Course Solutions And Notes - HW 9 Solution NenerPlante1 a3

Displaying 17001-17500 of 22530 documents:
next page of documents

LecSix26.pdf
Path: Colorado State >> CS >> 510 Fall, 2008
Description: Bicubic Surfaces Extend the concept of a cubic polynomial Curve to a Surface by adding a second parameter s and defining a curve that is itself defined by a parameterized geometry matrix. Q( s, t ) = S M G( t ) m1, 1 m 2, 1 1] m3, 1 m4, 1 m1, 2 ...
Date Added: 2009-06-06 17:27:44

xps.ps
Path: Wisconsin >> ECE >> 352 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips 5.72 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: hw3f97.dvi %CreationDate: Mon Oct 13 11:57:59 1997 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: %+ /afs/eng...
Date Added: 2009-06-06 17:28:21

Traidcraft_paper_July_07.pdf
Path: East Los Angeles College >> OPEN >> 10142 Fall, 2009
Description: Title The political rationalities of fair trade consumption in the United Kingdom Authors Nick Clarke, Clive Barnett, Paul Cloke and Alice Malpass Authors\' contact details Nick Clarke, School of Geography, University of Southampton, Highfield, Sout...
Date Added: 2009-06-06 17:28:29

Tri Filter Mixer.pptx
Path: Benjamin Franklin Institute of Technology >> ECE >> 3551 Fall, 2009
Description: ...
Date Added: 2009-06-06 17:29:51

349EfferentNS.ppt
Path: Western Washington >> BIOL >> 349 Spring, 2008
Description: Efferent Division of the Nervous System Somatic Motor Division: Controls Skeletal Muscles Where are the cell bodies of most somatic motor neurons located? Do motor neurons have a threshold? Why or why not? Name at least two sources of excitatory inp...
Date Added: 2009-06-06 17:30:36

log.txt
Path: Washington >> JOBS >> 100 Fall, 2009
Description: 000 (005.000.000) 06/19 16:44:16 Job submitted from host: <128.95.94.28:1058> . 001 (005.000.000) 06/19 16:44:43 Job executing on host: <172.25.101.23:1051> . 000 (105.000.000) 06/19 16:49:59 Job submitted from host: <128.95.94.28:1058> . 005 (005.00...
Date Added: 2009-06-06 17:31:42

GPvsAP.pdf
Path: Western Washington >> BIOL >> 349 Spring, 2008
Description: ...
Date Added: 2009-06-06 17:32:19

CS432_Wk7_TestModel.ppt
Path: Regis >> CS >> 432 Fall, 2009
Description: CS432ObjectOrientedAnalysis andDesign Week7 Testing 1 Software Testing Testing is the process of exercising a program with the specific intent of finding errors prior to delivery to the end user. You cant test in quality. If its not there before y...
Date Added: 2009-06-06 17:32:32

GPvsAP.pdf
Path: Western Washington >> BIOL >> 348 Fall, 2008
Description: ...
Date Added: 2009-06-06 17:33:01

George Washington Quotes.doc
Path: N. Georgia >> MJALBO >> 3708 Fall, 2009
Description: George Washington Quotes Associate yourself with men of good quality if you esteem your own reputation. It is better be alone than in bad company. Experience teaches us that it is much easier to prevent an enemy from posting themselves than it is t...
Date Added: 2009-06-06 17:33:26

lecture02_2005.pdf
Path: Toledo >> BIO >> 335 Fall, 2009
Description: Mycology - BIO 335, September 15,2005 Reading: Text chapter 2 Objective: Know what ultrastructural, life cycle and ecological features define the zoosporic fungi. Zoosporic Fungi Fungi are eukaryotes: Fungi are most closely related to animals: Th...
Date Added: 2009-06-06 17:34:34

Breadth 2.pdf
Path: Penn State >> SMD >> 301 Fall, 2009
Description: Loyola/Notre Dame Library, Baltimore, MD Thesis Proposal Sandra DiRupo Construction Management Dr. Horman Dec. 18, 2007 Breadth Analysis 2: Prefabricated Curtain Wall Analysis I will propose using a prefabricated curtain wall system instead of...
Date Added: 2009-06-06 17:37:02

homework2_2006.pdf
Path: CSU Channel Islands >> ICS >> 278 Fall, 2009
Description: ICS 278 Homework 2 Data Mining, ICS 278, Spring 2006 Due Date: Tuesday May 9th, in class Problem 1: Analyzing The Time and Space Complexity of Several Well-Known Classification Algorithms Estimate the time and space complexity (\"big 0\" notation, wor...
Date Added: 2009-06-06 17:37:48

PHIL problem of evil.doc
Path: Uni. Westminster >> CWT >> 1013 Fall, 2009
Description: Clinton Turner HW The best of all possible worlds (p 279) Quote p 279 Given all these facts, what type of world would God select? Obviously, the best of all logically possible worlds. In other words, this actual world must be the best of all possible...
Date Added: 2009-06-06 17:38:17

117week07.pdf
Path: Cal Poly >> MATH >> 117 Winter, 2008
Description: Math 117 Week 7, 5/11/2009 Robert Webb webb@calpoly.edu Department of Mathematics California Polytechnic State University San Luis Obispo, CA 93407, USA 117, Week 7 p.1/12 Agenda 8.1 2D Systems Graphing Substitution Elimination 8.5 Systems of Lin...
Date Added: 2009-06-06 17:39:06

Aug30_2007.pdf
Path: W. Carolina >> MATH >> 441 Fall, 2008
Description: ...
Date Added: 2009-06-06 17:41:05

Lab06.pdf
Path: HWS >> MATH >> 130 Fall, 2009
Description: Math 130: Lab 6 1. Either (a) or (b) will be on a quiz or test: a) Write out the h 0 denition of the derivative function of f (x). b) Write out the alternative x a denition of the derivative of f (a). c) Use the h 0 denition to nd f (x) if f (x) =...
Date Added: 2009-06-06 17:42:26

380.2005.Spring.Q2.pdf
Path: Roosevelt >> A >> 380 Fall, 2009
Description: A380/M480 Quiz 2a NAME February 8, 2005 20 pts. max Show all work; no work no credit. The test is printed on both sides of the paper. 1. Let P (A B ) = 0.2, P (A ) = 0.6, and P (B ) = 0.5. Then P (A B ) = A. 0.1 B. 0.3 C. 0.7 D. 0.8 E. ...
Date Added: 2009-06-06 17:45:22

mpl_field_gradients.pdf
Path: Carnegie Mellon >> PHYSICS >> 33340 Fall, 2009
Description: Carnegie Mellon University 33.340 Modern Physics Laboratory Estimating Field Gradients from Signal Decay Shapes Last Revision: R. A. Schumacher March 2008 ver. 1.5 I. INTRODUCTION In the NMR experiment, the \"free induction decay (FID)\" shape is a ...
Date Added: 2009-06-06 17:45:30

r52155_barrel_tick_U_pattern.ps
Path: Stanford >> MEETING >> 070109 Fall, 2009
Description: %!PS-Adobe-2.0 %Title: plots/tick_U_pattern.ps (Landscape A 4) %Pages: (atend) %Creator: ROOT Version 4.01/02 %CreationDate: Fri Mar 25 11:29:15 2005 %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} def /sw {st...
Date Added: 2009-06-06 17:46:42

YPR138C.t2k.str2-logo.pdf
Path: UCSC >> YPR >> 138 Fall, 2009
Description: YPR138C.t2k STR2 3 2 1 CC 1 H H H H Z S S G T T X XXXXXXSSXXX X H T S X 10 20 30 40 H 3 2 1 H S Q P H HHHHHHHHHHHHHHHHHHHHHHH X X X X X X X X X X X X X X X X X X X X X X X T G T S H H T T C G C C X X X X X H H HSTSGGT S T H S X X X X ...
Date Added: 2009-06-06 17:51:00

YPR136C.t2k.dssp-ehl2-logo.pdf
Path: UCSC >> YPR >> 136 Fall, 2009
Description: YPR136C.t2k DSSP-EHL2 1 C H E C C E E E E E E C C X X X X X X X X X X X X X X 1 10 20 30 40 E 1 H T T G H E H S H HEEEEEHHHHHHCCHEEEEHHHCCCCCCCCCCCCCCCEEH H H HH H C H H H H H E C C C H X X X X X X X X X X X X X X X X X X X X X X X X ...
Date Added: 2009-06-06 17:51:25

YPR196W.t2k.dssp-ebghstl-logo.pdf
Path: UCSC >> YPR >> 196 Fall, 2009
Description: YPR196W.t2k EBGHSTL 3 2 1 C X C H T X CH C HXXXXXXTX C T C X C T X H HHH HHHHHH T T T C X HXX H H X X X C H T H X X X X TSSS CTC C 20 T S S H SCTXBSHHHHTHCS SE XXXXXX E CC E X 1 10 30 40 H 3 2 1 X H T E H HH C C T CCHTT TSSTSHTH...
Date Added: 2009-06-06 17:51:36

YPR160C-A.t2k.dssp-ehl2-logo.pdf
Path: UCSC >> YPR >> 160 Fall, 2009
Description: YPR160C-A.t2k DSSP-EHL2 2 1 CEEEE C E X X X E CCCCCCCCCCC X X X C E H X X X X X X X X C C X X C X C C X X X C H H H H H H X X X X X X E EHEE H H C C C C C C X X X X E H E C C X C H C X X X C C C C X X X X C C C C C X X X X X X...
Date Added: 2009-06-06 17:51:39

YPR159C-A.t2k.dssp-ebghstl-logo.pdf
Path: UCSC >> YPR >> 159 Fall, 2009
Description: YPR159C-A.t2k EBGHSTL 3 2 1 CC X 1 10 20 S H T E 30 H HHHHHH E EEEE X MA TLD FTTKPLAL VIYMSVVLLLMVGV P L L FS S CCCE EEEEESES T S S S S T CCC SC X XXXXX C E E H E H X X X X X X X X X X X X X X X H E E E HH HHHHH T T C X X X X X T ...
Date Added: 2009-06-06 17:51:51

sh415a91f.pdf
Path: Cal Poly >> SSH >> 5310 Fall, 2009
Description: ...
Date Added: 2009-06-06 17:53:24

Lecture 1 slides.ppt
Path: East Los Angeles College >> AC >> 959 Fall, 2009
Description: AC959 Bank Strategy and Risk Dr. Paul Hamalainen pkhamal@essex.ac.uk Office Hours: Tuesday 2-4 Wednesday 10-11 Aims Identify the key environmental developments in banking in recent times identify and evaluate the main banking strategies to crea...
Date Added: 2009-06-06 17:53:48

Chap07.rtf
Path: Redlands >> CS >> 208 Fall, 2009
Description: Chapter 7 Objects and Classes A class is a template for objects. It defines the generic properties of objects and provides methods to manipulate them. An object is an instance of a class. An object is declared in the same way as a primitive ...
Date Added: 2009-06-06 17:54:39

escott_elliptic.pdf
Path: Harvard >> EDU >> 129 Spring, 2009
Description: Elliptic Curves David Wright Escott May 24, 2004 Final Paper for Mathematics 129: Algebraic Number Theory Taught by Professor William Stein 1 1 Elliptic Curves Elliptic curves are found at the intersection of a broad range of mathematics. As suc...
Date Added: 2009-06-06 17:55:12

structure.xls
Path: Purdue >> AAE >> 450 Fall, 2009
Description: all measurements are taken form the reference point of the vehicle, as the center of the wedge at the tip of the nose. geometry: wedge length ext length total length height Tip Width total width 9 8 17 2 prop mass empty weight Mass Ratio Mtot / Min...
Date Added: 2009-06-06 17:55:22

lecture19(geodatabases).ppt
Path: Mich Tech >> FW >> 3540 Spring, 2008
Description: Geographic Information Systems and Remote Sensing for Natural Resource Management FW3540 Lecture 19 ArcMap Geodatabases Is a collection of geographic datasets of various types held in a common file system folder. Elements within the Geodatabase Per...
Date Added: 2009-06-06 17:56:57

Queue Analysis.doc
Path: Syracuse >> CSE >> 681 Fall, 2008
Description: Queuing Analysis Version 2.0 Jim Fawcett CSE681/791 Software Modeling and Analysis Fall 2002 Queuing Analysis Assume that we have a queue with a constant average rate of arriving messages, . Our computer program can process each message with a co...
Date Added: 2009-06-06 17:58:16

notes-matrix-primer.pdf
Path: New Mexico >> CS >> 530 Fall, 2008
Description: A primer on matrices Stephen Boyd August 25, 2002 These notes describe the notation of matrices, the mechanics of matrix manipulation, and how to use matrices to formulate and solve sets of simultaneous linear equations. We won\'t cover linear algebr...
Date Added: 2009-06-06 17:58:50

Shap-6 Foreign Exch Mkt.ppt
Path: Villanova >> FIN >> 2335 Fall, 2009
Description: \"Rescue .for the Euro Falls Short.\" [New York Times, 9-24-00] x \"To the disappointment of many European bankers, American officials refrained from speaking out strongly in support of a stronger euro and raised doubts about their willingness to inter...
Date Added: 2009-06-06 17:59:01

Ex0730.txt
Path: Arizona >> RNR >> 613 Fall, 2008
Description: years,activity 0,5 0,6 0,7.5 0,9 0,9.5 0,11 5,16 6,16.5 8,11.5 10,16 12,25 13,25.5 17,25.5 18,23 19,26.5 ...
Date Added: 2009-06-06 17:59:32

Practice Problems Solutions2.pdf
Path: SUNY Buffalo >> CIE >> 429 Fall, 2009
Description: 212 Ketter Hall, North Campus, Buffalo, NY 14260 www.civil.buffalo.edu Fax: 716 645 3733 Tel: 716 645 2114 x 2400 CIE429 RC Design http:/civil.eng.buffalo.edu/cie429 Practice Problems Solutions 2 T Beams Instructor: Andrei M. Reinhorn P.E. Ph.D. P...
Date Added: 2009-06-06 18:00:16

Goldstein.pdf
Path: Stanford >> PUBS >> 10125 Fall, 2009
Description: The United States and the Republic of China, 19491978: Suspicious Allies Steven M. Goldstein February 2000 1 2 CONTENTS I. Allies of a Kind: 19501963 A. Overview B. Alliance Objectives -The United States -The ROC C. Alliance Management -The Unit...
Date Added: 2009-06-06 18:03:25

lec6.ps
Path: Harvard >> MATH >> 276 Fall, 2009
Description: %!PSAdobe2.0 %Title:MicrosoftWordMath276Lec %Creator:PrintMonitor %CreationDate:Wednesday,February24,1999 %Pages:(atend) %BoundingBox:? %PageBoundingBox:3031582761 %For:Taubes %DocumentProcSets:\"(AppleDictmd)\"710 %CopyrightAppleComputer,Inc.198992All...
Date Added: 2009-06-06 18:04:21

home2.doc
Path: CSU LA >> INSTRUCTIO >> 209 Fall, 2009
Description: Second Homework 1. The rents of some apartments in New York City are strictly regulated and are not allowed to rise. These are called rent controlled apartments. The rents in a different class of apartment are allowed to rise but the rate of increase...
Date Added: 2009-06-06 18:05:21

Week #1 Reader- 1of3.pdf
Path: Boston Architectural >> HT >> 110 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:05:54

practice3.pdf
Path: CSU Fresno >> MATH >> 151 Fall, 2009
Description: Math 151 Fall 2008 Practice problems for Test 3 The actual test will consist of 6 problems. You will have 1 hour to complete the test. 1. Prove that the intersection of two normal subgroups is normal. 2. Let G = GL2 (R), let H be the set of upper t...
Date Added: 2009-06-06 18:08:53

00000094.pdf
Path: Carnegie Mellon >> TERA >> 05101260 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:11:15

00000094.pdf
Path: Carnegie Mellon >> DISK >> 05101260 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:11:15

00000077.pdf
Path: Carnegie Mellon >> TERA >> 05101270 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:14:40

00000074.pdf
Path: Carnegie Mellon >> TERA >> 05101270 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:14:40

00000074.pdf
Path: Carnegie Mellon >> DISK >> 05101270 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:14:40

00000077.pdf
Path: Carnegie Mellon >> DISK >> 05101270 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:14:41

00000087.pdf
Path: Carnegie Mellon >> TERA >> 05101685 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:16:16

00000087.pdf
Path: Carnegie Mellon >> DISK >> 05101685 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:16:16

00000012.pdf
Path: Carnegie Mellon >> TERA >> 05101831 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:16:37

00000012.pdf
Path: Carnegie Mellon >> DISK >> 05101831 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:16:37

00000044.pdf
Path: Carnegie Mellon >> TERA >> 05101684 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:16:58

00000044.pdf
Path: Carnegie Mellon >> DISK >> 05101684 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:16:58

00000054.pdf
Path: Carnegie Mellon >> DISK >> 05102139 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:17:43

OCCUPATIONAL SEGREGATION.pdf
Path: Michigan State University >> LIR >> 891 Fall, 2008
Description: OCCUPATIONAL SEGREGATION DEFINITION SEX SEGREGATION IN THE WORKPLACE: Different distributions of men and women across occupation, jobs, and places of work (Padavic and Reskin, 2002). Basic Questions about Occupational Segregation: How does occup...
Date Added: 2009-06-06 18:23:17

Week06_PR_F05a_T21.xls
Path: USC >> CSCI >> 577 Fall, 2009
Description: Team Number: Week: Week End Date: Week End Date: Program Size (SLOC) Base Added Deleted Modified Reused # of COTS Total New SLOC Effort (Hours) Project Management Project Capabilities and Requirements COTS Assessment Design Life Cycle Planning Envior...
Date Added: 2009-06-06 18:23:36

Recitation13.pdf
Path: Midwestern State University >> ECONS >> 101 Fall, 2009
Description: RECITATION #13 Week 04/26/09 to 05/02/09 EXTERNALITIES AND PUBLIC GOODS CHAPTER 17 - EXTERNALITIES 1. Suppose there are just two firms in Smalltown and both of these firms emit pollution as part of their productive process. Firm A\'s marginal social...
Date Added: 2009-06-06 18:24:57

GTremblay_MScA-final_2004.pdf
Path: Stetson >> SYS >> 843 Fall, 2009
Description: COLE DE TECHNOLOGIE SUPRIEURE UNIVERSIT DU QUBEC MMOIRE PRSENT L\'COLE DE TECHNOLOGIE SUPRIEURE COMME EXIGENCE PARTIELLE L\'OBTENTION DE LA MATRISE EN GNIE DE LA PRODUCTION AUTOMATISE M.Ing. PAR GUILLAUME TREMBLAY OPTIMISATION D\'ENSEMBLES DE CLAS...
Date Added: 2009-06-06 18:26:30

MGS.ppt
Path: Wilfrid Laurier >> CPSC >> 605 Fall, 2009
Description: An overview of the MGS modeling system Min Zeng Department of Computer Science What is MGS A programming language for the simulation of biological processes Focus on dynamical systems with a dynamical structure Provide a unified view on several c...
Date Added: 2009-06-06 18:26:36

hand9.pdf
Path: Cleveland State >> C >> 53102 Fall, 2009
Description: Neuendorf Combinations and Permutations Combinations refer to collections of different events where order is not taken into account. Permutations are arrangements of a set of events in different orders. For example, the arrangements ABC and ACB repre...
Date Added: 2009-06-06 18:27:04

hand9.pdf
Path: Cleveland State >> C >> 53108 Fall, 2009
Description: Neuendorf Combinations and Permutations Combinations refer to collections of different events where order is not taken into account. Permutations are arrangements of a set of events in different orders. For example, the arrangements ABC and ACB repre...
Date Added: 2009-06-06 18:27:05

jamshidian.pdf
Path: Neumont >> H >> 6230 Fall, 2009
Description: Algorithme de Jamshidian pour la tarication doptions europennes sur obligations avec coue pons dans le cadre du mod`le de Vasicek e 1. Dans un premier temps, Vasicek [2] fournit le prix dune obligation coupon zro qui dcoule du mod`le quil propose : e...
Date Added: 2009-06-06 18:27:56

Lecture01.pdf
Path: University of Hawaii - Hilo >> ANTH >> 310 Fall, 2009
Description: Human Origins Prof. Michael Pietrusewsky Office Hours: Dean 207; Tues 3-4 PM and Wed 10-11 AM, or by appointment. mikep@hawaii.edu 1 Texts Reconstructing Human Origins by Glenn Conroy 2005 A Photographic Atlas for Physical Anthropology; Brief ...
Date Added: 2009-06-06 18:29:34

submit.txt
Path: Washington >> V >> 14000 Fall, 2009
Description: executable = allgamma_14052.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\v13r5\\jobs14000-14499/14...
Date Added: 2009-06-06 18:30:32

log.txt
Path: Washington >> V >> 14000 Fall, 2009
Description: 000 (29023.000.000) 12/05 07:29:12 Job submitted from host: <128.95.94.28:4757> . 001 (29023.000.000) 12/05 11:20:18 Job executing on host: <172.25.101.174:1158> . 006 (29023.000.000) 12/05 11:40:26 Image size of job updated: 418588 . 010 (29023.000....
Date Added: 2009-06-06 18:30:38

120sec8_2wsSP09.pdf
Path: Illinois State >> MAT >> 120 Fall, 2008
Description: Math 120 SP09 Brodnick 1. Section 8.2 Practice Bernoulli Trials & Binomial Random Variables 138 out of a group of 172 people are Bears fans. Suppose I randomly choose 30 people from the group of 172. a. What is the probability that 20 of them are B...
Date Added: 2009-06-06 18:30:59

HW1-D&S-2_2.pdf
Path: Eckerd >> EC >> 281 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:34:35

log.txt
Path: Washington >> V >> 14000 Fall, 2009
Description: 000 (29076.000.000) 12/05 07:29:29 Job submitted from host: <128.95.94.28:4757> . 001 (29076.000.000) 12/05 12:07:05 Job executing on host: <172.25.101.170:1094> . 006 (29076.000.000) 12/05 12:27:13 Image size of job updated: 454516 . 005 (29076.000....
Date Added: 2009-06-06 18:34:41

Chapter 7 - part 1.pdf
Path: UWO >> CEE >> 490 Fall, 2009
Description: CEE490b Chapter 7 Fatigue 7.1 General Repetitive loading of a structure during vibration may bring about its failure at a stress much lower than the static strength. Such a failure can often be attributed to a phenomenon called fatigue. This type ...
Date Added: 2009-06-06 18:35:10

log.txt
Path: Washington >> V >> 14000 Fall, 2009
Description: 000 (29041.000.000) 12/05 07:29:17 Job submitted from host: <128.95.94.28:4757> . 001 (29041.000.000) 12/05 11:26:51 Job executing on host: <172.25.101.190:1064> . 006 (29041.000.000) 12/05 11:46:59 Image size of job updated: 379588 . 006 (29041.000....
Date Added: 2009-06-06 18:36:27

DOfEd-single-sex.pdf
Path: North Texas >> CECS >> 0048 Fall, 2009
Description: POLICY AND PROGRAM STUDIES SERVICE Single-Sex Versus Coeducational Schooling: A Systematic Review 2005 U.S. DEPARTMENT OF EDUCATION DOC # 2005-01 OFFICE OF PLANNING, EVALUATION AND POLICY DEVELOPMENT Single-Sex Versus Coeducational Schooling: A ...
Date Added: 2009-06-06 18:36:49

sciences_agenda_20080515.pdf
Path: E. Michigan >> AGENDA >> 0708 Fall, 2009
Description: CAC-Sciences Subcommittee Meeting May 15, 2008 3:30 pm, 117 Mark Jefferson Approval of previous meeting\'s minutes Old Business: PDD 325 (Applied Statics and Strength of Materials Program Revision: BS, Polymers and Coatings Technology (CoT), clarifica...
Date Added: 2009-06-06 18:40:57

Cyclone pictures.pdf
Path: UNC >> ENVR >> 251 Fall, 2008
Description: ...
Date Added: 2009-06-06 18:42:13

exam1_2004.ps
Path: Boise State >> MATH >> 301 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: exam1.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR10 CMSS12 CMMI10 CMSY10 CMMI7 CMSY7 CMR7 CMEX10 %+ CMMIB10 CMBX10 %EndComments %DV...
Date Added: 2009-06-06 18:44:45

assign06.docx
Path: W. Florida >> CGS >> 1570 Fall, 2009
Description: CGS 1570 Excel Chapter 1 Assignment 6 Name: _ Section (Time/Day): _ Printouts Note: Download the files required for the text and store them on your media (preferably a USB drive) The files required for this assignment are found in the directory E...
Date Added: 2009-06-06 18:48:40

midtermmark.txt
Path: Maple Springs >> MATH >> 4130 Fall, 2009
Description: Ass1 Mid (/100) (/60) 65423 65 24 79672 62375 95 50 50938 95 45 43724 95 51 7628 95 50 98848 100 59 12701 95 37 47512 95 59 66035 75 44 4287 95 49 66843 95085 95 46 94117 95 54 99119 95 56 74268 95 41 94524 95 52 7950 95 32 76361 95 60 4...
Date Added: 2009-06-06 18:50:14

brodkey writing on the bias.pdf
Path: Western Washington >> STEVENS >> 301 Fall, 2009
Description: ...
Date Added: 2009-06-06 18:51:09

Handout 18, Hume I (Derk Pereboom).doc
Path: Cornell >> AC >> 385 Fall, 2009
Description: 1Philosophy 212: Hume and Kant Definitions of key notions 1. The analytic/synthetic distinction. (A6/B10ff) Kant\'s concept-containment characterization: a true subject/predicate judgment is analytically true if and only if the concept of the predica...
Date Added: 2009-06-06 18:52:38

7033AxialDispersionProblem.xls
Path: Tulsa >> CHE >> 7033 Fall, 2009
Description: Isothermal Axial Dispersion with First Order Rxn epsilon Us dp rho-bed Peclet-a k Dea Ca0 L coefficients of D.E. alpha beta roots of D.E. m1 m2 Other parameters m1-m2 (Apha^2+4Beta)^1/2 0.4 0.01 meter/s 0 meters 1200 kg/m^3 1.2 2 1.00E-05 m^3/kg-cat/...
Date Added: 2009-06-06 18:52:41

quiz3.doc
Path: Dallas >> POST >> 883 Fall, 2009
Description: QUIZ #3 NAME: _ PARKING CITATION CODES: (Describe the offense) 101 404 405 407 408 _ _ _ _ _ 410 411 501 502 503 __ _ _ _ _ DATE: _ PARKING CITATION CODES: (Fill in the fine amount) 101 _ 410 _ 404 _ 411 _ 405 _ 501 _ 407 _ 502 _ 408 _ 503 _ PARKI...
Date Added: 2009-06-06 18:52:55

W-11 VerticalOrganization&Transactions.doc
Path: Penn State >> R >> 420 Fall, 2009
Description: Agribusiness Management 420 Fall Semester 2009 Prof. Robert D. Weaver Exercise 9 Hardcopy Due Thursday in class, Week #12 Softcopy due in drop box before class, see file naming guidelines on Assignment Guidelines. Topic: Describe the organization of ...
Date Added: 2009-06-06 18:53:09

SYLLABUS CE 209.doc
Path: CUNY Baruch >> CE >> 209 Fall, 2009
Description: CE 209 Structural and Site Plans Objectives: Learn to graphically communicate information for civil engineering projects, learn to visualize in three dimensions from two-dimensional representation; learn practical aspects of construction. At end of c...
Date Added: 2009-06-06 18:55:13

CHAPTER 3.ppt
Path: Rogers State >> POLS >> 1113 Fall, 2009
Description: FEDERALISM Federal System - divides government authority between a national and state governments Unitary System - places formal authority in the central government Confederal System - places authority in the hands of state governments. The framer...
Date Added: 2009-06-06 18:56:10

cntrvs.pdf
Path: Michigan >> STAT >> 425 Fall, 2009
Description: 2 C wE 9 2 a p(Q4 6 P7 P E C wE ea P 9 W P f d 96 ` TQE a 6 !a 8DW a 2 a pF4 Y S7 7S P 9 2 v P P 2 Tw2 a Tw2 w7 u (XQE a hF4 Y 7 06 P 6 26S7 iW 6 P @p7 a QG2 f y @(X6 x Tw2 w2 a p7 u t0 s Y 97 0 v P P v 7 iW P 6S @TQE a h3P f g r6 a Tp7...
Date Added: 2009-06-06 18:56:23

coop-learn.wk1.eng110.sp09.doc
Path: Monmouth IL >> ENGLISH >> 110 Fall, 2008
Description: English 110: Solberg Cooperative Learning (Teamwork) Guidelines In our course, we will use a form of team work based on a method called Cooperative Learning. Here is some helpful information about it: Some myths about cooperative learning: One perso...
Date Added: 2009-06-06 18:56:55

veto_0.40mip_veto_rib_B.ps
Path: Stanford >> EXP >> 060809 Fall, 2009
Description: %!PS-Adobe-2.0 %Title: vetoOut/veto_0.40mip_veto_rib_B.ps: rib_B %Creator: ROOT Version 5.10/00 %CreationDate: Tue Sep 12 11:44:53 2006 %Orientation: Landscape %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} d...
Date Added: 2009-06-06 18:57:38

vetoFits_latest_garc_68.ps
Path: Stanford >> EXP >> 060909 Fall, 2009
Description: %!PS-Adobe-2.0 %Title: vetoFits_latest_garc_68.ps (Landscape A 4) %Pages: (atend) %Creator: ROOT Version 4.02/00 %CreationDate: Tue Sep 12 15:15:37 2006 %EndComments %BeginProlog /s {stroke} def /l {lineto} def /m {moveto} def /t {translate} def /sw ...
Date Added: 2009-06-06 18:57:51

AcdMip_gain.txt
Path: Stanford >> EXP >> 135005424 Fall, 2009
Description: #SYSTEM = acdCalib #instrument= LAT #timestamp = Wed Jan 18 17:05:53 2006 #calibType = ACD_ElecGain #fmtVersion = v1r0p0 #startTime = 135005424:1 #stopTime = 135005424:447360 #triggers = 407003/447360 #source = 0 #mode = 0 #START TILE PMT PEAK WIDTH ...
Date Added: 2009-06-06 18:59:29

r0237681823_ped.txt
Path: Stanford >> EXP >> 080713 Fall, 2009
Description: #SYSTEM = acdCalib #instrument= #timestamp = 2008-07-25 22:02:39 UTC #calibType = 0 #algorithm = MeanValue #startTime = 2.37682e+08 #endTime = 2.37688e+08 #triggers = 9961 #DTDVersion = v3 #fmtVersion = v3 #inputDigiFile = root:/glast-rdr.slac.st...
Date Added: 2009-06-06 19:01:40

r0237681823_ped.txt
Path: Stanford >> PED >> 080713 Fall, 2009
Description: #SYSTEM = acdCalib #instrument= #timestamp = 2008-07-25 22:02:39 UTC #calibType = 0 #algorithm = MeanValue #startTime = 2.37682e+08 #endTime = 2.37688e+08 #triggers = 9961 #DTDVersion = v3 #fmtVersion = v3 #inputDigiFile = root:/glast-rdr.slac.st...
Date Added: 2009-06-06 19:01:41

00000110.pdf
Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:04:08

00000229.pdf
Path: Carnegie Mellon >> DISK >> 31004972 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:04:31

00000006.pdf
Path: Carnegie Mellon >> DISK >> 31003847 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:05:23

00000144.pdf
Path: Carnegie Mellon >> DISK >> 31003471 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:06:58

00000282.pdf
Path: Carnegie Mellon >> DISK >> 31004639 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:09:17

00000010.pdf
Path: Carnegie Mellon >> TERA >> 31005936 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:10:11

00000010.pdf
Path: Carnegie Mellon >> DISK >> 31005936 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:10:11

00000127.pdf
Path: Carnegie Mellon >> TERA >> 31005936 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:11:37

00000127.pdf
Path: Carnegie Mellon >> DISK >> 31005936 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:11:37

00000151.pdf
Path: Carnegie Mellon >> TERA >> 31004003 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:12:44

00000151.pdf
Path: Carnegie Mellon >> DISK >> 31004003 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:12:44

00000270.pdf
Path: Carnegie Mellon >> TERA >> 31004003 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:13:19

00000270.pdf
Path: Carnegie Mellon >> DISK >> 31004003 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:13:20

00000042.pdf
Path: Carnegie Mellon >> TERA >> 05103079 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:13:59

00000042.pdf
Path: Carnegie Mellon >> DISK >> 05103079 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:13:59

00000054.pdf
Path: Carnegie Mellon >> DISK >> 31003475 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:15:13

00000142.pdf
Path: Carnegie Mellon >> DISK >> 31004004 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:16:18

00000384.pdf
Path: Carnegie Mellon >> DISK >> 31004004 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:17:15

00000339.pdf
Path: Carnegie Mellon >> DISK >> 31005769 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:18:24

00000121.pdf
Path: Carnegie Mellon >> DISK >> 31004302 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:19:00

00000153.pdf
Path: Carnegie Mellon >> DISK >> 31004302 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:19:06

00000224.pdf
Path: Carnegie Mellon >> DISK >> 31004302 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:19:20

00000112.pdf
Path: Carnegie Mellon >> DISK >> 31004642 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:20:40

00000112.pdf
Path: Carnegie Mellon >> TERA >> 31004642 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:20:40

00000387.pdf
Path: Carnegie Mellon >> TERA >> 31004642 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:22:03

00000387.pdf
Path: Carnegie Mellon >> DISK >> 31004642 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:22:03

00000028.pdf
Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:22:34

00000057.pdf
Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:22:39

00000065.pdf
Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:22:41

00000347.pdf
Path: Carnegie Mellon >> DISK >> 31003450 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:23:34

00000134.pdf
Path: Carnegie Mellon >> TERA >> 31004613 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:26:55

00000134.pdf
Path: Carnegie Mellon >> DISK >> 31004613 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:26:55

00000170.pdf
Path: Carnegie Mellon >> DISK >> 31004072 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:28:22

00000292.pdf
Path: Carnegie Mellon >> DISK >> 31004072 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:28:46

00000096.pdf
Path: Carnegie Mellon >> DISK >> 31004225 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:33:20

00000147.pdf
Path: Carnegie Mellon >> DISK >> 31004225 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:33:29

00000025.pdf
Path: Carnegie Mellon >> TERA >> 31004980 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:35:18

00000025.pdf
Path: Carnegie Mellon >> DISK >> 31004980 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:35:18

00000040.pdf
Path: Carnegie Mellon >> TERA >> 31004980 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:35:22

00000040.pdf
Path: Carnegie Mellon >> DISK >> 31004980 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:35:22

00000253.pdf
Path: Carnegie Mellon >> DISK >> 31005138 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:36:19

00000254.pdf
Path: Carnegie Mellon >> DISK >> 31005138 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:36:19

00000046.pdf
Path: Carnegie Mellon >> TERA >> 05102567 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:37:57

00000046.pdf
Path: Carnegie Mellon >> DISK >> 05102567 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:37:57

00000157.pdf
Path: Carnegie Mellon >> DISK >> 31005134 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:38:33

00000059.pdf
Path: Carnegie Mellon >> DISK >> 31004494 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:39:51

00000168.pdf
Path: Carnegie Mellon >> DISK >> 31004494 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:40:13

00000407.pdf
Path: Carnegie Mellon >> DISK >> 31004494 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:40:58

00000469.pdf
Path: Carnegie Mellon >> DISK >> 31004494 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:41:10

00000001.pdf
Path: Carnegie Mellon >> DISK >> 31004640 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:41:15

00000179.pdf
Path: Carnegie Mellon >> DISK >> 31004640 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:41:49

00000221.pdf
Path: Carnegie Mellon >> DISK >> 31004640 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:41:57

00000364.pdf
Path: Carnegie Mellon >> DISK >> 31004640 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:42:26

00000026.pdf
Path: Carnegie Mellon >> DISK >> 31005137 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:43:48

00000158.pdf
Path: Carnegie Mellon >> DISK >> 31005137 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:44:15

Economimesis.pdf
Path: Colorado >> ENVD >> 4114 Fall, 2008
Description: ...
Date Added: 2009-06-06 19:44:42

00000203.pdf
Path: Carnegie Mellon >> DISK >> 31004637 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:46:15

00000236.pdf
Path: Carnegie Mellon >> DISK >> 31004637 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:46:21

00000002.pdf
Path: Carnegie Mellon >> TERA >> 31005133 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:46:24

00000002.pdf
Path: Carnegie Mellon >> DISK >> 31005133 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:46:24

00000059.pdf
Path: Carnegie Mellon >> DISK >> 31004976 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:47:16

00000080.pdf
Path: Carnegie Mellon >> DISK >> 31004606 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:47:51

00000058.pdf
Path: Carnegie Mellon >> TERA >> 31004634 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:48:46

00000058.pdf
Path: Carnegie Mellon >> DISK >> 31004634 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:48:46

00000189.pdf
Path: Carnegie Mellon >> TERA >> 31004634 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:49:25

00000189.pdf
Path: Carnegie Mellon >> DISK >> 31004634 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:49:25

00000046.pdf
Path: Carnegie Mellon >> DISK >> 31003173 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:51:12

00000094.pdf
Path: Carnegie Mellon >> DISK >> 31003173 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:51:21

00000366.pdf
Path: Carnegie Mellon >> DISK >> 31005136 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:52:45

00000066.pdf
Path: Carnegie Mellon >> DISK >> 31003467 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:53:00

00000135.pdf
Path: Carnegie Mellon >> DISK >> 31003467 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:53:13

00000173.pdf
Path: Carnegie Mellon >> DISK >> 31003467 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:53:21

00000183.pdf
Path: Carnegie Mellon >> DISK >> 31003467 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:53:23

00000022.pdf
Path: Carnegie Mellon >> DISK >> 31006116 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:53:44

00000207.pdf
Path: Carnegie Mellon >> DISK >> 31004002 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:54:40

00000300.pdf
Path: Carnegie Mellon >> DISK >> 31004636 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:57:54

00000346.pdf
Path: Carnegie Mellon >> DISK >> 31004636 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:58:04

00000375.pdf
Path: Carnegie Mellon >> DISK >> 31004636 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:58:11

00000285.pdf
Path: Carnegie Mellon >> DISK >> 31003169 Fall, 2009
Description: ...
Date Added: 2009-06-06 19:59:34

00000015.pdf
Path: Carnegie Mellon >> DISK >> 31003171 Fall, 2009
Description: ...
Date Added: 2009-06-06 20:00:24

00000197.pdf
Path: Carnegie Mellon >> DISK >> 31003171 Fall, 2009
Description: ...
Date Added: 2009-06-06 20:01:03

ass2sols.pdf
Path: Allan Hancock College >> MATH >> 1061 Fall, 2009
Description: u u v u v y l g \' o{gS u y v WxlfWYjf{qxb \' t F F rB q@ 8 F g % 6 3B%@ I c \' ` 6 3BU@ bsXbXB QpiqR5FQfAeb`baYFXWVGE w jGW{lg(ihf{|nxu w y k g w t y g l t (b\"fiy{iwWyW ( (iwXjo Ws V el y e t y...
Date Added: 2009-06-06 20:03:05

f08_summ4.doc
Path: Wisc La Crosse >> PHY >> 155 Fall, 2009
Description: PHY 155 New Material for Final Exam (Fall 2008) You will receive a separate Study Guide to help you with the cumulative portion of the Final Exam. See that Study Guide for details of Exam Format, and further advice on what to study and various res...
Date Added: 2009-06-06 20:03:27

session39.pdf
Path: Purdue >> EE >> 538 Fall, 2008
Description: ...
Date Added: 2009-06-06 20:04:30

hw-8.txt
Path: Oregon State >> CS >> 321 Fall, 2008
Description: CS 321: Homework 8 This homework does not need to be handed in. But it is strongly suggested that you work out these solutions to prepare for the final. Section 9.2: 5c, 8 Section 12.1: 3, 5, 7 ...
Date Added: 2009-06-06 20:05:35

Lec26.pdf
Path: N.C. State >> ST >> 421 Fall, 2008
Description: ...
Date Added: 2009-06-06 20:07:02

Section 2.6.doc
Path: U. Houston >> MATH >> 1313 Fall, 2008
Description: Math 1313 Section 2.6 The Inverse of a Square Matrix In this section we discuss a procedure for finding the inverse of a matrix and show how the inverse can be used to help us solve a system of linear equations. Let A be a square matrix of size n. A ...
Date Added: 2009-06-06 20:08:13

HotelBookings.txt
Path: Allan Hancock College >> ITC >> 327 Fall, 2009
Description: srjava.util.Vector}[;IcapacityIncrementIelementCount[elementDatat[Ljava/lang/Object;xpur[Ljava.lang.Object;Xs)lxp srBooking@N.cI bookingIdIroomIdLbookieFirstNametLjava/lang/String;LbookieLastNameq~LbookiePhoneq~LendDateq~L startDateq~xptFtq~ t 1/04/2...
Date Added: 2009-06-06 20:08:27

homework1.pdf
Path: Emory >> POLS >> 508 Fall, 2008
Description: POLS 508, Fall 2005 Prof. Eric Reinhardt Sept 12, 2005 Assignment # 1 Due: Fri, Sept 16, 2005 at beginning of lab session For this assignment, you must write a codebook to an existing or proposed (i.e., nonexistent) dataset. First, choose a dataset. ...
Date Added: 2009-06-06 20:08:33

Marti04.pdf
Path: Mich Tech >> CS >> 6461 Fall, 2008
Description: Limited Reputation Sharing in P2P Systems Sergio Marti and Hector Garcia-Molina Stanford University {smarti, hector}@cs.stanford.edu ABSTRACT The increasing popularity of resource exchange through peerto-peer networks has encouraged the developmen...
Date Added: 2009-06-06 20:08:33

ece311_spring2004_q1_v1.pdf
Path: Ill. Chicago >> EECS >> 265 Fall, 2009
Description: 1. Given: sPM (t ) = A cos( ct + k p cos( mt ) (State your answers in terms of A , c , k p and m ) a) What is the power of sPM (t ) ? b) What is the instantaneous phase of sPM (t ) , in radians? c) What is the instantaneous frequency of sPM (t...
Date Added: 2009-06-06 20:09:21

query-proc1.pdf
Path: GWU >> CS >> 178 Fall, 2009
Description: 1 Database Design: Query Processing The DBMS will have several options for organizing data and process of physical database design involves choosing the particular data organization techniques that best suit the given application requirements from a...
Date Added: 2009-06-06 20:12:00

final92.pdf
Path: UF >> AEB >> 6553 Fall, 2008
Description: (1) Points (_/20) This spring Pepsi Cola started a new promotional program that incorporated both national television advertising, in-store promotions, and free distribution of a case of Diet Pepsi to selected consumers. Last week a national telephon...
Date Added: 2009-06-06 20:12:11

Timothy.Alderdice.doc
Path: Murray State KY >> CAMPUS >> 415 Fall, 2009
Description: COBOL By Timothy Alderdice For CSC 415 An examination of one of the oldest and most used programming languages in existence. 1.0 History 1.1 FLOW-MATIC - The only major business language predecessor to COBOL was the language FLOW-MATIC. The idea for ...
Date Added: 2009-06-06 20:13:14

ECE 205a Assignment 2.doc
Path: UWO >> ECE >> 205 Fall, 2009
Description: 2.20 Find V_af and V_ec in the circuit below: 2.28 Find V_1 in the circuit below: 2.36 Find I_L in the network below: 2.59 If the power absorbed by the 4-k resistor in the network below is 36 mW, find I_0. 2.83 A single-stage transistor amplifier...
Date Added: 2009-06-06 20:13:20

MedievalChronology.doc
Path: CUNY Baruch >> MUS >> 105 Fall, 2009
Description: CHRONOLOGY OF MEDIEVAL WORKS STUDIED IN MUSHL 105 _ 800 900 1000 1100 1200 13001400 __ Antiphon MONOPHONY Psalm Alleluia _ Organum (early) Leonin Motet Vitry Machaut Jacopo __ Kyrie Sequence Bernart POLYPHONY ...
Date Added: 2009-06-06 20:15:02

ECE722_HW2_sol.doc
Path: George Mason >> INFT >> 841 Fall, 2009
Description: ECE 722, Spring 2008 Solution of Homework #2 1. Look at the five properties of the fundamental matrix on pp. 36-37. Let F be a constant matrix. a) rewrite those five properties in terms of exp(Ft) and b) prove, using the series definition of exp(Ft)...
Date Added: 2009-06-06 20:16:44

CSE131 2007-11-08 Set ADT implementations (continued).pdf
Path: Washington University in St. Louis >> CS >> 131 Fall, 2009
Description: ...
Date Added: 2009-06-06 20:17:29

K-Transactions.ppt
Path: UPenn >> CIS >> 555 Fall, 2009
Description: Distributed Transactions and Security University of Pennsylvania CIS 455 / 555 Internet and Web Systems Zachary G. Ives April 16, 2009 Recall: LockBased Concurrency Control Strict Twophase Locking (Strict 2PL) Protocol: Each transaction must...
Date Added: 2009-06-06 20:17:45

SamTest3.pdf
Path: Lafayette >> WW >> 111 Fall, 2009
Description: Sample Test 3 This is a closed-note, closed-book test. Do all four problems. Show all your work. The way you work the problem will count as much as the correct answer. You must work on your own on this test and are expected to follow the normal gui...
Date Added: 2009-06-06 20:19:30

8221_Wk8_bsfb_lec.pdf
Path: Minnesota >> NEUROSCI >> 8221 Fall, 2009
Description: Brainstem, Thalamic and Cortical Mechanisms of Nociception Outline of the Lecture I. Brainstem A. Dorsal Column Nuclei 1. Input and output 2. Response characteristics () main points: many Lts, some nociceptive, role uncertain Ferrington et al 1988 ...
Date Added: 2009-06-06 20:20:31

mar03.pdf
Path: Goucher >> CS >> 200 Spring, 2009
Description: Computer and Network Security Tom Kelliher, CS 200 Mar. 3, 2005 1 Administrivia Announcements Assignment Read: Chapter 7. Turn in answers to these questions: 6, 9, 23. From Last Time Privacy. Coming Up Computer reliability. 2 Chapter Summary 1...
Date Added: 2009-06-06 20:20:43

mar10.pdf
Path: Goucher >> CS >> 200 Spring, 2009
Description: Computer Reliability Tom Kelliher, CS 200 Mar. 10, 2005 1 Administrivia Announcements Assignment Read: Chapter 8. Turn in answers to these questions: 2, 5, 10. From Last Time Computer and Network (In)Security Coming Up Work and Wealth 2 Chapte...
Date Added: 2009-06-06 20:20:43

tr810.pdf
Path: Carnegie Mellon >> TR >> 810 Fall, 2009
Description: A Bayesian Hierarchical method for fitting multiple health endpoints in a toxicity study Taeryon Choi,1 Mark J. Schervish,1 Ketra A. Schmitt2 and Mitchell J. Small2 1 Department of Statistics, Carnegie Mellon University, Pittsburgh, PA 15213 2 Dep...
Date Added: 2009-06-06 20:24:11

Review_07-11.pdf
Path: Delaware >> ELEG >> 212 Spring, 2008
Description: ...
Date Added: 2009-06-06 20:25:19

mism2311 test#1.doc
Path: Dallas >> RKM >> 010300 Fall, 2009
Description: Quiz #5 MISM2311 Spring 2000 Date: February 17, 2000 Name: _ Email Address: _ Have you done weekly Email Feedback: _ (Your Initial here). (Please try to do it after class and by Monday) Example: Evaluate the C expression step by step as shown be...
Date Added: 2009-06-06 20:27:51

mism2311 test#1.doc
Path: Dallas >> MISM >> 010300 Fall, 2009
Description: Quiz #5 MISM2311 Spring 2000 Date: February 17, 2000 Name: _ Email Address: _ Have you done weekly Email Feedback: _ (Your Initial here). (Please try to do it after class and by Monday) Example: Evaluate the C expression step by step as shown be...
Date Added: 2009-06-06 20:27:51

presentation_rubric.pdf
Path: Oregon State >> ECE >> 323 Spring, 2008
Description: Final Presentation Guidelines and Grading Group Size: Groups may be 1 or 2 people. Time: Groups should plan 7-8 minutes for presentation and 2-4 minutes for questions directly following the presentation. You will be given a 1 minute warning at 7 minu...
Date Added: 2009-06-06 20:28:26

ex9-36.txt
Path: Duke >> CH >> 113 Spring, 2009
Description: \"Fabric\" \"U\" \"A\" 1 36.4 28.5 2 55 20 3 51.5 46 4 38.7 34.5 5 43.2 36.5 6 48.8 52.5 7 25.6 26.5 8 49.8 46.5 ...
Date Added: 2009-06-06 20:30:42

YOR346W.t2k.str2-logo.pdf
Path: UCSC >> YOR >> 346 Fall, 2009
Description: 4 3 2 1 C GG HHT X X T G S H H TCHSSHCCCSSSCTCTTSS S C T TCS HHHHC T T S T CSCHHCSTSBSGSTSTTSS S T G B T G B T S T G B S T T S TTSSSZ T G T G S C C H C G H G C G H G H G C Z H T T H H H H H T H T C TCXXXHXXXXXSHX X XH X X X X X XXXXXXXXXXXXXXHXXXXX...
Date Added: 2009-06-06 20:32:01

YOR355W.t2k.dssp-ehl2-logo.pdf
Path: UCSC >> YOR >> 355 Fall, 2009
Description: YOR355W.t2k DSSP-EHL2 1 C C C C C E E C E E X X X X X X X X X X X X 10 20 30 40 H 1 T S E T E T T 51 60 70 80 90 T 1 C T T H T E H E E H E E E E H H E H H H H H H X X X X X X X X X X X X X H 1 CCHHHHHHCCCCCCCCCCCC C C C H ...
Date Added: 2009-06-06 20:32:18

YOR344C.t2k.stride-ebghtl-logo.pdf
Path: UCSC >> YOR >> 344 Fall, 2009
Description: YOR344C.t2k EBGHTL 2 1 CC TTTT X TTTCCTC TTTCCCTTTT TTTCCTTT CTT T G TTTXCCCCCCCTTCTXCXCCCCTTCCCCCCCCCCTTTCCCCCCCGTCTCC XX X XXX X X XXXXXXXXXXXXXXX X X X X X X B CC T X X X G E E E E E X X X X TTCT C T TTTT 30 G G G H H X X H H H H X X X X ...
Date Added: 2009-06-06 20:32:29

YOR304C-A.t2k.dssp-ebghstl-logo.pdf
Path: UCSC >> YOR >> 304 Fall, 2009
Description: YOR304C-A.t2k EBGHSTL 3 2 1 CC X 10 20 30 40 H 3 2 1 H E H HH 51 C H HCT HHT T C T T T C C H X X X XTXSXTCCXXXXXXXXTTTTSX X X X X X X X X T T C X 60 70 C HHHH HH HHH RQ MKE NDDEFSRS IQAIEDKLNKMSR X HH HHHHHHH C X 50 1 E EE H HHHH ...
Date Added: 2009-06-06 20:32:41

20071115_f03o_072128.pdf
Path: Stanford >> CUTR >> 1037 Fall, 2009
Description: Case 3:07-cv-02128-VRW Document 38 Filed 11/15/2007 Page 1 of 2 1 2 3 4 5 6 7 8 9 10 11 PETER A. BINKOW (State Bar No.173848) KARA M. WOLKE (State Bar No. 241521) GLANCY BINKOW & GOLDBERG LLP 1801 Avenue of the Stars, Suite 311 Los Angeles, Cali...
Date Added: 2009-06-06 20:33:13

05p1.pdf
Path: Oregon State >> ECE >> 679 Fall, 2008
Description: Internet Security Protocols 1 Outline of Course 1. Introduction 2. Secure TCP/IP Protocols (IPSec) 3. Secure Sockets Layer (SSL), Transport Layer Security (TLS) 4. Secure HTTP 5. Basic WWW Security 2 Protocol Stack at Outset What we have to star...
Date Added: 2009-06-06 20:33:21

CHOMP SQUAD 8.pdf
Path: San Diego State >> ART >> 445 Fall, 2009
Description: CHOMP SQUAD l lciromp smile c romp romp a n h o m p stomp stomp stomp s q SQUAD alliance CHOMP om smile smile smilesmile smile chomp smile chomp chomp smile smile smile smile l l i smile c ha n c CHOMP m p SQUAD o stomp salliance alliance rompc cho...
Date Added: 2009-06-06 20:35:08

SMILE 2.pdf
Path: San Diego State >> ART >> 445 Fall, 2009
Description: CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD ...
Date Added: 2009-06-06 20:35:09

Chapter 1.ppt
Path: Nicholls State >> BIOL >> 551 Fall, 2009
Description: Chapter 1: The Scope of Ecology Levels of Organization Biosystems are interactions between biotic and abiotic components. Can be studied at any level Fungi-algae = lichen; host-parasite (>population, <community) Typical Areas of Ecology Hierarc...
Date Added: 2009-06-06 20:35:52

WS1.5B.2.pdf
Path: Arizona >> M >> 124 Fall, 2009
Description: 3. Find the exactvaluefor cscA. h{G/ Utufr = -r{R 3 4. Solvefor the variable (ifpossible)so that 0 < variable( z. Express your answer radians. in A. l+tan v ^ \"=0 sin y tt \ ^(q): l/ C t^13). * | .- J U B. 2 co s2 t-16=0 Qou s t = i ( a c ...
Date Added: 2009-06-06 20:38:09

process_arrival.pdf
Path: Fayetteville State University >> CIS >> 5930 Fall, 2009
Description: PROCESS ARRIVAL PATTERN FOR MPI COLLECTIVE OPERATIONS Based on Paper A Study of Process Arrival Patterns for MPI Collective Operations Presenter: Zheng Gu Objective of this study What are the process arrival patterns in practical MPI programs Whet...
Date Added: 2009-06-06 20:39:28

cem181f08e1pracA.pdf
Path: Michigan State University >> CEM >> 181 Fall, 2009
Description: ...
Date Added: 2009-06-06 20:39:29

StDevWorksheet.doc
Path: Juniata >> MA >> 103 Fall, 2008
Description: i 1 2 3 4 5 6 7 xi xi-mean (xi-mean)2 sum = sum/(n-1) = std. dev. = i 1 2 3 4 5 6 7 xi xi-mean (xi-mean)2 sum = sum/(n-1) = std. dev. = ...
Date Added: 2009-06-06 20:43:47

games.txt
Path: Wisconsin >> HOMEPAGES >> 1977 Fall, 2009
Description: 09/02/1977 Penn State 45 Rutgers 7 09/03/1977 Alabama State 6 Jackson State 17 09/03/1977 Alcorn State 7 Central Michigan 39 09/03/1977 Be...
Date Added: 2009-06-06 20:45:34

output.txt
Path: Washington >> JOBS >> 70000 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3900 02/17/2008 12:03 AM <DIR> . 02/17/2008 12:03 ...
Date Added: 2009-06-06 20:47:00

log.txt
Path: Washington >> JOBS >> 70000 Fall, 2009
Description: 000 (59906.000.000) 02/16 21:20:23 Job submitted from host: <128.95.94.28:1092> . 001 (59906.000.000) 02/16 21:22:21 Job executing on host: <172.25.101.41:1057> . 006 (59906.000.000) 02/16 21:42:30 Image size of job updated: 333856 . 005 (59906.000.0...
Date Added: 2009-06-06 20:47:53

log.txt
Path: Washington >> JOBS >> 70000 Fall, 2009
Description: 000 (60011.000.000) 02/16 21:20:49 Job submitted from host: <128.95.94.28:1092> . 001 (60011.000.000) 02/16 21:25:32 Job executing on host: <172.25.101.93:1057> . 006 (60011.000.000) 02/16 21:45:40 Image size of job updated: 290548 . 006 (60011.000.0...
Date Added: 2009-06-06 20:49:48

submit.txt
Path: Washington >> JOBS >> 70000 Fall, 2009
Description: executable = pass6_70478.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs70000-70499/70478...
Date Added: 2009-06-06 20:50:27

Assignment 1 -Indy Faculty Club - Solution.doc
Path: IUPUI >> NEWCPT >> 288 Fall, 2009
Description: Assignment 1 Preferred Solution Indy Faculty Club Campus (CampusID, CampusName, Street, City, State, Zip, Phone, CampusDiscount) Members (Member ID, LastName, FirstName, CampusAddress, CampusPhone, CampusID, PositionID, ContactDuration) SK Last Name...
Date Added: 2009-06-06 20:51:14

log.txt
Path: Washington >> JOBS >> 70000 Fall, 2009
Description: 000 (60290.000.000) 02/16 21:22:22 Job submitted from host: <128.95.94.28:1092> . 001 (60290.000.000) 02/17 00:53:22 Job executing on host: <172.25.101.185:1056> . 006 (60290.000.000) 02/17 01:13:30 Image size of job updated: 396056 . 005 (60290.000....
Date Added: 2009-06-06 20:51:39

error.txt
Path: Washington >> JOBS >> 70415 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 01:01:15 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 02:22:58 2008 ( 4903 s elapsed) ...
Date Added: 2009-06-06 20:53:31

dp12_sp08.pdf
Path: St. Augustine NC >> DP >> 1212 Fall, 2009
Description: CHEM 1212 Daily Problem 12 Sp08 Name: _ Score: _ 1) Imagine some reaction is found to be 9th order, overall. What would the units be for the rate constant? Describe how you obtained your result. 2) The following experiments were completed on th...
Date Added: 2009-06-06 20:55:17

Oct 2008 Wasps have mite bodyguards REVIEW.pdf
Path: Acton School of Business >> BIOS >> 201 Fall, 2008
Description: Current Biology Vol 18 No 18 R866 together with other independent but overlapping pathways, such as PIP3 signalling, to produce co-ordinated changes in the cell structure. Indeed, different combinations of signals may also make the cell respond diff...
Date Added: 2009-06-06 20:55:48

rss1b-log.txt
Path: Harvard >> CSCIE >> 153 Fall, 2009
Description: file:/home/cscie153/htdocs/lecture_notes/examples_5/rss1b.xsl Line #9, Column #27: template match=\'/\' file:/home/cscie153/htdocs/lecture_notes/examples_5/rss1b.xsl Line #10, Column #27: apply-templates, select=\'null\': 400001: rss null Line #0,...
Date Added: 2009-06-06 20:57:48

3711 syllabus spring 2007 final.doc
Path: Minnesota >> PSY >> 3711 Fall, 2008
Description: UNIVERSITY OF MINNESOTA Psychology Department, Spring 2007 Tuesday & Thursday 9:45 11:00am, Vincent Hall, Room 16 PSYCHOLOGY 3711 INTRODUCTION TO INDUSTRIAL AND ORGANIZATIONAL PSYCHOLOGY _ Instructor Phone E-mail TAs: Amy C. Hooper 612-625-3529 die...
Date Added: 2009-06-06 20:58:15

(6) 8TAP & Stereotypes (fall 06)_WEB.pdf
Path: Minnesota >> PSY >> 3301 Fall, 2008
Description: Overview Transracial Adoption Paradox Fall 2006 Definition and History Domestic Transracial Adoption vs. International Transracial Adoption Brief Historical Background Transracial Adoption Research Psychological Outcome Studies Racial & Ethnic Ide...
Date Added: 2009-06-06 20:59:06

lecture 5 1 30 design, phys.pdf
Path: Minnesota >> PSY >> 5138 Spring, 2008
Description: Menu 1/30/07 Announcements About the review of a research report On physical aspects of aging More on research design Physical and sensory aspects of aging Summary of physical and sensory changes Y 1-appearance and mobility Y 2- sensory systems...
Date Added: 2009-06-06 20:59:21

fidler1977.pdf
Path: Stanford >> CBIO >> 101 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:01:16

cbio101 lecture19.pdf
Path: Stanford >> CBIO >> 101 Fall, 2009
Description: Cancer Epidemiology and Prevention Cancer Biology 101 June 3, 2008 Joe Lipsick Epidemiology study of the distribution and determinants of disease Goals of Epidemiology Describe regional & temporal trends in disease occurrence groups at high risk...
Date Added: 2009-06-06 21:02:01

jeffcathylauren.txt
Path: Duke >> CPS >> 004 Fall, 2009
Description: ATC ATC ATC ATC xxx ATC ATC ATC xxx - - 4 3 if chunk-size = 3 and threshold = 2 report 2 (both bigger) if chunk-size = 3 and threshold = 3 report 1 (only first repeat-seq) - AAGG AAGG AAGG CCGG CCGG CCGG - - repeat ...
Date Added: 2009-06-06 21:02:58

468.pdf
Path: Yale >> GEOLOGY >> 1975 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:03:05

gilkedMeasurement.pdf
Path: Wright State >> PSY >> 301 Fall, 2008
Description: PSY 301 Measurement PSY 301 Science (psychology) starts with observation The scientific method is based upon obtaining data through planned, systematic, controlled and repeatable observations. Most scientific observations are translated into number...
Date Added: 2009-06-06 21:03:12

Lecture10.pdf
Path: Columbia >> E >> 2161 Fall, 2009
Description: Van der Waals Force between Two Atoms Spring 2008 MSAE E4990y Introduction to STM and AFM Lecture 10 VdW, Ionic, and Repulsive Atomic Forces February 25, 2008 The additional interaction between the two atoms are: (1) The repulsive interaction betwe...
Date Added: 2009-06-06 21:03:44

3290class5.pdf
Path: University of Regina >> UCS >> 3290 Fall, 2009
Description: SOC 3290 Deviance Lecture 5: The Classical Perspective As the story in your reading relates, criminal justice personnel from other countries are often amazed - even disturbed - at how many people are incarcerated in North America relative to their ow...
Date Added: 2009-06-06 21:04:08

325Class-07.pdf
Path: Alabama >> CS >> 325 Fall, 2008
Description: CS 325 - Class 07 Today Iterator design pattern Design Patterns Big concern of CS 325 is \"scaling up\" your software skills Must be able to: Read and understand other implementations Build classes that are able to be used in a variety of applic...
Date Added: 2009-06-06 21:04:53

book.pdf
Path: Texas Tech >> ARCH >> 5604 Fall, 2008
Description: ...
Date Added: 2009-06-06 21:05:16

walden_openhand2.pdf
Path: BU >> AH >> 421 Spring, 2009
Description: ...
Date Added: 2009-06-06 21:06:43

hw23.pdf
Path: Mt. Holyoke >> MATH >> 324 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:07:55

ESE_GE_152_Apr_8.ppt
Path: Caltech >> WEEK >> 444 Fall, 2009
Description: QuickTime and a decompressor are needed to see this picture. QuickTime and a decompressor are needed to see this picture. QuickTime and a decompressor are needed to see this picture. QuickTime and a decompressor are needed to see this picture. Qu...
Date Added: 2009-06-06 21:08:16

DivSoln.pdf
Path: Rochester >> MATH >> 164 Fall, 2009
Description: flnSt /\\- r li a I n ri ! - . 1 1 i r r { phrakdn G, o,tV h,t s[ryrtily Techn,*l{y U b* wc* rt be,*gudskaut,toy, t,i+lu rf , l* 6v\\v,14{oto*...
Date Added: 2009-06-06 21:08:23

baase-ch2b.pdf
Path: NJIT >> CIS >> 677 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:10:32

RAMTV19Application.doc
Path: Winston Salem State >> A >> 3463 Fall, 2009
Description: RAM-TV19 STUDENT APPLICATION (Please Print) Name: _ Address: _ Phone: _ Class: (Circle One) Freshman Email: _ Sophomore Junior Senior * You must be a Mass Communications major or minor to produce or to crew at RAM-TV19. Are you a Mass Comm major or ...
Date Added: 2009-06-06 21:11:47

Factor Mobility.ppt
Path: Berkeley >> BA >> 187 Fall, 2009
Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|28 Nov 1999 20:27:30 -0000 vti_extenderversion:SR|4.0.2.2717 vti_filesize:IR|136192 vti_title:SR|Principles of Macroeconomics vti_backlinkinfo:VX|notes.htm vti_cacheddtm:TX|28 Nov 1999 19:27:30 -0000 vt...
Date Added: 2009-06-06 21:11:55

Mall_LastName.xls
Path: Purdue >> CE >> 361 Spring, 2008
Description: Your Name Date Time You Arrived at Bus Stop Bus Arrival- (F) NW/Grant Bus Arrival- (A) Downtown Bus Depart- (A) Downtown Bus Stop- (B) Main Earl Bus Stop- (D) Tipp Mall Bus Stop- (D) Tipp Mall Bus Stop- (C) Main & Earl Bus...
Date Added: 2009-06-06 21:12:10

hw3-126.pdf
Path: Oakland University >> MATH >> 126 Fall, 2009
Description: Math 126B Fall, 2004 Assignment 3, due September 15 Read: Sections 7.7, 8.1, 8.2 Do: Section 7.7 #1,3,5,7,11,15,17,21,23,37,47,51,57,81,87,88,89,90 Section 8.1 #3,5,7,13,21,23,33,40,43,45,49,53 Section 8.2 #5,7,9,13,23,25,27,29,41,54 Maple Worksheet ...
Date Added: 2009-06-06 21:12:23

LHHW kinetics.pdf
Path: NMSU >> CHE >> 452 Fall, 2009
Description: Ch E 452 Aspen Lab Langmuir-Hinshelwood Hougen-Watson (LHHW) Kinetics Objectives This problem will teach the use of Langmuir-Hinshelwood Hougen Watson kinetic expressions to model catalytic reactors in Aspen Plus using a PFR model. Process Descripti...
Date Added: 2009-06-06 21:12:41

ECE634S09_HW11.pdf
Path: New Hampshire >> ECE >> 634 Fall, 2008
Description: ECE634 Signals and Systems II, Spring 2009 Homework 11 The color-codes correspond to the colors you randomly selected in class. Do the problems that match your color. Show all work and write legibly for full credit. While some problems are not requi...
Date Added: 2009-06-06 21:15:05

notes_introduction.ppt
Path: UPenn >> INSR >> 811 Fall, 2009
Description: INSURANCE 811 Neil Doherty Risk Management Personal RM Insurance for house and car, pension, etc Investor RM Diversification, derivatives, etc Country RM World Bank helps countries manage catastrophe risk Corporate RM Corporate Risk Managem...
Date Added: 2009-06-06 21:18:05

135syllabus.pdf
Path: SEMO >> MA >> 135 Fall, 2009
Description: MA 135 SYLLABUS - PRECACLULUS: COLLEGE ALGEBRA AND PLANE TRIGONOMETRY DR. ANDREW SCHWARTZ, PH.D. Catalog Description: MA 135-01 Algebra Trigonometry (Spring 2009) Integrated course of College Algebra and Plane Trigonometry. Credit may not be receive...
Date Added: 2009-06-06 21:19:55

5_3_4.pdf
Path: NJIT >> M >> 331 Fall, 2009
Description: ut = ku xx - V0 u x (5.3.4) u (0, t ) = u ( L, t ) = 0 u ( x, 0) = f ( x) Separate variables: u ( x, t ) = ( x)h(t ) : h \' ( x) = k h(t ) \'- V0 h(t ) \' k h h \' \' V0 \' = - = - kh k (a ) Boundary value problem is not in Sturm-Liouville form...
Date Added: 2009-06-06 21:19:56

4sol.pdf
Path: Reed >> HW >> 332 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:21:12

DescriptiveStatisticsHandout.pdf
Path: IPFW >> ENGR >> 121 Fall, 2008
Description: ENGR 121 Descriptive Statistics (7.1, 7.2) S. S. Moor Histograms (absolute frequency) hist(data) plots a histogram of the data in ten equally spaced bins [z, x]= hist(data) Returns z vector of the frequencies in each bin and an x vector containing ...
Date Added: 2009-06-06 21:21:38

MultipleLinearEG.pdf
Path: IPFW >> ENGR >> 121 Fall, 2008
Description: ENGR 121 S. S. Moor Multiple Linear Example The table below lists the breaking tension force required to break steal bars of varying composition. The independent variables x1 and x2 are the percent of two different alloying elements in the steel. T...
Date Added: 2009-06-06 21:21:38

Fertility.ppt
Path: University of Hawaii - Hilo >> ECO >> 672 Fall, 2009
Description: Fertility I. Measurement II. Stylized Facts III. Determinants I. Measurement 1950 LDCs MDCs 44.6 22.4 2000 25.4 11.2 Crude birth rate: CBR = births/pop (000s) Source: United Nations 2001. I. Measurement (cont) TFR = a =15 ASFRa 49 Total ferti...
Date Added: 2009-06-06 21:22:22

confintsmall.ps
Path: Kentucky >> STA >> 281 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.55a Copyright 1986, 1994 Radical Eye Software %Title: confintsmall.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o confintsmall.ps confintsmall %DVIPSParameters: dp...
Date Added: 2009-06-06 21:23:05

setaxiom.pdf
Path: Kentucky >> STA >> 531 Fall, 2008
Description: y v fgr vc k {xd(wofRw3gg0Aqqucqc ` v p rcg c pr e ` rcg lr kc c p ce lc r vc ac tgg ` lec ac r jrp v p kg ` n0urt f9n0{dff9t(qn0Tr0efxp fAqdfuc(uu0hwH0fdf0gteuld(0sddf!c d609g gsd(9Pc(d0gx06sxvnwq99urhe HdfPhfn(d&q9dn...
Date Added: 2009-06-06 21:23:13

homework2.ps
Path: Kentucky >> STA >> 601 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.90a Copyright 2002 Radical Eye Software %Title: homework2.dvi %CreationDate: Mon Jan 27 12:54:25 2003 %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: CMR17 CMR12 CMR10 CMMI10 CMSY10 CMR8 CMMI...
Date Added: 2009-06-06 21:23:48

homework3.ps
Path: Kentucky >> STA >> 695 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: homework3.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o homework3.ps homework...
Date Added: 2009-06-06 21:23:50

homework6sol.ps
Path: Kentucky >> STA >> 281 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: homework6sol.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Helvetica Helvetica-Bold Helvetica-Oblique %+ Helvetica-BoldOblique Symbol %End...
Date Added: 2009-06-06 21:23:56

homework2.ps
Path: Kentucky >> STA >> 601 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: homework2.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o homework2.ps homework...
Date Added: 2009-06-06 21:24:22

simple_machines.ppt
Path: U. Houston >> CUIN >> 32023112 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:24:56

3Trait Theories.ppt
Path: Nichols >> PSY >> 308 Fall, 2009
Description: Trait and Type Theories Trait-relatively stable predisposition to behave in a certain way Surface trait-characteristic that can be inferred from observable behavior Source trait-Most fundamental dimensions of personality; relatively few of these ...
Date Added: 2009-06-06 21:24:59

still pretty prudent jentleson.pdf
Path: N.C. State >> PS >> 498 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:29:11

Lecture6A.pdf
Path: Stanford >> MSANDE >> 324 Fall, 2009
Description: Optimization of Fluid Networks Formulation Our fluid networks are described by t 0 Gu( s) ds + x (t ) = a + t M u( t ) x, u 0, b 0<t<T x (t ) is vector of fluid levels, u(t ) vector of flow rates, G the network topology/technology, M the resourc...
Date Added: 2009-06-06 21:29:51

nagle_phys3070_lecture1.pdf
Path: Colorado >> PHYS >> 3070 Fall, 2008
Description: Energy and the Environment PHYS 3070 and ENVS 3070 Professor Jamie Nagle The web page for this course will be used to link reading assignments, homework, solutions, additional materials, etc. http:/www.colorado.edu/physics/phys3070 Associate Profes...
Date Added: 2009-06-06 21:37:35

quiz4key.pdf
Path: Wisconsin >> WEB >> 103 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:41:20

lec23.pdf
Path: Wisconsin >> AOS >> 100 Fall, 2008
Description: Review of Previous Lecture www.geography.hunter.cuny.edu/ Amy Jones Patrick Pentek Thunderstorms Think about the worst thunderstorm you\'ve seem or experienced. Draw a picture of it Wind Hail Tornadoes Low dark clouds Heavy Rain Thu...
Date Added: 2009-06-06 21:41:32

practice1.pdf
Path: Duke >> X >> 130 Fall, 2009
Description: CPS 130: Practice problems on basic probability 1 Probability and random variables These problems are for practice only, please do not submit them for grading. 1. (Warmup, things you should know *very* well) (a) What is a discrete random variable?...
Date Added: 2009-06-06 21:48:05

pub168.pdf
Path: Allan Hancock College >> PAGE >> 28315 Fall, 2009
Description: A revised Rodinia supercontinent: no SWEAT, no AUSWUS Michael T.D. Wingate, Sergei A. Pisarevsky, and David A.D. Evans Tectonics Special Research Centre Abstract Although geological comparisons between Australia and North America have provided a basi...
Date Added: 2009-06-06 21:48:44

Lec6_99.doc
Path: Wisconsin >> AAE >> 760 Fall, 2009
Description: AAE 760 Dynamic Natural ResourceEconomics Lectures 6-7 Our goal is to examine numerical solutions of optimal control problems, with an application to the water conveyance problem presented by Chakravorty, Hochman, and Zilberman, JEEM 1995. First, tho...
Date Added: 2009-06-06 21:49:01

Diversity3.pdf
Path: Allan Hancock College >> PAGE >> 74506 Fall, 2009
Description: Lingua Franca and the Language Barrier \"A lingua franca is a language which is used habitually by people whose mother tongues are different in order to facilitate communication between them\" Spanning the Language Barrier Pidgins, Creoles, and Lingua...
Date Added: 2009-06-06 21:49:41

ADMN-290-1.pdf
Path: Laurentian >> PAGES >> 290 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:50:17

f2005.pdf
Path: ECCD >> DOE >> 4609 Fall, 2009
Description: ...
Date Added: 2009-06-06 21:53:45

escott_elliptic.pdf
Path: Washington >> MATH >> 129 Fall, 2009
Description: Elliptic Curves David Wright Escott May 24, 2004 Final Paper for Mathematics 129: Algebraic Number Theory Taught by Professor William Stein 1 1 Elliptic Curves Elliptic curves are found at the intersection of a broad range of mathematics. As suc...
Date Added: 2009-06-06 21:59:18

hou_39_event11.txt
Path: Stanford >> EDUC >> 39108 Fall, 2009
Description: &voices=h...
Date Added: 2009-06-06 22:00:13

aera_invitation_2008.pdf
Path: Michigan >> FILE >> 2262418 Fall, 2009
Description: Dean Deborah Loewenberg Ball invites you to join alumni, friends, and colleagues of the University of Michigan School of Education, for hors doeuvres, drinks, and conversation on Monday, March 24, 2008 7:00 - 9:00 p.m. Sheraton New York Hotel & Towe...
Date Added: 2009-06-06 22:00:54

final.pdf
Path: Sanford-Brown Institute >> CS >> 157 Fall, 2009
Description: CS157 Final Due:Tuesday, May 5, 2009, at 2pm. Instructions No collaboration is allowed on exams. The only references you can use are your own notes taken in class, the class textbook, and the course website. Using any other source including online s...
Date Added: 2009-06-06 22:00:59

jdb_1725a.pdf
Path: UNC Charlotte >> COE >> 1202 Fall, 2009
Description: ENGR 1202 (Civil) Spring 2009 Test No. 1 March 2, 2009 Test Format and Instructions 11 problems on 4 pages, 100 points total, open book and notes, show all calculations for partial credit Truss Analysis The truss shown at right has a vertical...
Date Added: 2009-06-06 22:09:34

likerttips.pdf
Path: UNC Charlotte >> ADMN >> 8699 Fall, 2008
Description: Tips for Developing Likert Rating Scales Rating scales yield a single score that references the direction and intensity of a person\'s attitude. The items are intended to differentiate between those respondents with favorable attitudes from those with...
Date Added: 2009-06-06 22:10:38

Apr242009.pdf
Path: NYU >> FVB >> 201 Fall, 2009
Description: Reading Group 4/20/2009 1 Matthes Christian 2 Nascimento Leandro 3 Orlik Anna 4 Presno Ignacio 5 Tretvoll Hakon 6 Laufer Steve 7 Parlatore Siritto Cecilia 8 Barillas Francisco 9 Zilberman Eduardo 10 Sergeyev Dmitriy 11 Flynn Sean 12 Zemel Michelle ...
Date Added: 2009-06-06 22:11:51

hw10.pdf
Path: Virginia Wesleyan >> CS >> 480 Fall, 2009
Description: CS 480 CS Topics: PHP/MySQL Course Project Spring\'09 Course Project - Online Course Survey DBMS (II) The Online Course Survey DBMS has the following pages. The first page (project home-page) homes the following links: (a) Part-1: create the databa...
Date Added: 2009-06-06 22:12:29

ch22.ppt
Path: UMBC >> CS >> 421 Fall, 1999
Description: Chapter 22: Windows XP Module 22: Windows XP s History s Design Principles s System Components s Environmental Subsystems s File system s Networking s Programmer Interface Operating System Concepts 22.2 Silberschatz, Galvin and Gagne 2005 Object...
Date Added: 2009-06-06 22:20:36

bat.txt
Path: Berkeley >> ASTRO >> 00020085 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-06 22:21:24

rec.pdf
Path: Berkeley >> CS >> 282 Fall, 2008
Description: ...
Date Added: 2009-06-06 22:27:38

Chapter 14.ppt
Path: W. Florida >> GEB >> 3453 Fall, 2008
Description: Consumer Stakeholders: Product and Service Issues 0 Chapter 14 1 Prepared by Deborah Baker Texas Christian University Business and Society: Ethics and Stakeholder Management, 7e Carroll & Buchholtz Copyright 2009 by South-Western, a division of ...
Date Added: 2009-06-06 22:31:55

poly.pdf
Path: Wisconsin >> STAT >> 371 Fall, 2002
Description: Statistics 333 Polynomial Regression in R Spring 2003 Problem 17 in Chapter 10 asks you to fit a succession of higher degree polynomials to a small data set and to examine what happens to the r2 and adjusted r2 statistics. This document will step ...
Date Added: 2009-06-06 22:33:56

Lecture6.pdf
Path: University of Illinois, Urbana Champaign >> AGEC >> 110 Fall, 2009
Description: ACE 564 Spring 2006 Lecture 6 The Multiple Regression Model: Joint Hypothesis Testing by Professor Scott H. Irwin Readings: Griffiths, Hill and Judge. \"Testing a Zero Null Hypothesis for all Response Coefficients, Section 10.6; \"Testing a Single Li...
Date Added: 2009-06-06 22:36:45

practice1-soln.pdf
Path: UGA >> M >> 221 Fall, 2009
Description: Solutions to the Practice Problems Math 2280 Febuary 2, 2004 1. For each of the following differential equations, decide whether the given function is a solution. 1+exp(x +2x) (a) y = (x + 1)(y 2 - 1), y = - 1-exp(x2 +2x) (here exp(z) = ez ) 2 We ha...
Date Added: 2009-06-06 22:43:02

syllabus.pdf
Path: UGA >> M >> 3150 Fall, 2009
Description: Syllabus for Math 3150, Fall, 2003 Partial Di erential Equations for Engineers Text: The text for this course is Partial Di erential Equations and Boundary Value Problems by Nakhle Asmar. Instructor: Jesse Ratzkin { O ce: JWB 217 { O ce Hours: Wedn...
Date Added: 2009-06-06 22:43:03

sectntmH.pdf
Path: Duke >> X >> 140 Spring, 2009
Description: CPS 140 - Mathematical Foundations of CS Dr. S. Rodger Section: Turing Machines (handout) Review Regular Languages FA, RG, RE recognize Context Free Languages PDA, CFG recognize DFA: input tape a tape head current state 0 5 4 1 3 2 b b a b head...
Date Added: 2009-06-06 22:48:57

CHOMP SQUAD 8.pdf
Path: San Diego State >> ART >> 448 Spring, 2008
Description: CHOMP SQUAD l lciromp smile c romp romp a n h o m p stomp stomp stomp s q SQUAD alliance CHOMP om smile smile smilesmile smile chomp smile chomp chomp smile smile smile smile l l i smile c ha n c CHOMP m p SQUAD o stomp salliance alliance rompc cho...
Date Added: 2009-06-06 23:08:33

SMILE 2.pdf
Path: San Diego State >> ART >> 448 Spring, 2008
Description: CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD ...
Date Added: 2009-06-06 23:08:34

NLPSetup.pdf
Path: Johns Hopkins >> MTS >> 251 Fall, 2009
Description: ...
Date Added: 2009-06-06 23:09:36

NLPSetup.pdf
Path: Johns Hopkins >> MTS >> 362 Fall, 2009
Description: ...
Date Added: 2009-06-06 23:10:07

RootFinding.xls
Path: Johns Hopkins >> MTS >> 362 Fall, 2009
Description: 12 10 8 6 4 2 0 -2 -1.5 -1 -0.5 0 0.5 1 1.5 x -1 -1 -1 -1 -1 -1 -0.99 -0.99 -0.99 -0.99 -0.99 -0.99 -0.99 -0.99 -0.99 -0.99 -0.98 -0.98 -0.98 -0.98 -0.98 -0.98 -0.98 -0.98 -0.98 -0.98 -0.97 -0.97 -0.97 -0.97 -0.97 -0.97 -0.97 -0.97 -0.9...
Date Added: 2009-06-06 23:10:12

sm-schoen5.pdf
Path: Minnesota >> SIEPMANN >> 8066 Fall, 2009
Description: REPORT OF THE INVESTIGATION COMMITTEE ON THE POSSIBILITY OF SCIENTIFIC MISCONDUCT IN THE WORK OF HENDRIK SCHN AND COAUTHORS September 2002 Executive Summary In late May 2002, the management of Bell Labs formed a committee to investigate \"the possibil...
Date Added: 2009-06-06 23:10:30

EEEN4343Problems1.doc
Path: TAMU Kingsville >> EEEN >> 4343 Fall, 2008
Description: EEEN 4343 Spring 2007 Suggested Problems 1: 1. Find the transfer function for the following circuit. Assume R2=5R1, C2=2C1. What type of filter is it? What is the DC gain? Use PSPICE or any variation of SPICE to simulate the following circuit. Perfor...
Date Added: 2009-06-06 23:11:01

Lec9.pdf
Path: FIU >> CS >> 3530 Fall, 2009
Description: Stacks return x; } public Object pop( ) { if( isEmpty( ) ) throw new EmptyStackException( ); return items.remove( items.size( ) - ...
Date Added: 2009-06-06 23:12:17

hack_guide_v2.pdf
Path: Texas A&M >> DOCS >> 614 Fall, 2009
Description: SimpleScalar Hackers Guide (for tool set release 2.0) Todd Austin info@simplescalar.com SimpleScalar LLC SimpleScalar LLC SimpleScalar Hackers Guide Todd Austin Tutorial Overview Computer Architecture Simulation Primer SimpleScalar Tool Set Ove...
Date Added: 2009-06-06 23:15:45

hack_guide_v2.pdf
Path: Texas A&M >> PROJ >> 614 Fall, 2009
Description: SimpleScalar Hackers Guide (for tool set release 2.0) Todd Austin info@simplescalar.com SimpleScalar LLC SimpleScalar LLC SimpleScalar Hackers Guide Todd Austin Tutorial Overview Computer Architecture Simulation Primer SimpleScalar Tool Set Ove...
Date Added: 2009-06-06 23:15:45

NordhausToTaxOrNotRevEnvEcAndPol07.pdf
Path: Université du Québec à Montréal >> ECO >> 8071 Fall, 2009
Description: 26 To Tax or Not to Tax: Alternative Approaches to Slowing Global Warming William D. Nordhaus How can countries best coordinate their policies to slow global warming? This study reviews different approaches to the political and economic control of g...
Date Added: 2009-06-06 23:25:28

hw4.pdf
Path: NJIT >> CS >> 610 Fall, 2009
Description: A. V. Gerbessiotis Homework Programming 4 CS 610-101 Oct 29, 2008 Fall 2008 90 points (c) Copyright A. Gerbessiotis. CS 610-101 : Fall 2008 . All rights reserved. This material should not be posted electronically, or in any other form, in any site...
Date Added: 2009-06-07 05:30:25

GA-party.pdf
Path: Harvard >> CSCIE >> 153 Fall, 2009
Description: United States 109th Congress, Page 1 of 1 United States 109th Congress Georgia Democrat Official Name Barrow, John Bishop, Sanford D. Jr. Lewis, John Marshall, Jim McKinney, Cynthia Scott, David State Georgia Georgia Georgia Georgia Georgia Georgia ...
Date Added: 2009-06-07 05:32:38

Kosik_lecture 6.pdf
Path: UCSB >> MCDB >> 152 Fall, 2008
Description: EPIGENETICS Arai JA et al., Transgenerational rescue of a genetic defect in long-term potentiation and memory formation by juvenile enrichment. J Neurosci. 2009 Feb 4;29(5):1496-502 Local Protein Synthesis The idea that qualities acquired from expe...
Date Added: 2009-06-07 05:32:57

Assignment4.doc
Path: CSU LA >> CS >> 420 Fall, 2009
Description: Assignment 4 Due November 21, 2005 during lecture 6% of course grade For this assignment, you will add two more pages to your web site. The first page will contain a form that allows the user to type in some information. The form will submit to anoth...
Date Added: 2009-06-07 05:34:07

3011tsa0.pdf
Path: Allan Hancock College >> STAT >> 3011 Summer, 2009
Description: STAT 3011/3911 Semester 1 Stochastic Processes and Time Series Analysis 2009 For 2009 the Time Series Analysis material will be given before the Stochastic Processes material. The Time Series lectures will be in Weeks 1-7 and the Stochastic Proce...
Date Added: 2009-06-07 05:39:21

pharmacogenomics4.pdf
Path: UCSB >> CHEM >> 162 Fall, 2009
Description: Mutagenesis vol.17 no.5 pp.445446, 2002 LETTER TO THE EDITOR Concerning the CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis 1Heather and 3Brian Spencer Feigelson, 2Roberta McKean-Cowdin E.Henderson of Epidemiology and Surveill...
Date Added: 2009-06-07 05:45:36

pm.pdf
Path: W. Alabama >> CS >> 330 Fall, 2009
Description: Anne Banks Pidduck School of Computer Science l l l l l l l PMI Fundamentals Project Organization Project Selection Project Portfolio Management Procurement Management Statement of Work (SOW) Project Charter Software Project Management 2 l l l Pr...
Date Added: 2009-06-07 05:45:51

MFocus.pdf
Path: Laurentian >> NMED >> 1000 Fall, 2009
Description: Manual Focus Auto focus is the easiest function to find fault with. Sometimes the camera will focus on the wrong subject or the camera will drift in an out of focus (hunting). Manual focusing will prevent these problems. Focus is a function of the di...
Date Added: 2009-06-07 05:46:57

DWathome.pdf
Path: Laurentian >> NMED >> 1000 Fall, 2009
Description: Working with Dreamweaver at Home Purchasing Dreamweaver You may purchase Dreamweaver MX at the U of L bookstore for the Academic price of approximately $150. This version is no different than the commercial version, which sells at approximately $600 ...
Date Added: 2009-06-07 05:46:58

01-04.21.2005_-_Sensors_Update.doc
Path: UC Davis >> ATT >> 0504 Fall, 2009
Description: Sensors Sub-Group Meeting with Professor Stroeve April 21, 2005 Cat litter emits some radiation clay is radioactive, or the way that the litter is processed is radioactive? Ideas: - Soap sprayer for gas leaks (bubbling indicates where leak is) - Res...
Date Added: 2009-06-07 05:47:12

diode_spice.pdf
Path: Mississippi State >> ECE >> 3243 Fall, 2009
Description: ECE 3243 Diode spice exercises vers 5.1 Defaults: Resistances are in k and currents are in mA unless otherwise indicated. D-1: Diode coupled resistance networks. The diode model in SPICE is a set of equations. Most are relatively simple. Some are ...
Date Added: 2009-06-07 05:54:45

selection-INFOCOM97.ps
Path: W. Alabama >> CS >> 856 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 Copyright 1986-91 Radical Eye Software %Title: sp.pro %EndComments /Times-Roman findfont 10 scalefont setfont /Attribution (In Proceedings of IEEE Infocom \'97, April 1997, Kobe, Japan) def Attribution stringwidth p...
Date Added: 2009-06-07 06:06:57

Horace 3.23.doc
Path: Columbia >> GSAS >> 3012 Fall, 2009
Description: Horace 3.23 (meter: Alcaic) Caelo supinas si tuleris manus nascente luna, rustica Phidyle, si ture placa-ris et horna fruge Lares avidaque porca, nec pestilentem sentiet Africum fecunda vitis nec sterilem seges ro-bi-gi...
Date Added: 2009-06-07 06:30:15

Chap. 2a SwitchNetworks.pdf
Path: Georgia Tech >> ECE >> 2030 Fall, 2008
Description: SWITCH DESIGN CHAPTER II-1 SWITCH DESIGN CHAPTER II CHAPTER II SWITCH NETWORKS AND SWITCH DESIGN R.M. Dansereau; v.1.0 SWITCH DESIGN CHAPTER II-2 SWITCH DESIGN SWITCH NETWORKS BASIC IDEAL SWITCH SWITCH NETWORKS Simplest structure in a computi...
Date Added: 2009-06-07 06:55:19

CBET000802.txt
Path: Harvard >> IAU >> 000800 Fall, 2009
Description: Electronic Telegram No. 802 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD.E...
Date Added: 2009-06-07 07:13:53

CBET001153.txt
Path: Harvard >> IAU >> 001100 Fall, 2009
Description: Electronic Telegram No. 1153 Central Bureau for Astronomical Telegrams INTERNATIONAL ASTRONOMICAL UNION M.S. 18, Smithsonian Astrophysical Observatory, Cambridge, MA 02138, U.S.A. IAUSUBS@CFA.HARVARD....
Date Added: 2009-06-07 07:14:54

ch10.ppt
Path: Utah State >> CS >> 1720 Fall, 2008
Description: Chapter 10 Characters, Strings, and the string Class 1 Starting Out with C+, 3rd Edition 10.1 Character Testing The C+ library provides several macros for testing characters. Be sure to include ctype.h header file 2 Starting Out with C+, 3rd ...
Date Added: 2009-06-07 07:32:31

submit.txt
Path: Washington >> JOBS >> 80500 Fall, 2009
Description: executable = pass6_6_80928.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs80500-80999/809...
Date Added: 2009-06-07 07:34:17

aac_I,II_08.pdf
Path: Allan Hancock College >> PSY >> 315 Fall, 2009
Description: Attention & Perception 1 Outline 1. The problem of visual attention 2. Behavioural studies of the attentional modulation of visual aftereffects in humans 3. Mechanisms of selective visual attention in the primate brain - single cell studies 4. Imag...
Date Added: 2009-06-07 07:34:31

In-class exercise 6 (answer key).doc
Path: Ohio State >> AEDE >> 403 Fall, 2009
Description: AEDE 403, Winter 2005 In-class exercise #6 Name:_ TRUE/FALSE. Write `T\' if the statement is true and `F\' if the statement is false. _F_ 1). Real rate of interest is the actual rate of interest charged by the suppliers of funds and paid by the demande...
Date Added: 2009-06-07 07:35:08

BlueChip.xls
Path: Penn State >> EJS >> 5116 Fall, 2009
Description: Erich Schaefer 05/22/2009 15:06:09 Blue Chip Stock Club Investment Analysis Initial Date Price Initial Stock Symbol Acquired Shares Per Share Cost 3M MMM 6/12/00 394 79.75 Caterpillar CAT 3/15/00 750 34.25 Coca-Cola KO 8/1/00 975 58.75 DuPont DD 9/12...
Date Added: 2009-06-07 07:35:23

Workshop 1 Solutions.pdf
Path: Minnesota >> CHEM >> 2302 Summer, 2008
Description: Chemistry 2302 Workshop 1 Solutions Multi-Step Organic Synthesis (Review) Friday, September 5 1. One major and one minor problem. Major: The 2, cyclohexyl tosylate will preferentially react via E2. OTs O O OTs HO H O The Williamson ether synt...
Date Added: 2009-06-07 07:35:31

vcs.ppt
Path: CSU Channel Islands >> ICS >> 216 Fall, 2009
Description: Doing the VCS Assignment 1. Download the Calc1 code 2. Unzip/Uncompress it 3. Go into the directory with the verilog code There are several verilog files including: calc1_top.v - the main design file testbench.v - contains the stimulus, instantiate...
Date Added: 2009-06-07 07:38:08

Raleigh N&O_Nuclear2_1_15_06.pdf
Path: UNC Wilmington >> PLS >> 543 Fall, 2009
Description: newsobserver.com http:/www.newsobserver.com/689/v-print/story/388784.html Published: Jan 15, 2006 12:30 AM Modified: Jan 15, 2006 02:50 AM What about reprocessing? JOHN MURAWSKI, Staff Writer Why not just recycle nuclear waste and reuse it forever...
Date Added: 2009-06-07 07:39:28

GWarming_Politics_Washington Post_5_28_06.pdf
Path: UNC Wilmington >> PLS >> 543 Fall, 2009
Description: The Tempest http:/www.washingtonpost.com/wp-dyn/content/article/2006/05/23/AR. The Tempest By Joel Achenbach Sunday, May 28, 2006; W08 As evidence mounts that humans are causing dangerous changes in Earth\'s climate, a handful of skeptics are provi...
Date Added: 2009-06-07 07:39:48

CHEMCurriculumChangeProposal.pdf
Path: Siena >> LW >> 20052006 Fall, 2009
Description: Proposed Changes to the Chemistry and Biochemistry Majors Curricula and the General Chemistry Course 1. Introduction Several years ago, the Chemistry Department at Siena College began a process of reviewing and revising its curriculum for the chemist...
Date Added: 2009-06-07 07:40:01

(Ambush Mktg) McKelvey_SMQ_2006.pdf
Path: NMSU >> M >> 454 Fall, 2009
Description: Sport MarHeting Quarterly, 2006, 15, 114-123, 2006 West Virginia University Coca-Cola vs. PepsiCo - A \"Super\' Battleground for the Cola Wars? Steve M. McKelvey Overview of the Soft Drink Industry Coca-Cola: The Defending Champion Since its incepti...
Date Added: 2009-06-07 07:40:30

5 Self Evaluation.doc
Path: Uni. Westminster >> BIOL >> 0320 Fall, 2009
Description: Self Evaluation Presentation: I felt that my presentation was decent. I strived to project a confident appearance, maintain good eye contact, and stick to the power point outline. Content: energy and outs simple. Overall: Most the content was on alte...
Date Added: 2009-06-07 07:43:37

PhysA_DiMatteo.pdf
Path: Allan Hancock College >> TAS >> 110 Fall, 2009
Description: Interest rates hierarchical structure T. Di Matteo a, , T. Aste a , S. T. Hyde a and S. Ramsden a a Applied Mathematics, Research School of Physical Sciences, Australian National University, 0200 Canberra, Australia. Abstract We propose a general m...
Date Added: 2009-06-07 07:45:39

pas20511.pdf
Path: East Los Angeles College >> PAS >> 205 Fall, 2009
Description: PAS205 Probability Modelling: Lecture 11 1 PAS205 PROBABILITY MODELLING: Lecture 11 11.1 Finding equilibrium distributions: nite state space We address here the general problem of nding the equilibrium distribution of an irreducible Markov chain w...
Date Added: 2009-06-07 07:46:49

CS681 01 Classical Approaches.pdf
Path: George Mason >> CS >> 681 Fall, 2008
Description: CS 681 Fall 2008 Designing Expert Systems Gheorghe Tecuci tecuci@gmu.edu http:/lac.gmu.edu/ Learning Agents Center and Computer Science Department George Mason University 2008, Learning Agents Center 1 Overview Class Introduction and Course\'s O...
Date Added: 2009-06-07 07:46:51

020402.pdf
Path: Wisconsin >> CHEM >> 343 Fall, 2008
Description: ...
Date Added: 2009-06-07 07:47:08

ANS3319C_IVFLab_Version3-07.pdf
Path: UF >> ANIMAL >> 3319 Fall, 2009
Description: ANS 3319C Reproductive Physiology and Endocrinology Techniques for In-Vitro Embryo Production Objectives 1) To gain an understanding of the process of in-vitro embryo production in cattle and other domestic species. 2) To provide hands-on experience ...
Date Added: 2009-06-07 07:47:22

FSM2.ppt
Path: Lehigh >> CSE >> 497 Fall, 2008
Description: Finite State Machines, cont. Chad Hogg Sections 5.3 & 5.4 of AI Game Programming Wisdom 2 What is an FSM ? To theoreticians, a Finite State Machine or Automaton is an abstract model of a computer. In the context of this course, an FSM is not so ab...
Date Added: 2009-06-07 07:48:08

Classification_from_book.pdf
Path: UC Riverside >> CS >> 235 Fall, 2008
Description: Data Mining Classification: Basic Concepts, Decision Trees, and Model Evaluation Lecture Notes for Chapter 4 Introduction to Data Mining by Tan, Steinbach, Kumar Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 1 Classification: Defin...
Date Added: 2009-06-07 07:48:35

hw2.ps
Path: Washington >> MATH >> 548 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips 5.55 Copyright 1986, 1994 Radical Eye Software %Title: hw2.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips hw2 -o %DVIPSParameters: dpi=300, comments removed %DVIPSSource...
Date Added: 2009-06-07 07:48:40

SSAD_RLCA_S08b_T08_v2.2.pdf
Path: USC >> CSCI >> 577 Fall, 2009
Description: System and Software Architecture Description (SSAD) Version no 2.2 System and Software Architecture Description (SSAD) Los Angeles Music and Art School (LAMAS) Team-8 Member Sahil Narang Anupam Vats Meghna Seth Manish Tewatia Tushar Patel Role P...
Date Added: 2009-06-07 07:50:38

19980226_192403_antstep.txt
Path: St. Mary MD >> CDF >> 101 Fall, 2009
Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd15/19980226_192403_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 100 nanoseconds PRF = 1000 Hertz Unambig_veloc...
Date Added: 2009-06-07 07:51:10

19980227_182411_antstep.txt
Path: St. Mary MD >> CDF >> 101 Fall, 2009
Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd16/19980227_182411_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 1000 Hertz Unambig_veloc...
Date Added: 2009-06-07 07:51:12

19980223_184853_antstep.txt
Path: St. Mary MD >> CDF >> 051 Fall, 2009
Description: File: /server/02/IPIX/DATA/Grimsby/netcdf/ipixcd13/19980223_184853_antstep.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 20 nanoseconds PRF = 1000 Hertz Unambig_veloc...
Date Added: 2009-06-07 07:51:31

19931117_115702_stareA0003.txt
Path: St. Mary MD >> CDF >> 201 Fall, 2009
Description: File: /server/02/IPIX/DATA/Dartmouth/netcdf/ohgr0019/19931117_115702_stareA0003.cdf % Variables: RF_frequency = 9.39 GHz Pulse_length = 200 nanoseconds PRF = 1000 Hertz Unambig_...
Date Added: 2009-06-07 07:51:56

femaleTBCM.xls
Path: USC >> EXSC >> 408 Fall, 2009
Description: applet data image: size: RTOE RHEEL RANKLE paste data set here: Page 1 applet data RKNEE RHIP LTOE LHEEL LANKLE Page 2 applet data LKNEE LHIP RSHOULDER RELBOW RWRIST Page 3 applet data RFINGER LSHOULDER LELBOW LWRIST LFINGER Page 4 applet da...
Date Added: 2009-06-07 07:53:22

Indonesia Study Guide.doc
Path: Laurentian >> MUSI >> 200703 Fall, 2009
Description: STUDY GUIDE: THE MUSIC OF INDONESIA The predominant musical ensemble in Indonesia is the gamelan, and its sound has influenced Western composers since Debussy. Due to its popularity in the West, a number of gamelan ensembles exist in American univers...
Date Added: 2009-06-07 07:53:26

bar_graph.pdf
Path: Wisc Green Bay >> EDUC >> 324 Spring, 2008
Description: Title: _25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 _ Flower 1 _ Flower 2 _ Flower 3 _ Flower 4 __ Flower 5 Label: _ Label:_ ...
Date Added: 2009-06-07 07:53:35

Lec 2.498Bio Spr08.011608.ppt
Path: University of Illinois, Urbana Champaign >> PHYS >> 498 Fall, 2008
Description: Central Dogma of Biology Nucleic Acids 1.Quiz next Wednesday on Intro Stryer reading 2. By next Wed., should have ECB textbook. (No class next Mon.-MLK celebration.) Grading (may be modified slightly if changes to course ) Grading 25%: Homework (ab...
Date Added: 2009-06-07 07:54:04

hw9.pdf
Path: Wisconsin >> ST >> 371 Fall, 2009
Description: Statistics 371 Homework #9, Due Friday March 12th, 5pm Spring 2004 Here are the assigned problems from the textbook. Please complete all calculations by hand (using a calculator for arithmetic only). Chapter 6 and 7 : 1. problem 6.42, page 212 2. ...
Date Added: 2009-06-07 07:54:11

SP III.A-1.pdf
Path: E. Kentucky >> ITTC >> 622 Fall, 2009
Description: Special Problem III.A-1 The vector wave equation: 1 2 E(r,t) E(r,t) - 2 = 0 2 c t 2 can be written in Cartesian coordinates as: 1 2 E(r,t) ^ Ex (r,t) + ^y Ey (r,t) + ^z Ez (r,t) - 2 x = 0 c t 2 2 2 2 where: E(r,t) = Ex (r,t) ^ + Ey (r,t) ^y ...
Date Added: 2009-06-07 07:55:21

AGC Implementation.pdf
Path: E. Kentucky >> ITTC >> 622 Fall, 2009
Description: ...
Date Added: 2009-06-07 07:55:49

lesson3_lec.pdf
Path: San Jose State >> CHE >> 185 Spring, 2008
Description: 1. Go over P-control lab report HW 2. Why addition of I action removes offset (use the 1/s tank model to explain) 3. Derive PI in Transfer function form and time-domain form 4. Best tuning for SP control will be too _ for regulatory control. 5. What ...
Date Added: 2009-06-07 07:56:28

hw11.pdf
Path: Auburn >> PHYS >> 2100 Spring, 2008
Description: Homework 11 - Assigned Problems: Ch. 8 9, 14, 17, 26, 28 NOTE:Iamnotafanofthevirialtheoremsolutions.Ipreferthis:E=Vmin=k2/2l2=T+U =>U=k/r,whereforacircularorbit,r=l2/k2.Therefore,U=k2/l2 Sothat:T=EU=+k2/l2=U/2 NOTE: Analternativeap...
Date Added: 2009-06-07 07:56:30

exam_2_soln.pdf
Path: Wisc Platteville >> MA >> 253 Fall, 2009
Description: ...
Date Added: 2009-06-07 07:57:23

ENSO_Corals.ppt
Path: Georgia Tech >> EAS >> 4300 Fall, 2008
Description: El Nio-Southern Oscillation: Past, Present, and Future Oceanography lecture, Kim Cobb Why study the El Nio-Southern Oscillation? 1. It is the largest source of year-to-year global climate variability. 2. It carries negative societal consequences, b...
Date Added: 2009-06-07 07:57:53

curves.pdf
Path: North-West Uni. >> MATH >> 285 Fall, 2009
Description: CURVES: VELOCITY, ACCELERATION, AND LENGTH As examples of curves, consider the situation where the amounts of n-commodities varies with time t, q(t) = (q1 (t), . . . , qn (t). Thus, the amount of the commodities are functions of time. We can also con...
Date Added: 2009-06-07 07:58:38

torres2.pdf
Path: North-West Uni. >> MATH >> 230 Fall, 2009
Description: Midterm 2 The exam has a total of 40 points. Show all your work. Good luck. 1. (10 points) Suppose that a duck is swimming in the circle x = cos t, y = sin t and that the water temperature is given by the formula T (x, y) = x2 ey xy 3 . Find dT /dt...
Date Added: 2009-06-07 07:58:45

test1-00.pdf
Path: North-West Uni. >> MATH >> 230 Fall, 2009
Description: Math 214-3 Test 1 February 1, 2000 R.C. Robinson No calculators, no books, no notes. (1) (15 Points) Plot the curve given by polar coordinates by r = 2 + 3 cos(). (2) (a) (15 Points) Find the equation of the plane containing the three points P (1,...
Date Added: 2009-06-07 07:58:46

Founds.pdf
Path: Idaho >> ECE >> 591 Fall, 2008
Description: _ University of Idaho ECE591 Department of Electrical & Computer Engineering Research Colloquium RADIOFREQUENCY DRIVE ELECTRONICS FOR A MASS SPECTROMETER Jennifer Founds, Graduate Student Dept of Electrical and Computer Engineering University of Id...
Date Added: 2009-06-07 07:58:54

Lu.pdf
Path: Idaho >> ECE >> 591 Fall, 2008
Description: _ University of Idaho ECE591 Department of Electrical & Computer Engineering Research Colloquium An Optimized Space-Vector Modulation Method for 3Phase-3Phase Matrix Converter Yuchen Lu, Graduate Student Dr. Herb Hess, Professor Dr. Brian Johnson, ...
Date Added: 2009-06-07 07:59:01

09Pres.pdf
Path: Texas >> BIO >> 346 Fall, 2008
Description: The Human Genome Project Brief History of the Human Genome Project Physical (or Molecular) Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA Identification of Disease Genes Use of Genomics for Individualized Me...
Date Added: 2009-06-07 08:01:46

SSRD_DCP_F08a_T03_V3.0.doc
Path: USC >> CSCI >> 577 Fall, 2009
Description: System and Softw ar e (SSRD ) (PRO) Revamping Pr oyecto Pastor al Requir ements D efinition [F all 2008] System and Softw ar e Requir ements D ocument (SSRD ) contains the r equir ements of the system that is identified by all the stak eholder s i...
Date Added: 2009-06-07 08:03:53

vapor_press_water.pdf
Path: Embry-Riddle FL/AZ >> PS >> 253 Fall, 2009
Description: ...
Date Added: 2009-06-07 08:04:43

Math 1111_10_test1_06.doc
Path: GA Southern >> MATH >> 1111 Fall, 2008
Description: Math 1111 Test 1A September 18, 2007 Chapter 1, 2.3, & 2.4 Solve the following Linear Equations: 2( x 1) + 3 = x 3( x + 1) 1) Name _ 2) 4 x 7 = 4( x 1) 3 3) 6 2x + 2 = x+3 x+3 Solve the following word problem: 4) The length of an American...
Date Added: 2009-06-07 08:06:52

Nader Campaign Strategy.pdf
Path: UCF >> POS >> 6045 Fall, 2008
Description: American Politics Research http:/apr.sagepub.com Ralph Nader\'s Campaign Strategy in the 2000 U.S. Presidential Election Barry C. Burden American Politics Research 2005; 33; 672 DOI: 10.1177/1532673X04272431 The online version of this article can be f...
Date Added: 2009-06-07 08:07:44

gnssr4.pdf
Path: Purdue >> AAE >> 575 Fall, 2009
Description: Techniques of Earth remote sensing using GNSS-R signals Prof. James L. Garrison Purdue University 315 N. Grant Street West Lafayette, IN, 47907-2023 (765)-496-7482 jgarriso@ecn.purdue.edu Part 4: Soil Moisture 4/12/09 GNSS-R Remote Sensing - UPC Ju...
Date Added: 2009-06-07 08:07:52

experiment 5.doc
Path: Montana >> EE >> 451 Spring, 2008
Description: Experiment 5 Flyback Converter 5.1 Objective The objective of this experiment is to study the characteristics of the flyback converter using the power-pole board in open loop control mode. Our main goal is to compare the theoretical results with the ...
Date Added: 2009-06-07 08:09:55

Review.doc
Path: CSU Fullerton >> BTS >> 730 Fall, 2009
Description: BTS730 Topic Review: For BTS730 test: Here are some of the key things we covered: Scope Mgmt WBS Scope Control o How do you improve user/stakeholder input? o How do you reduce incomplete & changing requirements Time Mgmt Activities, sequencing (de...
Date Added: 2009-06-07 08:10:16

ps9.pdf
Path: University of Illinois, Urbana Champaign >> ECE >> 403 Fall, 2008
Description: UNIVERSITY OF ILLINOIS AT URBANA-CHAMPAIGN Department of Electrical and Computer Engineering ECE 403 Audio Engineering Problem Set 9 Spring 2009 Oral Problem Presentations In Class: Friday, April 17, 2009. Reading: Hasegawa-Johnson lecture notes, ch...
Date Added: 2009-06-07 08:11:48

Copying, Present and Prospective.pdf
Path: Union College >> MER >> 245 Fall, 2009
Description: ...
Date Added: 2009-06-07 08:12:05

HW1 F07.pdf
Path: Union College >> MER >> 245 Fall, 2009
Description: MER/BIO 245 BIOMIMETICS PROBLEM 1: Determine the location ( x , y ) of the centroid C of the area shown in Figure P1. HW-1 F07 PROBLEM 2: Two solid cylindrical rods AB and BC are welded together at B and loaded as shown in Figure P2. Determine the ...
Date Added: 2009-06-07 08:12:06

Chap008.ppt
Path: U. Houston >> FINA >> 4354 Fall, 2008
Description: Chapter 8 Insurance Pricing McGrawHill/Irwin Copyright2004bytheMcGrawHillCompanies,Inc.Allrightsreserved. InsurancePricing Objective: Find the premium that covers an insurers expected costs, including a fair return to capital known as the Fair ...
Date Added: 2009-06-07 08:12:42

bicreg.txt
Path: Duke >> STA >> 242 Fall, 2008
Description: bicreg_function(x, y, wt = rep(1, length(y){ # S-PLUS function to apply Bayesian Model Averaging to variable # selection for linear regression models. Bayesian # Model Averaging accounts for the model uncertainty inherent in the # variable select...
Date Added: 2009-06-07 08:14:10

LymanMichael_set06.pdf
Path: SUNY Geneseo >> PHYS >> 112 Fall, 2009
Description: Lyman, Michael C p112s09 Due Wed, Mar 25, 2009 at 23:30 Physics 112: General Physics II Section 1 Set 6 CA ID 1893 PA pass through a 0.271T magnetic field that deflects them to the appropriate spot on the screen. Find the magnitude of the maximum ma...
Date Added: 2009-06-07 08:14:33

Writing Obj 3.pdf
Path: Diablo Valley College >> VOYAGER >> 128 Fall, 2009
Description: Writing an Objective and Conclusions Writing Objectives and Conclusions Each lab and observing project needs an objective and a conclusion. The objective and the conclusion for each laboratory exercise should be separate sections. Each section should...
Date Added: 2009-06-07 08:14:45

PrecisionSigFigs.pdf
Path: Diablo Valley College >> VOYAGER >> 128 Fall, 2009
Description: Precision and the Number of Significant Figures The number of digits after the decimal depends on the precision to which the number is known. For example, in the case, 5 x 1 09 , 5 Billion would be 5 with nine zeroes following it. The fact that we sh...
Date Added: 2009-06-07 08:14:46

TF_PPT_2.ppt
Path: Portland >> EMGT >> 510 Winter, 2008
Description: Problem Identification Oil prices increase. Limited fossil fuel reserves. Environmental problems (emissions). Energy demand is growing. Imperative to find energy alternatives Energy Alternatives Gasoline Pollution Free Waste Free Relia...
Date Added: 2009-06-07 08:16:08

math102sol_06.pdf
Path: East Los Angeles College >> HOMEPAGEMA >> 102 Fall, 2009
Description: \" U wT 3 1 ) B 3 1 ) @ v u 7 v 6 u 4 Q \" 4 h S R $ 4 3 #1 R q e e 9 vu h 7 v6u 4 e R % 9 h 7 v u 4 v5 u e 2 9 v u 4 3 v5 u 1 f e f S R R R ` ( % 9 v5 u 4 t 2 s c f d ( ) ...
Date Added: 2009-06-07 08:16:58

AbstractReview.pdf
Path: Texas >> M >> 505 Fall, 2008
Description: The following questions are taken from midterms given this semester in another precalculus class. They are perhaps more abstract than what you\'re used to, but a thorough understanding of the concepts contained in them will help you greatly on the fin...
Date Added: 2009-06-07 08:17:34

cs109sqlnotes9.doc
Path: Alaska Anch >> CS >> 109 Fall, 2009
Description: 1 9. Aggregation and Group By 9.1 9.2 9.3 9.4 9.5 Grouping By One Field Grouping By More than One Field GROUP BY with HAVING Finding Aggregates of Aggregates More on Nulls 9.1 Grouping By One Field 1. Recall that the term aggregation referred to bui...
Date Added: 2009-06-07 08:19:30

ch22assignment.doc
Path: Alaska Anch >> CS >> 304 Fall, 2009
Description: 1 Design Patterns in Java, Chapter 22, State, Assignment Assignment Points and Given Files Information about points: This assignment is worth 20 points. You are given several finished classes which you should not change. You have to provide the imple...
Date Added: 2009-06-07 08:19:45

Stor155Eg2Raw.xls
Path: UNC >> STOR >> 155 Fall, 2008
Description: Buffalo Annual Snowfalls 126.4 82.4 78.1 51.1 90.9 76.2 104.5 87.4 110.5 25 69.3 53.5 39.8 63.6 46.7 72.9 79.6 83.6 80.7 60.3 79 74.4 49.6 54.7 71.8 49.1 103.9 51.6 82.4 83.6 77.8 79.3 89.6 85.5 58 120.7 110.5 65.4 39.9 40.1 88.7 71.4 83 55.9 89.9 84...
Date Added: 2009-06-07 08:20:29

a3-4.ps
Path: Toledo >> CSC >> 363 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: a3-4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o a3-4.ps a3-4.dvi %DVIPSPar...
Date Added: 2009-06-07 08:20:35

tut10.ps
Path: Toledo >> CSC >> 363 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: tut10.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -o tut10.ps tut10.dvi %DVIPS...
Date Added: 2009-06-07 08:20:45

fig_abs.ps
Path: Montana >> PH >> 567 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: gnuplot 3.7 patchlevel 1 %CreationDate: Fri Jan 18 00:42:34 2002 %DocumentFonts: (atend) %BoundingBox: 50 50 554 770 %Orientation: Landscape %Pages: (atend) %EndComments /gnudict 256 dict def gnudict begin /Color true def /So...
Date Added: 2009-06-07 08:21:21

Ryutov_MHDScaling_2001.pdf
Path: Colorado >> PHYS >> 7810 Fall, 2008
Description: PHYSICS OF PLASMAS VOLUME 8, NUMBER 5 MAY 2001 Magnetohydrodynamic scaling: From astrophysics to the laboratory* D. D. Ryutov, B. A. Remington, and H. F. Robey Lawrence Livermore National Laboratory, Livermore, California 94551 R. P. Drake Univer...
Date Added: 2009-06-07 08:21:36

Exam 2 solution.pdf
Path: Idaho >> CE >> 431 Spring, 2008
Description: ...
Date Added: 2009-06-07 08:21:55

vardom.doc
Path: High Point >> CIS >> 203 Fall, 2009
Description: CIS 203 Variables and the DOM High Point University Download vardom.html from the Assignments page. Open vardom.html in the web browser and in a text editor (e.g., Notepad or Crimson Editor). Note that vardom.html contains a script element in the bo...
Date Added: 2009-06-07 08:22:48

Chapter 11.ppt
Path: High Point >> CIS >> 341 Fall, 2009
Description: Windows Database Applications CIS 341 Chapter 11 Objectives Declare and reference collections Collection types Data Structures Object collection Items collection of a list box Referencing Collection Items DsStoreSales1.Tables(\"Stores\") DsStor...
Date Added: 2009-06-07 08:22:56

outline3_4.doc
Path: Auburn >> REAL >> 4000 Fall, 2009
Description: Private & Public Restrictions on Ownership Private Restrictions on Ownership 0. Encumbrances 0. Restrictions or limitations on the owner\'s ability to use a property 1. Liens 1. Claim on property as a financial security interest or for fulfillment of...
Date Added: 2009-06-07 08:23:31

PAE3157.t04.o_notor2-logo.pdf
Path: UCSC >> PAE >> 3157 Fall, 2009
Description: PAE3157.t04 o_notor2 3 2 1 1 10 20 30 40 N 3 2 1 H N H B N B G N B A B M N 51 60 70 B A B N G N B A B N H 80 AT Y VEFWH PNYAVPLLVFRILSDEEFS R VI L LL R S LM G K M H N 50 ME P VLLVR EFEKEPVYELVEVLRFERG R RY V YR L V AG D R ...
Date Added: 2009-06-07 08:23:48

PAE3630.t06.w0.5-logo.pdf
Path: UCSC >> PAE >> 3630 Fall, 2009
Description: PAE3630.t06 w0.5 3 2 1 1 10 20 30 40 H 3 2 1 S G T U V S G T V E S G B A B A E G T E B A B A E 51 60 70 80 90 E D 3 2 1 E V E V S G E A P B H S H S H S G P S G H G T V S 101 110 120 130 140 G 3 2 1 E E Q E D ...
Date Added: 2009-06-07 08:24:14

PAE2412.t06.near-backbone-11-logo.pdf
Path: UCSC >> PAE >> 2412 Fall, 2009
Description: PAE2412.t06 near-backbone-11 2 1 1 10 20 30 40 G 2 1 I G H K I G I J I D J D J D J D J D K D G A D I B I A D G F D I D J E J D I D G I G 51 60 70 80 90 I G 2 1 D A J B D I D I D A D H D J G D G D G D I D G I G J D A I D I D A G...
Date Added: 2009-06-07 08:25:09

PAE3112.t06.CB_burial_14_7-logo.pdf
Path: UCSC >> PAE >> 3112 Fall, 2009
Description: PAE3112.t06 CB_burial_14_7 2 1 10 20 30 40 A F 2 1 D F D F E F E B D A D A E F D E D A B E B E D B E D E B A B D A B E 51 60 D F E B E F D A B D 70 KK G LLILG TTPYFVECENGECIAARAQ I B D A 50 1 MI V KLIYI RDVAIIKLGLDPCADVF...
Date Added: 2009-06-07 08:27:01

PAE2294.t06.alpha-logo.pdf
Path: UCSC >> PAE >> 2294 Fall, 2009
Description: PAE2294.t06 alpha 2 1 1 10 20 30 E A H S B S E B I H E H B S B E 40 MI A RCKNC GIVFYIFRTSLETFTLEIE K AE R KH G E IP H I N IE K ...
Date Added: 2009-06-07 08:27:06

PAE2294.t04.w0.5-logo.pdf
Path: UCSC >> PAE >> 2294 Fall, 2009
Description: PAE2294.t04 w0.5 2 1 1 10 20 30 E B E S E B A B A E S E E H S G V U V R Q E S G 40 MI A RCKNC GIVFYIFRTSLETFTLEIE K AE R KH G E IP H I N IE K ...
Date Added: 2009-06-07 08:27:06

PAE3399.t06.dssp-ehl2-logo.pdf
Path: UCSC >> PAE >> 3399 Fall, 2009
Description: PAE3399.t06 dssp-ehl2 2 1 1 10 20 30 40 E 2 1 H E H 51 60 70 80 90 E 2 1 H H E H H 101 110 120 130 140 H 2 1 E H E 151 160 170 180 190 H 2 1 H H 201 210 220 230 240 H 2 1 H 251 260 270 280 290 H 2 1 ...
Date Added: 2009-06-07 08:28:00

PAE1140.t06.o_notor-logo.pdf
Path: UCSC >> PAE >> 1140 Fall, 2009
Description: PAE1140.t06 o_notor 3 2 1 1 10 20 30 40 H 3 2 1 N H N H M G N P N A N B A N B 51 60 70 80 90 N 3 2 1 H N G N A B A H M N H M H N H M H N 101 110 120 130 140 H 3 2 1 M N B N G N B A B N M N 151 SK E TKIWI R...
Date Added: 2009-06-07 08:28:46

PAE1140.t06.near-backbone-11-logo.pdf
Path: UCSC >> PAE >> 1140 Fall, 2009
Description: PAE1140.t06 near-backbone-11 2 1 1 10 20 30 40 G 2 1 H I G I G A G A D G D I D I G I D G K I D G J D K D K A B A J D J D G D A G B D I D I G B I B A D I D G D I G J D J E J I 2 1 G D J G D G I E G I D G G D G D I D J D G A D I 101 ...
Date Added: 2009-06-07 08:28:46

PAE2069.t04.bys-logo.pdf
Path: UCSC >> PAE >> 2069 Fall, 2009
Description: PAE2069.t04 bys 4 3 2 1 1 10 20 30 40 E 4 3 2 1 H T E P T E P E P E P H T H 51 60 70 80 90 G S P H 4 3 2 1 G T H E H E H G T H E 101 110 120 130 140 H 4 3 2 1 E P H G H P H G E H G T S P H P H G P 151 160 170 1...
Date Added: 2009-06-07 08:29:18

PAE2343.t06.pb-logo.pdf
Path: UCSC >> PAE >> 2343 Fall, 2009
Description: PAE2343.t06 pb 4 3 2 1 1 10 20 30 40 D 4 3 2 1 F K M N O M B D D E H I A D F B 51 60 70 80 90 F M 4 3 2 1 B D D E H I A D F K M O P A D 101 110 120 130 140 F E H P A D 4 3 2 1 F E H I A D F K B D D F K O P A D F...
Date Added: 2009-06-07 08:29:32

PAE3151.t06.n_notor2-logo.pdf
Path: UCSC >> PAE >> 3151 Fall, 2009
Description: PAE3151.t06 n_notor2 3 2 1 1 10 20 30 40 N 3 2 1 B N H N S G N B N B N G N S N H 51 60 70 80 90 G I N 3 2 1 P N P N H N G N B A B N H N G N B N 101 110 120 130 140 S 3 2 1 N H N B N B H N B N H 151 N 160 VW ...
Date Added: 2009-06-07 08:30:10

PAE0855.t04.o_sep-logo.pdf
Path: UCSC >> PAE >> 0855 Fall, 2009
Description: PAE0855.t04 o_sep 3 2 1 1 10 20 30 40 A 3 2 1 D A G D H B D A D A G D A D A D A 51 60 70 80 D A D A D 90 KC K AKCTG QEEKCVVYRALTKGTLKFE C EE D AH A Q GT P K H 50 MI V GDREI DITGLRPIDLMLAALAYGI G IR Y ID M E GR P F E ME C E...
Date Added: 2009-06-07 08:30:20

chicagogreen.pdf
Path: Penn State >> LXY >> 128 Fall, 2009
Description: CHICAGO GREEN DoLPHIN JAZZ 2005 ...
Date Added: 2009-06-07 08:31:34

EE477_Lab12_VisualDSP_Spring_2004.pdf
Path: Montana >> EE >> 477 Fall, 2008
Description: EE477 Digital Signal Processing Laboratory Exercise #12 Learning to use VisualDSP+ Spring 2004 VisualDSP+ is an easy-to-use project management environment enabling management of projects from start to finish from within a single interface. The proje...
Date Added: 2009-06-07 08:32:16

responsesurface.pdf
Path: Minnesota >> STAT >> 5303 Fall, 2008
Description: This is a central composite design. There are three factors, concentration of detergent, wash temperature, and agitation time. The response is the whiteness of cotton cloth. The second factor was not quite centered where it should be for a genuine ce...
Date Added: 2009-06-07 08:32:17

Lect08.ppt
Path: University of Illinois, Urbana Champaign >> PHYS >> 211 Fall, 2008
Description: Physics 211: Lecture 8 Today\'s Agenda q q q Friction Recap Drag Forces Terminal speed Dynamics of many-body systems Atwood\'s machine General case of two attached blocks on inclined planes Some interesting problems Physics 211: Lecture 8, Pg 1 ...
Date Added: 2009-06-07 08:34:11

rts.ps
Path: East Los Angeles College >> CJN >> 503 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: tmpfinal.dvi %Pages: 8 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentFonts: Palatino-Roman Palatino-Bold Palatino-Italic %+ Courier-Bold Courier Symbol %D...
Date Added: 2009-06-07 08:35:20

map.ps
Path: East Los Angeles College >> CJN >> 503 Fall, 2009
Description: %!PS-Adobe-3.0 %Title: Microsoft Word - map.doc %Creator: Windows NT 4.0 %CreationDate: 11:45 11/16/1998 %Pages: (atend) %BoundingBox: 19 24 577 819 %LanguageLevel: 1 %DocumentNeededFonts: (atend) %DocumentSuppliedFonts: (atend) %EndComments % %Begin...
Date Added: 2009-06-07 08:35:29

Exam1_studyguide.doc
Path: U. Memphis >> GEOG >> 1010 Fall, 2008
Description: Geog 1010 Prof. Urbano Study guide Chapter 1 1) What is the key thing that links all aspects of geography together 1. What is the difference between physical and human geography 2) What is the sceintific method. (How is it different from faith) 1. Wh...
Date Added: 2009-06-07 08:36:53

tyler.ppt
Path: Oregon State >> BA >> 469 Fall, 2008
Description: Chapter 9 Diversification Snack Foods Beverage s Foods Frito-Lay North America Frito-Lay International Quaker North America Pepsi-Cola North America Gatorade/Tropicana North America PepsiCo Beverages International Snack Foods Frito-Lay ...
Date Added: 2009-06-07 08:38:01

Logitech - Spring 2008.doc
Path: Oregon State >> BA >> 469 Fall, 2008
Description: This is an open book, open note test. You may discuss your answers within your group, but do not discuss the questions or the answers with another group. When you are finished, email your answers in a Word attachment to don.neubaum@bus.oregonstate.ed...
Date Added: 2009-06-07 08:38:02

solution8.pdf
Path: East Los Angeles College >> MATH >> 20700 Fall, 2009
Description: l ScgAHq9ATTw5 HX`H5) }ec Wf# l ScgwSc Ts kA\') 5vCc g&1)0# k w} u hf kc c X k X X) rc 9gH` XSSH` qw` gd \'ls9c dec E eql15)Yw eeqkeSeH5ede d 5AqwdHTsdTk T `q e HXTe%dc ...
Date Added: 2009-06-07 08:38:23

xerces-c-2.6.0-3.src.rpm.txt
Path: Texas A&M >> JKP >> 2866 Fall, 2009
Description: PACKAGE: xerces-c-2.6.0-3.src.rpm Name : xerces-c Relocations: (not relocateable) Version : 2.6.0 Vendor: (none) Release : 3 Build Date: Fri 05 Nov 2004 10:42...
Date Added: 2009-06-07 08:38:44

T0487.t06.w0.5-logo.pdf
Path: UCSC >> T >> 0487 Fall, 2009
Description: T0487.t06 w0.5 4 3 2 1 M NH L G K T E V F LN R F AL R P LN P E EL R PW R L E V V LD P P PG R E EV Y P LL A Q VA R R A G GV T V R M G D G L A S WS P P E V L V LE G T L A R M GQ T Y A Y R L YP K G R R P L DP 10 20 30 40 50 60 70 80 90 1 ZMPA YZ 4 3 2 ...
Date Added: 2009-06-07 08:39:27

stochastic.pdf
Path: CSU Chico >> PHYS >> 250 Fall, 2009
Description: Chapter 6 Stochastic Methods Take a still beaker of water, and drip one drop of dye into the center. Over time the dye spreads out, and eventually distributes itself evenly throughout the water. How would we model this behavior computationally? The ...
Date Added: 2009-06-07 08:39:49

webpages.txt
Path: N. Colorado >> CS >> 101 Fall, 2009
Description: # webpages.tcl by Dr. I. for CS 101 during Fall, 1999 # This script read logins and names from a data file # and creates html for a web page # proc formatName {n} { upvar $n name set name [string toupper $name] } # puts -nonewline stdout \"Da...
Date Added: 2009-06-07 08:40:06

Three Different Design Approaches to Step.doc
Path: Texas Tech >> BA >> 5371 Fall, 2009
Description: Three Different Design Approaches to Step-Wide Improvements 1. Sell / Buy Assets (6) Sell assets others want to buy Buy (acquire) growth assets Sell the \"entire business\" (merge/acquisition by another firm) Joint venture Do an IPO (sell stock) wit...
Date Added: 2009-06-07 08:41:20

Internal Business Environment sp07.ppt
Path: Texas Tech >> BA >> 5371 Fall, 2009
Description: The Internal Business Environment of an Organization: Five Key Factors 1 Inputs Environmental Drivers 1. External/ Global Business Environment (15) 2. Internal Businesses Environment : Corporate Competencies B....
Date Added: 2009-06-07 08:41:20

Essay2&3.pdf
Path: Maryville TN >> FRS >> 140 Fall, 2009
Description: FRS 140, Spring 2006, Kneas Research Process Assignments 7 3 DUE: Friday, 4/7, by 5:00 PM in box outside Dr. Kneass Office (Sutton 225) By now you have completed extensive research on your topic of interest and are well on your way to...
Date Added: 2009-06-07 08:42:41

chaos-1.pdf
Path: Wisconsin >> MATH >> 630 Fall, 2009
Description: Chaos and Strange Attractors: The Lorenz Equations Project for Students of Calculus Edward N. Lorenz is a meteorologist at MIT, who published a famous paper in 1963 describing a simple model of fluid flow in the atmosphere. Fluids are distinguished f...
Date Added: 2009-06-07 08:45:29

StudyStrategies-eled4241.doc
Path: U. Memphis >> ELED >> 4241 Fall, 2008
Description: Guidelines for Teaching Strategies -Brozo & Simpson, 2003 Emphasize the Importance of Task Knowledge The more appropriate the match between a study process and an academic task, the more easily information can be transferred to long-term memory Whe...
Date Added: 2009-06-07 08:46:37

M202-L14.ppt
Path: Salisbury >> FACULTY >> 202 Fall, 2009
Description: 6.2 [4] Vol\'m of Rev abt X-axis (Washers) Rotate region bounded by y = x, y = x 2 , about X - axis Two vertical radii R1 ( x) = x, R2 ( x) = x 2 Cross - sectional area A( x) = R1 ( x) 2 - R2 ( x) 2 = x 2 - x 4 n i =1 A ( xi* ) x n i =1 V V = l...
Date Added: 2009-06-07 08:47:24

Lecture_7_Linux.pdf
Path: Maple Springs >> CSE >> 2031 Fall, 2009
Description: Warning: These notes are not complete, it is a Skelton that will be modified/add-to in the class. If you want to us them for studying, either attend the class or get the completed notes from someone who did CSE2301 Unix/Linux Introduction These slid...
Date Added: 2009-06-07 08:49:06

sol03.pdf
Path: Washington >> M >> 146 Fall, 2009
Description: M146 Test #03 04/13/2006 SOLUTIONS (1) A substance S is taken into the stomach, is absorbed into the blood, then is removed from the blood by the liver. S goes from the stomach to the blood at the (countinous) rate of 30 % per hour. S is removed from...
Date Added: 2009-06-07 08:50:24

15.doc
Path: N. Illinois >> FLTH >> 104 Spring, 2008
Description: 15. Direction : Fill in the blanks with given words and Translate into English. 5 5 1. 5 5 5 5 n^ 5 _^ n * 2. _ n _ n * 3. _ 4. 5 _ * 5. ^ _5 ...
Date Added: 2009-06-07 08:50:35

polyatomicions.pdf
Path: Laurentian >> CHEM >> 200303 Fall, 2009
Description: POLYATOMIC IONS Table of Names and Composition of Some Common Polyatomic Ions NH4 H 3O + + Corresponding Base or Acid NH3 H2O Base ammonia water Acid* Cation: Positive Ion ammonium ion hydronium ion Anions: Negative Ions Based on a Group 13 elemen...
Date Added: 2009-06-07 08:52:11

slides7.pdf
Path: UNC Charlotte >> ITCS >> 3182 Fall, 2008
Description: Design of the Processor Control Unit Design Control unit needs to: Generate signals for each register transfer action and other operations specified, and Be able to sequence through the steps for fetching/ executing the instructions in the prog...
Date Added: 2009-06-07 08:52:17

FAX_Sheet-March8.pdf
Path: Air Force Academy >> DOCS >> 20070308 Fall, 2009
Description: Health Emergency Management (What Health Care Professionals Should Know About Emergency Preparedness and Response) E-Learning Event March 8, 2007 FAX SHEET PHONE: (306) 966-8800 FAX to: (306) 966-2412 PLEASE PRINT CLEARLY SITE LOCATION:__ Here is m...
Date Added: 2009-06-07 08:54:24

04_069.txt
Path: UPenn >> VHM >> 801 Fall, 2009
Description: Exercise 4.69 - Minitab commands for computation of mean and standard deviation: MTB > Set c1 DATA> 1( 540 545 550 555 560 )1 DATA> End. MTB > name c1 \'temp_C\' MTB > Set c2 DATA> 1( .1 .25 .3 .25 .1 )1 DATA> End. MTB > name c2 \'prob\' MTB > ...
Date Added: 2009-06-07 08:55:11

GoldenAgeofScienceFiction.ppt
Path: Maple Springs >> HUMA >> 1905 Fall, 2009
Description: The Golden Age of Science Fiction Interior illustration for Ralph 124C 41+ ...
Date Added: 2009-06-07 08:57:06

quiz3L02.pdf
Path: Wilfrid Laurier >> ENGG >> 311 Fall, 2009
Description: ...
Date Added: 2009-06-07 08:57:08

LECTURE 2 -Neurons and glia.pdf
Path: Maple Springs >> KINE >> 4512 Fall, 2009
Description: Chapter 2, Box 2.5 Overview Neurons and glia Neuronal cell and types of neurons Types of glial cells Genetics 1. Human genome: 80,000 genes. 2. Neuron specific genes - very few, indicating that nerve cells share basic structural and functional pr...
Date Added: 2009-06-07 08:57:25

m583.pdf
Path: East Los Angeles College >> TECHNOLOGY >> 0809 Fall, 2009
Description: Oxford_Brookes Module timetable - U04585.S1+S2, Chassis Engineering (Wks H7-S2/11, 26/01/2009 - 27/04/2009) 09:00AM 10:00AM 11:00AM 12:00PM 01:00PM 02:00PM 03:00PM 04:00PM 05:00PM 06:00PM 07:00PM 08:00PM Mo Lectures, Wks S2/1-S2/9, S2/10-S2/11, 03/0...
Date Added: 2009-06-07 08:59:01

rubric_spanish.pdf
Path: S.F. State >> ITEC >> 601 Fall, 2009
Description: Luz RUBRIC FOR PROJECT # 1, \"CMO ESTS?\" Criterion Clarity and Correctness of writing. Use of vocabulary. 0 2 4 6 Score 0 2 4 6 Use of most of the grammatical concepts already learned. Ideas are express properly. The use of ideas/illustrations agrees...
Date Added: 2009-06-07 09:00:33

Overview Class.ppt
Path: St. Francis IL >> BSAD >> 431 Fall, 2009
Description: Unique Features of Services and The Gaps Model What Makes Services Unique? What is the Gaps Model? The Customer Gap The Provider Gaps: Overview Class Putting It All Together: Closing the Gaps Characteristics of Services Compared to Goods Int...
Date Added: 2009-06-07 09:02:17

Copy (2) of burns05_ppt06 rev.ppt
Path: St. Francis IL >> BSAD >> 332 Fall, 2009
Description: Using Secondary Data and Online Information Databases Primary Versus Secondary Data Primary data: information that is developed or gathered by the researcher specifically for the research project at hand. Secondary data: information that has previ...
Date Added: 2009-06-07 09:02:22

Copy of burns05_ppt06 rev.ppt
Path: St. Francis IL >> BSAD >> 332 Fall, 2009
Description: Using Secondary Data and Online Information Databases Primary Versus Secondary Data Primary data: information that is developed or gathered by the researcher specifically for the research project at hand. Secondary data: information that has previ...
Date Added: 2009-06-07 09:02:23

Copy of burns05_ppt02.ppt
Path: St. Francis IL >> BSAD >> 332 Fall, 2009
Description: The Marketing Research Process The Marketing Research Process: 11 Steps Establishing the Need for Marketing Research Step Two: Defining the Problem Step Three: Establishing Research Objectives Step Four: Determining Research Design Step Five: Id...
Date Added: 2009-06-07 09:02:23

burns05_ppt06 rev.ppt
Path: St. Francis IL >> BSAD >> 332 Fall, 2009
Description: Using Secondary Data and Online Information Databases Primary Versus Secondary Data Primary data: information that is developed or gathered by the researcher specifically for the research project at hand. Secondary data: information that has previ...
Date Added: 2009-06-07 09:02:50

P4.doc
Path: Midwestern State University >> EE >> 214 Fall, 2009
Description: Lab Project 4: Logic Minimization Revision: August 30, 2007 Produced in cooperation with www.digilentinc .com STUDENT I am submitting my own work, and I understand penalties will be assessed if I submit work for credit that is not my own. Estima...
Date Added: 2009-06-07 09:02:58

Discrete-probability-lec2002f.pdf
Path: UMass (Amherst) >> YR >> 540 Fall, 2009
Description: Probability Distributions: Lecture Notes Discrete Probability: Bioepi 540 UMASS-Amherst Fall 2002 Probability z A Probability Model is the set of assumptions used to assign probabilities to each outcome in a sample space. Discrete Probability Distr...
Date Added: 2009-06-07 09:03:11

Sp02-540exam2-takehome.pdf
Path: UMass (Amherst) >> YR >> 540 Fall, 2009
Description: Introduction to Biostatistics 540 2st Exam Take home Part Spring 2002 Instructions: You may use any books or notes to complete this exam, including computers and calculators. You may not talk to anyone about the exam, or receive any help or advice. T...
Date Added: 2009-06-07 09:03:14

Sp02-540finalexam-takehome.pdf
Path: UMass (Amherst) >> YR >> 540 Fall, 2009
Description: Final Exam- Take Home Portion BioEpi 540 Spring 2002 Instructions: You may use any books or notes to complete this exam, including computers and calculators. You may not talk to anyone about the exam, or receive any help or advice. This includes help...
Date Added: 2009-06-07 09:03:14

ap2.ps
Path: Iowa State >> CMU >> 301 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: ap2.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips ap2 %DVIPSParameters: dpi=1200...
Date Added: 2009-06-07 09:04:58

nm1.ps
Path: Iowa State >> CMU >> 301 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: nm1.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips nm1 %DVIPSParameters: dpi=1200...
Date Added: 2009-06-07 09:05:01

NumEC09.docx
Path: Delaware >> CIS >> 101 Fall, 2009
Description: Number Systems Extra Credit (18 pts) Convert these numbers from binary (base 2) to decimal (base 10). 1) 1102 = _10 2) 101102 =_10 3) 1010111102 =_10 Convert these numbers from decimal (base 10) to binary (base 2). 4) 3710 =__2 5) 11010 =_2 6) 6...
Date Added: 2009-06-07 09:05:04

Reason (1994).pdf
Path: Acton School of Business >> PSYC >> 101 Fall, 2008
Description: ...
Date Added: 2009-06-07 09:06:04

homework1.pdf
Path: Iowa State >> ME >> 515 Fall, 2009
Description: ME-515 FALL 2000 Dr. Jess Comer Page 1 Homework #1 Statistical Analysis (Normal) PART #1-Analysis of Small Data Set Listed below is a sample of 6 values for the diameter (inches) of a shaft that is being manufactured by Company A. 0.1799 0.1807 ...
Date Added: 2009-06-07 09:06:06

INF 111 - SET 10-6up.pdf
Path: CSU Channel Islands >> INF >> 111 Fall, 2009
Description: Announcements INF 111 / CSE 121: Software Tools and Methods Lecture Notes for Summer, 2008 Michele Rousseau Assignment #3 is due on Monday Quiz #3 regrades are due today Lecture Note 10 Effort Estimation Lecture Notes 10 - Effort Estimation 2 Pre...
Date Added: 2009-06-07 09:06:38

INF 117 - SET 2 - Requirements.pdf
Path: CSU Channel Islands >> INF >> 117 Fall, 2009
Description: INF 117 Project in Software Engineering Lecture Notes -Winter Quarter, 2008 Michele Rousseau Set 2 - Requirements Announcements kContact your Client Meet with your Client ASAP kCheck out the Deliverables Schedule kArrange your Meeting Schedules Mee...
Date Added: 2009-06-07 09:06:48

hit man phish.pdf
Path: JMU >> MKTG >> 470 Fall, 2008
Description: [print version] FBI warns of twist in extortion phishing scam | CNET News.com http:/www.news.com/ FBI warns of twist in extortion phishing scam By Dawn Kawamoto http:/news.com.com/FBI+warns+of+twist+in+extortion+phishing+scam/2100-7348_3-6150094.ht...
Date Added: 2009-06-07 09:07:08

sampletest3.xls
Path: Salisbury >> INFO >> 281 Spring, 2008
Description: SUMMARY OUTPUT Regression Statistics Multiple R 0.96 R Square 0.92 Adjusted R Square.91 0 Standard Error 3.39 Observations 10 ANOVA df Regression Residual Total Intercept GPA 1 8 9 SS 1108.33 91.77 1200.1 MS 1108.33 11.47 F Significance F 96.61 0 Co...
Date Added: 2009-06-07 09:07:52

20080911_6.pdf
Path: Colorado >> LASP >> 3500 Fall, 2009
Description: Problem: The mixing ratio of water vapor in the stratosphere is about 6 ppmv. If the ambient temperature is 230 K and the pressure is 54 hPa, what is the concentration of water (molecules cm-3) ? Solution: P = nkBT kB=1.38x10-23 kg m2s-2molecule-1K-1...
Date Added: 2009-06-07 09:08:32

1311modout.doc
Path: East Los Angeles College >> MUSI >> 1311 Fall, 2009
Description: Level 1 Performance School of Music University of Leeds 2007/08 Module outline: Performance A, MUSI 1311 Name:_ Module co-ordinator: Ms. Joanne Fairley Prerequisite: The normal pre-requisite for MUSI 1311 is Grade 8 ABRSM exam level merit or equi...
Date Added: 2009-06-07 09:09:00

SRF950908-13.ps
Path: Cornell >> SRF >> 950908 Fall, 2009
Description: %!PS-Adobe-3.0 %Title: (SRF950908-13.pdf) %Creator: (Acrobat\\252 Reader 2.1: LaserWriter 8 8.3) %CreationDate: (11:52 AM Wednesday, October 11, 1995) %For: (Tom Hays) %Pages: 8 %DocumentFonts: Times-Roman Times-Bold Times-Italic Helvetica Symbol %Doc...
Date Added: 2009-06-07 09:09:18

BankTellerModel.doc
Path: East Los Angeles College >> CS >> 366 Fall, 2009
Description: Micro Computer Simulation Micro Saint for Windows BANK TELLER MODEL DEVELOPMENT Model Description This simple queuing model illustrates many of the key concepts of discrete event simulation modeling and Micro Saint Sharp features that address those...
Date Added: 2009-06-07 09:09:41

COS280-lect-2006-02-10.pdf
Path: Taylor IN >> CSE >> 280 Fall, 2009
Description: Lisp-ish quotes while waiting \"Greenspun\'s Tenth Rule of Programming: any sufficiently complicated C or Fortran program contains an ad hoc informally-specified bug-ridden slow implementation of half of Common Lisp. - Philip Greenspun \"Including Comm...
Date Added: 2009-06-07 09:10:12

COS280-lect-2006-04-12.pdf
Path: Taylor IN >> CSE >> 280 Fall, 2009
Description: AI quotes while waiting AI is about making machines more fathomable and more under the control of human beings, not less. Conventional technology has indeed been making our environment more complex and more incomprehensible, and if it continues as i...
Date Added: 2009-06-07 09:10:15

dis13.ppt
Path: Berkeley >> CS >> 160 Fall, 1931
Description: CS160 Discussion Section Matthew Kam Apr 14, 2003 Ethical Considerations Sometimes tests can be distressing users have left in tears (embarrassed by mistakes) You have a responsibility to alleviate make voluntary with informed consent avoi...
Date Added: 2009-06-07 09:10:43

origami.speech.rtf
Path: Portland >> SPEECH >> 220 Fall, 2009
Description: Lisa Paul\'s Informative Speech - 12 February 2003 Introduction: Today, I\'m going to talk about origami. - But, not about its history (arising in Japan), nor show you how to make a paper crane (which is actually pretty hard for beginners) - Rather, my...
Date Added: 2009-06-07 09:11:25

cable.pdf
Path: Harvey Mudd College >> CS >> 181 Fall, 2000
Description: 2001-2002 ACM Northeastern European Regional Programming Contest Problem C \"Cable master\" Input file cable.in Output file cable.out Inhabitants of the Wonderland have decided to hold a regional programming contest. The Judging Committee has volunte...
Date Added: 2009-06-07 09:13:02

OptionLab_Solutions.xls
Path: UMass (Amherst) >> FIN >> 745 Fall, 2009
Description: St<20 Sell 2 call option contracts (30) Sell 2 put option contracts (20) Payoff Option premium income Net payoff 0 -2*100*(20-St) -2*100*(20-St) 20<=St<=30 St>30 0 -2*100*(St-30) 0 0 -2*100*(St-30) 0 2*100*2+2*100*3 2*100*2+2*100*3 1000-2*100*(20...
Date Added: 2009-06-07 09:13:14

OptionLab_Solutions.xls
Path: UMass (Amherst) >> FIN >> 304 Fall, 2009
Description: St<20 Sell 2 call option contracts (30) Sell 2 put option contracts (20) Payoff Option premium income Net payoff 0 -2*100*(20-St) -2*100*(20-St) 20<=St<=30 St>30 0 -2*100*(St-30) 0 0 -2*100*(St-30) 0 2*100*2+2*100*3 2*100*2+2*100*3 1000-2*100*(20...
Date Added: 2009-06-07 09:13:18

log.txt
Path: Washington >> JOBS >> 71784 Fall, 2009
Description: 000 (61667.000.000) 02/17 08:43:56 Job submitted from host: <128.95.94.28:1092> . 001 (61667.000.000) 02/17 14:08:40 Job executing on host: <172.25.101.166:1061> . 006 (61667.000.000) 02/17 14:28:49 Image size of job updated: 351524 . 005 (61667.000....
Date Added: 2009-06-07 09:15:29

error.txt
Path: Washington >> JOBS >> 71692 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 13:40:12 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 14:50:44 2008 ( 4232 s elapsed) ...
Date Added: 2009-06-07 09:16:41

submit.txt
Path: Washington >> JOBS >> 71947 Fall, 2009
Description: executable = pass6_71947.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71500-71999/71947...
Date Added: 2009-06-07 09:16:59

error.txt
Path: Washington >> JOBS >> 71623 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 12:42:46 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 13:54:48 2008 ( 4322 s elapsed) ...
Date Added: 2009-06-07 09:17:57

error.txt
Path: Washington >> JOBS >> 71611 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 12:40:16 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 13:52:14 2008 ( 4318 s elapsed) ...
Date Added: 2009-06-07 09:18:15

error.txt
Path: Washington >> JOBS >> 71830 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 17 14:53:32 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Sun Feb 17 16:03:14 2008 ( 4182 s elapsed) ...
Date Added: 2009-06-07 09:18:35

submit.txt
Path: Washington >> JOBS >> 71535 Fall, 2009
Description: executable = pass6_71535.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs71500-71999/71535...
Date Added: 2009-06-07 09:19:01

output.txt
Path: Washington >> JOBS >> 71500 Fall, 2009
Description: = running on = COMPUTERNAME=PHYSLAB-81WSNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3148 02/17/2008 01:49 PM <DIR> . 02/17/2008 01:49 ...
Date Added: 2009-06-07 09:19:03

XP-Questions.Dan.doc
Path: UNF >> CIS >> 6516 Fall, 2009
Description: 1) How does Extreme Programming compare to the other lightweight methodologies in terms how heavy or light it is? 2) In which scenarios and why will Extreme Programming succeed? 3) In which scenarios and why will Extreme Programming fail? 4) Explain ...
Date Added: 2009-06-07 09:20:35

29-Birthday.pdf
Path: Rose-Hulman >> CSSE >> 479 Fall, 2009
Description: DTTF/NB479: Dszquphsbqiz Announcements: Day 29 HW7 due tomorrow, along with factoring bonuses SHA bonus due Thursday night Week 9 (next week): Elliptic curve group presenting Thursday Project workday moved to Friday. Friday. Questions? This week: ...
Date Added: 2009-06-07 09:20:53

Thermodynamics.pdf
Path: Wisc Stevens Point >> CHEM >> 106 Fall, 2009
Description: Chemistry 106 - Fundamental Chemistry Enthalpies, Entropies, and Free Energies of Formation 1. Use standard enthalpies of formation from Appendix 2 to calculate the standard enthalpy change for each of the following reactions. a. NH3(g) + HCl(g) N...
Date Added: 2009-06-07 09:22:19

557_Fan_Laws_Air_Cleaners-1.pdf
Path: Washington >> ENVH >> 557 Fall, 2009
Description: Fans and air cleaners (2) Fan Laws Fan laws are very useful for finding operating points of a system (condition 1 2) #1 is starting point; #2 is new point 3 basic fan laws in terms of rotation rate (RPM) Q2 RPM 2 = RPM Q1 1 PS 2 Q2 = P...
Date Added: 2009-06-07 09:23:35

week10_Traditional_Intruments_Nigeria.ppt
Path: Maple Springs >> ARTS >> 3665 Fall, 2009
Description: Humanities 3665 3.0 African Oral Tradition November 14, 2006 Traditional Instruments of Nigeria: The Akan Talking Drums Tone Instruments Flutes, horns and drums Two or three tones, reflecting the tonal structure of the language By varyin...
Date Added: 2009-06-07 09:23:54

Stata Manual 8 Reserve List.pdf
Path: UNC >> E >> 570 Spring, 2009
Description: RESERVE MATERIALS LIST: Books Undergraduate Library, CB #3942 Instructor: Boone A. Turchi Office Address Course: Econ _70_ Phone No. 6-5348 Semester_Fall and Spring (permanent) No. of Students 100 (per semester) 200A Gardner Hall CB# 3305 Boone_Tur...
Date Added: 2009-06-07 09:24:49

Baseballsolved.xls
Path: WVU >> BADM >> 621 Fall, 2008
Description: Do baseball batting averages differ by position in the sample on the data worksheet? First sort the data by position then do a one-way ANOVA. Do the players in the American League (AL) have a higher average than the players in the National League (NL...
Date Added: 2009-06-07 09:24:55

outline-eco140-f07-v2.pdf
Path: UCSC >> ECO >> 140 Fall, 2009
Description: Econ 140: International Trade Fall 2007 TTH 8:00am 9:45am 240 College Eight Academic Building Course Outline (Preliminary and Subject to Change) Revised October 2, 2007 Week 0: Introduction to International Trade Krugman & Obstfeld, Chapter 1 Week 1...
Date Added: 2009-06-07 09:25:02

announce6.pdf
Path: Syracuse >> FACULTY >> 301 Fall, 2009
Description: ECN 301 (004) - ANNOUNCEMENTS - SPRING 2009 Thurs, Mar 5, 2009 1. Read Chapters 9 and 10 for the first week after the break. 2. For Thurs, Mar 19, turn in Problem 3, Assignment 5. ...
Date Added: 2009-06-07 09:25:40

505hosetsfs.pdf
Path: Syracuse >> FACULTY >> 505 Fall, 2009
Description: ECN 505 - HANDOUT - FALL 2009 SETS, FUNCTIONS, AND SPECIAL FUNCTIONS SETS A set denoted by A, B, etc., is a collection of objects or members or elements. A set possibly contains no elements; in this case we denote the set by and call it the empty o...
Date Added: 2009-06-07 09:25:54

week5m.ppt
Path: Augustana >> HELIOS >> 105 Fall, 2009
Description: PH105 Dr.CeciliaVogel Lecture12 Timbrereview Spectrum FourierSynthesis OUTLINE harmonicsandperiodicity FourierAnalysis Timbreandgraphs: Timegraph Spectrumgraph Spectrogram Timbreortonequality dependsprimarilyon Timbre Apuretonehasa tuning...
Date Added: 2009-06-07 09:26:50

week3-f-Q.ppt
Path: Augustana >> HELIOS >> 103 Fall, 2009
Description: Diffraction Ihaveaverynarrowslitinafoilsheet.FirstI sendredlaserlightthroughit,thengreen laserlight.Whichproducesthewider diffractionpattern? A. A. B. C. Redproducesalargerpattern,butlessthantwice aslarge. Redproducesmorethantwiceaslargeapattern. Gre...
Date Added: 2009-06-07 09:26:52

termmarks.pdf
Path: Toledo >> MAT >> 247 Fall, 2009
Description: MAT 247S Algebra II - Summary of term test marks Total marks: 100 Number of students: 47 Median and average marks: median=67; average=57. Number of marks between 90 and 100: 7 Number of marks between 80 and 89: 7 Number of marks between 70 and 79: 6 ...
Date Added: 2009-06-07 09:27:09

Woolfexcerpt.doc
Path: N. Colorado >> ENG >> 345 Fall, 2009
Description: Virginia Woolf, from A Room of Ones Own (1929) Let us imagine, since facts are so hard to come by, what would have happened had Shakespeare had a wonderfully gifted sister, called Judith . . . . She was as adventurous, as imaginative, as agog to see ...
Date Added: 2009-06-07 09:28:14

lec07.solvent_select.ppt
Path: UF >> FOS >> 6355 Fall, 2009
Description: Solvent Selection for Separation Solvent Selection for Separation Processes Requiring Solvents Extraction Partition Fractional Crystallization Extractive Distillation Liquid Chromatography Gas-Liquid Chromatography Solvent Selection for Sepa...
Date Added: 2009-06-07 09:30:34

L7.pdf
Path: Idaho >> EE >> 361 Fall, 2009
Description: 80C196 Memory Pg. 4-1 11/9/01 COE 361 / EE443 L7 1 Special purpose memory Pg. 4-4 11/9/01 COE 361 / EE443 L7 2 Register file Pg. 4-6 11/9/01 COE 361 / EE443 L7 3 Register file windowing Pg. 4-9 11/9/01 COE 361 / EE443 L7 4 Register file S...
Date Added: 2009-06-07 09:31:30

L7.pdf
Path: Idaho >> EE >> 443 Fall, 2009
Description: 80C196 Memory Pg. 4-1 11/9/01 COE 361 / EE443 L7 1 Special purpose memory Pg. 4-4 11/9/01 COE 361 / EE443 L7 2 Register file Pg. 4-6 11/9/01 COE 361 / EE443 L7 3 Register file windowing Pg. 4-9 11/9/01 COE 361 / EE443 L7 4 Register file S...
Date Added: 2009-06-07 09:31:30

Taking Sides[1].pdf
Path: CSU Northridge >> ML >> 610 Fall, 2009
Description: ...
Date Added: 2009-06-07 09:32:53

ps3.ps
Path: Wisconsin >> SSC >> 710 Fall, 2008
Description: #%-12345X@PJL JOB @PJL SET HOLD=OFF @PJL SET RESOLUTION = 600 @PJL SET BITSPERPIXEL = 2 @PJL SET ECONOMODE = OFF @PJL ENTER LANGUAGE = POSTSCRIPT %!PS-Adobe-3.0 %Title: C:\\Files\\docs\\classdocs\\710\\Ps3 %Creator: PScript5.dll Version 5.2.2 %CreationDat...
Date Added: 2009-06-07 09:32:55

Protection for Sale Lecture Notes.pdf
Path: Penn State >> AUR >> 507 Fall, 2009
Description: Lecture Notes for Grossman and Helpman\' s Protection for Sale Andrs Rodrguez-Clare Pennsylvania State University and NBER April 26, 2007 Here I follow Feenstra, Chapter 9, and its notation. Three steps: (1) economic structure, (2) political struct...
Date Added: 2009-06-07 09:32:59

lecture23.pdf
Path: Allan Hancock College >> MATH >> 3962 Fall, 2009
Description: Lecture 23 (Polynomials Over Q) Lemma 23.1 Let R and S be rings and : R S a ring homomorphism and x and y indeterminants. Then there is unique extension of to a homomorphism R[x] S[y] which takes x to y. Proof A homomorphism respects addition and...
Date Added: 2009-06-07 09:34:28

projsol.pdf
Path: Rochester >> ME >> 406 Fall, 2009
Description: ME 406 Project Solutions April 3, 2009 sysid Mathematica 6.0.3, DynPac 11.02, 432009 intreset; plotreset; imsize = 250; This notebook was written as the problem was being solved, so it shows the exploration as well as the final results. 1. System...
Date Added: 2009-06-07 09:37:33

455 09 week 14 day 1.doc
Path: UCCS >> BIO >> 455 Fall, 2009
Description: BIOL 455/555 Spring 2009, Week 14 Day 1 Lower Extremity Biomechanics - continued Thought for the Day: Some people say, it may be possible but it\'s too difficult. Others will say, it may be difficult but it\'s possible. I. II. Class Schedule The Hip...
Date Added: 2009-06-07 09:38:16

3 April 09 HIV AIDS.pdf
Path: Utah State >> BIOL >> 3000 Fall, 2008
Description: USU 1350 April 3, 2009 HIV AIDS How it disables the immune system. How it escapes treatment using natural selection AIDS patient, Kenya 1991 15.5 yrs Liberace 1887 Arthur Ashe Tennis star 1993 1981 1978 gay men in Sweden and the US Heterosexuals ...
Date Added: 2009-06-07 09:38:56

concept of culture.pdf
Path: Laurentian >> ANTH >> 1000 Fall, 2009
Description: The Concept of Culture Think of 10 ways in which we use the word culture or cultural. Eg. Culture shock, Canadian culture, multicultural Culture is a way of life Material Objects Ideas Attitudes Values Behavior Patterns \"Everything that people h...
Date Added: 2009-06-07 09:40:15

bobcat.doc
Path: Iowa State >> PUBLIC >> 0427 Fall, 2009
Description: Des Moines Register 04-21-07 Bobcat sighting reported in Ankeny By TOM BARTON REGISTER STAFF WRITER A curious and unexpected visitor has caused some alarm for residents in a southwest Ankeny neighborhood. Two residents living in a new development alo...
Date Added: 2009-06-07 09:40:29

13_Cardiovascular notes2.pdf
Path: South Carolina Upstate >> FACULTY >> 242 Fall, 2009
Description: Buffer Systems Provide or remove H+ and stabilize the pH. HC03- is the major buffer in the plasma. H+ + HC03H2C03 Under normal conditions excessive H+ is eliminated in the urine. Acid Base Disorders Respiratory acidosis: Hypoventilation. Accu...
Date Added: 2009-06-07 09:40:47

q2answers.pdf
Path: Richmond >> M >> 212 Fall, 2009
Description: ...
Date Added: 2009-06-07 09:42:03

NSA 290 FINAL PROJECT WEEK 10 AGENDA SP 06.pdf
Path: DeVry Mesa >> FACULTY >> 290 Fall, 2009
Description: NSA 290 Final Project Team Name Week 10 Agenda Section Project Title Here is our project agenda for this week: Welcome to Week 10 ! Last week\'s presentations were, as a whole, both excellent and exciting. Points wise, Jovanny Chonillo\'s Team N is ...
Date Added: 2009-06-07 09:42:45

NSA 290 FINAL PROJECT WEEK 12 AGENDA SP 06.pdf
Path: DeVry Mesa >> FACULTY >> 290 Fall, 2009
Description: NSA 290 Final Project Team Name Week 12 Agenda Section Project Title Here is our project agenda for this week: Welcome to Week 12 ! A reminder that the final run - through presentations will be next week: Thursday ( June 1 ) at 10:00 am for Group ...
Date Added: 2009-06-07 09:42:47

WEB 320 LAB 03 SU 05.pdf
Path: DeVry Mesa >> FACULTY >> 320 Fall, 2009
Description: WEB 320 Student Name Instructor e-Commerce LAB 3 GROUP Due Date Project Maximum Points Your Score 1 2 points 2 2 points 3 2 points 4 2 points 5 1 point 6 1 point TOTAL 10 points PROJECT ONE Domain Name Registration Objective To introduce ...
Date Added: 2009-06-07 09:43:24

Get Started With Course Hero Today!

Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
 

Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners.

Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs.

What People Are Saying About Course Hero

“I was going to fail my Evidence exam, but then I found a great outline on Course Hero!”
- Kim Cowan, Cornell University



“I worked for tens of hours on my chemistry lab reports this semester, and now I can publish my hard work to thousands of people who care to read about what I found.”
- David Grauer, Princeton University




“Many times, students learn best from other students, their peers, rather than from a teacher.  Course Hero provides such a forum for students to teach students.”
- Somerset Perry, Georgetown University


“Course Hero is a great new research tool for college students.  Students can find lots of pertinent information to their studies that they previously could not find or have access to.  It’s for sure an educational innovation and potentially an educational revolution.”
- Andy Suiter, UCLA and UC Davis



“As a freshman, Course Hero will help me to decide what I am actually interested in studying in college.”
- Caity Feindt, Ithaca College



“I have found lecture notes on corporate finance created by students from multiple schools, which has really helped me learn more about the subject.”
- John Stacey III, UCSB



“I study less and learn more with Course Hero.”
- John Sweazey, CU-Boulder



 

Explore the benefits of joining Course Hero's social learning network.

Get millions of study materials now!

Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!

Click below to sign-up for FREE.
 

Get over 200,000 textbook solutions now!

Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.

Click below to sign-up for FREE.
 

Meet over 300,000 students and your fellow classmates now!

Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!

Click below to sign-up for FREE.
 

Course Hero is not sponsored or endorsed by any college or university.