Course Solutions And Notes - PaparoditisPolitisNP 56
| 101exercises.pdf Path: Stanford >> EE >> 102 Fall, 2009 Description: Exercises on Static Circuits 1. Modelling a compact disc player. The (left or right channel) output of a typical CD player can be modeled as a voltage source that is able to produce voltage between 5V and +5V and currents between 10mA and +10mA witho... Date Added: 2009-04-21 18:53:24 |
| chapter4.pdf Path: SDSMT >> EE >> 621 Fall, 2009 Description: ... Date Added: 2009-04-21 18:57:12 |
| s2thWorld.pdf Path: Stanford >> E >> 158 Fall, 2009 Description: Qw(Cs) 0.2292 0.0019 NuTeV 0.2361 0.0017 E158 0.2330 0.0014 PDG2004 0.2312 0.0002 0.22 0.225 0.23 0.235 0.24 0.245 0.25 sin W(MZ) 2 ... Date Added: 2009-04-21 18:57:40 |
| Flyer.pdf Path: Evergreen >> AMR >> 0506 Fall, 2009 Description: American Chemical Society Puget Sound Section Presents Dr. Mary Virginia Orna Professor of Chemistry, College of New Rochelle, editor-atlarge of Chemical Heritage Magazine, & well-known author will lecture on her chemical work in archeology. Doing ... Date Added: 2009-04-21 18:58:12 |
| 2005811_r05c_051027.pdf Path: Stanford >> APSG >> 1033 Fall, 2009 Description: 1 2 3 4 BRAMSON, PLUTZIK, MAHLER & BIRKHAEUSER, LLP Alan R. Plutzik (Bar No . 077785) Aram S . Durphy (Bar No . 228948) 2125 Oak Grove Road, Suite 120 Walnut Creek , California 94598 Telephone : (925) 945-0200 Liaison Counsel for Plaintiffs 5 Andre... Date Added: 2009-04-21 18:58:30 |
| 200599_r13x_0305642.pdf Path: Stanford >> RBAKD >> 1029 Fall, 2009 Description: k-1E Grant & Eisenhofer P .A. Jay W. Eisenhofer Stuart M. Grant Megan D . McIntyre Chase Manhattan Centre 1201 North Market Street Wilm ington , DE 19801 Jeff A. Almeido* Nauman A. Amjed Peter B . Andrews James P. McEvilly, III * Sharon Nirmu l Ru... Date Added: 2009-04-21 18:59:04 |
| set_operations.pdf Path: ETSU >> NTES >> 1900 Fall, 2009 Description: CSCI 1900 Discrete Structures Operations on Sets Reading: Kolman, Section 1.2 Operation on Sets An operation on a set is where two sets are combined to produce a third CSCI 1900 Discrete Structures Operations on Sets Page 1 CSCI 1900 Discrete... Date Added: 2009-04-21 18:59:46 |
| 2007115_f01c_0709801.pdf Path: Stanford >> WM >> 1038 Fall, 2009 Description: .:J Judge \"MeMahen UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK DENNIS KOESTERER, on behalf of himself and all others similarly situated, Plaintiff, V. WASHINGTON MUTUAL, INC., KERRY K. KILLINGER, DAVID C. SCHNEIDER and THOMAS W. CASE... Date Added: 2009-04-21 18:59:52 |
| 20020405_r03x_0102450.pdf Path: Stanford >> TMTA >> 1018 Fall, 2009 Description: 1 2 3 4 5 6 7 8 9 10 11 12 PILLSBURY WINTHROP LLP WALTER J. ROBINSON III #40632 2550 Hanover Street Palo Alto, CA 94304 Telephone: (650) 233-4500 Facsimile: (650) 233-4545 PILLSBURY WINTHROP LLP CHARLES R. RAGAN #72319 WILLIAM O. FISHER #70841 50 Fr... Date Added: 2009-04-21 19:03:43 |
| wheres-minitab.pdf Path: Carnegie Mellon >> STAT >> 201 Fall, 2009 Description: | `~\" } | } \" ~ e p R\" ~}~X%` 8 e `%X~} ~}| |} } } | p` x}x X} R% x| s \" e ~%\" `s (`V | P R%p 3` ~}\"` 8 ( | ... Date Added: 2009-04-21 19:04:29 |
| 00000033.pdf Path: Carnegie Mellon >> TERA >> 05101181 Fall, 2009 Description: ... Date Added: 2009-04-21 19:05:03 |
| AS01.pdf Path: Scranton >> C >> 134 Fall, 2009 Description: CMPS 134 Spring 2009, Assignment 01 Assignment 01 Measurement Conversions (Due: Sunday February 15, 2009) (Due: Sunday February 15, 2009) Assuming that you have successfully accomplished Assignment 0, have read Chapters 1 and 2 of the course text... Date Added: 2009-04-21 19:06:16 |
| AS01.pdf Path: Scranton >> AS >> 134 Fall, 2009 Description: CMPS 134 Spring 2009, Assignment 01 Assignment 01 Measurement Conversions (Due: Sunday February 15, 2009) (Due: Sunday February 15, 2009) Assuming that you have successfully accomplished Assignment 0, have read Chapters 1 and 2 of the course text... Date Added: 2009-04-21 19:06:16 |
| Whittaker_Aimee_ETD.pdf Path: Texas Tech >> ETD >> 06092006 Fall, 2009 Description: COMPARING MODELS: THE BEST FIT FOR SOCIAL PREDICTORS OF BULIMIC PATHOLOGY by AIMEE E. WHITTAKER, B.S., M.A. A DISSERTATION IN COUNSELING PSYCHOLOGY Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements ... Date Added: 2009-04-21 19:08:16 |
| GCB535_notes_092904.pdf Path: UPenn >> CIS >> 535 Fall, 2009 Description: Motif discovery Detect significantly over-represented patterns in a given set of sequences. Examples. Translation start site (Ribosomal binding site) AACCATACTGGTAGTAACCATGGAA TCGATGTGATGGTTTTACCATGGGG ATATATATTTATAACCGCCATGCCC CGTGTGTAATATGTGGGCCATG... Date Added: 2009-04-21 19:09:33 |
| competitive_optimality.pdf Path: Mississippi State >> ECE >> 8813 Fall, 2009 Description: Competitive Optimality of Shannon Coding Shannon code: C Any other prex code: C prob {l(X) l (X) + c} 1 2c1 1 Upper bound on probability that Shannon code is outperformed by c bits 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 1 2 3 4 5 c ... Date Added: 2009-04-21 19:10:13 |
| 2-20.pdf Path: UPenn >> CIS >> 120 Fall, 2009 Description: Overloading Overloading Two methods (or constructors) in a class with the same name, but different arguments Convenience - same functionality, different way of specifying args public void moveTo(double x, double y) public void moveTo(Point p) De... Date Added: 2009-04-21 19:10:18 |
| handout01.pdf Path: Rochester >> A >> 241 Fall, 2009 Description: Ast 241 Stellar Atmospheres and Interiors Goal: basic understanding of the nature of stars Very important for astronomers Most of (known) mass and luminosity from stars Normal galaxies To understand galaxies (and universe), need to understan... Date Added: 2009-04-21 19:11:36 |
| 127APracticeTest1.pdf Path: Arizona >> CS >> 127 Fall, 2008 Description: C Sc 127A Practice Test 1 Section Leader _ Your Name _ 100pts 1. Circle the valid assignment statements after the initializations. Do not circle bad code that generates compile time errors. (6pts) double x = 0.0; int n = 0; n = 1; n = 1.5; x = 1; x =... Date Added: 2009-04-21 19:11:40 |
| Snodgrass2.pdf Path: Arizona >> CLAS >> 461 Spring, 2008 Description: At the request of Thetis, Achdes\' divine mother, Hepbaistos makes for : Achdles the complete new set of arms that he now needs; but it is on the sheld that Harnerk interest is almost entirely focused. It is a magnificent work of art in bronze, adorne... Date Added: 2009-04-21 19:12:10 |
| HumanCapabilities.pdf Path: Wellesley >> CS >> 215 Fall, 2008 Description: User-Centered Website Development: A HumanComputer Interaction Approach 2. Capabilities of Human Beings In this chapter you will learn about: Human senses, perception, memory, and interruptions Mental models, metaphors, and perceived affordance Some... Date Added: 2009-04-21 19:16:06 |
| EE494ProjectIdeasReising.pdf Path: Evansville >> EE >> 494 Fall, 2009 Description: EE 494 Project Ideas 2009 Industrial Sponsor: J. Reising Radio Direction Finder Client requires a small transmitter and a directional receiver that will function as a direction finder. The pair must operate over a distance of at least 100 feet. The r... Date Added: 2009-04-21 19:17:14 |
| Matthews.pdf Path: Evansville >> BE >> 4456 Fall, 2009 Description: JOURNAL OF BACTERIOLOGY, July 2001, p. 39103918 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.13.39103918.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Vol. 183, No. 13 Activation from a Distance: Roles of Lrp and Integr... Date Added: 2009-04-21 19:17:27 |
| proposal.pdf Path: Bradley >> CEGT >> 201 Fall, 2009 Description: Bradley University Department of Electrical and Computer Engineering Acoustic Fossil Imaging Project Proposal By Matt Kaiser and John Lewis Advisors Dr. James H. Irwin Mr. Jos Snchez December 11, 2003 Project Summary The acoustic imaging system... Date Added: 2009-04-21 19:18:52 |
| sq8.pdf Path: Alabama Huntsville >> MATH >> 508 Fall, 2009 Description: Math 508 Solution to Problem 1 (c) on Page 232 (7/29/03) 1 (c). Find a unitary 2 4 A = 1 2 3 6 matrix U such that U H AU is upper triangular. 2 1 . 3 Solution. We use the Schur decomposition process in two steps to nd U and T . Step 1. Find U... Date Added: 2009-04-21 19:19:44 |
| Regression_1.pdf Path: Colorado >> CSCI >> 5622 Fall, 2008 Description: Introduction to Regression Greg Grudic 1 Denitions 1. x means that the variable x is a member of the real numbers. 2. x d means that the d elements of the vector x = (x1 , ., xd ) all are members of the real numbers. 3. If x is a random variable,... Date Added: 2009-04-21 19:20:52 |
| 34ppt.pdf Path: Colorado >> MCDB >> 4777 Fall, 2008 Description: MCDB 4777/5777 Molecular Neurobiology Lecture 36 Regeneration and Repair LTD- turning synapse strength down Overview of neural development -in the hippocampus -in the cerebellum Spike timing and the importance of temporal context Types of regenerati... Date Added: 2009-04-21 19:21:18 |
| hw20.pdf Path: Colorado >> AMATH >> 1360 Spring, 2007 Description: ... Date Added: 2009-04-21 19:22:27 |
| Gizzi.pdf Path: Colorado >> PSCI >> 3041 Fall, 2008 Description: Splits in the P olitical P arties John Gizzi In both major parties there is a rich tradition of factionalism. Factions compete in both parties to shape policy direction and leadership. Intraparty factions always tend to claim that their rival f... Date Added: 2009-04-21 19:23:13 |
| hw2006_06.pdf Path: Colorado >> MCEN >> 3030 Fall, 2008 Description: 1 MCEN 3030: Homework 6 (100pts) Due date: Monday, March 24th, 2006 at the beginning of the lecture. 1- Three stages Runge-Kutta method A) Find the order conditions for a 3 stages explicit Runge-Kutta method (ERK). To simplify, suppose that y = f (... Date Added: 2009-04-21 19:23:14 |
| Homework7.pdf Path: Wisc La Crosse >> CS >> 120 Fall, 2008 Description: Homework 7 Email by 11:59 p.m. of December 8th Contact Database Assume that an abstract class named AbstractContact has been designed and implemented. The UML class diagram is listed below and the corresponding Java code is provided on the course we... Date Added: 2009-04-21 19:24:09 |
| P4165_Lab4.pdf Path: Colorado >> P >> 4165 Fall, 2009 Description: Psychology of Perception Psychology 4165, Fall 2001 Laboratory 4 Group Project Inclusion Task: Stem-Completion Performance Probability of Being Correct 1.0 0.8 0.6 0.4 0.2 0.0 0.00 0.05 0.10 0.15 0.20 0.25 Match High Prime Non-Match High Prime Match ... Date Added: 2009-04-21 19:24:19 |
| MS4_Mass_Analyzers_I.pdf Path: Colorado >> CHEM >> 5181 Fall, 2008 Description: Lecture 4: Mass Analyzers Part I CU- Boulder CHEM 5181 Mass Spectrometry & Chromatography Prof. Jose-Luis Jimenez Fall 2004 High Vacuum Sample Inlet Ion Source Mass Analyzer Detector Recorder MS Interpretation Lectures (Dan C.) Mass Analyzers Brain... Date Added: 2009-04-21 19:24:36 |
| lect26_Tu4_29.pdf Path: Colorado >> PHYS >> 1240 Fall, 2008 Description: CT 12.1.1d Dust The air in an open pipe is in the fundamental n=1 mode (shown above). A small speck of dust is located at the left hand end of the tube where the lines above come together. What does the dust do ? A) Wiggles up and down (towards /aw... Date Added: 2009-04-21 19:25:03 |
| flyback.pdf Path: Colorado >> ECEN >> 4517 Fall, 2008 Description: The Flyback Converter Lecture notes ECEN4517 ! ! ! ! Derivation of the flyback converter: a transformer-isolated version of the buck-boost converter Typical waveforms, and derivation of M(D) = V/Vg Flyback transformer design considerations Voltage ... Date Added: 2009-04-21 19:26:12 |
| Exam2-expectations.pdf Path: VCU >> BNFO >> 301 Spring, 2008 Description: Introduction to Bioinformatics Material for Exam #2 Questions for each of the exams will taken (with some modification) from the various Problem Sets, Study Questions, and tours covered since the last exam. For Exam #2, the following are fair game: P... Date Added: 2009-04-21 19:26:55 |
| Ishac_ANS_Intro_2005.pdf Path: VCU >> PHTX >> 603 Fall, 2008 Description: The Autonomic Nervous System Introduction Edward JN Ishac, Ph.D. Smith Building, Room 742 eishac@hsc.vcu.edu 8-2127 8-2126 Department of Pharmacology and Toxicology Medical College of Virginia Campus of Virginia Commonwealth University Richmond, Virg... Date Added: 2009-04-21 19:28:07 |
| 5kW_pvgrid_system.pdf Path: Colorado >> ECEN >> 2060 Fall, 2008 Description: ECEN2060 A 5 kW grid-connected PV system A grid-connected PV system consists of a PV array, an MPPT boost DC-DC converter and a single-phase DC-AC inverter as shown in Fig. 1. The PV array consists of 3 parallel strings of 19 series-connected Shell P... Date Added: 2009-04-21 19:28:46 |
| Thinking_Feeling.pdf Path: Colorado >> PSYC >> 4521 Fall, 2008 Description: Decisions: When making decisions, do you prefer to first look at logic and consistency or first look at the people and special circumstances? Do you like to put more weight on objective principles and impersonal facts (Thinking) or do you put more we... Date Added: 2009-04-21 19:31:05 |
| ch3-alu.pdf Path: Colorado >> ECEN >> 56300 Fall, 2009 Description: Chapter 3 Data Arithmetic Logic Unit 3.1 Introduction This section describes the architecture and the operation of the Data Arithmetic Logic Unit (Data ALU), the block where all the arithmetic and logical operations on data operands are performed. 3... Date Added: 2009-04-21 19:31:23 |
| lab02.pdf Path: Bucknell >> EG >> 100 Fall, 2008 Description: Lab02 Ice Danger In this lab exercise, you will crate an ice staking scene where a cleverStaker will stake around a pair of cones. On her staking path between cones you can interactively move a hole (a blue circle) so that if the clever skater is ska... Date Added: 2009-04-21 19:33:18 |
| caoose4-ch09.pdf Path: FAU >> CEN >> 4010 Fall, 2008 Description: Requirements Phase Page 9.1 REQUIREMENTS PHASE Misconception Must determine what client wants I know you believe you understood what you think I said, but I am not sure you realize that what you heard is not what I meant! Must determine clients ... Date Added: 2009-04-21 19:37:07 |
| Chapter%2021.pdf Path: Rose-Hulman >> CSSE >> 120 Fall, 2009 Description: Chapter 21 Network Programming Chapter Overview How do entities on one computer communicate with entities on another computer? Many modern applications involve multiple computers. This chapter introduces Java\'s primary mechanisms for making such i... Date Added: 2009-04-21 19:38:03 |
| 06%20FundamentalDataTypes.pdf Path: Rose-Hulman >> CSSE >> 200910 Fall, 2009 Description: Fundamental Data Types, Constants, Console Input, More Text Formatting Check out FundamentalDataTypes from SVN Table from Horstmann, Big Java (3e), John Wiley double d = 20.1; double e = i; / OK int ... Date Added: 2009-04-21 19:38:26 |
| mt1_sp_2004_final.pdf Path: Wesleyan >> ECON >> 300 Fall, 2009 Description: Midterm #1 (ECON300-1) February 18, 2003 Prof. Masami Imai Name Instructions: It is of extreme importance for you to show your work, reasoning, and calculations. I will not give a single point to any answer that does not provide any reasoning or calc... Date Added: 2009-04-21 19:39:25 |
| hw1.pdf Path: Wesleyan >> ECON >> 300 Fall, 2009 Description: ECON300: Spring 2004 Homework #1 The deadline for this homework is 11:00 am, January 28. I will not accept any late homework. We will pick 5 questions for grading. 1. An anti-smoking group in England called Action on Smoking and Health (ASH) proposed... Date Added: 2009-04-21 19:39:29 |
| ECE250-HW8-S.pdf Path: Rose-Hulman >> ECE >> 250 Fall, 2009 Description: ECE 250 HW8 Solutions 5 4 3 2 1 D D + R1 6.8k C + Vo - Vcc DC = 15 C Q1 QBf100 + - V4 DC = 3 I1 C1 0 + AC Sweep + + 1000u V1 Magnitude = 1 Phase = 0 - Vee DC = 15 0 DC = 1m - 0 B B Rose-Hulman Institute of Technology A ... Date Added: 2009-04-21 19:40:29 |
| ps.pdf Path: ECCD >> CS >> 136 Fall, 2008 Description: Lab 6 Due 7 April (TUESDAY) Handout 8 CSCI 136: Spring 2009 16 March P.S. Its Just a Stack 1 Short Answers Include answers to the following problems with your lab submission. Put these answers in a le called README. Problem 10.3 Problem 10.4 Proble... Date Added: 2009-04-21 19:42:42 |
| lect3.pdf Path: ECCD >> CS >> 434 Fall, 2009 Description: CS 434 Meeting 3 2/9/06 Introduction 1. Phase 1 + Intermediate form handouts will be available online (and outside my door?) by tomorrow. 2. Pick a language and a partner by tomorrow! Get started! 3. Brief tutorial on C programming shortly after cla... Date Added: 2009-04-21 19:43:07 |
| cs2851Lecture1b.pdf Path: MSOE >> CS >> 2851 Fall, 2009 Description: CS-1020 4 March 2008 Many classes within an application usually exhibit some type of Association between one another Associations represent permanent relationships between instances of classes: UML Revisted An Kennel contains Pets A Dog is a type... Date Added: 2009-04-21 19:44:25 |
| final-w0203.pdf Path: MSOE >> SE >> 3821 Fall, 2009 Description: SE-382 Software Requirements and Specification (Final Exam) SE 382 Requirements Engineering and Specification Winter Quarter 2002-2003 Final Exam Name:_ Q1 Q2 Q3 Q4 Q5 Q6 Q7 Total 10 10 15 15 20 20 10 100 SE-382 Software Requirements and Specifi... Date Added: 2009-04-21 19:44:39 |
| lec2Primitives.pdf Path: CUNY Baruch >> CSC >> 706 Fall, 2009 Description: Drawing Primitives OpenGL basics CSC 706 Computer Graphics / Dr. N. Gueorguieva 1 OpenGL Libraries OpenGL core library OpenGL32 on Windows GL on most unix/linux systems (libGL.a) OpenGL Utility Library (GLU) Provides functionality in OpenGL co... Date Added: 2009-04-21 19:45:28 |
| FF_Airlines.pdf Path: CUNY Baruch >> CSC >> 2008 Fall, 2009 Description: Flin Flon Airlines Flight Reservation System: Overview Flin Flon Airlines is a small but growing airline providing domestic flights across the US. In order to improve our service to our passengers, and to ensure that the flight scheduling process run... Date Added: 2009-04-21 19:45:34 |
| FF_Airlines.pdf Path: CUNY Baruch >> CSC >> 330 Fall, 2009 Description: Flin Flon Airlines Flight Reservation System: Overview Flin Flon Airlines is a small but growing airline providing domestic flights across the US. In order to improve our service to our passengers, and to ensure that the flight scheduling process run... Date Added: 2009-04-21 19:45:34 |
| Lecture8.pdf Path: Wayne State University >> PHY >> 2130 Fall, 2008 Description: General Physics (PHY 2130) Lecture VIII Solids and fluids density and pressure buoyant force Archimedes principle Fluids in motion Heat Temperature Thermal expansion Ideal gas Lightning Review Last lecture: 1. Rotational dynamics torque and angular... Date Added: 2009-04-21 19:50:38 |
| ic_rpt_gates_letter_19930922.pdf Path: GWU >> NSAEBB >> 208 Fall, 2009 Description: ... Date Added: 2009-04-21 19:52:29 |
| reading_midi_files.pdf Path: Rutgers >> MUSIC >> 127 Fall, 2009 Description: Interpreting a Standard MIDI File by Dave Sebald In the infant days of MIDI (the early 80s) every sequencer on the market saved files in its own proprietary format. The reason for this was probably just marketing. Each company could claim that the u... Date Added: 2009-04-21 19:53:06 |
| wireless.pdf Path: Rutgers >> CS >> 352 Spring, 2006 Description: CS 352-Wireless Protocols Dept. of Computer Science Rutgers University Slides from B. Nath, R. Yang, Vikram Reddy Outline 802.11 MACA CS352 Fall,2005 2 CS352 Fall,2005 3 IEEE 802.11 Frequency Band ! \" #$% \" ! CS352 Fall,2005 4 802.11b/g... Date Added: 2009-04-21 19:53:40 |
| sudoku.pdf Path: Rutgers >> CS >> 314 Fall, 2002 Description: CS314, Sec. 9 (Steinberg) Fall, 2005 Project 2 1 Project 2: Sudoku Sudoku is a kind of puzzle. It consists of a 9 x 9 grid like the following: Second cell in the top row 3 2 1 3 6 8 9 8 4 5 5 4 9 1 4 3 6 7 3 2 9 3 4 2 2 4 9 5 8 1 7 4 8 5 9 3... Date Added: 2009-04-21 19:53:48 |
| waterfallexample.pdf Path: Rutgers >> GEN >> 127 Fall, 2009 Description: > [X,Y] = meshgrid(-2:0.1:2); > Z = X.*exp(-(X-Y.^2).^2+Y.^2); > waterfall(X,Y,Z),xlabel(\'x\'), ylabel(\'y\'), zlabel(\'z\') 0.5 z 0 -0.5 2 1 0 -1 y -2 -2 -1 x 1 0 2 ... Date Added: 2009-04-21 19:54:56 |
| intro.pdf Path: Rutgers >> CS >> 553 Spring, 2009 Description: Outline Internet Services Introduction Introduction What are web services The vision The nay sayers Example using Googles web service 1 2 Web Service Overview Definition: A set of representations and protocols to export methods over the I... Date Added: 2009-04-21 19:55:24 |
| P2Fall2003Rev1.pdf Path: SUNY Buffalo >> LAW >> 623 Fall, 2009 Description: REAL ESTATE TRANSACTIONS PROPERTY TWO FALL 2003 THE BUFFALO SCHOOL OF LAW SUNY AT BUFFALO ROBERT I. REIS PROFESSOR OF LAW THESE MATERIALS ARE INTENDED FOR THE EXCLUSIVE USE OF STIDEMTS BUFFALO SCHOOL OF LAW Real Estate Transactions Syllabus Fall 2... Date Added: 2009-04-21 19:56:44 |
| lecture_notes_for_lecture6.pdf Path: SUNY Buffalo >> BCH >> 512 Fall, 2009 Description: Dorsal-Ventral Patterning: Weve now seen: Anterior-Posterior patterning and Segmentation: Segment Identity specification: What does this mean for organogenesis? These early axial patterning and segmentation events set up a coordinate grid on whi... Date Added: 2009-04-21 19:57:48 |
| 7-Survey.pdf Path: SUNY Buffalo >> PSY >> 250 Fall, 2009 Description: PSY250 7 Relational Sawusch Spring, 2009 Survey & Questionaire Research Obtain information across a large (or representative) set of individuals. The results are descriptive, based on self report. Thus, as with observational research, they can pro... Date Added: 2009-04-21 19:59:12 |
| presentation1.pdf Path: SUNY Buffalo >> EE >> 522 Fall, 2009 Description: ... Date Added: 2009-04-21 19:59:58 |
| pointerIntro.pdf Path: Millersville >> CS >> 362 Fall, 2009 Description: Pointers pointer - memory address of some piece of information pointer variable - variable that stores the address where another object resides int * myIntPtr; created space to hold a pointer to an integer - no integer yet & is the address operator *... Date Added: 2009-04-21 20:01:02 |
| syllabusINEL4215.pdf Path: UPR Mayagüez >> INEL >> 4215 Fall, 2009 Description: University of Puerto Rico Mayagez Campus College of Engineering Syllabus & Instructor Information Sheet Form A. COURSE SYLLABUS 1. General Information: Course Number: INEL 4215 Course Title: Computer Architecture and Organization Credit-Hours: 3 2. ... Date Added: 2009-04-21 20:02:01 |
| PS3.pdf Path: UPR Mayagüez >> PS >> 4206 Fall, 2009 Description: University of Puerto Rico Mayagez Campus School of Engineering INEL 4206 Microprocessors Problem Set 3 Due: Friday November 15 (No extensions!) Problem 1: Insertion Sort Using the instruction set discussed in class for the MIPS processor, you wil... Date Added: 2009-04-21 20:02:54 |
| 04_data_normalization_1.pdf Path: Norwich >> IS >> 240 Fall, 2009 Description: Data Normalization (1) IS240 DBMS Lecture # 4 2007-01-30 M. E. Kabay, PhD, CISSP-ISSMP Assoc. Prof. Information Assurance Division of Business & Management, Norwich University V: 802.479.7937 mailto:mkabay@norwich.edu 1 Copyright 2007 Jerry Post. ... Date Added: 2009-04-21 20:05:29 |
| Lecture1.pdf Path: NMSU >> PSY >> 340 Fall, 2009 Description: Lecture1:Cog Lecture 1: Cog smorgasbord: Alittlehistory,somebrainanatomy, andthewondersofneuroimaging d th d f i i January16th History Psychologybrokeofffromphilosophyinthe midtolate1800s Sciencebaseduponthescientificmethod b d h f h d (testableh... Date Added: 2009-04-21 20:06:32 |
| hw2.pdf Path: Michigan >> EECS >> 598 Fall, 2008 Description: EECS 598-1. WRITTEN HOMEWORK 2: DUE 3/19/2002 BEFORE THE CLASS March 12, 2002 Four-point scheme near the boundary. In this exercise we examine fourpoint scheme near boundary. You may use a computer algebra package or MATLAB for some matrix manipulat... Date Added: 2009-04-21 20:09:30 |
| Mean_Estimators.pdf Path: Michigan >> STAT >> 406 Fall, 2009 Description: Other estimators of the expected value Given data X1 , . . . , Xn , the sample mean X is an estimator of the population mean EX. The sample mean is not the only possible estimate of the population mean. There are other ways of combining the informat... Date Added: 2009-04-21 20:09:44 |
| avgns-ari.pdf Path: Michigan >> EECS >> 487 Fall, 2008 Description: Averaging Normals! Averaging Normals! 3 October 2008! Ari Grant! ! The purpose of averaging the normals of a ! At times the effect is unwanted and polygonal object is to remove the hard edges and make it appear smooth! destroys the hard edges that a... Date Added: 2009-04-21 20:12:30 |
| presentation.pdf Path: RIT >> MXH >> 2906 Spring, 2009 Description: Department of Computer Science Rochester Institute of Technology Masters Project Proposal Exploring the Topology of Small-world Networks Min Hu 1 Topics of Discussion ! Background ! Complex networks ! Basic graph concepts ! Project description ! Pr... Date Added: 2009-04-21 20:13:01 |
| 431s7hw7.pdf Path: Michigan >> ECON >> 431 Fall, 2008 Description: Economics 431 Homework 7 Due Mon, August 13 Part I Review of vertical relations End of chapter problems 18.1, 18.3 Part II Asymmetric information about product quality, signalling games Winter 2002 Final, question 5 Fall 2003 nal, quetsion 5 Advertis... Date Added: 2009-04-21 20:13:23 |
| lecture21.pdf Path: Sanford-Brown Institute >> CSCI >> 1430 Fall, 2009 Description: Introduction to Computer Vision Michael J. Black Lecture 21: Regularization and dense flow CS143 Intro to Computer Vision Michael J. Black News 1) Josh Tenenbaum, Bayesian models of human learning and inference. Metcalf 129, 4:00 2) Many uses seen... Date Added: 2009-04-21 20:13:43 |
| rete.pdf.pdf Path: Sanford-Brown Institute >> CS >> 295 Fall, 2009 Description: Production Matching for Large Learning Systems Robert B. Doorenbos January 31, 1995 CMU-CS-95-113 Computer Science Department Carnegie Mellon University Pittsburgh, PA Submitted in partial ful llment of the requirements for the degree of Doctor of ... Date Added: 2009-04-21 20:16:29 |
| assignmentfour.pdf Path: Sanford-Brown Institute >> EC >> 0206 Fall, 2009 Description: Economics 206 Spring 2007 (Prof. G. Loury) Assignment 4: Using Game Theory 1. Consider the simple duopoly model with linear demand: Two rms produce a homogeneous good for sale in a market with the inverse demand curve P = M ax{d Q, 0}, where P is th... Date Added: 2009-04-21 20:16:37 |
| 13consen.pdf Path: Sanford-Brown Institute >> CS >> 138 Fall, 2009 Description: This lecture is based on The Byzantine Generals Problem by L. Lamport, R. Shostak, and M. Pease. It appeared in ACM Transactions on Programming Languages and Systems, Vol. 4, No. 3 (July 1982). Within Brown it can be found at http:/portal.acm.org/toc... Date Added: 2009-04-21 20:18:00 |
| 486_2005GradesExam1.pdf Path: Michigan >> MATH >> 486 Fall, 2008 Description: Exam 1 figures Problem 1 32.5 30 27.5 25 22.5 20 17.5 15 12.5 10 7.5 5 2.5 0 12 13 14 15 16 17 18 19 20 30 27.5 25 22.5 20 17.5 15 12.5 10 7.5 5 2.5 0 5 6 Problem 2 7 8 9 10 Problem 3 22.5 20 17.5 15 12.5 10 7.5 5 2.5 0 0 1 2 3 4 5 6 7 8 9 10 ... Date Added: 2009-04-21 20:18:18 |
| secs-tans.pdf Path: Michigan >> MATH >> 486 Fall, 2008 Description: Tangent and secant lines A secant line to a graph is a line joining two points on that graph. Namely, if the function is denoted by f , then a secant line is determined by specifying two values x = a and x = b in the domain of f , then drawing the li... Date Added: 2009-04-21 20:18:18 |
| comm.pdf Path: Sanford-Brown Institute >> CS >> 138 Fall, 2009 Description: CS138 Comm CS138 Programming Assignment 1: Comm Assignment Out: Helpsession: Assignment Due: Feb. 3, 2004 Feb. 4, 2004 (Location TBD, 7pm) Feb 11, 2004 (11:59 pm) 1 Introduction Welcome to CS138! While we know youre all excited to get started on... Date Added: 2009-04-21 20:18:47 |
| examf.pdf Path: Michigan >> C >> 116 Fall, 2009 Description: Math 116 Final Exam December 17, 2007 Name: Instructor: 1. Do not open this exam until you are told to do so. 2. This exam has 11 pages including this cover. There are 10 problems. Note that the problems are not of equal diculty, and it may be to yo... Date Added: 2009-04-21 20:19:06 |
| hw4.pdf Path: Michigan >> BME >> 311 Fall, 2009 Description: BME 499.098/311 (Noll) 2/1/05 HW #4 Homework #4 Due Date: Feb. 8, 2005 1. O f) (hint use result of Example 3.5 and apply the shift theorem). Do part b as well. 2. Consider the periodic signal in Figure ... Date Added: 2009-04-21 20:20:58 |
| 31295017977827.pdf Path: Texas Tech >> ETD >> 07312008 Fall, 2009 Description: DESIGN OF AN AUTOMATED INKLESS WAFERMAP SYSTEM by XUELIN ZHOU, B.S.E.E. A THESIS IN ELECTRICAL ENGINEERING Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE IN E... Date Added: 2009-04-21 20:21:44 |
| 31295017086397.pdf Path: Texas Tech >> ETD >> 06272008 Fall, 2009 Description: CHARACTERIZATION OF ALLERGIC EFFECTS INDUCED BY A Penicillium chrvsopenum CONIDLA-ASSOCIATED ALLERGEN IN A MURINE MODEL by CHRISTOPHER JAY SCHWAB, B.S. A DISSERTATION IN MEDICAL MICROBIOLOGY Submitted to the Graduate Faculty of Texas Tech University... Date Added: 2009-04-21 20:22:26 |
| model.pdf Path: GWU >> STAT >> 210 Fall, 2009 Description: INTERPRETING COVARIATE EFFECTS IN REGRESSION MODELS: SEARCHING FOR SYNERGISM AND ANTAGONISM John M. Lachin, Sc. D. Professor of Biostatistics and Epidemiology, and of Statistics Department of Epidemiology and Biostatistics The Biostatistics Center Th... Date Added: 2009-04-21 20:23:28 |
| 20071001.pdf Path: Harvard >> CSCIE >> 153 Fall, 2009 Description: XSLT and XPath Page 1 of 65 XSLT and XPath Page 2 of 65 Table of Contents | All Slides | Link List | CSCI E-153 Home Announcements Course Web Site Student Locations Add your location to the Student Location map. If completed before 10/9, you wil... Date Added: 2009-04-21 20:24:40 |
| IL-Democrat.pdf Path: Harvard >> CSCIE >> 20061114 Fall, 2009 Description: United States 109th Congress, Page 1 of 1 United States 109th Congress Illinois Democrat Official Name Bean, Melissa L. Costello, Jerry F. Davis, Danny K. Emanuel, Rahm Evans, Lane Gutierrez, Luis V. Jackson, Jesse L. Jr. Lipinski, Daniel Rush, Bobb... Date Added: 2009-04-21 20:24:53 |
| fig10-1.pdf Path: NJIT >> CIS >> 365 Fall, 2009 Description: ... Date Added: 2009-04-21 20:25:34 |
| Wallace.pdf Path: Stanford >> POLISCI >> 440 Fall, 2009 Description: Cities and Stability: Directing Urbanization, Defining Unrest, and Distributing Transfers in China Jeremy Wallace Ph.D. Candidate Stanford University jeremy.wallace@stanford.edu [This chapter builds on the theory and empirical work presented in the ... Date Added: 2009-04-21 20:25:36 |
| lsnote.pdf Path: Wisconsin >> ECE >> 539 Fall, 1997 Description: ECE539 Lecture 2 Additional Notes Least Square Method In this note, we review the least square method for solving an over-determined linear systems of equations. This method is used in the lecture for solving the weights in the batch-mode learning me... Date Added: 2009-04-21 20:26:17 |
| hw13.pdf Path: Wisconsin >> MATH >> 221 Fall, 1992 Description: Sec. 6.4 l l , 4 4 3. 7. 15 9 5 , M = , x= 2 2 3 9 10. M 0 = 9 , M = 20 , x = 20 M0 = 14. ( 0,10 ) 4 4 , b. 0, 22. a. 4 25. 3 1 , 2 2 3 1 5 2 26. , Sec. 7.1 1. yes 13. 16. 21. 24. 2. no 3. no 4. no 5. yes 6. yes y = x 1 , ... Date Added: 2009-04-21 20:26:32 |
| EQ-SH.pdf Path: Wisconsin >> SS >> 322 Fall, 2009 Description: Equation sheet for -SOIL SCIENCE 322 t = g + p + o + W. 2rcos = r whg 2 P = 2/r h = 0.145 cm /r v = Vw/Vt = Vw/(Vs + Vf) = g(b/w) = g sb sb = b/w f = 1 - (b/s) s = Ms/Vs f = 1 - Vs/Vt 2 h = 2cos/rwg g = Mw/Ms Vt = Vs + Va + Vw b = Ms/Vt Vt = Vs +... Date Added: 2009-04-21 20:26:58 |
| Week12.pdf Path: Wisconsin >> ECON >> 302 Fall, 2008 Description: IS LM Model The IS Curve: depicts all combinations of the real interest rate (r) and real output levels (Y) in which the goods market and loanable funds markets are in equilibrium. Keynesian Cross Diagram to determine equilibrium level of output for... Date Added: 2009-04-21 20:30:31 |
| nfs.slides.pdf Path: Rutgers >> CS >> 352 Spring, 2006 Description: RPC and NFS Explained Chris Gates Chris VanHorn Jason Kwock Remote Procedure Calls (SunRPC) Allows inter-architecture / inter-operating system communications Operates over UDP, TCP, or TLI which is a transport layer provided by the kernel Created... Date Added: 2009-04-21 20:33:29 |
| pack3.pdf Path: Rutgers >> CS >> 352 Spring, 2006 Description: Medium Access Sublayer Medium Access Sublayer Network Layer Medium Access Sublayer Data Link Layer Physical Layer 1 2 Medium Access Sublayer (contd) Medium access (MAC) sublayer is not important on point-to-point links q The MAC sublayer is only... Date Added: 2009-04-21 20:33:32 |
| l7-4.pdf Path: Rutgers >> CS >> 519 Spring, 2002 Description: Two-Level Naming l l Directory Service l l symbolic name (external) => binary name (internal) binary name format l l l l i-node : no cross references among servers (server, i-node): a directory in one-server can refer a file on a different server... Date Added: 2009-04-21 20:33:35 |
| XML1.pdf Path: Rutgers >> CS >> 314 Fall, 2002 Description: XML pages 712-721 of text extensible markup language textual database with tree representations text encoding could be ASCII or richer representation optional consistency checking with XML Schemas XPATH query language (also XQUERY) XSL templat... Date Added: 2009-04-21 20:34:14 |
| Sala2007.pdf Path: Wisconsin >> PS >> 616 Fall, 2009 Description: | | Articles The Cold War on Ice: Constructivism and the Politics of Olympic Figure Skating Judging Brian R. Sala, John T. Scott, and James F. Spriggs II We examine judge bias in Olympic gure skating as an exploratory analysis of a leading constru... Date Added: 2009-04-21 20:35:02 |
| 2002829_r01o_019024.pdf Path: Stanford >> GENI >> 1021 Fall, 2009 Description: 2:01-cv-09024- S -VBK Document 47. Filed 09/2002 Page 1 of,6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 177 1$\' 19 0 26` 2^ 22 23 24 25 26 27 28 GROSSMAN & KLARFELD Richard A. Grossman (State Bar No. 47938) Gerald F. Phillips (State Bar No. 134369)... Date Added: 2009-04-21 20:37:48 |
| P151_Exam3_F05.pdf Path: Michigan >> PHYS >> 151 Fall, 2009 Description: Physics 151 December 2, 2005 Exam #3 Instructions: Name_ Lab Section Number_ There are 20 short answer questions (worth 2 points each), and 3 work problems (worth a total of 60 points). You must answer all questions to receive full credit. You must... Date Added: 2009-04-21 20:38:52 |
| 2006323_r03t_012661.pdf Path: Stanford >> EXDS >> 1019 Fall, 2009 Description: Case 3:01-cv-02661-MMC Document 283 Filed 03/23/2006 Page 1 of 8 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 DAVID M. FURBUSH (State Bar No. 83447) DHAIVAT H. SHAH (State Bar No. 196382) ROBERTA L. HARTING (State B... Date Added: 2009-04-21 20:39:17 |
| 2005812_r01k_0404156.pdf Path: Stanford >> IFX >> 1032 Fall, 2009 Description: US District Court Civil Docket as of 08/12/2005 Retrieved from the court on Monday, August 22, 2005 U.S. District Court California Northern District (San Jose) CIVIL DOCKET FOR CASE #: 5:04-cv-04156-JW IN RE:INFINEON TECHNOLOGIES AG SECURITIES LITI... Date Added: 2009-04-21 20:40:16 |
| 2007917_r05d_0702940.pdf Path: Stanford >> CNCT >> 1036 Fall, 2009 Description: E-FILING CHAMBE S COPY 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 BERNSTEIN LITOWITZ BERGER & GROSSMANN LLP DAVID R. STICKNEY (Bar No. 188574) MATTHEW P. SIBEN (Bar No. 223279) TAK.EO A. KELLAR (Bar No. 234470) 12481... Date Added: 2009-04-21 20:40:17 |
| example1.pdf Path: UNC Asheville >> CHEM >> 145 Fall, 2009 Description: Anal. Chem. 2003, 75, 2740-2745 Speciation of Nickel in a Hyperaccumulating Plant by High-Performance Liquid Chromatography-Inductively Coupled Plasma Mass Spectrometry and Electrospray MS/MS Assisted by Cloning Using Yeast Complementation Veronique... Date Added: 2009-04-21 20:43:12 |
| hw3.pdf Path: RIT >> EECC >> 756 Fall, 2009 Description: EECC 756 - Spring 2003 Homework Assignment #3, Due May 6th 1. This problem is based on questions 6-14 and 6-15 on page 192 in the Parallel Programming Techniques and Applications textbook. Given the provided room geometry, write a two dimensional mes... Date Added: 2009-04-21 20:46:15 |
| MiniAssignment02_P1.pdf Path: SUNY Buffalo >> MAE >> 576 Fall, 2009 Description: Department of Mechanical and Aerospace Engineering MAE 476 / 576: Mechatronics Spring Semester - 2003 State University of New York at Buffalo Mini Assignment 2 (Part 1) Theme: Analysis of Different Mechatronic Courses Available Instructor: Dr. Ven... Date Added: 2009-04-21 20:46:31 |
| 07Processing2.pdf Path: SUNY Buffalo >> CSE >> 562 Fall, 2009 Description: Outline Query Optimization CSE 562 Database Systems Query Processing: Algebraic Optimization Some slides are based or modified from originals by Database Systems: The Complete Book, Pearson Prentice Hall 2nd Edition 2008 Garcia-Molina, Ullman, and ... Date Added: 2009-04-21 20:47:17 |
| IDS250K.pdf Path: Appalachian State >> CAS >> 20022003 Fall, 2009 Description: 2002-2003 Bachelor of Arts (BA) Degree Code 250 * Concentration Code 250K I. Checksheet for Interdisciplinary Studies LIBERAL STUDIES: CLASSICAL PERIOD CORE CURRICULUM.. 44 Courses taken for core curriculum credit MAY NOT be used to satisfy requirem... Date Added: 2009-04-21 20:50:07 |
| DoeringGarrett_set03.pdf Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009 Description: Doering, Garrett P p112s09 Due Wed, Feb 18, 2009 at 23:30 Physics 112: General Physics II Section 2 Set 3 CA ID 8052 PA 12. [2pt] A spherical surface completely surrounds a collection of charges. Find the electric ux through the surface if the colle... Date Added: 2009-04-21 20:50:14 |
| LectI.pdf Path: Rutgers >> CHEM >> 323 Fall, 2009 Description: Statistical Quantum Mechanics How many quantum states are important? We need to extend all of the quantum mechanics we have learned from the case of an isolated atom or molecule, that is not interacting with its surroundings, to the case of two, thre... Date Added: 2009-04-21 20:50:15 |
| GlobalIllu.pdf Path: Stevens >> CS >> 437 Fall, 2009 Description: Global Illumination Local Illumination (e.g. Phong) shaded color depends purely on local surface configuration Other surfaces have no effect. No shadows, not effected by their emissions Global Illumination: Illumination of one object depends on... Date Added: 2009-04-21 20:50:53 |
| P4_06.pdf Path: Stevens >> E >> 344 Fall, 2009 Description: Silicon Carbide (SiC) is a ceramic material with the so-called zinc blende crystal structure. It can be constructed from the FCC unit cell using a two-atom basis consisting of a Si atom at (0,0,0) and a C atom at (, , ). (a) Calculate the percent io... Date Added: 2009-04-21 20:50:58 |
| Capabilitymaturitymodel.pdf Path: Stevens >> MIS >> 620 Fall, 2009 Description: Capability Maturity Model, Version l + l MARK . PAULK, r u CURTIS, and MARY C B BETH CHRlSSlS Software Engineering 7ns titu te CHARLESWEBER, Federal Systems Company V. IBM e The new version has more consistent wording and should be easier to use. I... Date Added: 2009-04-21 20:51:11 |
| selection2.pdf Path: Stevens >> CS >> 537 Fall, 2009 Description: ... Date Added: 2009-04-21 20:51:20 |
| Liberty_MBB_Game_Notes_vs_Anderson_Dec_15_2008.pdf Path: Liberty >> MEDIA >> 1912 Fall, 2009 Description: 2008-09 MENS BASKETBALL MEDIA INFORMATION . GAME 9: Liberty (6-2, 1-1 Big South) vs. Anderson (3-3, 1-1 Carolinas) Mon., Dec. 15 7 p.m. Lynchburg, Va. Vines Center (8,085) SCHEDULE/RESULTS N14 N18 N25 N28 N29 D1 D6 D7 D15 D17 D19 D22 D23 MONTREAT ... Date Added: 2009-04-21 20:51:24 |
| hw7.sol.pdf Path: Sanford-Brown Institute >> GS >> 019 Fall, 2009 Description: Limits of Computation: Homework 7 solutions Kevin Matulef March 13th, 2001 Problem 9.11 Show that the language MAXCLIQUE={ G, k | The largest clique of G has k vertices} is in NPSAT . A graph G has a maximum clique of size k if and only if it has a... Date Added: 2009-04-21 20:51:50 |
| pfinal.pdf Path: Sanford-Brown Institute >> EC >> 111 Fall, 2009 Description: Name_ Economics 111: Intermediate Microeconomics Spring 2005 Practice Final You have 3 hours. Only clarifying questions are allowed. Do not cheat. Do not panic. Enjoy the exam. Questions 1 to 10 are multiple choice or true/false. Circle the correct... Date Added: 2009-04-21 20:52:16 |
| 31295011238028.pdf Path: Texas Tech >> ETD >> 01292009 Fall, 2009 Description: PRESERVATION OF THE HISTORICAL ENVIRONMENT FOR CULTURAL HERITAGE: A CASE STUDY OF VERNACULAR ISTANBUL HOUSES by CENGIZ M. GULTEK, B.Arch. A THESIS IN ARCHITECTURE Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of ... Date Added: 2009-04-21 20:55:45 |
| lab1.pdf Path: Stanford >> EE >> 108 Fall, 2009 Description: EE108B Prof. Kozyrakis Win 08/09 EE108B Lab Assignment #01 MIPS Assembly Programming Due: Tuesday, January 20, 2008 1. Introduction Throughout these labs, you will be designing a processor that can execute programs written in MIPS assembly. Once t... Date Added: 2009-04-21 20:56:21 |
| lect.11.Memory.pdf Path: Stanford >> EE >> 108 Fall, 2009 Description: Lecture 11 Memory Design Christos Kozyrakis Stanford University http:/eeclass.stanford.edu/ee108b C. Kozyrakis EE 108b Lecture 11 1 Announcements TBD C. Kozyrakis EE 108b Lecture 11 2 Review: Reducing Branch Control Hazard Time (clock cycle... Date Added: 2009-04-21 20:56:22 |
| east.txt Path: Acton School of Business >> ECE >> 422 Fall, 1997 Description: | Test of RVRBOT world east boundary. clock pclka 1 0 0 0 clock pclkb 0 0 1 0 | Inputs ana pInt3 pInt2 pInt1 pInt0 | pIntensityx4, pRestart, pQueryReq, pDataReady | Outputs ana pP3 pP2 pP1 pP0 ana pBd3 pBd2 pBd1 pBd0 ana pDir1 pDir0 | pPosx4, pBou... Date Added: 2009-04-21 20:56:53 |
| homework3solution.pdf Path: UCSD >> ECE >> 161 Fall, 2008 Description: Homework #3 Solution ECE 161B DSPI L1 L2 L4 L3 P1 Determinant: = 1 L1 L2 L3 L4 + L1L2 + L1L3 = 1 2z 1 (k1 )k2 z 1 (k1 )k1z 1 + z 2 + z 1 (k1 )k2 z 1 = 1+ (2 + k1k2 + k12 ) z 1 + (1 k1k2 ) z 2 P 1 = k1 z 1 1 The transfer function H ( z) = k... Date Added: 2009-04-21 20:57:29 |
| lect3.pdf Path: UCSD >> ECE >> 244 Winter, 2009 Description: Statistical Optics Lecture 3 Distributions related to Gaussians Length of a sum of phasors Rayleigh and Ricean Distributions Ricean Distribution 2 Noncentral2 Gamma Distribution Statistical Optics Lecture 3 Winter Quarter 2009 Random Processes EC... Date Added: 2009-04-21 21:01:47 |
| TestingStrategies.pdf Path: BYU >> CS >> 340 Fall, 2009 Description: Testing Strategies Sources: Code Complete, 2nd Ed., Steve McConnell Software Engineering, 5th Ed., Roger Pressman Testing Computer Software, 2nd Ed., Cem Kaner, et. Al. Overall Testing Strategy System Engineering Requirements Design Construction Sy... Date Added: 2009-04-21 21:06:32 |
| test_1_notes00.pdf Path: LSU >> EE >> 2230 Fall, 2008 Description: Electrical and Computer Engineering EE2230 Test 1 Introduction: The test is intended to: 1. Test conceptual understanding of material 2. Demonstrate problem solving ability This test is not intended to: Trick you Flunk you Test your memorizatio... Date Added: 2009-04-21 21:10:23 |
| homework7-2007.pdf Path: Wisconsin >> CHE >> 735 Fall, 2009 Description: CBE 735 Homework 7 Due: Friday, November 9, 2007 Use transition state theory to derive an expression for the rate of a bimolecular reaction between two atoms (A and B) on a surface. The atoms and the transition state may all assumed to be 2-dimension... Date Added: 2009-04-21 21:13:49 |
| March%202006.pdf Path: Wisconsin >> DOCUMENT >> 22360 Fall, 2009 Description: 1-May-06 IceCube Project Monthly Report March 2006 Accomplishments The IceCube Data Acquisition collected more than 250 million events since mid-February 2006. UW and RPSC conducted a detailed planning meeting in early April to prepare for the next ... Date Added: 2009-04-21 21:13:54 |
| Top100February07.pdf Path: Michigan >> TOP >> 100 Fall, 2009 Description: The Top 100 February 1, 2007 A list of stocks topping our custom \'torpedo screen. Updated monthly. BKRS Bakers Footwear Group Inc. COSI Cosi Inc. CPWM Cost Plus Inc. DIET eDiets.com Inc. EBHI Eddie Bauer Holdings, Inc. HOTJ House of Taylor Jewelry In... Date Added: 2009-04-21 21:17:11 |
| PositiveFeedback.pdf Path: Wisconsin >> AAE >> 320 Fall, 2009 Description: [Newsletter Reprint] June 1997 -The Power of Positive Feedback \"You get what you reward.\" Bob Nelson, author of 1001 Ways to Reward Employees, made this statement during the \"TRANSFORMATIONS \'97\" post-conference workshop, \"Making Effective Use of Emp... Date Added: 2009-04-21 21:19:12 |
| practicemid1.pdf Path: Wisconsin >> STAT >> 201 Fall, 2009 Description: Stat 201 midterm 1 practice problems Spring 2003-04 1. Corrosion of reinforcing steel is a serious problem in concrete structures located in environments aected by severe weather conditions. For this reason, researchers have been investigating the... Date Added: 2009-04-21 21:20:57 |
| lecture10.pdf Path: Wisconsin >> STAT >> 312 Fall, 2008 Description: Stat 312: Lecture 10 Hypothesis testing Moo K. Chung mchung@stat.wisc.edu Feb 20, 2003 Concepts > mean(x) [1] 62.5 1. The null hypothesis H0 is a claim about the value of a population parameter. The alternate Since the average IQ of 10 dogs are lo... Date Added: 2009-04-21 21:21:00 |
| arithmetic.pdf Path: Mich Tech >> CS >> 1000 Fall, 2008 Description: CS/EE 1000 Binary Numbers and Arithmetic Overview Session Objectives Signed Integer Overview Binary Arithmetic Overview Add and subtract numbers in binary and 2s complement. Real quick exposure to multiplication. Representing real numbers ... Date Added: 2009-04-21 21:25:52 |
| hmwk1sol.pdf Path: Georgia Tech >> ISYE >> 3232 Fall, 2008 Description: ISyE 3232 J. Zhang Stochastic Manufacturing and Service Systems Summer 2008 Solutions to Homework 1 1. We are given that E[X] = 2 and V ar(X) = 16. Thus a) E[6 4X] = 6 4E[X] = 2 and V ar(6 4X) = 16V ar(X) = 256. 1 b) E[(X 3)/5] = 5 E[X] 3 5 ... Date Added: 2009-04-21 21:26:50 |
| midterm_samples.pdf Path: UCSD >> CSE >> 140 Winter, 1998 Description: (I) d 0 0 0 1 1 0 1 0 0 1 1 1 - a 0 1 b f= cd + bd + acd + abc c (II) Since we are asked to find the minimum product-of-sums, we start with all maxterm and dont care set. G0 G1 G2 G3 (0): 000 (2): 010 (3): 011 (6): 110 (7): 111 N N N N N G... Date Added: 2009-04-21 21:27:46 |
| study11.pdf Path: Alabama >> NHM >> 561 Fall, 2008 Description: ... Date Added: 2009-04-21 21:29:18 |
| set4_solutions.pdf Path: UCSD >> ECE >> 222 Fall, 2009 Description: ECE 222B, Winter 2007 Solutions for Homework Set 4 1. Assume that you are given a circular metallic waveguide of radius a. If the waveguide conductivity is very good (but not innite), for what frequency will the losses be a minimum for the dominant T... Date Added: 2009-04-21 21:29:40 |
| Assignment-4.pdf Path: Georgia Tech >> CS >> 3220 Fall, 2008 Description: CS3220: Assignment 4 TobedoneINGROUPS.Submitonecopyperteam;emailfilestoloh@ccby11:59PM10/28;NO LATESUBMISSIONSACCEPTED(Igotthetimes/datesmixedupisnotavalidexcuse).Submitfiles asa.zip,.tar.gzor.tar.bz2file.Includeallrelevant.vand.ucffiles.Thecodeshoul... Date Added: 2009-04-21 21:30:48 |
| Assignment-4.pdf Path: Georgia Tech >> CS >> 2009 Fall, 2009 Description: CS3220: Assignment 4 TobedoneINGROUPS.Submitonecopyperteam;emailfilestoloh@ccby11:59PM10/28;NO LATESUBMISSIONSACCEPTED(Igotthetimes/datesmixedupisnotavalidexcuse).Submitfiles asa.zip,.tar.gzor.tar.bz2file.Includeallrelevant.vand.ucffiles.Thecodeshoul... Date Added: 2009-04-21 21:30:48 |
| syllabus-2003.pdf Path: UF >> STA >> 7249 Fall, 2008 Description: STA 7249 Sec 0642 Generalized Linear Models Spring, 2004 Course Information Time: MWF, 10:40 a.m. 11:30 p.m. Instructor: Dr. Brett Presnell Oce: 220 FLO Oce Hours: See instructors web page. Web Page: http:/www.stat.ufl.edu/presnell Text: P. McCul... Date Added: 2009-04-21 21:34:05 |
| Q2-Key.pdf Path: Kutztown >> MAT >> 105 Fall, 2008 Description: MAT 105 Spring 2009 QUIZ #2 Key Name: #1. Is the ordered pair (2, 6) a solution for the equation y = (WORK) x 2 + 6x 4 ? x (2)2 + 6(2) 4 4 12 4 12 = = = 6 . So, (2, 6) is a solution. 2 2 2 #2. x x 7x . =7+ 11 6 66 (WORK) Solve x x ... Date Added: 2009-04-21 21:34:28 |
| nulltest11_ts.pdf Path: UCSD >> NULL >> 095 Fall, 2009 Description: munki0: Ellipse Fitting Off, No Modulation, Vacuum 0.015 0.01 0.005 0 -0.005 radians -0.01 -0.015 -0.02 -0.025 -0.03 0 50 100 150 200 time (min) 250 300 350 400 450 ... Date Added: 2009-04-21 21:35:46 |
| 1.14.09.pdf Path: Oregon State >> PH >> 441 Fall, 2008 Description: ... Date Added: 2009-04-21 21:40:55 |
| ps10.pdf Path: UCSD >> MAE >> 101 Fall, 2008 Description: Method of bisection We will use equation 9.44 as an example, but there may be other cases in which you cant nd a closed-form solution and you will need to use an iteration method. A2 Using P9.91 as an example, we know A = 1.44. Using equation 9.44: 1... Date Added: 2009-04-21 21:41:36 |
| hw02a.pdf Path: Michigan >> P >> 506 Fall, 2009 Description: Physics 506 Homework Assignment #2 Solutions Textbook problems: Ch. 8: 8.6, 8.8 Winter 2006 8.6 A resonant cavity of copper consists of a hollow, right circular cylinder of inner radius R and length L, with at end faces. a) Determine the resonant ... Date Added: 2009-04-21 21:42:01 |
| 2443syllabus.pdf Path: Southern Oregon >> MATH >> 2443 Fall, 2009 Description: MATH 2443.002: Calculus & Analytic Geometry 4 at the University of Oklahoma Spring 2005: MWF 12:30-1:20 p.m., PHSC 416 instructor: e-mail: Dr. TJ Murphy tjmurphy@math.ou.edu The best way to reach me is by e-mail. I tend not to answer my phone and I a... Date Added: 2009-04-21 21:42:26 |
| essaycollections.pdf Path: Southern Oregon >> LIS >> 5703 Fall, 2009 Description: ... Date Added: 2009-04-21 21:42:32 |
| slide01.pdf Path: Texas A&M >> CS >> 633 Fall, 2009 Description: 633-600 Machine Learning Instructor: Yoonsuck Choe Contact info: HRBB 322B, 845-5466, choe@tamu.edu Textbook Tom M. Mitchell (1997) Machine Learning, McGraw-Hill. Book webpage: http:/www.cs.cmu.edu/tom/mlbook.html Text and gures, etc. will be q... Date Added: 2009-04-21 21:43:18 |
| 05.1-06c.pdf Path: Texas A&M >> CVEN >> 446 Fall, 2008 Description: ... Date Added: 2009-04-21 21:43:35 |
| Man220.pdf Path: Texas A&M >> ARSSERV >> 66570000 Fall, 2009 Description: ... Date Added: 2009-04-21 21:43:49 |
| hwk4.pdf Path: Princeton >> ORF >> 523 Fall, 2009 Description: Nonlinear Optimization Spring 2008 Princeton University Prof. Eckstein Homework 3: Unconstrained Algorithms Due Wednesday, March 12 1. Coordinate descent methods are algorithms that perform line search only along coordinate directions, that is the d... Date Added: 2009-04-21 21:44:42 |
| lewishw2.pdf Path: Princeton >> PHI >> 340 Fall, 2009 Description: Philosophy 340 Problem Set X 1. Let $ be a system of spheres. Let $ be a system of comparative similarity derived from $. Show that P Q is true at i according to the system of spheres $ if and only if its true at i according to $ the system of compa... Date Added: 2009-04-21 21:45:14 |
| clarke2.pdf Path: Princeton >> MB >> 523 Fall, 2009 Description: print ncb1046 16/9/03 11:41 am Page 928 LETTERS S-phase checkpoint controls mitosis via an APCindependent Cdc20p function Duncan J. Clarke1,2, Marisa Segal1,3, Catherine A. Andrews2, Stanislav G. Rudyak1, Sanne Jensen1,4, Karen Smith2 and Steven... Date Added: 2009-04-21 21:46:13 |
| ps1.pdf Path: Princeton >> PH >> 106 Fall, 2009 Description: { A Yad f hu q f hud Y Y hu ud hu g fd f h fda wFcFeF#Fv5s #v~5v#FW#Fd#FcFd u d h s d h x u gd f hud a q fdau Y sd ud hu Yudau f Y zY h BfbYFpWbYFghcB#vFYWc}wtwWFvc#FB5vcvcw#eFecu g f f h h x q #dpvpuw\"F hcb#tsBFFt|... Date Added: 2009-04-21 21:46:46 |
| kestrel_4000_manual.pdf Path: Purdue >> EAS >> 535 Fall, 2008 Description: Kestrel 4000 Pocket Weather Tracker Pocket Weather Tracker Kestrel 4000 Instruction Manual FRONT MANUAL MEMORY BUTTON Press to manually store current conditions to memory. BACKLIGHT BUTTON Press to activate backlight for 1 minute. MODE BUTTON... Date Added: 2009-04-21 21:47:07 |
| harris.pdf Path: Columbia >> G >> 8965 Fall, 2009 Description: ... Date Added: 2009-04-21 21:47:38 |
| quiz1.pdf Path: Berkeley >> CS >> 152 Spring, 2008 Description: Computer Architecture and Engineering CS152 Quiz #1 February 19th, 2008 Professor Krste Asanovic Name:_ This is a closed book, closed notes exam. 80 Minutes 10 Pages Notes: Not all questions are of equal difficulty, so look over the entire exam a... Date Added: 2009-04-21 21:49:14 |
| flashhandout2.pdf Path: George Mason >> JHU >> 345 Fall, 2009 Description: NCLC 345 - Introduction to Multimedia New Century College | 5 credits Location: 336 Innovation Hall | Monday, Wednesday 10:30 AM 12:20 PM | Spring 2005 Meeting Notes of 04/04/2005 Action Items from the last meeting: 1. Individual Review the prese... Date Added: 2009-04-21 21:49:49 |
| quiz1.pdf Path: Bergen CC >> CS >> 152 Fall, 2009 Description: Computer Architecture and Engineering CS152 Quiz #1 February 19th, 2008 Professor Krste Asanovic Name:_ This is a closed book, closed notes exam. 80 Minutes 10 Pages Notes: Not all questions are of equal difficulty, so look over the entire exam a... Date Added: 2009-04-21 21:50:00 |
| AvanWavesUG.pdf Path: Berkeley >> EE >> 140 Fall, 2009 Description: AvanWaves User Guide Avant! Corporate Headquarters 1208 East Arques Avenue, Sunnyvale, CA 94086-5401 TEL +1 408 738 8881 . . . FAX +1 408 738 8508 . . . http:/www.avanticorp.com AvanWaves User Guide 1997 Avant! Corporation Version 1997.2 for u... Date Added: 2009-04-21 21:50:27 |
| Lab10.pdf Path: Berkeley >> ME >> 140 Fall, 2009 Description: ME140 Fall 2007 Prof. J.-Y. Chen LAB #10 Combustion Processes UCB GAS TURBINE COMBUSTOR This combustor is typically used in gas turbines systems. The fuel is injected as a liquid and sufficient air is provided near the injector to get approximately... Date Added: 2009-04-21 21:51:05 |
| leviciv.pdf Path: Berkeley >> PHYSICS >> 209 Fall, 2008 Description: Physics 209 Fall 2002 Notes 3 The Levi-Civita Symbol The Levi-Civita symbol is useful for converting cross products and curls into the language of tensor analysis, and for many other purposes. The following is a summary of its most useful properties... Date Added: 2009-04-21 21:51:55 |
| lecture02.pdf Path: Berkeley >> EE >> 230 Spring, 2008 Description: January 22, 2007 Lecture #2 Stereograms, Symmetry Elements, Groups, D3 (Quartz), Multiplication Table, and Character Table T \'n. _ q. -\\ e.\\f\' e. o~ a. ~ ~ e.\\i \"\'\" ~ ~ \\I\' Ct. \\tu\' c. ~ ~V\'~e.ct.\\O~ \'\\:~e. ?CL~ e. V\' e. C!) \\1: C) V ?c... Date Added: 2009-04-21 21:55:01 |
| dft.pdf Path: Michigan State University >> CEM >> 988 Fall, 2008 Description: DENSITY FUNCTIONAL THEORY Hohenberg & Kohn (1964) H = T +V ee + V (i) i =1 ^ ^ N r r E[ ] = F [ ] + (r )V (r ) dV NUCLEI Z r V (r ) = r K r K =1 r RK F [ ] = TS [ ] + J [ ] + E XC [ ] where E XC = T TS + Vee J DFT continued The ... Date Added: 2009-04-21 21:55:09 |
| PHAR-CNSdrugs2004.pdf Path: Berkeley >> OPT >> 226 Fall, 2009 Description: P SYCHOPHARMACOLOGY I. Background neurophysiology non-NMDA receptors - abnormality associated ... Date Added: 2009-04-21 21:55:20 |
| Quiz_2_key.pdf Path: University of Illinois, Urbana Champaign >> CHEM >> 104 Fall, 2008 Description: Name: Chern 104 BID Section: Quiz #2 Form A PV = nRT AE=q+w R = 8.314 J/mol K = 0.0821 L atm/mol K qsys= -qswrounding q = CLl T 101.3 J = 1 L atm w = -PextLl V LlOo = LlJr> -T LlSo q = m c Ll T Mlrxn= L n prod LlJr> prod -:E n react Mloreact -... Date Added: 2009-04-21 21:59:23 |
| 14_flow_I.pdf Path: University of Illinois, Urbana Champaign >> CS >> 473 Fall, 2008 Description: Network Flow 3/12/02 1 Network Flow Problem 1.1 Transfer as much merchandise as possible from one point to another. For example, we have a wireless network, and one would like to transfer a big le from s to t. The network have limited capacity, an... Date Added: 2009-04-21 22:02:08 |
| Mandel_Wolf-1965.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 460 Fall, 2008 Description: ... Date Added: 2009-04-21 22:02:09 |
| Lab1.pdf Path: Washington >> FIT >> 100 Fall, 2009 Description: FIT 100: Fluency with Information Technology Lab 1: UW NetID, Email, Student Web Pages Table of Contents: Obtain a UW Net ID (your email / web page identity): . 1 1. Setting Up An Account .. 2 2. UW Email: WebPine . 3 3. Creating folders using WebPin... Date Added: 2009-04-21 22:02:28 |
| StudyQuestion012408.pdf Path: Washington >> H >> 540 Fall, 2009 Description: Health and Human Rights Study Questions for January 24, 2008 1. How does the Silverman article complement and extend the scientific conclusions we reach after reading the Garcia-Moreno article? 2. How does the Burnham article further substantiate th... Date Added: 2009-04-21 22:07:23 |
| OOMOO_Series_4_-_MSDS.pdf Path: Washington >> ME >> 480 Fall, 2009 Description: Material Safety Data Sheet OOMOO Series Date Of Preparation: May 2, 2005 MSDS No. 821 Revision: 0004 Section 1 - Chemical Product and Company Identification Product/Chemical Name: OOMOO Series Part A General Use: Silicone Elastomer Manufacturer: S... Date Added: 2009-04-21 22:09:44 |
| vecvel.h.pdf Path: Washington >> EE >> 543 Fall, 2009 Description: EE543 Vector Velocity 1 Velocity of a Vector A If A Q is a point represented in frame A, then A VQ = limt0 Q(t + t) A Q(t) t We have just computed the velocity in frame A and it is also represented in frame A. Later we may wish to represent th... Date Added: 2009-04-21 22:10:39 |
| lecture25.pdf Path: University of Illinois, Urbana Champaign >> ASTRO >> 230 Fall, 2009 Description: Astronomy 230 Section 1 MWF 1400-1450 106 B6 Eng Hall This Class (Lecture 25): Future of Civilization Research Papers are due on May 5th. Outline What are our future plans? We are looking for advanced civilizations, but how do we become an advan... Date Added: 2009-04-21 22:10:42 |
| lec-9-28.pdf Path: University of Illinois, Urbana Champaign >> CS >> 225 Spring, 2008 Description: ... Date Added: 2009-04-21 22:10:45 |
| 21-ISA.pdf Path: University of Illinois, Urbana Champaign >> CS >> 231 Spring, 2008 Description: Instruction set architectures Last time we built a simple, but complete, datapath. The datapath is ultimately controlled by a programmer, so today well look at several aspects of this programming in more detail. How programs are executed on proces... Date Added: 2009-04-21 22:11:11 |
| 126Csyllabus.pdf Path: Washington >> M >> 126 Fall, 2009 Description: CALCULUS III Syllabus for Math 126 C - Spring 2007 Lecturer: Dr. Matthew M. Conroy Email: conroy@math.washington.edu Ofce: Padelford C-544 Web page: www.math.washington.edu/conroy Ofce hours are times when you can speak to me without making an appoi... Date Added: 2009-04-21 22:11:43 |
| 2008syll598.pdf Path: Washington >> HIST >> 598 Fall, 2008 Description: University of Washington, Department of History Fall 2008 HIST598: Methods of Historical Research (5 credits) Professor Uta Poiger Office: Smith 116 B Hours: by appointment and Tuesdays (meeting days only): 10:30-12 Email: poiger@u.washington.edu C... Date Added: 2009-04-21 22:15:17 |
| vernac_schedule_final_2007.pdf Path: Washington >> URBDP >> 587 Fall, 2008 Description: SCHEDULE denotes a long class (6-8:50pm) Th4Jan TOPIC1|INTRODUCION Courseandparticipantintroductions Tue9Jan TOPIC1|INTRODUCION Overviewofthebroadconcepts Readings: Discussants:Hanna ThomasC.Hubka,AmericanVernacularArchitecture DellUpton,ThePowero... Date Added: 2009-04-21 22:15:52 |
| kelsaybombers.pdf Path: Fayetteville State University >> REL >> 3170 Fall, 2009 Description: ... Date Added: 2009-04-21 22:17:02 |
| Lec15.pdf Path: Cornell >> CS >> 100 Fall, 2008 Description: 15. Structures Simple Structures Structure Arrays Structures with Array Fields Other Possibilities Data is Often Related A point in the plane has an x coordinate and y coordinate. If a program manipulates lots of points, there will be lots of x\'s an... Date Added: 2009-04-21 22:27:04 |
| week9_x4.pdf Path: Cornell >> CS >> 280 Fall, 2003 Description: 3 r Rr P H 6 # P 6 QutTP4VAf#R x 4\'hF4h 1 r 6 B P v R s R 6 8P E r P R R 6 QD%C!u9 x f#u%T#%hC4DCIDV x kTT%CB 3 a 4Cu9G9%T#%h ca %T#90h~QFDCC th9%UH v R 6 f v R 6H 8P E P P 6 # 6 v R 6 6 P s v R 6 v R 6 Q%#k9f#%hY%hktQufd... Date Added: 2009-04-21 22:27:32 |
| week02a-scirev.pdf Path: ASU >> HPS >> 323 Fall, 2008 Description: University system as center of orthodoxy Authority of Plato (Timaeus) Aristotle (the Organum) The Church 1543 - 1687 The LORD is king, robed with majesty; the LORD is robed, girded with might. The world will surely stand in place, never to... Date Added: 2009-04-21 22:29:00 |
| optoiso.pdf Path: Cal Poly >> EE >> 319 Fall, 2009 Description: MOTOROLA SEMICONDUCTOR TECHNICAL DATA Order this document by MOCD223/D Dual Channel Small Outline Optoisolators Darlington Output The MOCD223 device consists of two gallium arsenide infrared emitting diodes optically coupled to two monolithic sili... Date Added: 2009-04-21 22:33:16 |
| AM27C020.pdf Path: Washington University in St. Louis >> CSE >> 362 Fall, 2009 Description: FINAL Am27C020 2 Megabit (256 K x 8-Bit) CMOS EPROM DISTINCTIVE CHARACTERISTICS s Fast access time Speed options as fast as 55 ns s Low power consumption 100 A maximum CMOS standby current s JEDEC-approved pinout Plug in upgrade of 1 Mbit EPROM ... Date Added: 2009-04-21 22:33:50 |
| CV_PeterPerez.pdf Path: Penn State >> PLP >> 122 Fall, 2009 Description: Peter Larry Perez Diaz 1614 Highlandon Ct. State College, PA 16801 Phone: (814) 880-3506 E-mail: peter@psu.edu Date of Birth: 12/25/1974 Education College Bachelor of Science, Major Chemistry, Universidad Central de Venezuela (UCV), Caracas Venezu... Date Added: 2009-04-21 22:34:24 |
| promise-plasmonics.pdf Path: Washington University in St. Louis >> CHE >> 515 Fall, 2009 Description: The Promise of Plasmonics: Scientific American Page 1 of 5 Scientific American Magazine - March 18, 2007 The Promise of Plasmonics A technology that squeezes electromagnetic waves into minuscule structures may yield a new generation of superfast c... Date Added: 2009-04-21 22:34:26 |
| Ch08s.pdf Path: Penn State >> SMS >> 5267 Spring, 2009 Description: Chapter 8 Problem Solutions 8.1 a. b. i. VD D = 80 V Maximum power at VDS = ID = RD = PT 25 = = 0.625 A VD S 40 VD D 2 = 40 V ii. 80 - 40 RD = 64 0.625 VD D = 50 V Maximum power at VD S = ID = RD = PT 25 = =1 A VDS 25 VD D 2 = 25 V 50 -... Date Added: 2009-04-21 22:36:03 |
| HW9.pdf Path: Penn State >> ME >> 412 Fall, 2009 Description: ME 412, Heat Transfer Due Friday, April 6, by 5pm. Homework 9 Spring 2007 1. Consider a large vertical plate with a uniform surface temperature of 25C suspended in quiescent air at 130C and atmospheric pressure. (a) Estimate the boundary layer t... Date Added: 2009-04-21 22:36:12 |
| Matsuda.pdf Path: Penn State >> KEJ >> 493 Fall, 2009 Description: Wolf, C., & Spencer, S. (1996). Stereotypes and prejudice: Their overt and subtle in uence in the classroom. American Behavioral Scientist, 40, 176185. Young, D. (1990). An investigation of students perspectives on anxiety and speaking. Foreign Langu... Date Added: 2009-04-21 22:36:29 |
| wave1.pdf Path: UGA >> M >> 3150 Fall, 2009 Description: An Example Many people seemed confused by the last example we did in class on Nov. 20. So here are some more details. Recall that we were solving the di erential equation 2 2 @t u = @ x u with the initial conditions u(x; 0) = f (x) = 0; @t u(x; 0) =... Date Added: 2009-04-21 22:39:31 |
| wave1.pdf Path: Utah >> M >> 3150 Fall, 2009 Description: An Example Many people seemed confused by the last example we did in class on Nov. 20. So here are some more details. Recall that we were solving the di erential equation 2 2 @t u = @ x u with the initial conditions u(x; 0) = f (x) = 0; @t u(x; 0) =... Date Added: 2009-04-21 22:40:31 |
| skyeread_m1_reference_guide.pdf Path: UMass (Amherst) >> SDP >> 05 Fall, 2009 Description: SkyeRead M1 Reference Guide . 1/28/2004 Copyright 2002-2003 SkyeTek, LLC SkyeRead M1 Reference Guide Page1 SkyeRead M1 Reference Guide 1/28/2004 TABLE OF CONTENTS 1 PRODUCT OVERVIEW.. 4 1.1 1.2 2 3 4 GENERAL DESCRIPTION . 4 HIGHLIGHTED FEATUR... Date Added: 2009-04-21 22:47:30 |
| 13%20FractionalBrownian.pdf Path: Rose-Hulman >> CSSE >> 200830 Fall, 2009 Description: Session overview Fractional Brownian motion Announcements: Project 3 due now Project 4 assigned at the end of class, due Friday, 11:59 pm. March 24, 2008 CSSE/MA 325 Lecture #13 1 Review Brownian motion Direct displacements Simulated using Gaussian ... Date Added: 2009-04-22 03:20:01 |
| Wagner_Interaction.pdf Path: GWU >> ED >> 220 Fall, 2009 Description: c.= l\\J In Support Definition 1~lIcll of a Functional of Interaction D. Wagner 1scu!i1iil,n!\\ of il11eraClion do not dislingui~h If il11erUclion found in Conlemp()r,lry of media. di!i(:u!i!i \'1Clwccn Ihe two culcgoric!i pruclicc: inlcr;I(:lillI\\!... Date Added: 2009-04-22 03:20:17 |
| women_chapter6.pdf Path: NMSU >> CI >> 475 Fall, 2009 Description: ... Date Added: 2009-04-22 03:20:41 |
| VideoHomework2.pdf Path: Berkeley >> CS >> 301 Fall, 2008 Description: CS 301 (Barsky/Clancy) Fall 2008 Homework 2 One of the really important things you will do this semester in 301 is observe your own teaching through watching a video tape of your section. Below are the 6 steps that this multi-week assignment will h... Date Added: 2009-04-22 03:23:06 |
| 2AHS001sub.pdb1LTX.txt Path: UConn >> VKK >> 06001 Fall, 2009 Description: USING SAPE_WINDOW_SIZE=30 A total of 1 chains found A total of 4 chains found P1 has 1 and P2 has 4 chains Creating a cost matrix of 3 x 2448 Comparing [SUSAN/2AHS001sub-X] with [SUSAN/DataSet/1LTX-B] with SAPE - Eigen Distance = 2.832046 at window... Date Added: 2009-04-22 03:24:24 |
| amorthw.pdf Path: UConn >> MATH >> 105 Fall, 2009 Description: 6wlq TdqBwTT wqBwB wwwqT wcDz7 zDIwxj wqBwc 6Twc w6w wIzcDz7 D7TvXu slqX wss6 Tqww Tqww lwTIv xl7cx wqwwl wqwwl wqwwl w sllIc qz7c wD wwzwsz5ITBzTlwww#wi5zQFxezu... Date Added: 2009-04-22 03:24:41 |
| 2.pdf Path: Penn State >> STAT >> 318 Fall, 2008 Description: Stat318 Fall2003 Chapter 2: Random Variables (contd) Section 2.2: Continuous Random Variables In the first part of this chapter, we talked about Discrete Random Variables. The support was a finite set of positive integers {0,1,., n} or a countably i... Date Added: 2009-04-22 03:26:08 |
| Tracking.doc Path: Penn State >> HPA >> 332 Fall, 2009 Description: HPA 332 Monitoring Your Own Behavior Assignment Because the first step to changing undesirable patterns is to track them. Read the description of this exercise on pp. 129-131 of your text (Stop before the `lefthand column\' discussion on 130). This i... Date Added: 2009-04-22 03:29:50 |
| Ch4_trig.doc Path: S.F. State >> CHEM >> 353 Fall, 2009 Description: 27 Chapter 4: Trigonometry Plots Basic Trig Commands The trig commands are useful in plots and calculus. For this tutorial we will deal with the plots first, since sine plots are common for particle in a box problems. The wave functions yn that desc... Date Added: 2009-04-22 03:41:54 |
| resume.pdf Path: Penn State >> SOC >> 108 Spring, 2009 Description: SAMUEL CARABALLO OBJECTIVE 8313WATTSBURG RD. ERIE, PA 16509 814-882-0804 CARABALLOSAMUEL@AOL.COM A full time position in Mechanical Engineering that will allow me the opportunity to gain experience in, and to make contributions to, the research a... Date Added: 2009-04-22 03:46:00 |
| Lecture16.ppt Path: Oakland University >> CSE >> 30341 Fall, 2009 Description: Survey feedback I definately agree that we need more code in class. The idea of an operating system for a lot of newbie cse\'s is what they witness for mac, windows or linux. Very finite and tangible. With the openness of your lectures we get an imag... Date Added: 2009-04-22 03:46:32 |
| resume.doc Path: Penn State >> MBK >> 5004 Fall, 2009 Description: 910 Cricklewood Dr. Apt. 126 State College, PA 16803 Phone 412-916-8586 E-mail mbk5004@psu.edu Melanie Beth Kleinmann Education [ 2004-Present ] Business [ 1999-2004 ] General The Penn State University State College, PA Upper St. Clair High Sc... Date Added: 2009-04-22 03:49:48 |
| exam1_f07.pdf Path: Syracuse >> ECS >> 102 Fall, 2008 Description: Exam 1 ECS 102 Dr. Baruch Fall 2007 Name: No calculators. problem points score 1 3 2 8 3 2 4 10 5 6 6 6 7 6 8 9 9 11 10 6 11 6 12 14 13 4 14 4 15 5 Total 100 1 1. Which of the following could be variable names? Circle the syntactically correct name... Date Added: 2009-04-22 03:51:31 |
| ReadMe.txt Path: Syracuse >> CSE >> 681 Fall, 2008 Description: = MICROSOFT FOUNDATION CLASS LIBRARY : proto1 = AppWizard has created this proto1 application for you. This application not only demonstrates the basics of using the Microsoft Foundation classes but is also a starting point for writing your... Date Added: 2009-04-22 03:57:31 |
| hw4.pdf Path: Syracuse >> PHY >> 300 Fall, 2008 Description: Homework 4 Thursday 8 February - Due: Thursday 15 February 1. Use your lab4 final code to investigate the motion of waves in 1d with differing initial conditions. Specifically, replace the pulse boundary conditions with new ones in which the initial... Date Added: 2009-04-22 04:00:53 |
| syllabus.pdf Path: Syracuse >> PHY >> 731 Spring, 2008 Description: PHY 731 - Spring 2008 Thermodynamics and Statistical Mechanics Course Information Instructor: Gianfranco Vidali Rm. 221 Physics Building Phone: 315 443-9115 or 443-1801 (lab.) e-mail : gvidali@syr.edu Office hours: Thursdays: 2-4 pm and by appointmen... Date Added: 2009-04-22 04:01:43 |
| lecture6.ppt Path: Syracuse >> PHY >> 307 Fall, 2008 Description: Summary What have we learned ? Many physical systems are nonlinear (at least) two types of behavior periodic motion chaotic motion Simple example: logistic map xnew=axold(1-xold) (population dynamics) Two types of motion depending on a Close ... Date Added: 2009-04-22 04:01:51 |
| hw2.pdf Path: Wyoming >> CS >> 2150 Fall, 2009 Description: Cosc 2150 Due: February 2, 2009 Assignment 2 Work out the following arithmetic in binary. Convert each number to a 5 bit binary number and convert the answer back to Base10. Show all your work. Also state whether there was a carry and an overflow. ... Date Added: 2009-04-22 04:03:46 |
| 4-7_KimczakEtAl_IDProjectSuccessFactors.pdf Path: Syracuse >> IDE >> 830 Summer, 2008 Description: SUCCESS FACTORS >; views. \'The forus group interviews were ccrrrr prised of four to eight stakeholders in thv I I ) pror\'ss (s)7onsors, trainers, learners) a n d wct-c. led by an independent moderator tra1nt.d I I I conducting fc~cusgroup interviews... Date Added: 2009-04-22 04:04:27 |
| probleminstallbin.txt Path: Syracuse >> CIS >> 758 Fall, 2008 Description: Network library netwib - | KNOWN PROBLEMS | - This file describes known problems (incompatibilities, unsupported features, errors, etc.). If you seek help (... Date Added: 2009-04-22 04:04:54 |
| program-design.pdf Path: Syracuse >> CPS >> 196 Fall, 2008 Description: The Program-Design Process CPS 196 Spring 2009 There are four steps to the program-design process: 1. Specify the program requirements. Restate the problem. If you need additional information, find it and record it. If you\'re making any assumption... Date Added: 2009-04-22 04:05:25 |
| 10-Groups-4.pdf Path: Utah State >> PSY >> 6460 Fall, 2008 Description: II and III C. Parents ROLE and informed consent Interventions and Groups What are informed consent procedures with parents and students? What is the role/responsibilities between the psychologist and parent? What is proper ethical practice wh... Date Added: 2009-04-22 04:07:59 |
| resonance.pdf Path: Utah State >> PHYSICS >> 2110 Fall, 2009 Description: Notes on Resonance Simple Harmonic Oscillator A mass on an ideal spring with no friction and no external driving force Equation of motion: max = -kx Late time motion: x(t) = Asin( 0 t) OR x(t) = Acos( 0 t) OR x(t) = A( sin( 0t) + cos(0 t), where... Date Added: 2009-04-22 04:08:15 |
| Robert_Blaser_Actuator.ppt Path: Utah State >> ECE >> 5320 Spring, 2008 Description: Pneumatic Actuation Systems Robert Blaser Assignment #1 MechatronicsECE 5320 Outline Reference List To Explore Further Major Applications Introduction Components of a Pneumatic System Pneumatic System Basics NORGREN 92000/M Advantages/Disad... Date Added: 2009-04-22 04:09:29 |
| p150-nodder.pdf Path: Grand Valley State >> CS >> 623 Fall, 2008 Description: Evaluating the usability of an evolving collaborative product - changes in user type, tasks and evaluation methods over time. Chris Nodder, Gayna Williams, Deborah Microsoft Corporation One Microsoft Way Redmond, WA 98052 cnodder/gaynaw/debdu@microso... Date Added: 2009-04-22 04:11:36 |
| exam_f.pdf Path: Grand Valley State >> CIS >> 263 Fall, 2009 Description: is ! s ~` a$mc B ~ 6 #) ba\'6 ` ` % ! 0 f` 0` 6` b\'97y`Ay77\'0GC0oXT(T0 f 0 c & ~ e`B B B ` ~ Y 4B B B ` ~ 4 W e e 4 6 ` % `... Date Added: 2009-04-22 04:12:00 |
| midterm_s05.doc Path: Oklahoma State >> FIN >> 6660 Fall, 2008 Description: Midterm FIN 6660 Spring 2005 due by 5:00 pm March 7 (CBA104A) 1) In complete markets containing an underlying, a derivative written on the underlying and risk free borrowing or lending the absence of arbitrage opportunities implies a probability mea... Date Added: 2009-04-22 04:15:12 |
| followup5.doc Path: Oklahoma State >> AG >> 2112 Fall, 2008 Description: Lab 5 Follow up Answer the following questions CLEARLY and print them out to bring to lab. The help file will probably be useful for some of these questions. 1. What do you use to make formatting, layout, or appearance changes to every single slide i... Date Added: 2009-04-22 04:15:40 |
| CR-6602web.pdf Path: Oklahoma State >> DOCUMENT >> 995 Fall, 2009 Description: Oklahoma Cooperative Extension Service Current Report Roseanne Mayo Kuzmic Department of Horticulture and Landscape Architecture CR-6602 0902 Oklahoma Cooperative Extension Fact Sheets are also available on our website at: http:/osufacts.okstate.e... Date Added: 2009-04-22 04:16:10 |
| Announcements.doc Path: Minnesota >> EE >> 3161 Fall, 2008 Description: ANNOUNCEMENTS DATE POSTED 01/20/2009 02/04/2009 02/13/2009 ANNOUNCEMENT There is no discussion session this week. HW#1 (due 2/13/2009) posted on WebVista Solutions to HW#1 posted on WebVista ... Date Added: 2009-04-22 04:17:35 |
| ch17.ppt Path: Oklahoma State >> ACCTG >> 5513 Fall, 2009 Description: FRAUDEXAMINATION ALBRECHT,ALBRECHT,& ALBRECHT Fraud in E-Commerce Chapter17 LearningObjectives 1. 2. 3. Understand ecommerce fraud risk. Take measures to prevent fraud in e-commerce. Detect ebusiness fraud. DiscussInternetStatistics. YearstoRea... Date Added: 2009-04-22 04:18:21 |
| video.txt Path: Columbia >> CU >> 110195 Fall, 2009 Description: <!DOCTYPE HTML PUBLIC \"-/|ETF/DTD HTML 3.0/EN\" \"html.dtd.\"> <HTML> <HEAD> <TITLE>Video Compression</TITLE> </HEAD> <BODY BGCOLOR=\"#FFFFFF\"> <FONT SIZE=-1> <A HREF=\"./index.html\">Moment Home Page</A> <A HREF=\"moment.html\">Current Article Index</A>... Date Added: 2009-04-22 04:18:45 |
| Mexico.ppt Path: Minnesota >> ANTH >> 1095 Fall, 2009 Description: Understanding Global Cultures Mexico Cultural Metaphors \"Torn National Cultures\" Ch. 20 The Mexican Fiesta Ch. 21 The Russian Ballet Cultural Metaphors four generic types of cultures, plus \"Torn National Cultures\" one, such as Russia, that has... Date Added: 2009-04-22 04:18:52 |
| e123.txt Path: Minnesota >> E >> 123 Fall, 2009 Description: Title: Accumulated data of E123, Biodiversity I - Effects of plant biodiversity on population and ecosystem processes Principal investigators: David Tilman, Peter Reich, Johannes Knops, David Wedin LTER: Cedar Creek Natural His... Date Added: 2009-04-22 04:20:21 |
| WelfareEvaluation.pdf Path: Minnesota >> ECON >> 800102 Fall, 2009 Description: ECON 8001-2 INTRODUCTION WELFARE EVALUATION Instructor: Terry Hurley Up to this point, we have focused primarily on positive economic analysis. That is, we have worked to construct a framework that will be useful for interpreting why people make th... Date Added: 2009-04-22 04:21:15 |
| Mul-Div.pdf Path: U. Memphis >> EECE >> 4710 Fall, 2008 Description: MULTIPLY (unsigned) Paper and pencil example (unsigned): Multiplicand Multiplier Product 1000 1001 1000 0000 0000 1000 01001000 m bits x n bits = m+n bit product Binary makes it easy: 0 => place 0 ( 0 x multiplicand) 1 => place a copy ( 1 x mu... Date Added: 2009-04-22 04:21:40 |
| NSBA_prize_bridges_2001.pdf Path: U. Memphis >> CE >> 3121 Fall, 2009 Description: STEEL BRIDGE AL LIA NAL IO NC AT N Prize Bridge Competition E Eligibility All award-winning bridges are built of fabricated structural steel and are found within the United States (defined as the 50 states, the District of Columbia, and all U.S. t... Date Added: 2009-04-22 04:22:11 |
| 01-04.pdf Path: Minnesota >> CSCI >> 8271 Spring, 2008 Description: CSci 8271 Security and Privacy in Computing Lecture 1 Introduction Spring 2007 Yongdae Kim Introduction Class title Security and Privacy in Computing CSCI 8271 Third offering Experimental This is different from before! Seminar style May need... Date Added: 2009-04-22 04:24:58 |
| Lecture3_Gene_Regulate.ppt Path: Caltech >> APH >> 161 Fall, 2009 Description: Lecture 3: Statistical Mechanics of Gene Regulation (Small et al.) (Schulten et al.) Rob Phillips California Institute of Technology How Big is a Genome? The Great Polymer Languages A Reminder on DNA: One of the Great Polymer Languages The Meani... Date Added: 2009-04-22 04:28:28 |
| Lecture10_Diffusion.ppt Path: Caltech >> APH >> 161 Fall, 2009 Description: Lecture 10: Diffusive Dynamics Verkman et al. Rob Phillips California Institute of Technology How Big is a Genome? Part 2 Polymers as Random Walks Bustamante et al. Biological Dynamics is Where Its At! Diffusion Counts in Cells Verkman et al. ... Date Added: 2009-04-22 04:28:31 |
| lecture-12.pdf Path: Caltech >> CS >> 286 Fall, 2009 Description: Lecture 12 CS 286a Page 1 CS 286a Page 2 CS 286a Page 3 CS 286a Page 4 CS 286a Page 5 CS 286a Page 6 CS 286a Page 7 CS 286a Page 8 CS 286a Page 9 CS 286a Page 10 CS 286a Page 11 ... Date Added: 2009-04-22 04:30:51 |
| ce_8521_hw_03.pdf Path: Minnesota >> CE >> 8521 Fall, 2008 Description: Homework # 3 CE 8521: The Atmospheric Boundary Layer Answer briefly the following questions (from Stull\'s book): From Chapter 6: questions 4, 6, 7, 17, and 27. From Chapter 7: questions 6, 20 and 21. From Chapter 9: questions 5, 8, 20, 23, 28 and 29... Date Added: 2009-04-22 04:32:12 |
| 19-2007-03-28.ppt Path: Minnesota >> CSCI >> 5125 Fall, 2008 Description: Awareness CS 5125 Loren Terveen March 28, 2007 1 Topics Reflect on awareness systems What\'s the point? Privacy Consider different techniques, with different pros/cons What do you really need to be aware of anyway? . as exemplified by Ba... Date Added: 2009-04-22 04:32:45 |
| PLGRV.pdf Path: Minnesota >> ECON >> 8402 Fall, 2008 Description: ... Date Added: 2009-04-22 04:33:09 |
| P4_8sol.pdf Path: Auburn >> C >> 6710 Fall, 2009 Description: xB = 0.18 Cos@phi@tDD = 0.09 m yB = 0.18 Sin@phi@tDD = 0.155885 m vB1x = -0.18 Sin@phi@tDD phi @tD = -2.93835 ms vB1y = 0.18 Cos@phi@tDD phi @tD = 1.69646 ms 2 2 aB1x = -0.18 Cos@phi@tDD phi @tD - 0.18 Sin@phi@tDD phi @tD = -31.9775 ms^2 aB1y = -0.1... Date Added: 2009-04-22 04:36:34 |
| extra_notes_pages_drying08.pdf Path: Auburn >> MANS >> 486 Fall, 2009 Description: . ,.\"_.,~., ~,.,.~.~_.-, .-. o , Q~uA4T . w~,- ~(;,., rC 1 J I~_~ I( /,.; A(r Ir k: A.c. (\' II - lha. J-e be. (JJ. 0.-.~ c? . -. . ]!I (e y: : -_~_-F;- d,-T:-{-~-~-=~=_ -- _~r_s_ - \'- _~ _ - II tCQ~r1Q-=-~- -_-~-_~ ~-~_. ( P,:... Date Added: 2009-04-22 04:37:42 |
| status_11_7.ppt Path: Auburn >> COMP >> 7970 Fall, 2008 Description: Smart Media Network 1.0 week12 status Controller Team Server Team Device Team Controller / User Interfaces 1. Discover / present media devices on the SMN network LDAP 2. Provide an interface to the device controls Win32 / Borland C+ Builder 3. All... Date Added: 2009-04-22 04:38:45 |
| ch3b.doc Path: Iowa State >> ECON >> 301 Summer, 2008 Description: Chapter 4. Constructing a Model of consumer behavior Part B Copyright Kwan Choi, 2001 Indifference Curve A locus of consumption bundles along which utility level remains the same. Characteristics of Indifference Curves 1. Indifference curves are neg... Date Added: 2009-04-22 04:42:50 |
| UofM_FSKlab.pdf Path: Iowa State >> EE >> 423 Fall, 2009 Description: Experiment No. 2. Active Bandpass Filters; Frequency Shift Keying Communications By: Prof. Gabriel M. Rebeiz The University of Michigan EECS Dept. Ann Arbor, Michigan Purpose To measure the response of a bandpass filter for different Q, in time and ... Date Added: 2009-04-22 04:43:25 |
| radiative_transfer.pdf Path: Iowa State >> MT >> 301 Fall, 2009 Description: Meteorology 301 Chapter 4 Radiative Transfer Spring 2009 Meteorology 301 Radiative Transfer Primary method of energy exchange between the earth and rest of universe. Transfers occur between the atmosphere and earth and between layers of the atm... Date Added: 2009-04-22 04:44:07 |
| 120-EP229.pdf Path: Iowa State >> CE >> 486 Fall, 2009 Description: ... Date Added: 2009-04-22 04:44:50 |
| Student_Scores_sect_2.pdf Path: Iowa State >> ECON >> 101 Fall, 2008 Description: Cumulative Score as of February 14, 2009. Homeworks are 20% of score Scores are posted by the last five digits of your student ID Leading zeroes in your last 5 digits are dropped, so xxxx01234 shows up as 1234 Current Cumulative Distribution: Top1/4... Date Added: 2009-04-22 04:45:37 |
| lect03.pdf Path: Iowa State >> CPRE >> 545 Fall, 2009 Description: CprE 545: FAULT-TOLERANT SYSTEMS Lecture 3: Dependability Concepts CprE 545 Iowa State University Dependable System A system is dependable when it is trustworthy enough that reliance can be placed on the service that it delivers. For a system to b... Date Added: 2009-04-22 04:46:58 |
| Atomic-actions.ppt Path: Iowa State >> CPRE >> 545 Fall, 2009 Description: Atomic Actions CprE 545: Fault-Tolerant Systems (prepared by G. Sudha Anil Kumar) Iowa State University Atomic Actions Indivisibility Noninterference Strict sequencing All or nothing ACID Properties of Transactions Atomicity: either all o... Date Added: 2009-04-22 04:46:58 |
| Lecture8.pdf Path: Iowa State >> CPRE >> 581 Fall, 2009 Description: Instruction Flow Instruction flow must be PC continuous IM Target predictor Branch and Target Predictions Frontend organization, 1-bit BHT, 2-bit BHT, branch target buffer, return address stack Target prediction: What is the target PC Branch pr... Date Added: 2009-04-22 04:47:45 |
| lecture12.ppt Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: MPC555 On-chip I/O and Interrupt System Part II: MPC555 Internal I/O Modules, Hardware interconnects, Interrupt Controller, External Interrupt ESR 1 External Interrupt ESR Two major aspects: Exception processing: Interrupt and resume programming e... Date Added: 2009-04-22 04:48:19 |
| lecture5.ppt Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: Assembly Language Programming Programming Model Register Set Program data Code maintenance Program control Instruction Set Program code Code translation Computer Architecture CPU, Memory, I/O Instruction Execution Week 5 ISU, CprE 211, F... Date Added: 2009-04-22 04:48:30 |
| lab2.doc Path: Iowa State >> STAT >> 401 Fall, 2008 Description: Stat401 C Lab 2 Spring 2009 Objectives: Practice with the z distribution and the distribution of sample means; introduce fundamental ideas about testing hypotheses. Reading: Chapters 3 and 4 and section 7.1 in Howell (2007). Notice especially the... Date Added: 2009-04-22 04:49:52 |
| FinalExamFall2002_key.pdf Path: Iowa State >> ECON >> 330 Fall, 2008 Description: Economics 330 Fall 2002 Final Exam - Key Name _ Section: 1:00 2:00 Dist. Ed. Farm Business Management 1. When a farmer \"places a hedge\" for a commodity that he/she is selling, he/she does so by _. a. buying a futures contract on the Chicago Board ... Date Added: 2009-04-22 04:53:21 |
| bladder.txt Path: Iowa State >> STAT >> 565 Fall, 2008 Description: 1 0 0 1 1 1 2 1 0 1 1 3 3 4 0 1 2 1 4 7 0 1 1 1 5 10 0 1 5 1 6 6 1 1 4 ... Date Added: 2009-04-22 04:57:10 |
| 12_3_13.pdf Path: Iowa State >> M >> 166 Fall, 2009 Description: 12.3: #13 Find points of tangency. Ellipse 9x 2 + 4 y 2 = 1 y-intercept: (0, 6) x y2 + =1 4 9 2 (A) Equation of a tangent line for an ellipse (given in the book) at (x0, y0): xx0 yy 0 + = 1 (B) 4 9 Plugging the y-intercept (0, 6) into equation... Date Added: 2009-04-22 04:58:18 |
| final.pdf Path: Iowa State >> RU >> 373 Fall, 2009 Description: 8/17/99 Name: MATH 373 Section H6 Final Exam Explain your reasoning. Use the back of the paper if necessary. You will have until 9:00 pm to complete this exam. Problem Points Points Number Available Earned 1.) 25 2.) 15 3.) 25 4.) 15 5.) 10 6.) ... Date Added: 2009-04-22 04:58:33 |
| adrison_vid_200712_phd.pdf Path: Bowling Green >> ETD >> 11292007 Fall, 2009 Description: PERMISSION TO BORROW In presenting this dissertation as a partial fulfillment of the requirements for an advanced degree from Georgia State University, I agree that the Library of the University shall make it available for inspection and circulation ... Date Added: 2009-04-22 04:59:31 |
| 13-cancer.pdf Path: Iowa State >> STAT >> 480 Fall, 2008 Description: Exploring the cancer data Stat 480 Heike Hofmann Monday, February 23, 2009 1 Exploring the Cancer Data: Goals Practice data handling skills (done) Practice asking interesting questions Investigate spatial and temporal patterns: Time series plo... Date Added: 2009-04-22 05:01:56 |
| AN2373_PWM.pdf Path: Iowa State >> CPRE >> 211 Fall, 2009 Description: Application Note AN2373/D Rev. 0, 10/2002 Using the Pulse Width Modulation TPU Function (PWM) with the MPC500 Family Randy Dees TECD Applications This TPU Programming Note is intended to provide simple C interface routines to the pulse width modula... Date Added: 2009-04-22 05:04:26 |
| Week_10(AE-IS).ppt Path: The University of Akron >> ECON >> 600 Fall, 2009 Description: Foundation of Economic Analysis 3250:600 Instructor: Richard W. Stratton Meets: Thursday 5:20 7:50 pm CAS 134 Administration This Week\'s Assignments Farnham Chapter 12 (Aggregate Expenditures) Homework 07 (due next week) Next Week\'s Assign... Date Added: 2009-04-22 05:05:47 |
| JIT_FPGA_Compilation.pdf Path: Iowa State >> CPRE >> 583 Fall, 2009 Description: CprE583 Paper Presentation \"Dynamic FPGA Routing for JustInTime FPGA Compliation\" Written By: Roman Lysecky Fank Vahid Sheldon X.D. Tan Presented By: Bryan Infanger William Perreault December 6, 2005 JIT FPGA Compliation Introduction Just In Time... Date Added: 2009-04-22 05:06:20 |
| design-patterns3.pdf Path: Idaho State >> CS >> 263 Fall, 2009 Description: Presidency Election() Return unique-instance Examples to Accompany: Design Patterns Elements of Reusable Object-Oriented Software ATC Tower Flight 111 Flight 1011 Flight 112 Flight 747 Design Patterns - Elements of Reusable Object-Oriented Sof... Date Added: 2009-04-22 05:07:42 |
| exam1results.pdf Path: Iowa State >> STAT >> 101 Fall, 2008 Description: Results on Exam #1 for Sections C and D of Statistics 101 Fall 2008 Score on Exam (out of 70 points) 0 - 6.5 7 - 13.5 14 - 20.5 21 - 27.5 28 - 34.5 35 - 41.5 42 - 48.5 49 - 55.5 56 - 62.5 63 - 70 Number of Students 5 0 1 1 7 7 11 24 26 19 As you can... Date Added: 2009-04-22 05:09:02 |
| ConferenceMatchups.txt Path: Iowa State >> ECON >> 1956 Fall, 2009 Description: Conference Matchup Report Sorted by Conference, Matchup Score, Home Home field advantage = -4.59 C Column = Conference games B Column = Prediction is biased by assumptions Date C B Conf Levl Rank ( W- L) Visitor Conf Levl R... Date Added: 2009-04-22 05:09:16 |
| Homework_2_2.pdf Path: Idaho State >> MATH >> 465 Spring, 2008 Description: MATH 465-01: HOMEWORK PROBLEMS ON JANUARY 22, 2009 Exercises 1.6 on Page 31 1. What is the type of each of the following equations? (a) uxx uxy + 2uy + uyy 3uyx + 4u = 0. (b) 9uxx + 6uxy + uyy + ux = 0. [ Hint: In (a), assume that uyx = uxy and nd ... Date Added: 2009-04-22 05:09:20 |
| exercise.pdf Path: WVU >> MATH >> 573 Fall, 2008 Description: i q hy k n | k { ~UQ#0RP V V ` V 0up P T S H \"( \"(3 6 3 ( 1 \"( e s Q { vs { d 6 \'epI2Qs%u \'{ { ve { v u x u d ... Date Added: 2009-04-22 05:09:35 |
| JNHPresentation.ppt Path: WVU >> CPE >> 643 Fall, 2009 Description: AlgorithmBasedFaultTolerance forMatrixOperations Proposedby: KuangHuaHuang JacobA.Abraham ProblemDescription Achievingafaulttolerantmodelthatis algorithmbasedratherthanhardware based Existingtechniquesrequirehigh overheadcost ErrorMasking(har... Date Added: 2009-04-22 05:10:36 |
| Thinning.pdf Path: WVU >> WDSC >> 422 Fall, 2008 Description: What is Thinning? The most challenging logging chance faced by a harvesting system. The objectives of thinning are to: Remove small, poorly formed, diseased, or otherwise undesirable trees Improve the remaining stands Thinning vs. partial cuts WDSC ... Date Added: 2009-04-22 05:12:58 |
| LO_Ch02.pdf Path: WVU >> PSYC >> 101 Fall, 2008 Description: Learning Objectives for Chapter 2: The Research Enterprise in Psychology 1. Explain science\'s main assumption and describe the goals of the scientific enterprise in psychology. 2. Explain the relations between theory, hypotheses, and research. 3. Di... Date Added: 2009-04-22 05:13:40 |
| percteonlinewd.doc Path: WVU >> SPA >> 270 Fall, 2008 Description: Online Form (You need Microsoft Word to use this form. If the SPA 270 web site is not accessible, type the form using this format.) 270 Persuasive Speech Critical Thinking Exercise (CTE) NAME: LAB SECTION: DATE SUBMITTED: MIX E-MAIL: LAB INSTRUC... Date Added: 2009-04-22 05:14:12 |
| sol-01.pdf Path: Iowa State >> CS >> 342 Fall, 2009 Description: CS 342: Principles of Programming Languages Solution for Problem Set 1 Iowa State University Computer Science Department Sept 30, 2008 CS 342: Principles of Programming Languages 1 / 12 Problem 1 (20 points) Errors in a computer program can be cl... Date Added: 2009-04-22 05:19:45 |
| Test2Questions2008.doc Path: WVU >> G >> 231 Fall, 2009 Description: 1 Geology 331: Questions for Test 2, Fall 2008 All test questions will be taken from the following list, except that questions may be asked about diagrams or figures from assigned readings and class handouts. Biostratigraphy What are the three princ... Date Added: 2009-04-22 05:20:11 |
| excel-simple_data_series_edit.pdf Path: WVU >> CS >> 120 Fall, 2009 Description: Create a 2-D Linear graph where only Salary is the only data series and the years appear in the x-axis. Select table range (A3:B15). Select 2-D line graph. We need to remove year from the data series Right click on the graph and choose `Select Dat... Date Added: 2009-04-22 05:20:36 |
| math.doc Path: Iowa State >> MR >> 1207 Fall, 2009 Description: Des Moines Register 12-02-07 Allen: Ramp up education in math, science Benjamin Allen December 2, 2007 Of all the issues facing Iowans, none presents as compelling an impact on the state as the proficiency of our children in mathematics and science.... Date Added: 2009-04-22 05:20:58 |
| pset2-answer.pdf Path: Iowa State >> ECON >> 380 Fall, 2008 Description: Econ 380 Env. and Res. Econ. Answers to Problem Set #2 1. (1) Instructor: Dr. Jinhua Zhao If A starts to contribute first, her calculation is 50-2q=40, or qA=5. Individual B\' contribution level if A has not contributed is s 100-3q=40, or qB=20. But... Date Added: 2009-04-22 05:23:29 |
| FPGA.ppt Path: Iowa State >> EE >> 465 Fall, 2009 Description: FPGA Technology Overview Carl Lebsack * Some slides are from the Programmable Logic lecture slides by Dr. Morris Chang Whats an FPGA? FPGA Field Programmable Gate Array Logic Standard Logic Programmable Logic Devices Gate Arrays Cell-Based ICs ... Date Added: 2009-04-22 05:23:51 |
| b2b.pdf Path: UVA >> GBUS >> 885 Fall, 2008 Description: THE B2B OPPORTUNITY CREATING ADVANTAGE THROUGH E-MARKETPLACES OCTOBER 2000 The Boston Consulting Group is a general management consulting firm that is a global leader in business strategy. BCG has helped companies in every major industry and market ... Date Added: 2009-04-22 05:24:49 |
| 13-review-for-final.ppt Path: UVA >> CS >> 101 Fall, 2008 Description: TheStackClass FinalReview Fall2005 CS101 AaronBloomfield 1 Motivation SameasforVectors Wewantaneasywaytostoreelementsinaobjectwithouthaving toworryaboutmanipulatingarrays 2 PropertiesofourStackclass Itneedstohaveanarraytoholdthevalues T... Date Added: 2009-04-22 05:25:28 |
| GlennHGPS.pdf Path: UVA >> P >> 512 Fall, 2009 Description: MAPPING WALNUT CREEK PARK: An Exercise Utilizing the Trimble GPS Device as a Data Collection Tool for GIS Applications Glenn Heimgartner December 15, 2007 PLAN 512 Geographic Information Systems Professor David Phillips I. Purpose This project co... Date Added: 2009-04-22 05:25:32 |
| DeGeorgeJessica.pdf Path: UVA >> P >> 211 Fall, 2009 Description: Jessica DeGeorge Digital Visualization for Planners Overview Web Design 3 Table of Contents Image Processing 4 Poster Creawtion 5 3D Modeling 6 Image Blending 8 Thematic Mapping 10 Conclusion 12 Contact Information 12 PLAN211: Digital Visuali... Date Added: 2009-04-22 05:25:39 |
| lecture_22_spurious_regression.pdf Path: Iowa State >> ECON >> 674 Fall, 2008 Description: Lecture 22 Spurious and Cointegrating Regressions The time series regression theory and application developed in Econ 672 and 674 have assumed that the time series we are working with are stationary (or trend stationary). If we are working with diff... Date Added: 2009-04-22 05:25:57 |
| lab4-instructions-03.pdf Path: UVA >> ASTR >> 511 Fall, 2008 Description: 4 November, 2003 R. W. O\'Connell ASTR 511: PROCEDURES FOR LABORATORY IV I. BACKGROUND Group Work and Writeups: The class will work in groups on this project but with specific tasks broken out and assigned to individuals. The group should decide on ... Date Added: 2009-04-22 05:26:31 |
| test03.doc Path: UVA >> CS >> 432 Fall, 2008 Description: CS 432 Test 3 Fall 2007 Name _ EMAIL _ Caveat You have three hours to complete the test. I most likely will be unavailable via email when you take test. Any appropriate question I do answer will be posted on the class website. The test is open b... Date Added: 2009-04-22 05:27:13 |
| michopoulosMultiphysics.pdf Path: UVA >> CS >> 651 Fall, 2008 Description: Dynamic Data Driven Methodologies for Multiphysics System Modeling and Simulation J. Michopoulos1 , C. Farhat2 , E. Houstis3,4 , P. Tsompanopoulou4 , H. Zhang3 , and T. Gullaud2 Code 6390, Special Projects Group, U.S. Naval Research Laboratory, U.S.A... Date Added: 2009-04-22 05:27:45 |
| MACEPBrochure1.doc Path: Iowa State >> D >> 18895 Fall, 2009 Description: What is MACEP? The MACEP acronym is an abbreviation of Midcrest Area Cattle Evaluation Program. It began more than 25 years ago as a tool to help cow-calf producers learn how their cattle perform in the feedlot and on the rail. Representatives from c... Date Added: 2009-04-22 05:28:10 |
| srgs-8-30-05.pdf Path: Iowa State >> M >> 610 Spring, 2009 Description: Characterizations of Strongly Regular Graphs: matrix techniques and subconstituent algebras Sung Y. Song Iowa State University sysong@iastate.edu SRG(v, k, , ) All our graphs are proper (edge sets are not complete or empty), simple (no loops or mult... Date Added: 2009-04-22 05:29:51 |
| copd_breathretrain_ptjour.pdf Path: Maryville MO >> PT >> 316 Fall, 2009 Description: Perspective Evidence Underlying Breathing Retraining in People With Stable Chronic Obstructive Pulmonary Disease The efficacy of pursed-lip breathing (PLB) and diaphragmatic breathing (DB) in the rehabilitation of people with chronic obstructive pul... Date Added: 2009-04-22 05:30:31 |
| 6356-preview.pdf Path: Maryville MO >> COURSES >> 6356 Fall, 2009 Description: Study Guide Geometry First Half Unit by Carol Garrison, M.S. Cole Camp High School Cole Camp, Missouri Key Code: 6356 Center for Distance and Independent Study University Extension University of Missouri GEOMETRY First Half Unit Editor: James Ba... Date Added: 2009-04-22 05:30:46 |
| Exercise1_final_revised_again.doc Path: Maryville MO >> CECS >> 401 Fall, 2009 Description: SAP LAB EXERCISE 1 This is the first in a series of exercises that will take you through the entire supply chain transaction cycle of purchasing and paying for goods. You will be creating materials and vendors in your first exercise using your two... Date Added: 2009-04-22 05:31:07 |
| freyabstractW05.doc Path: Maryville MO >> SAS >> 410 Fall, 2009 Description: Use of Pedological and Morphological Characteristics to Assess Planar Borrowing at a Mandan Indian Village, North Dakota Crystal J. Frey Teaching Assistant, SEAS Abstract The Double Ditch State Historic Site is situated in a loess landscape east of ... Date Added: 2009-04-22 05:36:31 |
| F02Lab_7.doc Path: Clemson >> ME >> 221 Fall, 2009 Description: Flow Losses Objectives The objectives of this laboratory are to: 1. Introduce students to pressure driven flows and simple instrumentation, 2. Introduce the concept of a loss coefficient, and 3. And introduce students to uncertainty in experimental r... Date Added: 2009-04-22 05:36:42 |
| CmpE296P-Adv-OOAD-GreenSheet.doc Path: San Jose State >> CMPE >> 296 Fall, 2009 Description: COMPUTER ENGINEERING DEPARTMENT Course: CMPE 296P Course Title: Advanced Object-Oriented Analysis & Design Semester: Fall 2003 _ Instructor Information and Course Description Instructor: Dr. M.E. Fayad, Office Engr 283I, m.fayad@sjsu.edu, (408) 924... Date Added: 2009-04-22 05:38:50 |
| ch9prob.doc Path: San Jose State >> B >> 260 Fall, 2009 Description: Chapter 9 Problems (Solutions for 8, 11, 16, 53, 55, 57 are in the text) 1. Rott Irony manufactures four types of light fixtures. A fancy lamp yields a profit of $100, takes 10 hours of labor and 2 hours of machine time, and requires 10 square feet o... Date Added: 2009-04-22 05:40:25 |
| CHAPTER4.ppt Path: University of Hawaii - Hilo >> OCN >> 331 Fall, 2009 Description: Fisheries Management I. I. Renewable and Nonrenewable Resources Maximum Sustainable Yield A. Schaefer Model B. Beverton-Holt Model I. I. Resource Limited Population Practical and Theoretical Problems Renewable and Nonrenewable Resources I. I. Geolog... Date Added: 2009-04-22 05:41:15 |
| Lecture16_Classification.ppt Path: San Jose State >> CS >> 134 Spring, 2008 Description: Further AI: Intro to Decision Trees and Neural Networks Soon Tee Teoh CS 134 Classification Given information about the current state (player status, NPC status, environment data etc.) of the game, make a decision about NPC action (for example, to ... Date Added: 2009-04-22 05:42:12 |
| TTh_HW02_key.pdf Path: University of Hawaii - Hilo >> ASTRO >> 110 Fall, 2009 Description: Astronomy 110 Homework #02 Assigned: 01/23/2007 Due: 01/30/2007 Name: (Answer Key) Directions: Listed below are twenty (20) multiple-choice questions based on the material covered by the lectures this past week. Choose the correct response from thos... Date Added: 2009-04-22 05:42:35 |
| lecture.ppt Path: University of Hawaii - Hilo >> ICS >> 111 Fall, 2009 Description: Methods But what . is it good for?\" Engineer at the Advanced Computing Systems Divi... Date Added: 2009-04-22 05:42:56 |
| problem4.pdf Path: San Jose State >> CE >> 112 Fall, 2008 Description: ... Date Added: 2009-04-22 05:44:09 |
| bartunix.txt Path: University of Hawaii - Hilo >> ICS >> 313 Fall, 2009 Description: International Allegro CL Enterprise Edition 6.0 [Solaris] (Sep 8, 2004 10:49) Copyright (C) 1985-2000, Franz Inc., Berkeley, CA, USA. All Rights Reserved. This copy of Allegro CL is licensed to: David Chin, University of Hawaii ; Loading home ... Date Added: 2009-04-22 05:45:46 |
| astr110a_f08_lecture9.ppt Path: University of Hawaii - Hilo >> ASTR >> 110 Fall, 2008 Description: Today: ReviewNewtonsLaws Parallax Astr110A Fall 2008 Lecture 9: Sept. 22 Roy Gal Review:Gravity FproportionaltoM1xM2 Fproportionalto1/d2 ConstantofproportionalityisG QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture... Date Added: 2009-04-22 05:46:11 |
| lab4.doc Path: University of Hawaii - Hilo >> LING >> 631 Fall, 2009 Description: Linguistics431/631:Connectionistlanguagemodeling BenBergen Lab4:Morphology September21,2006 Thegoalofthislabisforyoutobeginbuildingaminiatureversionofthemodeldescribedinthe RummelhartandMcClelland(R&M)chapter. 1.Encodingandnetworkarchitecture Thebasi... Date Added: 2009-04-22 05:46:33 |
| 131B.announcement.pdf Path: San Jose State >> MATH >> 131 Fall, 2009 Description: San Jose State University Department of Mathematics Spring 2007 Math 131B: Introduction to Real Variables Instructor: Slobodan Simic e-mail: simic@math.sjsu.edu, phone: (408) 924-7485 Time and place: MW 12:00-13:15 in MH 233 Prerequisite: Math ... Date Added: 2009-04-22 05:46:59 |
| wheninrome_ihator.pdf Path: University of Hawaii - Hilo >> ENG >> 209 Spring, 2008 Description: When IN ROME - international business communication by Augustine Ihator source: http:/www.findarticles.com/p/articles/mi_m4422/is_1_17/ai_59228569/pg_1 and http:/www.findarticles.com/p/articles/mi_m4422/is_1_17/ai_59228569/pg_2 (originally published ... Date Added: 2009-04-22 05:48:05 |
| Willis.pdf Path: University of Hawaii - Hilo >> OCN >> 331 Fall, 2009 Description: January 2002: Nature\'s pharma sea 05/10/28 12:06 PM January 2002 Vol. 5, No. 1, pp. 3238. Focus: Automation Feature Article Table of Contents MDD Home Contact Us Sitemap Nature\'s pharma sea RANDALL C. WILLIS Through bioprospecting, new drugs ma... Date Added: 2009-04-22 05:48:43 |
| SandhillCranes.ppt Path: E. Kentucky >> BIO >> 586 Spring, 2008 Description: Sandhill Cranes (Grus canadensis) Alex Clevenger April 6, 2005 Description 37 inches long Wingspan of 80 inches Long, pointed bill Long thin neck Long, fluffy tertials droop down over tail and primaries Description Cont. Plumage often appea... Date Added: 2009-04-22 05:52:10 |
| ws468_muehlenhard_tr_fall05.pdf Path: E. Kentucky >> WS >> 468 Fall, 2009 Description: PSYC 468/WS 468 Psychology of Women Fall, 2005 Professor: Charlene Muehlenhard, Ph.D. (pronounced MULL\' en hard; the u is short) E-mail: charlene@ku.edu (mention Psych of Women in the subject line so I don\'t mistake it for spam) Phone number: (785) 8... Date Added: 2009-04-22 05:54:08 |
| sharing2.ppt Path: E. Kentucky >> MATH >> 105 Fall, 2009 Description: 3.4 The Lone-Chooser Method Preliminaries: One of the players is designated as the chooser, C. The other two players will be dividers D1 and D2. These assignments will be made randomly. The LoneChooser Method (for three players) Step 1.... Date Added: 2009-04-22 05:54:13 |
| spring04-assignment-3.doc Path: Ill. Chicago >> CS >> 201 Fall, 2008 Description: CS 201 - Data Structures and Discrete Mathematics I Spring 2004 Homework 3: Tree General Information Deadline: 11:59pm, April 28, 2004 Worth: 30 points The purpose of this homework is to practice Tree and traverse algorithm. You are required to use ... Date Added: 2009-04-22 05:55:13 |
| Hunter.txt Path: Ill. Chicago >> IDS >> 594 Fall, 2008 Description: David B. Hunter and Kenneth Lange A Tutorial on MM Algorithms. The American Statistician, Vol. 58 (2004), No. 1 (February), 30 - 37. Most problems in frequentist statistics involve optimiaztion of a function such as a likelihood or a ... Date Added: 2009-04-22 05:56:21 |
| lab1-s08.pdf Path: Ill. Chicago >> ECE >> 368 Fall, 2008 Description: 1 ECE 368Spring 2008, Instructor: Prof. Shantanu Dutt Lab 1 : Due Tue, Jan 31 (beginning of class) Goals The goals of this lab are: (1) To give an example of the divide-and-conquer (D&C) design methodsolving a design problem by breaking it into sma... Date Added: 2009-04-22 05:56:49 |
| 215problem.pdf Path: Ill. Chicago >> MATH >> 215 Fall, 2008 Description: Associativity of addition of natural numbers from Peano axioms We want to prove the following statement: a, b, c Z+ (a + b) + c = a + (b + c) (1) We shall use the Peano definition of the set of natural numbers i.e. defined as a set N with a distin... Date Added: 2009-04-22 05:57:37 |
| hw4_ans.pdf Path: Kentucky >> AST >> 192 Fall, 2008 Description: Astronomy 192 Section 001 Homework 4 Due Wednesday, February 9th Name _KEY_ Student Number (Last 4 digits only!) _0000_ The purpose of this assignment is to improve your understanding of force, mass, weight and acceleration. You will need to use dat... Date Added: 2009-04-22 05:58:29 |
| h12.pdf Path: Ill. Chicago >> MATH >> 165 Fall, 2008 Description: Math 165 Discussion (7.1-7.2) Tuesday 11/21/2006 Discussion is encouraged. For the quiz please read Examples (7.1.1), (7.1.2), (7.2.1), (7.2.2), (7.2.3) and do similar homework problems. 1. Describe the domain of the function and compute the indicat... Date Added: 2009-04-22 05:59:03 |
| HeadlinePoetry.pdf Path: Ill. Chicago >> P >> 382 Fall, 2009 Description: Headline Poetry. UIC Spiral Art Education, University of Illinois at Chicago. 2001 HEADLINE POETRY The Headline Poetry project was developed by Olivia Gude, Jason Bozonelos, and Lacy Foy in the Express Yourself! group of the 2001 Spiral Workshop at ... Date Added: 2009-04-22 05:59:41 |
| Lecture5.pdf Path: Pittsburgh >> IS >> 2610 Fall, 2009 Description: IS 2610: Data Structures Discuss HW 2 problems Binary Tree (continued) Introduction to Sorting Feb 9, 2004 Binary tree n A binary tree with N internal nodes has 2N links q N-1 to internal nodes n n Each internal node except root has a unique par... Date Added: 2009-04-22 06:04:02 |
| 112HamH5.pdf Path: Ill. Chicago >> CHEM >> 112 Fall, 2008 Description: Chemistry 112 - Spring 1997 Dr. Audrey Dell Hammerich Week of February 10 Chemical Reactions I NOTE: The first examination covering Chapters 1-3 and material introduced during lecture will be given on Wednesday, February 12. LAB ASSIGNMENT: Monday ... Date Added: 2009-04-22 06:04:10 |
| smith_Morals.pdf Path: CSU Sacramento >> ECON >> 101 Fall, 2009 Description: History of Economic Thought The Theory of Moral Sentiments. by Adam Smith Professor of Moral Philosophy in the University of Glasgow Excerpts Part I Of the Propriety of Action Consisting of Three Sections Section I Of the Sense of Propriety Chap. I ... Date Added: 2009-04-22 06:05:43 |
| week05.ppt Path: CSU Sacramento >> MIS >> 271 Fall, 2009 Description: Week 5 Monday, September 26 IT Planning Strategic IS Alignment R. Ching, Ph.D. MIS California State University, Sacramento 1 Planning Techniques Stages of Growth: Nolan\'s Stages Theory Rockart\'s Critical Success Factors (CSF) Porter\'s C... Date Added: 2009-04-22 06:05:48 |
| Hw5ExcelAccessOulook.doc Path: Pittsburgh >> CS >> 131 Spring, 2008 Description: Homework5 CS131 UniversityofPittsburghComputerScienceDepartment Excel, Advanced Access, and Outlook Name_ EmailAddress_ Score:_ Total=100points Thishomeworkincludesthefollowingactivities: 1. (35pts)a) UsingMicrosoftExcel,doExercises#4[CalculatingT... Date Added: 2009-04-22 06:10:51 |
| syllabus.pdf Path: CSU Sacramento >> PHY >> 150 Fall, 2009 Description: Quantum Mechanics (PHYS 150) Lecture: Sequoia 140 Tues, Thurs 10:30 11:45 Dr. William DeGraffenreid Office: Sequoia 434 Phone: (916) 278-5938 E-mail: degraff@csus.edu WWW: http:/www.csus.edu/indiv/D/DegraffenreidW Office Hours: Tues 11:00 12:00; We... Date Added: 2009-04-22 06:11:03 |
| L20_08s_dulai_1010AIDS.ppt Path: CSU Sacramento >> INTROBIO >> 1010 Fall, 2009 Description: Natural Selection The AIDS Story Basketball Player Magic Johnson 1991 at age 32 retires He has AIDS and possibly just a few years to live (8 - 10 years) Fast forward to 2007 - 16 years later and he is still alive How and why Medical advances an... Date Added: 2009-04-22 06:11:50 |
| CS2200Spring2005Test1ASOLUTION.doc Path: Georgia Tech >> CS >> 2200 Fall, 2008 Description: CS 2200 Spring2005 Test 1 Section A KEY KEY KEY KEY KEY KEY KEY KEY Name:_GT Number: gt_Sec:_A_ Please indicate your GT number in the grid below so we have some chance of being able to read it. g t 0 0 0 0 a 1 1 1 1 b 2 2 2 2 c 3 3 3 3 d 4 4 4 4 ... Date Added: 2009-04-22 06:12:41 |
| 2_879.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Paper #: 41 Title: NCSA\'s World Wide Web Server: Design and Performance (1) Problems This paper addresses the considerations in designing and implementing a heavily accessed WWW server (NCSA web server). The authors want to provide a load-balance... Date Added: 2009-04-22 06:13:47 |
| 2_879.txt Path: Georgia Tech >> CS >> 2003 Fall, 2009 Description: Paper #: 41 Title: NCSA\'s World Wide Web Server: Design and Performance (1) Problems This paper addresses the considerations in designing and implementing a heavily accessed WWW server (NCSA web server). The authors want to provide a load-balance... Date Added: 2009-04-22 06:13:47 |
| margarit.txt Path: Georgia Tech >> GTE >> 966 Fall, 2009 Description: #-PLEASE NOTE-# #This file is the author\'s own work and represents their interpretation of the # #song. You may only use this file for private study, scholarship, or research. # #--# # @SONG: Margaritaville @CHORDS: Mike A. Hall (mhall@moe.coe.uga.e... Date Added: 2009-04-22 06:14:00 |
| notes20a.ppt Path: UGA >> PHYS >> 1211 Fall, 2008 Description: SoundWaves Soundisalongitudinalwave Itrequiresamediumtoconveyit,e.g.agas, liquid,orsolid Inagas,theamplitudeofthesoundwaveis airpressureaseriesofslightlyenhanced (crest)andreduced(trough)pressure(orair density)regions Demo8.10.1 Thespeedthatthesepres... Date Added: 2009-04-22 06:16:09 |
| 195Fall02Test3Ans.doc Path: UGA >> EMT >> 668 Fall, 2009 Description: MAT 195 Fall Quarter 2002 TEST 3 - Answers NAME_ Show work and write clearly. For #1-12, find the derivative. Simplify your answer. 1 4 x +7 1. (7 pts.) y = 2 x4 7 x3 ANS: y = + . Use power rule. So, y = 4 + 0 = 2x 3 2 2 2 2 x x e +1 2. (7 pts.) y ... Date Added: 2009-04-22 06:16:45 |
| robust.pdf Path: UGA >> FORS >> 8390 Fall, 2008 Description: ROBUST DESIGN ! ! Combines in a single model the advantages of both open- and closed-population Advantages ! More robust estimation of parameters considered previously ! Estimation of certain parameters not otherwise estimable with either open or c... Date Added: 2009-04-22 06:17:16 |
| Chazan_IJCML1999.pdf Path: UGA >> EMAT >> 3500 Fall, 2008 Description: DANIEL CHAZAN ON TEACHERS\' MATHEMATICAL KNOWLEDGE AND STUDENT EXPLORATION: A PERSONAL STORY ABOUT TEACHING A TECHNOLOGICALLY SUPPORTED APPROACH TO SCHOOL ALGEBRA In the United States, examples of elementary school mathematics teaching (Ball, 1993b;... Date Added: 2009-04-22 06:17:38 |
| E_rod.pdf Path: Georgia Tech >> PHYSICS >> 2212 Fall, 2009 Description: VPython: Electric Field of a Uniformly Charged Rod The goal of this VPython problem is to write a program to calculate and display the electric field of a uniformly charged rod at locations not in the plane bisecting the rod (in other words, at locat... Date Added: 2009-04-22 06:17:50 |
| PostPRS.pdf Path: Georgia Tech >> PHYSICS >> 2212 Fall, 2009 Description: Which of these diagrams represent the same circuit? 1. a and b 2. a and c 3. b and c 4. a, b, and c 5. a, b, and d Which of these diagrams represent the same circuit? 1. a and b 2. a and c 3. b and c 4. a, b, and c 5. a, b, and d Which of these c... Date Added: 2009-04-22 06:18:37 |
| bridle.doc Path: UGA >> ENGL >> 4330 Fall, 2008 Description: The Fate of a Shrew: The Scold\'s Bridle ... Date Added: 2009-04-22 06:19:39 |
| geddis_demetris_l_200312_phd.pdf Path: Georgia Tech >> ETD >> 04082004 Fall, 2009 Description: ... Date Added: 2009-04-22 06:19:40 |
| HIST2702_source_analysis_4.doc Path: UGA >> HIST >> 2702 Fall, 2009 Description: Page 1 of 3 SOURCE ANALYSIS #4 Name: NOTE: Before starting, please re-read the syllabuss description of the purpose of these Source Analyses and the subsequent workshops. PAY CLOSE ATTENTION TO HOW POINTS WILL BE AWARDED FOR THIS AND SUBSEQUENT SO... Date Added: 2009-04-22 06:19:49 |
| aircraft1350.doc Path: Georgia Tech >> GTG >> 878 Fall, 2009 Description: AE1350 Design Project: Sanjeev Heda and Ryan Solomon A Revolution of Aviation: A Hydrogen Fueled Supersonic Aircraft 2 Summary We designed an aircraft that is able to go transcontinental and a cruising speed above the speed of sound. In the beginn... Date Added: 2009-04-22 06:20:26 |
| NESTINGMAP2006.pdf Path: Montana >> GEOG >> 411 Spring, 2008 Description: Rattlesnake Canyon, New Mexico Bird Project 2006 C12 C05 C14 C18 C15 T14 C13 T23 T04 C02 C16 T06 T05 T08 C09 T09 C17 Avg. A-Scale Noise Levels 48.8 decibels 50.3 decibels Avg. C-Scale Noise Levels 57.1 decibels 65.1 decibels # In Juniper 35 44... Date Added: 2009-04-22 06:20:40 |
| 4BG107.ppt Path: Montana >> MB >> 437 Fall, 2008 Description: Teach Evolution! Learn Science! Molecular Evolution MB437 and Advances in Molecular Evolution MB537 From the Big Bang to Bioinformatics From the primordial soup to Bioethics Fall, 2008, Tu/Th 11-12:15 Lewis Hall 110 Text: Fundamentals of Molecular E... Date Added: 2009-04-22 06:20:49 |
| 36109_Lab1_Impedance.pdf Path: Montana >> PHYSICS >> 361 Fall, 2009 Description: Laboratory Electronics II Phys 361 Spring 2009 Complex Impedance Purpose: Examine the frequency dependent behavior of the complex impedance in passive circuits made up of resisters, capacitors, and inductors. Equipment Required 1 Computer with Cap... Date Added: 2009-04-22 06:22:28 |
| EXAM_1_REVIEW.pdf Path: Montana >> SOC >> 101 Fall, 2009 Description: EXAM 1 REVIEW The format of the exam will be 20 multiple choice questions and 2 short answer questions. Focus on concepts, theorists, and theories. Dont just memorize lists or definitionsbe able to apply all concepts and theories. This review i... Date Added: 2009-04-22 06:23:09 |
| 4.3-MaxMin.pdf Path: Georgia Tech >> MATH >> 1501 Fall, 2008 Description: Math 1501: 4.3: Local Extreme Values and 4.4: Absolute Extreme Values Definition A function f is said to have: a local maximum at c if f (c) > f (x) for all x sufficiently close to c, a local minimum at c if f (c) < f (x) for all x sufficiently clos... Date Added: 2009-04-22 06:23:18 |
| MG.pdf Path: Montana >> M >> 581 Fall, 2009 Description: Multigrid Basics M581 Supplemental Notes December 5, 2005 Multigrid methods were developed to efficiently solve linear systems that arise from the discretization of diffusion equations. These methods rely on the fact there exist iterative methods, c... Date Added: 2009-04-22 06:23:38 |
| exam002.pdf Path: Montana >> M >> 182 Fall, 2009 Description: ... Date Added: 2009-04-22 06:24:03 |
| clock-driver-paper.pdf Path: Georgia Tech >> GTG >> 460 Fall, 2009 Description: Design Project Optimizing a Clock Driver Lan Sun David Friedman ECE 6430, Summer 2008 07/24/2008 Executive Summary The goal of this project was to create a circuit that is able to deliver a clock signal to four nodes within some performance speci... Date Added: 2009-04-22 06:24:38 |
| S07L15_MarketforSchoolQuality.pdf Path: UCSB >> ECON >> 120 Fall, 2008 Description: Todays Topics The market for public school quality Californias Academic Performance Index School District Choice Urban areas have many school districts Families choose a school district when they choose where to live What Do We See? Many districts ... Date Added: 2009-04-22 06:26:45 |
| L13_BidRentModeChoice.pdf Path: UCSB >> ECON >> 120 Fall, 2008 Description: Review Can simple model explain where rich and poor live within a city? Two forces Value of time in commuting->rich live closer Housing demand->rich live further Value of time proportional to wage Housing demand is also proportional Two forces offset... Date Added: 2009-04-22 06:27:15 |
| Exam_162_Topics_07.pdf Path: UCSB >> CHEM >> 162 Fall, 2009 Description: Chem 162/262 Exam Guide Winter 2007 (Kahn) The exam takes 50 minutes and is given on March 5th. The exam will test your knowledge and your understanding of the material that was covered in the lectures, tutorials, and in the required literature. Yo... Date Added: 2009-04-22 06:28:06 |
| Assignment_F8.pdf Path: UCSB >> CHEM >> 162 Fall, 2009 Description: Chem 162/262 (2008) Nuclear Receptors, Drug Metabolism, Prodrugs 1. Imagine that you are a doctor for an early-menopausal female patient who has been diagnosed with estrogen receptor positive breast cancer. The patient was first treated in the summer... Date Added: 2009-04-22 06:28:13 |
| experiment3.pdf Path: UCSB >> ECE >> 153 Fall, 2009 Description: $ % Analog Interfaces !\"# \" \" \" # % # \" % % * \' + Z:\\ClassDocs)\\DAC0800.pdf $ % ( % % # - # % \' () \" 01 % 2 \' 3! \" \" 45 # 6 \" \" ). 6 \" \" / # # \" + \" \' , \" ( % \'98 \' ( ( % \" STRB RDY& R... Date Added: 2009-04-22 06:28:17 |
| TaborekLongitudinalStability.pdf Path: N.C. State >> MAE >> 442 Spring, 2008 Description: ... Date Added: 2009-04-22 06:29:11 |
| Test3_f06.pdf Path: N.C. State >> ST >> 711 Fall, 2008 Description: Quiz 3, St 711, 2006 (Dickey) (1) I used the autoregressive order 1 structure, AR(1), in a REPEATED statement in PROC MIXED. From the REPEATED statement\'s RCORR option, a 4x4 autocorrelation matrix results, having 0.125 (=1/8) in the upper right corn... Date Added: 2009-04-22 06:32:35 |
| modelsim.pdf Path: UCSB >> ECE >> 156 Fall, 2009 Description: Tutorial for Using ModelSim (Linux) Updated 9/29/03 1. Open a terminal and edit your .cshrc file. You can find this file in your home directory. Add the following lines to it: set path = (/eci/mentor/modeltech/bin $path) setenv LM_LICENSE_FILE 1717@... Date Added: 2009-04-22 06:33:50 |
| Problem02.pdf Path: N.C. State >> NE >> 400 Spring, 2008 Description: A fuel rod has a volumetric heat generation rate given by r 2 z q(r , z ) = q01 + 2 cos R He where is a known positive constant. a) A common axial flux shape that is used in PWR safety analysis is the 1.55 chopped cosine, where the 1... Date Added: 2009-04-22 06:35:00 |
| vist-improved.pdf Path: UC Riverside >> CS >> 260 Fall, 2008 Description: On the Sequencing of Tree Structures for XML Indexing Haixun Wang IBM T. J. Watson Research Center haixun@us.ibm.com Xiaofeng Meng Renmin University of China xfmeng@ruc.edu.cn Abstract Sequence-based XML indexing aims at avoiding expensive join oper... Date Added: 2009-04-22 06:35:29 |
| DIS_P5.pdf Path: UC Riverside >> CHEM >> 110 Fall, 2009 Description: Chemistry 110A Lecturer Francisco Zaera Physical Chemistry Fall 2000 TA Stefan Wehner Discussion Problem Set #5 (M 10-30-00 and W 11-01-00) 5.1 Verify the Maxwell relations: T = V S p S V T V = p S S p S = p T V ... Date Added: 2009-04-22 06:35:45 |
| A2_Kiesling.pdf Path: UC Riverside >> ISMD >> 0731 Fall, 2009 Description: Partonic Interpretation of Diffraction at HERA Christian Kiesling, MPI Mnchen Introduction Experimental Methods General Features of Diffraction at HERA Partonic Structure from QCD Fits Tests of QCD Factorization Summary and Conclusions C. Kiesling, ... Date Added: 2009-04-22 06:35:50 |
| syllabus.pdf Path: USC >> CHEM >> 300 Fall, 2009 Description: Chemistry 300L Spring 2009 ANALYTICAL CHEMISTRY Instructors Prof. Thomas C. Flood Office: Stabler Hall (LJS) 250; Phone: (213) 740-7006; Email: flood@usc.edu Office Hours: Monday 4:00-5:00 and Wednesday 4:00-5:00, and by appointment Prof. Richard W.... Date Added: 2009-04-22 06:37:58 |
| lecture5.pdf Path: USC >> ENGR >> 582 Fall, 2009 Description: Web Technology for IE 26 September 2002 ISE 582: Web Technology for Industrial Engineering University of Southern California Department of Industrial and Systems Engineering Lecture 5 JAVA Cup 4: Problem Solving Handouts Lecture 5 slides READ W... Date Added: 2009-04-22 06:41:06 |
| lecture4.pdf Path: USC >> ENGR >> 582 Fall, 2009 Description: Information Technology for Industrial Engineers 20 September 2001 ISE 582: Information Technology for Industrial Engineers University of Southern California Department of Industrial and Systems Engineering Lecture 4 JAVA Cup 3 Handouts Lecture 4... Date Added: 2009-04-22 06:41:10 |
| Week01_PR_F04a_T1.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: TEAM #1 Period: 09/13/04 09/19/04 WEEKLY STATUS REPORT Team #1 Project Quality Management Information System Enhancement Week #1 Progress This is the first weekly report of the team 1. The project has just started. Project team started to study ex... Date Added: 2009-04-22 06:41:53 |
| OCD_LCO_F04a_T11.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Operational Concept Description (OCD) NSF DATABASE TEAM 11 TEAM MEMBER: PROJECT MANAGER: Muhammad Amer PROTOTYPE: Muhammad Zaki ARCHITECT: Salman Rafique PLAN: Jacob Everist REQUIREMENT: Ran Wang CONCEPT: Limei Wang OCD_LCO_F04_T11.doc Page i of 2... Date Added: 2009-04-22 06:42:06 |
| CMN_09_18_Fa07a_T04.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Client Meeting Notes - Vision Date: September 18th, 2007 Client Attendees: Prof. A Winsor Brown Dev Team Attendees: Ian Serlin, Rubaiz Singh Virk, Lloyd Matthews, Stephen Tratz Action Items o accept CSCI577team4 Google Group invitation so we can use... Date Added: 2009-04-22 06:42:40 |
| FRD_LCA_F06a_T16_V1.4.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Feasibility Rationale Description (FRD) USC CONIPMO Team No 16 Kumar Yalla Project Manager & Software Architect Gaurav Batra OCD Jenish Jariwala Prototyper Shivam Gupta Requirement Analyst Rashmi Shukla FRD Vinita Goyal Life Cycle Planner Dav... Date Added: 2009-04-22 06:43:41 |
| project1a.pdf Path: USC >> CSCI >> 460 Fall, 2008 Description: CSCI 460 Introduction to Artificial Intelligence Fall 2007 Project 1(a): Genetic Algorithm Due: October 4, 2007 1 Introduction Genetic algorithms are a particularly interesting due to them being inspired by evolutionary biology. This project gives... Date Added: 2009-04-22 06:44:32 |
| Session3.pdf Path: USC >> CSCI >> 585 Fall, 2008 Description: Session 3: Relational Data Model (CH-3) CSCI-585, Cyrus Shahabi Relational data model represents the database as a collection of tables, termed relations, each with a unique name (not to be confused with the relationships in ER model). A ... Date Added: 2009-04-22 06:45:05 |
| Session4.pdf Path: USC >> CSCI >> 585 Fall, 2008 Description: Session 4: EER: Extended (or Enhanced) ER Model (CH-2 and 3) CSCI-585 , Cyrus Shahabi Example ER for a real-world problem Generalization is the result of computing the union of two or more entity sets (or subclasses) to produce a higher-level entit... Date Added: 2009-04-22 06:45:09 |
| hw3.pdf Path: USC >> CSCI >> 561 Summer, 2008 Description: Homework 3 - Probabilities and Bayes Nets Problem 1 Of the entire population, 2% has a certain disease X. A test Y, which indicates whether or not a person has the disease, is not 100% accurate. If a person has the disease, there is a 6% chance that ... Date Added: 2009-04-22 06:45:25 |
| FRD_LCA_F05a_T05_V3.2.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Feasibility Rationale Description (FRD) Data Mining PubMed Results TEAM 5 TEAM MEMBERS PROJECT MANAGER: CONCEPT ENGINEER: REQUIREMENTS ANALYST: ARCHITECT: LIFE CYCLE PLANNER: PROTOTYPE DEVELOPER: IV V: Srikanth Ranganamyna Dinesh Siddhar... Date Added: 2009-04-22 06:47:03 |
| SID_IOC_S08b_T15_V4.2.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: Supporting Information Document (SID) Version 4.2 SUPPORTING INFORMATION DOCUMENT (SID) Proctor and Test Site Tracking System Team 15 Name Role Mingoo Kim Project Manager (mingoo.kim@usc.edu) Heeseo Chae Operational Concept Engineer (hchae@usc.edu... Date Added: 2009-04-22 06:47:27 |
| 577NonPrgrmg&PrsnlLrngTRLv1-Iv0.pdf Path: USC >> CSCI >> 577 Fall, 2009 Description: CS577 Non-Programming and Personal Learning Time Recording Log Instructions Use this log when there is no existing base process definition or one is not being used (only exception is software development: MUST use PSP). Base process definitions exist... Date Added: 2009-04-22 06:47:47 |
| TherapistsExperiencesRaceTherapyDyads.pdf Path: CSU Bakersfield >> BEHS >> 501 Winter, 2008 Description: Journal of Counseling Psychology 2003, Vol. 50, No. 4, 466 481 Copyright 2003 by the American Psychological Association, Inc. 0022-0167/03/$12.00 DOI: 10.1037/0022-0167.50.4.466 African American and European American Therapists\' Experiences of Add... Date Added: 2009-04-22 06:49:51 |
| MISSINGPAGES.pdf Path: UMKC >> BDS >> 545 Fall, 2008 Description: ... Date Added: 2009-04-22 06:50:49 |
| oxner.pdf Path: Nevada >> NRES >> 400 Fall, 2008 Description: Lethal Lakes: The Mitigation of Dissolved Gas Hazards in African Volcanic Lakes Andrew Oxner University of Nevada, Reno Second Annual Student World Water Forum November 17, 2005 1700 found mysteriously dead August 26, 1986, 1700 people suddenly per... Date Added: 2009-04-22 06:51:37 |
| 09Jul07.pdf Path: UF >> MCB >> 3020 Fall, 2008 Description: Post-transcriptional regulatory mechanisms -overview Controlling level of a protein via translational mechanisms (last lecture) Controlling level of protein via post-translational mechanisms (degradation) Controlling activity of enzyme via alloste... Date Added: 2009-04-22 06:53:19 |
| key11.pdf Path: UF >> STA >> 6329 Fall, 2008 Description: Assignment 11. 1. T h:14:3:7 (Proven in class). We can let V = P H P and P has full rank. Thus rank(AV A) = rank(AP H P A) = rank(P A)H P A) = rank(P A) = rank(A) = tr(A) 2. By T h:14:3:4 (proven in class), WQ nonsingular s.t. QH AQ = D = fdii g Si... Date Added: 2009-04-22 06:53:31 |
| AH.pdf Path: Michigan State University >> READ >> 1973 Fall, 2009 Description: ... Date Added: 2009-04-22 06:54:15 |
| lecture4_replication_C3.pdf Path: UF >> PCB >> 4522 Spring, 2008 Description: Molecular Genetics PCB4522 Spring 2004 Lecture 4-Replication-part C Dr. Eva Czarnecka-Verner Course web page: http:/PCB4522.IFAS.UFL.EDU -Or go to Microbiology & Cell Science home page and look under course material. 174 phage Genes VII, chapter 12 ... Date Added: 2009-04-22 06:54:40 |
| hw2_sols.pdf Path: UF >> PHY >> 6346 Fall, 2008 Description: Physics 6346, Electromagnetic Theory I Fall 2000 Homework 2 Solutions 1. Potential for the hydrogen atom. This is essentially Jackson 1.5 done in reverse. Start with the time averaged electron charge density (r) = -q 3 -r e , 8 (1) and a point charg... Date Added: 2009-04-22 06:54:56 |
| Quiz4.pdf Path: Michigan State University >> ME >> 416 Fall, 2008 Description: Fall 2008 ME 416 Computer Assisted Design of Thermal Systems Quiz #4 Closed Book, Closed Notes Hot exhaust gases enter a cross flow heat exchanger at 300C and leave at 100C and is used to heat pressurized water at 1 kg/s from 35C to 125C. Given the ... Date Added: 2009-04-22 06:55:35 |
| EML5215_Exam2.pdf Path: UF >> EML >> 5215 Fall, 2008 Description: Name: _ ANALYTICAL DYNAMICS EML 5215 EXAM 2 General instructions: For the in-class portion of this exam, one page of notes (front and back) is permitted. In contrast, the take-home portion is open book and open notes. All work on this exam should be... Date Added: 2009-04-22 06:56:33 |
| AT741_hw3.pdf Path: Colorado State >> AT >> 741 Fall, 2004 Description: AT 741 Overview of Assignment Tentative Due Date: Thursday, April 24th Homework 3 Spring 2008 Your task for this homework will be to complete a dual-Doppler synthesis of a convective system and describe the resulting kinematic and microphysical s... Date Added: 2009-04-22 06:57:49 |
| answers_test1_2008.pdf Path: Texas A&M >> P >> 208 Fall, 2009 Description: c-f fl-I (I I 1 0 - I 9/ (_) 0 (1 T ch I + I ... Date Added: 2009-04-22 06:59:12 |
| ex2asp04.pdf Path: Texas A&M >> STAT >> 302 Fall, 2008 Description: STAT303 Secs 508510 Spring 2004 Exam #2 Form A Instructor: Julie Hagen Carroll 1. Don\'t EVEN open this until you are told to do so. 2. There are 20 multiple-choice questions on this exam, each worth 5 points. There is partial credit. Please mark your... Date Added: 2009-04-22 06:59:20 |
| Final_Exam_Statistics_S2005.pdf Path: UNC >> ECON >> 165 Spring, 2009 Description: Summary Statistics for Score Count = 25 Average = 55.4284 Median = 54.29 Variance = 141.481 Standard deviation = 11.8946 Minimum = 34.29 Maximum = 85.71 Range = 51.42 Lower quartile = 48.57 Upper quartile = 60.0 Interquartile range = 11.43 Stnd. skew... Date Added: 2009-04-22 07:01:25 |
| 12B-ODCase-Yablonbski\'96.pdf Path: UNC >> BIOCHEM >> 104 Fall, 2009 Description: THE JOURNAL OF BIOLOGICAL CHEMISTRY 1996 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 271, No. 18, Issue of May 3, pp. 10704 10708, 1996 Printed in U.S.A. Intrinsic Activity and Stability of Bifunctional Human UMP Synt... Date Added: 2009-04-22 07:02:26 |
| 12A-ODCase-Porter\'00.pdf Path: UNC >> BIOCHEM >> 104 Fall, 2009 Description: 11788 Biochemistry 2000, 39, 11788-11800 Yeast Orotidine-5-Phosphate Decarboxylase: Steady-State and Pre-Steady-State Analysis of the Kinetic Mechanism of Substrate Decarboxylation David J. T. Porter* and Steven A. Short Glaxo Wellcome, 5 Moore Dri... Date Added: 2009-04-22 07:02:26 |
| Schedule+of+Fees+08-09+FINAL.pdf Path: UNC >> READ >> 4925833 Fall, 2009 Description: Schedule of Fees July 1, 2008 The Town Manager shall have the authority to set any fee not otherwise listed and shall have authority to make any interpretations of any fee listed on this schedule. Administration, Finance, and All Departments Agenda ... Date Added: 2009-04-22 07:03:11 |
| E3.23.pdf Path: UNC >> CS >> 060222 Fall, 2009 Description: ... Date Added: 2009-04-22 07:06:36 |
| Ford.pdf Path: UNC >> ANTH >> 226 Fall, 2008 Description: Kintigh: Tools for Quantitative Archaeology Distance 88 FORD: Plot a Ford (Battleship Curve) Diagram This program reads a file of percents of types (columns) by provenience (rows) and plots a publishable quality battleship curve diagram (made famou... Date Added: 2009-04-22 07:06:40 |
| Syllabus.pdf Path: UNC >> COMP >> 120 Fall, 2008 Description: Comp 120 Syllabus Spring Semester 2005 Textbook: Schedule: 1. (1/13) 2. (1/18) 3. (1/20) 4. (1/25) 5. (1/27) 6. (2/1) 7. (2/3) 8. (2/8) 9. (2/10) 10. (2/15) 11. (2/17) 12. (2/22) 13. (2/24) 14. (3/1) 15. (3/3) 16. (3/8) 17. (3/10) 18. (3/22) 19. (3/2... Date Added: 2009-04-22 07:08:17 |
| 253-265.pdf Path: UNC >> RELI >> 179 Spring, 2006 Description: ... Date Added: 2009-04-22 07:08:57 |
| EEL4310-Fall06-HW3-SOL.pdf Path: UF >> EEL >> 4310 Fall, 2009 Description: Problem 1. The layout of a NMOS transistor is shown below. The process parameters are: (a) Compute Cgs, Cgd, and Cgb in the cutoff region (Cgs = 1.0 fF) LM := 1um L := LM 2 LD W := 3um eox := 3.9 8.854 10 Cox := eox tox 7 F 14 F L = 0.8um cm Cox... Date Added: 2009-04-22 07:09:47 |
| 10-5questions.pdf Path: Texas A&M >> HORT >> 201 Fall, 2008 Description: QUESTIONS Exercise 10-5. Response to Fertilizer Rates 1) What fertilizer rate produced the best growth and quality? 2) What were the symptoms of the plants to the low fertilizer rates? 3) What were the symptoms of the plants to the high fertilizer ... Date Added: 2009-04-22 07:10:00 |
| PracticeExam3.pdf Path: Washington >> PASSR >> 209 Fall, 2009 Description: Dr. Michael Passer Psych 209, U. of Washington CAUTIONS ABOUT THE PRACTICE EXAM DEAR STUDENT: This practice tests consists of questions from past exams. By taking this practice test, you should gain an idea of whether you understand the course mate... Date Added: 2009-04-22 07:10:47 |
| quiz10.pdf Path: The University of Akron >> MATH >> 208 Fall, 2009 Description: Math 3450:208 Discrete Math Quiz November 6, 2007 1) How many 5-digit zip codes use only even digits? 2) How 5-letter words start with a,b or c and end with x,y, or z? 1 ... Date Added: 2009-04-22 07:11:53 |
| ANSI-3999.pdf Path: Oklahoma State >> DOCUMENT >> 1933 Fall, 2009 Description: Oklahoma Cooperative Extension Service ANSI-3999 Livestock Disease: Cause and Control Joe G. Berry Extension Poultry Specialist The livestock industry is extremely important to the economy of Oklahoma and includes not only commercial producers of ... Date Added: 2009-04-22 07:12:30 |
| exam3a.pdf Path: Kentucky >> MA >> 109 Fall, 2008 Description: MA 109 - College Algebra THIRD MIDTERM FALL 2007 11/14/2007 Name: Sec.: Do not remove this answer page - you will turn in the entire exam. You have two hours to do this exam. No books or notes may be used. You may use a graphing calculator during... Date Added: 2009-04-22 07:12:33 |
| ResumeCover.pdf Path: UConn >> SAB >> 03002 Fall, 2009 Description: Resume Experience Summary Personal Details Saptarshi has over 2 years 8 months of experience in E-Business and Web Development. His experience includes Website Designing, Database driven Internet applications development, and custom software devel... Date Added: 2009-04-22 07:12:39 |
| i-evaluate-class-s03.pdf Path: UVA >> CS >> 494 Fall, 2008 Description: CS 494 Object-Oriented Analysis & Design Evaluating Class Diagrams Topics include: Cohesion, Coupling Law of Demeter (handout) Generalization and specialization Generalization vs. aggregation Other aggregation issues Cohesion How diverse are ... Date Added: 2009-04-22 07:14:15 |
| Richards_et_al_2002.pdf Path: UVA >> ASTR >> 553 Fall, 2008 Description: The Astronomical Journal, 123:29452975, 2002 June # 2002. The American Astronomical Society. All rights reserved. Printed in U.S.A. SPECTROSCOPIC TARGET SELECTION IN THE SLOAN DIGITAL SKY SURVEY: THE QUASAR SAMPLE Gordon T. Richards,1 Xiaohui Fan,2 ... Date Added: 2009-04-22 07:15:36 |
| radix_worksheet_f05_ans.pdf Path: UVA >> CS >> 216 Fall, 2008 Description: CS 216 Fall 2005 Lab 3 - Radix Conversion Worksheet Convert: 1) 0x 4E23 into Octal (47043)8 2) 36210 into radix 7 (1025)7 3) 1100101101102 into Decimal (3254)10 4) 2BG19 into Decimal (947)10 5) Given the following positive binary integer in ... Date Added: 2009-04-22 07:16:15 |
| Mid_Ex_I_Sp2007.pdf Path: University of Illinois, Urbana Champaign >> ECON >> 503 Fall, 2008 Description: Econ 503 Midterm Exam I Spring 2007 1. Consider the following 3 sector single period economy. Household Sector: There is a continuum of measure 1 of households uniformly distributed on the [0,1] interval. Each household is endowed with 1 unit of ti... Date Added: 2009-04-22 07:18:06 |
| CourseScheduleWinter09.pdf Path: Cal Poly Pomona >> PHY >> 133 Fall, 2009 Description: Rough Course Schedule Winter 2009 Date 1/6 1/8 1/13 1/15 1/20 1/22 1/27 Topic Introduction, Electric Forces and Fields Electric Forces and Fields Electric Forces and Fields Gauss\'s Law Gauss\'s Law Electric Potentials First Exam Chapters 26,27,28 (Ele... Date Added: 2009-04-22 07:19:03 |
| appliances.pdf Path: Cal Poly Pomona >> SCI >> 210 Fall, 2009 Description: Electrical Household Appliances Lesson 6 Appliance Physics, Tasks, Power, and Energy Summer 2004 Cal Poly Pomona Objectives: (i) Investigate the physical principles involved in the operation of common electrical household appliances. (ii) Identify ... Date Added: 2009-04-22 07:19:08 |
| 420hwk02.pdf Path: Cal Poly Pomona >> WEB >> 420 Fall, 2009 Description: MAT 420-01 Differential Geometry Homework # 2 Assigned: January 31, 2008 Due: 1. Prove the following concerning directional derivatives: (a) If v Tp (M ), then v[f g] = v[f ]g + f v[g]. (c) If x(u, v) = x1 , x2 , x3 , then 3 (b) If v = v 1 , v 2 ,... Date Added: 2009-04-22 07:20:19 |
| Lecture17.pdf Path: University of Illinois, Urbana Champaign >> ECE >> 511 Fall, 2008 Description: Lecture 17 Compiler-Architecture Interaction: EPIC Architecture Outline Basic Compiler Structure Very Long Instruction Word Architectures Explicitly Parallel Instruction Computing W. W. Hwu and S. J. Patel, 2002 ECE 412, University of Illinois ... Date Added: 2009-04-22 07:20:40 |
| PR2.pdf Path: Pittsburgh >> ENGR >> 0715 Fall, 2008 Description: ENGR 0715: Engineering Applications for Society University of Pittsburgh TEAM 5 Progress Report #2 Team Meeting Date: January 22, 2009 Meeting Roles Primary Facilitator Secondary Facilitator Scribe Timekeeper Team Members: Shirley Ma (xsm1@pitt.... Date Added: 2009-04-22 07:22:37 |
| ps4solutions.pdf Path: Berkeley >> NE >> 120 Fall, 2009 Description: Department of Nuclear Engineering University of California, Berkeley NE120, Fall 2008, Prof. Wirth 1. Problem set 4 Due October 8, 2008 A diffusion couple is formed between pure copper and pure nickel. After heating the couple to 1000C for 500 hours... Date Added: 2009-04-22 07:23:24 |
| math1272Spring06_test3.pdf Path: Minnesota >> MATH >> 1272 Fall, 2008 Description: MATH 1272 CALCULUS II LEC 040 Spring 2006 Test 3 April 6, 2006 Name: Student I.D.: There are a total of 100 points on this exam. There will be partial credit awarded but it is important that you show your work on each problem. Answers unsupported b... Date Added: 2009-04-22 07:25:19 |
| 7270-wk4-p2p-3.ppt Path: Georgia Tech >> CS >> 7270 Fall, 2008 Description: CS 7270 Networked Applications Analyzing and Improving BitTorrent\" by A. Bharambe et al. Based on a 2006 paper Simulationbased... Date Added: 2009-04-22 07:25:58 |
| entomophagous_insects.pdf Path: Minnesota >> ENT >> 3005 Fall, 2008 Description: Insects as prey Predator avoidance (3) camouflage startle aposematism Predator Defense Inchworm caterpillar, J. Hahn Inchworm caterpillar, J. Hahn Walking stick, J. Hahn Katydid, J. Hahn Catocala cara, the darling underwing, J. Hahn Catocala ca... Date Added: 2009-04-22 07:26:54 |
| 1_758.txt Path: Georgia Tech >> CS >> 8803 Fall, 2008 Description: Mercator: A Scalable, Extensible Web Crawler Discussion: This paper gives a good overview of the Mercator Architecture. It provides good descriptions of the extensiblity points and the data structures used to make it a scalable architecture. Th... Date Added: 2009-04-22 07:28:18 |
| 3502_lecture_04.pdf Path: Minnesota >> CHEM >> 3502 Fall, 2008 Description: Chem 3502/4502 Physical Chemistry II (Quantum Mechanics) Spring Semester 2006 Christopher J. Cramer Lecture 4, January 25, 2006 3 Credits Solved Homework If an electron has a de Broglie wavelength of 1 (0.1 nm), then we can compute its momentum a... Date Added: 2009-04-22 07:29:42 |
| Pb_barrelfield.pdf Path: UCSC >> BIO >> 134 Fall, 2009 Description: Neonatal lead exposure impairs development of rodent barrel field cortex Mary Ann Wilson*, Michael V. Johnston*, Gary W. Goldstein*, and Mary E. Blue* *Kennedy Krieger Institute and Departments of Neurology, Pediatrics, and Environmental Health Scien... Date Added: 2009-04-22 07:30:03 |
| T0462.t2k.str-logo.pdf Path: UCSC >> T >> 0462 Fall, 2009 Description: T0462.t2k STR 6 5 4 3 2 1 1 10 20 30 40 G 6 5 4 3 2 1 T Z A Z E Z H T T Z E Z T S A 51 60 70 80 90 Z T 6 5 4 3 2 1 Z A Z H T Z S T H 101 110 120 130 140 T 6 5 4 3 2 1 Z T S Z T T Z S G T S 151 HP Q K 1... Date Added: 2009-04-22 07:30:40 |
| qumaxmin.pdf Path: Illinois State >> MATH >> 119 Spring, 2009 Description: Quadratic worksheet Maximums and minimums NAME: We will investigate quadratic relationships whose graphs have maximum or minimum y values. They are called local or relative maximums or minimums because, compared to other nearby points, they have th... Date Added: 2009-04-22 07:31:31 |
| transcript.doc Path: Penn State >> GRH >> 143 Fall, 2009 Description: ADVISING UNDERGRADUATE TRANSCRIPT HIGH SCHOOL: DATE OF ADMISSION: -FALL SEMESTER 2003 College: Campus: Course ART ENGL SOC PSY MATH ENGL CMPSC PSY MATH KINES BIOL PSY M I S 020 015 001 002 004 202B 100 021 217 ADVANCED STANDING INTRO DRAWING RHETORIC... Date Added: 2009-04-22 07:33:23 |
| assistive.doc Path: U. Houston >> CUIN >> 6345 Fall, 2008 Description: Texas and Assistive Technology Individuals with Disabilities Education Act (IDEA) defines an assistive technology as any item, piece of equipment, or product system, whether acquired commercially off the shelf, modified, or customized, that is used t... Date Added: 2009-04-22 07:33:59 |
| pop007filla.pdf Path: U. Houston >> M >> 1310 Fall, 2009 Description: Section 23966(8:30-10) Assignment 007 Grading ID Form A Section 23950 (11:30-1) 1. Find the domain: f ( x ) = 2x x -2 A. C. (- ,-2 ) (- 2 , ) (- ,-1) (1, ) B. (- ,1) (1, ) D. (- ,2 ) (2 , ) 2. Find the domain: f ( x ) = x 2 - 6 A. C... Date Added: 2009-04-22 07:34:04 |
| lesson23notesforclasspartfilla.pdf Path: U. Houston >> M >> 1314 Fall, 2009 Description: M1314 lesson 23 1 Math 1314 Lesson 23 Partial Derivatives When we are asked to find the derivative of a function of a single variable, f ( x ), we know exactly what to do. However, when we have a function of two variables, there is some ambiguity.... Date Added: 2009-04-22 07:34:06 |
| grades1.doc Path: U. Houston >> MCELES >> 3111 Fall, 2009 Description: Lakewood Elementary School 1000 E. Cypresswood, Cypress, Texas 77429 Phone: 281-555-1000 Fax: 281-555-1100 Dear Mr. and Mrs. Bradshaw, This letter is to inform you about your childs progress in Science. Dan is currently earning a/an A in Science. Tha... Date Added: 2009-04-22 07:34:41 |
| Project4.pdf Path: U. Houston >> CS >> 1408 Fall, 2009 Description: CS 1408 (Intro. to Computer Science with VB .NET) FALL SEMESTER 2008 Project #4 The game of Nim is a very popular game. There are several versions of Nim in simulation using computers. There are text-based as well as graphic-based computer games. We ... Date Added: 2009-04-22 07:34:55 |
| FinalExamAnswers2005.pdf Path: Penn State >> WFS >> 560 Fall, 2009 Description: Final Exam WFS 560 Fall 2005 1. The best model had weekly survival vary over the 13 weeks and differed between juveniles (1.5 yrs old) and adults (2.5+ yrs old), but did not differ between study areas or among years. Estimates of Derived Parameters ... Date Added: 2009-04-22 07:35:14 |
| 1100_Ex3_Circuits_Fall2002.doc Path: U. Houston >> ECE >> 1100 Fall, 2008 Description: ECE 1100 Fall 2002 Exam 3 Circuit Shattuck Section Exam 3 Date: December 9, 2002 This is the circuit that will appear on Exam 3. + + 29[V] iQ 7[k] 2[k] - 6[mA] vX 3[k] ... Date Added: 2009-04-22 07:35:29 |
| TechRpt2.pdf Path: Penn State >> ABC >> 164 Fall, 2009 Description: BUILDING AND PLANT ENERGY ANALYSIS REPORT Alicia Carbin Mechanical Option Longwood University\'s New Science Building in Farmville, VA Technical Assignment #2 10-27-04 TABLE OF CONTENTS . 1.0 Executive Summary..1 2.0 LEED Green Building Certificat... Date Added: 2009-04-22 07:37:50 |
| Thesis5_Pivtoraiko.doc Path: Portland >> CLASS >> 479 Fall, 2009 Description: Foreword.2 The Computer.3 Image Acquisition.4 Basic Image Manipulation.6 Resizing/Rotation.6 Color Space Conversion.7 Image Analysis..9 Thresholding.9 Edge Detection..10 Hough Transform.11 Color Segmentation..12 Structural Analysis.14 Contour Process... Date Added: 2009-04-22 07:38:10 |
| Class2.ppt Path: Portland >> BA >> 530 Fall, 2009 Description: Strategy Concepts John A. Hengeveld SCHOOLOFBUSINESSADMINISTRATION BA530JohnA.HengeveldWinter2003 Agenda for Today Term Project Discussion (0:40) How Functions impact competition Strategy Concepts Grant Chapter 5 (1:30) HE Butt Case (1:00+) S... Date Added: 2009-04-22 07:38:23 |
| proj2.doc Path: Portland >> CS >> 333 Winter, 2008 Description: CS-333 Operating Systems Programming Project 2: Threads and Interprocess Communication Due Date: Monday, October 17, 2005, start of class Duration: Two Weeks Overview and Goal In this project you will learn about threads and gain familiarity writin... Date Added: 2009-04-22 07:38:43 |
| Week03a.pdf Path: Portland >> GEOG >> 493 Fall, 2008 Description: Photogrammetry: DTM Extraction photo parameters Flight parameters GCPs Image match... Date Added: 2009-04-22 07:39:09 |
| Day19_2up.pdf Path: Caltech >> CS >> 184 Fall, 2009 Description: CS184b: Computer Architecture (Abstractions and Optimizations) Day 19: May 20, 2003 SCORE Caltech CS184 Spring2003 - DeHon 1 Previously Interfacing compute blocks with Processors Reconfigurable, specialized Single thread, single-cycle operati... Date Added: 2009-04-22 07:44:29 |
| G020218-00.ppt Path: Caltech >> G >> 020218 Fall, 2009 Description: All hands meeting topics Modification of the reporting structure Broadening staff participation in commissioning activities Moving in to the new building April 25, 2002 LIGO-G020218-00-L Mark Coles 1 Motivation We face lots of challenges in t... Date Added: 2009-04-22 07:45:49 |
| Choi_jm_2007.pdf Path: Caltech >> ETD >> 02142007 Fall, 2009 Description: Design, Fabrication, and Characterization of Semiconductor Transverse Bragg Resonance Lasers Thesis by John M. Choi In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy California Institute of Technology Pasadena, Calif... Date Added: 2009-04-22 07:46:01 |
| Session14_2.doc Path: UNC >> EC >> 434 Fall, 2009 Description: 1. Alternative Systems a. Goals of Alternative Systems i) Efficiency ii) Freedom iii) Equality b. Failures of the Market i) Monopolies ii) Provision of Public Goods and Free Riders iii) Externalities iv) Asymmetric Information v) Instability and Unfa... Date Added: 2009-04-22 07:49:03 |
| Proposal.doc Path: UNC >> COMP >> 790 Fall, 2008 Description: Mini-RoboCup Huai-Ping Lee and Lei Wei 1. Motivation and Background RoboCup is an international robotics soccer competition founded in 1993. It is intended to promote research and education of autonomous robotics and artificial intelligence. Many ne... Date Added: 2009-04-22 07:49:03 |
| MyTaylor4.txt Path: Berkeley >> MATH >> 128 Fall, 2008 Description: %MyTaylor4.m %Math 128B Spring 2005 %Hmwk6 - Solutions (Mar. 1, 2005) % %Implementation of 4th order Taylor method of solving IVP %Algorithm is on p. 483 of Mathews & Fink (see also Program 9.3) %FuncDer is name of function returning [y\', y\', y\', y\'... Date Added: 2009-04-22 07:49:21 |
| fluid.ppt Path: UNC >> COMP >> 259 Fall, 2008 Description: Introduction to Fluid Simulation Jacob Hicks 4/25/06 UNCCH The UNIVERSITY of NORTH CAROLINA at CHAPEL HILL Different Kind of Problem Can be particles, but lots of them Solve instead on a uniform grid 2 The UNIVERSITY of NORTH CAROLINA at CHAP... Date Added: 2009-04-22 07:49:22 |
| AutoInsLimits_Exercise.doc Path: Bowling Green >> RMI >> 3500 Fall, 2009 Description: Special Auto Insurance Exercise 1) Herman has purchased auto insurance liability coverage with the following split limits: $50,000/$150,000/$25,000. He also buys collision coverage with a $500 deductible and comprehensive coverage with a deductible ... Date Added: 2009-04-22 07:50:14 |
| hw9S.pdf Path: University of Illinois, Urbana Champaign >> MATH >> 347 Fall, 2008 Description: Fundamental Mathematics - 347 G1 Homework 9 Solutions 1. 13.6. The flaw in this reasoning is that we will never list any irrational number. 2. 13.8. False. Let S = {0, 1}. Then sup(S) = 1, inf(S) = 0, so that sup(S) S and inf(S) S, but S is not a ... Date Added: 2009-04-22 07:52:07 |
| ps8.txt Path: Utah >> CS >> 3500 Fall, 2008 Description: CS 3500, PS 8, Fall 2008 Grade Score: _ out of 100 Grader\'s name: Bug 1: Wrong number of flags given out at beginning [20 points] Wasn\'t a bug after all. Everyone that submitted a solution gets 20 points for this one. ... Date Added: 2009-04-22 07:53:38 |
| Lecture23.pdf Path: Utah >> PHYS >> 3610 Fall, 2008 Description: ... Date Added: 2009-04-22 07:55:40 |
| LEC17.doc Path: Utah >> PHYS >> 3610 Fall, 2008 Description: 17-1 LECTURE 17: P-N JUNCTIONS, A SLIGHTLY CLOSER LOOK These next few pages are an attempt to go somewhat beyond the material of the first quarter without taking the time to do everything. A better treatment can be obtained from deWaard and Lazarus,... Date Added: 2009-04-22 07:56:00 |
| lec08_MechanicsReview.pdf Path: Utah >> PHYS >> 7640 Fall, 2008 Description: Lagrangian Mechanics We consider a system with generalized coordinates qi and velocities qi = dqi /dt and a Lagrangian function L(qi , qi , t). Usually L = T - V where T is kinetic energy and V is potential energy. The classical trajectories qi (t)... Date Added: 2009-04-22 07:56:25 |
| final.review.1010v2.pdf Path: Utah >> MATH >> 1010 Fall, 2008 Description: Final Review Problems Math 1010 Section 1.1 1.2 1.3 1.4 1.5 2.1 2.2 2.3 2.4 2.5 3.1 3.2 3.3 3.4 3.6 3.7 4.1 4.2 4.3 5.1 5.2 5.3 5.4 5.5 5.6 6.1 6.2 6.3 6.4 6.5 6.6 7.1 7.2 7.3 7.4 7.5 7.6 8.1 8.2 8.3 8.5 page 9 19 28 37 47 66 75 89 103 113 135 145 15... Date Added: 2009-04-22 07:56:49 |
| driftmut.pdf Path: Utah >> ANT >> 5221 Fall, 2009 Description: Anthro/Bio 5221 Computer Lab Projects c Alan Rogers and Jon Seger October 3, 2008 Project 6 Simulating Genetic Drift and Mutation In real populations, allele frequencies change because a finite number of gametes are sampled from the parental genera... Date Added: 2009-04-22 07:57:15 |
| project20_final_paper.doc Path: University of Illinois, Urbana Champaign >> ECE >> 445 Spring, 2008 Description: DIGITAL SAMPLING FOR BIRD RADAR By Ryan Dawson Cliff Kucharski Megan Yuill ECE 345, SENIOR DESIGN PROJECT SPRING 2004 TA: Greg Sorenson Date: 5/4/04 Project No. 20 ABSTRACT Currently Professor Ronald Larkin operates a mobile radar unit to gather ... Date Added: 2009-04-22 07:57:19 |
| Atmos348Lecture16.pdf Path: University of Illinois, Urbana Champaign >> ATMOS >> 348 Fall, 2009 Description: ATMOS 348 Atmospheric Chemistry Lecture 16: Tropospheric Chem. Don Wuebbles Department of Atmospheric Sciences University of Illinois, Urbana-Champaign February 2004 Meridional Distribution Fishman and Crutzen(1978) An excess of ozone in the N... Date Added: 2009-04-22 08:00:45 |
| ITM352_03_Basic_HTML.ppt Path: University of Hawaii - Hilo >> CLASS >> 352 Fall, 2009 Description: ITM352 A Tour of PHP Lab 3 You will need the following information: Shidler web server db-itm.shidler.hawaii.edu SSH user: \"itm352\" password: \"!student!\" All uploads should be placed in the \"itm352/phpfiles\" directory SSH You might want to ... Date Added: 2009-04-22 08:01:47 |
| ocs_icd_004.doc Path: University of Hawaii - Hilo >> OCS >> 004 Fall, 2009 Description: Joint Astronomy Centre James Clerk Maxwell Telescope Russell O. Redman and Craig Walther 08Mar2004 OCS/ICD/004 JCMT Frontend OCS Interfaces A. Introduction This document sets out the DRAMA interface for a frontend, as decided at the \"JCMT Software I... Date Added: 2009-04-22 08:01:58 |
| pointers.txt Path: University of Hawaii - Hilo >> ICS >> 111 Fall, 2009 Description: Memory = sequence of numbered bytes = arrays of numbered bytes 1 byte = 8 bits = smallest unit of memory address = positive number, integer value, don\'t know where variables will be located Each variable in scope has: 1. name ... Date Added: 2009-04-22 08:02:39 |
| faq3.txt Path: Temple >> CIS >> 307 Fall, 2008 Description: Archive-name: os-research/part3 Version: $Revision: 1.3 $ Posting-Frequency: monthly Last-Modified: Tue Aug 13 21:03:20 1996 URL: http:/www.serpentine.com/~bos/os-faq/ Answers to frequently asked questions for comp.os.research: part 3 of 3 ... Date Added: 2009-04-22 08:03:26 |
| exam1.pdf Path: Kentucky >> MA >> 213 Fall, 2008 Description: MA 213 February 12, 2001 Name: 1. Know the denitions and theorems. Proofs of Theorem A (p 572), Theorem B (p 573), and Theorem C (p 607) are fair game. 2. Graph the following. Be sure to give the direction. Explain if each is closed and/or simple. ... Date Added: 2009-04-22 08:03:52 |
| lab10.ppt Path: Delaware >> MEEG >> 101 Fall, 2008 Description: As Class Convenes Post any Open Agenda items Prepare for Team Exam Open Agenda Session Agenda Open Agenda Discuss Project 2 Team Exam 2 min 8 min 40 min TURN IN in Team Folders Project 2 Less structured than ... Date Added: 2009-04-22 08:09:15 |
| AdWareScan2-18Apr2002.TXT Path: UNC >> INLS >> 187 Fall, 2009 Description: Sheet1 Scan initialized on 18/04/02 13:07:31. (AAW release 5.71, referencefile 103-07.04.2002) Err:510 Started memory scan Err:510 Running processes: #:1 : C:\\WINDOWS\\SYSTEM\\KERNEL32.DLL #:2 : C:\\WINDOWS\\SYSTEM\\MSGSRV32.EXE #:3 : C:\\WINDOWS\\SYSTEM\\S... Date Added: 2009-04-22 08:10:17 |
| Lecture6.pdf Path: San Jose State >> EE >> 140 Fall, 2008 Description: Gausss Law The Use of Symmetry Area Projections b A a b a 1 A A = A/r2 A = (A/r2 )cos() acos() a a r Fact: Area projects through the cosine of the angle of inclination and inversely as r2 Gausss Law: Point Charge dS = dSaN E = Er ar r unit s... Date Added: 2009-04-22 08:11:32 |
| inclass_streak.ppt Path: Delaware >> CIEG >> 305 Winter, 2008 Description: CIEG 305 IN CLASS EXERCISE ON FLOW PATTERNS Oil is spilling continuously from a tanker for 4 days with the following surface current patterns. Day 1 Day 2 Day 3 Day 4 Sketch the pathline of the particle passing through the tanker hull at the b... Date Added: 2009-04-22 08:12:00 |
| NCBI.pdf Path: Delaware >> ANSC >> 644 Fall, 2008 Description: Nucleic Acids Research, 2005, Vol. 33, Database issue D39D45 doi:10.1093/nar/gki062 Database resources of the National Center for Biotechnology Information David L. Wheeler*, Tanya Barrett, Dennis A. Benson, Stephen H. Bryant, Kathi Canese, Deanna M... Date Added: 2009-04-22 08:12:10 |
| chap1.pdf Path: Michigan State University >> CE >> 405 Fall, 2008 Description: CE 405: Design of Steel Structures Prof. Dr. A. Varma 1.0 INTRODUCTION TO STRUCTURAL ENGINEERING 1.1 GENERAL INTRODUCTION Structural design is a systematic and iterative process that involves: 1) Identification of intended use and occupancy of a s... Date Added: 2009-04-22 08:13:21 |
| 27_march_page_4.pdf Path: E. Mennonite >> V >> 49 Fall, 2009 Description: 4 March 27, 2003 News The Weather Vane SGA Hard at Work For Student Fund By Sarah Dick Contributing Writer Common Grounds was hit by a blast from the past as students in styles ranging from bell-bottoms and vests to highheeled boots or fros arriv... Date Added: 2009-04-22 08:14:28 |
| ASM222PP_Cost2Operate.pdf Path: Purdue >> ASM >> 222 Fall, 2008 Description: ASM 222 Crop Production Machinery Practice Problems: Annual Operating Costs Records for the past 3 years show that a tractor is used an average of 300 hours per year. The maintenance and repair costs during that time totaled $24,000. The annual bil... Date Added: 2009-04-22 08:14:37 |
| Ch01.ppt Path: Whitman >> POWER >> 102 Fall, 2009 Description: PowerPoint Lectures for CHAPTER 1 The Scope and Method of Economics Principles of Macroeconomics, 9e ; ; By Karl E. Case, Ray C. Fair & Sharon M. Oster 2009 Pearson Education, Inc. Publishing as Prentice Hall Principles of Macroeconomics 9e by C... Date Added: 2009-04-22 08:15:02 |
| hw4sol.pdf Path: Knox >> CS >> 142 Fall, 2009 Description: CS 142: Program design and methodology Winter Term, 2009 Solutions to Homework 4 3. (9 points) Implement the following methods of OurList. You should test them, but will not be graded on your testing. (a) A method numOccurrences that takes a string ... Date Added: 2009-04-22 08:15:23 |
| humres60107rg.pdf Path: Sewanee >> BAN >> 6 Fall, 2009 Description: SCT Banner Human Resources Release Guide December 2005 Release 6.1.7 What can we help you achieve? Confidential Business Information This documentation is proprietary information of SunGard SCT and is not to be copied, reproduced, lent or disposed ... Date Added: 2009-04-22 08:15:28 |
| BU126ch12.ppt Path: Mitchell >> BU >> 126 Fall, 2009 Description: Resolving Conflicts Chapter 12 Theories of Conflict Resolution What is conflict? Characterized by three elements\' Interdependence Interaction Incompatible goals Conflict Development Cycle Frustration Conceptualization Behavior Outcome C... Date Added: 2009-04-22 08:16:17 |
| selfval.doc Path: Loras >> PK >> 378999 Fall, 2009 Description: Peter Kirkendall Self Evaluation Accounting Strengths: My years at Loras have been great. I\'ve learned a lot about the fundamentals of accounting. From financial to tax, I believe I have received a strong background in the basics of accounting. Weakn... Date Added: 2009-04-22 08:19:27 |
| exercise03.pdf Path: Goucher >> CS >> 116 Fall, 2009 Description: Exercise 3: Applets and Variables CS 116 Sept. 9, 2002 1. Take a look at the file Lesson3.java from the class home page. Identify all the local and instance variables. Hint: There are three instance variables and one local variable. 2. Make a projec... Date Added: 2009-04-22 08:19:36 |
| lec33w.pdf Path: Purdue >> LECTURE >> 33 Fall, 2009 Description: Agricultural Scientific Revolution: Genetic Lecture 33 Ancient Empirical Knowledge of Inheritance Like begets Like Beginning of genetic wisdom Virgil\'s Georgics When she has calved, then set the dam aside; And for the tender progeny provide; Disti... Date Added: 2009-04-22 08:19:43 |
| lecture902.pdf Path: Purdue >> MA >> 265 Summer, 2001 Description: MA 265 Lecture 9 September 24th Homogeneous Systems Due to their special properties, homogeneous systems have a more developed theory than the general systems of linear equations. Finding a basis for the solution of a homogeneous system We set the... Date Added: 2009-04-22 08:19:47 |
| 03-Courses_Facilities2008.pdf Path: UC Davis >> LOG >> 0020 Fall, 2009 Description: Doctoral Studies in Plant Biology at the MSU-DOE Plant Research Laboratory DOE Plant Research Laboratory Michigan State University East Lansing, MI 48824-1312 517/353-2270 ReseaRch Facilities The PRL has exceptional research facilities. In addition... Date Added: 2009-04-22 08:23:52 |
| 03-Courses_Facilities2008.pdf Path: UC Davis >> LOG >> 0810 Fall, 2009 Description: Doctoral Studies in Plant Biology at the MSU-DOE Plant Research Laboratory DOE Plant Research Laboratory Michigan State University East Lansing, MI 48824-1312 517/353-2270 ReseaRch Facilities The PRL has exceptional research facilities. In addition... Date Added: 2009-04-22 08:23:52 |
| Lecture2.doc Path: Delaware >> HESC >> 689 Fall, 2008 Description: LabView Lecture #2 Outline 1. Arrays (Numeric, String, Boolean) 1. 1 dimensional controls 1. Polymorphous operation 1. Common array operators (Add elements, AND elements, OR elements) 1. Indexing arrays 1. Reversing arrays 2. Concatenating arrays 1. ... Date Added: 2009-04-22 08:24:32 |
| LumbarSpinalStenosis.pdf Path: Delaware >> HAIFANOV >> 5 Fall, 2009 Description: ... Date Added: 2009-04-22 08:24:47 |
| gehringer.pdf Path: N.C. State >> ISCA >> 1998 Fall, 2009 Description: ... Date Added: 2009-04-22 08:25:11 |
| syl2730.txt Path: Auburn >> SMITH >> 01 Fall, 2009 Description: COURSE SYLLABUS Course Number: MATH2730 Course Title: CALCULUS FOR ENGINEERING AND SCIENCE III Credit Hours: 4 Prerequisites: MATH1720 Corequisite: Objectives: To develop student mathematical and analytic skills. To present the fundamental concep... Date Added: 2009-04-22 08:26:09 |
| ARE306EXAM2Nov132001.pdf Path: N.C. State >> ARE >> 306 Spring, 2008 Description: ARE 306 EXAM II November 13, 2001 Select the best answer. You may use one 3x5 card of notes, handwritten, front and back, and no other materials. All answers must be placed on the Trans-Optic answer sheet using a number two pencil. (For True/False qu... Date Added: 2009-04-22 08:26:30 |
| hintsChap2.pdf Path: Auburn >> MH >> 6200 Fall, 2009 Description: Hints/Solutions Chapter 2 #1 Prove that the empty set is a subset of every set. February 20, 2005 Math 5200/6200 hint: Let A be a set. If is not a subset of A then what would need to happen? #2 A complex number z is said to be algebraic if there ... Date Added: 2009-04-22 08:26:36 |
| PosterEnergy.pdf Path: Wisc Green Bay >> CAPSTONE >> 05 Fall, 2009 Description: Alternate Energy Options for the University European vs. United States Wind Energy Installation of Wisconsin Green Bay Geothermal Energy Energy Education To increase awareness on campus regarding energy conservation, it may be helpful to provide han... Date Added: 2009-04-22 08:27:56 |
| wave-4.pdf Path: Cal Poly Pomona >> EVENTS >> 2 Fall, 2009 Description: WAVE 4 Group Memory Translating Vision Into Action Retreat for Campus Leaders April 29, 2005 DESIRED OUTCOMES The most ambitious group activity for the campus leaders was Translating Vision Into Action. Campus leaders were assigned to one of 8 table... Date Added: 2009-04-22 08:33:23 |
| PosterSession_II_odd.pdf Path: Cal Poly Pomona >> SCCUR >> 08 Fall, 2009 Description: Poster Session II, 4:30 pm 5:30 pm The poster sessions will be in the Bronco Student Event Center, Building 35, Ursa Major. At least one author should be with the poster for the entire session. Please take this opportunity to discuss your project wi... Date Added: 2009-04-22 08:33:26 |
| L2.pdf Path: Case Western >> ESA >> 2008 Fall, 2009 Description: Proc. ESA Annual Meeting on Electrostatics 2008, Paper L2 1 Annealing effects on the charge transfer in metal/polymer contact A. R. Akande Department of Physics University of Botswana, Private Bag 0022 Gaborone, Botswana. Fax: (+267) 3185097 e-mail... Date Added: 2009-04-22 08:39:33 |
| 14841.ppt Path: Pittsburgh >> SUPER >> 7 Fall, 2009 Description: \"For the triumph of evil it is only necessary for good men to do nothing.\" Edmund Burke Institutional corruption No individual within an institution wants misconduct to flourish, but nobody is directly responsible-so it does flourish. Bristol: ano... Date Added: 2009-04-22 08:39:59 |
| MT1-Practice.pdf Path: Wake Forest >> PHY >> 113 Fall, 2008 Description: PHY 113 Fall 2007 Practice Test for Midterm 1 Instructor: K. Burak Ucer Concept Questions 1. Two stones are released from rest at a certain height, one after the other. a) Will the difference in their speeds increase, decrease, or stay the same? b) ... Date Added: 2009-04-22 08:40:12 |
| lab03_data_import_info_f08.pdf Path: Wyoming >> RS >> 4111 Fall, 2009 Description: Lab 03: Data Import and Export Images come in many data formats and it is important to understand how to bring these data into whatever image processing software package you happen to be using. Erdas Imagine uses its own format with the extension .im... Date Added: 2009-04-22 08:41:33 |
| FlashboardsAd-630.pdf Path: UNL >> ARS >> 630 Fall, 2009 Description: Action Request System 6.3 Remedy Flashboards Administrators Guide January 2005 Part No: 49791 Copyright 19912005 BMC Software, Inc. All rights reserved. BMC, the BMC logo, all other BMC product or service names, BMC Software, the BMC Software logos... Date Added: 2009-04-22 08:43:54 |
| ch3.pdf Path: Michigan State University >> HANDBOOK >> 2002 Fall, 2009 Description: Chapter 3 EFFECTIVE TEACHING STRATEGIES Whether we teach courses in mathematics, science, English, or forestry, one of our goals as instructors is to provide students with opportunities to become active, critical thinkers who move beyond a view of le... Date Added: 2009-04-22 08:46:18 |
| marykin3.txt Path: CSU Fresno >> MP >> 3 Fall, 2009 Description: eBGL1CF If I Were The Marrying Kind Chorus: If I were the marrying kind, Which thank the Lord I\'m not sir, The kind of man that I would be. WOULD BE A RUGBY FULLBACK. I\'d find touch, she\'d find touch, We\'d both find touch together, We\'d be alri... Date Added: 2009-04-22 08:47:39 |
| sample.pdf Path: Ill. Chicago >> BA >> 200 Fall, 2008 Description: 1 To: From: Re: Date: Linda Landis Andrews, Professor BA 200 Justin Bryant, Student Information Interview Report with J. David Knight 24 September 2002 On 17 September 2002, I had the pleasure of interviewing Mr. J. David Knight, Consultant for Acce... Date Added: 2009-04-22 08:50:27 |
| Fluids.pdf Path: CSU Northridge >> VCMTH >> 02 Fall, 2009 Description: The inviscid limit of incompressible uid ow in an annulus Sara Frietze, Robert Gerrity, and Tiago Picon August 18, 2006 Abstract Incompressible, circularly symmetric uid ow in a two-dimensional annulus A = {x R2 |1 < |x| < 2} with xed outer boundar... Date Added: 2009-04-22 08:51:37 |
| ga1.pdf Path: Oakland University >> ME >> 498 Fall, 2009 Description: hk`2ekkT{Twk wTeuwxE s Tlx eke{ kEb{w xT TPbC9ll Hk wE77 TkTkxw Txey kTw Eek 2wy T T kE 9dRb bx v k ATekExw|Tue eTTsTwkek xT Yk{HT kw 2 l} w ... Date Added: 2009-04-22 08:52:29 |
| AME30362_HW05_f08_sol.pdf Path: Oakland University >> AME >> 30362 Fall, 2009 Description: University of Notre Dame Department of Aerospace and Mechanical Engineering AME30362: Design Methodology. Fall, 2008 Homework #5, Due: Solution to Selected Problems Material selection methods: Eggert (2005), Chapter 5. Exercise 16. Use data from tabl... Date Added: 2009-04-22 08:52:31 |
| hmk2.pdf Path: Oakland University >> ALGGEOMSPR >> 2009 Fall, 2009 Description: Homework 2 Algebraic Geometry, Spring 2009 1. Let f : A B be ring homomorphism. An ideal of B is the extension of an ideal I of A if it is generated by f (I). An ideal of A is the contraction of an ideal J of B if it equals f 1 (J). Show that there ... Date Added: 2009-04-22 08:52:49 |
| michelle2.pdf Path: Oakland University >> XSOC >> 591 Fall, 2009 Description: Statement of Teaching Philosophy Teaching requires dedication and expertise, both of which take time and effort to perfect. My goal is to become a master teacher. Master teachers, according to Edgerton, Cross, and Quinlan (1991) \"have a command of th... Date Added: 2009-04-22 08:52:58 |
| starbulletin.article.1.25.08.pdf Path: University of Hawaii - Hilo >> ARCHIVE >> 0708 Fall, 2009 Description: starbulletin.com | Features | /2008/01/25/ Page 1 of 4 74F / Partly Cloudy Vol. 13, Issue 25 - Friday, January 25, 2008 Info | Mobile Edition | Corrections | Calendars | Movies Obituaries | Vital Stats | Weather | Surf | Subscribe Search starbul... Date Added: 2009-04-22 08:55:59 |
| w-n-band.pdf Path: UNC >> LING >> 520 Fall, 2008 Description: ... Date Added: 2009-04-22 08:56:16 |
| ProblemSet05.pdf Path: UNC >> COMP >> 101 Fall, 2008 Description: The UNIVERSITY of NORTH CAROLINA at CHAPEL HILL Comp 101 Computer FITness Spring 2008 Problem Set #4 Issued Thursday, 4/16/08; Due Thursday, 4/23/08 Homework Information: Some problems are probably too long to be done the night before the due date, s... Date Added: 2009-04-22 08:56:37 |
| optical.pdf Path: UNC >> ENVR >> 416 Fall, 2008 Description: ... Date Added: 2009-04-22 08:56:40 |
| optical.pdf Path: UNC >> MIE >> 416 Fall, 2009 Description: ... Date Added: 2009-04-22 08:56:41 |
| morpheme-tree.pdf Path: UNC >> LING >> 101 Fall, 2008 Description: TYPES OF MORPHEMES FREE BOUND Content Function Clitics Pre/In/Suffixes Stems inflectional derivational Closed Class Open Class Closed Class: Additions are seldom made to this category, whose members have a grammatical rather than lexical fu... Date Added: 2009-04-22 08:57:26 |
| Lecture04.pdf Path: UNC >> COMP >> 411 Fall, 2002 Description: Concocting an Instruction Set Nerd Chef at work. move add add move rotate . flour,bowl milk,bowl egg,bowl bowl,mixer mixer Read: Chapter 2.1-2.6 9/5/06 L04 Instruction Set 1 Comp 411 Fall 2007 A General-Purpose Computer The von Neumann Model Ma... Date Added: 2009-04-22 08:57:29 |
| 14.Structruralheterogeneity.pdf Path: Dartmouth >> PDF >> 05 Fall, 2009 Description: Monteverde STRUCTURALHETEROGENEITYANDNUTRIENTAVAILABILITYEFFECTS ONSIMULATEDBROMELIADINVERTEBRATECOMMUNITIES TIMOTHYR.MATSUURA,LAKSHMINARAYANANDCAYELANC.CAREY Abstract:Nutrientavailabilityandstructuralheterogeneityareimportantregulatorsofinvertebra... Date Added: 2009-04-22 08:59:31 |
| 1-1.pdf Path: Bowling Green >> DSC >> 3100 Fall, 2009 Description: 1. Chapter 1: Examining Distributions introduction 1. Distribution a. Focus of this chapter b. The distribution of a variable tells us what values it takes and how often it takes these values 2. Variable a. categorical b. quantitative: takes numeric... Date Added: 2009-04-22 09:03:29 |
| DraytonHandout.doc Path: Clemson >> UNIT >> 5 Fall, 2009 Description: DRAYTON HALL THROUGH THE AGES PREPARED FOR SOUTH CAROLINA STUDIES 8th GRADE CURRICULUM SUPPLEMENT Unit 5 Resources of the Coastal Plain John R. Wagner, Clemson University Project Director SC MAPS Project Office 340 Brackett Hall Clemson Universit... Date Added: 2009-04-22 09:05:39 |
| srbull19005RE3.pdf Path: Clemson >> SERA >> 6 Fall, 2009 Description: State Soil Testing Procedures in S. US (SCSB #190-D) PROCEDURES USED BY STATE SOIL TESTING LABORATORIES IN THE SOUTHERN REGION OF THE UNITED STATES SOUTHERN COOPERATIVE SERIES BULLETIN #190-D MARCH, 2007 http:/www.clemson.edu/agsrvlb/sera6 Clemson... Date Added: 2009-04-22 09:06:00 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
