We don't have any documents tagged to this course yet.

Help us build our content library by uploading relevant materials from your courses.

Colby | BI Top Documents
  • 2 Pages MU111-Part I
    MU111-Part I

    School: Colby

    Course: Genetics

    Part I: Ideas from the Essays Cook says that although music may be hard to define, it can help define who we are as individuals and as a culture. Popular music is heavily influenced if not borrowed from prior classical music, and Cook criticizes music bus

  • 2 Pages exam1
    Exam1

    School: Colby

    Course: Genetics

    Name_ BI315 - Animal Cells, Tissues, and Organs ANSWERS to Exam I - Fall, 2010 1. A. They have a role in maintaining the integrity of hemidesmosomes, which link the basal epithelial cells to the basal lamina. B. Mast cell secretions call in other defensiv

  • 13 Pages Lee_2006
    Lee_2006

    School: Colby

    Course: Genomics

    Control of Developmental Regulators by Polycomb in Human Embryonic Stem Cells Tong Ihn Lee,1,8 Richard G. Jenner,1,8 Laurie A. Boyer,1,8 Matthew G. Guenther,1,8 Stuart S. Levine,1,8 Roshan M. Kumar,1 Brett Chevalier,1 Sarah E. Johnstone,1,2 Megan F. Cole,

  • 1 Page Prospero_genomic_seq
    Prospero_genomic_seq

    School: Colby

    Course: Genomics

    Prospero genomic region >chr3R:7194709-7197809 cttaaaattaatagttgtaaagaaaaccttagtaattaataaccaaaaacaaccccctaatttcctca gtgtaccaaatctccccttgctctcgagctatattttgcgatcatcagctgttggctgtggcgatcgt ttccttccgcatccgtattggcataggggctgcagattttttctcgatttcgcgttgctcttcgtgat t

  • 1 Page The Zon Lab @ Children's Hospital
    The Zon Lab @ Children's Hospital

    School: Colby

    Course: Genomics

  • 13 Pages Templeton_2007
    Templeton_2007

    School: Colby

    Course: Genomics

    PERSPECTIVE doi:10.1111/j.1558-5646.2007.00164.x GENETICS AND RECENT HUMAN EVOLUTION Alan R. Templeton Department of Biology, Campus Box 1137, Washington University, St. Louis, Missouri 63130 E-mail: temple a@wustl.edu Received January 12, 2007 Accepted A

  • 2 Pages Transformations-chem
    Transformations-chem

    School: Colby

    Course: Genomics

    March 25, 2009 Transformations with chemically competent cells Chemically competent cells can be made via many procedures. We use the Inoue protocol for supercompetent bugs as documented in Maniatis/Sambrook. Also, transformation protocol depends upon the

  • 2 Pages PCR_amplification
    PCR_amplification

    School: Colby

    Course: Genomics

    PCR Amplification February 21, 2009 To amplify a particular sequence from some DNA source, you must start with a template, appropriate 5 and 3 primer oligonucleotides, dNTPS, and a source of thermostable DNA polymerase with its accompanying buffer (usuall

Back to course listings