7 Million Study Materials
From students who've taken these classes before
From students who've taken these classes before
24/7 Access to Tutors
Personal attention for all your questions
Personal attention for all your questions
Learn
93% of our members earn better grades
93% of our members earn better grades
Washington | FISH 340
Genets & Molec Ecol
Professors
- Hauser,lorenz,
- Hauser, L
20 sample documents related to FISH 340
-
Washington FISH 340
Welcome ! FISH / BIOL 340 Introduction to Genetics and Molecular Ecology Spring 2003 Instructors Dr Lorenz Hauser School of Aquatic and Fishery Sciences Marine Studies, room 207 Tel: 685 3270, lhauser@u.washington.edu Todd Seamons School of A -
Washington FISH 340
Lecture 8 From Inheritance to Population Genetics Dominance and co-dominance Mendelian inheritance Hardy-Weinberg equilibrium Population differentiation Direct vs indirect sequence detection Direct Code of life Basis of inheritance Indirect -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab #1 DNA Extraction The purpose of this lab is to provide you with a tangible way of thinking about DNA as well as introducing you to some of the basic lab techniques used in genetics and -
Washington FISH 340
FISH/BIO 340 Genetics and Molecular Ecology Spring 2003 Writing Scientific Papers One of the aims of this class is to teach you how to write a formal scientific paper. Below we have outlined the general format of a scientific paper and have included -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 3 PCR, RFLPs The purpose of this lab is for you to understand how polymerase chain reaction (PCR) works, to learn how to perform a PCR experiment, to understand why PCR is important, -
Washington FISH 340
Mid-Term Exam; Name: _ Mid-Term Exam Answers Questions: 1. DNA has two anti-parallel strands with a 5\' and a 3\' end. a. Describe the molecular basis of this difference (4). b. What is the significance of this difference for: i. DNA replication in th -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab #2 Kinship studies The purpose of this lab is for you to learn how kinship studies are conducted and analyzed. Although we wont be doing a kinship study for the rockfish lab project, so -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 4 Intro to Hardy-Weinberg proportions The purpose of this lab is to introduce you to statistical methods used to determine whether genotype frequencies in a population conform to the -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 9 Phylogenetic Tree Building The purpose of this lab is to explain in more detail how phylogenetic trees are reconstructed. You will also learn what effects of homoplasy and saturatio -
Washington FISH 340
Final Exam FISH / BIOL 340; Answers Final exam This key is meant to aid your learning and to provide you with an idea where you went right and where you went wrong. 1) Allozymes gels often show quite complicated banding patterns, which can be explain -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 6 Gel electrophoresis The purpose of this lab is to introduce you to methods used to separate and visualize DNA fragments (extractions, PCR products, etc.). We extracted DNA; how did -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 5 Intro to Population Genetics The purpose of this lab is to introduce you to methods used to determine genetic differentiation between groups of organisms and the theory behind them. -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 8 Allozyme Electrophoresis The purpose of this lab is to show you how to carry out allozyme electrophoresis, and to provide additional data for the identification of the mystery fille -
Washington FISH 340
1 FISH/BIO 340: Genetics and Molecular Ecology Spring 2003 Lab # 7 GenBank and Alignment The purpose of this lab is to introduce you to online genetic databases; we will show you what information is available, how to find that information, and how -
Washington FISH 340
Grading Key for Term Paper A 3.5 4.0 General Structure Good development of a thesis `Hourglass\' organization Logical progression through the paper Arguments clear and focused, original No factual errors Clear and succinct style Good, selective backg -
Washington FISH 340
GAGTATGAGAAATGGCTAATATATGAATGTTATCTGATGTTACCAAGTTATCGATTTCACAAACCTTGTTTCGCTACATGTAATATGGGCTATTTTCAGCCCTTTACTGGGTATCTCATCAGAGATAGACATAATATGGAAAAGCGCAAACCAAGCAAGAGAAACGTACGTACATTCAGTTGTCCATTAATCAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG -
Washington FISH 340
1 Chapter 3 Molecular Identification: species, individuals and sex Introduction The two main problems with identification are agreeing about taxonomic units and recognising specific organisms It may seem surprising that the identification of macro-o -
Washington FISH 340
The molecular toolbox First: Plans for rest of class Today Lecture Thursday Guest lecture by Dr Gabrielle Rocap Genomics Class Evaluations Labs Review Sessions Bring questions Location to be determined Watch your e-mail and the webpa -
Washington FISH 340
Genomics in molecular ecology and evolution GenomicsWhat is it? Use of entire DNA sequence to study an organism What can genomics tell us? What cant genomics tell us? Evolutionary history of individual genes in the genome (Not always the sa -
Washington FISH 340
1st Assignment Due Thursday, April 24th, before class 10% of course mark The main purpose of this assignment is to monitor your understanding of the subject matter we have covered so far, and your ability to explain results of a molecular study to no
7,000,000 study materials • 24/7 tutors • earn better grades