Course Solutions And Notes - NSA 290 FINAL PROJECT WEEK 10 AGENDA SP 06 a3

Displaying 17501-18000 of 23186 documents:
next page of documents

0127_re_landscape_plant.doc
Path: Iowa State >> ENGL >> 302 Fall, 2008
Description: Engl 302, Spring 05 Manop Kaewmoracharoen RE: Landscape Plants (Question 1.1 page 27) Due 01/27/05 1. In this letter, the main point is buried in the second paragraph that the customer knows that he/she will get the replacement shipment. The customer...
Date Added: 2009-06-07 09:57:14

d2685.rtf
Path: East Los Angeles College >> H >> 808 Fall, 2009
Description: H808 The eLearning Professional: year plan 2006/07 Study Week/date 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 2 September 9 September 16 September 23 September 30 September 7 October 14 October 21 October 28 October 4 November 11 November 18 November 25 Nov...
Date Added: 2009-06-07 09:57:46

Case 3-7 Application Architecture.doc
Path: UCSC >> CMPS >> 058 Winter, 2009
Description: SADM 5/ed CASE STUDY 3 Milestone 7: Application Architecture Page: 7-1 MILESTONE 7 APPLICATION ARCHITECTURE J 0. Synopsis ust as we modeled business requirements during systems analysis, we should model technology architecture and requirement...
Date Added: 2009-06-07 09:57:51

Hints on Surface Integrals.doc
Path: UNC Wilmington >> M >> 261 Fall, 2009
Description: Hints on Surface Itegrals r = FdS S=bd(R) Is No Yes Is S closed? No Yes No Is S closed? Yes =0 Choose simplest surface S\' with the s same boundary Parametrize and Integrate rr = gFdV R Case 1. Parametrize and Integrate Write the parametric...
Date Added: 2009-06-07 09:57:56

Week Fourteen 4.11.ppt
Path: UNC Charlotte >> CWANG >> 6101 Fall, 2009
Description: Review (1): Statistical Risk and Power pvalue: The probability of not detecting a relationship when it actually exists. -value: The probability of detecting a relationship when it does not exist. Reject the null Accept the hypothesis null ...
Date Added: 2009-06-07 10:01:10

99a2216df.pdf
Path: Wisconsin >> LAW >> 731 Fall, 2008
Description: LRBa2216 03/30/2000 11x57:17 AM Page 1 3 n. 1999 DRAFTING REQUEST c Assembly Amendment (AA-ASAl-AB731) Received: 03/30/2000 Wanted: Today For: Glenn Grothman (608) 264-8486 This file may be shown to any legislator: NO May Contact: Subject: Children...
Date Added: 2009-06-07 10:01:20

Calc-151_HW7.pdf
Path: SUNY IT >> CALC >> 151 Fall, 2009
Description: MAT 151, Calculus I HOMEWORK 7 Problems from Stewart: p.230: 4, 8, 32, 36, 48, 52, 56, 72 . p.238: 14, 18, 20 , 30. p.247: 8, 12, 14, 24, 32, 52 . # the problem may be offered on next quiz as a bonus problem. 1 ...
Date Added: 2009-06-07 10:03:20

2.8.3.ppt
Path: University of Illinois, Urbana Champaign >> UNIT >> 248 Fall, 2009
Description: is Waiter 1 is Coffee 1 is Napkins 1 e ur t es o g t Lawyer 1 is Document 1 is Contract 1 is Client 1 is ...
Date Added: 2009-06-07 10:04:29

bermankenyon2006 celll 124 1055.pdf
Path: Berkeley >> MCB >> 240 Fall, 2009
Description: Germ-Cell Loss Extends C. elegans Life Span through Regulation of DAF-16 by kri-1 and Lipophilic-Hormone Signaling Jennifer R. Berman1 and Cynthia Kenyon1,* Department of Biochemistry and Biophysics, Mission Bay Genentech Hall, 600 16th Street, Room ...
Date Added: 2009-06-07 10:04:39

OverESTech3.pdf
Path: Penn State >> ALB >> 278 Fall, 2009
Description: Arnon L. Bazemore Construction Management CENTRE Alternative Methods Research Overall Executive Summary This assignment will encompass all of the areas that will be used for this thesis proposal. Each topic discussed, will address topics and issues...
Date Added: 2009-06-07 10:04:47

lecture15.pdf
Path: University of Illinois, Urbana Champaign >> ASTRO >> 230 Fall, 2009
Description: Astronomy 230 Section 1 MWF 1400-1450 106 B1 Eng Hall Jupiter\'s Clouds Kevin said: This Class (Lecture 13): John Wang Derrick Cheng John Tobin Next Class: Mary Ann Mulawka Vincent Vazzo Whitney Mihel Music: Hey Jupiter Tori Amos Sept 29, 2004 Ast...
Date Added: 2009-06-07 10:05:13

Methodology.ps
Path: Bowling Green >> CIS >> 3300 Fall, 2009
Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - Methodology %Creator: PSCRIPT.DRV Version 4.0 %CreationDate: 04/14/99 23:13:57 %BoundingBox: 16 14 597 779 %Pages: (atend) %PageOrder: Special %Requirements: %DocumentNeededFonts: (atend) %DocumentSupplie...
Date Added: 2009-06-07 10:05:47

Lecture14 (2-16).pdf
Path: Purdue >> CHM >> 224 Spring, 2008
Description: Aqueous Solutions and Chemical Equilibria: Acid-base titration Complexometric titration Separations Electrochemistry Etc., etc. Illustration: acid-base titrations Concepts and determination of pH during course of titration Acid-base titrations invol...
Date Added: 2009-06-07 10:05:58

Recruitment and Yield Class.pdf
Path: Idaho >> FISH >> 510 Spring, 2008
Description: Characteristics of Fish Populations Unexploited Populations Recruitment Mortality (natural) Growth Exploited Populations Recruitment and Yield Fishing and Natural Mortality Compensatory Growth Recruitment and Yield Recruitment is defined a...
Date Added: 2009-06-07 10:06:08

project04.xls
Path: Texas A&M >> GEOG >> 332 Fall, 2008
Description: Data Array 1.70E+01 4.50E+01 2.30E+01 7.80E+01 2.34E+02 1.37E+02 1.93E+02 8.80E+01 4.70E+01 6.20E+01 9.50E+01 1.37E+02 1.22E+02 5.60E+01 1.74E+02 1.83E+02 8.90E+01 7.90E+01 3.50E+01 2.30E+01 6.40E+01 1.49E+02 2.06E+02 2.22E+02 1.40E+01 9.00E+00 5.80E...
Date Added: 2009-06-07 10:06:35

Solutions1.pdf
Path: Michigan State University >> PHY >> 101 Fall, 2008
Description: PHY 101 Take home exam #1 Name _Solution Key_ Show and explain your work and hand in the answers on the exam sheet. 1/ The Earth rotates at a constant rate, with a period of 24 hours. What force (or torque) causes the rotation of the Earth? Explain...
Date Added: 2009-06-07 10:07:08

lrntask.ppt
Path: Minnesota >> CI >> 5336 Spring, 2008
Description: Conduct a Task Analysis Presented by s Patricia L. Smith, Ph.D. s Tillman J. Ragan, Ph.D. Learning Task Analysis - 1 Session Objective Given two tasks, conduct a task analysis to include the following components: the major steps of the task the r...
Date Added: 2009-06-07 10:07:51

foot 4_10.xls
Path: University of Illinois, Urbana Champaign >> PHYS >> 598 Fall, 2008
Description: x 0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16 0.18 0.2 0.22 0.24 0.26 0.28 0.3 0.32 0.34 0.36 0.38 0.4 0.42 0.44 0.46 0.48 0.5 0.52 0.54 0.56 0.58 0.6 0.62 0.64 0.66 0.68 0.7 0.72 0.74 0.76 0.78 0.8 0.82 0.84 0.86 0.88 0.9 0.92 0.94 0.96 0.98 V(x) -100...
Date Added: 2009-06-07 10:08:18

RCW_Trial_locs.txt
Path: UNC >> GEOG >> 801 Fall, 2008
Description: \"FID_\",\"FEATURE_ID\",\"EO_ID\",\"EONUM\",\"ELCODE\",\"EL_GROUP\",\"AN_PL\",\"N_CAT_DESC\",\"SNAME\",\"SCOMNAME\",\"GRANK\",\"SRANK\",\"USESA\",\"SPROT\",\"SEOTRACK\",\"SSHABITAT\",\"SURVEYDATE\",\"FIRSTOBS\",\"LASTOBS\",\"REP_ACC\",\"LAT_BCD\",\"LONG_BCD\",\"LAT\",\"LON\",\"X_UTM17\",\"Y_UTM17\",\"G...
Date Added: 2009-06-07 10:11:06

Chapter-13-SlideBearing.pdf
Path: Drexel >> MEM >> 431 Fall, 2009
Description: Chapter 13 Lubrication and Sliding Bearings 13.1. Type of Lubricants When relative motion occurs between the surfaces, it is usually desirable to minimize friction and wear. Any interposed substance that reduces friction and wear is a lubricant. Lubr...
Date Added: 2009-06-07 10:13:12

Email Instructions.doc
Path: E. Kentucky >> ENGL >> 102 Fall, 2009
Description: INDEPENDENTSTUDY ASSIGNMENTCOVERSHEET Dateofsubmissiontoyourinstructor: I. STUDENTUSEONLY StudentCode: CourseNameandNo.: AssignmentNo.: StudentsName: StudentsEmailAddress: Telephone: II. INSTRUCTORUSEONLY Date: Grade: InstructorsName: (over) ...
Date Added: 2009-06-07 10:13:13

24135.txt
Path: UNC >> DOCS >> 24135 Fall, 2009
Description: The Project Gutenberg eBook, The Measure of a Man, by Randall Garrett, Illustrated by Martinez This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under t...
Date Added: 2009-06-07 10:14:56

24869-0.txt
Path: UNC >> DOCS >> 24869 Fall, 2009
Description: The Project Gutenberg EBook of The Ramayana This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Project Gutenberg License included wi...
Date Added: 2009-06-07 10:15:40

lecture22.pdf
Path: Oakland University >> CSE >> 40532 Fall, 2009
Description: Genome annotation http:/www.turbocharged.com/catalog/parts_list.html 1 Building a \"Parts list\" Finding genes involves both computational and experimental methods. Downsides: Computational methods are often inadequate and miss things. Next-gen ...
Date Added: 2009-06-07 10:16:56

133t3AF07.pdf
Path: SEMO >> MA >> 133 Fall, 2009
Description: ...
Date Added: 2009-06-07 10:17:37

133finsgF07.pdf
Path: SEMO >> MA >> 133 Fall, 2009
Description: MA 133 Review for Final NOT COLLECTED 1. Convert 35 27\'13\" to decimal degrees, rounding to three places. 2. Convert 89.234 to degree-minutes-seconds. 3. Convert 159 to radians. 4. Convert 1.79 radians to decimal degrees 5. Find the length of an arc s...
Date Added: 2009-06-07 10:17:37

133finsgF07.pdf
Path: SEMO >> TESTS >> 133 Fall, 2009
Description: MA 133 Review for Final NOT COLLECTED 1. Convert 35 27\'13\" to decimal degrees, rounding to three places. 2. Convert 89.234 to degree-minutes-seconds. 3. Convert 159 to radians. 4. Convert 1.79 radians to decimal degrees 5. Find the length of an arc s...
Date Added: 2009-06-07 10:17:37

407ExampleDomainClassDiagram1.doc
Path: CSU Fullerton >> BTS >> 430 Fall, 2009
Description: 1.n 1 contains 1 Bill 1.n 0.n pays<-owned by 0.1 Trans ponder billed to Trip 1 billed to 0.1 LicensePlate 0.n owned by 1 1 1 Customer Conceptual Classes From 407 Example: Bill o date Transponder Trip o Photo (?) o TransponderCharge (?) o NonTr...
Date Added: 2009-06-07 10:18:28

HelloWorld.ppt
Path: Illinois Tech >> CS >> 447 Fall, 2009
Description: HelloWorld Revisit e Review HelloWorld Example R Idl R Generated files d Why separate GoodDay and GoodDayOperations d Operations may not want to extend from org.omg.CORBA.Object d Relationship among generated classes org.omg.CORBA.Object InterfaceNa...
Date Added: 2009-06-07 10:19:03

lec04.ps
Path: Princeton >> CS >> 426 Fall, 2009
Description: %!PS-Adobe-3.0 %Title: (10.pdf) %Creator: (Acrobat Reader) %CreationDate: (Sun Oct 4 14:29:41 1998) %For: (af) %Pages: 4 %EndComments /currentpacking where{pop currentpacking true setpacking}if userdict /PDF 75 dict put %BeginFile: pdfvars.prc %Copyr...
Date Added: 2009-06-07 10:19:13

AAR_SSRD_QFP_F07a_T13_v1.0.xls
Path: USC >> CSCI >> 577 Fall, 2009
Description: a3a947043bd0a3ae0eef2003addd51da0a0fc856.xls - Areas of Concern Log Project Name: Artifact: Module: MBASE Phase/level: Activity: Exit Criteria: Review Leader: Review Leader email: Review Leader phone: Author: EEO Section Database SSRD Review # Re...
Date Added: 2009-06-07 10:19:34

syllabus.ps
Path: Washington >> MATH >> 466 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: syllabus.dvi %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips syllabus.dvi -o syllabus....
Date Added: 2009-06-07 10:19:57

mathcs.pdf
Path: Bridgewater State >> WIRELESS >> 0607 Fall, 2009
Description: MATHEMATICS AND COMPUTER SCIENCE FACULTY Chairperson: Associate Professor Richard Quindley 4. to prepare students planning to teach mathematics on the secondary level; 5. to serve the needs of students in elds which rely on mathematics, e.g., experi...
Date Added: 2009-06-07 10:20:41

SOCI.pdf
Path: Bridgewater State >> WIRELESS >> 0708 Fall, 2009
Description: Course Descriptions SOCIOLOGY (SOCI) SOCI 102 Introduction to Sociology (3 credits) This course covers such areas as social structure, basic human institutions, analysis of social processes and major social forces. Either semester (CSOC; CMCL) SOCI 1...
Date Added: 2009-06-07 10:21:20

BIOE_BIOF_BIOL.pdf
Path: Bridgewater State >> WIRELESS >> 0607 Fall, 2009
Description: BIOLOGICAL SCIENCES (BIOE, BIOF, BIOL) BIOE 511 Advanced Biological Topics and Techniques (1-3 credits) Designed for secondary education science teachers, this course is composed of three one credit \"short courses.\" Short course topics will vary and ...
Date Added: 2009-06-07 10:21:44

MCB 135E Discussion Oct 28.ppt
Path: Berkeley >> MCB >> 135 Fall, 2008
Description: MCB 135E: Discussion Discussion Topics Lactation Gastrointestinal System Liver Lactation Mammary Gland Development Milk Production, Ejection, Cessation Benefits of Breast Feeding Mammary Gland Development 6th week of gestation Formation of...
Date Added: 2009-06-07 10:22:20

metis.20080228.txt
Path: BU >> CS >> 900 Fall, 2009
Description: A AA AAI AAR ABB ABC ABI ABK ABM ABN ABT ABV ABX ACE ACF ACG ACI ACK ACN ACO ACS ACV ADC ADF ADI ADM ADP ADS ADX AEC AED AEE AEF AEG AEM AEP AES AET AF AFC AFF AFG AFL AG Type: Bullish Pennant Start: X: 0.0 ...
Date Added: 2009-06-07 10:22:50

sa351d01.txt
Path: Sveriges lantbruksuniversitet >> ARTS >> 19973 Fall, 2009
Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: SA 351-4 D01 LOCATION: SFU TITLE: CLASS.MARXIST THGT SECTION TYPE: SEM SEMESTER: 1997-3 ENROL: 13...
Date Added: 2009-06-07 10:22:53

cmns494d01.txt
Path: Sveriges lantbruksuniversitet >> APSC >> 19973 Fall, 2009
Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: CMNS 494-0 D01 LOCATION: SFU TITLE: CMNS PRACTICUM III SECTION TYPE: SEC SEMESTER: 1997-3 ENROL: 15...
Date Added: 2009-06-07 10:23:21

hist379d02.txt
Path: Sveriges lantbruksuniversitet >> HIST >> 19973 Fall, 2009
Description: PROFILE OF STUDENTS IN SFU COURSES COURSE: HIST 379-4 D02 LOCATION: SFU TITLE: AM.CULTURE 1830-1900 SECTION TYPE: SEM SEMESTER: 1997-3 ENROL: 17...
Date Added: 2009-06-07 10:23:28

JAN_84.pdf
Path: Penn State >> BUB >> 1984 Fall, 2009
Description: ...
Date Added: 2009-06-07 10:23:56

PathIntegral-CylindricalCoordinates.pdf
Path: UNC Charlotte >> MATH >> 2242 Fall, 2008
Description: A Path Integral in Cylindrical Coordinates The (original) third graded homework had the following problem: Let c(t) = (t cos t, t sin t, t) and f (x, y, z) = |x2 + y 2 |. Calculate c f ds. A direct attempt in Cartesian coordinates goes as follows. Fi...
Date Added: 2009-06-07 10:24:39

Ch06RegularExpressions.ppt
Path: Winona >> CS >> 435 Fall, 2009
Description: Regular Expressions Chapter 6 1 Regular Languages L Regular Language Regular Expression Accepts Finite State Machine 2 Regular Expressions The regular expressions over an alphabet are all and only the strings that can be obtained as follows...
Date Added: 2009-06-07 10:25:49

HumanVisualSystem.pdf
Path: Utah State >> CS >> 5400 Fall, 2008
Description: Parts of the Eye Ocular Refractive Media Transparent Elements Cornea Aqueous Lens Shape changed by ciliary muscles Vitreous Light Refracted by anterior surface of cornea Refracted by lens to focus on retina Parts of the Eye (continued) Iris - Perip...
Date Added: 2009-06-07 10:26:19

Discussion 4 For565 Spr2005.pdf
Path: Wisconsin >> FOR >> 565 Fall, 2009
Description: Discussion 4 April 14, 2005 Principles of Landscape Ecology (FEM 565) Our discussion revolved around three papers: 1. Hanski, I. 1998. Metapopulation Dynamics. Question: Does landscape ecology (LSE) have a theoretical framework? Thought: Hanski is b...
Date Added: 2009-06-07 10:27:22

Boose_et_al.pdf
Path: Wisconsin >> LANDSCAPE >> 875 Fall, 2009
Description: ...
Date Added: 2009-06-07 10:27:24

lecture15.pdf
Path: San Diego State >> PHYS >> 608 Fall, 2008
Description: Lecture 15 - 3 Dead, Rotating, Bodies end of Scattering Cross Sections (Section 3.10) Quick look at the Lab point of view (Section 3.11) Brief look at three bodies (Section 3.12) Rotation Coordinates (Section 4.1) Orthogonal Transformations (Sec...
Date Added: 2009-06-07 10:27:49

lecture13.pdf
Path: San Diego State >> PHYS >> 610 Fall, 2009
Description: Lecture 13 Outline - Bound and Scattered out of the innite box [Section 5.2] into a nite well [problem 5.2.6] Completeness and matrix elements well eigenstates x|n n (x) then (x) = with orthonormal states m|n (x) (x) n=1 n=2 (x) cn x|n m...
Date Added: 2009-06-07 10:27:55

(Ambush Marketing) McKelvey_SMQ_2006.pdf
Path: NMSU >> M >> 454 Fall, 2009
Description: Sport MarHeting Quarterly, 2006, 15, 114-123, 2006 West Virginia University Coca-Cola vs. PepsiCo - A \"Super\' Battleground for the Cola Wars? Steve M. McKelvey Overview of the Soft Drink Industry Coca-Cola: The Defending Champion Since its incepti...
Date Added: 2009-06-07 10:30:20

Thu_Mar_19.txt
Path: Auburn >> RH >> 370 Fall, 2009
Description: onawooo smb8451 131.204.14.66 Thu Mar 19 22:56 - 23:06 (00:10) dps0003 smb5885 131.204.14.46 Thu Mar 19 22:30 - 22:41 (00:10) hzr0001 smb898 131.204.14.42 Thu Mar 19 21:56 - 22:07 (00:10) vzc0009 smb847 131.2...
Date Added: 2009-06-07 10:32:17

070126_variation.pdf
Path: WTAMU >> PHYS >> 4340 Fall, 2009
Description: Dealing with small variations Math Methods, D. Craig 20070126 Section 3.2: Cosmic dust The example in this section shows a technique using the first order term of the Taylor series to make a numerical estimate. I will go through the solution with co...
Date Added: 2009-06-07 10:32:25

error.txt
Path: Washington >> JOBS >> 31500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Feb 11 00:12:40 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 00:55:34 2008 ( 2574 s elapsed) ...
Date Added: 2009-06-07 10:33:59

submit.txt
Path: Washington >> JOBS >> 31500 Fall, 2009
Description: executable = pass6_31524.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31524...
Date Added: 2009-06-07 10:34:28

error.txt
Path: Washington >> JOBS >> 31500 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Sun Feb 10 23:43:14 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Feb 11 00:23:38 2008 ( 2424 s elapsed) ...
Date Added: 2009-06-07 10:35:17

LCS.pdf
Path: Mich Tech >> CS >> 2321 Fall, 2008
Description: Longest Common Subsequence Algorithm:lcs(X , Y ) Input : X a string of n symbols Input : Y a string of m symbols Output : A table L[n][m] where L[i][j] indicates the longest common substring from the first i characters of X and the first j characters...
Date Added: 2009-06-07 10:35:38

26h.pdf
Path: University of Hawaii - Hilo >> MATH >> 311 Fall, 2008
Description: Math 311 Hw 26 Name _ Score_/ 15 Hw 163: 30, 34. 305: 2, 10, 12. Recommended 163: 31, 35. 305: 3, 5ab, 9. Answer page 2.7,540, 4.4,4.5,547. 3DJH. . Describe an isomorphism L such that L:P2R3. L(at2+bt +c) = . Suppose V and W are vector spaces and L:V...
Date Added: 2009-06-07 10:35:46

HO-03.pdf
Path: Princeton >> ECO >> 323 Fall, 2009
Description: Department of Economics Princeton University Economics 323 Spring 1999 Hand Out 3 Deriving the MLR Condition Section 2 in Appendix B of the text provides a derivation of the MarshallLerner-Robinson (MLR) condition. Here is another, in exchange-market...
Date Added: 2009-06-07 10:35:56

hw10.pdf
Path: Maryland >> ASTR >> 320 Fall, 2008
Description: ASTR 320 Spring 2009 Prof. Ostriker ASSIGNMENT No. 10 DUE: Tuesday, May 12 Reading: Read Maoz 4.2 (pp. 69-81) on white dwarfs, and 4.3.2 (pp. 84-85) on neutron stars. 1. White dwarf properties In class, we showed that the pressure and density for ...
Date Added: 2009-06-07 10:37:21

Exam 2cc.doc
Path: Alabama >> PH >> 105 Fall, 2008
Description: PH105-001 Exam 2c retake Nov. 3, 2006 1. A 4-kg bomb initially at rest explodes into two fragments of masses 1 kg and 3 kg. The speed of the 1-kg fragment is 60 m/s. How much total energy was released in the explosion? (a) 400 J (b) 1800 J (c) 240...
Date Added: 2009-06-07 10:37:24

Annotated PE Lesson .doc
Path: Allan Hancock College >> TC >> 461 Fall, 2009
Description: Equipment (24 students) 24 Badminton Racquets 4 shuttlecocks 16 cones 3 courts and 3 nets Name: Class: Unit: Lesson: Striking with racquets and bats PE 4 of 4 The student will be able to . 1. When questioned explain at least one point about the im...
Date Added: 2009-06-07 10:37:32

Portfolio Rubric.doc
Path: Allan Hancock College >> TD >> 520 Fall, 2009
Description: Part A: Professional Portfolio (20%) The key deliverable for this task is the collation of an employment portfolio. The contents should focus on selected artifacts to enhance your employment chances. The portfolio should include all of the required c...
Date Added: 2009-06-07 10:37:34

agenda.pdf
Path: W. Alabama >> STAT >> 220 Fall, 2009
Description: University of Waterloo STAT 220_09_02 - W H. Cherry . Content overview for STAT 220 (about 37 lectures): Part Part Part Part Part Part Part Part Part 1: The subject of statistics (about 112 lectures). 2: Data characteristics and features...
Date Added: 2009-06-07 10:37:56

exercises.txt
Path: Emporia >> CS >> 552 Spring, 2008
Description: * * * * TASK-CENTERED USER INTERFACE DESIGN * * A Practical Introduction * * *...
Date Added: 2009-06-07 10:38:42

modl.txt
Path: Berkeley >> ASTRO >> 00020085 Fall, 2009
Description: chi^2/nu= 6.7824439 / 1 The fit is rejectable at 99.079412 % Confidence 1.00000e-05 1.00000e-05 1.0000000 7619.10 8619.86 0.020456486 8619.86 9927.07 0.019949700 ...
Date Added: 2009-06-07 10:40:35

Outline.Lect4.Bios106.pdf
Path: N. Illinois >> BIOS >> 106 Fall, 2008
Description: Matter and energy in environmental systems Matter: anything that takes up space and has mass exists in 3 principal forms: solid, gas or liquid Amount of matter stays relatively constant in earth\'s ecological systems (principle of conservation of m...
Date Added: 2009-06-07 10:41:03

unit2web.ppt
Path: ECCD >> CHEM >> 1003 Fall, 2009
Description: 2. Atoms and Elements chapter 2 Scanning Tunneling Microscope (STM) Image of gold atoms (Nanotechnology) Atomic radius of gold is ~ .2 nm (1 nm =10-9m or one billionth of a metre) Subatomic Particles (to Chemists) A proton is a subatomic particle wi...
Date Added: 2009-06-07 10:41:24

Test.doc
Path: Wisc Parkside >> CS >> 476 Fall, 2009
Description: Test 1 Software Engineering II Testing TEXT: Essentials of Software Engineering, Frank Tsui, Orlando Karam Chapter 10 through 10.4 PROJECT WORK: Inspect Acceptance Test Plan OBJECTIVES: The student shall be able to: Define white box test and blac...
Date Added: 2009-06-07 10:42:00

coverpg-pl.ps
Path: UNC >> I >> 386 Fall, 2009
Description: #!/usr/bin/perl # #From: mathews@ednet.gsfc.nasa.gov (Jason Mathews) #Message-Id: <199706022135.RAA23777@ednet.gsfc.nasa.gov> #Subject: MGETTY+SENDFAX\'s make.coverpg converted to perl - FYI #To: gert@greenie.muc.de #Date: Mon, 2 Jun 1997 17:35:43 -04...
Date Added: 2009-06-07 10:42:39

cs5811-ch11a-pop.ps
Path: Mich Tech >> CS >> 5811 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: cs5811-ch11a-pop.dvi %Pages: 49 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Bold Times-Roman Helvetica Helvetica-Oblique %EndComments %DVIPSWebP...
Date Added: 2009-06-07 10:44:37

lecture05-2x2.pdf
Path: Washington >> B >> 540 Fall, 2009
Description: Correlated Data Models, Spring 2009 1 Pre/Post Analyses In many experimental settings, repeated measurements are collected at xed times on each subject post-treatment and at one or more times prerandomization (i.e., baseline) In (most of) these e...
Date Added: 2009-06-07 10:46:38

homework1.pdf
Path: Washington >> DXARTS >> 470 Fall, 2008
Description: DXARTS 470 Spring 2006 HOMEWORK #1 1. What are the three essential properties of systems art? For each property, write a brief one-paragraph summary, and reference an artwork (not one shown in class!) that is an example of the property. 2. Using MAX,...
Date Added: 2009-06-07 10:46:54

FCSTriParishFlyer.pdf
Path: LSU >> C >> 56688 Fall, 2009
Description: To enhance the lives of individuals and families, strengthen communities, and shape the future of Louisiana through research based educational outreach. Vision Mission Statement Center ltural Agricu LSU Working for a healthy Louisiana: physically,...
Date Added: 2009-06-07 10:47:04

finalc.pdf
Path: UNC Charlotte >> M >> 1120 Fall, 2009
Description: Math 1120 Calculus Final Exam June 26, 2001 Your name The multiple choice problems count five points each. The total value of this test is 215 points. 1. Let f (x) = ln(x4 ). What is f (e2 )? (A) 0 (B) 2 (C) 4 (D) 4e-2 (E) 4e2 2. Which of the f...
Date Added: 2009-06-07 10:47:57

metrics.txt
Path: Wisconsin Milwaukee >> CS >> 301 Fall, 2009
Description: Nr. Classes Functions NCSS Package 1 6 32 134 . - - - 6 32 134 Total Packages Classes Functions NCSS | per - 1.00 6.00 32.00 134.00 | Project 6.00 ...
Date Added: 2009-06-07 10:48:50

s-apical.doc
Path: Auburn >> FLSP >> 0301 Fall, 2009
Description: A Madrid speaker using the typical retroflex [ ] and also the voiced variety [ ], with the tongue relatively concave: \". y soy [ ] de Madrid, Espaa [ ]. Cuando yo era nio iba todos [] los aos [ ] a pasar [ ] uno de los [ ] meses [ ] [ ] de vacaciones...
Date Added: 2009-06-07 10:50:01

p210_01c.ppt
Path: N. Illinois >> PHYS >> 210 Summer, 2008
Description: Units Unit Systems Systems set up fundamental units British system - foot, pound, second Metric system - meter, kilogram, second Time The unit of time originally was based on the day and the year. The second was 1/60 * 1/60 *1/24 of a d...
Date Added: 2009-06-07 10:50:31

p210_04d.ppt
Path: N. Illinois >> PHYS >> 210 Summer, 2008
Description: Range, Height and Time Projectile Path All projectiles follow the same shape path. This path is a parabola. Acceleration is constant. Horizontal velocity is also constant. Velocity and position change. Parameterized Curve The two equatio...
Date Added: 2009-06-07 10:50:33

sunrpt.doc
Path: Wisconsin >> ECE >> 539 Fall, 1997
Description: ECE/CS/ME 539 class project Yong Sun Introduction to Artificial Neural Networks and Fuzzy Systems ECE/CS/ME 539 Class Project Instructor: Yu Hen Hu Student: Yong Sun -1- ECE/CS/ME 539 class project Yong Sun Engine Operating Parameter Optimizat...
Date Added: 2009-06-07 10:51:34

math1241homeworkanswerstest2summer08.pdf
Path: UNC Charlotte >> MATH >> 1241 Fall, 2008
Description: ...
Date Added: 2009-06-07 10:51:49

theoretical.txt
Path: Washington >> GENOME >> 373 Fall, 2008
Description: 157 25 174 40 175 50 176 40 222 25 239 40 240 50 241 40 327 25 344 40 345 50 346 40 377 25 394 40 395 50 396 40 448 25 465 40 466 50 467 40 ...
Date Added: 2009-06-07 10:52:12

graphapp.pdf
Path: Virginia Tech >> CS >> 1704 Spring, 2003
Description: ...
Date Added: 2009-06-07 10:53:01

cs122a_Sep30_2.pdf
Path: UC Riverside >> CS >> 122 Fall, 2009
Description: CS122A: Embedded System Design 9/29/2003 Administrative Stuff Thursday, 10/2 Lecture Cancelled Presentation Sign up for article and time slot by NOW 5% of the grade Highly recommended to: Send your presentation material to me no later than ...
Date Added: 2009-06-07 10:53:08

02_20090507thu_notes_ode69870_s09.pdf
Path: Hillsborough >> MAP >> 2302 Fall, 2008
Description: ...
Date Added: 2009-06-07 10:54:44

lecture26.pdf
Path: UT Arlington >> CSE >> 6367 Fall, 2008
Description: Lecture 26 Searching Image Databases CSE 4392/6367 Computer Vision Spring 2009 Vassilis Athitsos University of Texas at Arlington Image Databases Photographs. Image Databases Art clips. Video Databases Movies. Video Databases Movies, TV foo...
Date Added: 2009-06-07 10:54:54

alumni.pdf
Path: Kentucky >> BULL >> 0506 Fall, 2009
Description: UK\'s Distinguished Alumni C 11 The University of Kentucky Alumni Association The purposes of the UK Alumni Association are to promote the best interests and welfare of the University of Kentucky; to fully acquaint the membership of the Association...
Date Added: 2009-06-07 10:54:57

Grant & Grant 2006 suppl.pdf
Path: Utah >> BIOLOGY >> 3410 Fall, 2009
Description: www.sciencemag.org/cgi/content/full/313/5784/224/DC1 Supporting Online Material for Evolution of Character Displacement in Darwins Finches Peter R. Grant* and B. Rosemary Grant *To whom correspondence should be addressed: E-mail: prgrant@princeton.e...
Date Added: 2009-06-07 10:56:04

xuhwk4.pdf
Path: Washington >> MATH >> 402 Fall, 2008
Description: ( Rc w c )TBcsf)TFgFHhDTFqeqwvhbTDfc 2 W Q 2 U G2C S2 Q4 G E Q AC S G S E 4hC 2 Q4 a ( \"hw `sf)SF%Din `sf \"h VTf4 v 2C p2C2 Q ( v 4W Q r2 SC A 2 U h g Q n ( f E %qVFTcTRiB`%Do3)2 (@ v iv w DoDf v ipT)T%DF)S Y2 Q4 f E r YW Q ...
Date Added: 2009-06-07 10:57:01

lp_hyd_3.ppt
Path: UNL >> CSE >> 932 Fall, 2009
Description: LogicLevel Power Estimation Vishwani D. Agrawal Auburn University, USA vagrawal@eng.auburn.edu LowPower Design and Test Srivaths Ravi Texas Instruments India Srivaths.ravi@ti.com http:/www.eng.auburn.edu/~vagrawal/hyd.html Hyderabad, July 3...
Date Added: 2009-06-07 10:57:30

N_salentino_write-up.doc
Path: Washington >> COURSES >> 451 Fall, 2009
Description: Northern Salentino 1 Raising We are told that stress generally falls on the penultimate syllable in N. Salentino, and in verbs with differing number of syllables in the suffix we find alternations between mid and high vowels like those shown in (0)....
Date Added: 2009-06-07 10:57:40

quiz10key.pdf
Path: UAB >> MA >> 227 Fall, 2009
Description: KEY Quiz 10 Calculus III - MA 227 7B April 23, 2007 Time : 10 min Instructions 1. Calculators are NOT permitted on this quiz. 2. Correct answers without any justication will earn no credit. Question 1. Find the work done by the force eld F in moving...
Date Added: 2009-06-07 10:58:00

hw2.pdf
Path: Hudson VCC >> ME >> 111 Fall, 2009
Description: ...
Date Added: 2009-06-07 10:58:09

BU124ch13.09.ppt
Path: Mitchell >> BU >> 124 Fall, 2009
Description: Chapter 12- Distribution Marketing Channels and Supply Chain Management An example An electronics manufacturer has produced 100,000 new DVD players overseas and delivers them to a US port by cargo ship. How will these DVD players become available t...
Date Added: 2009-06-07 10:58:53

Aseptic_Techniques.ppt
Path: Oregon State >> P >> 12004 Fall, 2009
Description: Aseptic Technique Information Taken from D.McAuley Global RPh Inc www.globalrph.com/aseptic.htm Some Important Rules (ASA) Always think of the patients Safety: The finished product must be free of contamination. The solution should be ...
Date Added: 2009-06-07 10:59:41

mm515040815.040712.txt
Path: Harvard >> MM >> 515 Fall, 2009
Description: time xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpnc[nmi] dwichita[nmi] djeffco[nmi] dwaco[nmi] 60.000 13.855 -97.593 36.185 -97.649 36.411 13.820 -97.620 36.296 36.161 85.293 415.864 299.122 0....
Date Added: 2009-06-07 11:02:04

mm545080813.080600.txt
Path: Harvard >> MM >> 545 Fall, 2009
Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 195.833 105.689 -75.714 49.338 -73.341 50.205 21.918 -74.528 49.772 4...
Date Added: 2009-06-07 11:02:42

mm545052120.051906.txt
Path: Harvard >> MM >> 545 Fall, 2009
Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 197.638 106.663 -61.058 44.356 -58.942 43.444 16.538 -60 43.9 4...
Date Added: 2009-06-07 11:03:32

mm545052813.052712.txt
Path: Harvard >> MM >> 545 Fall, 2009
Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 197.411 106.54 -60.999 44.42 -59.001 43.38 17.311 -60 43.9 4...
Date Added: 2009-06-07 11:03:41

HO_090211_Children.pdf
Path: Washington >> MHE >> 516 Fall, 2008
Description: Professor A. Mastroianni PHG 522/MHE 516 2/10/09 Topic: Children and Genetic Testing 1. 2. 3. 4. Reflections on Community protections discussion Children and Health Care Decisionmaking Davis article: Karen Compare and contrast position statements ...
Date Added: 2009-06-07 11:04:35

figure-15.5.ps
Path: Purdue >> CS >> 250 Fall, 2008
Description: %!PS-Adobe-1.0 %Creator: devps (Pipeline Associates, Inc.) %CreationDate: Thu Apr 1 22:30:57 2004 %Pages: (atend) %DocumentFonts: (atend) /X /exch load def /r /rmoveto load def /m /moveto load def /l /lineto load def /rl /rlineto load def /lc{yc X xc...
Date Added: 2009-06-07 11:06:01

sect7recursionH.ps
Path: Duke >> CPS >> 100 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.55a Copyright 1986, 1994 Radical Eye Software %Title: sect7recursionH.dvi %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips sect7recursionH %DVIPSParameters: dpi=600, compre...
Date Added: 2009-06-07 11:07:31

code.pdf
Path: Duke >> CPS >> 100 Fall, 2009
Description: Printed by Jeffrey R.N. Forbes Aug 29, 06 13:01 Printed by Jeffrey R.N. Forbes Aug 29, 06 13:01 IUniqueCounter.java Page 1/1 SetUniqueCounter.java Page 1/1 /* * Interface for reasoning about different methods for determining * number of differe...
Date Added: 2009-06-07 11:08:15

midterm1answers.pdf
Path: Duke >> CPS >> 100 Fall, 2009
Description: 1) boolean isSortOfOdd(int[] nums) { for (int i = 0; i < nums.length; i+){ if (nums[i] % 2 = 0){ if (i = nums.length1 | nums[i+1] % 2 = 0) return false; } } return true; } 2) public int compareTo (Object o){ Piece in = (Piece)o; if (time < in.getTim...
Date Added: 2009-06-07 11:08:34

Lecture16.ppt
Path: Michigan State University >> CSE >> 460 Fall, 2008
Description: Lecture 16 FSAs Defining FSAs Computing with FSAs Defining L(M) Defining language class LFSA Comparing LFSA to set of solvable languages (REC) 1 Quick Review What is the functional definition of a configuration? What is a computation? 2 F...
Date Added: 2009-06-07 11:09:57

ch4_test.pdf
Path: Pima CC >> MAT >> 092 Fall, 2008
Description: ...
Date Added: 2009-06-07 11:10:09

AlgorithmAnimator.java.txt
Path: NJIT >> AC >> 268 Fall, 2009
Description: package chapter7; import java.awt.Graphics; public abstract class AlgorithmAnimator extends DBAnimationApplet { abstract protected void algorithm(); public void run() { algorithm(); } final protected void pause() { if(Thread.currentThr...
Date Added: 2009-06-07 11:12:41

purdySoftwareEngineering.ppt
Path: Lynchburg College >> CS >> 350 Fall, 2009
Description: System Development Life Cycle OR The Recollections of an old \"EDP Guy\" 05/26/09 Prepared By: James R. Purdy 1 Common Terms Common Terms Software \"The entire set of computer programs, procedures and related documentation associated with a system\" - ...
Date Added: 2009-06-07 11:13:48

InstructionsforFinalPaper-CareerActionPlan.doc
Path: UCF >> MHS >> 2330 Fall, 2008
Description: MHS 2330 Fall 2006 Keri Nola, M.A., Instructor Instructions for Final Synthesis Paper and Career Action Plan & Presentation 1. What Did I Get Out of this Class? Review the chapters covered in the three major units: Personal Assessments The World ...
Date Added: 2009-06-07 11:14:05

Syllabus.doc
Path: UCF >> EML >> 5025 Fall, 2009
Description: INSTRUCTOR Chad or Shad Office ENGI 356* Class e-mail: Shad@mmae.ucf.edu OFFICE HOURS TEACHING ASSISTANT Phones (407) 823 3494 @ 356 Fax (407) 823 0208 TBA Open Door Policy,* Pre-notice is advisable Kunal Navale MW 5:30 to 8:15 Email:<proe_spr06@...
Date Added: 2009-06-07 11:14:14

BROA-BROP.pdf
Path: Messiah >> COMM >> 0910 Fall, 2009
Description: Broadcasting with Broadcast Production Concentration (Department of Communication) Major Requirements Major Courses Credits Semester Completed [COMM 105] Fundamentals of Oral Communication 3 [COMM 218] Mass Media and Society 3 3 One of the following...
Date Added: 2009-06-07 11:15:32

final_2008.pdf
Path: Washington >> PHYS >> 224 Fall, 2008
Description: Page 1 Thermal Physics 224 Autumn 2008 Name _ Final exam 8.25 am, Wednesday 10 December, 2008 Instructor: David Cobden Do not turn this page until 8.25. Hand your exam to me by the time I leave the room at 10.25. Attempt all the questions. Please w...
Date Added: 2009-06-07 11:16:21

smokescreen.doc
Path: UGA >> ECON >> 2106 Fall, 2008
Description: The Financial Times, April 26, 2007 Industry caught in carbon `smokescreen\' by Fiona Harvey and Stephen Fidler in London (copyright 2007 The Financial Times Limited) Companies and individuals rushing to go green have been spending millions on \"carbo...
Date Added: 2009-06-07 11:17:30

Exam2FinalKeyStudent.doc
Path: JMU >> ISAT >> 253 Fall, 2008
Description: ISAT 253: Foundations of Measurement and Instrumentation Spring 2005 EXAM 2: Basic Principles of Instrumentation and Measurement Instructions for the exam: 1. You have 75 minutes to complete all problems. Show all of your work on these pages. 2. The...
Date Added: 2009-06-07 11:17:59

Case 3-7 Application Architecture.doc
Path: UCSC >> ISM >> 058 Winter, 2009
Description: SADM 5/ed CASE STUDY 3 Milestone 7: Application Architecture Page: 7-1 MILESTONE 7 APPLICATION ARCHITECTURE J 0. Synopsis ust as we modeled business requirements during systems analysis, we should model technology architecture and requirement...
Date Added: 2009-06-07 11:20:10

jb41027b.doc
Path: Ole Miss >> POL >> 628 Fall, 2008
Description: Jordan Bankhead Party Emergence Bibliography Doctor Guo October 26, 2004 Party Emergence Annotated Bibliography Eldersveld, Samuel. Political Parties in American Society. 1982. Eldersveld argues in this textbook that political parties are not in perm...
Date Added: 2009-06-07 11:20:19

astr1020_finalreview.pdf
Path: Bowling Green >> ASTR >> 1020 Fall, 2009
Description: ASTR 1020 Final Exam April 30, 2009 Chapters 14-16 energy source for sun/stars; how much bigger is the sun than the Earth in size, in mass sun\'s surface temperature, core temperature; 3 atmospheric layers what\'s the composition of the sun/stars; wh...
Date Added: 2009-06-07 11:20:59

p2pNetworksEC04.pdf
Path: UCSC >> ISM >> 211 Spring, 2008
Description: Robust Incentive Techniques for Peer-to-Peer Networks Michal Feldman1 mfeldman@sims.berkeley.edu Kevin Lai2 klai@hp.com Ion Stoica3 istoica@cs.berkeley.edu John Chuang1 chuang@sims.berkeley.edu School of Information Management and Systems U.C. Be...
Date Added: 2009-06-07 11:21:18

T0393.pdb_blast.txt
Path: UCSC >> M >> 0393 Fall, 2009
Description: # BLASTP 2.2.17 [Aug-26-2007] # Query: T0393 # Database: /projects/compbio/data/pdb/dunbrack-pdbaa # Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score T0393 1g...
Date Added: 2009-06-07 11:23:46

Safe.pdf
Path: UMass (Amherst) >> CHE >> 402 Fall, 2009
Description: Safety Assessment Form for Experiments (SAFE) Safety Assessment Form for Experiments Chemical Engineering Laboratory Department of Chemical Engineering University of Massachusetts Written by: Revised by: Process Location Required Items for Lab: Hard ...
Date Added: 2009-06-07 11:28:14

Assign640-7.pdf
Path: UMass (Amherst) >> BE >> 640 Fall, 2009
Description: Assignment 7 Reading Chapter 11, Klinebaum et al. (pp187-211) Computing Problems1.Using the program from the WEB esb640p05.sas and the data set SCL11.SAS7bdat, conduct the analyses on Females that were conducted in class for males. Print a copy of yo...
Date Added: 2009-06-07 11:28:21

E2_2007-sol.pdf
Path: Rutgers >> PHYSICS >> 140 Fall, 2008
Description: Physics 140 Exam II April 4, 2007 Prof. Karin M. Rabe Your name sticker with exam code 9. A proctor will check your name sticker and your student ID sometime during the exam. Please have them ready. Useful Information Be sure to quickly scan throug...
Date Added: 2009-06-07 11:31:08

intlcash.pdf
Path: NYU >> B >> 403388 Fall, 2009
Description: INTERNATIONAL CASH PORTFOLIOS by Richard M. Levich New York University Stern School of Business Revised, January 1999 INTERNATIONAL CASH PORTFOLIOS by Richard M. Levich - While money market funds (MMFs) have been popular investment vehicles since 1...
Date Added: 2009-06-07 11:31:33

handout_Ch_3.pdf
Path: Washington >> CHEM >> 142 Fall, 2008
Description: Chapter 3 Stoichiometry Chapter 3 - Stoichiometry 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 Atomic Masses The Mole Molar Mass Percent Composition of Compounds Determining the Formula of a Compound Chemical Equations Balancing Chemical equations Stoichiometric...
Date Added: 2009-06-07 11:31:34

info_Chem312_outline_2007.pdf
Path: Washington >> CHEM >> 312 Fall, 2008
Description: Inorganic Chemistry Approximate Course Outline and Reading Assignments Text: Inorganic Chemistry, Shriver & Atkins (Overton, Rourke, Weller, Armstrong), 4th edition Chemistry 312 Topic I. Oxidation and Reduction Reactions a. Reduction Potentials b....
Date Added: 2009-06-07 11:32:17

Marine-Sedimentation-2007.pdf
Path: Washington >> OC >> 230 Fall, 2009
Description: Reading Material See class website \"Sediments\", from \"Oceanography\" M.G. Gross, Prentice-Hall Distribution of Marine Sediments Lithogenic sediment dominates near continents (shelf, slope, rise) because source from land glacial at high latitudes, fl...
Date Added: 2009-06-07 11:32:21

Shackleton_1987.pdf
Path: UCSC >> EART >> 120 Spring, 2008
Description: Quaternary Science Reviews, Vol. 6, pp. 183-i90, 1987. Printed in Great Britain. All rights reserved. [1277-3791/87$0.[X)+ .5(} Copyright 1987Pergamon Journals Ltd. OXYGEN ISOTOPES, ICE VOLUME AND SEA LEVEL N.J. Shackleton Godwin Laboratory for ...
Date Added: 2009-06-07 11:32:27

wolman.pdf
Path: UCSC >> ECON >> 205 Fall, 2009
Description: Sticky Prices, Marginal Cost, and the Behavior of Ination Alexander L. Wolman principal goal of economic modeling is to improve the formulation of economic policy. Macroeconomic models with imperfect competition and sticky prices set in a dynamic op...
Date Added: 2009-06-07 11:32:30

oldmt2.pdf
Path: UMass (Amherst) >> PHY >> 568 Fall, 2009
Description: PHY 568 - Midterm Exam October 25th, 2007 Solve the following problems. All the problems carry equal credit (but the questions inside each problem can have different weight). Books and notes are allowed. 1. In (1 + 1)-dimensional Minkowski space (met...
Date Added: 2009-06-07 11:33:59

ChallengesOfHeartDisease.doc
Path: UC Davis >> PDF >> 101 Fall, 2009
Description: References American Heart Association. 2003 Heart and Stroke Statistical Update. Dallas, Tex.: American Heart Association; 2002. Barnett E, Casper ML, Halverson JA, Elmes GA, Braham VE, Majeed ZA, Bloom AS, Stanley S. Men and Heart Disease: An Atlas ...
Date Added: 2009-06-07 11:34:33

2174notetakingkey.pdf
Path: Michigan State University >> WEB >> 2170 Fall, 2009
Description: KEY Note Taking Guide Topic # 2174 Bedding Plant Production Aaron Gearhart What are bedding plants? Flower and vegetable Transplants that are planted each spring Started in Greenhouses during the winter so they can be transplanted when danger of fro...
Date Added: 2009-06-07 11:34:34

In-classHeyer-2009KEY.pdf
Path: UC Davis >> MCB >> 221 Fall, 2009
Description: Name: KEY MCB221C/GGG201C - Midterm EXAM This exam has a total of 50 points. Heyer In-class examination Good luck HONOR CODE: My signature below affirms that I wrote this exam in the spirit of the honor system of the University of California, Dav...
Date Added: 2009-06-07 11:35:35

28TEAM4.TXT
Path: Wisconsin >> BOWL >> 9900 Fall, 2009
Description: Sheet1 Mad Rollers Game/Point Grand No High High Date Won Lost Hndcp Gm 1 Gm 2 Gm 3 Series Total Gms Avg Game Ser Err:510 09-10 3.0 .0 193 356 406 0 762 762 2 381 406 762 09-17 5.0 1.0 193 440 376 0 816 1578 4 394 440 816 09-24 8.0 1.0 193 400 443 0 ...
Date Added: 2009-06-07 11:37:46

Hickman.pdf
Path: Case Western >> BEH >> 380 Fall, 2009
Description: Hickman 1 Bryan E. Hickman Professor Koenigsberger ENGL 380 December 19, 2005 Fear and Loathing in Orwells Literature: The Formulation of Coming Up for Air The life of a young middle-class Englishman named Eric Blair began inconspicuously enough. Lit...
Date Added: 2009-06-07 11:37:51

07.pdf
Path: Wisconsin Milwaukee >> CS >> 201 Fall, 2009
Description: CS 201 Assignment #7 Due: Monday, April 13th, 2009. Main topics: Library Functions User Defined Functions Conditional Statements loop Statements. Program #7: Write a program that allows a single player (the user) to play a simple coin toss game of ch...
Date Added: 2009-06-07 11:38:22

Lesson_4.pdf
Path: Wisconsin Milwaukee >> CHEM >> 100 Fall, 2008
Description: Chapter 1 Lesson 4 Chapter 1 Density and The Temperature Scales: Fahrenheit, Celsius, and Kelvin Goals To understand the relationships between the three temperature scales To master converting between the three scales Understand the property, ...
Date Added: 2009-06-07 11:38:26

words2.txt
Path: Wisconsin Milwaukee >> LIB >> 1210 Fall, 2009
Description: 0 23984,23274,1026,1276 29 49704,5048,506,2153 30 12082,12122,984,2252 31 12142,16383,984,2233 32 12221,19168,984,2233 33 12181,23359,984,2213 34 12161,26199,1026,2213 35 12201,28970,984,2233 36 12142,31797,970,2252 37 12221,38842,984,2213 38 12221,4...
Date Added: 2009-06-07 11:39:11

p19_010.pdf
Path: Wisconsin >> ENGR >> 202 Fall, 2009
Description: ...
Date Added: 2009-06-07 11:40:09

warfseminar.ppt
Path: Wisconsin >> ENGR >> 200 Fall, 2008
Description: Biomedical Engineering Seminar Jeanine Burmania and Marnie Matt February 16, 2007 WARF Overview Established in 1925 by Prof. Harry Steenbock An independent tax exempt, not-for-profit corporation Officially designated technology transfer office fo...
Date Added: 2009-06-07 11:40:21

words2.txt
Path: Wisconsin Milwaukee >> LIB >> 1120 Fall, 2009
Description: a 42109,49835,613,852 alarms 12914,12411,582,5441 ambulance 51287,12065,613,8762 and 19645,52965,629,3059 and 32297,49914,629,3037 and 21415,55923,613,3059 any 20584,9375,928,2971 any 56706,13449,912,2971 any 48315,9139,928,3037 are 42874,10634,613,2...
Date Added: 2009-06-07 11:40:29

words2.txt
Path: Wisconsin Milwaukee >> LIB >> 567 Fall, 2009
Description: 36552,15957,34,1641 17366,56912,43,2362 53762,40233,34,3607 56762,62484,34,1631 53908,39859,43,4537 57421,39503,34,857 53239,40946,43,5332 17126,56547,34,2624 17377,56174,43,2362 52601,38764,43,4851 55100,37834,43,3324 54692,4...
Date Added: 2009-06-07 11:40:50

asmsdiag.doc
Path: Wisconsin >> ECE >> 352 Fall, 2008
Description: Idle 0 Go 1 Multiplier0 Shift 1 0 K0 0 1 B1B0=0 1 Add B1B0=1 Sub 1 0 ...
Date Added: 2009-06-07 11:40:57

HW_6_solution.doc
Path: Berkeley >> ME >> 252 Fall, 2009
Description: ME 252 HW #6 Solution 1. energy equation : (neglect axial conduction and viscous dissipation) u T T 2T +v = 2 x y y refer to previous homeworks and use the following nondimensionalizations : T T x y u vb X = 2 , Y = ,U = ,V = , = w b um b um Tw Ti...
Date Added: 2009-06-07 11:43:21

itc02_1.pdf
Path: Berkeley >> EECS >> 212 Fall, 2008
Description: Analysis of Delay Test Effectiveness with a Multiple-Clock Scheme Jing-Jia Liou, Li-C. Wang, and Kwang-Ting Cheng Department of ECE, UC-Santa Barbara jjliou, licwang, timcheng @ece.ucsb.edu Jennifer Dworak, and M. Ray Mercer Department of EE, Texas A...
Date Added: 2009-06-07 11:43:37

EE126_F08_OutcomesList.pdf
Path: Berkeley >> EE >> 126 Fall, 2009
Description: EE126_F\'08 Outcomes List Jean Walrand By the completion of EE126, Probability and Random Processes, students are expected to: 1. Basic Probability: Understand how to model uncertainty and appreciate the subjectivist and frequentist interpretations; ...
Date Added: 2009-06-07 11:45:50

AGEC455f03_14.ppt
Path: Purdue >> AGEC >> 455 Fall, 2008
Description: Class 14 Chapter 6 - Note \"key words\" Bonus Hmk. #2 - due today or Monday type only. Questions and Recitation Case Reporters Wilson & Voss action, facts and issue, Natasha Duke holding and rule, Lee Franklin Sanders action, facts and...
Date Added: 2009-06-07 11:48:33

unit1_3.ppt
Path: Fontbonne >> KADAM >> 565 Fall, 2009
Description: My Pictures Katie Adams Unit #1-3 Table of Contents Table of Contents 1. 2. 3. 4. 5. 6. Title Page Long Shot Medium Shot Close-Up Extreme Close-Up Horizontal Lines 1. 2. 3. 4. 5. 6. Rule of Thirds Circular Lines Special Effects #1 Special Effects ...
Date Added: 2009-06-07 11:48:42

L020059-00.pdf
Path: Caltech >> L >> 020059 Fall, 2009
Description: To: turner@ligo.caltech.edu (Linda Turner), rtischle@ligo.caltech.edu Subject: Put this article in the DCC LIGO-L020059-00-M 03/25/2002 By TOM SIEGFRIED / The Dallas Morning News PRINCETON, N.J. Raymond Chiao is the kind of physicist who would like...
Date Added: 2009-06-07 11:49:48

quiz-10-8-04.pdf
Path: Los Angeles Southwest College >> MATH >> 142 Fall, 2009
Description: PRINT Your Name: Quiz October 8, 2004 Find arctan x x . x0 8x3 lim Answer: The top and bottom both have limit zero. We apply Lhopitals rule to get that the limit is 1 1+x2 x0 lim 1 24x2 = 1(1+x2 ) 2 lim 1+x2 x0 24x = x2 1+x2 lim x0 24x2 =...
Date Added: 2009-06-07 11:53:03

company.ppt
Path: Temple >> TUA >> 48417 Fall, 2009
Description: Kroger Co. CIS55-607 Khoi Nguyen 9/29/2006 History in a Nutshell 1883 - The first store opens at 66 East Pearl Street in Cincinnati, Ohio. 1884 - Barney Kroger buys out his partner and opens a second store. 1928 - B. H. Kroger sells his company s...
Date Added: 2009-06-07 11:55:36

rubric_final.pdf
Path: S. Connecticut >> MAT >> 488 Spring, 2008
Description: MAT 488, Spring 2009 Scoring Guide for Technical Reports Final Project Names:_ Part 1: Technical Report Evaluation (100 points) Criterion 1: Abstract (a) Abstract states what was attempted and what was achieved. 1 2 3 4 5 Total Score: _ (b) Abstract...
Date Added: 2009-06-07 11:55:47

torqueinblisummary2.pdf
Path: Wisconsin >> ECE >> 355 Fall, 2009
Description: Torque and Emf Production in Bli Machines Summary 1 Physical Structure of Bli Machines Fig 1-1 defines the principal terms used in the notes - stator, rotor, stator B-field, rotor current distribution, idealized Bli machine 2 Torque in the Optimal Bl...
Date Added: 2009-06-07 11:57:47

PHYS-119-3.pdf
Path: Laurentian >> PHYS >> 119 Fall, 2009
Description: ...
Date Added: 2009-06-07 11:57:56

schd_s2005.doc
Path: UGA >> EBUS >> 5100 Fall, 2008
Description: Tentative Schedule EBUS 5100/7100 Systems Analysis and Design Spring Semester 2005 Rivers Crossing Room 143 Introduction Based on prior experience, this schedule is workable and should provide an accurate guide for due dates and course work. If adj...
Date Added: 2009-06-07 11:58:05

1866.pdf
Path: USF >> LIT >> 1866 Fall, 2009
Description: No coward soul is mine, No trembler in the worlds storm-troubled sphere: I see Heavens glories shine, And faith shines equal, arming me from fear. O God within my breast, Almighty, ever-present Deity! Lifethat in me has rest, As Iundying Lifehave pow...
Date Added: 2009-06-07 11:58:39

Cryptography.ppt
Path: Santa Clara >> COEN >> 150 Fall, 2009
Description: COEN 150 Information Assurance Essentials of Cryptography Cryptography Scrambles a plaintext into cryptotext. Enables to descramble plain text. Symmetric Cryptography Uses the same key for encryption, decryption Asymmetric...
Date Added: 2009-06-07 11:58:49

My+Profile+Results.pdf
Path: Berkeley >> SECURE >> 11085 Fall, 2009
Description: 2.0x Accessibility Review My Profile Tool Tool My Profile Page Home (Default): Profile/Search for Profile Home (Default): Profile/Search for Profile Home (Default): Profile/Search for Profile/Show my Profile Home (Default): Profile/Search for Profi...
Date Added: 2009-06-07 11:58:52

EXAM1AKEY.doc
Path: Iowa State >> ECON >> 353 Fall, 2008
Description: IOWA STATE UNIVERSITY Department of Economics Spring 2003 Economics 353: Section 2 Money, Banking and Financial Institutions ANSWER KEY FOR VERSION A PART ONE: Multiple-Choice Questions (Total 40 points: 1 point each) 1) Evidence from the United Stat...
Date Added: 2009-06-07 12:00:24

opengl_viewing_color_buffering.ppt
Path: Iowa State >> CS >> 229 Fall, 2009
Description: More on Transformations and Projections. Color spaces. Double Buffering David Kabala Model -> View -> Projection Modeling Transformation - - - Used to position geometry in the scene Used to position and orient the view of a scene Used to project...
Date Added: 2009-06-07 12:00:51

fall_lab5key.pdf
Path: Iowa State >> ECON >> 207 Spring, 2008
Description: ECONOMICS 207 FALL 2007 LABORATORY EXERCISE 5 Keys Problem 1: 2 1 3 A=4 2 1 4 3 a. Compute AB 2 3 3 0 4 1 15 0 3 15 0 3 2 2 1 3 5;B = 4 2 1 1 3 1 5 5 5 4 1 2 3 2 1 0 2 1 1 5;C = 4 3 1 2 2 1 2 5 1 1 1 3 2 1 5 0 b:Compute BA: Explain your answe...
Date Added: 2009-06-07 12:01:30

E207L6S08Key.pdf
Path: Iowa State >> ECON >> 207 Spring, 2008
Description: ECONOMICS 207 SPRING 2008 LABORATORY EXERCISE 6 KEY Problem 1. Find the derivatives of each of the following functions with respect to x. 3 a. y = 24x1/3 + 3x2 e2x 3 3 dy 1 = 24 x2/3 + 6xe2x + 3x2 (e2x (6x2 ) dx 3 = 8x2/3 + 6xe2x + 18x4 e2x 3 3 ...
Date Added: 2009-06-07 12:01:30

Exam4key.doc
Path: Iowa State >> ECON >> 101 Fall, 2008
Description: Exam4_Econ101_ss2007_Lulu Name_ID_ 1. The following table gives the short-run and long-run total costs for various level of output of some company: Quantity TC1 TC2 LRATC SRTFC SRTVC AFC AVC MC 0 0 450 1 400 500 400 450 50 450 50 50 2 500 535 250 450...
Date Added: 2009-06-07 12:02:10

internet.doc
Path: Iowa State >> MR >> 0921 Fall, 2009
Description: Ottumwa Courier, IA 09-18-07 Internet playing a bigger role than ever in campaigns By MATT MILNER Courier staff writer WASHINGTON, D.C. - Will this be the MySpace election? Or will \"Mr. Microtargeting\" rule the day? There are few better examples than...
Date Added: 2009-06-07 12:03:53

bat.txt
Path: Berkeley >> ASTRO >> 00020098 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 12:04:10

Notes23.pdf
Path: Illinois Tech >> CS >> 350 Fall, 2008
Description: CS 350 Computer Organization Arrays (continued) 2 / CS 350, Spring 2009 / Illinois Institute of Technology / J. Sasaki / More pointers, including some errors t...
Date Added: 2009-06-07 12:04:31

Notes25.pdf
Path: Illinois Tech >> CS >> 350 Fall, 2008
Description: CS 350 Computer Organization & Assembly Language Programming Spring 2009 Notes 25, 20090506 1 Final Exam Breakdown - 40% 10% Chapters 8 14, 16, comp arch 40% 10% Chapters 4 7 20% 10% Chapters 1 3 Plus corresponding labs and homeworks (The ...
Date Added: 2009-06-07 12:04:33

abs_074.pdf
Path: Allan Hancock College >> MDL >> 112 Fall, 2009
Description: Electron Transport in Crossed Electric and Magnetic RF Fields in CF4: Zero Phase Between The Fields S. Dujko,1,2 R.D. White,1 Z.Lj. Petrovi,2 and R.E. Robson3 School of Mathematical and Physical Science, James Cook University, Townsville, QLD 4810 Au...
Date Added: 2009-06-07 12:05:46

Unit-1-Molecules.ppt
Path: Wisc Eau Claire >> CHEM >> 150 Fall, 2009
Description: Chem 150 Unit 1 - Molecules Organic and Biological Chemistry substances are made of molecules. Being able to predict the structures and interactions of molecules is important to our understanding of Organic and Biological Chemistry Atomic Structure ...
Date Added: 2009-06-07 12:06:28

2pm.pdf
Path: W. Alabama >> CS >> 846 Fall, 2009
Description: Anne Banks Pidduck School of Computer Science l l l l l l l PMI Fundamentals Project Organization Project Selection Project Portfolio Management Procurement Management Statement of Work (SOW) Project Charter Software Project Management 2 l l l Pr...
Date Added: 2009-06-07 12:09:57

VLSM-Exercises.doc
Path: U. Houston >> ISAM >> 5636 Fall, 2009
Description: VLSM EXERCISE QUESTIONS 1- A company has the following office locations with the computers indicated in the parantheses: a. Houston (58) b. Clear Lake (49) c. Dickenson (29) d. Galveston (9) e. Texas City (13) f. Sugar Land (28) g. Rosenberg (12) h. ...
Date Added: 2009-06-07 12:12:01

assignm2new.pdf
Path: UC Davis >> ECS >> 165 Fall, 2009
Description: ECS 165A Database Systems Madhavi Gandhi Winter 2003 January 23 Assignment 2 Sample Auction Database and SQL Due Friday, January 31, at the Discussion section. Overview: In this assignment you have to work with the Oracle DBMS, which is installed...
Date Added: 2009-06-07 12:14:08

game5.pdf
Path: Delaware State >> AB >> 5120 Fall, 2009
Description: TRUE OR FALSE The New York Knicks went to the NBA nals in 1998 against the San Antonio Spurs? A) True B) False ...
Date Added: 2009-06-07 12:17:37

exam1.pdf
Path: CSU Long Beach >> EXAM >> 528 Fall, 2009
Description: CECS 528 Exam 1, Spring 2004, Professor Ebert Name: Show all work to receive full credit. 1. In terms of big-O notation, what is the relationship between the functions f (n) = 2n and g(n) = n!? Show work supporting your conclusions. (20 points) 2 2....
Date Added: 2009-06-07 12:19:50

short.pdf
Path: Maryville MO >> ALHABASHS >> 111908 Fall, 2009
Description: YOUTH 2 YOUTH: CHANGING PALESTINIAN-AMERICAN IMAGES AND STEREOTYPES THROUGH ONLINE SOCIAL NETWORKS Saleem Alhabash Dr. Fritz Cropp, Thesis Committee Chair ABSTRACT Throughout the past few years, the perceived images and stereotypes of Palestinians an...
Date Added: 2009-06-07 12:22:29

Chip_Testing_Elvis_Labview.pdf
Path: SUNY Buffalo >> CSE >> 45209 Fall, 2009
Description: ! \"# $ ! ! ! ! ! ! ! * * ! . \' ! %, ! %. 1 % \" % ( ! . ! \" ( ! \" $ ! \"3 + (2 / ) / $ % % \" \" ! ! % \"# % *+ \" \", \", ( % % \" \" 0 ! % (! $ ( (34 3 ) 2 2 ! 3 \" ! (34 3 , 5( & 2 2 ! ! (...
Date Added: 2009-06-07 12:22:52

FFOctober2006.pdf
Path: Iowa State >> NR >> 45341 Fall, 2009
Description: October, 2006 Greetings, Harvest is upon us. The soybean harvest is in full swing and even completed in some cases. The corn harvest will be a real challenge for many. Harvest of the down corn will be frustrating. Be safe - take your time and don\'t t...
Date Added: 2009-06-07 12:28:15

agenda_03_20_01.pdf
Path: SUNY Buffalo >> PDFS >> 0001 Fall, 2009
Description: March 20, 2001 Agenda I. Announcements II. Approval of the January meeting minutes III. Dr. Kerry Grant, Vice Provost for Academic Affairs, Dean of the Graduate School IV. Combined Degree Proposal BS/MS Architecture V. Curriculum Changes 1. Occupati...
Date Added: 2009-06-07 12:29:52

Lesson04.pdf
Path: Washington >> ENVIR >> 202 Fall, 2008
Description: Lesson 4: History Part Ii January 11, 2006 ENVIR 202: Lesson No. 4 History Occupational Health Sciences ENVIR 202: Lesson 4 1 Lesson Overview Finish Se...
Date Added: 2009-06-07 12:38:36

SupplRNAiscreen.pdf
Path: SUNY Buffalo >> BCH >> 512 Fall, 2009
Description: Supplemental Data A Whole-Genome RNAi Screen for C. elegans miRNA Pathway Genes Devin H. Parry, Jinling Xu, and Gary Ruvkun Supplemental Reference S1. Kim, J.K., Gabel, H.W., Kamath, R.S., Tewari, M., Pasquinelli, A., Rual, J.F., Kennedy, S., Dybbs, ...
Date Added: 2009-06-07 12:39:40

ELABORAT.DOC
Path: MD University College >> ADMN >> 687 Fall, 2009
Description: Although Assael discusses the Elaboration Likelihood Model in Chapter 9, he really doesn\'t provide much detail. We\'ll examine the model in some detail, but first, I need to discuss the cognitive response approach to persuasion as advanced by Petty an...
Date Added: 2009-06-07 12:39:59

Simulation_4_2009.doc
Path: Ohio State >> EE >> 743 Fall, 2009
Description: Simulation #4 (ECE743/Spring 2009) Objective: To study the dynamic and steady-state behavior of a two-phase synchronous machine. Problem Statement: The machine to be studied is a 2-pole, 2-phase, 75 hp, 440 V, 60Hz salient-pole synchronous machine wi...
Date Added: 2009-06-07 12:41:27

FED_VCP_Evaluation_IIVV_F08a_T13_V1.0.doc
Path: USC >> CSCI >> 577 Fall, 2009
Description: VC Evaluation Feasibility Evidence Description A) Management Overview Risk Assessment table contains detailed risk information and is easy to read B) Technical Details Well thought out risks C) Major Errors & Omissions D) Critical Concerns ...
Date Added: 2009-06-07 12:42:17

lec05.ps
Path: Allan Hancock College >> COMP >> 2410 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: lec05.dvi %Pages: 19 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 596 842 %DocumentFonts: Helvetica-Bold Helvetica ZapfDingbats CMSY10 Symbol %+ Couri...
Date Added: 2009-06-07 12:43:41

bat.txt
Path: Berkeley >> ASTRO >> 00020101 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 12:45:51

LEC27_462.pdf
Path: Washington >> GEOG >> 462 Fall, 2008
Description: Lecture 27 Sustainability, Coastal Zone Management and GIS Learning Objectives 27.1 What is the foundation of an ecological city approach to development? 27.2 What is the significance of the link among planning, programming, and projects? 27.3 What i...
Date Added: 2009-06-07 12:46:04

092306.pdf
Path: St. Olaf >> MEDIA >> 0607 Fall, 2009
Description: St. Olaf College Football ADMIT ONE Manitou Field general admission GAME THREE GAME THREE GAME THREE GAME THREE general admission general admission general admission Manitou Field Manitou Field Manitou Field ADMIT ONE ADMIT ONE ADMIT ONE ADMIT ONE Ma...
Date Added: 2009-06-07 12:46:21

lect0221Ray.pdf
Path: Iowa State >> ISU >> 690 Fall, 2009
Description: Lecture Notes Spring 2006 M690I: Extremal Graph Theory Scribe: Douglas Ray February 21, 2006 1 Regularity Lemma, Degree Form [RegLemDF] For every > 0, there is an M = M () such that if G = (V, E) is any graph and d [0, 1] is any real number then...
Date Added: 2009-06-07 12:46:46

C3s1and2.pdf
Path: CSU Northridge >> M >> 24771 Fall, 2009
Description: ...
Date Added: 2009-06-07 12:51:19

Lecture - Course Overview.ppt
Path: Washington University in St. Louis >> CS >> 456 Fall, 2009
Description: CS456 Software Engineering Workshop Keith Bennett Department of Computer Science Washington University in St. Louis Copyright 1997-1999 Keith J. Bennett Washington University in St. Louis 1st Class Review Class Handout Review Class Schedule Rev...
Date Added: 2009-06-07 13:00:15

Calipso-Track2-07-03-curtains.pdf
Path: University of Iowa >> B >> 200 Fall, 2009
Description: ...
Date Added: 2009-06-07 13:03:35

final_sample.pdf
Path: Washington >> C >> 152 Fall, 2009
Description: 1 of 16 Chemistry 162B Final Exam A June 8, 2000 Name_ TA_ I have neither given nor received any information on this exam _ sign _/_/_ date O.K. so here is the final exam. MAKE SURE YOU INDICATE WHICH EXAM YOU HAVE (A or B). This is all multiple ...
Date Added: 2009-06-07 13:04:06

CH380124.ppt
Path: Armstrong >> CH >> 3801 Fall, 2009
Description: Cascade for Biosynthesis of Eicosanoids Biosynthesis of Eicosanoids Arachadonic Acid (-6) Cleaved from phospholipids via a phospholipase Cyclooxygenases Prostaglandins (thromboxanes) Leukotrienes COX catalyzed reaction COX Inhibitors Aspirin ...
Date Added: 2009-06-07 13:10:32

syllabus.pdf
Path: Washington >> CHEM >> 410 Fall, 2008
Description: Chemistry 410: Nuclear Chemistry Laboratory Syllabus for Spring 2009 Lecture Tuesdays 10:30 11:20, Bagley 108 Laboratory Monday 9:30-12:20, Room 333 Bagley Hall Prof. K.A. Krohn, Room NW055 UWMC, 598-6245 (kkrohn@u.washington.edu) David Bliss, Room ...
Date Added: 2009-06-07 13:10:47

syllabus.doc
Path: Temple >> TUA >> 03226 Fall, 2009
Description: CIS 1055 Computers and Applications Laboratory Syllabus Summer 2007 Section 421 Laboratory Instructor: Meg Guerreiro E-Mail Address: megann@temple.edu Web Address: http:/astro.temple.edu/~tua03226 Office Location: 412 Wachman Hall Office Hours: Wedn...
Date Added: 2009-06-07 13:11:44

bat.txt
Path: Berkeley >> ASTRO >> 00020060 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 13:12:41

nn04-30.ppt
Path: California State University, Monterey Bay >> CS >> 672 Fall, 2009
Description: CS672 Lecture1 Implementation of neural Networks on parallel hardware. Thursday, April 30 , 2009 Why use parallel hardware? Neural networks are inherently parallel. Each neuron in a single layer can be computed independent of every other neuron. ...
Date Added: 2009-06-07 13:13:25

Dethlefsen, Nature.pdf
Path: Mines >> ESGN >> 586 Fall, 2008
Description: NATURE|Vol 449|18 October 2007|doi:10.1038/nature06245 INSIGHT REVIEW An ecological and evolutionary perspective on humanmicrobe mutualism and disease Les Dethlefsen1, Margaret McFall-Ngai2 & David A. Relman1,3,4 The microbial communities of humans...
Date Added: 2009-06-07 13:13:35

Lecture20.ppt
Path: Texas El Paso >> GEOL >> 1312 Fall, 2008
Description: Class 20: Space Junk (I) Class 20: Space Junk (I) Class Updates Reading: 23.10 Lecture schedule update Exams returned Todays topics: Asteroids Meteor-stuff Comets Asteroids Ida Mathilde Gaspra Asteroid Locations NEAs This Week QuickTime...
Date Added: 2009-06-07 13:14:36

Marine-Sedimentation-2007.pdf
Path: Washington >> COURSES >> 230 Fall, 2009
Description: Reading Material See class website \"Sediments\", from \"Oceanography\" M.G. Gross, Prentice-Hall Distribution of Marine Sediments Lithogenic sediment dominates near continents (shelf, slope, rise) because source from land glacial at high latitudes, fl...
Date Added: 2009-06-07 13:17:24

L08F2008.pdf
Path: University of Hawaii - Hilo >> BIOLOGY >> 101 Fall, 2009
Description: Ecosystems Ecology (Greek: \"house\") How organisms interact with each other environment Lecture 8 Ecosystems Communities of organ...
Date Added: 2009-06-07 13:24:11

23w.pdf
Path: University of Hawaii - Hilo >> MATH >> 373 Fall, 2009
Description: Math 373 Hw 23 Worked examples and comments. Rec 383: 10.19, 10.25. 390: 10.29, 10.31, 10.33. Hw 383: 10.16, 10.18, 10.22. 390: 10:29-31. Page 383. 10.19. Independent random samples of n1= 16 and n2= 13 are selected from two normal populations. We...
Date Added: 2009-06-07 13:27:34

Mangagonnermannmanga2005b.pdf
Path: Berkeley >> EPS >> 260 Fall, 2008
Description: DTD 5 ARTICLE IN PRESS Earth and Planetary Science Letters xx (2005) xxx xxx www.elsevier.com/locate/epsl Nonequilibrium magma degassing: Results from modeling of the ca. 1340 A.D. eruption of Mono Craters, California Helge M. Gonnermann a,*, Mic...
Date Added: 2009-06-07 13:28:06

h7.pdf
Path: Washington >> M >> 381 Fall, 2009
Description: Math 381 Handout 7 R. J. LeVeque October 12, 1998 Pig Farming and Greediness Homework due Wednesday 10 14 98: 1. Suppose a pig farmer can choose between two di erent kinds of feed for his pigs: corn or alfalfa. He can feed them all of one or the ot...
Date Added: 2009-06-07 13:28:34

MA185HW9.pdf
Path: Berkeley >> MATH >> 185 Fall, 2009
Description: MA185 HOMEWORK 9 0. Practice using contour integrals to arrive at real valued integrals; this is not to be handed in. 1. Follow the hints in the book to evaluate cos(x2 )dx = 0 0 sin(x2 )dx = 1 2 . 2 (problem 12, section 81) 2. You may assum...
Date Added: 2009-06-07 13:34:48

111-06-Sp-Syllabus.pdf
Path: University of Hawaii - Hilo >> ICS >> 111 Fall, 2009
Description: ICS111 Introduction to Computer Science I Spring 2006 Instructor: Blanca J. Polo Office location: DA-210 Contact Information: blanca@hawaii.edu, (808) 455-0319. Office Hours Monday and Wednesday from 12:30 to 1:30 pm Friday from 11:00 to 12:00 noon...
Date Added: 2009-06-07 13:34:59

Physics_100_chapt_24.ppt
Path: University of Hawaii - Hilo >> P >> 100 Fall, 2009
Description: Atomic Physics Dimitri Mendeleev Physics 100 Chapt 24 Periodic table of elements Elements in vertical rows have similar chemical properties Inert gasses Schroedinger\'s Equation for multielectron Atoms + - - Allowed energy levels are clustere...
Date Added: 2009-06-07 13:35:00

gray_convergent.pdf
Path: St. John Fisher >> CSCI >> 155 Fall, 2009
Description: The Kindle 2 By Scott Gray The Basics The Kindle 2 is part of a new wave of technology that allows the user to read digitalized books. This product can download books wirelessly in less than 60 seconds from one of the biggest e-Book stores, Amazon, ...
Date Added: 2009-06-07 13:35:37

9-24.pdf
Path: Maryville MO >> CHM >> 291 Fall, 2009
Description: CHM 291 9-24 4.4 Effect of the Atom Bonded to the Hydrogen on Acidity One should be able to make qualitative predictions of acidity based on the structure of the compound. The most important effects include: atom to which H is bonded, nearby charges ...
Date Added: 2009-06-07 13:40:32

map.pdf
Path: UWI Mona >> IO >> 2914 Fall, 2009
Description: ACS 2914 Mapping ERDs to Relational Databases Ron McFadyen Mapping an ERD to a Relational Database We use E/R Modeling to understand the informational needs of a system. Once the model is satisfactory, we then implement our design in a relational ...
Date Added: 2009-06-07 13:43:13

pprobs2.pdf
Path: East Los Angeles College >> PHYS >> 3002 Fall, 2009
Description: PHYS3002 - NUCLEI AND PARTICLES Problem Sheet 2 - Due March 7 2007 1. Use the Shell Model to determine, wherever possible, the spins and parities of the ground states of the following nuclides: 13 6 C, 14 6 C, 17 8 O, 16 8 O, 33 16 S, 31 15 P, 30 15...
Date Added: 2009-06-07 13:45:59

cbe8910.ppt
Path: UT Arlington >> CBE >> 8910 Fall, 2009
Description: Travel http:/students.uta.edu/cb/cbe8910 Corey Edwards If you are tired of sitting around the house, Then this site is exactly what you need. Want to have some serious fun then check out. King\'s Dominion Has over 30 different rides and a waterpar...
Date Added: 2009-06-07 13:46:15

hw09.pdf
Path: Maryland >> CMSC >> 250 Fall, 2007
Description: %tp p # h$rg y \"!R{ DR ysxsxDex x yvVr|yv 4yww |yvr ...
Date Added: 2009-06-07 13:47:19

key3.pdf
Path: Valdosta >> CHEM >> 1151 Fall, 2009
Description: Chemistry 1151K Test III MULTIPLE CHOICE (3 points each) 1. 2. 3. 4. 5. In the reaction: CH4 + 2 O2 CO2 + 2 H2O, methane (CH4) is a. an acid b. oxidized c. an oxidizing agent A substance is reduced if it a. gains oxygen b. gains electrons c. loses el...
Date Added: 2009-06-07 13:51:04

deflections.pdf
Path: Iowa State >> ME >> 325 Fall, 2009
Description: Review of calculating deflections in beams. Method of Integration Method of Superposition Method of Integration 1. Select interval(s) to be used; place co-ordinate system at end of interval 2. Indicate range of interval (i.e., 0 L) x 3. List all av...
Date Added: 2009-06-07 13:53:02

shaft_vibes.pdf
Path: Iowa State >> ME >> 325 Fall, 2009
Description: Lateral Vibration of Shafts Potential Energy = Kinetic Energy g ( m11 + m22 + m33 ) = n m112 + m22 2 + m33 2 2 2 = g ( ) n i n i mi i mi 2 i n = Wi i g i = g n Wi 2 i g i n g n i n i Wi i Wi 2 i Includes only gravitational l...
Date Added: 2009-06-07 13:53:13

Sample_Spreadsheet.xls
Path: U. Houston >> TRAINING >> 5531 Fall, 2009
Description: Student Name Johnette Doe Team Number 3 email address JDOE@hotmail.com Phone Number #1 281-000-0000 Phone Number #2 713-111-1111 ...
Date Added: 2009-06-07 13:53:39

Homework3CSE2400.pdf
Path: Benjamin Franklin Institute of Technology >> CSE >> 2400 Fall, 2009
Description: Homework 3 CSE2400 Spring 09 Work each of the following problems and show how you obtain your answers. In each solution you must (a) define the events and random variables that you need (unless they are already defined in the problem statement)...
Date Added: 2009-06-07 13:55:19

108_09Pubs.pdf
Path: Rochester >> V >> 108 Fall, 2009
Description: PubliCaTions anD ConferenCe PresenTaTions Publications and Conference Presentations Publications G. P. Grim, C. W. Barnes, P. A. Bradley, C. R. Christensen, A. Hauer, G. L. Morgan, J. A. Oertel, M. D. Wilke, D. C. Wilson, C. Barrera, S. W. Haan, B. ...
Date Added: 2009-06-07 13:55:33

Module05.ppt
Path: Michigan State University >> CSE >> 460 Fall, 2008
Description: Module 5 Topics Proof of the existence of unsolvable problems Proof Technique There are more problems/languages than there are programs/algorithms Countable and uncountable infinities 1 Overview We will show that there are more problems than ...
Date Added: 2009-06-07 13:57:38

obj.intro.pdf
Path: MSOE >> BE >> 410 Fall, 2009
Description: Learning Objectives Introductory Material BE-410, Spring \'06, Dr. C. S. Tritt Introduction to Biomaterials Be able to give a reasonable definition of what biomaterials are. Be able to define failure in the context of biomaterials. Be able to name 4 ...
Date Added: 2009-06-07 13:58:03

may15.pdf
Path: W. Alabama >> CS >> 788 Fall, 2009
Description: Resampling intersect volume with ray then sample or traverse voxels IMAGE(Images/vrRaySamplingInBox.eps) 1 Resampling sampling rate affects image quality and speed IMAGE(Images/vrVaseAliasing.eps) 2 Interpolation for each sample along ray in...
Date Added: 2009-06-07 14:00:29

escott_elliptic.pdf
Path: Harvard >> FAS >> 129 Fall, 2009
Description: Elliptic Curves David Wright Escott May 24, 2004 Final Paper for Mathematics 129: Algebraic Number Theory Taught by Professor William Stein 1 1 Elliptic Curves Elliptic curves are found at the intersection of a broad range of mathematics. As suc...
Date Added: 2009-06-07 14:01:14

HW3.pdf
Path: Dallas >> CS >> 5333 Fall, 2008
Description: ...
Date Added: 2009-06-07 14:03:48

EtiquetteDinner.pdf
Path: St. Augustine NC >> ACCT >> 4350 Fall, 2009
Description: Business&Dining g EtiquetteWorkshop Thursday,March12 Thursday, March 12th 69PM JaguarStudentActivity CenterBallroom Seatsarelimited,registerTODAY! Dinnerwillbeserved. ProfessionalattireandstudentIDswill berequiredtobeadmitted. Thiseventisfundedbythe...
Date Added: 2009-06-07 14:04:31

four_traditions_geo.pdf
Path: CUNY Baruch >> GEOG >> 701 Fall, 2009
Description: ...
Date Added: 2009-06-07 14:04:49

HW3.doc
Path: Dallas >> MIS >> 6326 Fall, 2008
Description: THE UNIVERSITY OF TEXAS AT DALLAS SCHOOL OF MANAGEMENT MIS 6326: DATABASE MANAGEMENT SYSTEMS SPRING 2000 Assignment # 3 Date Due: February 8, 2000 MS Access Macros; Relational Algebra (10 Points) 1. Create switchboard forms that w...
Date Added: 2009-06-07 14:08:30

BC_AST_2008_Lecs15-16Post.pdf
Path: UMBC >> PH >> 510 Fall, 2009
Description: Stellar Astrophysics Chris Engelbrecht Boston College Spring 2008 Stellar Astrophysics - BC 2008 Stellar Astrophysics - BC 2008 Stellar Astrophysics - BC 2008 Stellar Astrophysics - BC 2008 Credits: slides 2-5: NASA, Todd Boronson, AURA, NO...
Date Added: 2009-06-07 14:10:21

midterm09.pdf
Path: UCSD >> MAE >> 124 Fall, 2008
Description: MAE 124/ESYS 103 (Spring 2009) 1 Midterm Thursday, April 30, 9:30 am, in class, open note. Please write your name and student ID number on your blue book. 1. [50 points] Answer 5 of the following 7 questions: a. b. c. d. Why might water supplies f...
Date Added: 2009-06-07 14:15:22

intro.ps
Path: Duke >> X >> 170 Fall, 2009
Description: %!PS-Adobe-3.0 %Title: Microsoft PowerPoint - Intro %Creator: PScript5.dll Version 5.2 %CreationDate: 3/18/2003 13:54:53 %For: parr %BoundingBox: (atend) %Pages: (atend) %Orientation: Portrait %PageOrder: Special %DocumentNeededResources: (atend) %Do...
Date Added: 2009-06-07 14:15:55

hw2.ps
Path: Duke >> X >> 296 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: homework-main.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips homework-main %DVIPS...
Date Added: 2009-06-07 14:15:58

InstallingMoticSoftware.pdf
Path: MSOE >> BI >> 102 Fall, 2009
Description: Installing the Motic Microscope Imaging Software (v. 1.1) BI-102, Fall \'07, Dr. C. S. Tritt The Motic software is needed to acquire images for microscope lab exercise. It may already be installed on your laptops. If it is not, use the provided CD. Yo...
Date Added: 2009-06-07 14:19:06

oral.pdf
Path: UCSC >> CE >> 185 Fall, 2009
Description: Chapter 5 Oral Reports 5.1 Goalsclear oral presentation Oral reports are often a form of advertisingeither internally, within a company, where people from dierent departments see projects displayed by their creators, or externally, where a company ...
Date Added: 2009-06-07 14:21:40

hw2.pdf
Path: UCLA >> STATS >> 105 Fall, 2009
Description: Stat105Lec1-09S: HW2 due Friday 4/10/09 in class 4/3/09 10:59 AM Jump to. LearningPortal Stat105Lec1-09S Resources HW2 due Friday 4/10/09 in class Excerises 6-12, 6-48, 6-24, 6-40, 6-52, 6-72. (Data for 6-24 are available at http:/www.stat....
Date Added: 2009-06-07 14:24:53

snowball.doc
Path: UNI >> FACULTY >> 021 Fall, 2009
Description: Page 1 of 2 Look at the 2nd page header and footer too. I do not know where family doctors acquired illegibly perplexing handwriting; nevertheless, extraordinary pharmaceutical intellectuality, counterbalancing indecipherability, transcendentalizes...
Date Added: 2009-06-07 14:29:25

collaborativecriticaledition.pdf
Path: Boise State >> E >> 275 Fall, 2009
Description: English 275 Introduction to Literary Studies Spring 2009 (350 points total) Collaborative Critical Edition The Collaborative Critical Edition is the final, major assignment for this class, and as such it combines the elements of literary studies we\'v...
Date Added: 2009-06-07 14:33:07

UF6812_board_construction_V16.pdf
Path: UF >> EEL >> 4744 Fall, 2009
Description: University of Florida Department of Electrical and Computer Engineering EEL4744 Revision 16 Dr. Eric M. Schwartz 16-May-06 Page 1/7 OBJECTIVES Building a UF 68HC12 Board from a Development Board Kit In this document you will learn how to solder a...
Date Added: 2009-06-07 14:38:40

verma&stevenson.pdf
Path: San Diego State >> BIO >> 630 Fall, 2009
Description: Proc. Natl. Acad. Sci. USA Vol. 94, pp. 1175811760, October 1997 Perspective I B kinase: Beginning, not the end Inder M. Verma* and Jennifer Stevenson Laboratory of Genetics, The Salk Institute, 10010 North Torrey Pines Road, La Jolla, CA 92037 It ...
Date Added: 2009-06-07 14:39:21

quiz3summer08solutions.pdf
Path: Washington >> M >> 125 Fall, 2009
Description: Math 125 A Quiz 3 Name Student number (25 minutes) There are two problems in this quiz, with a total of 20 points. No notes are allowed, but you may use a scientific calculator. Write legibly and show your work fully. 1. (10 points) Evaluate the ...
Date Added: 2009-06-07 14:41:11

acrostic.doc
Path: U. Houston >> CUIN >> 3111 Fall, 2008
Description: ...
Date Added: 2009-06-07 14:43:43

PersonalEssay.doc
Path: Middlebury >> WRPR >> 0202 Fall, 2009
Description: WRPR0202A M. E. Bertolini Spring 2004 Paper #4-Personal Essay-35 pages due Wednesday midnight, April 9 as a gem and 3 copies in class on Thursday, April 10 Write a 35 essay in which you react to a loss or a difficulty in your own life. This may ...
Date Added: 2009-06-07 14:43:58

inspec.pdf
Path: Mississippi State >> ECE >> 3254 Fall, 2009
Description: EXAMPLES: ANALYSIS BY INSPECTION +20 800 vI 10 0.5 200 1mA GND R3(MAX) _ vL/vI _ 10 vL Rout _ Rin _ Defaults: K = 1 mA/V2, |VTH| = |VP| = 1 +20 9 600 vL Rin _ Rout _ vL/vI _ R3(MAX) _ vI 0.25 300 0.1mA 18 GND Default: F = 100 +12 120 Rin _...
Date Added: 2009-06-07 14:47:39

internet-sec1.pdf
Path: Oregon State >> ECE >> 478 Fall, 2008
Description: Internet Security Protocols 1 Outline of Course 1. Introduction 2. Secure TCP/IP Protocols (IPSec) 3. Secure Sockets Layer (SSL), Transport Layer Security (TLS) 4. Secure HTTP 5. Basic WWW Security 2 Protocol Stack at Outset What we have to star...
Date Added: 2009-06-07 14:50:30

05.03_1-10.txt
Path: Pacific Lutheran >> CCLI >> 152 Fall, 2009
Description: # DESCRIPTION# Calculus: The Fundamental Theorem of Calculus# ENDDESCRIPTION# KEYWORDS(\'calculus\', \'integrals\', \'fundamental theorem of calculus\')# Tagged by XW# DBsubject(\'Calculus\')# DBchapter(\'Integrals\')# DBsection(\'The Fundamental Theorem of Cal...
Date Added: 2009-06-07 14:52:45

Week03_Notes.doc
Path: U. Houston >> WEEK >> 3111 Fall, 2009
Description: CUIN3111:TechnologyintheClassroom Lecturer:Dr.EvelynBeyer/http:/viking.coe.uh.edu/~elbeyer ClassTimes:W3pmand4pm,Room302/WebCTOnline:T,W,Th7pm9pm Today\'sActivities: 03 Runningthemap.vbsscript:maps/connectsadrivefromaUHSSLcomputertotheviking serve...
Date Added: 2009-06-07 14:54:27

Final-dummy-PHL110-S09.pdf
Path: Iona >> PHL >> 110 Fall, 2009
Description: Iona College Department of Philosophy PHL110 X Introduction to Philosophy Dr. Adam M. Goldstein Dummy Final Exam: Some Date Last name: First name: Section: DO NOT OPEN THIS EXAM UNTIL INSTRUCTED TO DO SO. Directions: When instructed do so, write yo...
Date Added: 2009-06-07 14:56:15

FinalProduct.doc
Path: U. Houston >> CUIN >> 3112 Fall, 2008
Description: *Unit Plan Template Unit Author First and Last Name Unit Overview CurriculumFraming Questions David Campbell Essential Question What is history? How do we separate fact from fiction? Who decides what is important? How can modern technology help ...
Date Added: 2009-06-07 14:56:27

F0530.pdf
Path: Simons Rock >> CH >> 250 Fall, 2009
Description: Instruction register PC Address Instruction or data Memory data register Data A Register # Memory Registers Register # B Register # ALU ALUOut Data ...
Date Added: 2009-06-07 14:56:58

13_misc.pdf
Path: University of Louisiana at Lafayette >> CACS >> 360 Fall, 2009
Description: MiscellaneousTopics inJava (2005.12.30) MiscellaneousTopicsinJava 2 I.J2ME,J2EEandJSTL J2ME MiscellaneousTopicsinJava 3 Java2MicroEdition lowfootprintJavaruntimeenvironment targetedatsmallwirelessconsumerproducts http:/java.sun.com/j2me/in...
Date Added: 2009-06-07 15:02:05

CreativeAcccess.doc
Path: Johns Hopkins >> DATA >> 2064 Fall, 2009
Description: Ears to Listen, Places to Play By Amy Lundy Through The Creative Access, Peabody students are bringing the world of music to audiences who might never find their way into a traditional concert hall. Classical guitarist Matt Carvin still remembers tha...
Date Added: 2009-06-07 15:07:39

chapter8-4up.pdf
Path: Duke >> X >> 006 Fall, 2009
Description: Vectors Vectors are homogeneous collections with random access Store the same type/class of object, e.g., int, string, The 1000th object in a vector can be accessed just as quickly as the 2nd object Strings are collections of characters supporting o...
Date Added: 2009-06-07 15:14:26

HsiehUrquiola(2004).pdf
Path: Columbia >> MSU >> 2101 Fall, 2008
Description: When schools compete, how do they compete? An assessment of Chiles nationwide school voucher program Chang-Tai Hsieh University of California, Berkeley Miguel Urquiola Columbia University November, 2004 In 1981, Chile introduced nationwide school...
Date Added: 2009-06-07 15:15:41

samplepermissionsrequest-1.doc
Path: Columbia >> MEDIA >> 4795 Fall, 2009
Description: Date_ Dear Rights and Permissions Manager: I am presently preparing the following title for publication in 2_ by Columbia University Press, a nonprofit organization. The book will be approximately _ pages in length and approximately 1200 cloth copies...
Date Added: 2009-06-07 15:15:45

bat.txt
Path: Berkeley >> ASTRO >> 00020103 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 15:16:59

2008fall Exer-15.pdf
Path: CSU Long Beach >> SOC >> 100 Fall, 2009
Description: Soc.100 / Hicks Marlowe Discussion Exercise #15 Politic (Chap. 15) Note Taker: Group Mem bers: (5 pts.each) 1. As the text suggests, \"power\" is the ability to carry out your will in spite of resistance. More simply, it is the ability to get others ...
Date Added: 2009-06-07 15:24:54

2008spring Exer-15.pdf
Path: CSU Long Beach >> SOC >> 100 Fall, 2009
Description: Soc.100 / Hicks Marlowe Discussion Exercise #15 Politic (Chap. 15) Note Taker: Group Mem bers: (5 pts.each) 1. As the text suggests, \"power\" is the ability to carry out your will in spite of resistance. More simply, it is the ability to get others ...
Date Added: 2009-06-07 15:25:00

average-ms-tup.pdf
Path: Berkeley >> CS >> 1004 Fall, 2009
Description: 10.00 InnoDB Rose ms per tuple insertion 1.00 0.10 0.01 0.00 0.1 1 10 million tuples inserted ...
Date Added: 2009-06-07 15:25:31

horton_what_is_a_domain.pdf
Path: University of Illinois, Urbana Champaign >> LIS >> 390 Fall, 2008
Description: What is a Domain? Mark R. Horton ABSTRACT In the past, electronic mail has used many different kinds of syntax, naming a computer and a login name on that computer. A new system, called domains, is becoming widely used, based on a heirarchical nami...
Date Added: 2009-06-07 15:27:17

pinouts.txt
Path: UF >> DOCS >> 3701 Fall, 2009
Description: For more info (and more chips) go to http:/www.kingswood-consulting.co.uk/giicm/ 7400 Quad 2-input NAND gates. +-+-+-+ +-+-*-+ _ 1A |1 +-+ 14| VCC | A | B |/Y | /Y = AB 1B |2 13| 4B +=+=*=+ /...
Date Added: 2009-06-07 15:28:08

cacm-p29-elrad.pdf
Path: DePaul >> CSC >> 447 Fall, 2009
Description: 28 October 2001/Vol. 44, No. 10 COMMUNICATIONS OF THE ACM PROGRAMMING ASPECT-ORIENTED C PAUL WILEY Computer science has experienced an evolution in programming languages and systems from the crude assembly and machine codes of the earliest compu...
Date Added: 2009-06-07 15:30:32

labfinalreview.pdf
Path: Duke >> X >> 001 Fall, 2009
Description: 1 WHAT YOU SHOULD KNOW (and More) FOR THE LAB FINAL Explanation of Java What is an object? o An object is a value of a class type o An example is: String, Sound or a Robot What is a primitive type? o A primitive type is a number type or Boolean typ...
Date Added: 2009-06-07 15:33:18

midterm1answers.pdf
Path: Duke >> X >> 100 Fall, 2009
Description: 1) boolean isSortOfOdd(int[] nums) { for (int i = 0; i < nums.length; i+){ if (nums[i] % 2 = 0){ if (i = nums.length1 | nums[i+1] % 2 = 0) return false; } } return true; } 2) public int compareTo (Object o){ Piece in = (Piece)o; if (time < in.getTim...
Date Added: 2009-06-07 15:35:37

code.pdf
Path: Duke >> X >> 100 Fall, 2009
Description: Printed by Jeffrey R.N. Forbes Aug 29, 06 13:01 Printed by Jeffrey R.N. Forbes Aug 29, 06 13:01 IUniqueCounter.java Page 1/1 SetUniqueCounter.java Page 1/1 /* * Interface for reasoning about different methods for determining * number of differe...
Date Added: 2009-06-07 15:37:14

ResumeSample1.pdf
Path: University of Dayton >> D >> 124 Fall, 2009
Description: Arthur B. Radley aradley@hotmail.com Permanent Address: 3434 West Avenue West Chester, OH 45069 (513) 547-1170 School Address: 25 Engle Park Drive, #2 Dayton, OH 45419 (937) 435-4578 Education: University of Dayton School of Law, Dayton, Ohio Candid...
Date Added: 2009-06-07 15:39:39

index.pdf
Path: Temple >> MATH >> 1012 Fall, 2008
Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Spring 2009 Course Syllabus Course: Mathematics 1012.000. Course Title: Elements of Mathematical Thought. Time: Fix this. Place: Fix this!. Instructor: Lipschutz, Seymour...
Date Added: 2009-06-07 15:40:55

080818.PMCB.lecture1.pdf
Path: UF >> PCB >> 5530 Fall, 2008
Description: Plant Molecular and Cellular Biology FOR5530 F. Altpeter, Agronomy J. Davis, Forest Resources A. Hanson, Horticultural Sciences G. Peter, Forest Resources 8/18/2008 1 Plant Molecular and Cellular Biology Lecture 1: Course Overview & Intro to Recombi...
Date Added: 2009-06-07 15:41:59

Quiz5.pdf
Path: Air Force Academy >> ME >> 330 Fall, 2009
Description: ...
Date Added: 2009-06-07 15:46:24

par_10_script13.txt
Path: Stanford >> EDUC >> 39108 Fall, 2009
Description: &scripts=I had fun in class yesterday!*Me, too! The school looked better after the cleanup.*I learned a lot about recycling, too! Now, I will separate my cans and my papers at home!*Yes, me too!*Yes, and I will al...
Date Added: 2009-06-07 15:46:52

gilbert.pdf
Path: Stanford >> SLAC >> 020419 Fall, 2009
Description: What is new on BaBarGrid at SLAC ? Gilbert Grosdidier BaBarGrid - CERN Goals and Steps (1) Bring SLAC to the same level of GRID (BaBarGrid) accessibility as other sites (UK, Lyon, LAL, .) at Globus level as a first milestone more or less already ...
Date Added: 2009-06-07 15:49:35

2003-oct22.pdf
Path: Air Force Academy >> WEW >> 036 Fall, 2009
Description: ...
Date Added: 2009-06-07 15:51:33

L15.doc
Path: Allan Hancock College >> ELEC >> 3200 Fall, 2009
Description: 3e30215 1 3e30215 2 3e30215 3 ...
Date Added: 2009-06-07 15:55:22

lecture6.pdf
Path: Duke >> X >> 001 Fall, 2009
Description: CPS 1: Computer Science Fundamentals Vijay Abhijit 24th May, 2001 Assignment 2 / Lab 2 First part (making Hello World applet and modifications, posting onto newsgroup) [due tonight, May 24, 11:59pm] Second part (making modifications to Decision T...
Date Added: 2009-06-07 15:55:29

migration-bw.pdf
Path: Washington >> GENOM >> 453 Fall, 2009
Description: Population subdivision and migration Eects of population isolation Adding migration Migration and drft Migration and selection Isolated populations Populations with no possibility of interbreeding are independent gene pools Each one has its ...
Date Added: 2009-06-07 15:59:25

EMA6518-additional.pdf
Path: UF >> EMA >> 6518 Fall, 2008
Description: ...
Date Added: 2009-06-07 16:01:03

13-Herbicide_Processes.doc
Path: UF >> IPM >> 5305 Spring, 2008
Description: Herbicide Processes (Learning Objectives) 1. Define the following terms: a. Adsorption b. Photochemical decomposition c. Leaching d. Volatilization 2. Name several chemical processes that inactivate herbicides. 3. For leaching, describe: a. Desirable...
Date Added: 2009-06-07 16:02:27

motherboard_ml.pdf
Path: Stanford >> E >> 158 Fall, 2009
Description: MATERIAL LIST FOR: STANFORD LINEAR ACCELERATOR CENTER U.S. DEPARTMENT OF ENERGY STANFORD UNIVERSITY DATE ENGINEER: W.ROSS, P.CORREDOURA, M.BROWNE M.BROWNE 9/17/02 APPROVED BY: STANFORD, CA DATE PEP-II/SPEAR3 RF SYSTEM RF PROCESSING MODULE VXIBUS MO...
Date Added: 2009-06-07 16:05:35

GarageBandScreenCapture.pdf
Path: Texas San Antonio >> MULTIMEDIA >> 3313 Fall, 2009
Description: Step by Step Guide to How to Take a Screenshot of your Project This tutorial will show you how to capture a rectangular area of your computer screen and prepare it for display on the web. You!ll be using this technique throughout the semester, but r...
Date Added: 2009-06-07 16:08:48

partial.key.txt
Path: Northeastern >> CSU >> 370 Fall, 2009
Description: Partial answer key for final exam in CS U370, fall 2003. These were the most difficult questions, plus the programming questions. Except where noted, the most popular answers were correct. 56 students took the test. The low score was 56, the medi...
Date Added: 2009-06-07 16:09:55

hw3.pdf
Path: Stanford >> MATH >> 172 Fall, 2009
Description: ...
Date Added: 2009-06-07 16:10:00

status.txt
Path: Stanford >> LOG >> 1395011 Fall, 2009
Description: spbuild - 1395011 - New run directory /afs/slac.stanford.edu/g/babar/prod/log/allruns/1395011 - Thu Apr 4 19:44:38 2002 spbuild - building G10.3.1V01 - Thu Apr 4 19:44:38 2002 spbuild - building M10.3.1V01x18F - Thu Apr 4 19:44:38 2002 spbuild - b...
Date Added: 2009-06-07 16:13:33

Lecture%209%20notes.pdf
Path: Texas State >> FILE >> 313 Fall, 2009
Description: Lecture 9, Slide 1 In James Slezaks book titled ODYSSEY TO EXCELLENCE, he compares numerous leadership models and asserts that these models are applicable to educational settings; further, Slezak reminds the reader that numerous styles of leadership ...
Date Added: 2009-06-07 16:16:07

81.PPT
Path: Stanford >> C >> 0303241 Fall, 2009
Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|01 Aug 2003 16:25:15 -0000 vti_extenderversion:SR|5.0.2.4330 vti_author:SR|SLAC\ ereit vti_modifiedby:SR|SLAC\ ereit vti_timecreated:TR|01 Aug 2003 16:25:15 -0000 vti_cacheddtm:TX|01 Aug 2003 16:25:15 -...
Date Added: 2009-06-07 16:22:46

bat.txt
Path: Berkeley >> ASTRO >> 00020099 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 16:25:50

prog05.pdf
Path: Utah >> CS >> 6620 Spring, 2008
Description: Program 5 Advanced Computer Graphics II Due: 11:59:59, April 2, 2008 The Assignment: Implement texture mapping in your ray tracer. You will implement a checkerboard texture (that toggles between two different materials), a noise-based marble texture...
Date Added: 2009-06-07 16:27:11

2280.pdf
Path: UPenn >> FIN >> 2275 Fall, 2009
Description: 2280 External Loans of Artwork Policy Last Reviewed: July 2007 Responsible Office: Treasurer & Curator Approval: Treasurer View PDF Version Purpose To provide guidelines for external loans of items in the Universitys Art Collection. Policy Institut...
Date Added: 2009-06-07 16:27:56

design_critique.doc
Path: Utah >> COMM >> 5520 Fall, 2008
Description: Ryan Muranaka Page 1 The Sims Critique 5/29/2009 The Sims is a computer game wherein the player assumes the role of a simulated person (i.e. Sim) within the game. The player may create their own Sim or use a premade one. The premade Sims are u...
Date Added: 2009-06-07 16:32:52

Homework13.pdf
Path: Lehigh >> PHYSICS >> 016182 Fall, 2009
Description: ...
Date Added: 2009-06-07 16:38:45

Lab8Spring2009.doc
Path: Lynchburg College >> CS >> 141 Fall, 2009
Description: CS141 Lab #8 String Functions Write the following functions that operate on strings. Function: int stringLength(const char* string) Description: Determine the length of the string the number of characters before the null terminator. Inputs: const c...
Date Added: 2009-06-07 16:42:50

glutglui.pdf
Path: Oregon State >> CS >> 553 Fall, 2008
Description: Your Application GLUI GLUT OpenGL X / MFC Window System Framebuffer ...
Date Added: 2009-06-07 16:53:05

practiceExam2solutions.pdf
Path: N. Colorado >> MATH >> 121 Fall, 2009
Description: MATH 121 Practice Test 2 Name: September, 21 2007 There are 7 questions for a total of 95 points. Solutions for this exam will be posted at http:/www.unco.edu/nhs/mathsci/facstaff/Wakefield/math121.htm (15) 1. Suppose f (x) = 6x + 2, (a) When is f...
Date Added: 2009-06-07 16:57:33

TrendsCellBiol12-205.pdf
Path: Colorado >> MCDB >> 3150 Fall, 2008
Description: Research Update TRENDS in Cell Biology Vol.12 No.5 May 2002 205 Research News The awesome power of multiple model systems: interpreting the complex nature of spindle checkpoint signaling David N. Millband, Leigh Campbell and Kevin G. Hardwick The...
Date Added: 2009-06-07 17:00:48

FM_CH17.PPT
Path: Missouri S&T >> EMGT >> 322 Fall, 2009
Description: Product Costing Systems Organizations have a range of choices in order to distribute product costs. Two ends of that spectrum are: Job order costing system. Process costing system. 17-1 Copyright Houghton Mifflin Company. All rights reserved. P...
Date Added: 2009-06-07 17:01:36

6.6-6.9.pdf
Path: Colorado >> AMATH >> 1350 Fall, 2006
Description: ...
Date Added: 2009-06-07 17:01:42

replica.pdf
Path: Penn State >> CSE >> 513 Spring, 2008
Description: Replication Strategies in Unstructured Peer-to-Peer Networks Edith Cohen AT&T LabsResearch 180 Park Avenue Florham Park, NJ 07932, USA Scott Shenker ICSI Berkeley, CA 94704 USA edith@research.att.com ABSTRACT The Peer-to-Peer (P2P) architectures th...
Date Added: 2009-06-07 17:03:52

cpa15_soc301.doc
Path: Wake Forest >> CPAS >> 301 Fall, 2009
Description: 1David Yamane Sociology 301/Religion 351 Course Preparation Written Assignment CAMPUS SPEAKER: DAVID BROMLEY Introduction: David Bromley is Professor of Sociology and Religious Studies at Virginia Commonwealth University. He received his B.A. degree ...
Date Added: 2009-06-07 17:04:31

t10AInformationRepresentationMachineInstructions.ppt
Path: IUPUI >> CSCI >> 230 Fall, 2008
Description: Department of Computer and Information Science, School of Science, IUPUI CSCI 230 Information Representation: Machine Instructions Dale Roberts, Lecturer IUPUI droberts@cs.iupui.edu Dale Roberts Review: Computer Organization A Typical Von-Neumann...
Date Added: 2009-06-07 17:14:04

bat.txt
Path: Berkeley >> ASTRO >> 00020089 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 17:20:05

both.txt
Path: Berkeley >> ASTRO >> 00020089 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 17:20:05

xrt.txt
Path: Berkeley >> ASTRO >> 00020089 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-07 17:20:06

interview_questions.pdf
Path: Cal Poly >> ENGL >> 518 Fall, 2009
Description: 1. Focus on experience, not extrapolation. Avoid questions that force the participant to give an answer beyond their limited understanding of the problem at hand. Bad: \"Is this a useful feature?\" Better: \"Would this feature, as it\'s currently present...
Date Added: 2009-06-07 17:25:03

Q2 ChE 313 01.doc
Path: Cornell >> CHEM >> 313 Fall, 2008
Description: ChE 313 - Summer 2003 - Quiz #2 - 5/28/02 I\'m using a portable compressed air tank to inflate a flat tire. The tank has V=1.5 ft3 and is initially filled with compressed air at P=100 psia and T=70oF (=530oR). The air initially in the tire is at atmos...
Date Added: 2009-06-07 17:27:38

2009313_r01c_0807062.pdf
Path: Stanford >> KFN >> 1040 Fall, 2009
Description: UNITED STATES DISTRICT COURT SOUTHERN DISTRICT OF NEW YORK CHARTER TOWNSHIP OF CLINTON : Civil Action No. 08-CIV-07062 POLICE AND FIRE RETIREMENT SYSTEM, Individually and On Behalf of All : CLASS ACTION Others Similarly Situated, . AMENDED COMPLAIN...
Date Added: 2009-06-07 17:39:05

Defuzzification.pdf
Path: MSOE >> CS >> 470 Fall, 2009
Description: Fuzzy Logic - Defuzzification 1 Fuzzy Logic - Defuzzification 2 Fuzzy Logic - Defuzzification 3 Fuzzy Logic - Defuzzification 4 Fuzzy Logic - Defuzzification 5 Fuzzy Logic - Defuzzification 6 ...
Date Added: 2009-06-07 17:39:51

19_LectureOutline.ppt
Path: Cal Poly >> PHYS >> 132 Fall, 2009
Description: Chapter 19 The First Law of Thermodynamics Lectures by James Pazun Copyright 2008 Pearson Education Inc., publishing as Pearson Addison-Wesley Introduction A steam locomotive is driven by a steam engine. The hotter the flame, the more energy may...
Date Added: 2009-06-07 17:41:27

341-Lecture2.ppt
Path: W. Alabama >> CS >> 341 Fall, 2009
Description: Lecture 2 We have given O(n3), O(n2), O(nlogn) algorithms for the max sub-range problem. This time, a linear time algorithm! The idea is as follows: suppose we have found the maximum subrange sum for x[1.n-1]. Now we have to find it for x[1.n]...
Date Added: 2009-06-07 17:57:16

syl.doc
Path: Portland >> SBA >> 101 Fall, 2009
Description: INTRODUCTIONTOBUSINESS BA101 Spring2006 _ Instructor:PaulBrennan,MBAOffice:M/W810 Office:N/aTelephone:N/A ClassLocation:SBA490Email:PaulB@sba.pdx.edu ACCESSIBILITYSTATEMENT:Icanmosteasilybecontactedbeforeorafterclass.I purposefullygivebreakssoyoucan...
Date Added: 2009-06-07 18:01:47

446-049.pdf
Path: Virginia Tech >> PUBS >> 446 Fall, 2009
Description: publication 446-049 General Permit Requirements for Confined Animal Feeding Operations in Virginia David Kenyon, Professor of Agricultural and Applied Economics, Virginia Tech, Blacksburg, Virginia. Introduction A new waste management permit for c...
Date Added: 2009-06-07 18:04:54

watt_08.txt
Path: UWO >> CS >> 4490 Fall, 2009
Description: 1. Portability in Pen Computing. (Software) Study the portability issues in pen-based computing by developing a simple notepad application that operates in three environments. 2. Cloud computing (Software) Study the issues in cloud computing by d...
Date Added: 2009-06-07 18:06:43

cs641_4_4.pdf
Path: UWO >> CS >> 641 Fall, 2009
Description: The First Idea The Early Game Development Process From Concept to Proposal Most games begin with a single idea. This idea can revolve around: A character A setting A story A style of gameplay A philosophy A new technology And so on 2 The F...
Date Added: 2009-06-07 18:08:56

03_Example1.pdf
Path: Portland >> EAS >> 361 Fall, 2008
Description: ...
Date Added: 2009-06-07 18:13:58

Lecture3.Hydrologic.pdf
Path: Portland >> CE >> 410 Fall, 2008
Description: Hydrologic Analysis Section 1b Basic Hydrology Section Outline Unit Hydrographs S Curve Method Synthetic UH Multi-period storms UH Applications Kinematic Wave Section 1 Basic Hydrology Scoggins Dam Hagg Lake Section 1 Basic Hydrology 1 Scoggi...
Date Added: 2009-06-07 18:14:39

433-2009-Winter-pw.txt
Path: Wright State >> CS >> 233 Fall, 2009
Description: ceg43300:august+kirk:1300:433:ceg43300-2008-Spring-OSIS-WSU:/home/ceg433/ceg43300:/bin/bash ceg43301:thee+nut:1301:433:ceg43301-2008-Spring-OSIS-WSU:/home/ceg433/ceg43301:/bin/bash ceg43302:first+invoke:1302:433:ceg43302-2008-Spring-OSIS-WSU:/home/ce...
Date Added: 2009-06-07 18:15:46

420-527.pdf
Path: Virginia Tech >> PUBS >> 420 Fall, 2009
Description: publication 420-527 Sustaining America\'s Aquatic Biodiversity Frog Biodiversity and Conservation David Bishop, Department of Fisheries and Wildlife Sciences, Virginia Tech Carola Haas, Department of Fisheries and Wildlife Sciences, Virginia Tech b...
Date Added: 2009-06-07 18:16:26

211LN7.1.pdf
Path: ASU >> STAT >> 211 Fall, 2009
Description: 7.1. Systems of Linear Equations Algebra deals mainly with equations of one variable. At the end of MAT 117 (or whatever class you took), you learned how to solve equations with more than one variable in them, such as: x + 3y = 5 4x 2y = 8 How? The...
Date Added: 2009-06-07 18:20:54

170h4.pdf
Path: ASU >> STAT >> 170 Fall, 2009
Description: MAT 170 Written Homework #4 2.4, 2.5 Due: February 26, 2009 Solve the following problems, showing any necessary work. If the nal answer is short, you should circle or box it. 1. Let p(x) = x3 4x2 + 11x 20. a. [2 points] Divide p(x) by x + 3, usin...
Date Added: 2009-06-07 18:21:09

211s10.pdf
Path: ASU >> STAT >> 211 Fall, 2009
Description: MAT 211 Written Homework #10 8.3, 8.4, 8.5 SOLUTIONS Due: April 17, 2009 Solve the following problems, showing any necessary work. If the nal answer is short, you should circle or box it. 1. A fair coin is tossed three times. Let A be the event hea...
Date Added: 2009-06-07 18:21:23

The Virtual Project.doc
Path: UNC Wilmington >> POM >> 572 Fall, 2009
Description: READING 233 RE A D iN G THE VIRTUAL PROJECT: MANAGING TOMORROW\'S TEAM TODAY* J. R. Adams and L. L. Adams Extraordinary demands are placed on project personnel -demands that require extraordinary commitments in order to accomplish the task at ha...
Date Added: 2009-06-07 18:25:02

mgmte160.pdf
Path: Harvard >> EXTENSION >> 12513 Fall, 2009
Description: Harvard University Extension School MGMT E - 160: Managing in the Global Economy Instructor: Dr. Boroschek August 3, 2007 1 COURSE SYLLABUS: Harvard University Extension School MGMT E - 160: Managing in the Global Economy Instructor: Dr. Borosch...
Date Added: 2009-06-07 18:30:24

problem3.pdf
Path: Utah State >> MATH >> 1060 Fall, 2008
Description: Evaluating Trigonometric Functions Problem 3. Determine the value of the six trigonometric functions. 15 ; lies in quadrant IV 17 sin = - ...
Date Added: 2009-06-07 18:33:05

finals99.ps
Path: Wisconsin >> CS >> 525 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: fin99s.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips fin99s %DVIPSParameters: dpi=...
Date Added: 2009-06-07 18:35:31

mid99s.ps
Path: Wisconsin >> CS >> 525 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: mid99s.dvi %Pages: 9 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips mid99s %DVIPSParameters: dpi=6...
Date Added: 2009-06-07 18:35:32

fin99s.ps
Path: Wisconsin >> CS >> 525 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: fin99s.dvi %Pages: 10 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentPaperSizes: Letter %EndComments %DVIPSCommandLine: dvips fin99s %DVIPSParameters: dpi=...
Date Added: 2009-06-07 18:35:34

strategy_prompts.doc
Path: North Texas >> COE >> 4870 Fall, 2009
Description: Reading Strategies: Prompts to Focus Readers on Strategies Word Level Decoding/Comprehension Using graphic information Look at the picture to help you figure out the word. Where have you seen that word before? Read the story using the punctua...
Date Added: 2009-06-07 18:46:53

YPR203W.t2k.dssp-ehl2-logo.pdf
Path: UCSC >> YPR >> 203 Fall, 2009
Description: YPR203W.t2k DSSP-EHL2 1 C C X X X 10 20 30 40 H 1 T H T H E H E H H C H C C H C H C C C C C C C C H H H H C C C C C C C H X X X X X X X X X X X X X X X X X X 51 60 70 80 90 T 1 T H E H T T E CC E X X 101 PS 100 E EECC ...
Date Added: 2009-06-07 18:55:03

YDR521W.t2k.w0.5-logo.pdf
Path: UCSC >> YDR >> 521 Fall, 2009
Description: YDR521W.t2k w0.5 2 1 M L V I W G K K S S F L L L GFLLPLFLGLFV L G XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX VL Y H I I L V V I L F Y Y Y I I I I I I I I L N L V V V V V V V V Q Q I I T S LL V L VLLLLL F FF L Y I I I V V V Y I ...
Date Added: 2009-06-07 18:55:05

Substitutions-present.pdf
Path: Allan Hancock College >> FIT >> 3013 Fall, 2009
Description: Outline Assigning Meanings to Programs Defining AMN constructs Computing proof obligations System Modelling and Design Generalised Substitutions and Proof Obligationss Revision: 1.2, March 27, 2002 Ken Robinson School of Computer Science & Engineer...
Date Added: 2009-06-07 18:57:46

LookUpKeyInClass.Form1.vb.txt
Path: La Salle >> TEACH >> 230 Fall, 2009
Description: Public Class Form1 Dim keys(100) As Integer Dim movies(100) As String Dim numMovies As Integer Private Function ExtractLine(ByVal text As String, ByRef line As String, ByRef startPos As Integer, ByRef foundPos As Integer) As Boolea...
Date Added: 2009-06-07 18:58:16

SDD.doc
Path: FIU >> PBART >> 001 Fall, 2009
Description: Florida International University School of Computer Science Advanced Software Engineering (CEN5011) Fall 2004 Term System Design Document of the Inventory Control System Instructor: Masoud Sadjadi Due Date: 11/10/04 Group Members: Pramod Barthwal, ...
Date Added: 2009-06-07 18:59:13

lec03.ppt
Path: UAB >> GROUP >> 2658 Fall, 2009
Description: CLA 222/HIS 204 Lecture 3: Historical Background II: Athens Lecture Outline 1. Union of Attica 2. Four Property Classes of Solon 3. Reforms of Cleisthenes (508 BCE) 4. Democratic Constitution of Cleisthenes 5. Changes in Constitution after 508 ...
Date Added: 2009-06-07 18:59:36

YPR065W.t2k.str2-logo.pdf
Path: UCSC >> YPR >> 065 Fall, 2009
Description: YPR065W.t2k STR2 3 2 1 CCCCCC S X X T S H S H H S T H H C S T S T H T H T H G G S G T H T S G S S T T S G G X X X X X X X C H X TC CCC S 10 HCC C T XXSXXXXXXXXXTXX X X C H H 1 20 30 40 T 3 2 1 H T H H G HHHHT HHHHHH C HS X G S H G...
Date Added: 2009-06-07 19:01:05

CHOMP SQUAD 8.pdf
Path: San Diego State >> ART >> 344 Fall, 2008
Description: CHOMP SQUAD l lciromp smile c romp romp a n h o m p stomp stomp stomp s q SQUAD alliance CHOMP om smile smile smilesmile smile chomp smile chomp chomp smile smile smile smile l l i smile c ha n c CHOMP m p SQUAD o stomp salliance alliance rompc cho...
Date Added: 2009-06-07 19:09:20

inclass02.pdf
Path: Evansville >> CS >> 210 Fall, 2009
Description: CS 210 Fundamentals of Programming I Spring 2009 In-class Exercise for 1/12/09 (M) & 1/13/09 (T) (10 points) You may work in pairs if you wish to do so. Consider the following problem statement and an analysis and design to solve the problem. Prob...
Date Added: 2009-06-07 19:12:42

07fam3k.doc
Path: Drake >> ECON >> 107 Fall, 2009
Description: Introduction to Econometrics (Econ 107) Drake University, Fall 2007 William M. Boal MIDTERM EXAMINATION #3 ANSWER KEY \"Multiple Regression With Cross-Sectional Data\" November 13, 2007 VERSION A I. MULTIPLE CHOICE (1)a. (2)a. (3)c. (4)a. II. MULTIPLE...
Date Added: 2009-06-07 19:15:40

09assign12.pdf
Path: Rutgers >> MATH >> 338 Fall, 2008
Description: Math 338: Problem Set 12, Spring 2009, These problems are due on Thursday, April 30. Hand in 2(a) and (b) and 3. We will discuss how to do them in Tuesday\'s class. 1. Consider the following hidden Markov chain model. The hidden chain itself has a sta...
Date Added: 2009-06-07 19:18:30

hack_guide_v2.pdf
Path: Texas A&M >> CS >> 614 Fall, 2009
Description: SimpleScalar Hackers Guide (for tool set release 2.0) Todd Austin info@simplescalar.com SimpleScalar LLC SimpleScalar LLC SimpleScalar Hackers Guide Todd Austin Tutorial Overview Computer Architecture Simulation Primer SimpleScalar Tool Set Ove...
Date Added: 2009-06-07 19:20:34

Ch10.ppt
Path: MTSU >> CS >> 4560 Fall, 2009
Description: Copyright 2007 Pearson Education, Inc. Publishing as Pearson Addison-Wesley Slide 10- 1 Chapter 10 Functional Dependencies and Normalization for Relational Databases Copyright 2007 Pearson Education, Inc. Publishing as Pearson AddisonWesley Cha...
Date Added: 2009-06-07 19:21:40

nyse_euronext_merger.pdf
Path: Rutgers >> ECON >> 394 Fall, 2009
Description: BBC NEWS | Business | NYSE and Euronext in $20bn merger http:/newsvote.bbc.co.uk/mpapps/pagetools/print/news.bbc.co.uk/1/hi/bu. NYSE and Euronext in $20bn merger The New York Stock Exchange (NYSE) has agreed to buy the pan-European Euronext exchang...
Date Added: 2009-06-07 19:23:49

maglite.pdf
Path: Rowan >> ENG >> 102 Fall, 2009
Description: Competitive Assessment of Maglite Flashlights Assigned January 27 & 28, 2004 Purpose of Laboratory Have you ever wondered how something works? An automobile? A pencil sharpener? A pepper grinder? How about a rocket, or a harmonica? Have you ever had ...
Date Added: 2009-06-07 19:23:52

blue-white+bands.doc
Path: UNC >> READ >> 1051568 Fall, 2009
Description: 2002 2003 Mens Basketball White Band Clemson-1/14-7:00p Wake Forest-2/2-5:30p Virginia-2/12-7:00p NC A&T-2/18-8:00p DOOK-3/9-4:00p Flute (16) Kelly Austin Brandi Burroghs Matthieu Campbell Catherine Carter Lisa Cassidy Dana Hackett Victoria Hairsto...
Date Added: 2009-06-07 19:34:05

02-24.pdf
Path: Delaware >> CHAPTER >> 403 Fall, 2009
Description: ...
Date Added: 2009-06-07 19:35:13

0rcs48-235.doc
Path: Neumont >> CSC >> 1913 Fall, 2009
Description: Supreme Court Of Canada. In Re Dean, 48 S.C.R. 235 Date: 1913-02-23 In Re Charles Dean. 1913: February 23; 1913: February 25 Present: Mr. Justice Duff, in Chambers. Criminal law-Habeas corpus-Common law offences-Construction of statute-\"Supreme Cour...
Date Added: 2009-06-07 19:37:22

SMILE 2.pdf
Path: San Diego State >> ART >> 344 Fall, 2008
Description: CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD ...
Date Added: 2009-06-07 19:41:18

dst_index_1987_11.txt
Path: UCLA >> PT >> 1987 Fall, 2009
Description: 1987 11 1 0 -36 1987 11 1 1 -36 1987 11 1 2 -34 1987 11 1 3 -32 1987 11 1 4 -33 1987 11 1 5 -36 1987 11 1 6 -37 1987 11 1 7 -38 1987 11 1 8 -37 1987 11 1 9 -35 1987 11 1 10 -38 1987 11 1 11 -40 1987 11 ...
Date Added: 2009-06-07 19:41:50

e2f97.pdf
Path: SUNY Albany >> MATH >> 326 Fall, 2009
Description: Math 326 Exam 2 Fall \'97 Show all of your work. 1. What is the exponent of Z ? 12 2. What is (63, 000)? 3. a) What are the possible orders of the elements of Z ? 25 b) What is the order of 4 in Z ? 25 c) What is the smallest positive integer congr...
Date Added: 2009-06-07 19:42:12

OCD_Draft_F06a_T09_v0.1.pdf
Path: USC >> CSCI >> 577 Fall, 2009
Description: Operational Concept Description (OCD) Personal Care Technology Team 9 Team Members: Preeti Agrawal Project Manager Akash Haswani OCD Manager Neha Singla Prototype Developer Prateek Tandon SSRD Person Unnati Sethi SSAD Person Varun Dua FRD Per...
Date Added: 2009-06-07 19:44:04

04.pdf
Path: Allan Hancock College >> BK >> 1982 Fall, 2009
Description: ...
Date Added: 2009-06-07 19:44:40

mathp1310.pdf
Path: East Los Angeles College >> ENVI >> 1310 Fall, 2009
Description: p wev rqr rqpp qqVusVXtqshqGp on m lGkYw s jU0 iVDh `0X e we w W g f g e g e d a g W DF0 d 0 2q c dV WD0xV0W a V! qqh s y W `0X#u VdSBxa vs t W y w u rXqXihfdb`SXVT ppe g e caU Y WU 6G(SR40(C2R4Q\"IPH!GC231#CFEDC AB9@86%50(312#)0 &\'%...
Date Added: 2009-06-07 19:46:15

error.txt
Path: Washington >> V >> 11904 Fall, 2009
Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Mon Dec 03 18:48:01 2007 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Mon Dec 03 19:59:48 2007 ( 4307 s elapsed) ...
Date Added: 2009-06-07 19:49:50

pq1.pdf
Path: UVA >> ASTR >> 124 Summer, 2008
Description: ...
Date Added: 2009-06-07 19:50:38

log.txt
Path: Washington >> V >> 11871 Fall, 2009
Description: 000 (26416.000.000) 12/03 13:19:33 Job submitted from host: <128.95.94.28:4757> . 001 (26416.000.000) 12/03 18:17:24 Job executing on host: <172.25.101.174:1158> . 006 (26416.000.000) 12/03 18:37:31 Image size of job updated: 460208 . 005 (26416.000....
Date Added: 2009-06-07 19:51:19

T0462.t06.n_sep-logo.pdf
Path: UCSC >> G >> 0462 Fall, 2009
Description: T0462.t06 n_sep 3 2 1 75 80 90 100 110 D 3 2 1 A D A D D K A D A D A D G D A D A D 120 GG E LPLIL ADDGTYEITKLNGGRRFLF R MK N LG I E SG K K I QV S G R RY Y I E A D 125 130 140 A D A D 150 GR E IDLGY GEATKIWVRRVSDAGEESH P QK ...
Date Added: 2009-06-07 19:59:11

lect12.pdf
Path: Rochester >> A >> 453 Fall, 2009
Description: Lecture 12 Convection We adopt an approximate theory of convection All current theories of convection are approximate i.e. \"mixing length\", with arbitrary length some fraction of the scale height Our theory just the first order approximation Goo...
Date Added: 2009-06-07 20:00:52

types_of_inheritance.pdf
Path: UNI >> CNS >> 053 Fall, 2009
Description: ...
Date Added: 2009-06-07 20:01:13

0708c-csse432-midterm-2-solns.pdf
Path: Rose-Hulman >> CSSE >> 200930 Fall, 2009
Description: CSSE 432 - Computer Networks Spring 2007-2008 Rose-Hulman Institute of Technology Computer Science and Software Engineering Mid-term Exam 2 Name:_ CM: _ Instructions: Write all answers on these pages. Skim the entire examination before starting, ...
Date Added: 2009-06-07 20:05:43

lecture-19-state-machines-NuSMV-6.pdf
Path: Minnesota >> CSCI >> 5802 Spring, 2008
Description: Lecture 19 - State Machines and NuSMV Spring 2009 Introduction Csci 5802 Introduction to State Machines and NuSMV Language http:/www.umsec.umn.edu Describing embedded system\'s processing behavior Can be extremely difficult Complexity increasing w...
Date Added: 2009-06-07 20:05:55

ForeignNationalInformationForm_02242009_.pdf
Path: Middlebury >> AA >> 494 Fall, 2009
Description: FOREIGN NATIONAL INFORMATION FORM (PAGE 1) The Foreign National Information Form MUST be completed and returned before you can receive any form of payment. All applicable questions below must be answered. A copy of the picture page and the visa page ...
Date Added: 2009-06-07 20:12:52

Sight Distance Scans
Path: Georgia Tech >> CEE >> 4600 Fall, 2007
Description: ...
Date Added: 2009-06-07 22:27:53

TEST2P1
Path: Georgia Tech >> MATH >> 2401 Spring, 2009
Description: ...
Date Added: 2009-06-07 22:42:44

DiffNOTES_0012
Path: Georgia Perimeter >> MATH >> 2652 Spring, 2008
Description: ...
Date Added: 2009-06-07 23:10:30

03A-Cognitive-Foundations.ppt
Path: Cal Poly >> CSC >> 484 Fall, 2009
Description: UserCenteredDesignand Development Instructor:FranzJ.Kurfess ComputerScienceDept. CalPolySanLuisObispo FJK 2005 Copyright Notice These slides are a revised version of the originals provided with the book Interaction Design by Jennifer Preece, Yvonn...
Date Added: 2009-06-08 06:27:39

29213.pdf
Path: Doane >> LAR >> 375 Fall, 2009
Description: ...
Date Added: 2009-06-08 06:30:10

29213.pdf
Path: Doane >> LAR >> 399 Fall, 2009
Description: ...
Date Added: 2009-06-08 06:31:42

20220240100583_RC_1598_12.txt
Path: East Los Angeles College >> MODULE >> 2022024010 Fall, 2009
Description: #chan code gain offset innse comment 0 1000 50.5 37.1 713 unbonded 1 1000 50.7 0.5 674 unbonded 2 1000 49.7 16.1 697 unbonded 3 1000 49.6 12.6 715 unbonded 4 1000 51.4 7.3 672 unbonded 5 1000 49.1 7.7 739 unbonded 6 1000 51...
Date Added: 2009-06-08 06:34:46

03_Dialogclassic.ppt
Path: Toledo >> FIS >> 1325 Fall, 2009
Description: DIALOG TRAINING SEMINAR Introduction to DIALOG Featuring DialogClassic Allison Evatt Graduate Education Program 2007 The Dialog Corporation Agenda Introduction to DIALOG Planning and Conducting the Search Modifying and Enhancing a Search Ba...
Date Added: 2009-06-08 06:35:06

Peter_McLaren_Correspondence_1989_Letter_from_Richard_Smith_supporting_McLarens_nomination_for_Renow
Path: McGill >> ARCHIVE >> 500 Fall, 2009
Description: t i\'-ll JAMES COOK UNIVERSITY OF NORTH QUEENSLAND POSTAL ADDRESS; James Cook University TELEPHONE 1077) 81 4111 TELEX; AA47009 FACSIMILE; (0771796371 TOWNSVILLE Q 4811 AUSTRALIA SCHOOL OF EDUCATION Department of Social and Cultural Studies Head...
Date Added: 2009-06-08 06:38:28

Selling a corporate software product that costs hundreds of thousands of dollars is a tough project
Path: S.E. Louisiana >> MRKT >> 303 Spring, 2009
Description: Selling a corporate software product that costs hundreds of thousands of dollars is a tough project. You cant just broadly advertise and expect results. Instead, you need to reach directly into the offices of executive buyers. Theres no shortage of g...
Date Added: 2009-06-08 06:40:03

jobs.txt
Path: Dickinson State >> CS >> 474 Fall, 2009
Description: process p1 0 10 1 8 9 2 3 6 4 4 4 7 7 2 2 1 1 2 4 6 7 9 4 5 1 2 5 5 5 6 6 7 7 8 8 2 1 1 3 6 process p2 3 12 1 8 9 2 3 6 4 4 4 7 7 2 2 1 1 2 4 6 7 9 4 5 1 2 5 5 5 6 6 process p3 5 14 0 1 2 3 4 5 6 7 8 9 10 11 11 10 9 8 7 6 5 4 3 2 1 0 0 1 ...
Date Added: 2009-06-08 06:41:39

LOWRISKDATINGSTRATEGYPart2powerpoint.pdf
Path: Wisc Stevens Point >> TSTEW >> 892 Fall, 2009
Description: How to Really Know Somebody Concepts from the book How to Avoid Marrying a Jerk How t really know someone H to ll k 3 Ts 1) Time 2) Talking T lki 3) Togetherness It is important to see a person in many different situations- having fun being fun, ser...
Date Added: 2009-06-08 06:44:18

311HW1.pdf
Path: Charleston Law >> HOME >> 311 Fall, 2009
Description: ENGN 311 Fluid Mechanics Winter 2009 Homework #1 Due Wednesday, January 14, 2009 Introductory Material 1. 1.55 (pg. 34) 2. 1.59 (pg. 35) Pressure 3. 2.27 (pg. 82) 4. 2.41 (pg. 85) 5. 2.61 (pg. 87) 6. 2.63 (pg. 88) ...
Date Added: 2009-06-08 06:50:41

311HW1.pdf
Path: Charleston Law >> ENGN >> 311 Fall, 2009
Description: ENGN 311 Fluid Mechanics Winter 2009 Homework #1 Due Wednesday, January 14, 2009 Introductory Material 1. 1.55 (pg. 34) 2. 1.59 (pg. 35) Pressure 3. 2.27 (pg. 82) 4. 2.41 (pg. 85) 5. 2.61 (pg. 87) 6. 2.63 (pg. 88) ...
Date Added: 2009-06-08 06:50:41

607lpsa.ppt
Path: Loyola Marymount >> MBAA >> 607 Fall, 2009
Description: Sensitivity Analysis Sensitivity analysis examines how the optimal solution will be impacted by changes in the model coefficients due to uncertainty, error or human intervention. In particular, it can address: how a change in an objective func...
Date Added: 2009-06-08 06:52:43

Requirements.doc
Path: Mississippi State >> ECE >> 4522 Fall, 2009
Description: CS DEPARTMENT OF ELECTRICAL & COMPUTER ENGINEERING Requirements document for Automatic Meter Reading Submitted to: Professor Joseph Picone ECE 4512: Senior Design I Department of Electrical and Computer Engineering Mississippi State University Mis...
Date Added: 2009-06-08 06:53:25

bat.txt
Path: Berkeley >> ASTRO >> 00020095 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 06:55:46

both.txt
Path: Berkeley >> ASTRO >> 00020095 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 06:55:46

xrt.txt
Path: Berkeley >> ASTRO >> 00020095 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 06:55:48

cable.pdf
Path: Harvey Mudd College >> CS >> 189 Fall, 2005
Description: 2001-2002 ACM Northeastern European Regional Programming Contest Problem C \"Cable master\" Input file cable.in Output file cable.out Inhabitants of the Wonderland have decided to hold a regional programming contest. The Judging Committee has volunte...
Date Added: 2009-06-08 07:01:37

symm-systems.pdf
Path: Minnesota >> FOLD >> 0018 Fall, 2009
Description: On cooperative parabolic systems: Harnack inequalities and asymptotic symmetry J. Fldes and P. Polik o ac School of Mathematics, University of Minnesota Minneapolis, MN 55455 Abstract We consider fully nonlinear weakly coupled systems of parabolic e...
Date Added: 2009-06-08 07:10:44

bat.txt
Path: Berkeley >> ASTRO >> 00020062 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 07:11:00

ACCT220A82086911.doc
Path: MD University College >> ASIA >> 2088 Fall, 2009
Description: Syllabus for ACCT220 - A820 Principles of Accounting I Instructor: Robyn Harris Email: rharris@asia.umuc.edu Course Description An introduction to the basic theory and techniques of contemporary financial accounting. Topics include the accounting cy...
Date Added: 2009-06-08 07:11:58

F06_final.pdf
Path: UCSD >> PHYS >> 140 Fall, 2009
Description: 140a Final Exam, Fall 2006 Data: P0 105 P a, R = 8.314 103 J/kmol K = NA k, NA = 6.02 1026 parti- cles/kilomole, TC = TK - 273.15. dU = T dS - P dV + 2 1 i dNi , i U = TS - PV + 2 i Ni i dQ/Text S2 - S1 = / , P dQR /T / 1 Defs: 1 V V...
Date Added: 2009-06-08 07:15:46

302.03.doc
Path: Penn State >> BKP >> 302 Fall, 2009
Description: 302.03 Lab Page. 1 302.03 Risk Management Planning Project Risk Management is an ongoing element to nearly all projects. Planning and dealing with risks throughout the lifecycle of a project will dictate whether a project ends in a success or fa...
Date Added: 2009-06-08 07:16:00

ellenkim3.txt
Path: Princeton >> COS >> 325 Fall, 2009
Description: ellenkim3.wav, 3/4/09 The intro and conclusion are not convoluted. I convoluted two original soundfiles: a common childhood round, with me tapping a pen and my keychain together. The result is as expected. Duration: 0:44.01 ellenkim3b.wav, 3/4...
Date Added: 2009-06-08 07:16:33

176.pdf
Path: Pittsburgh >> AEI >> 3032 Fall, 2009
Description: ...
Date Added: 2009-06-08 07:19:54

hw3.pdf
Path: Pittsburgh >> EE >> 1473 Fall, 2009
Description: Homework #3 EE 1473, Spring 2002 University of Pittsburgh 1. Suppose that we toss a coin three times and observe the sequence of heads and tails. (a) Find the sample space (A selection of outcomes of the experiment). (b) If we assume each outcome is ...
Date Added: 2009-06-08 07:21:02

howelljuly16.doc
Path: Pittsburgh >> AEI >> 6118 Fall, 2009
Description: The Europeanization of British Financial Services Regulation By Kerry E. Howell Research Unit for Institutional Governance Ashcroft International Business School, APU Email k.e.howell@apu.ac.uk ESRC/UACES (Sheffield University) Conference Britain in...
Date Added: 2009-06-08 07:24:27

SEN.127.62.pdf
Path: Concordia OR >> SGA >> 127 Fall, 2009
Description: SEN.127.62 A Resolution to REVISE THE UNIVERSITY POSTING POLICY Whereas, the current University posting rules are restrictive, and Whereas, a lack of bulletin boards on campus allows for only a few legal places to post signs according to the current ...
Date Added: 2009-06-08 07:51:52

66518_1.pdf
Path: Pittsburgh >> AEI >> 9851 Fall, 2009
Description: ...
Date Added: 2009-06-08 07:52:24

dst_index_1984_06.txt
Path: UCLA >> PT >> 1984 Fall, 2009
Description: 1984 6 1 0 -12 1984 6 1 1 -10 1984 6 1 2 -7 1984 6 1 3 -6 1984 6 1 4 -6 1984 6 1 5 -8 1984 6 1 6 -6 1984 6 1 7 -2 1984 6 1 8 -3 1984 6 1 9 0 1984 6 1 10 7 1984 6 1 11 12 1984 6 ...
Date Added: 2009-06-08 07:55:42

66922_1.pdf
Path: Pittsburgh >> AEI >> 9897 Fall, 2009
Description: ...
Date Added: 2009-06-08 07:56:59

Bork - Slouching Toward Gomorrah.pdf
Path: Rochester >> CAS >> 105 Fall, 2009
Description: ...
Date Added: 2009-06-08 07:57:17

000593_1.pdf
Path: Pittsburgh >> AEI >> 3442 Fall, 2009
Description: ...
Date Added: 2009-06-08 07:59:36

Cameroneuma1.pdf
Path: Pittsburgh >> AEI >> 9068 Fall, 2009
Description: Robert Schuman Miami-Florida European Union Center of Excellence EUMA Germany\'s Marriage of Necessity - Fraser Cameron EUMA Vol.1 No. 2 November 2005 This publication is sponsored by the EU Commission. EUMA European Union Miami Analysis (EUMA) ...
Date Added: 2009-06-08 08:02:58

004008_1.pdf
Path: Pittsburgh >> AEI >> 5884 Fall, 2009
Description: 11-12 ...
Date Added: 2009-06-08 08:03:04

Tut6_internal_forces.pdf
Path: Washington >> AA >> 210 Fall, 2009
Description: ENGR 210 - Statics Tutorial 6 Your Name: Partners\' Names: Section:_ _ _ _ _ _ _ _ DISTRIBUTED LOADS; INTERNAL FORCES and MOMENTS IN BEAMS Consider the simply mounted bean with triangular load and uniform weight per length as shown: y Total weight o...
Date Added: 2009-06-08 08:04:18

key_quiz2.pdf
Path: UCLA >> CHEM >> 144 Fall, 2008
Description: NAME: ORGANIC CHEMISTRY 144 QUIZ 2 Key 1. List the pKa\'s of the following compounds. Acetone 20 Acetylene 25 Diethylamine 36 Ethanol 17 Benzene 40 Acetic Acid 5 2. Provide reagents for the following transformations. Me Br Me CHO a) 2 eq t-BuLi THF...
Date Added: 2009-06-08 08:14:22

exam1_spr04.pdf
Path: SUNY IT >> STA >> 100 Fall, 2009
Description: STA 100 Prof. Thistleton Exam 1 February 20, 2004 1. There are 40 students in a statistics class. 25 of these students are women. One third of the men are independent voters. There are 10 independent voters in the class. (a) Fill in the following ...
Date Added: 2009-06-08 08:15:56

Notes_Jun_08.pdf
Path: Allan Hancock College >> PAGE >> 124523 Fall, 2009
Description: NOTES FROM A MEEING OF THE FACULTY ADMINISTRATIVE OFFICERS/SUBDEANS\' GROUP HELD ON FRIDAY 6 JUNE 2008 IN THE SENATE ROOM AT 9:30AM 1. UPDATE FROM ACADEMIC COUNCIL Sylvia Lang provided the following update on the Academic Council meeting held on We...
Date Added: 2009-06-08 08:17:45

05p1.pdf
Path: UCSB >> CS >> 290 Fall, 2009
Description: Internet Security Protocols 1 Outline of Course 1. Introduction 2. Secure TCP/IP Protocols (IPSec) 3. Secure Sockets Layer (SSL), Transport Layer Security (TLS) 4. Secure HTTP 5. Basic WWW Security 2 Protocol Stack at Outset What we have to star...
Date Added: 2009-06-08 08:19:42

frameworks.ppt
Path: Georgia Tech >> CS >> 2340 Fall, 2008
Description: Frameworks and Design CS2340 References Building Application Frameworks: ObjectOriented Foundations of Framework Design; Mohammed Fayed, Douglas Schmidt, Ralph Johnson; Wiley 1999 Framework-Based Software Development in C+; Gregory Rodgers; Pren...
Date Added: 2009-06-08 08:20:31

EASC412D01.TXT
Path: Sveriges lantbruksuniversitet >> SCI >> 20003 Fall, 2009
Description: Sheet1 PROFILE OF STUDENTS IN SFU COURSES COURSE: EASC 412-3 D01 LOCATION: SFU TITLE: ADVN GEOCHEMISTRY SECTION TYPE: LEC SEMESTER: 2000-3 ENROL: 11 = PROGRAM OF STUDENT (Top 5 programs reported in each category Programs with < 3 students not shown s...
Date Added: 2009-06-08 08:22:11

SP09-212-c27p.pdf
Path: Washington University in St. Louis >> PHYSICS >> 212 Spring, 2009
Description: Problem 27.15 v0 = 1.41 106 m/s, R = 0.050 m, m = 9.109 10-31 kg, q = -1.602 10-19 C. (a) Since F = qv B and q is negative, we see that B is directed into the page . F = mv2 /R |q|vB sin = |q|vB = mv2 /R mv B= = 1.60 10-8 T . |q| R (b) t = R...
Date Added: 2009-06-08 08:25:40

final.pdf
Path: Purdue >> EE >> 423 Fall, 2009
Description: Name:_ EE423 Final Exam Spring, 2008 The following circuit applies to problems 1 -3. Parameters for the dc machine are: r a = 0.2 , L AA = 100 mH , k v = 0.01 V-s/rad , B m = 0 , T L = 0.001 r . iS + iS iD ia ra L AA va + k v wr iS! iS iD ...
Date Added: 2009-06-08 08:31:14

bat.txt
Path: Berkeley >> ASTRO >> 00020086 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 08:38:35

s0025.pdf
Path: Georgia Tech >> ECE >> 2030 Fall, 2008
Description: A Ten Transistor Transparent Latch Part A IN0 OUT IN1 Select Part B Enable IN OUT Part C Phi 1 Phi 2 INPUT 1 A 0 1 B 0 1 C 0 1 D 0 ...
Date Added: 2009-06-08 08:41:27

Transl_Mechanism_Eukaryotic.ppt
Path: UMass (Amherst) >> BIO >> 642 Fall, 2009
Description: eIF1A eIF2B eIF1 eIF4B eIF4A eIF4E PABP G eIF5B SUMMARY OF TRANSLATION INITIATION IN EUKARYOTES WEAVER: FIG. 17.28 QuickTime and a Photo - JPEG decompressor are needed to see this picture. SEQUENCE OF ASSEMBLY OF THE EUKARYOTIC TRANSLATION IN...
Date Added: 2009-06-08 08:50:04

Homework4_phone.doc
Path: George Mason >> IT >> 101 Fall, 2008
Description: HOMEWORK # 4 GRADE Name: _ SECTION : _005_ Please enclose your answers in the boxes provided. Each question is worth 6.25 points answer 1. The telephone system is based on which of the following? a. Packet switching b. Circuit switc...
Date Added: 2009-06-08 08:55:58

bat.txt
Path: Berkeley >> ASTRO >> 00020088 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 08:56:00

bat.txt
Path: Berkeley >> ASTRO >> 00020068 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 08:56:29

Uncertainty_notes.ppt
Path: George Mason >> PHYS >> 244 Fall, 2008
Description: Treatment of Uncertainties PHYS 244 and PHYS 246 Uncertainty 1 Types of Uncertainties Random Uncertainties: result from the randomness of measuring instruments. They can be dealt with by making repeated measurements and averaging. One can calculat...
Date Added: 2009-06-08 08:57:17

207_16.4.pdf
Path: San Jose State >> CS >> 257 Spring, 2008
Description: The Query Compiler (16.4) DATABASE SYSTEMS The Complete Book Presented By: Maciej Kicinski Under the supervision of: Dr. T.Y.Lin Topics to be covered Estimating the Cost of Operation Estimating Sizes of Intermediate Relations Estimating t...
Date Added: 2009-06-08 08:58:24

104_13.4.ppt
Path: San Jose State >> CS >> 257 Spring, 2008
Description: Presenter: Namrata Buddhadev (104_224_13.4.1-13.4.4) Professor: Dr T Y Lin Index 13.4 Disk Failures 13.4.1 Intermittent Failures 13.4.2 Checksums 13.4.3 Stable Storage 13.4.4 Error- Handling Capabilities of Stable Storage Types of Errors Interm...
Date Added: 2009-06-08 08:58:46

DimRed_3.pdf
Path: George Mason >> INFS >> 795 Fall, 2008
Description: Dimensionality Reduction Many dimensions are often interdependent (correlated); We can: Reduce the dimensionality of problems; Transform interdependent coordinates into significant and independent ones; Principal Component Analysis 1 Principal ...
Date Added: 2009-06-08 09:00:48

FileOpsExercise.pdf
Path: Eastern Oregon >> MM >> 419 Fall, 2009
Description: Exercise: Exploring File Operation Failures Background One of the costs of doing any kind of programming using file input and output is that your program is dependent on external entities that won\'t necessarily be under your (the developer\'s) control...
Date Added: 2009-06-08 09:02:26

UT_HUnter_Huntington.xls
Path: UC Riverside >> CERT >> 308 Fall, 2009
Description: Huntington Company Stack ID 1 2 Stack Test Date 9/19/2001 9/19/2001 Height (ft) 600 600 Exit Area (ft^2) 452.39 452.39 Exit Dia. (ft) 24 24 DAQ ID 1284 1285 Hunter Plant ID 10238 10238 DAQ Stack ID 1281 1282 1283 Company Stack ID 1 2 3 Plant ID ...
Date Added: 2009-06-08 09:05:47

sect6linklistH.pdf
Path: Duke >> X >> 100 Fall, 2009
Description: CPS 100E - Program Design and Analysis I Prof. Rodger Section: Linked Lists handout Read A12.3-12.4, W6.4, W16 Linked List Data structure way to organize data in a list exact t Linked list made of nodes A linked list links together exactly the numb...
Date Added: 2009-06-08 09:07:28

S4L08.ppt
Path: Alabama >> CS >> 325 Fall, 2008
Description: CS325 UnixProgrammingEnvironment and WindowsProgramming withMicrosoftFoundationClasses(MFC) Lecture8 Today Unixprogrammingenvironment Chmod Iterators project2 Homework ReadingAssignments Unix ChmodIterators,binarytreeiterators http:/...
Date Added: 2009-06-08 09:10:09

ElijahFinal.pdf
Path: Wisc Stevens Point >> HJANI >> 736 Fall, 2009
Description: ...
Date Added: 2009-06-08 09:15:22

Hillfinal09.pdf
Path: St. Anselm >> CFA >> 14292 Fall, 2009
Description: Charlotte Hill Inaction through Tears: Realism and U.S. Policy on Genocide \"Politics have no relation to morals.\" Niccolo Machiavelli1 By Charlotte Hill, University of California, Berkeley PART 1 Regardless of the U.S. government\'s strong condemna...
Date Added: 2009-06-08 09:17:12

WMST245ReviewQuestionsSpring2009.doc
Path: WVU >> WMST >> 245 Fall, 2008
Description: W. Graeme Donovan, WMST 245: Review Questions , Page 1 West Virginia University Eberly College of Arts and Sciences Women\'s Studies Center WMST 245: WOMEN IN INTERNATIONAL DEVELOPMENT REV...
Date Added: 2009-06-08 09:17:24

hw5.pdf
Path: CSU Channel Islands >> COMPSCI >> 161 Fall, 2009
Description: Homework 5 Problems ICS 161Spring, 2009Dillencourt 1. (a) You are given two inputs: an integer k, and an array A containing n integers. Give an algorithm to nd any one of the k smallest elements of A, using at most n k comparisons. (In other words, ...
Date Added: 2009-06-08 09:18:55

AOP-Intro-p29-elrad.pdf
Path: Michigan State University >> CSE >> 870 Fall, 2008
Description: 28 October 2001/Vol. 44, No. 10 COMMUNICATIONS OF THE ACM PROGRAMMING ASPECT-ORIENTED C PAUL WILEY Computer science has experienced an evolution in programming languages and systems from the crude assembly and machine codes of the earliest compu...
Date Added: 2009-06-08 09:20:33

metric-prefix-table2.pdf
Path: E. Michigan >> MATH >> 110 Fall, 2008
Description: 1, 000, 000, 000, 000 Prefix tera Abbrev. T Name trillion Power of 10 1012 Typical units you might s bytes 1, 000, 000, 000 giga G billion 109 bytes, watts 1, 000, 000 mega M million 106 bytes, watts 1, 000 100 10 1 0.1 0.01 0.001 ...
Date Added: 2009-06-08 09:23:56

winter2006.pdf
Path: UPenn >> ALUMNI >> 1969 Fall, 2009
Description: WINTER 2006 1969 Dear Classmates W e certainly can be proud to wave the Red and Blue! We are happy to report that the weather outside may be frightful but it did not stop the University and Penn students from helping those in need. This past fall, ...
Date Added: 2009-06-08 09:28:11

winter2007.pdf
Path: UPenn >> ALUMNI >> 1961 Fall, 2009
Description: WINTER 2007 The Class of 1961 Newsletter is published for the members of the Class of 1961 by Penn Alumni and the Office of Alumni Relations. To find out how you can become involved in University and class activities, please contact Lynn Carroll in ...
Date Added: 2009-06-08 09:28:12

lecture-redblacktree.pdf
Path: Maryland >> USERS >> 420 Fall, 2009
Description: ...
Date Added: 2009-06-08 09:30:14

lecture-redblacktree.pdf
Path: Maryland >> CMSC >> 420 Fall, 2005
Description: ...
Date Added: 2009-06-08 09:30:24

fruit.pdf
Path: University of Illinois, Urbana Champaign >> ILAGSTAT >> 1950 Fall, 2009
Description: -3 \' Crop Reporting Service tI ;t J\\;,ak - Ill: and U. S. Departments of Agriculture 1 -*s:` Illinois : -*y,.%a\\ \" .y+:)Y , :a` I 1945-49 -Continued 11*` Disposition of principal crops on farms where produced, Illinois, . D . -j * >`* *., 5 * . ...
Date Added: 2009-06-08 09:30:47

ms709-001f08.pdf
Path: Michigan >> SSW >> 20092 Fall, 2009
Description: Social Work 709: Training in Intergroup Dialogue Facilitation: Skills for Multicultural Social Work Practice Professor Michael S. Spencer E-mail: spencerm@umich.edu Office: SSWB 2728 Laura Wernick, Phd Candidate E-mail: lwernick@umich.edu Office: SSW...
Date Added: 2009-06-08 09:31:03

f01h9.pdf
Path: Michigan >> PHYSICS >> 406 Fall, 2003
Description: Physics 406 Homework Assignment #9 Due Date: Monday November 26, 2001 Please keep in mind the statement in the syllabus concerning homework assignments: \"Students may consult with the lecturer (and are encouraged to do so) for help on these problems ...
Date Added: 2009-06-08 09:32:21

class27-2x3.pdf
Path: UVA >> CS >> 150 Fall, 2008
Description: Glue, Photons, P=NP? DNA Helix Photomosaic from cover of Nature, 15 Feb 2001 (made by Eric Lander) The lambda calculus is a universal, fundamental model of computation. You can view it as \"the essence of Scheme\". It contains terms and rules descri...
Date Added: 2009-06-08 09:32:31

project39_final_paper.pdf
Path: University of Illinois, Urbana Champaign >> ECE >> 445 Spring, 2008
Description: MICROSTRIP TRANSMISSION LINE DESIGN WITH LEFT-HANDED MATERIAL PROPERTIES By Brian Boerman Xu Chen ECE 445, SENIOR DESIGN PROJECT FALL 2004 TA: Adam Gustafson December 7, 2004 Project No. 39 ABSTRACT A class of metamaterials called left-handed mat...
Date Added: 2009-06-08 09:32:35

prob5.8.txt
Path: UNC >> BIOS >> 162 Fall, 2009
Description: 1701 1956 2580 2438 2750 2807 1956 1843 1871 2041 2296 2183 2268 2495 2070 1673 1786 1843 3175 3572 2495 2778 1956 1588 2296 2183 3232 2778 1446 2268 1559 1304 2835 2892 2495 2353 1559 2466 ...
Date Added: 2009-06-08 09:32:59

ME430 Le1_1 Introduction To Mechatronics.pdf
Path: Rose-Hulman >> ME >> 430 Fall, 2009
Description: ME 430 Mechatronic Systems Introduction to Mechatronics What is Mechatronics ? From the Rose-Hulman catalog \"Applications of microprocessors and microcontrollers and digital electronics to the design and utilization of embedded control systems in sm...
Date Added: 2009-06-08 09:35:56

YMR012W.t2k.stride-ebghtl-logo.pdf
Path: UCSC >> YMR >> 012 Fall, 2009
Description: 3 2 1 T CH C E E E EE X X X X X X 51 60 70 80 90 H 3 2 1 T E T E T H E T E EEE C C X X X X X X C ECC C C T ETTTT X H E T X X X 101 110 120 130 140 H 3 2 1 T E T TG GT TCTTG CCCCCCTTTCTCGTTTTTCCC TGHH TT TCCCT TCCGCCC...
Date Added: 2009-06-08 09:36:52

YMR071C.t2k.dssp-ehl2-logo.pdf
Path: UCSC >> YMR >> 071 Fall, 2009
Description: YMR071C.t2k DSSP-EHL2 2 1 C C C C C C X X X X X X E E C X H C C C C C C C C X X X X C X X X H H HHHHH H X X X X X H H H X C H X X X X X X X X X HHCCCCCC E E HHHHH 30 X X X X 1 10 20 40 T H 2 1 HHH HEEEHH E H X X X X X X E E ...
Date Added: 2009-06-08 09:37:07

YMR014W.t2k.w0.5-logo.pdf
Path: UCSC >> YMR >> 014 Fall, 2009
Description: YMR014W.t2k w0.5 4 3 2 1 M L V I XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX I S S S S P E V L IY L L V F E I I V V Q K LD LEY F L Y F L Q L H I V YL F Y I I V V Q K K T S L F L E PRYP F L I V K K T A LYN F L CIG A V L L ...
Date Added: 2009-06-08 09:37:20

YMR015C.t2k.alpha-logo.pdf
Path: UCSC >> YMR >> 015 Fall, 2009
Description: YMR015C.t2k ALPHA 3 2 1 B XXXII I H 10 20 30 40 B H 3 2 1 S H S E H E H HHHHHHHHHH G I I X X X X X X X X X X I I I X X H H I I HX B H H X X X H X H X D CB BE BC BEB IHH BC E II XXEXXXXXXXCBXXXXHXSXXXXHI X XX X E S S C S E B E B ...
Date Added: 2009-06-08 09:37:42

YMR076C.t2k.w0.5-logo.pdf
Path: UCSC >> YMR >> 076 Fall, 2009
Description: 15 16 17 18 19 T 5 4 3 2 1 L I V K E P S T H T S H XXX 201 210 220 230 240 H 5 4 3 2 1 N S D K T H T S T 251 260 270 280 290 H 5 4 3 2 1 R H L I L XXXXXXXXXXXXXXXXXX T C S F VG S A N L I M K D S L S F Y I E A L V F ...
Date Added: 2009-06-08 09:38:08

bat.txt
Path: Berkeley >> ASTRO >> 00020067 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 09:48:34

both.txt
Path: Berkeley >> ASTRO >> 00020067 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 09:48:34

xrt.txt
Path: Berkeley >> ASTRO >> 00020067 Fall, 2009
Description: 1e-05 1e-05 1 1 ...
Date Added: 2009-06-08 09:48:35

f06labexam.pdf
Path: Laurentian >> BIOL >> 200803 Fall, 2009
Description: List of aquatic taxa for the lab exam Chara Isoetes Equisetum Ceratophyllum Potamogeton vaginatus filiformis natans praelongus perfoliatus richardsonii Myriophyllum Scirpus Typha Utricularia Najas Nymphaea Nuphar Crustacea Cladocera Daphniidae Bosmin...
Date Added: 2009-06-08 10:01:42

xquery-tut.pdf
Path: Bowling Green >> CS >> 8711 Fall, 2009
Description: Xquery Tutorial Craig Knoblock University of Southern California References XQuery 1.0: An XML Query Language www.w3.org/TR/xquery/ XML Query Use Cases www.w3.org/TR/xmlquery-use-cases Demonstration site: http:/www.cocoonhive.org/xquery/xqueryform...
Date Added: 2009-06-08 10:04:10

hw5sol.pdf
Path: University of Illinois, Urbana Champaign >> CS >> 475 Fall, 2008
Description: CS 475 Homework 5 (due 05/05/09 in class) Spring 2009 CS 475:Formal Models of Computation Homework 5 1. [10 points] Let (N, <) be the model with universe N (natural numbers) and the \"less than\" relation. Prove that Th(N, <) is decidable. Answer. P...
Date Added: 2009-06-08 10:15:11

HW6Solution2007.doc
Path: Cal Poly Pomona >> EGR >> 549 Fall, 2009
Description: EGR 549 Page 1079 Example 5 M/M/1, service rate=12 #/hr, Performance WinQSB measure Utilization 83.3% W Wq L Lq Effective arrival rate P(j =< 5) 0.5 hr 0.42 hr 5 4.2 10 0.665 HW 6 Solution arrival rate=10 #/hr Arena 100000 run 0.834 29.3 min = 0.5 h...
Date Added: 2009-06-08 10:17:46

ch5.ppt
Path: Mich Tech >> CS >> 3141 Fall, 2008
Description: Project management Ian Sommerville 2004 Software Engineering, 7th edition. Chapter 5 Slide 1 Objectives q q q q q To explain the main tasks undertaken by project managers To introduce software project management and to describe its distinctiv...
Date Added: 2009-06-08 10:20:23

Dunn-JASA-1213-1971.pdf
Path: University of Illinois, Urbana Champaign >> BRL >> 1971 Fall, 2009
Description: LETTERS TO THE EDITOR ACKNOWLEDGMENTS This study was supported part by a PHS grant in F. S. Brodnitz, Voca/Rehabilitation (Whiting Press, Rochester, from the National Institute for Neurological Diseases Minnesota,1959),pp. 16-59. and Stroke.Mar...
Date Added: 2009-06-08 10:20:49

sp-1-sol.pdf
Path: Berkeley >> CS >> 170 Fall, 2006
Description: m ~ } | k U $ @ a a Q ` $ U ! $ $ U $ fF b \'{%$EC I I $ )I vgi\"#V5)#U 5I I E I %# U 5I VQ $0 I h\"foVR%qf I #V5#\"bb I w a Q ` $ QS $ C !$ a Q ` Sx f $ U Q $ a Q ` $ f U...
Date Added: 2009-06-08 10:25:10

sp-f.pdf
Path: Berkeley >> CS >> 174 Fall, 2008
Description: CS174 J. Canny Final Exam Spring 98 May 20 This is a closed-book exam with 6 questions. The marks for each question are shown in parentheses, and the total is 120 points. Make sure you allocate enough time to attempt all the questions. You are all...
Date Added: 2009-06-08 10:25:33

sp-f.pdf
Path: Berkeley >> CS >> 150 Fall, 1996
Description: Your Name: _ UNIVERSITY OF CALIFORNIA AT BERKELEY BERKELEY DAVIS IRVINE LOS ANGELES RIVERSIDE SAN DIEGO SAN FRANCISCO SANTA BARBARA SANTA CRUZ Department of Electrical Engineering and Computer Sciences CS 150 - Spring 1997 Prof. A. R. Newton...
Date Added: 2009-06-08 10:25:35

L14.pdf
Path: Duke >> X >> 130 Fall, 2009
Description: Lecture 14: Dynamic Programming (CLRS 15.2-15.3) June 6th, 2002 1 Dynamic programming We have previously discussed how divide-and-conquer can often be used to obtain ecient algorithms. Examples: matrix multiplication, merge-sort, quick-sort,. S...
Date Added: 2009-06-08 10:31:51

L-14.ps
Path: Duke >> X >> 130 Fall, 2009
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: Book.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Roman Times-Bold Courier Times-Italic %EndComments %DVIPSWebPage: (www.radicaley...
Date Added: 2009-06-08 10:32:10

types_of_inheritance.pdf
Path: UNI >> CS >> 053 Fall, 2009
Description: ...
Date Added: 2009-06-08 10:34:02

phys212_s09_pe4.pdf
Path: University of Montana >> PHYS >> 212 Fall, 2009
Description: Phys 222 Full Name (PRINT): Phys 222 Full Name (PRINT): Exam 4 KEY Exam 4 Spring 2 Signature: Spring 2008 1.(5) 222 Phys What do you see at the center of the shadow4 Exam created by laser light falling on a small sphere (as sh Spring 2008 Full Nam...
Date Added: 2009-06-08 10:38:45

Market Structure.doc
Path: Tulane >> BREESE >> 714 Fall, 2009
Description: Market Structure Order specifies what to trade, how much, buy or sell, and conditions Orders are made because traders do not usually arrange their own trades go through a broker or dealer Terms Ask = offer Bid Size = quantity Firm Price for active...
Date Added: 2009-06-08 10:44:33

10818.pdf
Path: Duke >> X >> 149 Fall, 2009
Description: Dora Trip http:/acm.uva.es/p/v108/10818.html Problem E: Dora Trip Time limit: 3 seconds Nobita is in great trouble. Today he failed to hand in his homework again, so he was heavily punished at school. Learning that, his mother gets furious, and th...
Date Added: 2009-06-08 10:54:58

ReviewProbs.pdf
Path: Cornell >> CS >> 4220 Spring, 2009
Description: CS 4220: Review Probs 1. (a) The unit roundoff EPS is approximately the smallest floating point number x such that 1 + x is greater than 1 in floating point arithmetic. How is EPS related to the floating point mantissa length? (b) Assuming that a and...
Date Added: 2009-06-08 10:56:17

YDL155W.t2k.str2-logo.pdf
Path: UCSC >> YDL >> 155 Fall, 2009
Description: YDL155W.t2k STR2 2 1 CC C S H C H H XXXXX C C H H H H H X X X X X XXXXHX X H H H H H H X H H T H H C T Y S C C CQZCCC Z T S S X X X X X XX C C CCCCCCCCSC XXXXXXXXXXXXXXX X X X X S S S S S T C T S S S S H C C S C H H T H H H H H X X X X ...
Date Added: 2009-06-08 11:04:20

YDL118W.t2k.w0.5-logo.pdf
Path: UCSC >> YDL >> 118 Fall, 2009
Description: YDL118W.t2k w0.5 2 1 M L I V 1 10 20 30 40 H 2 1 I L V S H T H E H T H E E T S E T T E F LL FF FL L L V H N XXXXXXX XXXXXX I I I V V V K S Y Y Y X L I Y I I V V A S WI F L XXXXXXXX C F L Y V A I V A L L VL Y I I L V V V I R ...
Date Added: 2009-06-08 11:04:44

YDL186W.t2k.dssp-ehl2-logo.pdf
Path: UCSC >> YDL >> 186 Fall, 2009
Description: YDL186W.t2k DSSP-EHL2 1 C C C E E X X X X X X 1 10 20 30 40 H T 1 H H C C C C C C C C C X X X X X X X X X X X T S H T H E H 51 60 70 80 90 H 1 E H E H T E CXHHHXCCCCCCCCCCCCCCCCCCCHCC C H C H X X X X X X X X X X X CCCCC H...
Date Added: 2009-06-08 11:05:36

YDL147W.t2k.CB_burial_14_7-logo.pdf
Path: UCSC >> YDL >> 147 Fall, 2009
Description: YDL147W.t2k CB_BURIAL_14_7 3 2 1 AAAAAA AAAAA AA A X X X X X 1 10 20 30 40 A 3 2 1 D A D B E B E D B A D B A D E B E B E D A D A A B B C C D D X X A C ECE FBEFB B C B CD C D DD EB C B C E A E B ECCEEBCEDCDE D C E E E B A C B F F C...
Date Added: 2009-06-08 11:05:38

slides3.pdf
Path: Duke >> X >> 100 Fall, 2009
Description: What\'s a pointer, why good, why bad? Pointer is a memory address, it\'s an indirect reference to memory or an object. Rather than say we have an int, we say we have a pointer to an int If x is an int, xptr can be a pointer to x Same thing works with ...
Date Added: 2009-06-08 11:07:41

p173.pdf
Path: Cornell >> CS >> 1112 Fall, 2009
Description: 7.2. Topo Maps 4 3.5 3 2.5 2 1.5 1 0.5 0 173 0 1 2 3 4 5 6 Figure 7.4. Output From the Script Eg7 2 110 100 90 80 70 y=1 y=2 y=3 T(x,y) 60 50 40 30 20 10 0 1 2 3 4 5 6 x Figure 7.5. Output for the Script Eg7 2 Talking Point: Automatic ...
Date Added: 2009-06-08 11:19:52

flowcharts1.pdf
Path: Western Washington >> CS >> 172 Fall, 2009
Description: Flowcharts Part 1 Dr. Jianna J. Zhang copyright 2009 Department of Computer Science, Western Washington University Basic Types of Flowcharts 1. Process Flowchart show higher level steps with plain English 2. Program Flowchart show detailed steps...
Date Added: 2009-06-08 11:23:56

A2_200910sLL.pdf
Path: Western Washington >> MYWEB >> 125 Fall, 2009
Description: ...
Date Added: 2009-06-08 11:24:41

ACCTG.pdf
Path: San Diego State >> GB >> 0506 Fall, 2009
Description: Accountancy In the College of Business Administration Faculty Andrew H. Barnett, Ph.D., Professor of Accountancy, Director of School John C. Anderson, Ph.D., Professor of Accountancy Allan R. Bailey, Ph.D., Professor of Accountancy Robert J. Capettin...
Date Added: 2009-06-08 11:35:11

wk12-RegGeneExpress_Student.doc
Path: New Mexico >> BIOLOGY >> 202 Fall, 2009
Description: Bio 202L Week 12 Regulation of Gene Expression Lac operon - genes involved in lactose metabolism. Spring 2009 Here\'s the overall layout of genes on chromosome. Note that \"operon\" is only the part that makes one polycistronic mRNA. (Technically, th...
Date Added: 2009-06-08 11:35:57

py212_14.ppt
Path: BU >> PY >> 212 Fall, 2009
Description: III3 Magnetic Dipoles 27. 7. 2003 1 Main Topics Magnetic Dipoles The Fields they Produce Their Behavior in External Magnetic Fields Calculation of Some Magnetic Fields Solenoid Toroid Thick Wire with Current 27. 7. 2003 2 Magnetic Dipoles ...
Date Added: 2009-06-08 11:41:44

Biol Memo.pdf
Path: Georgia Tech >> ECE >> 20040317 Fall, 2009
Description: School of Biology Atlanta, Georgia 30332-0230 USA Phone: 404 894-3700 Fax: 404 894-0519 March 11, 2004 To: Scott Wills, Chair Institute Undergraduate Curriculum Committee From: Jung H. Choi, Undergraduate Coordinator School of Biology Re: New cou...
Date Added: 2009-06-08 11:49:45

disability_statement.pdf
Path: Wooster >> JACOBS >> 101 Fall, 2009
Description: If you are a student with a documented disability in this course, please register with Pam Rose, Director of the Learning Center. The Learning Center is located in the Rubbermaid Student Services Building ext. 2595) and is the office that will assist...
Date Added: 2009-06-08 11:49:52

disability_statement.pdf
Path: Wooster >> JACOBS >> 102 Fall, 2009
Description: If you are a student with a documented disability in this course, please register with Pam Rose, Director of the Learning Center. The Learning Center is located in the Rubbermaid Student Services Building ext. 2595) and is the office that will assist...
Date Added: 2009-06-08 11:49:52

slac-pub-6896.pdf
Path: Stanford >> PUBS >> 6750 Fall, 2009
Description: SLAC-PUB-95-6896 THE PEP-II PROJECT-WIDE DATABASE A. Chan, S. Calish, G. Crane, I. MacGregor, S. Meyer, J. Wong, Stanford Linear Accelerator Center, Stanford University, Stanford, CA 94309 USA A. Weinstein, Lawrence Livermore National Laboratory, Li...
Date Added: 2009-06-08 11:52:49

Seminar 5.doc
Path: Allan Hancock College >> INFO >> 5991 Fall, 2009
Description: UNIVERSITY OF SYDNEY School of Information Technologies INFO5991 IT Professional Services Seminar 5 Week 5 1. PURPOSE AND SCOPE Topics Content Objectives 1. 2. 1. 2. 3. 4. IT processes and IT planning processes Leading a group discussion Understand...
Date Added: 2009-06-08 11:53:00

index.pdf
Path: Temple >> MATH >> 111 Summer, 2009
Description: College of Science and Technology Department of Mathematics TEMPLE UNIVERSITY Summer1 2009 Course Syllabus Course: Mathematics 0824.111. Course Title: Mathematical Patterns. Time: TWR 7:45 PM - 10:25 PM. Place: AMBLER WIDENER HALL Room 109. Instruc...
Date Added: 2009-06-08 11:53:13

hw11.pdf
Path: Oregon State >> PH >> 203 Spring, 2008
Description: PH 203H/213H S09 Homework due Monday, May 4, 2009 1. The square loop of wire of side b = 0.16 m lies on a long straight wire with a = 0.12 m on one side of the wire and b a = 0.04 m on the other side. The current in the long wire is I = 4.50t2 1...
Date Added: 2009-06-08 11:54:46

Syllabus303-2004.doc
Path: USC >> RCF >> 303 Fall, 2009
Description: Syllabus for Economics 303: Intermediate Microeconomics Dr. Svetlana Pevnitskaya Fall 2004 Class meeting: 2:00-3:50pm Monday, Wednesday, WPH102 Office Hours: Monday 11am-12pm, Wednesday 4-5pm and by appointment Phone: 213-740-2110 E-mail: pevnitsk@u...
Date Added: 2009-06-08 11:54:57

f01h7.pdf
Path: Michigan >> PHYSICS >> 406 Fall, 2003
Description: Physics 406 Homework Assignment #7 Due Date: November 9, 2001 Please keep in mind the statement in the syllabus concerning homework assignments: \"Students may consult with the lecturer (and are encouraged to do so) for help on these problems but they...
Date Added: 2009-06-08 11:59:02

TP_IOC0_S06b_T23_V1.1.pdf
Path: USC >> CSCI >> 577 Fall, 2009
Description: Transition Plan (TP) Open Source XML Parser-Based Code Count Tool Team 23 Ali Afzal Malik Harsh Nayak Kunal Kulkarni Vannak Touch Naman Modi Matthew Benjamin Leonard Cayetano Elaine Huang Transition Plan Peer Review Plan Quality Management Plan T...
Date Added: 2009-06-08 11:59:39

TP_DCP_F08a_T02_V1.0.doc
Path: USC >> CSCI >> 577 Fall, 2009
Description: Transition Plan (TP) Version 1.0 Transition Plan (TP) Housing Application Tracing System Team 02 Kaushik Das Pratik Kumar Deep Thakkar Alloki Bhatt Mayank Dedhia Bhuvan Vijayvergiya Gaurav Kumar Project Manager Requirement Engineer Feasibility A...
Date Added: 2009-06-08 11:59:45

Drainage Diversion.ppt
Path: Wisc Green Bay >> EARTHSC >> 202 Fall, 2009
Description: Drainage Diversion The Huang He: \"China\'s Sorrow\" 1887: 2,000,000 dead 1931: 3,700,000 dead 1938: The Chinese dynamite levees to slow the Japanese; half a million Chinese died. River Diversions in the Caspian Region Stream Piracy: Northeast Eng...
Date Added: 2009-06-08 12:00:55

102Climate and Climate Change.ppt
Path: Wisc Green Bay >> EARTHSC >> 102 Fall, 2009
Description: Climate and Climate Change Take-Away Points 1. Climate and weather prediction are completely different 2. Detecting climate change is very complex 3. X 4. The main greenhouse gas on Earth is water vapor 5. A little greenhouse effect is a good thing ...
Date Added: 2009-06-08 12:00:59

1832.txt
Path: UCCS >> CS >> 591 Fall, 2009
Description: Rule: - Sid: 1832 - Summary: This event is generated when activity relating to network chat clients is detected. - Impact: Policy Violation. Use of chat clients to communicate with unkown external sources may be against the policy of many organiz...
Date Added: 2009-06-08 12:04:39

Giffin.pdf
Path: Stanford >> BIOCHEM >> 230 Fall, 2009
Description: ...
Date Added: 2009-06-08 12:09:38

chapter01.ppt
Path: Kent State >> CS >> 10051 Fall, 2008
Description: Chapter1:AnIntroduction toComputerScience Invitation to Computer Science, C+ Version, Third Edition Objectives In this chapter, you will learn about: The definition of computer science Algorithms A brief history of computing Organization of the te...
Date Added: 2009-06-08 12:10:32

hw10.pdf
Path: Maryland >> CMSC >> 250 Fall, 2007
Description: hhw}vd3}vlhwQ}v} vvvQvqv}B}whd}~hw3 x ivh x} hBw}w}{~dihBw8}w1 DhwwHw s}~ Dgx hvw }hx}hv}xhshB3vx Dhww}w3UQhd }3hd}~} v iDhwwi}wf{hxw }wf vd{ h}...
Date Added: 2009-06-08 12:11:51

hw1.ps
Path: Minnesota >> STAT >> 8101 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: hw1.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMMI12 CMR8 CMSY10 CMSY8 CMMI8 %EndComments %DVIPSWebPage: (www.radicaleye.com) %...
Date Added: 2009-06-08 12:22:52

lab15.ps
Path: Minnesota >> STAT >> 3011 Fall, 2008
Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.92b Copyright 2002 Radical Eye Software %Title: lab15.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMR12 CMBX12 CMCSC10 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLi...
Date Added: 2009-06-08 12:23:02

TLCAN_completo.ppt
Path: Acton School of Business >> JCF >> 4702 Fall, 2009
Description: Tr at ado de L ibr e Comer cio de Amr ica del Nor t e [TL CAN] http:/veimages.gsfc.nasa.gov/16603/tree_cover_lrg.jpg Qu es TL CAN? http:/www.internationaleducationmedia.com/mexico/mexico_globe.jpg I nt r oduccin TL CAN = TL CAN (TL C) T Tr at ad...
Date Added: 2009-06-08 12:23:04

week_6_blackboard_examples.ppt
Path: Allan Hancock College >> WEEK >> 11118 Fall, 2009
Description: #C#week_6_blackboard_examples.ppt#`Z?~IVS ]kZ#cb#]Ja 0#dYbbkvv9mmm s ss r^{^sK @h I_#J#Y@s+2#A1#3#\\/#ePw#N# Csm!r #J#85 o #\\ph#44c xfd#i#7#/#_[3O#V`#Q# %P#JI * -# s#Fb#61{sim\'#O#ue#Z#Y#b#nE#4-\\W#gkW)y =.#o#*E)!Nx^/$;#6#y#;lBE#Bz\\ ...
Date Added: 2009-06-08 12:25:50

hw4s02sol.doc
Path: Wisconsin >> ECE >> 734 Fall, 2000
Description: June 1, 2009 Yu Hen Hu Department of Electrical and Computer Engineering University of Wisconsin Madison ECE 734 VLSI Array Structures for Digital Signal Processing Spring 2002 Homework #4 Solution This homework consists of questions taken from t...
Date Added: 2009-06-08 12:26:17

s98hw3.ps
Path: Wisconsin >> ECE >> 734 Fall, 2000
Description: %!PS-Adobe-2.0 %Creator: dvips 5.76 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: s98hw3.dvi %CreationDate: Thu May 7 16:27:35 1998 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMTI10 CMBX10 CMBX12 CMR10 H...
Date Added: 2009-06-08 12:26:18

Full_Avg_Depth.rtf
Path: Eastern Washington University >> CSCD >> 327 Fall, 2009
Description: Average Node Depth in a Full Binary Tree Timothy Rolfe In a completely full binary tree, the number of nodes (n) for a tree with height k is given by n = 2k+1 1. This defines n and k in the following discussion. To average the node depth, we simply ...
Date Added: 2009-06-08 12:26:30

Presentation.pdf
Path: Texas A&M >> TTH >> 4515 Fall, 2009
Description: Feature-Sensitive Motion Planning Terra Horton http:/parasol.tamu.edu/~tth4515 Motion Planning start The Basic concept of motion planning is to find a path that moves a robot (movable object) from a start configuration to a goal configuration with...
Date Added: 2009-06-08 12:28:31

lecture_6_08_text.doc
Path: Arizona >> PRES >> 517 Fall, 2009
Description: Lecture 6: A Primer on Relational Database Management Systems Introduction The last two lectures provided the conceptual foundation necessary for the construction and management of relational databases. Todays lecture begins the transition from conce...
Date Added: 2009-06-08 12:29:11

page178.pdf
Path: ECCD >> DOE >> 315 Fall, 2009
Description: 97.315 Course Notes Page 178 Winter 2001 The rotor flux can be estimated using N I R la R = - where is the effective magnetic circuit reluctance, N is the number of rotor windings, l is the slot length, a is the rotor diameter, and I R is the r...
Date Added: 2009-06-08 12:32:24

MAT1033_T4_Q10.pdf
Path: Fayetteville State University >> MAT >> 1033 Fall, 2009
Description: ...
Date Added: 2009-06-08 12:32:29

quiz8.pdf
Path: Michigan State University >> PHY >> 183 Fall, 2008
Description: ...
Date Added: 2009-06-08 12:33:14

ee2303Spring2007Q2Sol.pdf
Path: UT Arlington >> EE >> 2303 Fall, 2008
Description: ...
Date Added: 2009-06-08 12:34:51

HW15_09.ppt
Path: Texas A&M >> BAEN >> 673 Fall, 2008
Description: BAEN 673 / April 28, 2009 Announcements Today\'s topics HW#15 and 16 due HW#15 HW#16 End of year projects HW #15 SWAT Simulation of Sugar Creek Previous simulation (HW#13) nitrogen stress days very high Nitrogen stress days = 123 d...
Date Added: 2009-06-08 12:35:22

031grades.xls
Path: Cal Poly >> ACTG >> 031 Fall, 2009
Description: ACTG 322 A winter 2003 Ahave given B+ B BC+ C Cxyz C+ C BBB+ B B+ B B+ B+ B+ BB BB B CBC C B+ xyz AA AB B AB+ C B ABA A C 0.925 0.895 0.869 0.825 0.800 0.770 0.725 0.700 9999 0101 0592 1045 1209 1254 2958 3167 3280 3290 3389 3559 3756 3767 4257 4272...
Date Added: 2009-06-08 12:36:04

epstein_1973.pdf
Path: Auburn >> HDFS >> 8040 Fall, 2008
Description: ...
Date Added: 2009-06-08 12:37:40

ecen689-613-final-project.pdf
Path: Texas A&M >> ECEN >> 689 Fall, 2008
Description: ECEN 689-613: SP TP PROB GRAPHICAL MODELS, Spring`09 Final Project Final Project: Identification & Analysis of Gene Regulatory Network Due dates: Part-1 : Implementation of Pearl\'s inference algorithm for Bayesian Networks. Submission of progress...
Date Added: 2009-06-08 12:38:38

memory_fill_2.txt
Path: BYU >> ECE >> 224 Fall, 2008
Description: x00 0101 000 000 1 00000 - AND R0,R0,#0 x01 0001 001 000 1 00001 - ADD R1,R0,#1 x02 1001 011 001 111111 - NOT R3,R1 x03 0100 1 00000000100 - JSR x4 (+PC) x04 0000000000000011 - x3 x05 0000000000010010 - x12 x06 0000000000000011 - x3 x07...
Date Added: 2009-06-08 12:38:53

Get Started With Course Hero Today!

Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.

Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners.

Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs.

What People Are Saying About Course Hero

“I was going to fail my Evidence exam, but then I found a great outline on Course Hero!”
- Kim Cowan, Cornell University



“I worked for tens of hours on my chemistry lab reports this semester, and now I can publish my hard work to thousands of people who care to read about what I found.”
- David Grauer, Princeton University




“Many times, students learn best from other students, their peers, rather than from a teacher.  Course Hero provides such a forum for students to teach students.”
- Somerset Perry, Georgetown University


“Course Hero is a great new research tool for college students.  Students can find lots of pertinent information to their studies that they previously could not find or have access to.  It’s for sure an educational innovation and potentially an educational revolution.”
- Andy Suiter, UCLA and UC Davis



“As a freshman, Course Hero will help me to decide what I am actually interested in studying in college.”
- Caity Feindt, Ithaca College



“I have found lecture notes on corporate finance created by students from multiple schools, which has really helped me learn more about the subject.”
- John Stacey III, UCSB



“I study less and learn more with Course Hero.”
- John Sweazey, CU-Boulder



 

Explore the benefits of joining Course Hero's social learning network.

Get millions of study materials now!

Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!

Get over 200,000 textbook solutions now!

Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.

Meet over 300,000 students and your fellow classmates now!

Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!