Course Solutions And Notes - chapter01 a3
| s98hw3.ps Path: Wisconsin >> ECE >> 734 Fall, 2000 Description: %!PS-Adobe-2.0 %Creator: dvips 5.76 Copyright 1997 Radical Eye Software (www.radicaleye.com) %Title: s98hw3.dvi %CreationDate: Thu May 7 16:27:35 1998 %Pages: 2 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: CMTI10 CMBX10 CMBX12 CMR10 H... Date Added: 2009-06-08 12:26:18 |
| Full_Avg_Depth.rtf Path: Eastern Washington University >> CSCD >> 327 Fall, 2009 Description: Average Node Depth in a Full Binary Tree Timothy Rolfe In a completely full binary tree, the number of nodes (n) for a tree with height k is given by n = 2k+1 1. This defines n and k in the following discussion. To average the node depth, we simply ... Date Added: 2009-06-08 12:26:30 |
| Presentation.pdf Path: Texas A&M >> TTH >> 4515 Fall, 2009 Description: Feature-Sensitive Motion Planning Terra Horton http:/parasol.tamu.edu/~tth4515 Motion Planning start The Basic concept of motion planning is to find a path that moves a robot (movable object) from a start configuration to a goal configuration with... Date Added: 2009-06-08 12:28:31 |
| lecture_6_08_text.doc Path: Arizona >> PRES >> 517 Fall, 2009 Description: Lecture 6: A Primer on Relational Database Management Systems Introduction The last two lectures provided the conceptual foundation necessary for the construction and management of relational databases. Todays lecture begins the transition from conce... Date Added: 2009-06-08 12:29:11 |
| page178.pdf Path: ECCD >> DOE >> 315 Fall, 2009 Description: 97.315 Course Notes Page 178 Winter 2001 The rotor flux can be estimated using N I R la R = - where is the effective magnetic circuit reluctance, N is the number of rotor windings, l is the slot length, a is the rotor diameter, and I R is the r... Date Added: 2009-06-08 12:32:24 |
| MAT1033_T4_Q10.pdf Path: Fayetteville State University >> MAT >> 1033 Fall, 2009 Description: ... Date Added: 2009-06-08 12:32:29 |
| quiz8.pdf Path: Michigan State University >> PHY >> 183 Fall, 2008 Description: ... Date Added: 2009-06-08 12:33:14 |
| ee2303Spring2007Q2Sol.pdf Path: UT Arlington >> EE >> 2303 Fall, 2008 Description: ... Date Added: 2009-06-08 12:34:51 |
| HW15_09.ppt Path: Texas A&M >> BAEN >> 673 Fall, 2008 Description: BAEN 673 / April 28, 2009 Announcements Today\'s topics HW#15 and 16 due HW#15 HW#16 End of year projects HW #15 SWAT Simulation of Sugar Creek Previous simulation (HW#13) nitrogen stress days very high Nitrogen stress days = 123 d... Date Added: 2009-06-08 12:35:22 |
| 031grades.xls Path: Cal Poly >> ACTG >> 031 Fall, 2009 Description: ACTG 322 A winter 2003 Ahave given B+ B BC+ C Cxyz C+ C BBB+ B B+ B B+ B+ B+ BB BB B CBC C B+ xyz AA AB B AB+ C B ABA A C 0.925 0.895 0.869 0.825 0.800 0.770 0.725 0.700 9999 0101 0592 1045 1209 1254 2958 3167 3280 3290 3389 3559 3756 3767 4257 4272... Date Added: 2009-06-08 12:36:04 |
| epstein_1973.pdf Path: Auburn >> HDFS >> 8040 Fall, 2008 Description: ... Date Added: 2009-06-08 12:37:40 |
| ecen689-613-final-project.pdf Path: Texas A&M >> ECEN >> 689 Fall, 2008 Description: ECEN 689-613: SP TP PROB GRAPHICAL MODELS, Spring`09 Final Project Final Project: Identification & Analysis of Gene Regulatory Network Due dates: Part-1 : Implementation of Pearl\'s inference algorithm for Bayesian Networks. Submission of progress... Date Added: 2009-06-08 12:38:38 |
| memory_fill_2.txt Path: BYU >> ECE >> 224 Fall, 2008 Description: x00 0101 000 000 1 00000 - AND R0,R0,#0 x01 0001 001 000 1 00001 - ADD R1,R0,#1 x02 1001 011 001 111111 - NOT R3,R1 x03 0100 1 00000000100 - JSR x4 (+PC) x04 0000000000000011 - x3 x05 0000000000010010 - x12 x06 0000000000000011 - x3 x07... Date Added: 2009-06-08 12:38:53 |
| 094-LARx.pdf Path: Arizona >> SCHEDULE >> 094 Fall, 2009 Description: Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # Crs. # (units) Call # Sec # Course/Section Title Time Days Instructor Bldg. Room # LANDSCAPE ARCHITECTURE (LAR ) Ronald R. Stoltz, Director, 1040 N. Olive Road... Date Added: 2009-06-08 12:57:21 |
| resume.doc Path: Lehigh >> SEN >> 209 Fall, 2009 Description: SarahElizabethNearhood School: Box F595 | 39 University Drive | Bethlehem, PA | 18015-3041 Phone: (610) 974-0745 Cell Phone: (814) 931-6264 E-mail: sen209@lehigh.edu Home: 515 East Penn Ave. | Altoona, PA | 16601 Phone (814) 946-1116 Objective: To ob... Date Added: 2009-06-08 12:57:23 |
| E172HW1.pdf Path: Harvey Mudd College >> E >> 172 Fall, 2009 Description: ... Date Added: 2009-06-08 13:15:16 |
| 2005_MVRDV Keithley.pdf Path: Acton School of Business >> ARCH >> 316 Fall, 2008 Description: Clint Keithley ARCH 516 / Fall 2005 Professor Mark Oberholzer WINDMILLS RAIN FLOOR FOREST POTS GLASS HOUSE DUNES OFFICES The Dutch Pavilion for the EXPO 2000 in Hannover, Germany is MVRDVs prototype for better living in an increasingly densely po... Date Added: 2009-06-08 13:16:07 |
| resume.pdf Path: Penn State >> GMB >> 5026 Fall, 2009 Description: GINA M. BARTOLACCI EDUCATION Penn State Smeal College of Business Bachelor of Science in Finance Liberal Arts Minor in Spanish High School 4.0/4.0 GPA 8 AP credits University Park, PA Anticipated May 2010 Anticipated May 2010 Newtown, PA 2002-200... Date Added: 2009-06-08 13:23:32 |
| table15worldsupplyanduse.xls Path: Cornell >> ERS >> 89004 Fall, 2009 Description: Appendix table 15-World cotton supply and use, 1965/66-2005/06 Year beginning Harvested Beginning August 1 area Yield stocks Million ha Kg/ha 1965 1966 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 198... Date Added: 2009-06-08 13:25:00 |
| trees_1022.pdf Path: UNC >> LING >> 101 Fall, 2008 Description: Trees from M Oct 22 lecture (1) Declarative sentence, with an AP modifier in the subject NP Now we assume that every sentence (IP) has a surrounding CP, with Q in C (2) The yes-no question corresponding to (1) The Inversion rule has applied (3) ... Date Added: 2009-06-08 13:25:31 |
| Quiz4-Version2.pdf Path: Kentucky >> MA >> 162 Fall, 2008 Description: MA 162 Finite Mathematics Recitation Quiz 4 Name Date: April 7, 2005 Please answer all questions completely. Be sure to write neatly so that your solution may be read as you intended it to be read. Partial credit will be awarded if work is shown. 1... Date Added: 2009-06-08 13:27:28 |
| 211s10.pdf Path: ASU >> MATH >> 211 Fall, 2009 Description: MAT 211 Written Homework #10 8.3, 8.4, 8.5 SOLUTIONS Due: April 17, 2009 Solve the following problems, showing any necessary work. If the nal answer is short, you should circle or box it. 1. A fair coin is tossed three times. Let A be the event hea... Date Added: 2009-06-08 13:27:33 |
| 91.txt Path: Rutgers >> MLIS >> 551 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>a376e5746ee79f250226ca016fa72cabc8639cd8.txt</Key><RequestId>E8CD7FB0FE093783</RequestId><HostId>Pc1kFdvNKvXdRJO5v6DGjhO3enWI... Date Added: 2009-06-08 13:28:14 |
| doc00001.doc Path: Los Angeles Southwest College >> MISC >> 0507 Fall, 2009 Description: Meeting Report for the Hypoxia Response Workshop Baruch Institute Kimbel Center, Georgetown, South Carolina July 7, 2005 Summary of Discussion: To follow up on the Long Bay Hypoxia Study workshop that was held on June 14th, 2005, a second workshop wa... Date Added: 2009-06-08 13:29:59 |
| AcadAffPSFA.pdf Path: San Diego State >> GENFUND >> 0506 Fall, 2009 Description: San Diego State University 2005-06 General Fund Budget Academic Affairs COLLEGE OF PROFESSIONAL STUDIES & FINE ARTS SALARIES ACADEMIC FACULTY ACADEMIC NON-FACULTY MANAGEMENT SUPPORT STAFF TEMPORARY HELP STUDENT ASSISTANT OVERTIME 198.2 5.2 4.0 45.8 1... Date Added: 2009-06-08 13:30:57 |
| Exam1.pdf Path: East Carolina >> GEOG >> 1020 Fall, 2009 Description: Study Guide for Exam#1 Spring 2006 Terminology: Geomorphology System Equilibrium Feedback mechanism Sima Sial Asthenosphere Lithosphere Mineral Fractional crystallization Igneous extrusive rocks (know examples) Igneous intrusive rocks (know examples)... Date Added: 2009-06-08 13:31:53 |
| wsref.pdf Path: Clemson >> WS >> 301 Fall, 2009 Description: Elisa Kay Sparks Department of English Clemson University February 10, 1998 Getting Started: Bibliography, Reference, and Periodicals in Women\'s Studies CUL designates Clemson call number EKS = I own a copy JMM = Judy Melton owns a copy yReference ... Date Added: 2009-06-08 13:32:52 |
| NM8_board_stud.pdf Path: UF >> LECT >> 3421 Fall, 2009 Description: CGN 3421 - Computer Methods Gurley Numerical Methods Lecture 8 Due to poor attendance in lecture, I will be using the board for most of the rest of the year. I may not post any additional notes, so show up if you want the material. Numerical Metho... Date Added: 2009-06-08 13:33:42 |
| Objectives_Ch_18.pdf Path: Roanoke >> CHEM >> 112 Fall, 2009 Description: Objectives for Ch 18 Acid Base Reactions When we finish this chapter, you should be able to know or do the following. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. Explain the meaning of equivalence point Give the balanced chemical equation for any acid... Date Added: 2009-06-08 13:34:09 |
| Carroll-When-Business-Closes-Down.pdf Path: Marshall >> LE >> 691 Fall, 2008 Description: ... Date Added: 2009-06-08 13:40:49 |
| Goal seek.xls Path: CSU Long Beach >> IS >> 602 Fall, 2009 Description: Subject Score Credit Units GPA English Math History Science Average GPA 85 71 92 62 3 3 3 3 3 2 4 1 2.5 SUMMARY OUTPUT Regression Statistics Multiple R R Square Adjusted R Square Standard Error Observations ANOVA df Regression Residual Total 1 18 19... Date Added: 2009-06-08 13:43:08 |
| KnopfLiteratureReviewPS07.pdf Path: WVU >> PS >> 300 Fall, 2009 Description: Doing a Literature Review Jeffrey W. Knopf, Naval Postgraduate School entering a graduate program S tudentsdiffers fromnew papers they often encounter a type of assignment that the had to write in high school or as college undergraduates: the litera... Date Added: 2009-06-08 13:43:50 |
| Huydecoper - liccur-eng.doc Path: East Los Angeles College >> LW >> 786 Fall, 2009 Description: <?xml version=\"1.0\" encoding=\"UTF-8\"?> <Error><Code>NoSuchKey</Code><Message>The specified key does not exist.</Message><Key>a31afb2bd4589300794f20c67632d2955b962774.doc</Key><RequestId>C 822E2B3FA71E1EE</RequestId><HostId>mIk4ZbLewivmOmenFt2/NKavW4N... Date Added: 2009-06-08 13:44:10 |
| Class07.pdf Path: Ill. Chicago >> SDIXON >> 415 Fall, 2009 Description: Oct27LectureClassAssignment6: CascadingStyleSheetsI divandspantags pp153156 Usedinthecreationofcustomtagelements.The<div></div>tagisforblockelements,and the<span></span> forinlineelements.UsedinconjunctionwithCSSidandclass attributesdiscussedonlater... Date Added: 2009-06-08 13:45:39 |
| hw1_solution.doc Path: FIU >> TCN >> 4211 Fall, 2008 Description: Problem 2. a) A circuit-switched network would be well suited to the application described, because the application involves long sessions with predictable smooth bandwidth requirements. Since the transmission rate is known and not bursty, bandwidth ... Date Added: 2009-06-08 13:50:20 |
| bat.txt Path: Berkeley >> ASTRO >> 00020096 Fall, 2009 Description: 1e-05 1e-05 1 1 ... Date Added: 2009-06-08 13:54:12 |
| fin-practice1-sol.pdf Path: Cornell >> CS >> 280 Fall, 2003 Description: CS 280, Final, solutions December 16, 1999 1. a) i) tautology, ii) not, by truth tables b) (p q r) (p q r) c) No. Every proposition built from , is false when the atoms are all false. 2. a) i) Everybody loves somebody. ii) If somebody loves ... Date Added: 2009-06-08 13:54:16 |
| GrundyTnlRegRev.pdf Path: University of Hawaii - Hilo >> MICRO >> 671 Fall, 2009 Description: Critical Reviews in Biochemistry and Molecular Biology, 41:329338, 2006 Copyright c Informa Healthcare ISSN: 1040-9238 print / 1549-7798 online DOI: 10.1080/10409230600914294 From Ribosome to Riboswitch: Control of Gene Expression in Bacteria by RNA... Date Added: 2009-06-08 13:54:44 |
| GroupA3PDR9.pdf Path: Oakland University >> ME >> 463 Fall, 2009 Description: Human Powered Potable Water Still ASME Design Contest HOME BREW WATER CREW John Cogill Nick Puglisi Blake Shelide Jesse Batsche Project Status Current Phase: Virtual Model, Prototype Development and Construction Beginning Documentation Upcoming ... Date Added: 2009-06-08 13:56:57 |
| James.pdf Path: Stanford >> ERE >> 1979 Fall, 2009 Description: I R E I N J E C T I O N STRATEGY @ Russell James, D.S.I.R., Wairakei ABSTRACT Because of t h e complexity of underground conditions within a geothermal r e s e r v o i r , r e i n j e c t i o n is d i f f i c u l t t o explain s c i e n t i f i c... Date Added: 2009-06-08 13:59:26 |
| Permeable pavements.ppt Path: UConn >> CE >> 254 Spring, 2008 Description: A Guide to the Use and Performance of Permeable Pavements N. W. Garrick K. A. Brown Overview Porous Pavements Types Applications Locations Types of Porous Pavements Plastic lattices Open-jointed paving blocks Open celled paving grids Por... Date Added: 2009-06-08 14:03:27 |
| HW 9 Solution NenerPlante1.doc Path: UConn >> CE >> 254 Spring, 2008 Description: CE 2710 Transportation Engineering Homework 9 Solution 1. Please see the below calculation (R = 200m, = 20, BC @ Sta. 12 + 00 m): 5730 5730 D= = = 8.7347 R 200m 3.28 ft m 100 100 ft 20 L= = = 228.97 ft = 69.8m D 8.7347 EC = BC + L = ( Sta. 12 + 00... Date Added: 2009-06-08 14:03:33 |
| tex101.pdf Path: Texas A&M >> M >> 401 Fall, 2009 Description: TEX 101 Typing Mathematical Expressions A The TEX system created by Donald Knuth, along with its derivatives such as L TEX, has become the standard means of producing documents and books in mathematics, physics, and some other elds. (Crudely speaking... Date Added: 2009-06-08 14:03:52 |
| finalsol.pdf Path: Texas A&M >> M >> 412 Fall, 2009 Description: Math. 412 Final Examination Solutions 9 December 2005 Calculators may be used for simple arithmetic operations only! Some possibly useful information Laplacian operator in polar coordinates: 2 2 2 u = u + 1 u + 1 u . r r r 2 r 2 2 Laplacian ope... Date Added: 2009-06-08 14:04:22 |
| 5_4_3r.txt Path: Texas A&M >> M >> 311 Fall, 2009 Description: Math. 311 Fall 1996 HOMEWORK SUMMARY REPORT Week number: 8 Problem number: 5.4.3 Number of ... Date Added: 2009-06-08 14:05:02 |
| 8_1_1r.txt Path: Texas A&M >> M >> 311 Fall, 2009 Description: Math. 311 Fall 1996 HOMEWORK SUMMARY REPORT Week number: 13 Problem number: 8.1.1 Number of papers received: 2 Reviewing committ... Date Added: 2009-06-08 14:05:15 |
| QoD_paper_Mattes_-_Gyimah_Boadi.pdf Path: Stanford >> PUBS >> 20442 Fall, 2009 Description: Robert Mattes and E. Gyimah-Boadi The Quality of Two Liberal Democracies in Africa: Ghana and South Africa Paper Presented at Conference On \"The Quality of Democracy: Improvement of Subversion?\" Centre on Democracy, Development and Rule of Law and ... Date Added: 2009-06-08 14:05:23 |
| lec6.ppt Path: UCF >> EEL >> 4767 Fall, 2009 Description: The 68HC11 Microcontroller Chapter 6: Interrupts and Resets The 68HC11 Microcontroller 6-1 The 68HC11 Microcontroller Basics of Interrupts What is an interrupt? An unusual event that requires the CPU to stop normal program execution and perform ... Date Added: 2009-06-08 14:08:03 |
| Request.doc Path: Penn State >> LMH >> 300 Fall, 2009 Description: Request For A New Application Date Submitted: November 14, 2006 Submitted by: Logan Harding Purpose: Develop an application that can display the value the U.S. dollars in euros and pounds. Application Title: Algorithms: Logans Currency Converter U.S.... Date Added: 2009-06-08 14:08:21 |
| PHYS490_HW6.pdf Path: Purdue >> PH >> 241 Fall, 2009 Description: Home Work 6 Physics 490 Special Nuclear Materials (1) Finish Reading the report World at Risk, page 65 through 112. We will be discussing in detail Recommendation 12 and the Recommendation on page 111, on Tuesday, March 24. We will have a short, in c... Date Added: 2009-06-08 14:20:32 |
| session39.pdf Path: Purdue >> EE >> 648 Spring, 2001 Description: ... Date Added: 2009-06-08 14:21:13 |
| baranowski-essay02.pdf Path: Purdue >> MATH >> 315 Fall, 2009 Description: ELISA BARANOWSKI MA 315 SEPTEMBER 6, 2000 ASSIGNMENT 2 First of all I want to address the mathematical activities of a mathematician. After reading The Ideal Mathematician by Davis and Hersh (pages 34-43), I understand more about what mathematicians... Date Added: 2009-06-08 14:24:45 |
| agenda20060817b.pdf Path: Arkansas >> DEPTS >> 20060817 Fall, 2009 Description: ATTACHMENT B UNIVERSITY OF ARKANSAS GRADUATE SCHOOL GRADUATE FACULTY APPLICATION (Please type or print. Submit a vitae or resume with application.) 1. Group: for office use only Name__ (Last) (First) (MI) Date of Birth (mm/dd/yyyy):_ Identificatio... Date Added: 2009-06-08 14:27:27 |
| l1.ppt Path: Duke >> X >> 214 Spring, 2009 Description: Computer Networks 15744 Spring 2007 January 17, 2006 www.cs.cmu.edu/~dga/15 744/S07 Logistics Target class size: 24 # people registered: 29 # people on waitlist: 29 So: Please sign roll sheet today & Monday! But: If you\'re not a Ph.D. st... Date Added: 2009-06-08 14:32:34 |
| 29213.pdf Path: Doane >> LAR >> 15733 Fall, 2009 Description: ... Date Added: 2009-06-08 14:36:11 |
| Colloq09Brochure1-21-09B%2B.pdf Path: UNC >> READ >> 5000769 Fall, 2009 Description: On April 24, 2009 The National Guardianship Association Presents A Colloquium on Guardianship Hilton Charlotte University Place, Charlotte, North Carolina The Ethics of Our Decisions: Avoiding the Danger Zones Thursday, April 23, 2009 - Colloquium ... Date Added: 2009-06-08 14:39:29 |
| Practicum_Experience_Paper.pdf Path: Wisc Stevens Point >> JNASS >> 074 Fall, 2009 Description: Practicum Experience Prior to the Education 351 course, I was unaware of many aspects of teaching students with disabilities. I was familiar with the variety of disabilities; however, I did not realize the importance of detailed instructions, modific... Date Added: 2009-06-08 14:41:11 |
| hack_guide_v2.pdf Path: Georgia Tech >> ECE >> 4100 Fall, 2008 Description: SimpleScalar Hackers Guide (for tool set release 2.0) Todd Austin info@simplescalar.com SimpleScalar LLC SimpleScalar LLC SimpleScalar Hackers Guide Todd Austin Tutorial Overview Computer Architecture Simulation Primer SimpleScalar Tool Set Ove... Date Added: 2009-06-08 14:44:16 |
| composites_3_feb_2003.pdf Path: Stanford >> SLAC >> 030203 Fall, 2009 Description: Composite Candidate issues 1 Composite Candidate issues Mario Bondioli 3 February 2003 Composite Candidate issues 3 February 2003 Mario Bondioli Reasons for composite storage in new-micro There are some arguments that suggest composite candidat... Date Added: 2009-06-08 14:49:27 |
| 2009331_o01c_091414.pdf Path: Stanford >> OPCAX >> 1042 Fall, 2009 Description: 1 BERMAN DEVALERIO Nicole Lavallee (No. 165755) 2 425 California Street, Suite 2100 San Francisco, California 94104 3 Telephone: (415) 433-3200 Facsimile: (415) 433-6382 4 nlavallee@bermandevalerio.com C kj ry ORIGINAL FALE0 ( ` MAR 3 I 200q RICHAR... Date Added: 2009-06-08 14:51:17 |
| CEM352_Exam_3_Key.pdf Path: Michigan State University >> SS >> 352 Fall, 2009 Description: ... Date Added: 2009-06-08 15:23:41 |
| cvsman1.ps Path: Duke >> X >> 108 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: groff version 1.09 %CreationDate: Mon Feb 5 09:41:07 1996 %DocumentNeededResources: font Times-Roman %+ font Times-Bold %+ font Times-Italic %DocumentSuppliedResources: procset grops 1.09 0 %Pages: 17 %PageOrder: Ascend %Orie... Date Added: 2009-06-08 15:25:52 |
| ch5.ppt Path: UF >> CEN >> 3031 Fall, 2008 Description: Project management Ian Sommerville 2004 Software Engineering, 7th edition. Chapter 5 Slide 1 Objectives q q q q q To explain the main tasks undertaken by project managers To introduce software project management and to describe its distinctiv... Date Added: 2009-06-08 15:26:13 |
| slides10u.ps Path: Duke >> X >> 108 Fall, 2009 Description: %!PS-Adobe-3.0 %Title: (slides10.ppt) %Creator: (Microsoft PowerPoint: LaserWriter 8 8.1.1) %CreationDate: (12:10 AM Friday, September 26, 1997) %For: (owen) %Pages: 4 0 %DocumentFonts: Palatino-Bold Helvetica-Bold Courier-Bold ZapfDingbats %Document... Date Added: 2009-06-08 15:26:32 |
| slides17.ppt Path: Duke >> X >> 108 Fall, 2009 Description: From C+ to Java q q Javahistory:Oak,toasterovens,internetlanguage,panacea Whatitis OOlanguage,notahybrid(cf.C+) compiledtobytecode,executedonJVM bytecodeishighlyportable,writeoncerunanywhere simple,objectorientd,portable,interpreted,robust,secure... Date Added: 2009-06-08 15:26:37 |
| scores.txt Path: Duke >> X >> 149 Fall, 2009 Description: * Final Standings * Contest started at 21:29 GMT Key: #attempts/elapsed time HH:MM until solved Division I Rank Team Probs Pnlty Prob 0 Prob 1 Prob 2 Prob 3 Prob 4 Prob 5 -- 1 3 4 332 1/00:43 1/00:18 1/00:00 2/02:19 1... Date Added: 2009-06-08 15:27:12 |
| IC220_S09_Set17_Ch5.pdf Path: Naval Academy >> IC >> 220 Spring, 2009 Description: ADMIN Reading finish Chapter 5 Sections 5.4 (skip 511-515), 5.5, 5.11, 5.12 IC220 Set #17: Caching Finale and Virtual Reality (Chapter 5) 1 2 Cache Performance Simplified model: execution time = (execution cycles + stall cycles) cycle time =... Date Added: 2009-06-08 15:34:24 |
| Fish.pdf Path: Idaho >> AGECON >> 40403 Fall, 2009 Description: Fisheries Ward: Environmental and Natural Resource Economics 2006 Pearson Education, Upper Saddle River, NJ 07458. All Rights Reserved 1 The Problem History: 3 important points Long history (fig. 12-1) US history Fish provide the world\'s only... Date Added: 2009-06-08 15:35:34 |
| 3013-mt1-S2008s.pdf Path: Oklahoma State >> MATH >> 3013 Fall, 2008 Description: Math 3013 SOLUTIONS TO FIRST EXAM February 22, 2008 1. (5 pts each) Give the precise definitions of the following mathematical notions: (a) the span of a set of vectors The span of a set {v1 , . . . , vk } of vectors in Rn is the set span (v1 , . . .... Date Added: 2009-06-08 15:45:17 |
| switchgrass.doc Path: Iowa State >> MR >> 0323 Fall, 2009 Description: Des Moines Register 03-18-07 Targets pin corn at $35 a ton to produce; switchgrass is at $50. By PHILIP BRASHER REGISTER WASHINGTON BUREAU Washington, D.C. - Some Iowa farmers already know what it takes to grow crops like switchgrass for energy, and ... Date Added: 2009-06-08 15:45:55 |
| hw7.doc Path: DePaul >> HCI >> 201 Fall, 2009 Description: Web Site Evaluation: Find and critique a personal website Find a personal website online using a search engine. Business sites are not allowed. A good way to find personal websites is by searching the Hobbies section of Yahoo, or typing in \"personal ... Date Added: 2009-06-08 15:50:16 |
| Area34_Map1_2007_scores.pdf Path: UMKC >> MAPARCHIVE >> 0607 Fall, 2009 Description: BALTIMORE WORNALL ! 126TH STATE LINE OAKMONT ACCESS ROAD PRIVATE ST AN DR E TAM-O-SHANTER Area 34 - Martin City 12 8T Map 1 H W 127TH 127TH G BI LOCUS T EE CG UP RR (Union Pacific Railroad) ! UE BL 7 2100 BLUE RIDGE New Life In Christ C... Date Added: 2009-06-08 15:54:18 |
| forging.pdf Path: Iowa State >> ME >> 324 Fall, 2009 Description: 5.5.1 Tensile vs. Compressive Deformation The equations for nominal stress, nominal strain, true stress and true strain in compression are the same as introduced earlier for tension. Defining true strain as below removes the complication of +ive and ... Date Added: 2009-06-08 15:54:37 |
| H39.pdf Path: UMKC >> MAPARCHIVE >> 0607 Fall, 2009 Description: N B R UN T BLVD Antioch LADPs Map - KC Parkville Core Urban Occupancy status our2.0 Housing Occupied i River Vacant Nearman 2.7 Underutilization Indust. Riverside Wyandotte Nearman Hills Chouteau Briarcliff Co. Lake N Quindaro Fairfax Bluffs Indust.... Date Added: 2009-06-08 15:54:37 |
| 345 Slides Heuristics.doc Path: Washington >> FACULTY >> 345 Fall, 2009 Description: a3476a1d2988ffbce3f3e498f8b1f3e708a54b83.doc 1 a3476a1d2988ffbce3f3e498f8b1f3e708a54b83.doc Slide 1 Cognitive Heuristics _ Efficient problemsolving strategies that generally yield accurate solutions __ _ _ _ _ _ Slide 2 The Representativeness... Date Added: 2009-06-08 15:54:58 |
| surfrun.txt Path: Arizona >> GEOS >> 581 Fall, 2008 Description: basis { data surfwusnp.txt: tab transform surfrule.txt meta surfmeta.txt: tab } sample { data montezum.txt: napd-ascii transform napdrule.txt } distance squared_chord report { name surface.out: tab closest 10 meta all } verbose ... Date Added: 2009-06-08 15:55:52 |
| m371tx.txt Path: East Los Angeles College >> M >> 371 Fall, 2009 Description: 106 311 5094 Actual line C:\\My Documents\\Miao\\Concordance\\TextFromClipboard-File1.txt 18/11/2001 17:38:08 Program copyright (c) R.J.C. Watt 1998. All rights reserved. -ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz A-SHE 67 1 6 a-she. ... Date Added: 2009-06-08 15:55:59 |
| week04-2.ppt Path: Fayetteville State University >> COP >> 4610 Fall, 2009 Description: Outline Device Management Device Drivers I/O Strategies Polling vs. interrupt-driven I/O Device Manager Design Buffering Optimizing Access for Rotating Devices Device Management in Linux Announcements We are going to have a quiz at the en... Date Added: 2009-06-08 16:24:56 |
| u010406a.pdf Path: UF >> U >> 010406 Fall, 2009 Description: CNS /Update Newsletter Feature NERDC\'s Bob Smith Retires After 38 Years CNS Document ID: u010406a Last Updated: 4/2/01 UF Computing & Networking Services 112 Bryant Space Sciences Bldg, University of Florida P.O. Box 112050 Gainesville Florida 3261... Date Added: 2009-06-08 16:32:21 |
| 1452.pdf Path: USF >> LIT >> 1400 Fall, 2009 Description: Donatello, said Miriam anxiously, as they came through the Piazza Barberini, what can I do for you, my beloved friend? You are shaking as with the cold fit of the Roman fever. Yes, said Donatello; my heart shivers. As soon as she could collect her th... Date Added: 2009-06-08 16:33:05 |
| q8.doc Path: UNI >> CS >> 051 Fall, 2009 Description: Quiz #8 Name: Suppose that you have defined: phrase = Its Friday! What are the results of invoking the following commands? 1. len(phrase) 2. phrase[ 1 ] 3. phrase[ 6 : 9 ] 4. phrase[ : 3 ] 5. phrase[ -1 ] Quiz #8 Name: Suppose that you have defi... Date Added: 2009-06-08 16:38:31 |
| lab14checkoff.doc Path: UNI >> CS >> 051 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|11 May 2009 15:43:19 -0000 vti_extenderversion:SR|5.0.2.6790 vti_author:SR|BEN-SCHAFER\\schafer vti_modifiedby:SR|BEN-SCHAFER\\schafer vti_timecreated:TR|31 Mar 2008 18:11:27 -0000 vti_title:SR|1-1 Create... Date Added: 2009-06-08 16:38:37 |
| plate4x4.ps Path: Allan Hancock College >> MULT >> 3004 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: plate4x4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -... Date Added: 2009-06-08 16:39:04 |
| Chapter 18.pdf Path: UCSB >> MATH >> 115 Fall, 2009 Description: ... Date Added: 2009-06-08 16:39:46 |
| Chapter 10 Version 2.pdf Path: UVA >> ECON >> 302 Fall, 2008 Description: Chapter 10: An Intertemporal Model with Money Definitions of Money Money Supply (money creation) The Demand for Financial Assets (Portfolio decisions) Money Demand Money Market Equilibrium Inflation 1 3 Roles of Money Medium of exchange: Mo... Date Added: 2009-06-08 16:41:32 |
| Emerson poetry.doc Path: SUNY Cortland >> AED >> 404 Fall, 2009 Description: Haiku Examples 1. Pulling at his sleeve Tugging, stretching, begging Daddys little boy. 2. Blowing in the wind summer breeze swept him away she struggles but stands. 3. Life as a candle burning wick and sweating wax set in a glass jar 4. Runn... Date Added: 2009-06-08 16:42:18 |
| Review chapters 1 and 2.doc Path: TCU >> FACULTY >> 2312 Fall, 2009 Description: Keith & Haag Chapter 1: Ideas, People, and Economics in Texas Politics Below are actual multiple choice questions from this chapter that I may ask on the exam, minus the options. Do the best you can to look up and know the following topics. During th... Date Added: 2009-06-08 16:42:41 |
| hw1_solution.doc Path: FIU >> EEL >> 5718 Fall, 2008 Description: Problem 2. a) A circuit-switched network would be well suited to the application described, because the application involves long sessions with predictable smooth bandwidth requirements. Since the transmission rate is known and not bursty, bandwidth ... Date Added: 2009-06-08 16:44:43 |
| Conversion_Table.pdf Path: SUNY Purchase >> CS >> 270 Fall, 2009 Description: Conversion Table Let A ={xU | p}, B ={xU | q}. Set Operations & Relations Logical Operators A B A B A B ~A A= B A B pq p q p q p pq p q ... Date Added: 2009-06-08 16:44:47 |
| cs837_lec07_stereo.pptx Path: UWO >> CS >> 9837 Fall, 2009 Description: Multiple View Geometry Martin Quinn .with many illustrations from Hartley and Zisserman \"Multi View Geometry\". A number of slides are stolen from Alexei Efros, Steve Seitz, and Jianbo Shi Yuri Boykov, UWO Why do we have two eyes? Cyclope vs. O... Date Added: 2009-06-08 16:51:22 |
| COEN-243-UA-Assignment 22.xls Path: Contra Costa College >> COEN >> 243 Fall, 2009 Description: Sheet1 Student List Assignment 2 Course Name : COEN 243/2 U In Ac. Year 2007-2008 session Student IDLast NameFirst NameQ1Q2Q3Q4Q5Total 3740803AL KADAMANIKAIS 6139108CHAUDRYBABAR2020202020100 6019544DAHERELIE2020202020100 6187765DUBEGUILLAUME202020202... Date Added: 2009-06-08 16:51:45 |
| 1998.pdf Path: Tennessee >> TEST >> 320 Fall, 2009 Description: TEST 1 STAT 320 Fall 1998 Name_ Instructions: Show all work for partial credit. Mark your answers clearly. Each question is worth 10 points. Use the output included in the back of the test to answer the following questions regarding Case 18 on p. 25.... Date Added: 2009-06-08 16:53:09 |
| sa1.pdf Path: SUNY Canton >> IT >> 501 Fall, 2009 Description: | tv !pd#x !dpd#se#pde9f~zerwevw#up!dpd#r hv g tv r vx oxv r k t f o x tx o xy r |v g tv r tr m v t t r f gx t v g | o v x rf r y us5x0dpv3vE!epvdurt y d#su3Vexo 9x v g x tv x t rf x r o x vx r v g tv r x x q g ty o m vk h ... Date Added: 2009-06-08 16:54:43 |
| Ochsner_TD_BU_in_press.pdf Path: Columbia >> KO >> 2132 Fall, 2009 Description: Manuscript under review for Psychological Science r Fo Re vi ew On ly Page 1 of 26 Manuscript under review for Psychological Science 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 ... Date Added: 2009-06-08 16:54:58 |
| Quiz 8 sample problems.doc Path: Oregon State >> BA >> 340 Fall, 2008 Description: Capital Structure Questions: Problem 1, page 80 in the class packet. 1. Briefly explain the terms, \"capital structure\" and \"optimal capital structure\". Answer: Capital Structure: The mix (or proportions) of long-term financing sources: debt, preferre... Date Added: 2009-06-08 16:56:19 |
| multreg3.pdf Path: Idaho >> STAT >> 401 Summer, 2008 Description: 1 Regression diagnostics: residual analysis Recall from Chapter 8 that the residuals E in the multiple regression model Y = 0 + 1 X1 + . + k Xk + E should 1) be independent, 2) have a mean of 0, 3) have a common variance 2 , and 4) have a normal d... Date Added: 2009-06-08 17:01:30 |
| Measures_Variability_Lab.doc Path: UNC >> SOCI >> 052 Spring, 2009 Description: Measures of Variability Lab Lab Objective: The objectives of this lab are: Learn to calculate measures of variability in SPSS. Learn to use box plots in SPSS. Learn to use measures of variability to evaluate a research question. Directions: Use th... Date Added: 2009-06-08 17:02:53 |
| March01agenda.pdf Path: SUNY Buffalo >> VPAA >> 0001 Fall, 2009 Description: March 20, 2001 Agenda I. Announcements II. Approval of the January meeting minutes III. Dr. Kerry Grant, Vice Provost for Academic Affairs, Dean of the Graduate School IV. Combined Degree Proposal BS/MS Architecture V. Curriculum Changes 1. Occupati... Date Added: 2009-06-08 17:05:08 |
| control2.pdf Path: Washington University in St. Louis >> CS >> 520 Fall, 2009 Description: Chenyang Lu Feedback Control Theory (II) from Computer System\'s Perspective CS/CoE 520S Misc Project System environment Workload/benchmarks Keep working on it every week Prof. Chenyang Lu 9/24/2003 9/24/2003 1 9/24/2003 2 Outline Introd... Date Added: 2009-06-08 17:05:17 |
| LTL-cost temp.xls Path: Iowa State >> TRLOG >> 462 Fall, 2009 Description: Information Sheet (LTL costing) Pickup Time Distance Dock time Time Distance Dock time Time Distance PUD Tractor PUD Trailer LH Tractor LH Trailer PUD Tractor PUD Trailer LH Tractor LH Trailer PUD LH hrs miles hrs hrs miles hrs hrs miles per day per ... Date Added: 2009-06-08 17:05:31 |
| EB403_L4_v2.pdf Path: East Los Angeles College >> EB >> 403 Fall, 2009 Description: Overview of this session EB 403: Introduction to Accounting and Finance Lecture 4 Necessary adjustments: Stock, depreciation, accruals and bad debts 2:00 - 4:00pm Dr Svetlana Warhurst, Lecturer School of Entrepreneurship and Business University of Es... Date Added: 2009-06-08 17:05:49 |
| homework4.ps Path: Georgia Tech >> CS >> 6290 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.526a Copyright 1986, 1993 Radical Eye Software %Title: homework4.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips homework4 -o %DVIPSParameters: dpi=300, comments remov... Date Added: 2009-06-08 17:07:00 |
| lab3.pdf Path: Utah >> ECE >> 5710 Fall, 2008 Description: ECE/CS 5710/6710 Digital VLSI Design Lab Assignment #3 Due Sunday Sept. 21st via e-mail 1 Introduction In this assignment you will design a register cell. This cell should be a single-bit edgetriggered D-type flip flop that you could use to make ... Date Added: 2009-06-08 17:07:10 |
| lab4.pdf Path: Delaware >> CISC >> 181 Fall, 2008 Description: Lab 4 programming with classes and rand() Notes This is a multi-part lab. Each part main part (1, 2, 3, etc) should be a separate file like lab04.1.cc and each part should be scripted. Each part builds on the previous part, so just start by copyin... Date Added: 2009-06-08 17:10:14 |
| 73175_1.pdf Path: Pittsburgh >> AEI >> 10513 Fall, 2009 Description: ... Date Added: 2009-06-08 17:12:57 |
| prob 5.xls Path: Laurentian >> ECON >> 200801 Fall, 2009 Description: Value of Goods and Services Hours 100 90 80 70 60 50 40 30 20 10 0 2000 2900 3700 4400 5000 5500 5900 6200 6400 6500 6500 4530 5030 5530 6030 6530 2000 2000 2000 2000 2000 2000 2000 2000 2000 2000 2000 3050 3750 4450 5150 5850 6550 7250 ... Date Added: 2009-06-08 17:13:29 |
| mgp00012.txt Path: N.C. State >> PYTHON >> 101 Fall, 2009 Description: I claim complex data structures in python are easier From Programming Perl, 2e, p271 Print a hash of hashes: foreach $record (keys(%hash_of_hashs) { print \"record $record:\ \"; foreach $field (keys %{$hash_of_hashs{$record}) { ... Date Added: 2009-06-08 17:13:32 |
| bis12z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20090305 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/09030500_upa.wxp Date: 0000Z 5 MAR 09 Searching for KBIS. Searching the city database file for: KBIS . Date:0000Z 5 MAR 09 Station: KBIS... Date Added: 2009-06-08 17:14:56 |
| 0474.pdf Path: USF >> LIT >> 0474 Fall, 2009 Description: Chapter 24: How the Tin Woodman Told the Sad News The Tin Woodman received Princess Dorothy\'s party with much grace and cordiality, yet the little girl decided that something must be worrying with her old friend, because he was not so merry as usual.... Date Added: 2009-06-08 17:15:43 |
| 07A_rl time constant (unfin).doc Path: University of Hawaii - Hilo >> EE >> 211 Fall, 2009 Description: RL Time Constants EE 211 Introduction In this lab we will investigate the pulsed DC, transient response and waveforms associated with a resistor-inductor circuit. Time constants will be generated for the included circuits and inductor values will be ... Date Added: 2009-06-08 17:18:06 |
| Quiz1Keypg2.pdf Path: Midwestern State University >> MATH >> 202 Fall, 2009 Description: ... Date Added: 2009-06-08 17:18:25 |
| slac-pub-1164.pdf Path: Stanford >> PUBS >> 1000 Fall, 2009 Description: I DESIGN, CONSTRUCTION, AND OPERATIONAL M. Davier, CHARACTERISTICS K. Mauro, OF A PROPORTIONAL and D. McShurley BEAM HODCSCOPE SYSTEM* R. G. Friday, Stanford Linear Accelerator Center Stanford University, Stanford, California 94305 Introductio... Date Added: 2009-06-08 17:19:21 |
| Tailgate Party Final Draft.doc Path: Uni. Westminster >> JIH >> 0329 Fall, 2009 Description: Joey Hellrung COMM 302-01 August 27, 2007 Forum Article: First Draft Tailgate Party Held to Hype Fall Sports The Fall Sports Tailgate Party, sponsored by ASWC, was held last Friday next to Dumke Field to kick off the fall sports season, which include... Date Added: 2009-06-08 17:20:08 |
| attachment-0001.doc Path: Pittsburgh >> E >> 20090420 Fall, 2009 Description: Annual Review Schedule (Room 902 Salk Hall) Monday, May 11, 2009 9:00 am 9:20 am 9:40 am 10:00 am 10:20 am 10:40 am 11:00am 11:30 pm 1:00 pm 1:20 pm 1:40 pm 2:00 pm ZuWei Zhai Kareem Khoury Gitanjali Sharma Ananda Chowdhury Yijun Huang Tian Zhou Dia... Date Added: 2009-06-08 17:23:51 |
| Bus. Comm. Assignment Sheet for Chapter 1.doc Path: Rogers State >> BADM >> 2523 Fall, 2009 Description: Name: _ Due Date: _ BUSINESS COMMUNICATION Assignment Sheet for Chapter 1 Read Chapter 1. Ex. 1-2 on page 21. Be certain to provide the name of the speaker and the channel; the summary should consist of at least 3 paragraphs. InfoTrac Exercise o... Date Added: 2009-06-08 17:27:17 |
| 060831_15.ps Path: Wisconsin >> SH >> 060831 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: MATLAB, The Mathworks, Inc. %Title: 060831_15.ps %CreationDate: 08/31/2006 11:14:14 %DocumentNeededFonts: Helvetica %DocumentProcessColors: Cyan Magenta Yellow Black %Extensions: CMYK %Pages: (atend) %BoundingBox: (atend) %En... Date Added: 2009-06-08 17:28:36 |
| FINAL May 23JAPANPowerpoint Japan.ppt Path: Penn State >> DMS >> 201 Fall, 2009 Description: Rural Barriers: Healthy Lifestyles Program, Using Diabetes as a Model Diane Spokus Doctoral Candidate The Pennsylvania State University Workforce Education/Training & Development Background PEPPI ACTIVE AHEC Continuing Professional Development ... Date Added: 2009-06-08 17:34:00 |
| PPc2s1KEY.pdf Path: Los Angeles Southwest College >> MATH >> 526 Fall, 2009 Description: ... Date Added: 2009-06-08 17:37:40 |
| Lecture4-MechanicalAdaptation(Burr).ppt Path: IUPUI >> G >> 819 Fall, 2009 Description: Importance of Mechanical Adaptation Understanding how cells use mechanical cues to guide their growth, differentiation, movement and gene expression would represent a major advance in cell biology. Hopkin, 1996 J of NIH Research Wolff\'s Law Wolff... Date Added: 2009-06-08 17:42:41 |
| TPSR_Levels.doc Path: Idaho >> PEP >> 440 Spring, 2008 Description: TEACHING PERSONAL AND SOCIAL RESPONSIBILITY The Levels Level 0 Irresponsibility Students who operate at Level 0 make excuses and blame others for their behavior and deny personal responsibility for what they do or fail to do. Level I Respect Stu... Date Added: 2009-06-08 17:43:08 |
| 5. Interviews.ppt Path: Cal Poly Pomona >> COM >> 108 Fall, 2009 Description: Interviews: Obvious Problems Lack of self-confidence Getting complete information Knowing what questions to ask next Taking notes Coping with taciturn respondents Coping with non-stop talkers Interviews: Hidden Problems Not asking q... Date Added: 2009-06-08 17:46:42 |
| 8. APA Ch.4.ppt Path: Cal Poly Pomona >> COM >> 108 Fall, 2009 Description: APA Manual Ch.4: References Distinguish references and bibliography. Agreement of in-text and end-of-text refs. Cite personal communications in text. Note `hanging indent\'. Note acceptable abbreviations. Publishers\' locations. Order by alphabet, year... Date Added: 2009-06-08 17:46:42 |
| sf.pdf Path: Cal Poly >> JOHN >> 2312 Fall, 2009 Description: Sample nal This is the subset of the union of two actual nals I have given in the past. I have deleted many questions since this semester I have covered much less material than in the past. You should make sure you can solve easy problems! you can pr... Date Added: 2009-06-08 17:48:29 |
| agenda12162002.pdf Path: Rose-Hulman >> CS >> 414 Fall, 2009 Description: CS 414 Software Engineering Monday 16 2002 8:20 Leader: David Schue Note Taker: Stuart Ford Timekeeper: Zach Miller Team 3 AGENDA Review Agenda Dave Schue o Make modifications if needed Confirm Team Roles Dave Schue o Make modifications if ne... Date Added: 2009-06-08 17:48:55 |
| CAD-assignment_F06.pdf Path: Georgia Tech >> ME >> 3015 Fall, 2008 Description: Georgia Institute of Technology Woodruff School of Mechanical Engineering ME3015C System Dynamics and Control Computer-aided-design assignment Issued: November 16, 2006, Due: December 7, 2006 Consider the inverted pendulum mounted on the motor dri... Date Added: 2009-06-08 17:52:20 |
| slac-pub-5019.pdf Path: Stanford >> PUBS >> 5000 Fall, 2009 Description: t. .- SLAG-PUB-5019 SCIPP August Pm) 88/32 1989 Future Limits on the v, Mass* J. J. GOMEZ-CADENAS and A. SEIDEN 1 Santa Cruz Institute . for Particle Physics University of California, Santa Cruz, CA 95064, USA and M. C.GQNZALEZ-GARCIA ... Date Added: 2009-06-08 17:53:03 |
| slac-pub-5095.pdf Path: Stanford >> PUBS >> 5000 Fall, 2009 Description: SLAC-PUB-5095 September 1989 c (NJ General QED/QCD Aspects of Simple Systems* VALENTINE L. TELEGDI CH-8092!, Zurich, with Institute for High h7nergy Physics, ETH, in collaboration STANLEY Switzerland J. BRODSKY * Stanford Linear Accelerat... Date Added: 2009-06-08 17:53:14 |
| chapter27.pdf Path: Michigan State University >> PHY >> 232 Fall, 2008 Description: Quantum physics \"Anyone who is not shocked by the quantum theory has not understood it.\" Niels Bohr, Nobel Prize in 1922 (1885-1962) \"I can safely say that nobody understands quantum physics\" Richard Feynman Nobel Lecture, 1966, (1918-1988) PHY2... Date Added: 2009-06-08 17:54:36 |
| NPDE02h.pdf Path: University of Illinois, Urbana Champaign >> CS >> 455 Spring, 2008 Description: Numerical Methods for Partial Differential Equations Eric de Sturler Department of Computer Science University of Illinois at Urbana-Champaign Fall 2002 Eric de Sturler 2002 What does it cost? We see that the explicit time integration leads to a r... Date Added: 2009-06-08 17:55:09 |
| Jul31.ppt Path: Cal Poly Pomona >> PSY >> 334 Fall, 2009 Description: Cognitive Processes PSY 334 Chapter 6 Human Memory: Encoding and Storage July 31, 2003 Depth of Processing Craik & Lockhart proposed that it is not how long material is rehearsed but the depth of processing that matters. Levels of processing de... Date Added: 2009-06-08 17:55:24 |
| FIN3100 - Sample_MidtermI_spring06_solutions.doc Path: Kennesaw >> FIN >> 3100 Fall, 2008 Description: Prof. Stefano Mazzotta Kennesaw State University Principles of Finance FIN3100. Fall 2005 First Midterm Exam: Spring 2003 Last Name: _ First Name: _ Student ID Number: _ Preliminaries Exam time is: 70 minutes. Total points for this exam is: 250 ... Date Added: 2009-06-08 17:56:24 |
| Lab2Start.doc Path: UAB >> CS >> 101 Fall, 2008 Description: Lab 2 Starter Data Instant Video Total Rentals and Quarterly Goals Store Location Glenwood Springfield Westbury Sherport Windley Jan 10323 19232 14321 14312 15312 Feb 10041 18724 15213 16423 13242 Mar 17046 19403 15103 13542 13153 Apr 24000 23313 120... Date Added: 2009-06-08 17:57:01 |
| faf0809032.pdf Path: LA Tech >> DOCS >> 0809 Fall, 2009 Description: Louisiana Tech University Division of Student Financial Aid P.O. Box 7925 Ruston, LA 7l272 Telephone: (318) 257-264l FAX: (318) 257-2628 Please Print or Type: Students Name _Soc. Sec. #__ Mailing Address _ _ Daytime Ph.# _ City/State/Zip _ _E-mail_... Date Added: 2009-06-08 18:01:28 |
| faf0809072.pdf Path: LA Tech >> DOCS >> 0809 Fall, 2009 Description: Verification of Household Size/Number in College Independent Student Student Name: Student CWID: On the FAFSA you reported that your household will consist of _ people during the 2008-2009 year, and of those family members_ will be attending a posts... Date Added: 2009-06-08 18:02:02 |
| faf0607087.pdf Path: LA Tech >> DOCS >> 0607 Fall, 2009 Description: REQUEST FOR STUDENT WORKER PAY INCREASE This form is to be filled out and turned into the Financial Aid Office when the department wishes to increase the student\'s pay rate. Name of Student: Department Name: Student\'s Current Pay Rate: Effective Date... Date Added: 2009-06-08 18:02:17 |
| shireen_proj2_51use.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: Museum of Contemorary Art Chicago 220 E. Chicago Avenue, Chicago, IL 60611 Phone Number: 312.280.2660 Web Address: www.mcachicago.org Museum Hours Monday Exhibitions Closed Tuesday 10 am8 pm Wednesday to Sunday 10 am5 pm ALEXANDER CALDER View Calder... Date Added: 2009-06-08 18:15:09 |
| slac-pub-0564.pdf Path: Stanford >> PUBS >> 0500 Fall, 2009 Description: I . SLAGFJUB-564 ASYMPTOTIC OF BEHAVIOR COMPOSITE OF FORM FACTORS + t PARTICLES A. C. SLAC, Stanford, Finn California, 94305 and San Francisco State College, San Francisco, California and Michael SLAC, Stanford, H. Goldhaber California, ... Date Added: 2009-06-08 18:20:06 |
| pskey9.pdf Path: Michigan >> CHEM >> 260 Winter, 2008 Description: Chem. 260 Next to Last Problem Set Atkins 3.27 Keq=e-DG/RT If DGo=0, Keq=e0 = 1 Atkins 3.36 a)DG = -202.87 (-95.30-16.45) = -91.12 kJ/mol DG = 3(-856.64)- 2(-1582.30) = +594.7 DG = -100.4 (-33.56) = -66.8 DG = 2(-33.56)-(-166.9) = +99.8 DG = -690.0... Date Added: 2009-06-08 18:22:35 |
| mathbaselineskills.pdf Path: Wittenberg >> P >> 107 Fall, 2009 Description: Math Skills Baseline This will not count toward your grade in any way, but it will give you an idea of the level of math skills required in this course. I will post a solution after Friday. If you have any questions, stop by to see me or visit www.SO... Date Added: 2009-06-08 18:32:13 |
| Takkellapati.pdf Path: Illinois Tech >> CS >> 561 Fall, 2009 Description: Virtual Memory Harsha Takkellapati 10431702 The lecture outline for Virtual Memory follows as: Memory: Computer data storage, often called storage or memory. The details about Memory Hierarchy. Types of Memory: Real Memory which is also called as Mai... Date Added: 2009-06-08 18:32:53 |
| board 2.pdf Path: University of Illinois, Urbana Champaign >> LA >> 338 Fall, 2009 Description: South End Analysis Existing Land Use Existing one story small commercial strip 10 th 11 th 12 th 13 th Existing allee and Veteran\'s Memorial in Lincoln Park 14 th 15 th 16 th 17 th 18 th Bo nd M ar ke t Existing traffic problems near Lincoln ... Date Added: 2009-06-08 18:33:19 |
| ex11.pdf Path: Université du Québec à Montréal >> INF >> 8541 Fall, 2009 Description: ... Date Added: 2009-06-08 18:33:41 |
| BUS304HWK-Ch1-CK-Solution.pdf Path: CSU San Marcos >> BUS >> 304 Fall, 2009 Description: (Type your name here) BUS 304 Homework Assignment Chapter 1 Problem #1: Microsoft Equation 3.0 Exercise. - skipped Problem #2: Exercise 1.54 (P23) For each of the following variables, indicate what the level of data measurement is. a. number of year... Date Added: 2009-06-08 18:34:05 |
| trans3.pdf Path: Washington University in St. Louis >> EPSC >> 210 Fall, 2009 Description: ... Date Added: 2009-06-08 18:34:40 |
| sectRecEnumH.pdf Path: Duke >> CPS >> 140 Fall, 2009 Description: recursively enumerable languages context-free languages regular languages ... Date Added: 2009-06-08 18:34:53 |
| design_outline_bw.pdf Path: Utah State >> ECE >> 5460 Spring, 2008 Description: Verilog Based Design An outline of a Verilog based synthesized ASIC design ECE 5460-70 Alan W Shaw 2004 Front End Design Starts from an idea P Concept What P Algorithm How P Preliminary Functional Partition ECE 5460-70 Alan W Shaw 2004 Prelim... Date Added: 2009-06-08 18:35:02 |
| cheatsheet.pdf Path: UMBC >> CS >> 203 Fall, 2005 Description: ... Date Added: 2009-06-08 18:41:10 |
| ma211_hmk19ans.pdf Path: Richmond >> MA >> 211 Fall, 2009 Description: ... Date Added: 2009-06-08 18:41:48 |
| f07_ma211hmk19ans.pdf Path: Richmond >> MA >> 211 Fall, 2009 Description: ... Date Added: 2009-06-08 18:41:56 |
| ma211hmk19ans.pdf Path: Richmond >> MA >> 211 Fall, 2009 Description: ... Date Added: 2009-06-08 18:42:07 |
| pc362.pdf Path: CSU Northridge >> BJC >> 20362 Fall, 2009 Description: ... Date Added: 2009-06-08 18:47:04 |
| latelevtemp.doc Path: UF >> STAT >> 3024 Fall, 2009 Description: lat elev 29.767 41 32.850 440 26.933 25 31.950 2851 34.800 3840 33.450 1461 28.700 815 32.450 2380 31.800 3918 34.850 2040 30.867 3000 36.350 3693 30.300 597 26.900 315 28.450 459 25.900 19 temp 56 48 60 46 38 46 53 46 44 41 47 36 52 60 56 62 Surfa... Date Added: 2009-06-08 18:47:23 |
| solution1.5.b.pdf Path: Washington >> MATH >> 308 Fall, 2008 Description: Solution: Problem 1.5.B MATH 308E A 3 3 matrix H is called a Heisenberg matrix if it 1 H= 0 0 has the form a b 1 c . 0 1 Show that if A and B are Heisenberg matrices, then so is AB. By denition, we may write 1 A= 0 0 a 1 0 b c 1 and 1 B=... Date Added: 2009-06-08 18:49:08 |
| Lecture_w14_Visualization.ppt Path: Texas El Paso >> GEO >> 5336 Fall, 2009 Description: Visualization Place holder Earthquake Activity of the San Andreas Fault System Year 1906 SanFrancisco M7.8Earthquake SantaBarbara LosAngeles SanDiego 20 10 0 -10 -20 mm ImperialValley M6.2Earthquake NorthSouth displacemen t Visualization Center... Date Added: 2009-06-08 18:52:39 |
| hw3.pdf Path: ASU >> ECN >> 726 Fall, 2009 Description: ECN 726 Fall 2006 1. ASSIGNMENT 3 DUE November 7 (Tuesday) S. C. AHN (20 pts.; 10 on each.) Consider the following single equation in a simultaneous equations system: y1 = Y11 + X11 + 1 = Z11 + 1, where y1, Y1, X1 and 1 are T1, Tp1, Tp2, and T1, ... Date Added: 2009-06-08 19:02:36 |
| reviewch11.pdf Path: ASU >> MAT >> 271 Fall, 2009 Description: TEST FOR CONVERGENCE OR DIVERGENCE OF A SERIES (Sections 11.1-11.6) Geometric series: a r n1 n=1 converges if r1 diverges if r1. If the series converges the sum is Test for divergence: If lim a n does not exists or if n s= a 1r lim a n0, ... Date Added: 2009-06-08 19:05:04 |
| L07IntroToC.ppt Path: UMBC >> PUB >> 104 Fall, 2009 Description: Introduction to C Topics Compilation Using the gcc Compiler The Anatomy of a C Program 104 C Programming Standards and Indentation Styles Reading Sections 1.7 - 1.13, 2.1 - 2.2 CMSC 104, Version 9/01 Writing C Programs A programmer uses a tex... Date Added: 2009-06-08 19:06:52 |
| L14Switch.ppt Path: UMBC >> PUB >> 104 Fall, 2009 Description: The switch Statement Topics Multiple Selection switch Statement char Data Type and getchar( ) EOF constant Reading Section 4.7, 4.12 CMSC 104, Version 9/01 Multiple Selection So far, we have only seen binary selection. if ( age >= 18 ) { pri... Date Added: 2009-06-08 19:06:54 |
| README-HTML.txt Path: UMBC >> PUB >> 331 Fall, 2009 Description: README-HTML.txt file for Thinking in Java, 2nd Edition Copyright (c)2000 by Bruce Eckel www.BruceEckel.com This set of HTML files is designed to work with most web browsers. You will find here the entire book, \"Thinking in Java, 2nd Edition\" in its... Date Added: 2009-06-08 19:07:03 |
| 08s_ex1a_ma221.pdf Path: Stevens >> MA >> 221 Fall, 2009 Description: Name:_ Lecture Section: _ Lecturer _ Ma 221 Exam IA 08S I pledge my honor that I have abided by the Stevens Honor System._ You may not use a calculator, cell phone, or computer while taking this exam. All work must be shown to obtain full credi... Date Added: 2009-06-08 19:13:52 |
| lecture-static-color.pdf Path: San Diego State >> MATH >> 693 Fall, 2009 Description: blomgren@terminus.SDSU.EDU http:/terminus.SDSU.EDU $Id: lecture.tex,v 1.6 2008/01/31 23:12:51 blomgren Exp $ Analysis of Finite Difference Schemes: Fourier Analysis; Von Neu... Date Added: 2009-06-08 19:16:58 |
| 12 - Supplement.ppt Path: Oakland University >> CSE >> 40547 Fall, 2009 Description: Recall.MOSFET in cross section. gs With applied V , depletion region forms n P n M.T. Niemier 1-1 MOS Capacitor Gate and body form MOS capacitor Operating modes M.T. Niemier 1-2 New, high- dielectrics I de a: I ncre thickne to re ase ss... Date Added: 2009-06-08 19:17:23 |
| ELE2300JCours04.pdf Path: Cal Poly >> ELE >> 2300 Fall, 2009 Description: Cours 4 : Bye Bye Booley En ce cours, on abandonne l\'Algbre de Boole pour les Tables de Karnaugh. Les sujets couverts sont : Distance de Hamming Tables de Karnaugh D\'autres mthodes de simplification comme celle de Quine-McCluskey, et les Hypercubes C... Date Added: 2009-06-08 19:20:46 |
| 241_P4_tight comp real 2.pdf Path: San Diego State >> ART >> 241 Fall, 2008 Description: i to E le C ou si ne black and white Champagne Since 2009 Etoile Cuisine Champagne Imported from Mexico Distributed to Etoile Cousine Restaurant color applications for for Stern Skateboards symbol mark stern skateboards toile cuisine estrella s... Date Added: 2009-06-08 19:21:54 |
| LEC4.pdf Path: Washington >> PHYS >> 421 Fall, 2008 Description: ... Date Added: 2009-06-08 19:25:10 |
| l08.pdf Path: Allan Hancock College >> EMS >> 3027 Fall, 2009 Description: The Water Cycle EMSC3027 Global Cycles and Paleoceanography The Hydrological Cycle Lecture 4 (Local) Michael Roderick, RSES Oki Trenberth 1997 (and IPCC 2001) 1 From Global to Lo... Date Added: 2009-06-08 19:28:21 |
| ms122NW19961206.pdf Path: Southern Utah >> MS >> 122 Fall, 2009 Description: LEAVITT PROMISES A SAFETY NET Lois M. Collins Deseret News. Salt Lake City, Utah: December 6, 1996 Copyright Deseret News December 6, 1996 At least four fragile nursing home residents will lose their Medicaid funding this month under federal welfare ... Date Added: 2009-06-08 19:34:01 |
| herdave.txt Path: Iowa State >> ANS >> 352 Fall, 2009 Description: HERD SUMMARY CALF CROP 10 HERD NUMBER P H E N O T Y P E NUMBER CALVES WN WT GAIN YR WT MEAT QS - - - - - - - 1 36 502 3.03 987 49.9 9 2 0 3 0 4 0 ... Date Added: 2009-06-08 19:34:58 |
| l21.pdf Path: Texas A&M >> CPSC >> 689 Fall, 2008 Description: LECTURE 21: Support Vector Machines g g g g g Empirical Risk Minimization The VC dimension Structural Risk Minimization Maximum margin hyperplane The Lagrangian dual problem Introduction to Pattern Analysis Ricardo Gutierrez-Osuna Texas A&M Univers... Date Added: 2009-06-08 19:36:22 |
| equil_implications.pdf Path: UCSC >> ECON >> 180 Winter, 2008 Description: 1 EQUILIBRIUM AND IMPLICATIONS (Borjas, Ch. 5) BRIEF COMMENTS ON: A. The cobweb model p. 182-1st edition 164 (relevant where supply adjustment takes time0 B. Public sector p. 196-1st edition 184 (absence of profit motive; what is maximized?) C. Mono... Date Added: 2009-06-08 19:37:14 |
| BUS3700-Business letter.pdf Path: Western Michigan >> BUS >> 3700 Fall, 2008 Description: BUS3700: Business letter (Block Format): Type every line flush with the left margin (begin at top margin) 1. Return address of the letter writer. 1800 Front Street Kalamazoo, MI 49008 (four single spaces) 2. The date of the letter. July 3, 2007 (or 3... Date Added: 2009-06-08 19:37:15 |
| HW_Set_7_Solutions Path: Michigan State University >> ECE >> 366 Spring, 2009 Description: Introduction to Signal Processing Homework Set #7 Solutions Wednesday, March 25, 2009 (In class) ECE 366 Introduction to Signal Processing Spring 2009 Michigan State University Department of Electrical and Computer Engineering [1] Problem 7.2-4 N... Date Added: 2009-06-08 19:37:15 |
| Hartlapp_CommissionEnforcement_ShortVersion.pdf Path: Pittsburgh >> AEI >> 3036 Fall, 2009 Description: (Non-)Compliance, EU Commission Enforcement and Differing National Responses by Miriam Hartlapp Social Science Research Center Berlin hartlapp@wz-berlin.de Presentation at the EUSA Ninth Biennial International Conference, Austin, Texas, 31 March2 A... Date Added: 2009-06-08 19:41:12 |
| solution.pdf Path: Uni. Worcester >> CS >> 536 Fall, 2009 Description: C8 y @$ # d vB0q e 8 ! mm{6 r 6s es l fCe{ r i {r r m { r p r zyRAA r r{ r{ 4 { v{ s r { 34 { s A 8l4 dm4 y r R r %... Date Added: 2009-06-08 19:48:23 |
| hws3.ps Path: Washington >> UW >> 351 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86f Copyright 2001 Radical Eye Software %Title: hws3.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %EndComments %DVIPSWebPage: (www.radicaleye.com) %DVIPSCommandLine: dvips -x 1100 -y 1100 -O -0.5in,-0... Date Added: 2009-06-08 19:51:33 |
| Ladd_Laura.doc Path: Sveriges lantbruksuniversitet >> C >> 333 Fall, 2009 Description: The Use of Lithium Drugs for the Treatment of Bipolar Disorder History of lithium: - first discovered in 1817, found in mineral ores, igneous rock - name from Greek word \"lithos\" meaning \"stone\" Properties of lithium metal: - symbol Li, atomic # 3, a... Date Added: 2009-06-08 19:59:11 |
| quatphys.ppt Path: Acton School of Business >> ESCI >> 102 Spring, 2005 Description: The Quaternary Period 1.64 Ma Only 38 seconds long! Cenozoic Time Scale Pleistocene-Holocene Tectonism and Volcanism Best known for glaciation but also a time of volcanism and tectonic activity Continuing orogeny Himalayas Andes Mountains ... Date Added: 2009-06-08 20:05:09 |
| MidtermS02ans.pdf Path: Virgin Islands >> EXAMS >> 204 Fall, 2009 Description: ... Date Added: 2009-06-08 20:10:02 |
| homework11.pdf Path: Dallas >> TE >> 3302 Fall, 2008 Description: p y w v r p I B 6 Aa s)VxVuts8G7`5HCb\' B 5a A 5 Y 6 i B Q 7bV7HXFP8G8IPV`vs sT} p y w v r p I g G Q B 6 Aa msFVxVuts8GFohHV}`7`5HCb\' B 5a A 5 Y 6 i B Q 7bV7HXFP8G8IPVvs sT} p y w v r p I x t g G Q q x t q x Qt... Date Added: 2009-06-08 20:13:50 |
| study3.pdf Path: Loyola Marymount >> MATH >> 122 Fall, 2009 Description: Study guide for test 3 MATH 132 (sections 3 and 4) The third test will cover the material from sections 3.3-5.4 of the text. You will be expected to show an understanding of implicit differentiation, related rates problems, exponential, and logarith... Date Added: 2009-06-08 20:15:23 |
| hw4linegraphproblem.pdf Path: San Diego State >> MATH >> 3134 Fall, 2009 Description: Let G be an undirected graph. The line graph L(G) of G is the undirected graph whose vertices correspond to the edges of G, and two vertices are adjacent if and only if the corresponding edges in G are incident to the same vertex. See the graphs belo... Date Added: 2009-06-08 20:17:03 |
| Presentation_Interfaces_Vocales_032008.pdf Path: Cal Poly >> IND >> 6409 Fall, 2009 Description: Interfaces vocales Enjeux actuels et futurs Chrystel Black Mars 2008 Objectifs Origines, tendances et enjeux des interfaces vocales Modes de conception, de modlisation et dvaluation des interfaces vocales 1 Droulement Dfinitions Terminologie Un p... Date Added: 2009-06-08 20:19:24 |
| Meteo535.Problem_04.58_Solution.pdf Path: Penn State >> METEO >> 535 Fall, 2008 Description: ... Date Added: 2009-06-08 20:22:33 |
| problem4_solution_step1.pdf Path: Utah State >> MATH >> 1010 Fall, 2008 Description: Problem Definition Problem 4. Simplify the following expression. (7 + 3i) - (4 - i) Solution: 3 + 4i ... Date Added: 2009-06-08 20:23:35 |
| 99s0392_1.pdf Path: Wisconsin >> LAW >> 524 Fall, 2009 Description: 1999 2000 LEGISLATURE LRBs0392/1 PJK:kmg:hmh ASSEMBLY SUBSTITUTE AMENDMENT 1, TO 1999 ASSEMBLY BILL 524 March 14, 2000 Offered by COMMITTEE ON FAMILY LAW. 1 2 3 4 5 6 AN ACT to repeal 767.115 (1) (b) and 767.115 (4); to renumber and amend 767.... Date Added: 2009-06-08 20:26:47 |
| ps6.pdf Path: George Mason >> ECE >> 754 Spring, 2009 Description: George Mason University Electrical and Computer Engineering Department ECE 754 Optimum Array Processing I Problem Set 6 Spring 2009 Issued: Friday, April 17, 2009 Assigned reading 4/15/09 4/22/09 Due: Wednesday, April 22, 2009 Sections 6.6-6.10 ... Date Added: 2009-06-08 20:30:17 |
| delta G vs temp.doc Path: St. Francis IL >> CHEM >> 100 Fall, 2009 Description: For a reaction in which S > 0 T 273 300 350 370.08 373 400 425 G 11.5 8.3 2.4 0.0 -0.3 -3.6 -6.5 For a reaction in which S < 0 T 273 300 350 370.08 373 400 425 G 12.73 13 13.5 13.7008 13.73 14 14.25 ... Date Added: 2009-06-08 20:30:41 |
| requirementsExample.doc Path: Oregon >> CIT >> 381 Fall, 2008 Description: CIT 381 Database Systems Requirements Analysis Example I. Designers meet the client Bookstore owner B is working with database designers D1 and D2. The owner B has thought a lot about what is needed: \"I would like my customers to be able to browse m... Date Added: 2009-06-08 20:30:57 |
| Heat and Temperature.ppt Path: Indiana State >> PH >> 101 Fall, 2009 Description: Heat and Temperature Physics 101 Common Temperatures Photosphere of Sun is 6000 oC or 11,000oF Sun Spots are cooler at 4000oC or 7,000oF 16 to 20 million oC at the center of the Sun which sustains nuclear fusion Dry Ice -78.5 oC Liquid N2 7... Date Added: 2009-06-08 20:32:34 |
| lecture-10-F08.pdf Path: Oregon >> CIS >> 443 Fall, 2008 Description: Lecture 10: 3D Interfaces and Virtual Reality Chapter 6: Section 6.4 and Section 6.5 3D Interfaces \"Pure\" 3D interfaces have strong utility in some contexts, e.g., medical, product design. In other situations, more constrained interaction may actua... Date Added: 2009-06-08 20:33:56 |
| 4_24_9am.xls Path: RIT >> P >> 08404 Fall, 2009 Description: 21.13 21.38 21.59 21.8 21.96 22.12 22.28 24 27.01 30 33.01 36 39.01 42 45 48.01 51 54.01 57 60.01 63 66 69.01 72 75.01 78 81.01 84 87.01 90.01 93 96.01 99 102.01 105 108.01 111.01 114 117.01 120 123.01 126 129.01 132.01 135 138.01 141 144.01 147 150.... Date Added: 2009-06-08 20:34:30 |
| QuizII2008Solutions.pdf Path: Georgia Tech >> ECE >> 843 Fall, 2009 Description: Name:_ Student ID:_ ECE 2040 Electric Circuits Professor Kevin Kornegay Fall 2008 This is a closed book exam. Please be mindful of the university\'s academic integrity policy and show all work to receive partial credit. Please use the opposite sid... Date Added: 2009-06-08 20:35:01 |
| gcnR_flux.txt Path: Berkeley >> ASTRO >> 00311159 Fall, 2009 Description: -53439.3 2.742526e-04 2.778556e-05 R no -53090.2 2.767902e-04 3.059198e-05 R no -52459.5 2.119096e-04 2.537288e-05 R no -51372.6 1.413028e-04 1.691881e-05 ... Date Added: 2009-06-08 20:37:09 |
| radvt0.txt Path: Berkeley >> ASTRO >> 00311159 Fall, 2009 Description: # t1 t2 dt rad_min rad_max cts err scl bg bg_rat wt 0.148192 0.148383 0.000191 0. 16. 9.00 3.00 0.860843 0.000000 0.279568 1 0.148383 0.148564 0.000181 0. 16. 9.00 ... Date Added: 2009-06-08 20:37:13 |
| crypto.ppt Path: Oregon >> CIS >> 170 Fall, 2008 Description: Caesar Cipher abcdefghIjklmnopqrstuvwxyz bcdefghIjklmnopqrstuvwxyza cdefghIjklmnopqrstuvwxyzab . zabcdefghIjklmnopqrstuvwxy shift of 25 shift of 1 shift of 2 \"attack at dawn\" => \"buubdl bu ebxo\" with shift of 1 How can we crack this? 1. Letter frequ... Date Added: 2009-06-08 20:40:26 |
| topic1 BIOL1030NR.pdf Path: Auburn >> BIOL >> 1030 Fall, 2008 Description: BIOL 1030 TOPIC 1 LECTURE NOTES Topic 1: Classification and the Diversity of Life (Chapters 25, 26.6) I. Background review (Biology 1020 material) A. Scientific Method 1. 2. observations scientific model 3. 4. 5. explains observations makes test... Date Added: 2009-06-08 20:43:06 |
| avl.txt Path: Utah State >> CS >> 2420 Fall, 2008 Description: insert 3 print 3 insert 2 print 2 insert 1 print 1 insert 4 print 4 insert 5 print 5 insert 6 print 6 insert 7 print 7 insert 16 print 16 insert 15 print 15 insert 14 print 14 insert 13 print 13 insert 12 print 12 insert 11 print 11 insert 10 print 1... Date Added: 2009-06-08 20:44:13 |
| syr2k_sample.pdf Path: Texas >> CS >> 378 Fall, 2008 Description: q S X # X X sj%nol| yh o linu k q jo plso {s f p kfo k X ) z# ) u nwdededptgf~ gfe doqpys kmr o S k jejenp z y}VezzypHqG q j... Date Added: 2009-06-08 20:46:15 |
| graph-ex2.pdf Path: Utah >> P >> 2210 Fall, 2009 Description: Physics 2210 - Fall 2006 - Exam 2 Average=46 30 25 20 15 10 5 0 0 5 10 15 20 25 30 35 40 45 50 55 60 65 70 75 80 85 90 95 100 Pre-test (44) 60 50 40 Number 30 20 10 0 0 5 10 15 20 25 30 35 40 45 Exam 1 (74) Exam 2 (46) Score 50 55 60 65 70 ... Date Added: 2009-06-08 20:50:16 |
| lec16_oct_23.pdf Path: University of Illinois, Urbana Champaign >> CS >> 476 Fall, 2008 Description: Program Verification: Lecture 16 Jos Meseguer e Computer Science Department University of Illinois at Urbana-Champaign 1 An Interpreter The above functional module has given a precise axiomatization of our chosen subset of Java that is sufficient... Date Added: 2009-06-08 20:50:31 |
| ChiralityAndHelicity.pdf Path: SMU - Cox School of Business >> PHYSICS >> 7314 Fall, 2009 Description: ... Date Added: 2009-06-08 20:51:59 |
| OCTSpeckle.pdf Path: University of Iowa >> BME >> 060 Fall, 2009 Description: April 15, 2000 / Vol. 25, No. 8 / OPTICS LETTERS 545 Statistics and reduction of speckle in optical coherence tomography M. Bashkansky and J. Reintjes Code 5614, Naval Research Laboratory, Washington, D.C. 20375 Received December 23, 1999 Studies ... Date Added: 2009-06-08 20:57:29 |
| YFL034C-B.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YFL >> 034 Fall, 2009 Description: YFL034C-B.t2k EBGHSTL 3 2 1 CC X C G H CSCCHTCCCHTCGTGTTGGTTEETCCCSEEECTCTSHTTTHGSSTGS CCC S H T C TSG S S T TTT H SHTHHSTCCGHST C C S C T C S E S E S C H C G T S T S S E E S B H H H G G S G T H H H H H H T H S G S H S X X X X XTTXSSSXXSHGHXHSTSXXX... Date Added: 2009-06-08 20:57:40 |
| lecture6_Bourne Shell Programming.pdf Path: Mich Tech >> CS >> 3451 Spring, 2008 Description: Borne Shell Background Early Unix shell that was written by Steve Bourne of AT&T Bell Lab. Basic shell provided with many commercial versions of UNIX Many system shell scripts are written to run under Bourne Shell A long and successful history 1 Bo... Date Added: 2009-06-08 20:58:33 |
| Strategic_Week 10.pdf Path: Allan Hancock College >> MGMT >> 2035 Fall, 2009 Description: Week 10: Questions Organisations face frame-breaking changes today. What are some of these changes? How do the environmental dimensions of information uncertainty and resource dependence constrain an organisations response to its environment? Which s... Date Added: 2009-06-08 20:58:52 |
| Lecture-8 2008 -3 sheets per page.pdf Path: Minnesota >> INET >> 4031 Fall, 2008 Description: INet 4031 Lecture 8 March 23, 2009 1 Lecture 8 Topics Review Homework Exercise 1 Review Mid Term Exam Discussion - IT-business alignment two articles Homework Exercise 2 Review Presentation \"Windows Policies . Tips for installi... Date Added: 2009-06-08 21:02:20 |
| exam1sc3.ps Path: Utah >> M >> 2210 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.60.1 Copyright 1986, 1996 Radical Eye Software %Title: exam1sc3.dvi %CreationDate: Mon Jun 5 17:09:29 2006 %Pages: 4 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips exam1sc3.dvi %DVI... Date Added: 2009-06-08 21:04:06 |
| index15.txt Path: Berkeley >> ASTRO >> 00180977 Fall, 2009 Description: chi^2/nu= 3339.4746 / 1384 The fit is rejectable at 100.00000 % Confidence 1.9499969 9.7699890 7.2729939 -0.081516816 1846.2806 9.7699890 13.679993 9.7111226 -1.0719325 91... Date Added: 2009-06-08 21:04:40 |
| index57.txt Path: Berkeley >> ASTRO >> 00180977 Fall, 2009 Description: chi^2/nu= 3298.0534 / 1390 The fit is rejectable at 100.00000 % Confidence 1.9499969 9.7699890 5.8717556 0.54005234 677.71230 9.7699890 13.679993 9.8304281 -1.0680381 10... Date Added: 2009-06-08 21:04:47 |
| YPL001W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YPL >> 001 Fall, 2009 Description: YPL001W.t2k EBGHSTL 3 2 1 CC X S G G H S H T T E T T E H T H H X X X X X X X X CCCCSHHHH S S G T X C X H E X X S C C C E C T T H S T G C C S E S G C C S S H G T E T E G S T C B C H X X X X X X X X X X X X X X X X X X X X X X X X X SE T C ... Date Added: 2009-06-08 21:05:12 |
| The GSMP Framework.doc Path: Berkeley >> IEOR >> 261 Fall, 2008 Description: The GSMP Framework A generalized semi-Markov process (GSMP) model is the common framework for which IPA results are derived. We construct GSMPs following the developments of Fu and Hu (1997), and Glasserman (1991). Define the following: S countable s... Date Added: 2009-06-08 21:06:11 |
| h11.pdf Path: Maryland >> CMSC >> 250 Fall, 2007 Description: CMSC 250 Homework 11 Fall 2005 0201 & 0202 Due Wed Nov 16 at the beginning of your discussion section. You must write the solutions to the problems single-sided on your own lined paper, with all sheets stapled together, and with all answers written i... Date Added: 2009-06-08 21:06:21 |
| YGL157W.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YGL >> 157 Fall, 2009 Description: YGL157W.t2k EBGHSTL 3 2 1 CC C EEE X G E SC X X T ST TC CS X SC E E X X X X X X X G E S C C H X X X X X X ECTT H S CSC T SH G SC C T 1 10 20 30 40 S T 3 2 1 T H T E H T C C SSC T H H E S X X X X X X X X X X 51 60 70 80 90... Date Added: 2009-06-08 21:08:16 |
| YGL169W.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YGL >> 169 Fall, 2009 Description: YGL169W.t2k EBGHTL 3 2 1 CEEE X E E CHHHE T H C H X X X X X H X T C C C T E X X X T TTCTTTTTTC TT TCCCTCCCHCCT T TEETE H H C C H E E H T E C T H H H X X X X X X X X X X X X X X X X X X X X X X X X X CCTCCCCCCTT TT T TC C H X C E H H H T T... Date Added: 2009-06-08 21:08:23 |
| sped5310-slocum-sp08.pdf Path: Utah State >> SPED >> 5310 Fall, 2008 Description: Credits: Instructors: SPED 5310 Teaching Reading and Language to Students with Mild/Moderate Disabilities Spring 2008 4 Timothy A. Slocum, Ph.D. tim.slocum@ usu.edu 435-797-3212 Wednesdays, 4:30-7:00 pm. Respective Distance Education sites. Contact ... Date Added: 2009-06-08 21:08:39 |
| Respond_AARSummary_RSM_LCODraft_F07a_T05.xls Path: USC >> CSCI >> 577 Fall, 2009 Description: a3ee57c24ce0355d2af55fb017e9bdc2b845d36e.xls - Areas of Concern Log Project Name: Artifact: Module: MBASE Phase/level: Activity: Exit Criteria: Reviewer: Review Leader email: Review Leader phone: Author: Crystal Stairs Dashboard Protype : SSAD_LCO... Date Added: 2009-06-08 21:09:55 |
| reflection-what i bring to the experience.doc Path: Loras >> PH >> 314248 Fall, 2009 Description: Peter Hoff Reflective Teaching Inga Schilling August 29, 2004 4.1 Learning experiences I believe that I have experienced several learning experiences that changed my way of thinking. My first grade teacher was my most influential teacher; she taught ... Date Added: 2009-06-08 21:10:24 |
| ousterhoutThreads.ps Path: Texas >> CS >> 372 Fall, 2009 Description: %!PS-Adobe-3.0 %Creator: Windows PSCRIPT %Title: PowerPoint - THREADS.PPT %BoundingBox: 14 9 597 784 %DocumentNeededResources: (atend) %DocumentSuppliedResources: (atend) %Pages: (atend) %BeginResource: procset Win35Dict 3 1 /Win35Dict 290 dict def W... Date Added: 2009-06-08 21:12:53 |
| VLSI L7 Pass Trans Logic.pdf Path: UCSD >> ECE >> 260 Fall, 2009 Description: ECE 260A VLSI Digital Circuits MJIrwin PSU 2002] VLSI Design: L7 Pass Transistor Log... Date Added: 2009-06-08 21:18:37 |
| 99a1360df.pdf Path: Wisconsin >> LAW >> 701 Fall, 2009 Description: LRBa1360 ~b2/09/2000 01:45:22 PM Page 1 1999 DRAFTING REQUEST Assembly Amendment (AA-AB701) Received:02JO9/2000 Wanted: 02/09/2000 For: Marlin Schneider (608) 266-0215 This file may be shown to any legislator: NO May Contact: Subject: Elections - c... Date Added: 2009-06-08 21:20:15 |
| lab01.pdf Path: Maryville MO >> CSC >> 350 Spring, 2009 Description: CSC 350 Fundamental of Mathematical Computation, Lab 01 01/24/2005 1 CSC 350 Fundamental of Mathematical Computation Lab 01, Spring 2005 Monday, January 31, 2005 Due date: Maple: Monday, February 06, at the beginning of the lab C+/Java: Monday,... Date Added: 2009-06-08 21:23:05 |
| Final Updated Proposal.pdf Path: Penn State >> JDM >> 5017 Fall, 2009 Description: Visteon Village Corporate Center Van Buren Township, MI Thesis Proposal Jamison Morse Structural Option Advisor: Dr. Andres Lepage Jamison Morse Advisor: Dr. Andres Lepage Structural Option Thesis Proposal Visteon Corporate Village Center Van Bur... Date Added: 2009-06-08 21:24:47 |
| Diffie-Hellman key exchange.doc Path: CSU Northridge >> YZ >> 497 Fall, 2009 Description: Diffie-Hellman key exchange The simplest, and original, implementation of the protocol uses the multiplicative group of integers modulo p, where p is prime and g is primitive mod p. Modulo (or mod) means that the integers between 0 and p - 1 are used... Date Added: 2009-06-08 21:25:16 |
| E080045-A.pdf Path: Caltech >> E >> 080045 Fall, 2009 Description: LASER INTERFEROMETER GRAVITATIONAL WAVE OBSERVATORY E080045 -A- D Drawing No Rev. Group SPECIFICATION Sheet 1 of 2 BLANK MATERIAL, AdLIGO FOLDING MIRROR APPROVALS AUTHOR: V. Parames CHECKED: G Billingsley APPROVED: DCC RELEASE DATE 01/23/08 04/... Date Added: 2009-06-08 21:25:23 |
| YNL244C.t2k.CB_burial_14_7-logo.pdf Path: UCSC >> YNL >> 244 Fall, 2009 Description: YNL244C.t2k CB_BURIAL_14_7 3 2 1 AA 1 A 10 20 30 40 B E D E D B A B D E B D A B 3 2 1 D E B A E F D C C E C D D D E C C E E E E D G D D B A A C D B C D F F D G D C D G D D D D A C C D D D D A A C D F C E A F B D E D D D D D D D D D X ... Date Added: 2009-06-08 21:28:35 |
| Simple DAQmx.rtf Path: Nevada >> MECH >> 322 Fall, 2009 Description: Simple DAQmx.vi Connector Pane Front Panel Block Diagram Express VI Configuration Information Formula Formula Uses a calculator interface to create mathematical formulas. You can use this Express VI to perform most math functions that a basic scie... Date Added: 2009-06-08 21:39:21 |
| autoCompleteDoc.txt Path: BYU >> IPT >> 560 Fall, 2009 Description: Autocomplete - a jQuery plugin NOTE: This is a modification of the jQuery Autocomplete Plug-in written by Dylan Verheul. The documentation is also based on Dylan\'s documentation, I made additions/changes as need to support my modifications. Usage: ... Date Added: 2009-06-08 21:58:07 |
| NewFinSvsOption.pdf Path: CSU Northridge >> HFBUS >> 021 Fall, 2009 Description: College of Business and Economics Finance, Real Estate, and Insurance FINANCIAL SERVICES REQUIREMENTS FOR THE BACHELOR OF SCIENCE DEGREE IN BUSINESS ADMINISTRATION WITH AN OPTION IN FINANCIAL SERVICES Note: Students who select the Financial Services... Date Added: 2009-06-08 22:00:02 |
| boosting.ps Path: Texas San Antonio >> CS >> 6463 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: talk.dvi %Pages: 18 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %DocumentFonts: Times-Bold Times-Roman Courier Times-Italic %EndComments %DVIPSCommandLine: dvips... Date Added: 2009-06-08 22:03:00 |
| 17-32.pdf Path: St. Olaf >> MG >> 0809 Fall, 2009 Description: 2 0 0 8 - 0 9 S t. O l a f w o m e n s h o c k e y s e a s o n g u i d e | b i o g r a p h i e s Melissa Sailor 5 - 4 | S en i or For ward R ams e y, Minn . Iron da l e Hi g h S c h o o l AT ST. O LAF 2007-08 ( Junior) - Played in all 25 games. Had... Date Added: 2009-06-08 22:10:06 |
| Intels shadow.doc Path: NYU >> B >> 012301 Fall, 2009 Description: Intel\'s shadow Fortune; New York; Jul 6, 1998; David Kirkpatrick; Volume: Issue: Start Page: ISSN: Subject Terms: 138 1 187-188 00158259 Microprocessors Corporate profiles Corporate growth Stock prices Market positioning Product lines Microprocess... Date Added: 2009-06-08 22:33:05 |
| ch5.ppt Path: ECCD >> COMP >> 3104 Fall, 2009 Description: Project management Ian Sommerville 2004 Software Engineering, 7th edition. Chapter 5 Slide 1 Objectives q q q q q To explain the main tasks undertaken by project managers To introduce software project management and to describe its distinctiv... Date Added: 2009-06-08 22:34:15 |
| rosamondnotes.pdf Path: Toledo >> INDIVIDUAL >> 243 Fall, 2009 Description: Glosses for The Complaint of Rosamond plaine complain (and/or explain?) spot blemish; kinde most likely, sex sheete i.e. death-shroud Caron Charon, the ferryman of the dead in Greek mythology that riuer the river Styx; one of four rivers in Hades, th... Date Added: 2009-06-08 22:34:22 |
| brochureforBreastfeeding.pdf Path: LSU >> NR >> 51507 Fall, 2009 Description: To learn more about this study, contact: Julissa Salguero or Emily Gilbert 225 578-7160 jsalgu1@lsu.edu 202B Knapp Hall, Louisiana State University Se habla espaol Are you pregnant? Are you planning to breast feed your baby? Author: Julissa Sa... Date Added: 2009-06-08 22:49:43 |
| ma311_hw2.pdf Path: Bucknell >> NCR >> 006 Fall, 2009 Description: Homework 2 This problem set is due January 30th. Set-up for 1-3 The rst few problems deal with the RSA encryption algorithm described here: 1. Alice picks two large primes (how one does this is nontrivial) and lets n = pq. 2. Alice then computes (n) ... Date Added: 2009-06-08 22:49:45 |
| HW 6 Path: UCSD >> MAE 20 >> 614106 Spring, 2009 Description: HW 6 (Due 2/25 Mon) 10-19 A Nb-60wt% W alloy is heated to 2800C. Determine (a) the composition of the solid and liquid phases in both wt% and at%;(b) the amount of each phase in both wt% and at%; and (c) assuming that the density of the solid is 16.0... Date Added: 2009-06-09 04:43:01 |
| YER073W.t2k.dssp-ehl2-logo.pdf Path: UCSC >> YER >> 073 Fall, 2009 Description: YER073W.t2k DSSP-EHL2 2 1 CCCCC X C C C C H C CXXHHHHHXHCCCCCCCCCHCCXXXCX C C C C C C C C H C C C C E H C H H H C H H C H H H X X X X X X X X X X X X X X X X CC CCC HHH X X X X X X X X X X X X X X X X X X X HHHHHH X C X ECC C X H X EECC ... Date Added: 2009-06-11 14:28:31 |
| week03.ppt Path: Allan Hancock College >> INFT >> 061 Fall, 2009 Description: Week 3 Conditionals and Loops Conditionals and Loops Now we will examine programming statements that allow us to: make decisions repeat processing steps in a loop Chapter 5 focuses on: boolean expressions conditional statements comparing da... Date Added: 2009-06-11 14:33:44 |
| CHOMP SQUAD 8.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: CHOMP SQUAD l lciromp smile c romp romp a n h o m p stomp stomp stomp s q SQUAD alliance CHOMP om smile smile smilesmile smile chomp smile chomp chomp smile smile smile smile l l i smile c ha n c CHOMP m p SQUAD o stomp salliance alliance rompc cho... Date Added: 2009-06-11 14:50:36 |
| SMILE 2.pdf Path: San Diego State >> ART >> 496 Fall, 2008 Description: CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD CHOMP SQUAD ... Date Added: 2009-06-11 14:50:36 |
| YDR041W.t2k.w0.5-logo.pdf Path: UCSC >> YDR >> 041 Fall, 2009 Description: YDR041W.t2k w0.5 3 2 1 XXXXXXXXXXXXXX R L E V S N L S S L R L L L L X X X E F A XXXXXXXX XXXX Q Q P A N V P K L V L Y K L K V I P N A X X XXXXXXX K T XXXXAXLX XAX X E E LK K S Q C M IRV V M ILS K I GF V X X D L X Y K... Date Added: 2009-06-11 15:30:06 |
| intro.ppt Path: Duke >> X >> 296 Fall, 2009 Description: Experimentation in Computer Systems Research Why: \"It doesn\'t matter how beautiful your theory is, it doesn\'t matter how smart you are if it doesn\'t agree with the experiment, it\'s wrong.\" R. Feynman 2003, Carla Ellis Why? W. Tichy in \"Should Co... Date Added: 2009-06-11 15:38:06 |
| YGR010W.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YGR >> 010 Fall, 2009 Description: YGR010W.t2k EBGHTL 3 2 1 CTTTTC TCCGC C X G B B G B B B B E E H H X X X X X X X X X X X X 1 10 20 30 40 T 3 2 1 C T T T T TTCTCTTT CCTCCCTCTCTTTCCTT CC ETEEEECTCTCCCCCCCTTTCTTTCGCGCCCTTCC T G X X HHCTH C CEE G CT E G H T T E T T G E E T... Date Added: 2009-06-11 15:42:49 |
| 060120presc.txt Path: Chester >> ECO >> 338 Fall, 2008 Description: The K Street Prescription - New York Times January 20, 2006 Op-Ed Columnist The K Street Prescription By PAUL KRUGMAN The new prescription drug benefit is off to a catastrophic start. Tens of thousands of older Americans have arrived at pharm... Date Added: 2009-06-11 15:46:04 |
| YOL102C.t2k.alpha-logo.pdf Path: UCSC >> YOL >> 102 Fall, 2009 Description: YOL102C.t2k ALPHA 3 2 1 E H S E E A H B B B D H E H I I X XXXXXXHIXXIXIII XX H 1 10 20 30 40 H S E 3 2 1 B H S B H B T E B H B S E B H B A A B S I E E H XXX 51 60 70 80 90 S 3 2 1 B S B H S H B S E B H B S E B E B S E B E... Date Added: 2009-06-11 15:58:58 |
| 32461-7.pdf Path: Virginia Tech >> EE >> 008000 Fall, 2009 Description: LOW-CONCENTRATING WATER-COOLED PV-THERMAL HYBRID SYSTEMS FOR HIGH LATITUDES Maria Brogren and Bjrn Karlsson 1 1 2,3 Uppsala University, Dept of Materials Science, P.O. Box 534, SE-751 21 Uppsala, Sweden E-mail: maria.brogren@angstrom.uu.se, Phone: +... Date Added: 2009-06-11 16:28:22 |
| m02b_cheat.pdf Path: Maryland >> ASTR >> 121 Fall, 2008 Description: %y!yub i g ETx F 2g v xE x E x E % { g G Fq5 { g F F c hGh %eut nF { nu RpnRX G \'F v b u yXW U F a TY1tv V! A~ ! | { { f { x {g F F nit G 6T4F s 6 vo F F x 4 o F F x n1 l qk A s F x T x eF F { g ... Date Added: 2009-06-11 16:37:39 |
| readme.pdf Path: Maryland >> CHEN >> 1279 Fall, 2009 Description: Documentation of IDSC-based foliage recognition Haibin Ling 8/20/2006 This is a brief documentation of the IDSC-based package for foliage recongition used in EFG prototype system. Matlab function for segmentation, recognition and clustering. There ar... Date Added: 2009-06-11 16:37:44 |
| bat.txt Path: Berkeley >> ASTRO >> 00020058 Fall, 2009 Description: 1e-05 1e-05 1 1 ... Date Added: 2009-06-11 17:23:33 |
| csc2529.ppt Path: Toledo >> CSC >> 2529 Fall, 2009 Description: Layered Acting for Character Animation By Mira Dontcheva Gary Yngve Zoran Popovi SIGGRAPH 2003 presented by Danny House Editing Motion Keyframing: positions and tangents Physical Simulation: initial conditions Motion Graphs: splicing Texturing ... Date Added: 2009-06-11 17:27:56 |
| bat.txt Path: Berkeley >> ASTRO >> 00020083 Fall, 2009 Description: 1e-05 1e-05 1 1 ... Date Added: 2009-06-11 17:32:01 |
| YDR298C.t2k.stride-ebghtl-logo.pdf Path: UCSC >> YDR >> 298 Fall, 2009 Description: YDR298C.t2k EBGHTL 3 2 1 CC 1 TTC H H T C T H T T T T C T C C T C C C T T C T H C C C T C C T T X X X X X X X X X X X X X X X X X X X H H HHHH HHHHHHHHH X HTTTH C G C G H T H H X X CC X X X CCHH X X X HHHH X C C X X X X 10 20 30 40 ... Date Added: 2009-06-11 18:24:46 |
| YDR263C.t2k.dssp-ebghstl-logo.pdf Path: UCSC >> YDR >> 263 Fall, 2009 Description: YDR263C.t2k EBGHSTL 3 2 1 CC 1 C T S G S G G T T C G G GXTGXGGHHEXXCTXCSHEXCCHXCSX T S C S S T T T C C H C H G C X X X X X X X X X X X X X X X X X X X X X X X X X THTHG H HHHHHHH GG GTTCCCE T H S CCHHHHT CE C E GG TG HSS 10 20 30 40 H... Date Added: 2009-06-11 18:25:00 |
| YDR206W.t2k.w0.5-logo.pdf Path: UCSC >> YDR >> 206 Fall, 2009 Description: YDR206W.t2k w0.5 5 4 3 2 1 M L I E V D X VH R H F S L W ED I D L L C I V F LR XXXXXXXXXXXXXXXXXXXXXXXXVXXXXXXXXXXXXXGXXXXX X XX X X E N E K T V D N V K E E LE Y Q M E I R R I A L I L F Y L E Q G A K Q N S I R V Q L F E YD L F Y L I ... Date Added: 2009-06-11 18:25:19 |
| Ch2 Solns Path: University of Hawaii, Manoa >> BUS >> 314 Summer, 2009 Description: Financial Markets and Institutions Answers to EndofChapter Questions Chapter 2 21 The prices of goods and services must cover their costs. Costs include labor, materials, and capital. Capital costs to a borrower include a return to the saver wh... Date Added: 2009-06-11 18:28:00 |
| Project_04_Script.txt Path: UNC >> DAY >> 102 Spring, 2009 Description: # Test for existence of anything named \"index\" if [ ! -e index ] then pwd echo - nothing here named index exit fi # It\'s here, make sure it\'s a regular file if [ ! -f index ] then pwd echo - index is here but is not a file exit fi # ... Date Added: 2009-06-11 18:35:01 |
| Lecture11.pdf Path: Georgia Tech >> EAS >> 8803 Fall, 2008 Description: Lecture 11. Terrestrial infrared radiative processes. Part 4: IR radiative heating/cooling rates . Objectives: 1. IR radiative transfer revisited. 2. Infrared radiative heating/cooling rates in the cloud-free atmosphere. 3. Concept of the broadband ... Date Added: 2009-06-11 18:59:52 |
| EXPT546.txt.densities.pdf Path: Princeton >> EXPT >> 546 Fall, 2009 Description: over-representation structuraltransport, p<0.01 constituent of cuticle, p<1e-05 phosphate transport, p<1e-07 phosphate transport, p<0.01 phosphate constituent of cuticle, p<1e-10 structuraltransport, p<1e-04 phosphate signal transduction, p<1e-05 ... Date Added: 2009-06-11 19:01:53 |
| 001893_1.pdf Path: Pittsburgh >> AEI >> 4246 Fall, 2009 Description: ... Date Added: 2009-06-11 19:02:14 |
| chap1.pdf Path: Allan Hancock College >> CSSE >> 3305 Fall, 2009 Description: Workbook CSE3305 Formal Methods II Semester 1, 2007 - Kevin Korb - Monash University Clayton School of Information Technology This workbook will contain all the required reading for this subject outside of the lecture notes themselves. However, stu... Date Added: 2009-06-11 19:03:33 |
| project2Solutions.pdf Path: Montana >> STAT >> 401 Fall, 2008 Description: PROJECT 2 SOLUTIONS Statistics 401: Spring 2007 1. (5 pts) What\'s more important, the public\'s right to know the details of the slaying of Jason Wright or the fair-trial rights of two former Montana State University athletes accused of killing him? A... Date Added: 2009-06-11 19:04:01 |
| handout.pdf Path: Colorado State >> MKT >> 305 Fall, 2008 Description: 1 Opening Slide MKT305 Fundamentals of Marketing Instructors: Hoffman and Weiss Module 6 Business-to-Business Marketing 2 Module 6 Learning Objectives 1. Define the three types of business markets. 2. Discuss how business demand differs 3. 4. 5... Date Added: 2009-06-11 19:15:40 |
| Stor155Eg1.xls Path: UNC >> UNCSTOR >> 155 Fall, 2009 Description: Class Example 1 List of Names Al Bob Cal Don Ed Fin Copy (to reorder) Cal Ed Bob Fin Don Al Random #\'s from RAND function 0.33 0.34 0.2 0.18 0.53 0.86 Caution: these change every time the spreadsheet is \"recomputed\" so they are already \"out of orde... Date Added: 2009-06-11 19:19:28 |
| lecture03.ps Path: San Diego State >> PHYS >> 608 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.95a Copyright 2005 Radical Eye Software %Title: lecture03.dvi %Pages: 13 %PageOrder: Ascend %Orientation: Landscape %BoundingBox: 0 0 612 792 %DocumentFonts: CMBX12 CMSY10 CMR12 CMMI12 CMMI8 CMR8 CMEX10 CMMI6 %+ CM... Date Added: 2009-06-11 19:21:40 |
| ShuDefense-0929.ppt Path: Texas >> CS >> 386 Fall, 2008 Description: On Multiple Sequence Alignment Shu Wang Ph.D. Defense Committee Members: Professor Daniel Miranker, advisor Professor Tony Ambler, co-advisor Professor Joydeep Ghosh Professor Robin Gutell Professor Driga Mircea Computer Engineering Curriculum Track ... Date Added: 2009-06-11 19:23:03 |
| Phys 227_08_Lec_14 App B.pdf Path: Washington >> PHYS >> 2278 Fall, 2009 Description: Lecture 14 Appendix B: Some sample problems from Boas Here are some solutions to the sample problems assigned for Chapter 8. 8.2: 6 Solution: We want to find the solution to the following first order equation using separation of variables. We find ... Date Added: 2009-06-11 19:23:38 |
| Class 13.pdf Path: University of Regina >> UCS >> 6002 Fall, 2009 Description: ECONOMICS 6002 CLASS 13 SIMULTANEOUS EQUATION MODELS 1. In simultaneous systems, some endogenous variable appears in more than one equation in the system. a. As a result, OLS estimation may be inconsistent, because an endogenous variable acts as an \"... Date Added: 2009-06-11 19:24:04 |
| submit.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: executable = pass6_31760.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = F:\\condor\\allgamma\\pass6\\jobs31500-31999/31760... Date Added: 2009-06-11 19:28:26 |
| output.txt Path: Washington >> JOBS >> 31500 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-945QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_2104 02/10/2008 10:56 PM <DIR> . 02/10/2008 10:56 ... Date Added: 2009-06-11 19:28:54 |
| Day37.txt Path: Mich Tech >> CS >> 2321 Fall, 2008 Description: Final Exam <2 weeks A lot of material - start review Hw A due Today (Final Hw!) I. Last Time: A. Weighted Graph 1. Weights are properties/decorations on edges 2. A path will have a path weight - sum of all weights of edges... Date Added: 2009-06-11 19:29:29 |
| syllabus.ps Path: Caltech >> CDS >> 111 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: syllabus.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips -o ./www/syllabus.ps syllabus %DVIPSParameters: dpi=300,... Date Added: 2009-06-11 19:30:46 |
| trajgen_07Jan08.pdf Path: Caltech >> CDS >> 110 Fall, 2009 Description: Optimization-Based Control Richard M. Murray Control and Dynamical Systems California Institute of Technology DRAFT v1.0a, 7 January 2008 c California Institute of Technology All rights reserved. This manuscript is for review purposes only and may... Date Added: 2009-06-11 19:30:47 |
| f6-4.pdf Path: Oregon State >> ECE >> 478 Fall, 2008 Description: Source A Destination B Message Source X Encryption Algorithm Y Encryption Algorithm Z Decryption Algorithm Y Decryption Algorithm X Message Dest. KUb Key Pair Source KRb KRa KUa Key Pair Source Figure 6.4 Public-Key Cryptosystem: Sec... Date Added: 2009-06-11 19:31:24 |
| unix-imp.ps Path: Yale >> CS >> 422 Fall, 2009 Description: %!PS-Adobe-1.0 %Creator: doom.citi.umich.edu:honey (Peter Honeyman) %Title: stdin (ditroff) %CreationDate: Mon Dec 30 16:37:53 1991 %EndComments % lib/psdit.pro - prolog for psdit (ditroff) files % Copyright (c) 1984, 1985 Adobe Systems Incorporated.... Date Added: 2009-06-11 19:33:09 |
| Canadian Identity.ppt Path: Laurentian >> MGT >> 3210 Fall, 2009 Description: Canadian Identity By: Alissa Grant and Samantha Turner Agenda What the Canadian Identity is. Marketing using the Canadian Identity Problems using the Canadian Identity Conclusion Questions 03/06/09 copyright 2006 Free template from brainybett... Date Added: 2009-06-11 19:34:24 |
| nov9.pdf Path: Kentucky >> CS >> 621 Fall, 2008 Description: o wppwpzxxo wpow wtx{ nv zv mo nx y n } yzz nt yzto own }mown mt t z r }ztppw }p} x tx ztzzo x {pt owpx{ }{px{x n znwpnm n tnm x zw qtpomt znpx{lzptnpn t m w x v tn z x x {}py wpy tvp zn x{tpwpnptozn}npztopvp m t zp to wpow wy xw... Date Added: 2009-06-11 19:36:30 |
| p600_04f.ppt Path: N. Illinois >> PHYS >> 600 Fall, 2008 Description: Transformations Point Transformation Lagranges method is independent of the coordinate choice. L(q j , q j , t )dt = 0 t1 t2 This represents a change in configuration space Q. y r, q (q , t ) j k k j q k j q = j q q k q (q , t ) x q... Date Added: 2009-06-11 19:38:58 |
| Scintillators.ppt Path: N. Illinois >> PHYS >> 690 Fall, 2009 Description: Scintillators Scintillation Detector Scintillation detectors are widely used to measure radiation. The detectors rely on the emission of photons from excited states. Counters Calorimeters 1. An incident photon or particle ionizes the medium. 2. I... Date Added: 2009-06-11 19:39:05 |
| 210sreview1.pdf Path: N. Illinois >> PHYS >> 210 Summer, 2008 Description: P H Y S 2 1 0 - F I N A L - S U M M E R 2 0 0 7 - F O R T N E R Multiple Choice (2 points each) Complete the problems on the attached diagnostic test. True or False (2 points each) 1. _ The angle of a frictionless ramp does not affect the sp... Date Added: 2009-06-11 19:39:14 |
| 10MultSterCentKey.pdf Path: UT Arlington >> CHEM >> 2321 Fall, 2008 Description: ... Date Added: 2009-06-11 19:40:41 |
| Lab 4.pdf Path: Maryville MO >> BE >> 315 Fall, 2009 Description: BE 315 TRANSISTOR CIRCUITS Lab 4 To get familiar with the design and functioning of basic amplifier circuits, you will measure some basic characteristics of a simple transistor-based amplifier during this lab period. 1. Construct a transistor ampli... Date Added: 2009-06-11 19:40:57 |
| MRastegar_CMD2.doc Path: Santa Clara >> COEN >> 120 Fall, 2009 Description: GetAwayChair Report on Configuration DefaultConfig PACKAGES Default GLOBALS: Relations: itsMassager Composition of massager, Multiplicity of 3, Uni-directional CLASSES: buttons The buttons available are located here. Button 1: On/Off Preprogrammed ... Date Added: 2009-06-11 19:45:00 |
| pfizerwarning.pdf Path: Oregon State >> P >> 12004 Fall, 2009 Description: DEPARTMENT OF HEALTH & HUMAN SERVICES Public Health Service Food and Drug Administration Rockville, MD 20857 TRANSMITTED BY FACSIMILE Robert B. Clark Vice President, US Regulatory Pfizer Inc. Regulatory Affairs 235 East 42nd Street New York, New Y... Date Added: 2009-06-11 19:45:27 |
| Marshall JCB 07 cilia rev.pdf Path: UCSD >> BISP >> 194 Fall, 2008 Description: JCB: MINI-REVIEW The cell biological basis of ciliary disease Wallace F. Marshall Department of Biochemistry and Biophysics, University of California, San Francisco, San Francisco, CA 94143 THE JOURNAL OF CELL BIOLOGY Defects in cilia cause a broa... Date Added: 2009-06-11 19:46:09 |
| mm545060213.053106.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.762 107.809 -72.724 43.323 -70.281 43.083 5.269 -71.502 43.203 3... Date Added: 2009-06-11 19:46:48 |
| mm545060720.060506.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 197.451 106.562 -71.311 44.541 -69.256 43.556 17.177 -70.284 44.048 6... Date Added: 2009-06-11 19:47:11 |
| mm545080513.080218.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 195.784 105.662 -75.435 49.115 -73.62 50.429 22.046 -74.528 49.772 4... Date Added: 2009-06-11 19:48:09 |
| mm545071120.070912.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dgfk[nmi] dduluth[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.44 107.095 -91.492 45.664 -89.056 46.227 13.456 -90.274 45.945 307.145 91.294 ... Date Added: 2009-06-11 19:48:57 |
| mm545053013.052906.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.95 107.911 -59.9 43.004 -60.1 44.796 2.405 -60 43.9 4... Date Added: 2009-06-11 19:49:19 |
| mm515072720.072612.txt Path: Harvard >> MM >> 515 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] dchibougamau[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 198.241 106.988 -68.133 44.422 -69.348 45.986 14.283 -68.74 45.20... Date Added: 2009-06-11 19:50:09 |
| mm545080220.073118.txt Path: Harvard >> MM >> 545 Fall, 2009 Description: time[min] xsec[km] xsec[nmi] x1.1st y1.1st x2.1st y2.1st xsec2[nmi] ctr.x ctr.y dpease[nmi] djeffco[nmi] dbangor[nmi] arpt1.1st arpt2.1st arpt1.2nd arpt2.2nd 0 199.055 107.428 -65.67 42.916 -66.57 44.584 10.478 -66.12 43.75 2... Date Added: 2009-06-11 19:50:35 |
| 511-ICN-040213v0.doc Path: USC >> CSCI >> 511 Fall, 2008 Description: USC C S E University of Southern California Center for Software Engineering CS511 Winter/Spring 2004 In Class Notes 02/13/04 2009 AW Brown, JP Alstad, & USC-CSE a33116d9e9d1134581f45ca15e1f023e9a33099a.doc1 v0.0 - 06/03/09 USC C S E Unive... Date Added: 2009-06-11 19:54:59 |
| ch02ReadGuide.pdf Path: Salem State >> CSC >> 215 Fall, 2009 Description: CSC215-01 Instructor: Beifang Yi Reading/Practicing Guidelines for Chapter 2: ALL the sections and their Section Q&Es. =The Important Notice= This Chapter is one of the most important chapters of the textbook. The above are only Reading assignment... Date Added: 2009-06-11 19:55:36 |
| figure2.ps Path: UCCS >> CS >> 993018 Fall, 2009 Description: %! %BoundingBox: 0 0 0 0 %Creator: funes.rockefeller.edu:marcelo(Marcelo Magnasco,SHA B7,212 327 8542,Rockefeller University) %Title: Unix plot file %CreationDate: Mon May 11 16:57:05 1998 %DocumentFonts: Courier %EndComments save 50 dict begin /pspl... Date Added: 2009-06-11 19:56:08 |
| ps3sol13.pdf Path: Cornell >> P >> 214 Fall, 2009 Description: ... Date Added: 2009-06-11 19:56:20 |
| ps9.ps Path: Cornell >> P >> 214 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.66a Copyright 1986-97 Radical Eye Software (www.radicaleye.com) %Title: HW9.dvi %Pages: 3 %PageOrder: Ascend %BoundingBox: 0 0 612 792 %EndComments %DVIPSCommandLine: dvips HW9 %DVIPSParameters: dpi=600, compressed %... Date Added: 2009-06-11 19:56:25 |
| W6_stud_H_atom_2.pdf Path: San Jose State >> MATE >> 153 Fall, 2008 Description: Week 6 Periodic Table Announcements MatE 153, Dr. Gleixner 1 Hydrogen Atom (Solution 3) Use the V from Coulombic potential energy of one proton and one electron (H atom) in S. d 2 2m (E V ) = 0 + dx 2 h 2 Zq 2 V(r) = 4 0 r Get a ... Date Added: 2009-06-11 19:57:28 |
| Copy of W14_stud_magnetic_field.ppt Path: San Jose State >> MATE >> 153 Fall, 2008 Description: Week 14: Magnetic Fields Announcements MatE 153, Dr. Gleixner 1 General Concept Behind Magnetism Circulating current sets up a magnetic moment ( m) perpendicular to the current This results in a B field (magnetic field) that must terminate back... Date Added: 2009-06-11 19:57:29 |
| Problems 9b and c .pdf Path: Austin Peay >> MATH >> 1410 Fall, 2009 Description: http:/www.apsu.edu/witherspoonm/math1410/F2005Tests1410/Review1Key/Page5.JPG http:/www.apsu.edu/witherspoonm/math1410/F2005Tests1410/Review1Key/Page5.JPG (1 of 2)4/7/2006 7:54:20 AM http:/www.apsu.edu/witherspoonm/math1410/F2005Tests1410/Review1Key... Date Added: 2009-06-11 19:57:52 |
| lecture19.ppt Path: W. Alabama >> PSYCH >> 207 Fall, 2009 Description: Psych 207 Final Exam Mon 18 April 9:00-12:00 RCH 301,302,305,306,309 Room RCH 301 RCH 302 RCH 305 RCH 306 RCH 309 Last Name AE FL MQ RS TZ Thinking and Problem Solving Chapter 10 The Triangle Problem Move three points to get the triangle to poin... Date Added: 2009-06-11 20:00:26 |
| lecture07.pdf Path: Valparaiso >> P >> 111 Fall, 2009 Description: Physics 111 Tuesday, September 14, 2004 Ch 4: Projectile Motion - last example Ch 5: Newtons Laws Intro Force Tues Sept .14. Announcements Phys 111 Help this week: Wednesday, 8 - 12 am in NSC 118/119 Midnight Madness! No help session this Sund... Date Added: 2009-06-11 20:00:34 |
| Checklist_Exp9.pdf Path: UNC Charlotte >> ETEE >> 3156 Fall, 2008 Description: NAME:_ Short Report Format Experiment 9: JFET Biasing 1. Title/Cover Page _ Experiment title, course & section numbers, author name, date performed, lab partners, due date, date submitted, lab instructor\'s name, word processor used, schematic captu... Date Added: 2009-06-11 20:02:39 |
| v04-n053.txt Path: Air Force Academy >> V >> 575 Fall, 2009 Description: From: owner-cdn-firearms-digest@sfn.saskatoon.sk.ca on behalf of Cdn-Firearms Digest [owner-cdn-firearms-digest@sfn.saskatoon.sk.ca] Sent: Tuesday, 28 August, 2001 21:06 To: cdn-firearms-digest@broadway.sfn.saskatoon.sk.ca Subject: Cdn-Firearms Diges... Date Added: 2009-06-11 20:03:02 |
| UntimedSQSS-Ex2.pdf Path: UNF >> COP >> 4300 Spring, 2008 Description: Use the Executiv e to stop event simulation when \"door locked\" and arriv als = departures count Single-queue, single-server model using a stopping criteria other than time UntimedSQSS.mox 8 elapsed time (hours) arriv als departures B N door locked... Date Added: 2009-06-11 20:04:10 |
| VLP-RNGs.pdf Path: UNF >> COP >> 4300 Spring, 2008 Description: GFSR Pseudorandom Number Generation The linear congruential method for pseudorandom number generation is commonly used, and is easily implemented in any high level language; however, the period length of its random number stream is limited by the un... Date Added: 2009-06-11 20:04:16 |
| UntimedSQSS-Ex2.pdf Path: UNF >> COP >> 4300 Spring, 2008 Description: UntimedSQSS.mox Use the Executive to stop simulation when \"door locked\" and arrivals = departures count Single-queue, single-server model using a stopping criteria other than time 8.397 elapsed time (hours) arrivals departures B A a=b Y N door lock... Date Added: 2009-06-11 20:04:57 |
| Cx1-cpp.pdf Path: UNF >> COP >> 3601 Fall, 2008 Description: The C Preprocessor: an example program exercising it\'s main features main() /* Whether or not you provide preprocessor commands, the preprocessor does a few things for you automatically: 1. by default it replaces all C comments by single spaces 2. al... Date Added: 2009-06-11 20:05:28 |
| hw2.pdf Path: UGA >> M >> 5200 Fall, 2009 Description: Math 5200/7200, Fall 2007 Second Assignment These problems are due Monday, Feb. 4. First of all, so problems 2.4.7, 2.4.9, 2.4.10, 2.6.2, and 2.6.3 from the text. Then do: a. Proposition 30 of Euclid states: Straight lines parallel to the same straig... Date Added: 2009-06-11 20:07:42 |
| appendixa.doc Path: Iowa State >> MAY >> 0214 Fall, 2009 Description: APPENDIX A Introduction The goal of this project is to develop a guide that aids users in the decision analysis procedure. The guide include an outline of a list of topics that are used in the decisionmaking process along with extensive information ... Date Added: 2009-06-11 20:08:00 |
| May07-11 Design Repor v1.doc Path: Iowa State >> MAY >> 0711 Fall, 2009 Description: Highway Deer Identification System Design Report May 07-11 Client: Senior Design Advisor: Dr. Degang Chen Team Members: Tony DeLouis Matt Bonneau Nathan Schoening Steven Schreiber REPORT DISCLAIMER NOTICE DISCLAIMER: This document was developed as a ... Date Added: 2009-06-11 20:08:34 |
| ChairEndProduct.doc Path: Iowa State >> MAY >> 0609 Fall, 2009 Description: Chair-Mounted Computer Workstation End-Product Design Senior Design May06-09 Client: Lockheed Martin Faculty Advisors: Arun Somani Zhao Zhang Team Members: Christian Baldus Isi Oamen David Roberts Shawn Yockey DISCLAIMER: This document was developed ... Date Added: 2009-06-11 20:08:44 |
| Notes 3_02.pdf Path: UCF >> EGN >> 3365 Fall, 2008 Description: 32 Chapter 3 / Structures of Metals and Ceramics FIGURE 3.1 For the facecentered cubic crystal structure: (a) a hard sphere unit cell representation, (b) a reduced-sphere unit cell, and (c) an aggregate of many atoms. (Figure c adapted from W. G. ... Date Added: 2009-06-11 20:09:51 |
| hines et al 2003.pdf Path: University of Alaska Fairbanks >> WLF >> 625 Fall, 2009 Description: The Auk 120(4):11511158, 2003 ON THE USE OF THE ROBUST DESIGN WITH TRANSIENT CAPTURERECAPTURE MODELS James E. Hines, William L. Kendall,1 and James D. Nichols United States Geological Survey, Patuxent Wildlife Research Center, Laurel, Maryland 20708... Date Added: 2009-06-11 20:10:46 |
| Ass13.pdf Path: Acton School of Business >> CHEM >> 151 Fall, 2008 Description: Ass 13 10: 45,51,65,98 11: 2,8,12 1 45) .05 moles of HAc + 0.02 moles NaAc in 500mL H20 this corresponds to [HAc]0=0.1 and [Ac-]0=.04 acid dissociation reaction is HAc + H2O = H3O+ + Ac[ H3O+ ][ Ac ! ] = 1.76x10 !5 Ka = [HAc ] [ H O ] = [ Ac ] *1... Date Added: 2009-06-11 20:14:32 |
| week05-05.ppt Path: Allan Hancock College >> COIT >> 13121 Fall, 2009 Description: #C#week05-05.ppt#}#\\SM#B#P+# X#D#AQl+5@HH + vZ[zKH}QrossOgn/T#c`6# [ f# ^0?WY AG#*_Y#SS#9i#o/\\WV^8va$f#kkk#k;#;\'N5#j9;tvvsC#0HmmRG}G#}}# ee8#T... Date Added: 2009-06-11 20:15:03 |
| 05_04_09.pdf Path: Arizona >> MATH >> 250 Fall, 2008 Description: ... Date Added: 2009-06-11 20:15:35 |
| icws4-C.pdf Path: Willamette >> MATH >> 142 Fall, 2009 Description: In-Class Assignment 4 MATH 142-02 Friday, March 9, 2007 Directions: Work neatly on a separate sheet of paper. Your group will hand in one write-up with everyone\'s name on it. DO NOT fold the corner over to hold everything together! Work together on e... Date Added: 2009-06-11 20:15:45 |
| log.txt Path: Washington >> V >> 12000 Fall, 2009 Description: 000 (45758.000.000) 01/31 07:10:42 Job submitted from host: <128.95.94.28:1098> . 001 (45758.000.000) 01/31 09:27:06 Job executing on host: <172.25.101.173:1056> . 010 (45758.000.000) 01/31 09:33:14 Job was suspended. Number of processes actually su... Date Added: 2009-06-11 20:16:53 |
| output.txt Path: Washington >> V >> 12017 Fall, 2009 Description: = running on = COMPUTERNAME=PHYSLAB-295QNB1 - local directory - Volume in drive C has no label. Volume Serial Number is 9843-D647 Directory of C:\\condor\\execute\\dir_3936 01/31/2008 07:10 AM <DIR> . 01/31/2008 07:10 ... Date Added: 2009-06-11 20:19:07 |
| submit.txt Path: Washington >> V >> 12261 Fall, 2009 Description: executable = allgamma_12261.bat universe = vanilla error = error.txt output = output.txt log = log.txt # set by submitting script Requirements= (OpSys = \"WINNT51\" ) initialdir = f:\\condor\\allgamma\\v13r9\\jobs12000-12499/12... Date Added: 2009-06-11 20:19:51 |
| lec14.4.pdf Path: Allan Hancock College >> COMP >> 1110 Fall, 2009 Description: Recursion (II) Recursive Data Structures Lists Consider an ordered list of birthdays of nieces and nephews: birthdays q Weve met recursive data structures before: s Lists s Stacks q Theyre recursive since one part can be identied as being of the ... Date Added: 2009-06-11 20:23:55 |
| Reproduction and cloning, fall 2008.ppt Path: UNC Charlotte >> BIOL >> 1110 Fall, 2008 Description: All you ever wanted to know about cloning but were afraid to ask! First we need to talk a little about \"normal\" reproduction . . . As you know, HAPLOID gametes are produced by meiosis During fertilization, the sperm cell encounters an egg cell and... Date Added: 2009-06-11 20:24:45 |
| ass5_CORA.xls Path: NJIT >> RLA >> 673 Fall, 2009 Description: Object / Component Oriented Requirements Analysis Program Template by Professor Paul G. Ranky, PhD, NJIT / MERC, ver. 5 Sound Recording Equiptment Enter customer rating for our product Enter customer rating for competitor C\'s product Enter customer r... Date Added: 2009-06-11 20:29:02 |
| jobsample1-cover.pdf Path: Penn State >> PMK >> 202 Fall, 2009 Description: Lou Slips xxx Locust Lane State College, PA 16801 September 11, 2000 Sharon Wilkerson Corporate Recruiter WinMill Software 420 Lexington Avenue Suite 307 New York, NY 10170 Dear Ms. Wilkerson: I am writing in response to the Internet Development Cons... Date Added: 2009-06-11 20:30:43 |
| gcnR_flux.txt Path: Berkeley >> ASTRO >> 00143708 Fall, 2009 Description: -7.81499 1 1 ... Date Added: 2009-06-11 20:31:05 |
| Slouching2_18falling.doc Path: Berkeley >> ECON >> 161 Fall, 2008 Description: 113 -XVIII. Falling into World War IIA. Hitler 1. From the Rhineland to Munich While other countries continued their painfully slow climbs out of the Great Depression, the German economy recovered rapidly. But peaceful spendingfueled recovery was no... Date Added: 2009-06-11 20:32:31 |
| c_hello.txt Path: San Diego State >> CS >> 575 Fall, 2009 Description: #include <stdio.h> #include \"mpi.h\" #include <math.h> /* This is a simple hello world program. Each processor prints out it\'s rank and the size of the current MPI run (Total number of processors). **/ int main(argc,argv) int argc; char *argv[]; {... Date Added: 2009-06-11 20:34:03 |
| 1FJ4_side_chain_dist.txt Path: UWO >> PFAM >> 00109 Fall, 2009 Description: 2 3 4.76563573933216 2 4 8.10810785572071 2 5 10.4067859111255 2 6 14.6132865913182 2 7 14.7214711900679 2 8 18.3962806295186 2 9 21.9574760844684 2 10 23.8779257683744 2 11 27.4696402961524 2 12 31.459096554097 2 13 31.633406455834 2 14 35.426020507... Date Added: 2009-06-11 20:36:02 |
| 1B02.count.txt Path: UWO >> COG >> 0207 Fall, 2009 Description: pos A C D E F G H I K L M N P Q R S T V W Y entropy 2 gapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgap 0 3 gapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgap 0 4 gapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgapgap 0 5 1... Date Added: 2009-06-11 20:38:17 |
| durbin-hmm.pdf Path: Emory >> CS >> 740 Fall, 2009 Description: ... Date Added: 2009-06-11 20:41:44 |
| radvt0.txt Path: Berkeley >> ASTRO >> 00335895 Fall, 2009 Description: # t1 t2 dt rad_min rad_max cts err scl bg bg_rat wt 0.206103 0.206422 0.000319 0. 16. 9.00 3.00 0.890093 0.000000 0.530794 1 0.206422 0.206746 0.000324 0. 16. 9.00 ... Date Added: 2009-06-11 20:41:51 |
| matlabPrimer35.pdf Path: Toledo >> CSC >> 2503 Fall, 2009 Description: MATLAB Primer Second Edition Kermit Sigmon Department of Mathematics University of Florida Department of Mathematics University of Florida Gainesville, FL 32611 sigmon@math.ufl.edu sigmon@ufpine.bitnet Copyright c 1989, 1992 by Kermit Sigmon Copyri... Date Added: 2009-06-11 20:42:45 |
| 360Spr08_Ch6_4up.pdf Path: Wisconsin >> SSC >> 360 Fall, 2009 Description: Example of a Two-Way Table The sinking of the Titanic in 1912 seemed to expose some sad facts of the class system of pre-World War I Britain. We can inquire about the relationship between class of service and survival by analyzing a two-way table. S... Date Added: 2009-06-11 20:43:03 |
| 35503_wk5.pdf Path: Wisconsin >> GEOG >> 355 Fall, 2008 Description: ... Date Added: 2009-06-11 20:43:34 |
| blog.txt Path: N. Michigan >> CS >> 460 Fall, 2008 Description: Your mission is to make a blog. The first page is a form where the user can enter the title (textbox) body (textarea), and their current mood( radio buttons). The second page shows blog entries, one after another. All data must be stored in files.... Date Added: 2009-06-11 20:44:49 |
| Pre-Suffixes List.doc Path: UNC Wilmington >> PR >> 141 Fall, 2009 Description: Greek - - - - - - - - - - - - English a- General Meaning negation Examples atheist, agnostic, atypical amphitheatre, amphibian Anabaptist, anagram Antichrist, antithesis apostasy, apocalypse diameter, dialogue dysfunction, dysentery euthanasia, ... Date Added: 2009-06-11 20:45:10 |
| topography.doc Path: University of Alaska Fairbanks >> NRM >> 341 Fall, 2009 Description: NRM341 Spring 2008 Page#1 of 3 Topographic Analysis Tools Due noon Thursday 17-April-2008 Use the ArcGIS Help, or the website: http:/webhelp.esri.com/arcgisdesktop/9.2/ to answer the following questions about the following Spatial Analyst topograp... Date Added: 2009-06-11 20:46:23 |
| chapter4.ppt Path: Duke >> CPS >> 006 Fall, 2009 Description: Control, Functions, Classes q We\'ve used builtin types like int and double as well as the standard class string and the streams cin and cout Each type supports certain operations and has a specific range of values What are these for the types we... Date Added: 2009-06-11 20:47:08 |
| M&Mhw03.pdf Path: Washington University in St. Louis >> MATH >> 109 Fall, 2008 Description: Homework 3 Math 109 / Music 109A, Spring 2003 Due Wednesday, February 26. (1) Identify these chords by root note and suffix (e.g., G m7 or B aug). In the case of augmented or diminished seventh chords, take the root to be the lowest note. (a) ... Date Added: 2009-06-11 20:48:33 |
| Note-2810.pdf Path: Neumont >> IFT >> 2810 Fall, 2009 Description: Devoir1 1016405 3066002 6087805 7098101 10068102 12085608 15056605 20048005 21047804 26047607 27086906 27557601 20 14 9 14 17 17 20 * 10 20 20 17 Devoir 2 16 18 14 20 16 18 16 * 18 20 20 7 Intra 54 72 61 40 50 65 49 35 24,5 92 99 * ... Date Added: 2009-06-11 20:48:48 |
| WegmannN01.pdf Path: Georgia Tech >> ISYE >> 8851 Fall, 2009 Description: Conceptual Modeling of Complex Systems Using an RM-ODP Based Ontology Alain Wegmann, Andrey Naumenko Institute for computer Communications and Applications Swiss Federal Institute of Technology Lausanne EPFL-DSC-ICA CH-1015 Lausanne, Switzerland {al... Date Added: 2009-06-11 20:49:11 |
| Day7.ppt Path: Virginia Tech >> MATH >> 1206 Fall, 2008 Description: Question from Test 1 Liquid drains into a tank at the rate 21e-3t units per minute. If the tank starts empty and can hold 6 units, at what time will it overflow? A. log(7)/3 B. (1/3)log(13/7) C. 3 log (13/7) D. 3log(7) E. Never Chapter 5.3 &... Date Added: 2009-06-11 20:50:08 |
| 4920pages61-70.pdf Path: Maryville MO >> MATH >> 4920 Fall, 2009 Description: ... Date Added: 2009-06-11 20:51:02 |
| incompressible_ns_fv_unsteady.pdf Path: Penn State >> PXM >> 260 Fall, 2009 Description: Journal of Computational Physics 192 (2003) 277311 www.elsevier.com/locate/jcp Parallel unsteady incompressible viscous flow computations using an unstructured multigrid method Chin Hoe Tai, Yong Zhao * School of Mechanical and Production Engineerin... Date Added: 2009-06-11 20:51:13 |
| 11-17-05.txt Path: University of Hawaii - Hilo >> CENT >> 130 Fall, 2009 Description: NFS file sharing Unix and linux native file sharing system Linux NFS layer 567 windows need client for nfs SMB NFS client /mnt/nfsmount mount a network nfs share create a directory for the mount mount ipaddress /nffsshare or name directory /m... Date Added: 2009-06-11 20:51:35 |
| hw_le26_2006.pdf Path: Rose-Hulman >> EM >> 406 Fall, 2009 Description: Lecture 26 Homework Problem 26.1 Determine the natural frequencies and mass normalized modes for this system. x1 k m 2k 2m x2 3k 2m x3 2k To get a copy of a portion of a Matlab session type diary on to start writing to a file, and diary off when you... Date Added: 2009-06-11 20:53:13 |
| problem1_input1.txt Path: RIT >> CS >> 800 Fall, 2008 Description: 3 ... Date Added: 2009-06-11 20:54:06 |
| problem2_input1.txt Path: RIT >> CS >> 800 Fall, 2008 Description: 3 ... Date Added: 2009-06-11 20:54:07 |
| problem2_output2.txt Path: RIT >> CS >> 800 Fall, 2008 Description: 0 2 4 6 8 10 ... Date Added: 2009-06-11 20:54:08 |
| hw4_pr3_out1.txt Path: RIT >> CS >> 800 Fall, 2008 Description: 3 ... Date Added: 2009-06-11 20:54:15 |
| hw6_pr2_out1.txt Path: RIT >> CS >> 800 Fall, 2008 Description: 3 ... Date Added: 2009-06-11 20:54:19 |
| Overview2Sp07Web.pdf Path: N. Illinois >> BIOS >> 106 Fall, 2008 Description: Topics Environmental problems occur at different geographical scales How does science work? Human dimension of environmental problems Environmental perspectives 1 Environmental Science - Goal Environ. problems: steps in addressing Identify, Un... Date Added: 2009-06-11 20:56:08 |
| Phase-Behaviour.ppt Path: St. Francis IL >> CHEM >> 231 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|01 Dec 2008 16:10:13 -0000 vti_extenderversion:SR|6.0.2.8161 vti_backlinkinfo:VX|Presentations-2007.htm Presentations.htm vti_author:SR|WEBFX\\gmarango vti_modifiedby:SR|WEBFX\\gmarango vti_timecreated:TR... Date Added: 2009-06-11 20:58:32 |
| 204b-2009-L6.pdf Path: UCSB >> E >> 204 Fall, 2009 Description: Dynamic Programming Under Certainty 6 Marek Kapicka, Econ 204b April 15, 2009 Today We will 1. Look at the dynamics of the solution in the optimal growth model 2. Look at stochastic dynamic programming 6.1. Example: Optimal Growth v (k ) = 0y f (... Date Added: 2009-06-11 21:03:21 |
| sight.doc Path: U. Houston >> QUEST >> 4297 Fall, 2009 Description: Yolanda Cruz HISD Explorations I. Lesson Objectives * Target Age: Kindergarten * TEKS: Science: (2) Scientific processes. The student develops abilities necessary to do scientific inquiry in the field and the classroom. The student is expected to: (B... Date Added: 2009-06-11 21:08:31 |
| Physics308PJL2008Lecture19.pdf Path: Haverford >> PHYSICS >> 308 Fall, 2009 Description: ... Date Added: 2009-06-11 21:08:43 |
| 4166-2007-sem1-topic05-07.rtf Path: Allan Hancock College >> LAW >> 4166 Fall, 2009 Description: Topic 5 The Migration Act Immigration and Discretion Executive versus the Judiciary Evolution of the structure of the Migration Act The 1958 Act repealed the Immigration Restriction Act 1901 but continued its policies An instrument of control 2nd... Date Added: 2009-06-11 21:09:27 |
| II_lin_1420a.pdf Path: Hamline >> SAVE >> 110207 Fall, 2009 Description: LINGFIELD, SURREY Dame Eleanor Cobham M.S. IV London: \"D\" series1 SS Peter and Paul II lin 1420a A full-length, full-face effigy of Dame Eleanor, the daughter of Thomas Colepeper, first wife of Sir Reginald Cobham, third Baron Cobham of Sterboroug... Date Added: 2009-06-11 21:10:53 |
| Y_ayl_1507.pdf Path: Hamline >> SAVE >> 110207 Fall, 2009 Description: AYLSHAM, NORFOLK Thomas Wymer M.S. V Norwich: series 6a1 St. Michael Y ayl 1507 The effigy of Thomas Wymer, \"worsted wever,\" a benefactor to the Church both during life and after death, 1507, in shroud. Local. Inscription in Latin. On the floor of... Date Added: 2009-06-11 21:11:24 |
| license.txt Path: Texas >> ISCHOOL >> 2081 Fall, 2009 Description: License granted by Jennifer Lindley (jlindley@ischool.utexas.edu) on 2007-08-13T01:16:57Z (GMT): NON-EXCLUSIVE PRESERVATION AND DISTRIBUTION LICENSE By signing and submitting this license, you (the author(s) or copyright owner) grants to the Schoo... Date Added: 2009-06-11 21:12:25 |
| 13table20.pdf Path: Oregon State >> SR >> 1053 Fall, 2009 Description: Table 20. 1999 fourth-cut protein yield, TDN yield, CA TDN yield, PNW TDN yield, DDM yield, NEL, ENE, ME, NEM, NEG, and pounds of N/ton of DM for the 1998 planted alfalfa fall dormancy trial at Central Oregon Agricultural Research Center, Madras, Ore... Date Added: 2009-06-11 21:14:27 |
| Chesapeake.pdf Path: Penn State >> PLC >> 103 Fall, 2009 Description: Penn State Joins Chesapeake Research Consortium February 6, 2004 Penn State recently became a member of the Chesapeake Research Consortium (CRC). The CRC is a non-profit corporation that has had long-standing involvement in research on problems affec... Date Added: 2009-06-11 21:17:05 |
| Chapter10 2004.ppt Path: Wisc Stevens Point >> BIOL >> 101 Fall, 2009 Description: Fig. 10.1b Fig. 10.2a Fig. 10.2b Fig. 10.2c Fig. 10.3 Fig. 10.6 Fig. 10.7 Fig. 10.8 Fig. 10.10a Fig. 10.10b Table 10.1 Table 10.2 ... Date Added: 2009-06-11 21:17:16 |
| tp1.pdf Path: Neumont >> IFT >> 2240 Fall, 2009 Description: IFT2240 Travail pratique #1 22/01/06 \"BOOT LOADER\", CLAVIER ET SOURIS Marc Feeley Le TP1 a pour but de vous introduire au syst`me d\'exploitation minimal que vous devrez tendre de e e diverses faons dans les travaux pratiques. Nous utiliserons le no... Date Added: 2009-06-11 21:18:27 |
| KEY Problem Set 2.doc Path: Middlebury >> PHIL >> 0212 Fall, 2009 Description: NB: The following is a composite of some of the best student answers to the problems, combined with some of my own remarks. Method of Agreement: Analyze each of the following scientific reports, explaining how the pattern of the Method of Agreement i... Date Added: 2009-06-11 21:20:58 |
| Team Member Roles.pdf Path: RIT >> P >> 09011 Fall, 2009 Description: KGCOE MSD: Work Breakdown Structure and Team Roles P09011: Apparatus for Visual and Auditory Object Recognition Study Work Breakdown Structure and Team Roles Lead meetings. Actuator/Motor and Battery Research. Organize technical issues to... Date Added: 2009-06-11 21:21:10 |
| LabVIEW Introduction - with notes.pdf Path: Mines >> PHGN >> 384 Fall, 2008 Description: Virtual Instrumentation With LabVIEW 1 Course Goals Understand the components of a Virtual Instrument Introduce LabVIEW and common LabVIEW functions Build a simple data acquisition application Create a subroutine in LabVIEW Work with Arrays, C... Date Added: 2009-06-11 21:21:27 |
| Review.pdf Path: Mines >> PHGN >> 341 Spring, 2008 Description: \'{OIJ KNOW, SC.HooL WOUltlNI\" BE SC Bf>.D IF \'(Cl\\! \\) IDt{T I-l~NE 10 GO EVER\'{ D~\'{. A lOI\" Of mlNGS ARE U\\<.E TII,!>\'\\. N<JBOI)\'f A5K5 ME H()W 111\\NGS QUGU 1<J \\3E. lVE. GClT 10N5 OF IDEI\\S! I ~.J tf 0 ItJ I\' Ikt Co ok \\11.\' cd (ty ; . l... Date Added: 2009-06-11 21:21:30 |
| Boyce.doc Path: Willamette >> CLA >> 100 Fall, 2009 Description: ECON 122-05 Fall `06 Nathan Sivers Boyce Handout #1 August 30, 2006 Syllabus PRINCIPLES OF MICROECONOMICS Course Goals: This course is intended to introduce you to the fundamentals of microeconomic analysis. My primary goal for the semester is to i... Date Added: 2009-06-11 21:21:43 |
| WassmerEdwardsCausesSprawl.pdf Path: CSU Sacramento >> PPA >> 20703 Spring, 2009 Description: Causes of Urban Sprawl (Decentralization) in the United States: Natural Evolution, Flight from Blight, and the Fiscalization of Land Use* Robert W. Wassmer Professor Department of Public Policy and Administration Sacramento State University Sacramen... Date Added: 2009-06-11 21:23:42 |
| slide5.ps Path: Kentucky >> CS >> 623 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvipsk 5.58f Copyright 1986, 1994 Radical Eye Software %Title: all.dvi %Pages: 1 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: A4 %EndComments %DVIPSCommandLine: dvips -o slide5.ps all.dvi %DVIPSParameters... Date Added: 2009-06-11 21:24:10 |
| exp12-06.txt Path: Purdue >> STAT >> 511 Fall, 2008 Description: \"moistcon\",\"filtrate\" 77.9,125.3 76.8,98.2 81.5,201.4 79.8,147.3 78.2,145.9 78.3,124.7 77.5,112.2 77,120.2 80.1,161.2 80.2,178.9 79.9,159.5 79,145.8 76.7,75.1 78.2,151.4 79.5,144.2 78.1,125 81.5,198.8 77,132.5 79,159.6 78.6,110.7 ... Date Added: 2009-06-11 21:25:50 |
| ex11-55.xls Path: Purdue >> STAT >> 511 Fall, 2008 Description: Test Run 1 Iron Extraction (%) 7 11 7 12 21 41 27 48 28 51 33 57 70 95 77 99 ... Date Added: 2009-06-11 21:25:56 |
| exp13-19.xls Path: Purdue >> STAT >> 511 Fall, 2008 Description: y 60.00 61.00 65.00 30.50 63.50 65.00 44.00 52.00 54.50 30.00 26.00 23.00 54.00 36.00 53.50 57.00 33.50 34.00 44.00 33.00 39.00 53.00 38.50 39.50 36.00 8.50 30.00 29.00 26.50 24.50 26.50 x1 2400 2450 2450 2500 2500 2500 2700 2700 2700 2750 2775 2800... Date Added: 2009-06-11 21:26:19 |
| ex01-28.xls Path: Purdue >> STAT >> 511 Fall, 2008 Description: c1 20.90 19.60 20.40 20.30 20.80 20.60 20.50 20.40 19.90 19.80 19.50 20.20 16.50 18.30 18.70 19.60 20.00 20.00 19.50 19.60 19.10 18.80 18.30 17.60 17.20 17.80 18.70 19.00 19.00 18.60 18.80 19.00 18.50 18.30 17.50 16.90 17.00 17.80 18.10 18.80 18.90 1... Date Added: 2009-06-11 21:26:53 |
| projdocreq2006.rtf Path: Walla Walla University >> ENGR >> 480 Fall, 2009 Description: ENGR480 Final Documentation Requirements 2006-05-31 The documentation for your lab project will be in the form of a manual for the operation of your machine. This manual must include: Instructions for: a. specifying puzzle pieces b. starting the m... Date Added: 2009-06-11 21:27:38 |
| outline.pdf Path: Virginia Tech >> AOE >> 2074 Fall, 2008 Description: AOE 2074 Introduction to Numerical Methods 22 August 2000 Instructor: Dr. E.M. Cliff Office: 219 C Randolph Hall 231-9059 or The Wright House 231-7667 Home Phone: 552-4411 e-mail : cliff@icam.vt.edu Office Hours: M -W 2:00pm - 4:00pm (Randolph 219 ... Date Added: 2009-06-11 21:28:41 |
| assoc.doc Path: Bucknell >> CS >> 208 Fall, 2009 Description: \\libdoc{assoc}{Association lists} \\label{sec:lib:assoc} \\makebox[\\linewidth]{\\hfill Authors: \\emph{Richard A. O\'Keefe, L.Damas, V.S.Costa and Markus Triska}\\vspace{2ex} \ oindent Elements of an association list have 2 components: A (unique) \\emph{key... Date Added: 2009-06-11 21:28:49 |
| practice_test2.pdf Path: Kennesaw >> MATH >> 3332 Fall, 2008 Description: Spring 2009 MATH 3332 Practice test 2 1. A package of 8 batteries is checked to determine if there are any dead batteries. Four batteries are checked. If one or more are dead, the package is not sold. What is the probability that the package will no... Date Added: 2009-06-11 21:29:01 |
| grayCode.pdf Path: RIT >> CIS >> 20083 Fall, 2009 Description: ... Date Added: 2009-06-11 21:31:40 |
| en101fall04_4C28.pdf Path: S. Connecticut >> ENG >> 101 Fall, 2009 Description: English 101: Composition II / Research Writing Course Topic: \"Racial Difference Should we work for color-blindness or color-consciousness? SCSU English Department Fall, 2004 M/W 3:25-4:40 pm & 4:50-6:05 pm Engleman B305 Prof. ... Date Added: 2009-06-11 21:37:12 |
| c.pdf Path: Old Dominion >> CS >> 475 Fall, 2008 Description: 535 C. Parameter Estimation Summary This appendix contains a summary of the parameter estimates for the discrete and continuous stationary parametric models presented in this text. See Section 9.2.1 for a discussion of how to hypothesize a model (... Date Added: 2009-06-11 21:38:37 |
| writtencommunicationPSY313.ppt Path: CSU San Marcos >> PSY >> 313 Fall, 2009 Description: Chapter 12 Written Communications in Job Hunting Presentation Overview: Chapter 12 Types of job search letters Writing resumes Resume styles Alternative resumes Career objectives Resume vs. vita References Record-keeping Job searching on t... Date Added: 2009-06-11 21:39:35 |
| abs028.pdf Path: Stanford >> C >> 0805263 Fall, 2009 Description: MUTAU NEUTRINO REFRACTION AND COLLECTIVE THREE-FLAVOR TRANSFORMATIONS IN SUPERNOVAE S. Pastor (1), A. Esteban-Pretel (1), G.G. Raffelt (2), R. Toms (3), G. Sigl (3) (1) Institut de Fsica Corpuscular (CSICUniversitat de Valncia), Valncia, Spain (2) Ma... Date Added: 2009-06-11 21:40:39 |
| exam-3.pdf Path: Cal Poly Pomona >> ECE >> 209 Fall, 2009 Description: California State Polytechnic University, Pomona Electrical & Computer Eng. Dr. Zekeriya Aliyazicioglu ECE 209 - 01 Network Analysis II Exam # 3 Name:_ 1. Find f(t) for the following function November 14, 2001 (35 point) 25s 2 + 86s + 40 F (s) = s... Date Added: 2009-06-11 21:40:57 |
| retail service assignment.doc Path: UF >> MAR >> 7786 Fall, 2008 Description: December 5 Retailing and Service Issues Kaltcheva, Velitchka and Barton Weitz, \"When Should a Retailer Create An Exciting Store Environment?\" Journal of Marketing, 79(January 2006), 107-118. (Soo and Park) Stephen Hoch, Eric Bradlow, and Brian Wansi... Date Added: 2009-06-11 21:41:15 |
| grassroots.doc Path: Iowa State >> MR >> 0420 Fall, 2009 Description: Des Moines Register 04-15-07 Grassroots FFA leadership event starts Monday at ISU The 79th Iowa FFA Leadership Conference will be held Monday and Tuesday at the Iowa State Center in Ames. Chapter delegates and Iowa FFA officers will conduct the organ... Date Added: 2009-06-11 21:41:44 |
| h270.ps Path: Arizona >> Q >> 1545 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:56:51 2001 %DocumentData: Clean... Date Added: 2009-06-11 21:42:48 |
| h190.ps Path: Arizona >> Q >> 1229 Fall, 2009 Description: %!PS-Adobe-3.0 %BoundingBox: 54 54 558 738 %Title: Graphics produced by IDL %For: mmorita@lithops.as.arizona.edu, /net/qso/d5/mmorita/HST/HSTfinal3.5 %Creator: IDL Version 5.4 (sunos sparc) %CreationDate: Tue Jan 16 18:40:25 2001 %DocumentData: Clean... Date Added: 2009-06-11 21:43:16 |
| 12-Cache.2p.pdf Path: UCSC >> CMPE >> 110 Winter, 2008 Description: Mon Jan 2 17:20:12 PST 2006 <> Page 1 Rel. speed: 1 registers MEMORY ADDRESS 1-2 on-chip cache data not in registers data Mon Jan 2 17:20:12 PST 2006 is it here? N 2-5 off... Date Added: 2009-06-11 21:43:26 |
| Reli207.S19.PROPHET2.ppt Path: UVA >> RELI >> 207 Fall, 2008 Description: THE PROPHET/THE STATESMAN MUSLIM UMMA AFTER THE HIJRA TO MEDINA THE GENESIS OF UMMA Historical unfolding of the social challenge Acceptance of God also required acceptance of Muhammad\'s leadership The private and the public intertwined The first... Date Added: 2009-06-11 21:43:35 |
| birds.doc Path: U. Houston >> CUIN >> 3113 Fall, 2008 Description: Parrot Facts By Kayla What do they eat? Where do they live? How do they survive? The most interesting fact that I learned about PARROTS is Woodpecker Facts By Courtney M. What do they eat? Where do they live? How do they survive? The most in... Date Added: 2009-06-11 21:44:46 |
| Fortune Favors the Bold.ppt Path: UNC Wilmington >> MGT >> 455 Fall, 2009 Description: Fortune Favors the Bold Lester Thurow MIT Global Trends - A general increase in the development of technology The Third Industrial Revolution - Low cost country (LCC) manufacturing - seeking the lowest costs area to manufacture / assemble product... Date Added: 2009-06-11 21:45:07 |
| Chapter08.ppt Path: ECPI >> CIS >> 202 Fall, 2009 Description: CCNA Guide to Cisco Networking Chapter 8: Routing Protocols and Network Address Translation CCNA Guide to Cisco Networking 1 Objectives Understand the purpose and operation of network address translation (NAT) Configure static NAT, dynamic NAT, ... Date Added: 2009-06-11 21:47:58 |
| as5-key.pdf Path: Arkansas Little Rock >> CS >> 229 Fall, 2009 Description: Key by Nicholas M. Boers CMPUT 229 CMPUT 229 COMPUTER ORGANIZATION AND ARCHITECTURE (I) Written Assignment 5 Due before Class, Wednesday December 6, 2006 1. Register $f2 contains 0x3F000000 and Register $f4 contains 0xC0800000. What are the values... Date Added: 2009-06-11 21:48:40 |
| error.txt Path: Washington >> JOBS >> 60121 Fall, 2009 Description: Starting test Glast-Gaudi job with job options file joboptions.txt Current time: Wed Feb 13 18:47:13 2008 ( 0 s elapsed) Area not found in title: assuming 60000 cm^2 Current time: Wed Feb 13 19:59:36 2008 ( 4343 s elapsed) ... Date Added: 2009-06-11 21:50:12 |
| output.txt Path: Washington >> JOBS >> 60026 Fall, 2009 Description: = running on = COMPUTERNAME=B280WS3 - local directory - Volume in drive C has no label. Volume Serial Number is 7A24-68F3 Directory of C:\\condor\\execute\\dir_1056 02/13/2008 02:00 PM <DIR> . 02/13/2008 02:00 PM <D... Date Added: 2009-06-11 21:50:14 |
| log.txt Path: Washington >> JOBS >> 60000 Fall, 2009 Description: 000 (59411.000.000) 02/13 11:17:28 Job submitted from host: <128.95.94.28:1092> . 009 (59411.000.000) 02/13 11:32:24 Job was aborted by the user. via condor_rm (by user burnett) . 000 (59611.000.000) 02/13 11:50:18 Job submitted from host: <128.95.9... Date Added: 2009-06-11 21:50:44 |
| Exam 3B Solns.pdf Path: Texas El Paso >> MATH >> 1312 Fall, 2008 Description: ... Date Added: 2009-06-11 21:53:35 |
| hws6.pdf Path: Virginia Tech >> ST >> 5044 Fall, 2009 Description: STAT5044: Regression and ANOVA, Fall 2007 The Solution of Homework #6 Inyoung Kim Problem# 1. 1.1 > astime<-data5[,1] > sigtype<-data5[,2] > sigtype [1] p p p p p s s s s s f f f f f Levels: f p s > > contrast.mat<-cbind(c(-1/2,1,-1/2),c(1,0,-1) > c... Date Added: 2009-06-11 21:55:22 |
| P211_C5_solutions_Sp09.pdf Path: Ferris State >> P >> 211 Fall, 2009 Description: Chapter 5 Solutions C.W. Fay February 19, 2009 19, 33, 51, 58, 64, 76, 102,11, 45, 52, 74, 85, 95, 101 Assigned 1 Problem 5.19 A 500kg lightweight helicpoter ascends from the ground with an acceleration of 2.00m/s2 . Over a 5.00s interval, what is... Date Added: 2009-06-11 21:56:56 |
| P212_Electron.pdf Path: Ferris State >> FAYC >> 212 Fall, 2009 Description: 13 The Electron OBJECTIVES The objective of this lab is to measure fundamental properties related to the formation of quantum mechanics. The quantization of charge in the electron, and plank\'s constant. THEORY Calculating the charge to mass ratio. ... Date Added: 2009-06-11 21:57:09 |
| a.fessler.congressrecordsaddam.cq.92.doc Path: Los Angeles Southwest College >> POLI >> 740 Fall, 2009 Description: Title: Congress\' record on Saddam: Decade of talk, not action. (cover story) Authors:Fessler, P. Source:Congressional Quarterly Weekly Report; 4/27/91, Vol. 49 Issue 17, p1068, 10p, 1 illustration, 17bw CONGRESS\' RECORD ON SADDAM DECADE OF TALK, NOT ... Date Added: 2009-06-11 21:57:39 |
| Quiz06v0.pdf Path: Scranton >> C >> 134 Fall, 2009 Description: CMPS 134 Fall 2008 Quiz 06 v0 Illustration Name:_ 1. Consider the following program. import java.util.Scanner; public class Program { public static void main(String[] args) { Scanner keyboard = new Scanner(System.in); final int LIMIT = 10; int Di... Date Added: 2009-06-11 21:58:17 |
| 102405_A_Lee.doc Path: UNC >> EC >> 434 Fall, 2009 Description: Adrian Lee October 24th, 2005 German Historicism and American Institutionalism 1. Thorstein Velben: Iconoclast Father of Institutionalism Defined instincts of humans Parenthood, workmanship and idle curiosity-produce high quality efficient product... Date Added: 2009-06-11 22:01:45 |
| joavi1.doc Path: Columbia >> DJ >> 114 Fall, 2008 Description: CBS Semester 1 David Juran Statistics Midterm Cheat Sheets Descriptive Statistics: Term Sort Mean Meaning Sort values in increasing order Average Population Formula N Sample Formula n Example {1,16,1,3,9} {1,1,3,9,16} = Median Mode Variance The m... Date Added: 2009-06-11 22:02:01 |
| History9 Va Montecillo.pdf Path: Texas Tech >> LARC >> 1302 Fall, 2008 Description: Architect Politician Horticulturist Scientist Beer Brewer Thomas Jefferson Third President 1801-1809 Monticello The Vegetable Garden The Fruit Garden The Flower Garden The Vegetable Garden Source of food. Laboratory experiments -50 varieties of... Date Added: 2009-06-11 22:03:34 |
| jan12z.txt Path: University of Illinois, Urbana Champaign >> ATMOS >> 20081205 Fall, 2009 Description: UPPER AIR CALCULATIONS AND PLOTTING (Ver 5.48.1-LINUX-X11) Current filename: /mnt/noaaport/nwstg/convert/08120500_upa.wxp Date: 0000Z 5 DEC 08 Searching for KJAN. Searching the city database file for: KJAN . Date:0000Z 5 DEC 08 Station: KJAN... Date Added: 2009-06-11 22:03:46 |
| class44_01may.pdf Path: Colorado >> PHYS >> 2130 Fall, 2008 Description: AnnouncementsforMay1. Homeworkassignmentduetoday. FinalExamMonday,May4,4:307:00PM,inDUANE G1B20.WillbecumulaLvebutwithemphasisonmaterial coveredsincelastMidterm;ie,Chapters10and15. Reviewalreadyposted;OldExamswillbeavailablelater today. Lastclass! D... Date Added: 2009-06-11 22:03:49 |
| main3.ps Path: UMass (Amherst) >> ECE >> 665 Fall, 2009 Description: %!PS-Adobe-2.0 %Creator: dvips 5.47 Copyright 1986-91 Radical Eye Software %Title: main3.dvi %Pages: 55 1 %BoundingBox: 0 0 612 792 %EndComments %BeginProcSet: tex.pro /TeXDict 200 dict def TeXDict begin /N /def load def /B{bind def}N /S /exch load d... Date Added: 2009-06-11 22:04:18 |
| Vosshall03.pdf Path: Cornell >> FS >> 616 Fall, 2009 Description: Cell, Vol. 112, 271282, January 24, 2003, Copyright 2003 by Cell Press Two-Photon Calcium Imaging Reveals an Odor-Evoked Map of Activity in the Fly Brain Jing W. Wang,1 Allan M. Wong,1 Jorge Flores,1 Leslie B. Vosshall,2 and Richard Axel1,* 1 Depart... Date Added: 2009-06-11 22:04:57 |
| Lect1.ppt Path: Allan Hancock College >> MATH >> 11246 Fall, 2009 Description: #!G#Lect1.ppt# # ct M mm V m6;m}=^#d! # #57Q#s|o?w%#[8 I>#y`W1PJzNG+#S[~h(#I#^#`S |C vpKKD#f #)C\\#-#g(ZQ]XxtM7#00# #Q< Pa +I2: qn#XBMB{P-K4d\'4Yz n 51Ru5}hwIW}A= -d]x-L\\#JX IAAX=HH = ;#... Date Added: 2009-06-11 22:05:25 |
| old_announcements.txt Path: Texas >> M >> 348 Fall, 2008 Description: % <li> Exam #3 has been graded (see link below for stats). <br> <br> <li> Exam #3 (final exam) is Saturday, May 15, 2-5pm. <ul> <li> Place: Check the University Final Exam Schedule (<A HREF=\"http:/www.utexas.edu/student/registrar/rose/\">available ... Date Added: 2009-06-11 22:06:22 |
| Lecture31239.pdf Path: UMass (Amherst) >> CC >> 239 Fall, 2009 Description: Canadian Environmental Policy Continued Lecture 31 General Points About Canadian Policy (Continued) Lecture 31 P Lack of information a handicap to policy makers? < Poor science < Reliance on sources for information P Public scrutiny lacking < Legi... Date Added: 2009-06-11 22:08:09 |
| tut09.pdf Path: Allan Hancock College >> MATH >> 2962 Fall, 2009 Description: The University of Sydney School of Mathematics and Statistics Tutorial 9 (Week 10) MATH2962: Real and Complex Analysis (Advanced) Web Page: http:/www.maths.usyd.edu.au/u/UG/IM/MATH2962/ Lecturer: Daniel Daners Semester 1, 2009 Questions marked wit... Date Added: 2009-06-11 22:09:17 |
| quiz5.pdf Path: UNL >> MATH >> 208 Fall, 2008 Description: Math 208 - Fall 2006 Name Quiz 5 Find the absolute extrema of the function in two variables f (x, y) = ex (x2 + xy) in the region bounded by x = 3, x = y, y = 0. 1 ... Date Added: 2009-06-11 22:12:05 |
| test2_review_solutions.pdf Path: UNL >> MATH >> 208 Fall, 2008 Description: Math 208: Calculus - Fall 06 Test 2: Review Name This review is meant to help you on what you need to focus for the test. It is not meant to replace the book, the homework assigments, or any other activities we do in class. 1. Consider the surface ... Date Added: 2009-06-11 22:12:06 |
| Chapter10_S09_answers.pdf Path: Kentucky >> MA >> 123 Fall, 2008 Description: ... Date Added: 2009-06-11 22:12:50 |
| MED338-Reflection4.pdf Path: Wisc Stevens Point >> CGHAS >> 136 Fall, 2009 Description: Objectives and Expectations There were a few objectives that we focused on in our practicum and we went into it expecting that the group would a similar amount of knowledge, since they were all in the same class and were all about the same age. The f... Date Added: 2009-06-11 22:12:55 |
| lect25.pdf Path: Rochester >> PHY >> 521 Fall, 2009 Description: fii -rcLv.a \"\':. It- - 5Y~ ~ IL_ f;1:. s.r- ~ h~ CuU~bv\'S\' , ~ 0-. Dc G t-J./I b~v-iL Q.\"~d~ . ~,f ~ C~A.-S uPU 5\'~ ~cT ~ ~ ~.w~ 4~1J ~ ~ ~ ~ \\ ah\'r ~ t \'d ~ 5:U~e# cf~1 ch. ; /\'t.-tLY1.-dCM-V i 0-/ 3. ~ ~ ~ riJo-~ .+ t, . ~ ~ pJ ~ t -t&-e ~.t... Date Added: 2009-06-11 22:13:56 |
| lect21.pdf Path: Rochester >> PHY >> 415 Fall, 2009 Description: ... Date Added: 2009-06-11 22:14:32 |
| L1a.pdf Path: Columbia >> KF >> 2119 Fall, 2009 Description: Neuroscience of speech and language BBS 4032 1: why (and how) neuroscience? Youll have to leave out the brain but that still leaves the mind, so it doesnt solve your problem. (Neil Smith) If the human mind were simple enough to understand, wed be... Date Added: 2009-06-11 22:15:52 |
| timeStamp.pdf Path: Stanford >> SLAC >> 06302006 Fall, 2009 Description: ISOC/SVAC Timestamp Instrument Analysis Meeting, June 30, 2006 Gamma-ray Large Area Space Telescope Anders W. Borgland Science Verification, Analysis and Calibrations / ISOC Anders W. Borgland 1 ISOC/SVAC Time stamp Instrument Analysis Meeti... Date Added: 2009-06-11 22:16:04 |
| PDU_16Towers_05_05_06.ppt Path: Stanford >> SLAC >> 05052006 Fall, 2009 Description: Gamma-ray Large Area Space Telescope Update on PDU Voltage Noise Dependence Claudia Cecchi Stefano Germani Monica Pepe INFN Perugia Instrument Analysis Meeting May 5, 2006 GLAST LAT Project Outline IA Meeting, May 5, 2006 Update on Noise Study ... Date Added: 2009-06-11 22:16:10 |
| IAAnnouncementsMarch182005.pdf Path: Stanford >> SLAC >> 03182005 Fall, 2009 Description: GLAST LAT Project IA Meeting Mar 18, 2005 Announcements Data Taking Will happen most likely on Monday yes, I hear you, it is a week delay but we are almost there. Code Release Today we have a release of baseline Richard wants to enforce the... Date Added: 2009-06-11 22:16:53 |
| Blanket_background.pdf Path: Stanford >> SLAC >> 13062006 Fall, 2009 Description: Background gammas created by cosmic ray protons in LAT MMS History. We (ACD team) during a phase of ACD design (2001) studied the effect of background gammas created in MMS by protons, but only assuming the proton trajectory which goes parallel to th... Date Added: 2009-06-11 22:17:21 |
| TKR.pdf Path: Stanford >> SLAC >> 05092005 Fall, 2009 Description: GLAST LAT Project Instrument Analysis Meeting Dec 9, 2005 Gamma-ray Large Area Space Telescope Noisy Strip determination Takuya Kawamoto (Hiroshima Univ) Hiro Tajima (SLAC) TKR takuya@slac.stanford.edu Takuya Kawamoto , TKR Noisy Strip determinat... Date Added: 2009-06-11 22:17:32 |
| 5Cyrus McCormick.doc Path: Ole Miss >> WEEK >> 622 Fall, 2009 Description: Cyrus McCormick: A Legitimate Marketing Genius by Dr. Peter Reid Dickson, Florida International University Limited editorial revision, Hugh Sloan The making and marketing of the mechanical reaper is one of the great triumphs of modern civilization. ... Date Added: 2009-06-11 22:17:52 |
| midterm_solutions_292S_2009.pdf Path: Toledo >> PHY >> 292 Fall, 2009 Description: ... Date Added: 2009-06-11 22:18:13 |
| p00110.xls Path: University of Hawaii - Hilo >> JACH >> 001 Fall, 2009 Description: 5350.12 0 83.23 0.03 -48.39 3.57 83.2 Offset Angle 0.1 Offset -3.22 -0.7 -0.67 0.25 Phase 76.63 22.75 34.09 0.5 Mag 20.78 4.56 4.04 0.75 Wheel 3 1 970712 6896.95Figure 1 RADY, radial arm inclinometry of 97 07 12 970819 10655.82 970819 16469.49 1.25... Date Added: 2009-06-11 22:19:29 |
| mtun001.txt Path: University of Hawaii - Hilo >> MT >> 001 Fall, 2009 Description: SIO - Menu handling system Page 1 MTUN/1.1 SCIENCE AND ENGINEERING RESEARCH COUNCIL MTUN/1.1 CAVENDISH LABORATORY MULLARD RADIO ASTRONOMY OBSERVATORY MT Project ... Date Added: 2009-06-11 22:20:06 |
| 11 Principles of Animation.ppt Path: Presbyterian >> CSC >> 307 Fall, 2008 Description: 11 Principles of Animation Information thanks to a variety of sources found throughout the notes 1 11 Principles of Animation Squash and Stretch Timing Anticipation Staging Follow Through and Overlapping Action Straight Ahead Action and... Date Added: 2009-06-11 22:20:30 |
| mgp00054.txt Path: East Los Angeles College >> SEWTHA >> 2050 Fall, 2009 Description: PLANS ... Date Added: 2009-06-11 22:20:31 |
| mgp00037.txt Path: East Los Angeles College >> SEWTHA >> 2050 Fall, 2009 Description: ausra.com ... Date Added: 2009-06-11 22:20:33 |
| Storytelling Through Lighting1.doc Path: Presbyterian >> CSC >> 307 Fall, 2008 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|22 Feb 2006 14:04:49 -0000 vti_extenderversion:SR|6.0.2.5516 vti_backlinkinfo:VX|Notes/ProfNotes/professor_notes.htm ... Date Added: 2009-06-11 22:20:38 |
| tr2_fig3.ps Path: University of Hawaii - Hilo >> TR >> 002 Fall, 2009 Description: %!PS-Adobe-1.0 %Creator: psmerge V1.0 %Creation date: Wed May 10 21:41:29 1995 %Pages: 1 %DocumentFonts: (atend) %EndComments %Page: ? 1 clippath pathbbox pop pop translate/BEGINEPSFILE{ /EPSFsave save def 0 setgray 0 setlinecap 1 setlinewidth 0 setl... Date Added: 2009-06-11 22:20:42 |
| Mathcad - P6-8.pdf Path: NMSU >> CHE >> 441 Fall, 2009 Description: Fogler P6-8 0.15 0.6 k := 0.1 0.2 dose := 250 Vbody := 40 CA0 := dose Vbody -k C - k C 1 1 2 1 C := D( t , C) := k 1 C1 - if ( C2 < 0 , k 1 C1 - k 4 C2 , k 3) - k 4 C2 f := rkfixed ( C , 0 , 4 , 1000 , D) t := f 1 CA := f 2 C... Date Added: 2009-06-11 22:22:25 |
| Kelsey 98.pdf Path: UCSC >> CMPS >> 223 Fall, 2008 Description: Cryptanalytic Attacks on Pseudorandom Number Generators John Kelsey David Wagner Bruce Schneier Chris Hall Abstract. In this paper we discuss PRNGs: the mechanisms used by real-world secure systems to generate cryptographic keys, initialization ve... Date Added: 2009-06-11 22:24:02 |
| 22 Results.pdf Path: Delta State >> SSC >> 470 Fall, 2009 Description: # \' + . 3 5 $ (% ( ) , ! / \" 7 $0 ! % * \" \" \" 6 \"% % * / 1% 6 8 / \" %/ % ! ( % % )! ) * 9 + % % % ; : ) $ * , < $ % % % 2 - ./ $ \" $ - .3 \" \" * ) 5 % - .3 \" \" - .3 \" \" 6 - .3 \" \" % / = 4% $ 0 % * 2 ... Date Added: 2009-06-11 22:24:28 |
| SSC101 SP08 Syllabus.pdf Path: Delta State >> SSC >> 101 Fall, 2009 Description: ! \" \" $ # $ % ! 3 +/ 1 3 4 5 % % ! 6 3 $ $ % ! 0 \' ($ ) ; , 91 # ! ( 1!; < 93- $ ! 3 - ; =1> % $ 1( ! 2* 5 0*70 9 ; % ( \" % ! ( $# $ % ( ( $ < # ! - ) ! /*! 1 - ) ! /*! 1 , - - ) ! / !... Date Added: 2009-06-11 22:24:50 |
| xr02-65.xls Path: CSU Fullerton >> UNIT >> 222 Fall, 2009 Description: Ctgry-1 8.5 15.2 15.2 12.1 10.4 8.2 9.5 13.5 13.6 11.1 7.8 9.9 13.2 10.2 9.6 7.7 10.9 11.2 9.4 7 15.3 8.2 7.7 12.8 9.9 10.4 9.8 11.4 9 10.7 14.1 12 13.1 9.1 8.6 8.6 9.5 3.7 8.7 11.9 10 8.3 10.5 9.8 9 12.3 12.2 12.3 7 9.7 8.8 12.5 Ctgry-2 18.9 14 7.2... Date Added: 2009-06-11 22:25:14 |
| WORD%20-%20CHAPTER%203(1).xls Path: CSU Northridge >> COMP >> 100 Fall, 2009 Description: Comprehensive Word Chapter 3 LastName FirstName Project-Based Exam (Scenario 1) Ah Choy Noble aljuraiban jasser ANUJUO DEREK Arias Ariadna Baker John Baker Matthew Barkley Kory Brink Hannah Butcher Kevin Cervantes Marisol Choi Jessica Duran Idalia Es... Date Added: 2009-06-11 22:27:12 |
| last-day-stuff1.doc Path: UT Chattanooga >> ENGR >> 328 Fall, 2009 Description: From - From - Thu Apr 19 16:31:56 2007 X-UIDL: e22fe6d99280f700f7de1dba59e095eb X-Mozilla-Status: 0000 X-Mozilla-Status2: 00000000 X-Auth-No: Return-Path: <kasey-decker@utc.edu> Received: from web1 not authenticated [10.44.2.72] by utc.edu with NetM... Date Added: 2009-06-11 22:28:20 |
| Quiz-08b-.doc Path: UT Chattanooga >> ENGR >> 328 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|28 Dec 2005 21:19:55 -0000 vti_extenderversion:SR|5.0.2.6738 vti_lineageid:SR|{02D05C90-30DC-4734-9F10-A062233D8870} vti_title:SR|Quiz 1 ENGR 430 11 January 2001 vti_modifiedby:SR|CHEMSERVER\\jhenry vti_... Date Added: 2009-06-11 22:30:36 |
| Lecture12.pdf Path: UCCS >> CS >> 208 Fall, 2009 Description: Lecture 12 1. Continuation of discussion of the programs in handout from Lecture 10 2. Condition checking in Bash scripts: use of [.] and [] to bracket conditions 3. Integer comparison: -eq, -ne, -gt, -lt, -le, <, <=, >, >=; Inside [.] there is flexi... Date Added: 2009-06-11 22:31:43 |
| CAAM452Lecture11b.pdf Path: Acton School of Business >> CAAM >> 452 Fall, 2009 Description: Numerical Methods for Partial Differential Equations CAAM 452 Spring 2005 Lecture 11 Instructor: Tim Warburton Today Flux functions for finite-volume methods Higher order reconstruction Limiters Some nice notes at: http:/www.astro.uiuc.edu/clas... Date Added: 2009-06-11 22:32:40 |
| safety_contract_MS.pdf Path: CSU Northridge >> KSC >> 63842 Fall, 2009 Description: Flinn Scientifics Middle School Science Safety Contract PURPOSE Science is a hands-on laboratory class. However, science activities may have potential hazards. We will use some equipment and animals that may be dangerous if not handled properly. Safe... Date Added: 2009-06-11 22:34:10 |
| Littell-StatMed2000.pdf Path: Washington >> B >> 571 Fall, 2009 Description: STATISTICS IN MEDICINE Statist. Med. 2000; 19:17931819 TUTORIAL IN BIOSTATISTICS Modelling covariance structure in the analysis of repeated measures data Ramon C. Littell1; , Jane Pendergast2 and Ranjini Natarajan3 of Statistics; Institute of Food a... Date Added: 2009-06-11 22:36:59 |
| slides1.ppt Path: Duke >> CPS >> 108 Fall, 2009 Description: CPS 108 Software Design and Implementation Owen Astrachan http:/www.cs.duke.edu/courses/cps108/current Software Design 1.1 What is Computer Science? What is it that distinguishes it from the separate subjects with which it is related? What is th... Date Added: 2009-06-11 22:37:17 |
| slides12.ppt Path: Duke >> CPS >> 108 Fall, 2009 Description: From XP to javax.swing.* q Whatpartsofembracingchangecanweembracein108? Evolutionarydesign,smallreleases,iterativeenhancement Simpledesign,dontbuildforthefuture(willyouneedit?) Lotsoftesting,testing,testing Refactoring:changedesign,notfunctional... Date Added: 2009-06-11 22:37:18 |
| MShanBhag1BS.doc Path: Syracuse >> CSE >> 784 Fall, 2008 Description: NetTestUnity B Level Specifications CSE 784 Fall 2003 NetTestUnity An automated testing framework B Level Specifications By Mithun Shanbhag 09/15/2003 For CSE 784 Fall 2003 1 NetTestUnity B Level Specifications CSE 784 Fall 200... Date Added: 2009-06-11 22:37:26 |
| sample survey.doc Path: MTSU >> ASSIGN >> 3040 Fall, 2009 Description: Dear Aging Studies Alumnus: In an effort to improve the Aging Studies Program at Middle Tennessee State University, a survey of alumni is being conducted to assess their opinions of and attitudes towards the program. As alumnus with either an undergr... Date Added: 2009-06-11 22:37:37 |
| mandelplot.pdf Path: George Mason >> CSI >> 701 Spring, 2008 Description: ... Date Added: 2009-06-11 22:38:21 |
| WaveMotion_1110.doc Path: Colorado >> PHYS >> 1110 Fall, 2008 Description: wave-1 Wave Motion A wave is a self-propagating disturbance in a medium. Waves carry energy, momentum, information, but not matter. Examples: Sound waves (pressure waves) in air (or in any gas or solid or liquid) Waves on a stretched string Waves... Date Added: 2009-06-11 22:38:58 |
| Sec1045.pdf Path: UMKC >> CE >> 020701 Fall, 2009 Description: SECTION 1045 PAINT FOR STRUCTURAL STEEL 1045.1 Paint and Paint Material. 1045.1.1 General. All single component paints shall be ready-mixed at the factory to comply with the specification formula for the type of paint ordered; shall be well ground t... Date Added: 2009-06-11 22:39:44 |
| chapter7_2.txt Path: UAB >> IS >> 303 Fall, 2009 Description: u 00:00:11.7 00:01:03.6 http:/dl1.lhl.uab.edu/sob/is303/sld187.html u 00:01:03.7 00:02:20.5 http:/dl1.lhl.uab.edu/sob/is303/sld188.html u 00:02:20.6 00:03:07.0 http:/dl1.lhl.uab.edu/sob/is303/sld189.html u 00:03:07.1 00:04:49.8 &... Date Added: 2009-06-11 22:40:15 |
| 505_student_info.pdf Path: S.F. State >> ONLINE >> 505 Fall, 2008 Description: San Francisco State University DAI 505 INDUSTRIAL RESEARCH & DEVELOPMENT Student Information Sheet STUDENT INFORMATION Please Print Name: _ Student ID: CONFIDENTIAL Fall 2003 Digital Photo No. _ Please call me/nickname: __ _ Address: _ City: _ Z... Date Added: 2009-06-11 22:41:32 |
| lquiz4.pdf Path: Wisconsin >> P >> 104 Fall, 2009 Description: Section #:_ Name:_ PHYS104: Lab Quiz 4 1. Multiple Choice: choose the best answer (1pt each). (a) For the second experiment, using the 15V voltage supply, how did the power dissipated from the series circuit consisting of 4700 and 1... Date Added: 2009-06-11 22:41:55 |
| exam3fall00.pdf Path: Purdue >> EE >> 255 Spring, 2006 Description: ... Date Added: 2009-06-11 22:42:00 |
| 230 Syllabus 2005.doc Path: Kentucky >> AS >> 230 Fall, 2009 Description: GLY 230 Fundamentals of Geology I Fall 2005 GLY 230 (Fundamentals of Geology or Field Methods) and its follow up course (GLY 235; offered Spring 2006) are intended to introduce students to the mechanics and methods of geologic field work and geologic... Date Added: 2009-06-11 22:42:20 |
| StatementsArgumentsetc.doc Path: George Mason >> PHIL >> 1002 Fall, 2009 Description: STATEMENTS, ARGUMENTS, VALIDITY, SOUNDNESS AND INFORMAL FALLACIES STATEMENTS (Sometimes called \'Proposition\') A statement is something that may be true or false. Consider the following: Paris is a city. The moon is made of green cheese. 16% of the p... Date Added: 2009-06-11 22:43:06 |
| disc_lqr.pdf Path: Georgia Tech >> AE >> 6531 Fall, 2008 Description: EE363 Winter 2005-06 Lecture 1 Linear quadratic regulator: Discrete-time finite horizon LQR cost function multi-objective interpretation LQR via least-squares dynamic programming solution steady-state LQR control extensions: time-varying syst... Date Added: 2009-06-11 22:43:19 |
| Assignment 2 -- Logic Puzzle Analysis.doc Path: Kent State >> CS >> 23022 Fall, 2008 Description: Assignment 2 Logic Puzzle Analysis Dean Zeller CS23022 Summer, 2007 Objective Due: Thursday, June 14th by 1:00 PM 10 points The student will perform analysis on logic puzzles in a program, algorithm, diagram, or paper. Instructions For this assign... Date Added: 2009-06-11 22:43:51 |
| EME232Lecture32_StillMoreConstrained MotionDynamics.doc Path: Loras >> CM >> 418218 Fall, 2009 Description: EME 232 Engineering Dynamics Lecture 32: More Constrained Plane Motion Today: Homework Questions Read Chap 16 Section 8 Homework: Chap. 16, Problems 105, 110, 111, 134 Spring 2009 Lecture Outcomes: Following today\'s lecture you should be able to - ... Date Added: 2009-06-11 22:44:21 |
| engr2030project2.pdf Path: Armstrong >> ENGR >> 2030 Spring, 2008 Description: ENGR 2030 Project #2 Spring 2009 Given: 1/19/2009 Due: 1/28/2009 Develop a coding scheme to aid in tracking the CD collection of your instructor. For this project, assume that your instructor may purchase up to 10 CDs a year from the time he was t... Date Added: 2009-06-11 22:45:13 |
| sec10.10(2).pdf Path: RPI >> MATH >> 102 Fall, 2009 Description: ... Date Added: 2009-06-11 22:45:38 |
| paroles13.pdf Path: Portland >> FR >> 200 Fall, 2009 Description: Ensuite, chapitre 13 FR202 Paroles: Conqutes professionnelles Mots-cls: 35 mots mmoriser Verbes: mmorisez le sens et la conjugaison (prsent et participe pass). accder se spcialiser en . (biologie, histoire, langues, etc.) mener (une carrire, un ... Date Added: 2009-06-11 22:46:01 |
| Ch10Lec1b.ppt Path: St. Xavier >> CHAPTER >> 260 Fall, 2009 Description: Variables and Inheritance A More Complex Example Alice A steerable car The task is to create a car-steering simulation. To steer the car, the user presses keys to control: moving the car forward or backward turning the wheels right or left Of co... Date Added: 2009-06-11 22:46:52 |
| prog2_input1.txt Path: UCSB >> CS >> 130 Fall, 2009 Description: (1,2) 1 (2,2) 3 (-3,2) 2 (2,3) 4 (3,4) 5 (4,1) 6 (4,5) 7 ... Date Added: 2009-06-11 22:48:55 |
| implement.00.p.pdf Path: East Los Angeles College >> COMS >> 21102 Fall, 2009 Description: Implementation Techniques: Intro Implementation Techniques: Intro Implementation Techniques: Intro When you are writing trivial programs, performance doesnt usually matter that much: Data-sets are small and results often obvious. Running times are... Date Added: 2009-06-11 22:50:48 |
| chap010-revised.ppt Path: Creighton >> MIS >> 253 Fall, 2009 Description: Chapter 10 Developing Business/IT Solutions Systems Development Life Cycle Prototyping End User Development Project Management Change Management McGrawHill/Irwin Copyright 2007 by The McGrawHill Companies, Inc. All rights reserved. The Systems Ap... Date Added: 2009-06-11 22:51:08 |
| 10-11.sas.txt Path: Ill. Chicago >> HW >> 511 Fall, 2009 Description: data HW5p3; input NO WP sym qin count; if count=0 then count=10e-5; cards; 1 1 1 1 5 1 2 2 5 3 1 3 3 5 0 1 4 4 5 0 2 1 2 5 3 2 2 5 2 11 2 3 6 5 4 2 4 7 5 0 3 1 3 5 2 3 2 6 5 13 3 3 8 3 3 3 4 9 5 4 4 1 4 5 1 4 2 7 5 2 4 3 9 5 4 4 4 10 4 14 ; Proc cat... Date Added: 2009-06-11 22:51:39 |
| 261 - 1 Meador.pdf Path: Coker >> BIO >> 211 Fall, 2009 Description: Copyright 1999 by the Genetics Society of America A Direct Screen Identifies New Flight Muscle Mutants on the Drosophila Second Chromosome Upendra Nongthomba1 and Nallur B. Ramachandra Department of Studies in Zoology, University of Mysore, Manasag... Date Added: 2009-06-11 22:52:46 |
| 261 - 1.pdf Path: Coker >> BIO >> 411 Fall, 2009 Description: Copyright 1999 by the Genetics Society of America A Direct Screen Identifies New Flight Muscle Mutants on the Drosophila Second Chromosome Upendra Nongthomba1 and Nallur B. Ramachandra Department of Studies in Zoology, University of Mysore, Manasag... Date Added: 2009-06-11 22:52:53 |
| Making a Thumbnail Picture in MS Expression Web.pdf Path: Trinity U >> CS >> 1300 Fall, 2009 Description: Making a Thumbnail Picture in MS Expression Web Select the page and the spot that you want to put your picture choose Insert>Picture>From File: picture: Pick the photo you want to turn into a thumbnail: Insert it and select it: Make sure your Pic... Date Added: 2009-06-11 22:53:07 |
| create_paragraphs.txt Path: Delaware >> PROJECT >> 103 Fall, 2009 Description: <html> <head> <title>Creating Paragraphs.</title> </head> <body> White space is an important element of design, and one that we often take for granted when working with word-processing or page-layout programs. With those types of programs, if we w... Date Added: 2009-06-11 22:54:38 |
| Mat265-B2Sp2006syll.doc Path: Iowa State >> MAT >> 265 Fall, 2009 Description: Math 265 Section B2 Instructor: Mr. Aaron A. Allen. Class Times: Monday, Tuesday, Thursday, and Friday, 10:00 AM to 10:50 AM. Meeting Place: Carver Hall, room 184. Office: Carver Hall, room 487. Office hours: TBA E-mail address: aaallen@iastate.edu C... Date Added: 2009-06-11 22:54:50 |
| M345Ex4.pdf Path: Colorado State >> M >> 345 Fall, 2009 Description: M 345 Take Home Test 4 (150 points) 1. Consider an elastic system, idealized as three masses supported by four springs. Let x j t = displacement from equilibrium of mass #j j = 1, 2, 3 e k t = extension of spring #k at time t k = 1, 2, 3, 4 f k t = i... Date Added: 2009-06-11 22:57:47 |
| snelsire.pdf Path: Clemson >> PARL >> 307 Fall, 2009 Description: ... Date Added: 2009-06-11 23:00:05 |
| match.ps Path: CSU Long Beach >> CECS >> 528 Fall, 2008 Description: %!PS-Adobe-2.0 %Creator: dvips(k) 5.86 Copyright 1999 Radical Eye Software %Title: match.dvi %CreationDate: Tue Jan 14 13:07:02 2003 %Pages: 13 %PageOrder: Ascend %BoundingBox: 0 0 596 842 %DocumentPaperSizes: a4 %EndComments %DVIPSWebPage: (www.radi... Date Added: 2009-06-11 23:01:35 |
| prob.pdf Path: CSU Long Beach >> CECS >> 406 Spring, 2008 Description: Probability Models Preliminaries Random Variable: a variable X that instantiates to a particular value in accordance with a measure of likelihood for each possible value. Such a measure is called a probability measure or probability distribution. ... Date Added: 2009-06-11 23:02:00 |
| CCS.ppt Path: Virginia Tech >> CS >> 5204 Fall, 2000 Description: A Simple Agent A CCS agent is described both by a structural diagram and one or more algebraic equations. The diagram is for readability and is not part of the formalism. The structural diagram shows the agent as a circle. The name of the agent is wr... Date Added: 2009-06-11 23:03:56 |
| IT460 - Lesson 03 - Human Cognition.ppt Path: Naval Academy >> IT >> 460 Fall, 2009 Description: Human Cognition IT460 Human Computer Interaction How People Think Perception Thought Learning Memory Mental Models Involves unconscious and conscious processes, where images and analogies are activated based on a particular view Deep versus s... Date Added: 2009-06-11 23:04:15 |
| lect34.ppt Path: UConn >> PHYS >> 1501 Fall, 2009 Description: Physics 151: Lecture 34 Today\'s Agenda q Waves chapter 16 travelling waves in 1d waves on a string Copyright, Department of Physics, University of Illinois at Urbana-Champaign Physics 151: Lecture 34, Pg 1 What is a wave ? q A definition of ... Date Added: 2009-06-11 23:05:48 |
| Mathcad-HW2sol.pdf Path: Purdue >> CE >> 479 Fall, 2008 Description: ... Date Added: 2009-06-11 23:06:49 |
| hw3.pdf Path: Cal Poly Pomona >> CS >> 525 Fall, 2009 Description: CS525 Homework #3 Spring 2009 Due Date: Wednesday, May 28, 2009. 1. To increase cache performance, some of strategies are: (1) reducing the hit time; and (2) reducing the miss penalty. For each of these two strategies, please describe two hardware o... Date Added: 2009-06-11 23:07:00 |
| ps07GC.pdf Path: Minnesota >> CHEM >> 4242 Fall, 2009 Description: Problem Set 7. Gas Chromatography Calculations Chem 4242, Spring 2005 Due Monday, April 25. 1. (Based on SHN5e 27-21) A GC column was used for the separation of methyl esters under the following conditions: Length of packing, L Column diameter, dc Ba... Date Added: 2009-06-11 23:07:39 |
| Wind Stats Examples.doc Path: UWO >> ENG >> 491 Fall, 2009 Description: Self-study questions - WIND STATISTICS (1) Over a period of 9 years the highest (extreme) hourly mean wind speeds recorded in each year at a height of 10m above the ground at a meteorological station were: 20, 14, 17, 25, 21, 13, 16, 18 and 15 m/s (... Date Added: 2009-06-11 23:08:32 |
| anscombe.txt Path: JMU >> EC >> 485 Fall, 2009 Description: Y1 X1 Y2 X2 Y3 X3 Y4 X4 8.04 10 9.14 10 7.46 10 6.58 8 6.95 8 8.14 8 6.77 8 5.76 8 7.58 13 8.74 13 12.74 13 7.71 8 8.81 9 8.77 9 7.11 9 8.84 8 8.33 11 9.26 11 7.81 11 8.47 8 9.96 14 8.1 14 8.84 14 7.04 ... Date Added: 2009-06-11 23:09:29 |
| Lab 9.doc Path: BYU >> CE >> 662 Fall, 2009 Description: vti_encoding:SR|utf8-nl vti_timelastmodified:TR|13 Mar 2003 18:47:03 -0000 vti_extenderversion:SR|6.0.2.6353 vti_backlinkinfo:VX| vti_nexttolasttimemodified:TR|13 Mar 2003 18:47:03 -0000 vti_title:SR|CEEn 662 vti_author:SR|msaito vti_timecreated:TR|2... Date Added: 2009-06-11 23:10:12 |
| exam03aut2003.pdf Path: Washington >> ME >> 320 Fall, 2009 Description: First Name: Last Name: page 1 University of Washington Department of Mechanical Engineering ME 320 Introduction to Thermodynamics Autumn 2003 Exam III Wednesday December 10, 2003 11:30 a.m.12:20 p.m. MEB 248 The exam is open class textbook plus t... Date Added: 2009-06-11 23:10:33 |
| errata02.pdf Path: Laurentian >> LOGI >> 200103 Fall, 2009 Description: Chapter 2: Errata Page 32, line 11: Change \"not free accept\" to \"not free to accept\" ARGUMENT: Critical Thinking, Logic and the Fallacies Chapter 2: Errata 222 ... Date Added: 2009-06-11 23:11:41 |
| problem_sets_Problem_Set_08_Key.pdf Path: Washington >> CHEM >> 152 Fall, 2008 Description: ... Date Added: 2009-06-11 23:12:24 |
| 99-1286_1.pdf Path: Wisconsin >> LAW >> 120 Fall, 2009 Description: 1999 2000 LEGISLATURE LRB1286/1 JEO&MGG:kg:km 1999 ASSEMBLY BILL 120 February 11, 1999 Introduced by Representatives SKINDRUD, ALBERS, BRANDEMUEHL, FREESE, GOETSCH, HAHN, HANDRICK, HASENOHRL, HOVEN, KEDZIE, F. LASEE, LASSA, J. LEHMAN, MONTGOMERY... Date Added: 2009-06-11 23:13:40 |
| 99-2085_P1dn.pdf Path: Wisconsin >> LAW >> 209 Fall, 2009 Description: DRAFTER\'S NOTE FROM THE LRB2085/P1dn JEO:jlg:hmh LEGISLATIVE REFERENCE BUREAU Friday, February 12, 1999 Misha: Please note the following when reviewing this draft: 1. I modified the definition of \"laser pointer\" slightly to make it clear that what... Date Added: 2009-06-11 23:14:50 |
| 99-2973feDOJorg.pdf Path: Wisconsin >> LAW >> 418 Fall, 2009 Description: ... Date Added: 2009-06-11 23:14:55 |
| 99-3613_2.pdf Path: Wisconsin >> LAW >> 092 Fall, 2009 Description: 1999 2000 LEGISLATURE LRB3613/2 JTK:kmg:jf 1999 ASSEMBLY JOINT RESOLUTION 92 November 5, 1999 Introduced by Representatives WALKER, STASKUNAS, STONE, HAHN, SPILLNER, PLOUFF, ALBERS, LASSA, OLSEN, TRAVIS, J. LEHMAN, KREIBICH, PETTIS and DUFF, cos... Date Added: 2009-06-11 23:15:37 |
| 99s0224df.pdf Path: Wisconsin >> LAW >> 251 Fall, 2009 Description: ... Date Added: 2009-06-11 23:16:33 |
| 99-3528df_pt14of39.pdf Path: Wisconsin >> LAW >> 465 Fall, 2009 Description: Soked Item List Store File Name -3266.1 -3266.2 -3266.3 -3266.4 -3266.5 -3266.6 -3266.7 -3361.1 -3361.2 -3361.3 -3361.4 -3361.5 -3361.6 -3361.7 -3361.8 -3361.9 -3266.8 -3266.9 -3266.10 -3266.1 I -3266.12 Text 6.18 of the statutes is amended to read: ... Date Added: 2009-06-11 23:16:50 |
| 99-2366_1dn.pdf Path: Wisconsin >> LAW >> 323 Fall, 2009 Description: DRAFTER\'S NOTE FROM THE LRB2366/1dn RAC:pgt&jlg:jf LEGISLATIVE REFERENCE BUREAU March 2, 1999 This draft changes 1997 AB421 in the following ways: 1. I did not include the amendment to s. 40.02 (7), because this change has been accomplished by the... Date Added: 2009-06-11 23:17:41 |
|
|
Get Started With Course Hero Today!
Get study guides, join study groups, and more!
Sign up in seconds with your Facebook account!
Course Hero is a Facebook Application Partner.
Click below to sign-up for FREE.
Our Social Learning Network was built to provide students and key learning partners like professors a platform to share, meet and collaborate while accelerating their comprehension of course-related theories and concepts. We are committed to providing you immediate access to a growing wealth of study materials and an unparalleled academic network of students, professors and other key partners. Why do you care? Because you want the best grade possible and at times need a 24/7 resource that’s responsive to your needs. |
|
What People Are Saying About Course Hero
|
|||
|
|||
|
Explore the benefits of joining Course Hero's social learning network.
|
|||
 |
Get millions of study materials now!Need lecture notes for a missed class or want insightful explanation of the theories and concepts you learn in class? Look no further, Course Hero’s Study Materials empowers you to find a broad and deep set of materials that can help you right now!
Click below to sign-up for FREE.
|
||
 |
Get over 200,000 textbook solutions now!Having difficulty with your homework and need documents that are relevant for your Textbook? Don't be frustrated. Course Hero's Textbook Help presents you study materials from many college courses.
Click below to sign-up for FREE.
|
||
 |
Meet over 300,000 students and your fellow classmates now!Want to meet your current classmates or those that took the class last year? Don’t worry or have anxiety. Course Hero’s Study Groups gives you the seamless opportunity to develop both anonymous or direct relationships with those classmates whom you want to meet and get help from right now!
Click below to sign-up for FREE.
|
||
