puzzle, and discuss a simple formula that enables us to perform calculations more easily. Recall the problem of arranging two letters ... Date Added: 2009-06-07 15:44:09 |
| DRAWING+ASSIGNMENT+10.pdf Path: Eckerd >> AR >> 102 Fall, 2009 Description: DRAWING ASSIGNMENT 10 FOR TUESDAY APRIL 29: TWO DRAWINGS TOTAL, THE CHOICES AS FOLLOWS: FOR ASSIGNMENT 10, REFER TO THE PREVIOUS ASSIGNMENT (NUMBER 9) AND CHOOSE TWO OPTIONS YOU DID NOT DO, OR REVISIT ONE YOU DID AND DO IT DIFFERENTLY. 3.5 HRS. CONSI... Date Added: 2009-06-07 15:46:39 |
| Lecture33.pdf Path: UF >> MET >> 1010 Fall, 2008 Description: Thunderstorms Current weather conditions RECAP Thunderstorm development and structure Flooding Conditions: the influx of water into an area is more than the amount of water that can drain away from the region. The ground is saturated from pr... Date Added: 2009-06-07 15:56:55 |
| ESP_flowdata_PNW_split.txt Path: Washington >> CURR >> 20071101 Fall, 2009 Description: Monthly Average ESP Streamflows (cfs) for start date: 20071101 Format: columns are sequential months starting with: 11-2007 (Apr and Aug are splitted). rows, for each location, are ordered by fcst. met. years, 1960-1999 signifying th... Date Added: 2009-06-07 15:58:22 |
| student_conduct_board_application.pdf Path: New Haven >> UNH >> 04212008 Fall, 2009 Description: University of New Haven Student Conduct Board Application Name:_ Building/Room:_ If commuter list permanent address: _ _ Room/Home Phone:_ Cell Phone:_ Major:_ Class Year:_ Email:_ Please answer the questions below. You may use other side of this fo... Date Added: 2009-06-07 16:00:17 |
| Halevy.DataIntegrationTeenageYears.ppt Path: BYU >> CS >> 652 Fall, 2008 Description: Data Integration: The Teenage Years Alon Halevy (Google) Anand Rajaraman (Kosmix) Joann Ordille (Avaya) VLDB 2006 Agenda A few perspectives on the last 10 years Technical, commercial Perspectives from our personal paths Wild speculations about ... Date Added: 2009-06-07 16:05:26 |
| Chap008.ppt Path: Mitchell >> BU >> 325 Fall, 2009 Description: 8 Chapter McGrawHill/Irwin Sources of ShortTerm Financing Copyright 2008 by The McGrawHill Companies, Inc. All rights reserved. Chapter Outline Trade credit from suppliers. Bank loans. Commercial paper. Borrowing in foreign markets. Using co... Date Added: 2009-06-07 16:09:18 |
| Chapter4.pdf Path: Texas San Antonio >> CS >> 1023 Fall, 2008 Description: A Gift of Fire Third edition Sara Baase Chapter 4: Intellectual Property What We Will Cover Intellectual Property and Changing Technology Copyright Law and Significant Cases Copying and Sharing Search Engines and Online Libraries Free-Speech Issue... Date Added: 2009-06-07 16:11:25 |
| prooflect.pdf Path: Stanford >> LINGUIST >> 233 Fall, 2009 Description: \'23 ) \' %& fa da da cX V aab ` W UV TS XY E 0 \'2 I e 10 ( hh i h g dh mnl o o o dh h jk h k p rq h sk aV u e U z | V fw U X f X k dh t hg i v 5 A0 \'0 7 \' \' A2 \'E C \'I E0 I 8C 3 B h 6 EC C ( 3I CI $0 fa X... Date Added: 2009-06-07 16:12:45 |
| T0457.t2k.pb-logo.pdf Path: UCSC >> T >> 0457 Fall, 2009 Description: T0457.t2k pb 5 4 3 2 1 M VE I F N E I M Q RV K E AE T I II H R HV R PD P D A Y G SQ L G LK L Y LE R K FP E K NI Y A T G EA E P S L S F I G D L DE I D D S V Y SD A L V I V C DT A N A P R I DD Q R Y L N G QS 1 10 20 30 40 50 60 70 80 90 M 5 4 3 2 1 B... Date Added: 2009-06-07 16:18:00 |
| ESP_flowdata_COLO_split.txt Path: Washington >> CURR >> 20081101 Fall, 2009 Description: Monthly Average ESP Streamflows (cfs) for start date: 20081101 Format: columns are sequential months starting with: 11-2008 (Apr and Aug are splitted). rows, for each location, are ordered by fcst. met. years, 1960-1999 signifying th... Date Added: 2009-06-07 16:22:10 |
| HW4.doc Path: San Jose State >> METR >> 112 Fall, 2008 Description: Homework Assignment 4 METR112 Due December 4, 2008 1. Explain how a decrease in the earth\'s tilt would change the climate (i.e. temperature) of North America. 2. Right now the perihelion of the earth\'s orbit occurs in December and thus the souther... Date Added: 2009-06-07 16:23:33 |
| CGS_SpecSheets_CertificateLeadership.pdf Path: Northwestern MN >> PDFS >> 1721 Fall, 2009 Description: Revised 10/08 Graduate CertifiCate in Leadership GRaduate CeRtifiCate in LeadeRship The Graduate Certificate in Leadership provides an introduction to graduate-level education and offers the opportunity to expand skills and knowledge related to lead... Date Added: 2009-06-07 16:24:24 |
| edtametal.pdf Path: CSU Channel Islands >> PS >> 151 Fall, 2009 Description: EDTA-Metal ion Complexation. Chem 151 Fall 2006. R. Corn EDTA is a polyprotic acid - Ethylenediaminetetraacetic Acid. H4Y. pK1 = 1.99; pK2 = 2.67; pK3 = 6.16; pK4 = 10.26. Alpha fraction for Y4-: 4- = Y K1K 2 K 3 K 4 [H + ]4 + K1[H + ]3 + K1K 2... Date Added: 2009-06-07 16:24:32 |
| L13-Gas_Transport.pdf Path: Utah >> BE >> 6000 Fall, 2009 Description: Respiratory Physiology Respiratory Physiology Bioengineering 6000- Systems Physiology Organization Gas transport and acid/base balance in blood Hb, O2 and CO2 transport Principles of acid-base balance Mechanics of ventilation Physical aspects... Date Added: 2009-06-07 16:24:40 |
| METO112-climatefeedback.ppt Path: San Jose State >> METR >> 112 Fall, 2008 Description: MET 112 Global Climate Change - Climate Feedbacks Professor Menglin Jin San Jose State University Outline Stability/instability Feedbacks Examples Activity MET 112 Global Climate Change 1 Climate Feedbacks Earth/Atmosphere is delicate balance... Date Added: 2009-06-07 16:26:37 |
| TomasulosAlgorithm.pdf Path: Villanova >> CSC >> 8400 Fall, 2009 Description: R. M. Tomasulo An Efficient Algorithm for Exploiting Multiple Arithmetic Units Abstract: Thispaperdescribes the methods employed in thefloating-pointareaof the System/360Model 91 to exploitthe existence of multiple execution units. Basic to these te... Date Added: 2009-06-07 16:26:41 |
| chap10_examples.ppt Path: Texas A&M >> CVEN >> 302 Fall, 2008 Description: LU Decomposition > A=[2 1 -3 5; 5 -1 2 4; 6 1 -3 2; 1 4 2 -5] A = 2 1 -3 5 5 -1 2 4 6 1 -3 2 1 4 2 -5 > f21=5/2; f31=6/2; f41=1/2; > F1=[1 0 0 0; -f21 1 0 0; -f31 0 1 0; -f41 0 0 1] F1 = 1.0000 -2.5000 -3.0000 -0.5000 > F1*A ans = 2.0000 0 0 0 1.0000... Date Added: 2009-06-07 16:27:26 |
| logical-connectives.txt Path: UCF >> COMS >> 342 Fall, 2009 Description: Com S 342 meeting -*- Outline -*- * logical connectives (3.2) - LOGICAL CONNECTIVES (3.2) problem: verbosity (define member? ; TYPE: (-> (T (list T) boolean) (lambda (e ls) (if (not (null? ls) (if (equal? e (car ls) ... Date Added: 2009-06-07 16:29:16 |
| peereval.txt Path: Carleton >> CS >> 117 Fall, 2009 Description: Peer Evaluation Form Because you are working on a team, I would like some information as to how the experience went. Specifically, I want you to give me an honest appraisal of the work that both you and your partner(s) did on your assignments. Pro... Date Added: 2009-06-07 16:29:34 |
| 2000324_f01c_002284.pdf Path: Stanford >> MCMINC >> 1017 Fall, 2009 Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK CROMER FINANCE, LTD., individually and on behalf f all others similarly situated, Plaintiff, -against- ORIGINAL :0 0 00- \\ AR 7 ,c7) n ,(71 /I CLASS ACT/ON COMPLAINT MICHAEL BERGER, DELOIT... Date Added: 2009-06-07 16:35:36 |
| agenda.txt Path: Stanford >> SLAC >> 20080610 Fall, 2009 Description: Call: 510-665-5437 When: June 10, 2008, 07:30 AM America/Los_Angeles Meeting ID: 2101 Preliminary Agenda Items - o) Chase up German FA on Tier A funding proposal. [FFW/BS] o) Add contingency to tape request for 2009. [GPDF] o) Updated usage statis... Date Added: 2009-06-07 16:38:17 |
| sources.txt Path: Brookdale >> WEEK >> 1100 Fall, 2009 Description: /* Author: Christopher Baltzer Date written: October 31, 2006 Description: Prints out an array */ public class Exercise_1 { public static void main(String[] args) { / Setup the array int[] array = {10, 12, 11, 9, 11}; / Print the ... Date Added: 2009-06-07 16:42:28 |
| ws12s09key.pdf Path: Texas >> CH >> 302 Fall, 2008 Description: 1. What factors determine the rate of a reaction? How does each of them affect the rate? Answer: Rate = []xAe[-Ea/RT]. Shown in this equation, the factors affecting rate of reaction are: concentration and order of reactants and products ([]x, which i... Date Added: 2009-06-07 16:56:50 |
| SimplifyingComplexityAReviewOfComplexityTheory.pdf Path: East Los Angeles College >> JO >> 115 Fall, 2009 Description: Simplifying Complexity: A Review Of Complexity Theory \"there is no one identifiable complexity theory\" \"the exact nature of complexity research is hard to discover due to the large degree to which complexity ideas are traded across disciplinary bound... Date Added: 2009-06-07 16:56:52 |
| HW6.pdf Path: Missouri S&T >> ME >> 401 Fall, 2009 Description: ME401 Homework Assignment No. 6 [20 pts] Assigned: Tuesday, February 25, 2003 Due: Tuesday, March 4, 2002. z u(x,t) M x K b h L Figure 1. Cantilevered beam with end mass and spring. Table 1. Beam dimensions, material constants. Parameter L b h ... Date Added: 2009-06-07 17:00:52 |
| Lec4.pdf Path: Wyoming >> COSC >> 3015 Fall, 2008 Description: COSC 3015: Lecture 4 Lecture given by Prof. Caldwell and scribed by Sunil Kothari September 16, 2008 1 Recap Somebody asked about what\'s going on ? So here is the response. Recall functions from dom a to codomain b: a b where, a and b are type va... Date Added: 2009-06-07 17:05:54 |
| slac-pub-10876.pdf Path: Stanford >> PUBS >> 10750 Fall, 2009 Description: SLACPUB10876 December 2004 A Super Strong Permanent Magnet Quadrupole for the Final Focus in a Linear Collider* Takanori Mihara, Yoshihisa Iwashita Kyoto University, Gokanosho, Uji, Kyoto 611-0011, Japan Masayuki Kumada, Antokhin Evgeny National Ins... Date Added: 2009-06-07 17:19:18 |
| t15BStructuresFunctionsAndArrays.ppt Path: IUPUI >> CSCI >> 230 Fall, 2008 Description: Department of Computer and Information Science, School of Science, IUPUI CSCI 230 Structures Functions and Arrays Dale Roberts, Lecturer Computer Science, IUPUI E-mail: droberts@cs.iupui.edu Dale Roberts Using Structures With Functions Passing st... Date Added: 2009-06-07 17:19:27 |
| rec_errors.txt Path: BYU >> DEG >> 192 Fall, 2009 Description: Tidy (vers 4th August 2000) Parsing \"InputStream\" InputStream: Document content looks like HTML 3.2 1 warnings/errors were found! Exception in thread \"main\" java.lang.ArrayIndexOutOfBoundsException: 1 >= 1 at java.util.Vector.elementAt(Vector.jav... Date Added: 2009-06-07 17:20:03 |
| sol2.pdf Path: UCSD >> MA >> 102 Fall, 2009 Description: Mathematics 102 Fall 2008 Quiz 2 Name: No aids are allowed. Be sure to write down all row operations used. Remember that you can often check your answers. This quiz contains 2 questions, one on this side, the other on the ip side. 1) (5 points) Com... Date Added: 2009-06-07 17:21:22 |
| output.txt Path: BYU >> DEG >> 128 Fall, 2009 Description: insert into DigitalCamera values(1001, \", \", \"4.99\", \", \", \") insert into DigitalCamera values(1002, \", \", \"1\", \", \", \") insert into DigitalCamera values(1004, \", \", \"1\", \", \", \") insert into DigitalCamera values(1005, \", \", \"1\", \", \", \") insert into... Date Added: 2009-06-07 17:21:26 |
| lecture1.pdf Path: UCSD >> PS >> 271 Fall, 2008 Description: PS 271B: Advanced Statitical Applications Lecture Notes Langche Zeng zeng@ucsd.edu 2 The Empirical Research Process; Fundamental Methodological Issues Theory; Data; Models/model selection; Estimation; Inference. (Order?) Examples: Presidential ap... Date Added: 2009-06-07 17:31:32 |
| GEOL485_S07_G01.pdf Path: UNLV >> GEOL >> 485 Fall, 2008 Description: GEOL 485/796 CE 432/632 Spring 2007 Graduate Assignment #1 Due: 3/6/07 1) Locate a journal or conference proceeding that documents an engineering project in which a rock slope was stabilized. The article should be short (less than 10 pages) and be... Date Added: 2009-06-07 17:31:36 |
| johns&doswell_92.pdf Path: S.F. State >> M >> 530 Fall, 2009 Description: ... Date Added: 2009-06-07 17:35:25 |
| CreativityQuotes.doc Path: Portland >> SBA >> 346 Fall, 2009 Description: TW0 GREAT QUOTES ON CREATIVITY FROM Roger van Oech and Edward deBono Dogma \"Nothing clouds your mind like dogma,\" says Roger van Oech, creative consultant, in his book A Kick In the Seat of the Pants (Harper and Row). Dogma can come from an outsi... Date Added: 2009-06-07 17:56:44 |
| beyondrecon.pdf Path: Cleveland State >> HIS >> 317 Fall, 2009 Description: Financial Legacy of War Politics Republicans Northern workers, farmers Southern black people Increasingly business-oriented Abandoned abolitionist goals of equality Financial Legacy of War Politics Democrats Northern minority party Souther... Date Added: 2009-06-07 17:58:36 |
| CS-310-4.pdf Path: Laurentian >> CS >> 310 Fall, 2009 Description: ... Date Added: 2009-06-07 17:59:07 |
| Rubin-Ford-1970.pdf Path: Rutgers >> GRAD >> 690 Fall, 2009 Description: 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R 1970ApJ.159.379R... Date Added: 2009-06-07 18:13:26 |
| hw8_soln.pdf Path: UCSC >> EE >> 171 Winter, 2008 Description: ... Date Added: 2009-06-07 18:15:53 |
| 01-NEJM_money_and_culture_of_medicine.pdf Path: UC Davis >> ATT >> 0901 Fall, 2009 Description: The NEW ENGLA ND JOURNAL of MEDICINE Perspective january 8, 2009 Money and the Changing Culture of Medicine Pamela Hartzband, M.D., and Jerome Groopman, M.D. apidly rising health care costs over recent decades have prompted the application of b... Date Added: 2009-06-07 18:16:13 |
| blicq7.ppt Path: Allan Hancock College >> USERS >> 70210 Fall, 2009 Description: Engineering Communications Surveying U.S.Q. 1 Objectives Describe how to write a user\'s manual. s Provide detailed guidelines for wri... Date Added: 2009-06-07 18:19:27 |
| CLOQUET.xls Path: Minnesota >> FR >> 3131 Fall, 2008 Description: Data File Cloquet Homework 2 Extra FR3131/5131 Spring 2003 Polygon_Number 2 3 4 6 8 9 10 11 12 14 15 16 17 20 21 22 23 24 25 26 27 30 31 32 33 34 35 36 37 38 39 40 41 42 43 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 Area ... Date Added: 2009-06-07 18:20:21 |
| emailTestOneFall2005.txt Path: UNI >> CNS >> 030 Fall, 2009 Description: Date: Mon, 7 Nov 2005 12:07:38 -0600 (CST) From: Mark Jacobson <jacobson@math-cs.cns.uni.edu> To: 810-030-01@uni.edu Subject: Test one on Wednesday. Hi VB students, The class web page at: http:/www.cns.uni.edu/~jacobson/c030.html ... Date Added: 2009-06-07 18:22:30 |
| 442-306.pdf Path: Virginia Tech >> PUBS >> 442 Fall, 2009 Description: publication 442-306 Selecting a Treatment Technology for Manure Management Jactone Arogo Ogejo, Assistant Professor, Department of Biological Systems Engineering Animal manure has been used for centuries as a fertilizer and a soil builder because i... Date Added: 2009-06-07 18:22:33 |
| 0914-minor-russialaborcase.pdf Path: Virginia Tech >> USA >> 1919 Fall, 2009 Description: Minor: Russia - The World\'s Greatest Labor Case [Sept. 14, 1919] 1 Russia - The World\'s Greatest Labor Case: A Speech in San Francisco. by Robert Minor Published in the New York Call Magazine, September 14, 1919, pp. 1, 4-5. Robert Minor, cartooni... Date Added: 2009-06-07 18:24:47 |
| 414-020.pdf Path: Virginia Tech >> PUBS >> 414 Fall, 2009 Description: publication 414-020 Composting for Mortality Disposal on Hog Farms Allen F. Harper, Extension Animal Scientist-Swine, and Mark J. Estienne, Swine Research Physiologist, Virginia Tech Tidewater Agricultural Research and Extension Center Introduction... Date Added: 2009-06-07 18:31:03 |
| handout15.pdf Path: UC Davis >> STA >> 100 Fall, 2008 Description: . i;+.-.I-.-.-\" I \' \'Ij i ,\'. L1 c . - , r- , . . ... Date Added: 2009-06-07 18:31:26 |
| hwk4-scores.pdf Path: UCSC >> AMS >> 005 Fall, 2009 Description: ... Date Added: 2009-06-07 18:32:03 |
| problem2_solution_step2.pdf Path: Utah State >> MATH >> 0900 Fall, 2008 Description: Ratios Problem 2. Write a ratio for the word phrase. Simplify fractions. 45 people to 21 people Solution Step 1: Remember to write the ratio as a fraction. You should have: 45 people 21 people Solution Step 2: After simplifying, your final answer sho... Date Added: 2009-06-07 18:36:11 |
| abstract.doc Path: Bridgeport >> CS >> 597 Fall, 2009 Description: Abstract IC Package Simulation Extractor is a fast simulation-extracting tool that generates two files: Spice file and Text file. It consists of two parts. One is simulation extraction and the other is user interface. The main code (simulation part) ... Date Added: 2009-06-07 18:36:32 |
| makehelp.txt Path: CSU Chico >> CSCI >> 151 Fall, 2009 Description: Make utility The following makefile examples will show (1) a basic makefile, (2) a makefile that allows the use of the UNIX xdb debugger, and (3) a makefile with simple macros. The makefile syntax is: target: dependencies action (The acti... Date Added: 2009-06-07 18:36:52 |
| 01-posting.doc Path: UC Davis >> ATT >> 0589 Fall, 2009 Description: D\'ANGELO LAW LIBRARY, UNIVERSITY OF CHICAGO Associate Law Librarian for Public Services The D\'Angelo Law Library of the University of Chicago is seeking highly motivated and service oriented candidates for the position of Associate Law Librarian for ... Date Added: 2009-06-07 18:36:56 |
| hw6-ak.doc Path: W. Kentucky >> CSC >> 425 Fall, 2009 Description: CSC 425/525 Homework #6 answer key. 1. i. While humans learn through induction, the processes from Winston and Mitchell are too rudimentary and not very cognitively realistic. ii. Humans do not process massive amounts of data as we see in decision tr... Date Added: 2009-06-07 18:39:46 |
| 100BTest2Review.pdf Path: CSU Sacramento >> ECON >> 100 Fall, 2009 Description: 1 Review Questions for Test Two: Chapter Seven: 1. Define and then derive the expression for the marginal rate of technical substitution (MRTS). 2. Suppose an isoquant is a straight line with a slope of -1. What does this imply concerning the margin... Date Added: 2009-06-07 18:41:17 |
| b1047igsa.txt Path: Mt. Holyoke >> BSOL >> 1047 Fall, 2009 Description: -10.6671 573 -10.6218 565 -10.5765 567 -10.5312 548 -10.4859 556 -10.4406 570 -10.3953 541 -10.3500 526 -10.3047 519 -10.2595 537 -10.2142 546 -10.1689 546 -10.1236 547 -10.0783 556 -10.0330 572 -9.9877 586 -9.9424 588 -9.8971 587 -9.8518 589 -9.8065... Date Added: 2009-06-07 18:52:14 |
| staticpressurereview.pdf Path: Charleston Law >> HOME >> 311 Fall, 2009 Description: ENGN 311/311L Schematic for Fluid Statics Equation Derivation Forces on a fluid element at rest: z y g p dz ^ p + dxdy - k z 2 p dx i p - dydz ^ x 2 ( ) () dz x p dy p - dxdz ^ j y 2 () dFB dx dy p dy p + dxdz - ^ j y 2 ... Date Added: 2009-06-07 18:53:09 |
| staticpressurereview.pdf Path: Charleston Law >> ENGN >> 311 Fall, 2009 Description: ENGN 311/311L Schematic for Fluid Statics Equation Derivation Forces on a fluid element at rest: z y g p dz ^ p + dxdy - k z 2 p dx i p - dydz ^ x 2 ( ) () dz x p dy p - dxdz ^ j y 2 () dFB dx dy p dy p + dxdz - ^ j y 2 ... Date Added: 2009-06-07 18:53:09 |
| YCL011C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YCL >> 011 Fall, 2009 Description: YCL011C.t2k EBGHSTL 3 2 1 C X C E T X C CCC C SSS CCCC TT CSCCCCTTSTSSSTTTSTSTSTTTTTSTTTSTSSSTSSTTSSTTSSHH S TTTSTTSSTTSSTHCC T C H S T T S T S S S S T S S S H H S S S H T X XXX CCCC C T CCCCCC C C C CCCCCCCCCCCCCCCC C XX H X H H H H H H H... Date Added: 2009-06-07 18:55:57 |
| sunpath_equinox.pdf Path: UNLV >> ASTRO >> 002 Fall, 2009 Description: Sun\'s Path on an Equinox Transit Point Zenith Above Horizon NCP eri dia n Th S Observer Ho riz on eM W N E Below Horizon DJ Jeffery UNLV 2003 ... Date Added: 2009-06-07 19:04:54 |
| SoftArchDoc_Team 1.doc Path: Rose-Hulman >> TEAM >> 374 Fall, 2009 Description: Software Architecture Documentation for 2-D Object Tracker Team 1: Jeffrey Gehring, Wes Winham 02/12/06 1. Introduction The purpose of this document is to outline and explain the software architecture. 2. Background This system shall be able to det... Date Added: 2009-06-07 19:05:53 |
| SampleExam2.pdf Path: Acton School of Business >> CHEM >> 211 Fall, 2009 Description: Chem. 211 Exam No. 2 10/10/01 Name_ Pledge_ __ You may use only molecular models and a calculator on this exam. 1. (10 points) Show a neat drawing of the two chair conformations of the following cyclohexanes. State which of your conformers is more... Date Added: 2009-06-07 19:05:57 |
| Vision Statement.doc Path: Rose-Hulman >> TEAM >> 374 Fall, 2009 Description: Vision Statement Andrew Compton & Justin Hutchings CSSE 374 Introduction The Digital Homework Helper is an interactive, portal that allows students to share homework files. While Fraternities and Sororities at many College campuses have been doing t... Date Added: 2009-06-07 19:06:01 |
| SoftArchDoc_Team_1.doc Path: Rose-Hulman >> TEAM >> 374 Fall, 2009 Description: Software Architecture Documentation for 2-D Object Tracker Team 1: Jeffrey Gehring, Wes Winham 02/12/06 1. Introduction The purpose of this document is to outline and explain the software architecture. 2. Background This system shall be able to det... Date Added: 2009-06-07 19:06:07 |
| YOR281C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YOR >> 281 Fall, 2009 Description: YOR281C.t2k CB_BURIAL_14_7 3 2 1 AAAAAA AAAA AAAA B C C C C D D C D D B C C D D X X X X X X X X X X X X 1 10 20 30 40 A 3 2 1 D A D A A AAAAAAABABABAABBAABBABBBA BB B B BBBB B B B CCC C CDDCDDDCDCD C CC D BB C C D C E X X X X X X X X X ... Date Added: 2009-06-07 19:06:42 |
| svn-ref.pdf Path: Allan Hancock College >> COMP >> 2303 Fall, 2009 Description: ... Date Added: 2009-06-07 19:12:18 |
| formula_final.pdf Path: Colorado >> AMATH >> 1360 Spring, 2007 Description: APPM 1360 Final Exam Spring 2009 Formulae The following equations may be useful Equations from Chapter 5 Note: these are all definite integrals; the limits of integration and the variable you integrate with respect to depend on the formulation of... Date Added: 2009-06-07 19:12:24 |
| Raisanen2007.pdf Path: UNC Wilmington >> PHY >> 420 Fall, 2009 Description: Tellus (2007), 59A, 229 Printed in Singapore. All rights reserved C 2006 The Author Journal compilation C 2006 Blackwell Munksgaard TELLUS REVIEW ARTICLE How reliable are climate models? By J O U N I R A I S A N E N , Department of Physical ... Date Added: 2009-06-07 19:12:31 |
| 3-6.pdf Path: UNC Wilmington >> M >> 161 Fall, 2009 Description: Implicit Differentiation 3.6 Implicit Differentiation Thursday, March 09, 2006 3:56 PM 3. Differentiation Rules Page 1 3.6a Implicit Differentiation 3. Differentiation Rules Page 2 3.6b Implicit Differentiation (Cont.) 3. Differentiation Rules ... Date Added: 2009-06-07 19:13:59 |
| 582_L13.pdf Path: Mich Tech >> EE >> 582 Fall, 2009 Description: ... Date Added: 2009-06-07 19:15:46 |
| syl.pdf Path: Delaware >> CIS >> 689 Spring, 2009 Description: ... Date Added: 2009-06-07 19:16:21 |
| PDFactorial.doc Path: NJIT >> CIS >> 602 Fall, 2009 Description: CIS 602- CH 4 Week 5 Planning Document/Exercise 4.1 Name: Date: Source: Marie J. Garlitos February 19, 2006 Factorial.java Use Case UC1: Calculate Factorial of a Number Scope: Factorial Calculator Application Level: User Goal Primary Actor: Person ... Date Added: 2009-06-07 19:27:47 |
| file_modification_in_linux.doc Path: MS Women >> BU >> 399 Summer, 2009 Description: File Modification in Linux June 8, 2005 Redirecting Output from a Utility to a File: o Thus far, we have learned to use utilities and have the output displayed on the screen. o We can instruct the shell to redirect the output of a utility away from ... Date Added: 2009-06-07 19:29:34 |
| childeric.doc Path: Columbia >> AJK >> 1061 Fall, 2009 Description: The Deposition of Childeric (751) 1. It now happened that with the consent and advice of all the Franks the most excellent Pippin submitted a proposition to the Apostolic See, and having first obtained its sanction, was made king, and Bertrada queen.... Date Added: 2009-06-07 19:30:00 |
| Ball+State+speech,+Greening+the+Campus.doc Path: UNC >> READ >> 456456 Fall, 2009 Description: Greening the Campus Ball State University Luncheon Speech By Cindy Pollock Shea September 20, 2001 Moving into the Mainstream & Integrating Sustainability Across Campus My goal is not to incrementally green my campus @ UNC Chapel Hill, although that\'... Date Added: 2009-06-07 19:34:57 |
| thiols&skunks.pdf Path: Laurentian >> CHEM >> 200303 Fall, 2009 Description: Dr. Kevin Smith Thiols: Secretion of Skunks and Natural Gas There are many skunkish substances but not all of them are found in skunks. Chemically, these odiferous substances are predominately low molecular weight organic compounds containing sulfu... Date Added: 2009-06-07 19:35:41 |
| Colloquium-TerenceTaoFlyer.pdf Path: Allan Hancock College >> ASTRO >> 112942 Fall, 2009 Description: The 2009 Clay-Mahler Colloquium: Compressed Sensing A specialist Colloquium with Professor Terence Tao, Professor of Mathematics, UCLA About this Colloquium Suppose one wants to recover an unknown signal x in R^n from a given vector Ax=b in R^m of l... Date Added: 2009-06-07 19:36:40 |
| hw3sol.pdf Path: Acton School of Business >> ELEC >> 430 Fall, 2008 Description: Dr. Ashu Sabharwal ELEC 430 Department of Electrical and Computer Engineering Rice University Due 30 Jan 2009 HOMEWORK 3 - Random Processes II Exercise 1. Sampling Random Processes A discrete-time stochastic process Yn XnT is obtained by periodic sa... Date Added: 2009-06-07 19:36:47 |
| 435_6_2.pdf Path: Acton School of Business >> CAAM >> 435 Fall, 2008 Description: CAAM 435 Homework # 6 (Part 2) due Nov. 29. 3. 1-D Map Consider the map xn+1 = rsin(xn ) (a) Determine the r-values for the first 5 period doubling bifurcations to three decimal places. Label them on an attractor diagram. Use the last three to approx... Date Added: 2009-06-07 19:37:03 |
| reallyfinaloutsidethebag_escobales1.pdf Path: San Diego State >> ART >> 344 Fall, 2008 Description: ... Date Added: 2009-06-07 19:40:17 |
| Lab4-manual.doc Path: ECCD >> SYSC >> 4600 Fall, 2009 Description: Department of Systems and Computer Engineering Digital Communication Theory (SYSC 4600) Computer Simulation Laboratory III Convolutional Codes By Amir H. Banihashemi, Pirouz Zarrinkhat, and Mohammadreza Yazdani Objectives This laboratory experiment ... Date Added: 2009-06-07 19:40:48 |
| Liability+Insurance+Requirements+Evaluation.doc Path: UNC >> READ >> 4886424 Fall, 2009 Description: Liability Insurance Requirements Evaluation Date: _ Completed by:_ Name of Project: _ Estimated cost of project: __ Is cost of contract over $10,000? Y Is this a construction contract? only) Y / / N N (answer no if professional services N Will cont... Date Added: 2009-06-07 19:40:48 |
| 210-005_nourie.doc Path: Illinois State >> CI >> 051 Fall, 2009 Description: ILLINOIS STATE UNIVERSITY CURRICULUM AND INSTRUCTION 210: Section. (05) CHILD GROWTH AND DEVELOPMENT Thursday from 5:30 8:20 Spring 2005 Terry Nourie Office: DeGarmo 216 Office Phone: 438-5604 E-mail: tnourie@ilstu.edu Office Hours: Tues. & Thurs. 1... Date Added: 2009-06-07 19:41:07 |
| dst_index_1985_11.txt Path: UCLA >> PT >> 1985 Fall, 2009 Description: 1985 11 1 0 -8 1985 11 1 1 -4 1985 11 1 2 -5 1985 11 1 3 -9 1985 11 1 4 -11 1985 11 1 5 -14 1985 11 1 6 -9 1985 11 1 7 -3 1985 11 1 8 -1 1985 11 1 9 -5 1985 11 1 10 -10 1985 11 1 11 -14 1985 11 ... Date Added: 2009-06-07 19:41:50 |
| splines.pdf Path: Minnesota >> CSCI >> 2031 Fall, 2008 Description: Week 14 - Splines nd - 2 Degree - Cubic Natural Splines Find equations between any pair of points to make the lines connect Splines First degree: Si(x) = yi + mi(x-ti) mi = yi+1 - yi ti+1 - ti Splines First degree: x y 1 2 2 4 3 5 S0(x) = y0 + m0... Date Added: 2009-06-07 19:43:46 |
| Project2.s06.pdf Path: Gordon MA >> CS >> 112 Fall, 2009 Description: CS112 - INTRODUCTION TO PROGRAMMING Programming Project #2 - Due Monday, February 27, at the start of class Purpose: 1. To give you further experience with Java arithmetic and the use of the Math class. 2. To give you experience with drawing in Java ... Date Added: 2009-06-07 19:44:32 |
| INT_754_CGE_Proposal_APPROVED.pdf Path: Gallaudet >> AY >> 0708 Fall, 2009 Description: COUNCIL ON GRADUATE EDUCATION PROPOSAL FOR NEW GRADUATE COURSE 1.0 Department: Interpretation 2.0 Course Number: INT 754 3.0 Course Title: Interpreting Medical Discourse 4.0 Course Credits: 3 5.0 Formal (Catalog) Description The course focuses on in... Date Added: 2009-06-07 19:46:13 |
| submit.txt Path: Washington >> V >> 11557 Fall, 2009 Description: executable = allgamma_11557.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs11500-11999/11... Date Added: 2009-06-07 19:49:53 |
| group1.ps Path: Case Western >> ASTR >> 328 Fall, 2009 Description: ... Date Added: 2009-06-07 19:50:04 |
| drewmar1.pdf Path: Oregon State >> ECE >> 441 Fall, 2008 Description: Name: Drew Haven Date: March 1st, 2007 Team Number: 8 Local Positioning System February Progress Report Accomplishments: Created communication between the base transceiver and the mobile transceiver. Helped program the microcontroller for use with ... Date Added: 2009-06-07 19:51:22 |
| input2.txt Path: UMBC >> PROJ >> 202 Fall, 2009 Description: Player001 37 1 2 3 1 4 3 5 2 6 0 7 0 8 -4 9 -3 10 -1 11 2 12 2 15 -1 16 -3 17 -1 18 3 19 2 20 -2 21 -3 23 0 24 -1 26 -3 27 1 28 -4 29 3 30 -1 32 0 33 -2 34 -2 35 -2 36 0 37 -2 38 -1 39 -2 40 0 41 -3 43 2 45 0 Player002 37 2 -2 3 -3 4 -3 5 -4 6 -5 7 -... Date Added: 2009-06-07 19:51:57 |
| 12_presentation.ppt Path: Toledo >> ISCHOOL >> 2115 Fall, 2009 Description: FIS 2115 Data Librarianship Spring 2009 Mike McCaffrey Faculty of Information University of Toronto Lecture 12 April 1 , 2009 st Outline Assignment Discussion Confidentiality and Privacy Issues Case Studies. Arab Cross-Tabs (U.S.) 1911 Censu... Date Added: 2009-06-07 19:58:33 |
| FOSE-MAts-Full.pdf Path: Minnesota >> CSCI >> 5802 Spring, 2008 Description: Safety and Software Intensive Systems: Challenges Old and New Mats P.E. Heimdahl Mats Heimdahl earned an M.S. in Computer Science and Engineering from the Royal Institute of Technology in Stockholm, Sweden and a Ph.D. in Information and Computer Sci... Date Added: 2009-06-07 19:59:13 |
| pattern-examples.pdf Path: UNI >> CNS >> 062 Fall, 2009 Description: Presidency Election() Return unique-instance Examples to Accompany: Design Patterns Elements of Reusable Object-Oriented Software ATC Tower Flight 111 Flight 1011 Flight 112 Flight 747 Design Patterns - Elements of Reusable Object-Oriented Sof... Date Added: 2009-06-07 20:00:46 |
| s26.ppt Path: UNI >> CNS >> 112 Fall, 2009 Description: CSCW Objectives for today Any questions ? Debrief Amtrak Talk a little bit about tangible interfaces (last time\'s slides) CSCW? Computer-Supported Cooperative Work (CSCW) Def.: \"the study of how people work together using computer technology\" ... Date Added: 2009-06-07 20:00:54 |
| pattern-examples.pdf Path: UNI >> CNS >> 053 Fall, 2009 Description: Presidency Election() Return unique-instance Examples to Accompany: Design Patterns Elements of Reusable Object-Oriented Software ATC Tower Flight 111 Flight 1011 Flight 112 Flight 747 Design Patterns - Elements of Reusable Object-Oriented Sof... Date Added: 2009-06-07 20:01:01 |
| 01-COED_position.doc Path: UC Davis >> ATT >> 0021 Fall, 2009 Description: People\'s Grocery Community Outreach and Education Director Job Description The Community Outreach and Education Director (COED) oversees and builds People\'s Grocery\'s Community Outreach and Education Program area, which encompasses outreach, nutritio... Date Added: 2009-06-07 20:03:59 |
| 01-COED_position.doc Path: UC Davis >> ATT >> 0705 Fall, 2009 Description: People\'s Grocery Community Outreach and Education Director Job Description The Community Outreach and Education Director (COED) oversees and builds People\'s Grocery\'s Community Outreach and Education Program area, which encompasses outreach, nutritio... Date Added: 2009-06-07 20:03:59 |
| mphysmmathphys_allocation_120607.pdf Path: East Los Angeles College >> PX >> 0708 Fall, 2009 Description: MPhys/MMathsPhys - 2007-2008 SUPERVISOR TITLE Electron diffraction from atomically clean III-V semiconductor surfaces Developing solid-state NMR experiments to determine internuclear distances Eddy current measurements of cracks in metals Fabricati... Date Added: 2009-06-07 20:04:05 |
| PDprob.pdf Path: Texas >> MA >> 302 Fall, 2009 Description: ... Date Added: 2009-06-07 20:13:02 |
| Lab1Assignment Path: Georgia Tech >> CEE >> 4600 Fall, 2007 Description: CEE 4600 Fall 2007 LAB 1 DRIVER EXPECTANCY AND DRIVER BEHAVIOR Due: Section C1 - August 27, 2007 Section C2 August 30, 2007 1. Conduct a group field review at two locations within a ten (10) mile radius of campus. The first location is I-75 Southbo... Date Added: 2009-06-07 22:26:58 |
| FHWA_FTA_EnvImpactRelatedProcedures Path: Georgia Tech >> CEE >> 4620 Spring, 2009 Description: Federal Agency Regulations FHWA/FTA Environmental Impact Related Procedures Agency Responsibilities Requirements Actions of Classes Categorical Exclusions Other Specific Requirements More stringent and specific than the CEQ regulations Operating pr... Date Added: 2009-06-07 22:32:49 |
| HWP17 Path: Georgia Tech >> MATH >> 2401 Spring, 2009 Description: ... Date Added: 2009-06-07 22:42:23 |
| Phys2212_33.1+to+33.4 Path: Georgia Perimeter >> PHYSICS >> 2212 Fall, 2008 Description: Physics 2212 Electricity and Magnetism Lecture 21 (Knight:33.1-33.4) Electromagnetic Induction Induced Magnetic Dipoles When an unmagnetized ferromagnetic material is placed in an externally applied magnetic field, magnetic domains in the material t... Date Added: 2009-06-07 23:41:31 |
| noise Path: Georgia Tech >> CEE >> 4620 Spring, 2009 Description: Sheet1 Present Lane No./Road Segment Vehicle Class N (vph) S (km/h) D (m) 1 (degrees) 2 (degrees) (Lo) Ei (dBA) 10 LOG (NiDo/Si) (dB) 10 LOG (Do/D) (dBA) 15 LOG (Do/D) (dBA) (2 1) 10 LOG (0(1,2)/) (dBA) 10 LOG (1/2(1,2)/) (dBA) L (degrees) R (degre... Date Added: 2009-06-08 06:09:49 |
| tute_08_sol.pdf Path: Allan Hancock College >> MATH >> 11218 Fall, 2009 Description: MATH11218 Engineering Foundation Mathematics Tutorial Sheet 8 Solutions Term 1 2005 1. For matrix addition to be a valid operation the matrices involved must be of the same size (that is have the same number of rows and the same number of rows). Op... Date Added: 2009-06-08 06:31:57 |
| Cudworth.pdf Path: East Los Angeles College >> KA >> 519 Fall, 2009 Description: The Cambridge Platonists II Ralph Cudworth Summary We conclude therefore, That from the Nature of Mind and Knowledge, it is Demonstrable, That there can be but One Original and Self-Existent Mind, or Understanding Being, from which all other Minds ... Date Added: 2009-06-08 06:32:45 |
| 469.TXT Path: East Los Angeles College >> LJ >> 310 Fall, 2009 Description: -0.505357 -0.497793 -0.216590 -1.244088 -1.244088 -0.216591 0.413153 -0.787285 -1.422399 -0.787286 0.238404 0.238405 -0.504965 -0.487009 0.081190 1.350628 0.081191 -1.995069 -1.995070 1.000556 1.000557 -1.069070 -2.358775 -1.069072 -0.496772 -0.20145... Date Added: 2009-06-08 06:35:20 |
| x04.pdf Path: Drake >> ECON >> 002 Fall, 2009 Description: Principles of Microeconomics (Econ 2) Drake University, Summer 2009 William M. Boal Signature: Printed name: HOMEWORK EXERCISE #4: \"Elasticities\" Due July 16, 2009 (1) [Calculating elasticities: 9 pts] Suppose that when the price of milk is $2 per ... Date Added: 2009-06-08 06:42:44 |
| rhymeaweek.pdf Path: Wisc Stevens Point >> AALBR >> 389 Fall, 2009 Description: RhymeaWeek Rationale:Thepurposeofrhymeaweekistointroducestudentstoclassicnurseryrhymes,aswellas provideexperienceswithrhymingconcepts. Standards: C.4.2Listentoandcomprehendoralcommunications. D.4.1Developtheirvocabularyofwords,phrases,andidiomsasam... Date Added: 2009-06-08 06:43:07 |
| Ed310LAandScienceLesson.pdf Path: Wisc Stevens Point >> AALBR >> 389 Fall, 2009 Description: Autumn Albrecht Ed 310 \"In the Forest\" Subjects: Language Arts/Science Lesson Grade Level: 1 Rationale: It is important that students learn about animals through reading nonfiction books. The students will learn how animals meet their b... Date Added: 2009-06-08 06:43:07 |
| cost12eppt_17.ppt Path: CSU Bakersfield >> ACCT >> 303 Fall, 2008 Description: CHAPTER 17 Process Costing Job-Costing and Process Costing: Opposite Ends of a Continuum Job-Costing Systems Distinct, identifiable units of a product or service Examples: Custom-made machines, Houses Process-Costing Systems Masses of identical o... Date Added: 2009-06-08 06:45:14 |
| Final project on the theories of management in Path: S.E. Louisiana >> MRKT >> 303 Spring, 2009 Description: Final project on the theories of management in the film THE MIRICAL THE GRUP MEMBERS ARE: Najaf Maqbool 9202 Hafiz Huzafa 9214 Rana Atif 9238 Introduction of The Miracle Starring Kurt Russell, Eddie Cahill, Patricia Clarkson, Noah Emmerich based o... Date Added: 2009-06-08 06:45:35 |
| LECT17.PPT Path: UMBC >> CSEE >> 104 Spring, 2001 Description: More Loops for loops and do-while loops CMSC 104 Counter-Controlled Repetition with a while loop #include <stdio.h> main () { int i = 1; /* count from 1 to 10 */ while ( i < 11 ) { printf (%d , i); i+; } } CMSC 104 initialization of loop control ... Date Added: 2009-06-08 06:45:37 |
| YIR020W-A.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YIR >> 020 Fall, 2009 Description: YIR020W-A.t2k CB_BURIAL_14_7 2 1 AAAAAA AAAA C X X AA BBBBBB BBBBBB X X B A A A B A A A C D B B B F A C C C C C E E C C C C C D CCDXXDDXXXDDBEFXEXCXDXXBBBXXXXXABABXXXXXXXXXAXXAX CCCCCCXXX C C D D D D D D D B C D X X X X X X X X X X X B A F D D... Date Added: 2009-06-08 06:46:22 |
| SMTMP.pdf Path: Berkeley >> I >> 247 Fall, 2009 Description: Show Me the Numbers Pre-Test 1. Define the term \"table\" and describe what tables do well. 2. Define the term \"graph\" and describe what graphs do well. 3. What is usually the most effective way to visually separate the rows and columns of a table? ... Date Added: 2009-06-08 06:51:34 |
| 1032.pdf Path: UMBC >> ID >> 1032 Fall, 2009 Description: Using Semantic Web technology in Multi-Agent Systems: a case study in the TAGA trading agent environment Youyong Zou, Tim Finin, Li Ding, Harry Chen, Rong Pan U.Maryland Baltimore County 1000 Hilltop Circle Baltimore, MD, 21250 410-455-3971 {yzou1,f... Date Added: 2009-06-08 06:52:22 |
| PS.StructurePrediction.A.pdf Path: Youngstown >> CHEM >> 1506 Fall, 2008 Description: ... Date Added: 2009-06-08 06:55:43 |
| selfReview2003.doc Path: Penn State >> JPS >> 120 Fall, 2009 Description: Activities Report for Joseph Stitt during the year 2002. Research and Technical Activities: Projects done under the supervision of Gerry Michard. Analysis, design, and implementation of a 28-feature classifier for the AZURITE program. Design and impl... Date Added: 2009-06-08 07:01:20 |
| bodyBorg.pdf Path: Penn State >> IE >> 553 Fall, 2009 Description: ... Date Added: 2009-06-08 07:02:52 |
| ScatteringOld.pdf Path: SMU - Cox School of Business >> PHYSICS >> 7360 Fall, 2009 Description: ... Date Added: 2009-06-08 07:06:51 |
| lab8.pdf Path: Minnesota >> CSCI >> 1901 Fall, 2008 Description: CSci 1901 Lab 8: Sets and associative lists Your Name: Partner\'s Name: Question Initials Set manipulation Associative lists Start this lab on March 12. You should be able to finish it in lab on March 12. Set manipulation A set is a data structure t... Date Added: 2009-06-08 07:12:22 |
| Lect18-3-13-09-stars2-6pp.pdf Path: Minnesota >> ASTRONOMY >> 1001 Fall, 2009 Description: 3/27/2009 The fusion of large nuclei to form elements heavier than carbon requires extremely high temperatures to overcome the large electromagnetic repulsion of these nuclei. Stars continued Notes compiled by Paul Woodward Department of Astronomy ... Date Added: 2009-06-08 07:12:32 |
| m598bh9h.pdf Path: Penn State >> M >> 598 Fall, 2009 Description: M598B: Hint to Homework Assignment 9 Date: Oct. 30 5. Use Theorem 3 of the lecture notes on Friday. Find the eigenvalues of the matrix A. Do not need to verify the smallness condition of R(t, x), although it is required by the theorem. To give a comp... Date Added: 2009-06-08 07:13:04 |
| maes-i-07d.pdf Path: Pittsburgh >> AEI >> 7956 Fall, 2009 Description: 8 May 2007 First draft Not to be quoted Macroeconomic governance in the European Union: Did we learn the lessons from the past? Ivo Maes* Paper prepared for the 2007 EUSA Conference, Montral, 17-19 May, 2007 * The author would like to thank all ... Date Added: 2009-06-08 07:19:34 |
| 66625_1.pdf Path: Pittsburgh >> AEI >> 9861 Fall, 2009 Description: ... Date Added: 2009-06-08 07:19:42 |
| 73332_1.pdf Path: Pittsburgh >> AEI >> 10525 Fall, 2009 Description: ... Date Added: 2009-06-08 07:23:59 |
| data_simu_tight_clust.txt Path: Pittsburgh >> BIOST >> 2055 Spring, 2008 Description: 2.258 1.814 2.048 1.996 1.746 2.363 1.613 1.968 1.974 1.644 0.2276 0.2327 -0.1151 0.08008 0.2761 -0.03619 -0.2072 -0.0707 0.08162 -0.2904 1 1 ... Date Added: 2009-06-08 07:26:20 |
| 31735055281103_1.pdf Path: Pittsburgh >> AEI >> 9340 Fall, 2009 Description: ... Date Added: 2009-06-08 07:34:27 |
| STAR_2_UP_1.pdf Path: San Diego State >> ART >> 448 Spring, 2008 Description: ... Date Added: 2009-06-08 07:39:52 |
| 002122_1.pdf Path: Pittsburgh >> AEI >> 2113 Fall, 2009 Description: ... Date Added: 2009-06-08 07:40:25 |
| 108.pdf Path: Pittsburgh >> AEI >> 2859 Fall, 2009 Description: ... Date Added: 2009-06-08 07:43:37 |
| 20020419_r01c_0110944.pdf Path: Stanford >> DALN >> 1022 Fall, 2009 Description: 04/22/2002 02:06 PM EST UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK IN RE INITIAL PUBLIC OFFERING SECURITIES LITIGATION X : : : : X X : : : : : : : : X Daleen Master File No. 21 MC 92 (SAS) IN RE DALEEN TECHNOLOGIES, INC. INITIAL P... Date Added: 2009-06-08 07:55:40 |
| terms.ppt Path: Oklahoma State >> AGED >> 3103 Fall, 2008 Description: Selected Teaching-Learning Terms: Working Definitions . . . Aptitude One\'s ability for learning a task, skill, concept, or body of knowledge Assessment The act of measuring student learning Authentic Assessment A measure of student learning tha... Date Added: 2009-06-08 07:56:02 |
| wn08-proof.pdf Path: Virginia Tech >> CS >> 5214 Fall, 2008 Description: Metadata of the article that will be visualized in OnlineFirst 1 Article Title Journal Name On optimal batch rekeying for secure group communications in wireless networks Wireless Networks Prefix Family name Particle Given name Suffix Degrees Prefi... Date Added: 2009-06-08 07:56:28 |
| Bork - Slouching Toward Gomorrah II.pdf Path: Rochester >> CAS >> 105 Fall, 2009 Description: ... Date Added: 2009-06-08 07:57:17 |
| 71807_1.pdf Path: Pittsburgh >> AEI >> 10398 Fall, 2009 Description: ... Date Added: 2009-06-08 07:59:03 |
| 68423_1.pdf Path: Pittsburgh >> AEI >> 10024 Fall, 2009 Description: ... Date Added: 2009-06-08 07:59:58 |
| 000202_1.pdf Path: Pittsburgh >> AEI >> 3825 Fall, 2009 Description: ... Date Added: 2009-06-08 08:03:00 |
| 003712_1.pdf Path: Pittsburgh >> AEI >> 5757 Fall, 2009 Description: ... Date Added: 2009-06-08 08:03:19 |
| 2005114_r01m_031539.pdf Path: Stanford >> AHO >> 1027 Fall, 2009 Description: Case 1:03-md-01539-CCB Document 642-1 Filed 11/04/2005 Page 1 of 1 IN THE UNITED STATES DISTRICT COURT FOR THE DISTRICT OF MARYLAND NORTHERN DIVISION 03-MD-1539-CCB RELATED TO ALL SECURITIES ACTIONS IN RE ROYAL AHOLD SECURITIES AND \"ERISA\" LITIG... Date Added: 2009-06-08 08:10:27 |
| SEsweep.ppt Path: Georgia Tech >> CEE >> 200202 Fall, 2009 Description: Constructing Solid Models Swept Protrusion Course: Introduction to Engineering Graphics and Visualization copyright 2001, Georgia Institute of Technology Sheet 1 Sweep Features Sweeping a cross-section along a user-defined closed or open path(s) ... Date Added: 2009-06-08 08:11:36 |
| Accessing Vnet recordings.doc Path: U. Houston >> MATH >> 3305 Fall, 2008 Description: Accessing Vnet recordings go to www.vnet.uh.edu Get a home page by using the \"new user\" wizard. Be sure to have your fee bill nearby for all the info they need. Once my course shows up on your homepage with them, you click on Documents and then \"watc... Date Added: 2009-06-08 08:16:06 |
| STAR_2_UP_1.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: ... Date Added: 2009-06-08 08:17:52 |
| nakamura.pdf Path: UPenn >> RIDER >> 790 Fall, 2009 Description: Financial Modernization: Vastly Different or Fundamentally the Same? Edward G. Boehne Economics and the New Economy: The Invisible Hand Meets Creative Destruction Leonard I. Nakamura* A s the third millennium begins, the buzzwords new economy and... Date Added: 2009-06-08 08:18:00 |
| 200677_r09d_01CV20418.pdf Path: Stanford >> CSCO >> 1018 Fall, 2009 Description: Case 5:01-cv-20418-JW Document 570 Filed 07/07/2006 Page 1 of 7 1 LERACH COUGHLIN STOIA GELLER RUDMAN & ROBBINS LLP 2 WILLIAM S. LERACH (68581) SPENCER A. BURKHOLZ (147029) 3 DANIEL S. DROSMAN (200643) JONAH H. GOLDSTEIN (193777) 4 MATTHEW P. MON... Date Added: 2009-06-08 08:19:25 |
| 02p1.pdf Path: UCSB >> CS >> 290 Fall, 2009 Description: Public Key Cryptography 1 Outline Foundations Merkle\'s puzzles, Diffie-Hellman Trapdoor function model Practical issues Examples Knapsacks, RSA, McEliece, Goldwasser-Micali, ElGamal 2 Foundations Two cryptographic problems privacy: Alice... Date Added: 2009-06-08 08:19:41 |
| probleminstallbin.txt Path: Syracuse >> CIS >> 785 Spring, 2008 Description: Network library netwib - | KNOWN PROBLEMS | - This file describes known problems (incompatibilities, unsupported features, errors, etc.). If you seek help (... Date Added: 2009-06-08 08:22:27 |
| 064-RxSS.pdf Path: Arizona >> SCHEDULE >> 064 Fall, 2009 Description: Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # RUSSIAN & SOVIET STUDIES (R SS) R SS374 (3) 66261 LEC R SS374 (3) 59195 LEC ... Date Added: 2009-06-08 08:23:29 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
